Sample records for dna binding sequence

  1. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  2. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  3. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  4. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  5. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  6. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  7. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  8. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    PubMed

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  9. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  10. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  11. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  12. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  13. How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

    PubMed Central

    2017-01-01

    Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

  14. Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

    PubMed Central

    Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

    2013-01-01

    Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

  15. Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

    PubMed Central

    Pastor, N; Pardo, L; Weinstein, H

    1997-01-01

    The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

  16. Molecular dynamics studies on the DNA-binding process of ERG.

    PubMed

    Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

    2016-11-15

    The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

  17. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  18. Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

    PubMed

    Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

    2017-05-01

    Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    PubMed

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    PubMed

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  1. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  2. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  3. Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

    PubMed

    Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

    2016-04-20

    DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

  4. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  5. HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

    PubMed Central

    Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

    1995-01-01

    The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

  6. Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

    2004-04-16

    2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

  7. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    PubMed

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    PubMed

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  9. Role of indirect readout mechanism in TATA box binding protein-DNA interaction.

    PubMed

    Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

    2015-03-01

    Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

  10. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  11. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  12. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  13. Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

    PubMed Central

    Siepel, Adam; Lis, John T.

    2012-01-01

    DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

  14. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  15. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  16. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  17. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  18. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  19. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  20. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  1. A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

    PubMed Central

    Yang, Yu; Hebron, Haroun R.; Hang, Jun

    2009-01-01

    A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

  2. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  3. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  4. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  5. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  6. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  7. Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

    PubMed

    Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

    2014-09-25

    In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

  8. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  9. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  10. A TATA binding protein mutant with increased affinity for DNA directs transcription from a reversed TATA sequence in vivo.

    PubMed

    Spencer, J Vaughn; Arndt, Karen M

    2002-12-01

    The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.

  11. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  12. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  13. Sequence specificity of single-stranded DNA-binding proteins: a novel DNA microarray approach

    PubMed Central

    Morgan, Hugh P.; Estibeiro, Peter; Wear, Martin A.; Max, Klaas E.A.; Heinemann, Udo; Cubeddu, Liza; Gallagher, Maurice P.; Sadler, Peter J.; Walkinshaw, Malcolm D.

    2007-01-01

    We have developed a novel DNA microarray-based approach for identification of the sequence-specificity of single-stranded nucleic-acid-binding proteins (SNABPs). For verification, we have shown that the major cold shock protein (CspB) from Bacillus subtilis binds with high affinity to pyrimidine-rich sequences, with a binding preference for the consensus sequence, 5′-GTCTTTG/T-3′. The sequence was modelled onto the known structure of CspB and a cytosine-binding pocket was identified, which explains the strong preference for a cytosine base at position 3. This microarray method offers a rapid high-throughput approach for determining the specificity and strength of ss DNA–protein interactions. Further screening of this newly emerging family of transcription factors will help provide an insight into their cellular function. PMID:17488853

  14. Sequence-specific binding of counterions to B-DNA

    PubMed Central

    Denisov, Vladimir P.; Halle, Bertil

    2000-01-01

    Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

  15. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  16. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  17. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-01-01

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

  18. Evaluation of DNA Binding Drugs as Inhibitors of ESX, and ETS Domain Transcription Factor Associated With Breast Cancer: Effects of ESX/DNA Complex Disruption

    DTIC Science & Technology

    2000-08-01

    4). Sequence recognition of all four DNA bases is achieved by positioning an N- methylimidazole opposite guanine or N-methylpyrrole opposite...unique sequences of DNA based upon selective binding motifs to all four DNA bases , although relatively little is known about the ability of these agents to

  19. Selection and Screening of DNA Aptamers for Inorganic Nanomaterials.

    PubMed

    Zhou, Yibo; Huang, Zhicheng; Yang, Ronghua; Liu, Juewen

    2018-02-21

    Searching for DNA sequences that can strongly and selectively bind to inorganic surfaces is a long-standing topic in bionanotechnology, analytical chemistry and biointerface research. This can be achieved either by aptamer selection starting with a very large library of ≈10 14 random DNA sequences, or by careful screening of a much smaller library (usually from a few to a few hundred) with rationally designed sequences. Unlike typical molecular targets, inorganic surfaces often have quite strong DNA adsorption affinities due to polyvalent binding and even chemical interactions. This leads to a very high background binding making aptamer selection difficult. Screening, on the other hand, can be designed to compare relative binding affinities of different DNA sequences and could be more appropriate for inorganic surfaces. The resulting sequences have been used for DNA-directed assembly, sorting of carbon nanotubes, and DNA-controlled growth of inorganic nanomaterials. It was recently discovered that poly-cytosine (C) DNA can strongly bind to a diverse range of nanomaterials including nanocarbons (graphene oxide and carbon nanotubes), various metal oxides and transition-metal dichalcogenides. In this Concept article, we articulate the need for screening and potential artifacts associated with traditional aptamer selection methods for inorganic surfaces. Representative examples of application are discussed, and a few future research opportunities are proposed towards the end of this article. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

    PubMed

    Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

    1995-04-11

    SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

  2. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    PubMed Central

    Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

    2011-01-01

    Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

  3. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  4. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  5. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  6. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    PubMed Central

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-01-01

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

  7. Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

    PubMed Central

    Evers, R; Grummt, I

    1995-01-01

    Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

  8. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  9. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    NASA Astrophysics Data System (ADS)

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-10-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  10. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies.

    PubMed

    Shlyakhtenko, Luda S; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S; Lyubchenko, Yuri L

    2015-10-27

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  11. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  12. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    PubMed

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  13. Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

    PubMed Central

    Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

    2010-01-01

    The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

  14. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  15. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  16. Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

    PubMed

    Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-05-01

    Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  17. Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

    PubMed Central

    Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2017-01-01

    The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

  18. Non-B-Form DNA Is Enriched at Centromeres

    PubMed Central

    Henikoff, Steven

    2018-01-01

    Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

  19. On the connection between inherent DNA flexure and preferred binding of hydroxymethyluracil-containing DNA by the type II DNA-binding protein TF1.

    PubMed

    Grove, A; Galeone, A; Mayol, L; Geiduschek, E P

    1996-07-12

    TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.

  20. A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

    PubMed

    Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

    1993-11-11

    Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

  1. Sequence2Vec: a novel embedding approach for modeling transcription factor binding affinity landscape.

    PubMed

    Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

    2017-11-15

    An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  2. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  3. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  4. Structure-based Analysis to Hu-DNA Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

  5. Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    PubMed Central

    Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.

    2015-01-01

    The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315

  6. Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

    PubMed

    Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

    2014-07-01

    Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

  7. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Electrostatic study of Alanine mutational effects on transcription: application to GATA-3:DNA interaction complex.

    PubMed

    El-Assaad, Atlal; Dawy, Zaher; Nemer, Georges

    2015-01-01

    Protein-DNA interaction is of fundamental importance in molecular biology, playing roles in functions as diverse as DNA transcription, DNA structure formation, and DNA repair. Protein-DNA association is also important in medicine; understanding Protein-DNA binding kinetics can assist in identifying disease root causes which can contribute to drug development. In this perspective, this work focuses on the transcription process by the GATA Transcription Factor (TF). GATA TF binds to DNA promoter region represented by `G,A,T,A' nucleotides sequence, and initiates transcription of target genes. When proper regulation fails due to some mutations on the GATA TF protein sequence or on the DNA promoter sequence (weak promoter), deregulation of the target genes might lead to various disorders. In this study, we aim to understand the electrostatic mechanism behind GATA TF and DNA promoter interactions, in order to predict Protein-DNA binding in the presence of mutations, while elaborating on non-covalent binding kinetics. To generate a family of mutants for the GATA:DNA complex, we replaced every charged amino acid, one at a time, with a neutral amino acid like Alanine (Ala). We then applied Poisson-Boltzmann electrostatic calculations feeding into free energy calculations, for each mutation. These calculations delineate the contribution to binding from each Ala-replaced amino acid in the GATA:DNA interaction. After analyzing the obtained data in view of a two-step model, we are able to identify potential key amino acids in binding. Finally, we applied the model to GATA-3:DNA (crystal structure with PDB-ID: 3DFV) binding complex and validated it against experimental results from the literature.

  9. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  10. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  11. Inhibition of HMGA2 binding to DNA by netropsin

    PubMed Central

    Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

    2008-01-01

    The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

  12. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-01-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163

  13. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  14. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  15. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    PubMed Central

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-01-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA. PMID:26503602

  16. Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

    PubMed

    Rohs, Remo; Sklenar, Heinz

    2004-04-01

    The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

  17. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  18. Recognition of platinum-DNA adducts by HMGB1a.

    PubMed

    Ramachandran, Srinivas; Temple, Brenda; Alexandrova, Anastassia N; Chaney, Stephen G; Dokholyan, Nikolay V

    2012-09-25

    Cisplatin (CP) and oxaliplatin (OX), platinum-based drugs used widely in chemotherapy, form adducts on intrastrand guanines (5'GG) in genomic DNA. DNA damage recognition proteins, transcription factors, mismatch repair proteins, and DNA polymerases discriminate between CP- and OX-GG DNA adducts, which could partly account for differences in the efficacy, toxicity, and mutagenicity of CP and OX. In addition, differential recognition of CP- and OX-GG adducts is highly dependent on the sequence context of the Pt-GG adduct. In particular, DNA binding protein domain HMGB1a binds to CP-GG DNA adducts with up to 53-fold greater affinity than to OX-GG adducts in the TGGA sequence context but shows much smaller differences in binding in the AGGC or TGGT sequence contexts. Here, simulations of the HMGB1a-Pt-DNA complex in the three sequence contexts revealed a higher number of interface contacts for the CP-DNA complex in the TGGA sequence context than in the OX-DNA complex. However, the number of interface contacts was similar in the TGGT and AGGC sequence contexts. The higher number of interface contacts in the CP-TGGA sequence context corresponded to a larger roll of the Pt-GG base pair step. Furthermore, geometric analysis of stacking of phenylalanine 37 in HMGB1a (Phe37) with the platinated guanines revealed more favorable stacking modes correlated with a larger roll of the Pt-GG base pair step in the TGGA sequence context. These data are consistent with our previous molecular dynamics simulations showing that the CP-TGGA complex was able to sample larger roll angles than the OX-TGGA complex or either CP- or OX-DNA complexes in the AGGC or TGGT sequences. We infer that the high binding affinity of HMGB1a for CP-TGGA is due to the greater flexibility of CP-TGGA compared to OX-TGGA and other Pt-DNA adducts. This increased flexibility is reflected in the ability of CP-TGGA to sample larger roll angles, which allows for a higher number of interface contacts between the Pt-DNA adduct and HMGB1a.

  19. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  20. Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

    PubMed Central

    Robinson, Clifford R.; Sligar, Stephen G.

    1998-01-01

    Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

  1. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  2. Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

    PubMed Central

    2011-01-01

    Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

  3. Predicting the binding preference of transcription factors to individual DNA k-mers.

    PubMed

    Alleyne, Trevis M; Peña-Castillo, Lourdes; Badis, Gwenael; Talukder, Shaheynoor; Berger, Michael F; Gehrke, Andrew R; Philippakis, Anthony A; Bulyk, Martha L; Morris, Quaid D; Hughes, Timothy R

    2009-04-15

    Recognition of specific DNA sequences is a central mechanism by which transcription factors (TFs) control gene expression. Many TF-binding preferences, however, are unknown or poorly characterized, in part due to the difficulty associated with determining their specificity experimentally, and an incomplete understanding of the mechanisms governing sequence specificity. New techniques that estimate the affinity of TFs to all possible k-mers provide a new opportunity to study DNA-protein interaction mechanisms, and may facilitate inference of binding preferences for members of a given TF family when such information is available for other family members. We employed a new dataset consisting of the relative preferences of mouse homeodomains for all eight-base DNA sequences in order to ask how well we can predict the binding profiles of homeodomains when only their protein sequences are given. We evaluated a panel of standard statistical inference techniques, as well as variations of the protein features considered. Nearest neighbour among functionally important residues emerged among the most effective methods. Our results underscore the complexity of TF-DNA recognition, and suggest a rational approach for future analyses of TF families.

  4. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    PubMed

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  5. Multiple conformational states of DnaA protein regulate its interaction with DnaA boxes in the initiation of DNA replication.

    PubMed

    Patel, Meera J; Bhatia, Lavesh; Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

    2017-09-01

    DnaA protein is the initiator of genomic DNA replication in prokaryotes. It binds to specific DNA sequences in the origin of DNA replication and unwinds small AT-rich sequences downstream for the assembly of the replisome. The mechanism of activation of DnaA that enables it to bind and organize the origin DNA and leads to replication initiation remains unclear. In this study, we have developed double-labeled fluorescent DnaA probes to analyze conformational states of DnaA protein upon binding DNA, nucleotide, and Soj sporulation protein using Fluorescence Resonance Energy Transfer (FRET). Our studies demonstrate that DnaA protein undergoes large conformational changes upon binding to substrates and there are multiple distinct conformational states that enable it to initiate DNA replication. DnaA protein adopted a relaxed conformation by expanding ~15Å upon binding ATP and DNA to form the ATP·DnaA·DNA complex. Hydrolysis of bound ATP to ADP led to a contraction of DnaA within the complex. The relaxed conformation of DnaA is likely required for the formation of the multi-protein ATP·DnaA·DNA complex. In the initiation of sporulation, Soj binding to DnaA prevented relaxation of its conformation. Soj·ADP appeared to block the activation of DnaA, suggesting a mechanism for Soj·ADP in switching initiation of DNA replication to sporulation. Our studies demonstrate that multiple conformational states of DnaA protein regulate its binding to DNA in the initiation of DNA replication. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  7. DNA mimic proteins: functions, structures, and bioinformatic analysis.

    PubMed

    Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

    2014-05-13

    DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

  8. RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

    PubMed

    Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

    2006-11-21

    Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

  9. Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

    PubMed

    Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

    2007-11-02

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  10. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

    2015-02-01

    The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

  11. Sequence-Specific Recognition of DNA by Proteins: Binding Motifs Discovered Using a Novel Statistical/Computational Analysis

    PubMed Central

    Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri

    2016-01-01

    Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774

  12. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  13. Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

    PubMed

    Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

    2005-12-27

    Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

  14. iDNA-Prot: Identification of DNA Binding Proteins Using Random Forest with Grey Model

    PubMed Central

    Lin, Wei-Zhong; Fang, Jian-An; Xiao, Xuan; Chou, Kuo-Chen

    2011-01-01

    DNA-binding proteins play crucial roles in various cellular processes. Developing high throughput tools for rapidly and effectively identifying DNA-binding proteins is one of the major challenges in the field of genome annotation. Although many efforts have been made in this regard, further effort is needed to enhance the prediction power. By incorporating the features into the general form of pseudo amino acid composition that were extracted from protein sequences via the “grey model” and by adopting the random forest operation engine, we proposed a new predictor, called iDNA-Prot, for identifying uncharacterized proteins as DNA-binding proteins or non-DNA binding proteins based on their amino acid sequences information alone. The overall success rate by iDNA-Prot was 83.96% that was obtained via jackknife tests on a newly constructed stringent benchmark dataset in which none of the proteins included has pairwise sequence identity to any other in a same subset. In addition to achieving high success rate, the computational time for iDNA-Prot is remarkably shorter in comparison with the relevant existing predictors. Hence it is anticipated that iDNA-Prot may become a useful high throughput tool for large-scale analysis of DNA-binding proteins. As a user-friendly web-server, iDNA-Prot is freely accessible to the public at the web-site on http://icpr.jci.edu.cn/bioinfo/iDNA-Prot or http://www.jci-bioinfo.cn/iDNA-Prot. Moreover, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results. PMID:21935457

  15. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  16. The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pan, Yi; Fiscus, Valena; Meng, Wuyi

    2012-02-08

    The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

  17. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  18. Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Benasutti, M.; Ejadi, S.; Whitlow, M.D.

    The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines inmore » some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.« less

  19. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Programmable RNA recognition and cleavage by CRISPR/Cas9.

    PubMed

    O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

    2014-12-11

    The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

  1. Programmable RNA recognition and cleavage by CRISPR/Cas9

    PubMed Central

    O’Connell, Mitchell R.; Oakes, Benjamin L.; Sternberg, Samuel H.; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A.

    2014-01-01

    The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific doublestranded DNA (dsDNA) cleavage1-5. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, the protospacer adjacent motif (PAM), next to and on the strand opposite the 20-nucleotide target site in dsDNA4-7. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in many cell types and organisms8, but it has been thought to be incapable of targeting RNA5. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalyzed DNA cleavage7. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous mRNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable and tagless transcript recognition. PMID:25274302

  2. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain.

    PubMed

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-06-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. The identification of FANCD2 DNA binding domains reveals nuclear localization sequences.

    PubMed

    Niraj, Joshi; Caron, Marie-Christine; Drapeau, Karine; Bérubé, Stéphanie; Guitton-Sert, Laure; Coulombe, Yan; Couturier, Anthony M; Masson, Jean-Yves

    2017-08-21

    Fanconi anemia (FA) is a recessive genetic disorder characterized by congenital abnormalities, progressive bone-marrow failure, and cancer susceptibility. The FA pathway consists of at least 21 FANC genes (FANCA-FANCV), and the encoded protein products interact in a common cellular pathway to gain resistance against DNA interstrand crosslinks. After DNA damage, FANCD2 is monoubiquitinated and accumulates on chromatin. FANCD2 plays a central role in the FA pathway, using yet unidentified DNA binding regions. By using synthetic peptide mapping and DNA binding screen by electromobility shift assays, we found that FANCD2 bears two major DNA binding domains predominantly consisting of evolutionary conserved lysine residues. Furthermore, one domain at the N-terminus of FANCD2 bears also nuclear localization sequences for the protein. Mutations in the bifunctional DNA binding/NLS domain lead to a reduction in FANCD2 monoubiquitination and increase in mitomycin C sensitivity. Such phenotypes are not fully rescued by fusion with an heterologous NLS, which enable separation of DNA binding and nuclear import functions within this domain that are necessary for FANCD2 functions. Collectively, our results enlighten the importance of DNA binding and NLS residues in FANCD2 to activate an efficient FA pathway. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

    PubMed

    Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

    2018-05-14

    The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

  5. DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

    PubMed

    Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

    2010-06-01

    A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

  6. Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

    PubMed

    Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

    2007-02-27

    Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

  7. Structural changes induced by binding of the high-mobility group I protein to a mouse satellite DNA sequence.

    PubMed Central

    Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P

    2000-01-01

    Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751

  8. TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

    PubMed

    Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

    2015-01-01

    It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

  9. Role of DNA conformation & energetic insights in Msx-1-DNA recognition as revealed by molecular dynamics studies on specific and nonspecific complexes.

    PubMed

    Kachhap, Sangita; Singh, Balvinder

    2015-01-01

    In most of homeodomain-DNA complexes, glutamine or lysine is present at 50th position and interacts with 5th and 6th nucleotide of core recognition region. Molecular dynamics simulations of Msx-1-DNA complex (Q50-TG) and its variant complexes, that is specific (Q50K-CC), nonspecific (Q50-CC) having mutation in DNA and (Q50K-TG) in protein, have been carried out. Analysis of protein-DNA interactions and structure of DNA in specific and nonspecific complexes show that amino acid residues use sequence-dependent shape of DNA to interact. The binding free energies of all four complexes were analysed to define role of amino acid residue at 50th position in terms of binding strength considering the variation in DNA on stability of protein-DNA complexes. The order of stability of protein-DNA complexes shows that specific complexes are more stable than nonspecific ones. Decomposition analysis shows that N-terminal amino acid residues have been found to contribute maximally in binding free energy of protein-DNA complexes. Among specific protein-DNA complexes, K50 contributes more as compared to Q50 towards binding free energy in respective complexes. The sequence dependence of local conformation of DNA enables Q50/Q50K to make hydrogen bond with nucleotide(s) of DNA. The changes in amino acid sequence of protein are accommodated and stabilized around TAAT core region of DNA having variation in nucleotides.

  10. Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

    PubMed Central

    Prouse, Michael B.; Campbell, Malcolm M.

    2013-01-01

    Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

  11. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    PubMed

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  12. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    PubMed

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

    2014-02-21

    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  13. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  14. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  15. Sequence Dependent Interactions Between DNA and Single-Walled Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Roxbury, Daniel

    It is known that single-stranded DNA adopts a helical wrap around a single-walled carbon nanotube (SWCNT), forming a water-dispersible hybrid molecule. The ability to sort mixtures of SWCNTs based on chirality (electronic species) has recently been demonstrated using special short DNA sequences that recognize certain matching SWCNTs of specific chirality. This thesis investigates the intricacies of DNA-SWCNT sequence-specific interactions through both experimental and molecular simulation studies. The DNA-SWCNT binding strengths were experimentally quantified by studying the kinetics of DNA replacement by a surfactant on the surface of particular SWCNTs. Recognition ability was found to correlate strongly with measured binding strength, e.g. DNA sequence (TAT)4 was found to bind 20 times stronger to the (6,5)-SWCNT than sequence (TAT)4T. Next, using replica exchange molecular dynamics (REMD) simulations, equilibrium structures formed by (a) single-strands and (b) multiple-strands of 12-mer oligonucleotides adsorbed on various SWCNTs were explored. A number of structural motifs were discovered in which the DNA strand wraps around the SWCNT and 'stitches' to itself via hydrogen bonding. Great variability among equilibrium structures was observed and shown to be directly influenced by DNA sequence and SWCNT type. For example, the (6,5)-SWCNT DNA recognition sequence, (TAT)4, was found to wrap in a tight single-stranded right-handed helical conformation. In contrast, DNA sequence T12 forms a beta-barrel left-handed structure on the same SWCNT. These are the first theoretical indications that DNA-based SWCNT selectivity can arise on a molecular level. In a biomedical collaboration with the Mayo Clinic, pathways for DNA-SWCNT internalization into healthy human endothelial cells were explored. Through absorbance spectroscopy, TEM imaging, and confocal fluorescence microscopy, we showed that intracellular concentrations of SWCNTs far exceeded those of the incubation solution, which suggested an energy-dependent pathway. Additionally, by means of pharmacological inhibition and vector-induced gene knockout studies, the DNA-SWCNTs were shown to enter the cells via Rac1-mediated macropinocytosis.

  16. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  17. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  18. [Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

    PubMed

    Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

    2009-01-01

    The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

  19. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  20. Promoter selection in human mitochondria involves binding of a transcription factor to orientation-independent upstream regulatory elements.

    PubMed

    Fisher, R P; Topper, J N; Clayton, D A

    1987-07-17

    Selective transcription of human mitochondrial DNA requires a transcription factor (mtTF) in addition to an essentially nonselective RNA polymerase. Partially purified mtTF is able to sequester promoter-containing DNA in preinitiation complexes in the absence of mitochondrial RNA polymerase, suggesting a DNA-binding mechanism for factor activity. Functional domains, required for positive transcriptional regulation by mtTF, are identified within both major promoters of human mtDNA through transcription of mutant promoter templates in a reconstituted in vitro system. These domains are essentially coextensive with DNA sequences protected from nuclease digestion by mtTF-binding. Comparison of the sequences of the two mtTF-responsive elements reveals significant homology only when one sequence is inverted; the binding sites are in opposite orientations with respect to the predominant direction of transcription. Thus mtTF may function bidirectionally, requiring additional protein-DNA interactions to dictate transcriptional polarity. The mtTF-responsive elements are arrayed as direct repeats, separated by approximately 80 bp within the displacement-loop region of human mitochondrial DNA; this arrangement may reflect duplication of an ancestral bidirectional promoter, giving rise to separate, unidirectional promoters for each strand.

  1. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  2. DNA-binding by Haemophilus influenzae and Escherichia coli YbaB, members of a widely-distributed bacterial protein family.

    PubMed

    Cooley, Anne E; Riley, Sean P; Kral, Keith; Miller, M Clarke; DeMoll, Edward; Fried, Michael G; Stevenson, Brian

    2009-07-13

    Genes orthologous to the ybaB loci of Escherichia coli and Haemophilus influenzae are widely distributed among eubacteria. Several years ago, the three-dimensional structures of the YbaB orthologs of both E. coli and H. influenzae were determined, revealing a novel "tweezer"-like structure. However, a function for YbaB had remained elusive, with an early study of the H. influenzae ortholog failing to detect DNA-binding activity. Our group recently determined that the Borrelia burgdorferi YbaB ortholog, EbfC, is a DNA-binding protein. To reconcile those results, we assessed the abilities of both the H. influenzae and E. coli YbaB proteins to bind DNA to which B. burgdorferi EbfC can bind. Both the H. influenzae and the E. coli YbaB proteins bound to tested DNAs. DNA-binding was not well competed with poly-dI-dC, indicating some sequence preferences for those two proteins. Analyses of binding characteristics determined that both YbaB orthologs bind as homodimers. Different DNA sequence preferences were observed between H. influenzae YbaB, E. coli YbaB and B. burgdorferi EbfC, consistent with amino acid differences in the putative DNA-binding domains of these proteins. Three distinct members of the YbaB/EbfC bacterial protein family have now been demonstrated to bind DNA. Members of this protein family are encoded by a broad range of bacteria, including many pathogenic species, and results of our studies suggest that all such proteins have DNA-binding activities. The functions of YbaB/EbfC family members in each bacterial species are as-yet unknown, but given the ubiquity of these DNA-binding proteins among Eubacteria, further investigations are warranted.

  3. DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

    PubMed

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

    2013-03-29

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

  4. DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

    PubMed Central

    Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

    2013-01-01

    The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

  5. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    PubMed

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  6. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  7. Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain

    PubMed Central

    Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.

    2012-01-01

    Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066

  8. Simulation studies of DNA at the nanoscale: Interactions with proteins, polycations, and surfaces

    NASA Astrophysics Data System (ADS)

    Elder, Robert M.

    Understanding the nanoscale interactions of DNA, a multifunctional biopolymer with sequence-dependent properties, with other biological and synthetic substrates and molecules is essential to advancing these technologies. This doctoral thesis research is aimed at understanding the thermodynamics and molecular-level structure when DNA interacts with proteins, polycations, and functionalized surfaces. First, we investigate the ability of a DNA damage recognition protein (HMGB1a) to bind to anti-cancer drug-induced DNA damage, seeking to explain how HMGB1a differentiates between the drugs in vivo. Using atomistic molecular dynamics simulations, we show that the structure of the drug-DNA molecule exhibits drug- and base sequence-dependence that explains some of the experimentally observed differential recognition of the drugs in various sequence contexts. Then, we show how steric hindrance from the drug decreases the deformability of the drug-DNA molecule, which decreases recognition by the protein, a concept that can be applied to rational drug design. Second, we study how polycation architecture and chemistry affect polycation-DNA binding so as to design optimal polycations for high efficiency gene (DNA) delivery. Using a multiscale computational approach involving atomistic and coarse-grained simulations, we examine how rearranging polylysine from a linear to a grafted architecture, and several aspects of the grafted architecture, affect polycation-DNA binding and the structure of polycation-DNA complexes. Next, going beyond lysine we examine how oligopeptide chemistry and sequence in the grafted architecture affects polycation-DNA binding and find that strategic placement of hydrophobic peptides might be used to tailor binding strength. Third, we study the adsorption and conformations of single-stranded DNA (an amphiphilic biopolymer) on model hydrophilic and hydrophobic surfaces. Short ssDNA oligomers adsorb to both surfaces with similar strength, with the strength of adsorption to the hydrophobic surface depending on the composition of the DNA strands, i.e. purine or pyrimidine bases. Additionally, DNA-surface and DNA-water interactions near the surfaces govern the adsorption. For longer ssDNA oligomers, the effects of surface chemistry and temperature on ssDNA conformations are rather small, but either the hydrophilic surface or increased temperature favor slightly more compact conformations due to energetic and entropic effects, respectively.

  9. Diversification of transcription factor-DNA interactions and the evolution of gene regulatory networks.

    PubMed

    Rogers, Julia M; Bulyk, Martha L

    2018-04-25

    Sequence-specific transcription factors (TFs) bind short DNA sequences in the genome to regulate the expression of target genes. In the last decade, numerous technical advances have enabled the determination of the DNA-binding specificities of many of these factors. Large-scale screens of many TFs enabled the creation of databases of TF DNA-binding specificities, typically represented as position weight matrices (PWMs). Although great progress has been made in determining and predicting binding specificities systematically, there are still many surprises to be found when studying a particular TF's interactions with DNA in detail. Paralogous TFs' binding specificities can differ in subtle ways, in a manner that is not immediately apparent from looking at their PWMs. These differences affect gene regulatory outputs and enable TFs to rewire transcriptional networks over evolutionary time. This review discusses recent observations made in the study of TF-DNA interactions that highlight the importance of continued in-depth analysis of TF-DNA interactions and their inherent complexity. This article is categorized under: Biological Mechanisms > Regulatory Biology. © 2018 Wiley Periodicals, Inc.

  10. Multiple Intrinsically Disordered Sequences Alter DNA Binding by the Homeodomain of the Drosophila Hox Protein Ultrabithorax*S⃞

    PubMed Central

    Liu, Ying; Matthews, Kathleen S.; Bondos, Sarah E.

    2008-01-01

    During animal development, distinct tissues, organs, and appendages are specified through differential gene transcription by Hox transcription factors. However, the conserved Hox homeodomains bind DNA with high affinity yet low specificity. We have therefore explored the structure of the Drosophila melanogaster Hox protein Ultrabithorax and the impact of its nonhomeodomain regions on DNA binding properties. Computational and experimental approaches identified several conserved, intrinsically disordered regions outside the homeodomain of Ultrabithorax that impact DNA binding by the homeodomain. Full-length Ultrabithorax bound to target DNA 2.5-fold weaker than its isolated homeodomain. Using N-terminal and C-terminal deletion mutants, we demonstrate that the YPWM region and the disordered microexons (termed the I1 region) inhibit DNA binding ∼2-fold, whereas the disordered I2 region inhibits homeodomain-DNA interaction a further ∼40-fold. Binding is restored almost to homeodomain affinity by the mostly disordered N-terminal 174 amino acids (R region) in a length-dependent manner. Both the I2 and R regions contain portions of the activation domain, functionally linking DNA binding and transcription regulation. Given that (i) the I1 region and a portion of the R region alter homeodomain-DNA binding as a function of pH and (ii) an internal deletion within I1 increases Ultrabithorax-DNA affinity, I1 must directly impact homeodomain-DNA interaction energetics. However, I2 appears to indirectly affect DNA binding in a manner countered by the N terminus. The amino acid sequences of I2 and much of the I1 and R regions vary significantly among Ultrabithorax orthologues, potentially diversifying Hox-DNA interactions. PMID:18508761

  11. Structural insight into the specificity of the B3 DNA-binding domains provided by the co-crystal structure of the C-terminal fragment of BfiI restriction enzyme

    PubMed Central

    Golovenko, Dmitrij; Manakova, Elena; Zakrys, Linas; Zaremba, Mindaugas; Sasnauskas, Giedrius; Gražulis, Saulius; Siksnys, Virginijus

    2014-01-01

    The B3 DNA-binding domains (DBDs) of plant transcription factors (TF) and DBDs of EcoRII and BfiI restriction endonucleases (EcoRII-N and BfiI-C) share a common structural fold, classified as the DNA-binding pseudobarrel. The B3 DBDs in the plant TFs recognize a diverse set of target sequences. The only available co-crystal structure of the B3-like DBD is that of EcoRII-N (recognition sequence 5′-CCTGG-3′). In order to understand the structural and molecular mechanisms of specificity of B3 DBDs, we have solved the crystal structure of BfiI-C (recognition sequence 5′-ACTGGG-3′) complexed with 12-bp cognate oligoduplex. Structural comparison of BfiI-C–DNA and EcoRII-N–DNA complexes reveals a conserved DNA-binding mode and a conserved pattern of interactions with the phosphodiester backbone. The determinants of the target specificity are located in the loops that emanate from the conserved structural core. The BfiI-C–DNA structure presented here expands a range of templates for modeling of the DNA-bound complexes of the B3 family of plant TFs. PMID:24423868

  12. The NMR solution structure of a mutant of the Max b/HLH/LZ free of DNA: insights into the specific and reversible DNA binding mechanism of dimeric transcription factors.

    PubMed

    Sauvé, Simon; Tremblay, Luc; Lavigne, Pierre

    2004-09-17

    Basic region-helix1-loop-helix2-leucine zipper (b/H(1)LH(2)/LZ) transcription factors bind specific DNA sequence in their target gene promoters as dimers. Max, a b/H(1)LH(2)/LZ transcription factor, is the obligate heterodimeric partner of the related b/H(1)LH(2)/LZ proteins of the Myc and Mad families. These heterodimers specifically bind E-box DNA sequence (CACGTG) to activate (e.g. c-Myc/Max) and repress (e.g. Mad1/Max) transcription. Max can also homodimerize and bind E-box sequences in c-Myc target gene promoters. While the X-ray structure of the Max b/H(1)LH(2)/LZ/DNA complex and that of others have been reported, the precise sequence of events leading to the reversible and specific binding of these important transcription factors is still largely unknown. In order to provide insights into the DNA binding mechanism, we have solved the NMR solution structure of a covalently homodimerized version of a Max b/H(1)LH(2)/LZ protein with two stabilizing mutations in the LZ, and characterized its backbone dynamics from (15)N spin-relaxation measurements in the absence of DNA. Apart from minor differences in the pitch of the LZ, possibly resulting from the mutations in the construct, we observe that the packing of the helices in the H(1)LH(2) domain is almost identical to that of the two crystal structures, indicating that no important conformational change in these helices occurs upon DNA binding. Conversely to the crystal structures of the DNA complexes, the first 14 residues of the basic region are found to be mostly unfolded while the loop is observed to be flexible. This indicates that these domains undergo conformational changes upon DNA binding. On the other hand, we find the last four residues of the basic region form a persistent helical turn contiguous to H(1). In addition, we provide evidence of the existence of internal motions in the backbone of H(1) that are of larger amplitude and longer time-scale (nanoseconds) than the ones in the H(2) and LZ domain. Most interestingly, we note that conformers in the ensemble of calculated structures have highly conserved basic residues (located in the persistent helical turn of the basic region and in the loop) known to be important for specific binding in a conformation that matches that of the DNA-bound state. These partially prefolded conformers can directly fit into the major groove of DNA and as such are proposed to lie on the pathway leading to the reversible and specific DNA binding. In these conformers, the conserved basic side-chains form a cluster that elevates the local electrostatic potential and could provide the necessary driving force for the generation of the internal motions localized in the H(1) and therefore link structural determinants with the DNA binding function. Overall, our results suggests that the Max homodimeric b/H(1)LH(2)/LZ can rapidly and preferentially bind DNA sequence through transient and partially prefolded states and subsequently, adopt the fully helical bound state in a DNA-assisted mechanism or induced-fit.

  13. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

    PubMed Central

    Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

    2012-01-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

  14. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

    PubMed

    Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

    2012-06-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

  15. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

    PubMed

    Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

    2008-09-01

    WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

  16. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA

    PubMed Central

    Mori, Tetsuya; Saveliev, Sergei V.; Xu, Yao; Stafford, Walter F.; Cox, Michael M.; Inman, Ross B.; Johnson, Carl H.

    2002-01-01

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecA/DnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecA/DnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns. PMID:12477935

  17. Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

    PubMed

    Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

    2018-05-22

    Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Binding to the DNA Minor Groove by Heterocyclic Dications: From AT Specific Monomers to GC Recognition with Dimers

    PubMed Central

    Nanjunda, Rupesh; Wilson, W. David

    2012-01-01

    Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206

  19. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  20. Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

    PubMed

    Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

    2017-11-01

    DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. The structures of non-CG-repeat Z-DNAs co-crystallized with the Z-DNA-binding domain, hZ alpha(ADAR1).

    PubMed

    Ha, Sung Chul; Choi, Jongkeun; Hwang, Hye-Yeon; Rich, Alexander; Kim, Yang-Gyun; Kim, Kyeong Kyu

    2009-02-01

    The Z-DNA conformation preferentially occurs at alternating purine-pyrimidine repeats, and is specifically recognized by Z alpha domains identified in several Z-DNA-binding proteins. The binding of Z alpha to foreign or chromosomal DNA in various sequence contexts is known to influence various biological functions, including the DNA-mediated innate immune response and transcriptional modulation of gene expression. For these reasons, understanding its binding mode and the conformational diversity of Z alpha bound Z-DNAs is of considerable importance. However, structural studies of Z alpha bound Z-DNA have been mostly limited to standard CG-repeat DNAs. Here, we have solved the crystal structures of three representative non-CG repeat DNAs, d(CACGTG)(2), d(CGTACG)(2) and d(CGGCCG)(2) complexed to hZ alpha(ADAR1) and compared those structures with that of hZ alpha(ADAR1)/d(CGCGCG)(2) and the Z alpha-free Z-DNAs. hZ alpha(ADAR1) bound to each of the three Z-DNAs showed a well conserved binding mode with very limited structural deviation irrespective of the DNA sequence, although varying numbers of residues were in contact with Z-DNA. Z-DNAs display less structural alterations in the Z alpha-bound state than in their free form, thereby suggesting that conformational diversities of Z-DNAs are restrained by the binding pocket of Z alpha. These data suggest that Z-DNAs are recognized by Z alpha through common conformational features regardless of the sequence and structural alterations.

  2. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

    PubMed Central

    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

    2016-01-01

    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

  3. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

    PubMed

    Raghav, Sunil Kumar; Deplancke, Bart

    2012-01-01

    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  4. Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.

    PubMed Central

    Kelly, J J; Baird, E E; Dervan, P B

    1996-01-01

    Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930

  5. Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

    PubMed

    Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

    2009-01-01

    Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

  6. Interaction of the alpha-subunit of Escherichia coli RNA polymerase with DNA: rigid body nature of the protein-DNA contact.

    PubMed

    Heyduk, E; Baichoo, N; Heyduk, T

    2001-11-30

    The alpha-subunit of Escherichia coli RNA polymerase plays an important role in the activity of many promoters by providing a direct protein-DNA contact with a specific sequence (UP element) located upstream of the core promoter sequence. To obtain insight into the nature of thermodynamic forces involved in the formation of this protein-DNA contact, the binding of the alpha-subunit of E. coli RNA polymerase to a fluorochrome-labeled DNA fragment containing the rrnB P1 promoter UP element sequence was quantitatively studied using fluorescence polarization. The alpha dimer and DNA formed a 1:1 complex in solution. Complex formation at 25 degrees C was enthalpy-driven, the binding was accompanied by a net release of 1-2 ions, and no significant specific ion effects were observed. The van't Hoff plot of temperature dependence of binding was linear suggesting that the heat capacity change (Deltac(p)) was close to zero. Protein footprinting with hydroxyradicals showed that the protein did not change its conformation upon protein-DNA contact formation. No conformational changes in the DNA molecule were detected by CD spectroscopy upon protein-DNA complex formation. The thermodynamic characteristics of the binding together with the lack of significant conformational changes in the protein and in the DNA suggested that the alpha-subunit formed a rigid body-like contact with the DNA in which a tight complementary recognition interface between alpha-subunit and DNA was not formed.

  7. Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

    PubMed

    Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

    2015-11-10

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

  8. Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

    PubMed Central

    2015-01-01

    Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

  9. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  10. Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

    PubMed

    Silva, M V; Pasternack, L B; Kearns, D R

    1997-12-15

    Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

  11. Switching bonds in a DNA gel: an all-DNA vitrimer.

    PubMed

    Romano, Flavio; Sciortino, Francesco

    2015-02-20

    We design an all-DNA system that behaves like vitrimers, innovative plastics with self-healing and stress-releasing properties. The DNA sequences are engineered to self-assemble first into tetra- and bifunctional units which, upon further cooling, bind to each other forming a fully bonded network gel. An innovative design of the binding regions of the DNA sequences, exploiting a double toehold-mediated strand displacement, generates a network gel which is able to reshuffle its bonds, retaining at all times full bonding. As in vitrimers, the rate of bond switching can be controlled via a thermally activated catalyst, which in the present design is very short DNA strands.

  12. A conserved mechanism for replication origin recognition and binding in archaea.

    PubMed

    Majerník, Alan I; Chong, James P J

    2008-01-15

    To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.

  13. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  14. STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

    PubMed Central

    Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

    2013-01-01

    The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

  15. Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

    PubMed

    Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

    2014-06-01

    RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

  16. Specificity determinants for the abscisic acid response element.

    PubMed

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  17. IFI16 Preferentially Binds to DNA with Quadruplex Structure and Enhances DNA Quadruplex Formation.

    PubMed

    Hároníková, Lucia; Coufal, Jan; Kejnovská, Iva; Jagelská, Eva B; Fojta, Miroslav; Dvořáková, Petra; Muller, Petr; Vojtesek, Borivoj; Brázda, Václav

    2016-01-01

    Interferon-inducible protein 16 (IFI16) is a member of the HIN-200 protein family, containing two HIN domains and one PYRIN domain. IFI16 acts as a sensor of viral and bacterial DNA and is important for innate immune responses. IFI16 binds DNA and binding has been described to be DNA length-dependent, but a preference for supercoiled DNA has also been demonstrated. Here we report a specific preference of IFI16 for binding to quadruplex DNA compared to other DNA structures. IFI16 binds to quadruplex DNA with significantly higher affinity than to the same sequence in double stranded DNA. By circular dichroism (CD) spectroscopy we also demonstrated the ability of IFI16 to stabilize quadruplex structures with quadruplex-forming oligonucleotides derived from human telomere (HTEL) sequences and the MYC promotor. A novel H/D exchange mass spectrometry approach was developed to assess protein interactions with quadruplex DNA. Quadruplex DNA changed the IFI16 deuteration profile in parts of the PYRIN domain (aa 0-80) and in structurally identical parts of both HIN domains (aa 271-302 and aa 586-617) compared to single stranded or double stranded DNAs, supporting the preferential affinity of IFI16 for structured DNA. Our results reveal the importance of quadruplex DNA structure in IFI16 binding and improve our understanding of how IFI16 senses DNA. IFI16 selectivity for quadruplex structure provides a mechanistic framework for IFI16 in immunity and cellular processes including DNA damage responses and cell proliferation.

  18. ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

    PubMed Central

    Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

    1997-01-01

    ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

  19. Specific DNA binding activity of T antigen subclasses varies among different SV40-transformed cell lines.

    PubMed

    Burger, C; Fanning, E

    1983-04-15

    Large tumor antigen (T antigen) occurs in at least three different oligomeric subclasses in cells infected or transformed by simian virus 40 (SV40): 5-7 S, 14-16 S, and 23-25 S. The 23-25 S form is complexed with a host phosphoprotein (p53). The DNA binding properties of these three subclasses of T antigen from nine different cell lines and free p53 protein were compared using an immunoprecipitation assay. All three subclasses of T antigen bound specifically to SV40 DNA sequences near the origin of replication. However, the DNA binding activity varied between different cell lines over a 40- to 50-fold range. The 23-25 S and 14-16 S forms from most of the cell lines tested bound much less SV40 origin DNA than 5-7 S T antigen. The free p53 phosphoprotein did not bind specifically to any SV40 DNA sequences.

  20. The Replication Focus Targeting Sequence (RFTS) Domain Is a DNA-competitive Inhibitor of Dnmt1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Syeda, Farisa; Fagan, Rebecca L.; Wean, Matthew

    Dnmt1 (DNA methyltransferase 1) is the principal enzyme responsible for maintenance of cytosine methylation at CpG dinucleotides in the mammalian genome. The N-terminal replication focus targeting sequence (RFTS) domain of Dnmt1 has been implicated in subcellular localization, protein association, and catalytic function. However, progress in understanding its function has been limited by the lack of assays for and a structure of this domain. Here, we show that the naked DNA- and polynucleosome-binding activities of Dnmt1 are inhibited by the RFTS domain, which functions by virtue of binding the catalytic domain to the exclusion of DNA. Kinetic analysis with a fluorogenicmore » DNA substrate established the RFTS domain as a 600-fold inhibitor of Dnmt1 enzymatic activity. The crystal structure of the RFTS domain reveals a novel fold and supports a mechanism in which an RFTS-targeted Dnmt1-binding protein, such as Uhrf1, may activate Dnmt1 for DNA binding.« less

  1. Using FRET to Measure the Angle at Which a Protein Bends DNA: TBP Binding a TATA Box as a Model System

    ERIC Educational Resources Information Center

    Kugel, Jennifer F.

    2008-01-01

    An undergraduate biochemistry laboratory experiment that will teach the technique of fluorescence resonance energy transfer (FRET) while analyzing protein-induced DNA bending is described. The experiment uses the protein TATA binding protein (TBP), which is a general transcription factor that recognizes and binds specific DNA sequences known as…

  2. TIA-1 RRM23 binding and recognition of target oligonucleotides

    PubMed Central

    Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

    2017-01-01

    Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

  3. TIA-1 RRM23 binding and recognition of target oligonucleotides.

    PubMed

    Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

    2017-05-05

    TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Mechanism of foreign DNA selection in a bacterial adaptive immune system

    PubMed Central

    Sashital, Dipali G.; Wiedenheft, Blake; Doudna, Jennifer A.

    2012-01-01

    Summary In bacterial and archaeal CRISPR immune pathways, DNA sequences from invading bacteriophage or plasmids are integrated into CRISPR loci within the host genome, conferring immunity against subsequent infections. The ribonucleoprotein complex Cascade utilizes RNAs generated from these loci to target complementary “non-self” DNA sequences for destruction, while avoiding binding to “self” sequences within the CRISPR locus. Here we show that CasA, the largest protein subunit of Cascade, is required for non-self target recognition and binding. Combining a 2.3 Å crystal structure of CasA with cryo-EM structures of Cascade, we have identified a loop that is required for viral defense. This loop contacts a conserved 3-base pair motif that is required for non-self target selection. Our data suggest a model in which the CasA loop scans DNA for this short motif prior to target destabilization and binding, maximizing the efficiency of DNA surveillance by Cascade. PMID:22521690

  5. Engineering and Application of Zinc Finger Proteins and TALEs for Biomedical Research.

    PubMed

    Kim, Moon-Soo; Kini, Anu Ganesh

    2017-08-01

    Engineered DNA-binding domains provide a powerful technology for numerous biomedical studies due to their ability to recognize specific DNA sequences. Zinc fingers (ZF) are one of the most common DNA-binding domains and have been extensively studied for a variety of applications, such as gene regulation, genome engineering and diagnostics. Another novel DNA-binding domain known as a transcriptional activator-like effector (TALE) has been more recently discovered, which has a previously undescribed DNA-binding mode. Due to their modular architecture and flexibility, TALEs have been rapidly developed into artificial gene targeting reagents. Here, we describe the methods used to design these DNA-binding proteins and their key applications in biomedical research.

  6. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  7. Structure of the MecI repressor from Staphylococcus aureus in complex with the cognate DNA operator of mec

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safo, Martin K., E-mail: msafo@vcu.edu; Ko, Tzu-Ping; Musayev, Faik N.

    The up-and-down binding of dimeric MecI to mecA dyad DNA may account for the cooperative effect of the repressor. The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of β-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Å resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA,more » and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtual DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI–mec complex, but unlike the MecI–bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

  8. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    PubMed

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Richardson, C.C.

    1993-12-31

    This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

  10. Studies of Xenopus laevis mitochondrial DNA: D-loop mapping and characterization of DNA-binding proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cairns, S.S.

    1987-01-01

    In X. laevis oocytes, mitochondrial DNA accumulates to 10/sup 5/ times the somatic cell complement, and is characterized by a high frequency of a triple-stranded displacement hoop structure at the origin of replication. To map the termini of the single strands, it was necessary to correct the nucleotide sequence of the D-loop region. The revised sequence of 2458 nucleotides contains 54 discrepancies in comparison to a previously published sequence. Radiolabeling of the nascent strands of the D-loop structure either at the 5' end or at the 3' end identifies a major species with a length of 1670 nucleotides. Cleavage ofmore » the 5' labeled strands reveals two families of ends located near several matches to an element, designated CSB-1, that is conserved in this location in several vertebrate genomes. Cleavage of 3' labeled strands produced one fragment. The unique 3' end maps to about 15 nucleotides preceding the tRNA/sup Pro/ gene. A search for proteins which may bind to mtDNA in this region to regulate nucleic acid synthesis has identified three activities in lysates of X. laevis mitochondria. The DNA-binding proteins were assayed by monitoring their ability to retard the migration of labeled double- or single-stranded DNA fragments in polyacrylamide gels. The DNA binding preference was determined by competition with an excess of either ds- or ssDNA.« less

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  12. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  13. Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

    NASA Astrophysics Data System (ADS)

    Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

    Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

  14. In silico characterization and analysis of RTBP1 and NgTRF1 protein through MD simulation and molecular docking - A comparative study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-02-06

    Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  15. In Silico Characterization and Analysis of RTBP1 and NgTRF1 Protein Through MD Simulation and Molecular Docking: A Comparative Study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-09-01

    Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  16. Analysis of the DNA-Binding Activities of the Arabidopsis R2R3-MYB Transcription Factor Family by One-Hybrid Experiments in Yeast

    PubMed Central

    Kelemen, Zsolt; Sebastian, Alvaro; Xu, Wenjia; Grain, Damaris; Salsac, Fabien; Avon, Alexandra; Berger, Nathalie; Tran, Joseph; Dubreucq, Bertrand; Lurin, Claire; Lepiniec, Loïc; Contreras-Moreira, Bruno; Dubos, Christian

    2015-01-01

    The control of growth and development of all living organisms is a complex and dynamic process that requires the harmonious expression of numerous genes. Gene expression is mainly controlled by the activity of sequence-specific DNA binding proteins called transcription factors (TFs). Amongst the various classes of eukaryotic TFs, the MYB superfamily is one of the largest and most diverse, and it has considerably expanded in the plant kingdom. R2R3-MYBs have been extensively studied over the last 15 years. However, DNA-binding specificity has been characterized for only a small subset of these proteins. Therefore, one of the remaining challenges is the exhaustive characterization of the DNA-binding specificity of all R2R3-MYB proteins. In this study, we have developed a library of Arabidopsis thaliana R2R3-MYB open reading frames, whose DNA-binding activities were assayed in vivo (yeast one-hybrid experiments) with a pool of selected cis-regulatory elements. Altogether 1904 interactions were assayed leading to the discovery of specific patterns of interactions between the various R2R3-MYB subgroups and their DNA target sequences and to the identification of key features that govern these interactions. The present work provides a comprehensive in vivo analysis of R2R3-MYB binding activities that should help in predicting new DNA motifs and identifying new putative target genes for each member of this very large family of TFs. In a broader perspective, the generated data will help to better understand how TF interact with their target DNA sequences. PMID:26484765

  17. DNA binding of the p21 repressor ZBTB2 is inhibited by cytosine hydroxymethylation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lafaye, Céline; Barbier, Ewa; Miscioscia, Audrey

    2014-03-28

    Highlights: • 5-hmC epigenetic modification is measurable in HeLa, SH-SY5Y and UT7-MPL cell lines. • ZBTB2 binds to DNA probes containing 5-mC but not to sequences containing 5-hmC. • This differential binding is verified with DNA sequences involved in p21 regulation. - Abstract: Recent studies have demonstrated that the modified base 5-hydroxymethylcytosine (5-hmC) is detectable at various rates in DNA extracted from human tissues. This oxidative product of 5-methylcytosine (5-mC) constitutes a new and important actor of epigenetic mechanisms. We designed a DNA pull down assay to trap and identify nuclear proteins bound to 5-hmC and/or 5-mC. We applied thismore » strategy to three cancerous cell lines (HeLa, SH-SY5Y and UT7-MPL) in which we also measured 5-mC and 5-hmC levels by HPLC-MS/MS. We found that the putative oncoprotein Zinc finger and BTB domain-containing protein 2 (ZBTB2) is associated with methylated DNA sequences and that this interaction is inhibited by the presence of 5-hmC replacing 5-mC. As published data mention ZBTB2 recognition of p21 regulating sequences, we verified that this sequence specific binding was also alleviated by 5-hmC. ZBTB2 being considered as a multifunctional cell proliferation activator, notably through p21 repression, this work points out new epigenetic processes potentially involved in carcinogenesis.« less

  18. Unveiling Stability Criteria of DNA-Carbon Nanotubes Constructs by Scanning Tunneling Microscopy and Computational Modeling

    DOE PAGES

    Kilina, Svetlana; Yarotski, Dzmitry A.; Talin, A. Alec; ...

    2011-01-01

    We present a combined approach that relies on computational simulations and scanning tunneling microscopy (STM) measurements to reveal morphological properties and stability criteria of carbon nanotube-DNA (CNT-DNA) constructs. Application of STM allows direct observation of very stable CNT-DNA hybrid structures with the well-defined DNA wrapping angle of 63.4 ° and a coiling period of 3.3 nm. Using force field simulations, we determine how the DNA-CNT binding energy depends on the sequence and binding geometry of a single strand DNA. This dependence allows us to quantitatively characterize the stability of a hybrid structure with an optimal π-stacking between DNA nucleotides and themore » tube surface and better interpret STM data. Our simulations clearly demonstrate the existence of a very stable DNA binding geometry for (6,5) CNT as evidenced by the presence of a well-defined minimum in the binding energy as a function of an angle between DNA strand and the nanotube chiral vector. This novel approach demonstrates the feasibility of CNT-DNA geometry studies with subnanometer resolution and paves the way towards complete characterization of the structural and electronic properties of drug-delivering systems based on DNA-CNT hybrids as a function of DNA sequence and a nanotube chirality.« less

  19. Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

    PubMed

    Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

    2006-01-01

    The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

  20. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  1. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

    2015-01-01

    The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  3. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  4. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed Central

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-01-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

  5. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-03-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

  6. Topological Interaction by Entanglement of DNA

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

    2012-02-01

    We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

  7. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

    PubMed

    Pessler, Frank; Hernandez, Nouria

    2003-08-01

    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  8. Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

    PubMed

    Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

    2013-04-16

    In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

  9. High-resolution biophysical analysis of the dynamics of nucleosome formation

    PubMed Central

    Hatakeyama, Akiko; Hartmann, Brigitte; Travers, Andrew; Nogues, Claude; Buckle, Malcolm

    2016-01-01

    We describe a biophysical approach that enables changes in the structure of DNA to be followed during nucleosome formation in in vitro reconstitution with either the canonical “Widom” sequence or a judiciously mutated sequence. The rapid non-perturbing photochemical analysis presented here provides ‘snapshots’ of the DNA configuration at any given moment in time during nucleosome formation under a very broad range of reaction conditions. Changes in DNA photochemical reactivity upon protein binding are interpreted as being mainly induced by alterations in individual base pair roll angles. The results strengthen the importance of the role of an initial (H3/H4)2 histone tetramer-DNA interaction and highlight the modulation of this early event by the DNA sequence. (H3/H4)2 binding precedes and dictates subsequent H2A/H2B-DNA interactions, which are less affected by the DNA sequence, leading to the final octameric nucleosome. Overall, our results provide a novel, exciting way to investigate those biophysical properties of DNA that constitute a crucial component in nucleosome formation and stabilization. PMID:27263658

  10. An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes.

    PubMed

    Hamula, Camille L A; Peng, Hanyong; Wang, Zhixin; Tyrrell, Gregory J; Li, Xing-Fang; Le, X Chris

    2016-03-15

    Streptococcus pyogenes is a clinically important pathogen consisting of various serotypes determined by different M proteins expressed on the cell surface. The M type is therefore a useful marker to monitor the spread of invasive S. pyogenes in a population. Serotyping and nucleic acid amplification/sequencing methods for the identification of M types are laborious, inconsistent, and usually confined to reference laboratories. The primary objective of this work is to develop a technique that enables generation of aptamers binding to specific M-types of S. pyogenes. We describe here an in vitro technique that directly used live bacterial cells and the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) strategy. Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences. Those sequences that bound to the cells were separated, amplified using polymerase chain reaction (PCR), purified using gel electrophoresis, and served as the input DNA pool for the next round of SELEX selection. A specially designed forward primer containing extended polyA20/5Sp9 facilitated gel electrophoresis purification of ssDNA after PCR amplification. A counter-selection step using non-target cells was introduced to improve selectivity. DNA libraries of different starting sequence diversity (10(16) and 10(14)) were compared. Aptamer pools from each round of selection were tested for their binding to the target and non-target cells using flow cytometry. Selected aptamer pools were then cloned and sequenced. Individual aptamer sequences were screened on the basis of their binding to the 10 M-types that were used as targets. Aptamer pools obtained from SELEX rounds 5-8 showed high affinity to the target S. pyogenes cells. Tests against non-target Streptococcus bovis, Streptococcus pneumoniae, and Enterococcus species demonstrated selectivity of these aptamers for binding to S. pyogenes. Several aptamer sequences were found to bind preferentially to the M11 M-type of S. pyogenes. Estimated binding dissociation constants (Kd) were in the low nanomolar range for the M11 specific sequences; for example, sequence E-CA20 had a Kd of 7±1 nM. These affinities are comparable to those of a monoclonal antibody. The improved bacterial cell-SELEX technique is successful in generating aptamers selective for S. pyogenes and some of its M-types. These aptamers are potentially useful for detecting S. pyogenes, achieving binding profiles of the various M-types, and developing new M-typing technologies for non-specialized laboratories or point-of-care testing. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Study of base pair mutations in proline-rich homeodomain (PRH)-DNA complexes using molecular dynamics.

    PubMed

    Jalili, Seifollah; Karami, Leila; Schofield, Jeremy

    2013-06-01

    Proline-rich homeodomain (PRH) is a regulatory protein controlling transcription and gene expression processes by binding to the specific sequence of DNA, especially to the sequence 5'-TAATNN-3'. The impact of base pair mutations on the binding between the PRH protein and DNA is investigated using molecular dynamics and free energy simulations to identify DNA sequences that form stable complexes with PRH. Three 20-ns molecular dynamics simulations (PRH-TAATTG, PRH-TAATTA and PRH-TAATGG complexes) in explicit solvent water were performed to investigate three complexes structurally. Structural analysis shows that the native TAATTG sequence forms a complex that is more stable than complexes with base pair mutations. It is also observed that upon mutation, the number and occupancy of the direct and water-mediated hydrogen bonds decrease. Free energy calculations performed with the thermodynamic integration method predict relative binding free energies of 0.64 and 2 kcal/mol for GC to AT and TA to GC mutations, respectively, suggesting that among the three DNA sequences, the PRH-TAATTG complex is more stable than the two mutated complexes. In addition, it is demonstrated that the stability of the PRH-TAATTA complex is greater than that of the PRH-TAATGG complex.

  12. Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

    PubMed

    Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

    2017-02-07

    We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

  13. The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response

    PubMed Central

    Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G.; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio

    2017-01-01

    Abstract Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. PMID:27940556

  14. Structure of the Mecl Repressor from Staphylococcus aureus in Complex with the Cognate DNA Operator of mec

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Safo,M.; Ko, T.; Musayev, F.

    The dimeric repressor MecI regulates the mecA gene that encodes the penicillin-binding protein PBP-2a in methicillin-resistant Staphylococcus aureus (MRSA). MecI is similar to BlaI, the repressor for the blaZ gene of {beta}-lactamase. MecI and BlaI can bind to both operator DNA sequences. The crystal structure of MecI in complex with the 32 base-pair cognate DNA of mec was determined to 3.8 Angstroms resolution. MecI is a homodimer and each monomer consists of a compact N-terminal winged-helix domain, which binds to DNA, and a loosely packed C-terminal helical domain, which intertwines with its counter-monomer. The crystal contains horizontal layers of virtualmore » DNA double helices extending in three directions, which are separated by perpendicular DNA segments. Each DNA segment is bound to two MecI dimers. Similar to the BlaI-mec complex, but unlike the MecI-bla complex, the MecI repressors bind to both sides of the mec DNA dyad that contains four conserved sequences of TACA/TGTA. The results confirm the up-and-down binding to the mec operator, which may account for cooperative effect of the repressor.« less

  15. The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

    PubMed

    Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

    2011-04-01

    The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

  16. An electrochemical sensing platform based on local repression of electrolyte diffusion for single-step, reagentless, sensitive detection of a sequence-specific DNA-binding protein.

    PubMed

    Zhang, Yun; Liu, Fang; Nie, Jinfang; Jiang, Fuyang; Zhou, Caibin; Yang, Jiani; Fan, Jinlong; Li, Jianping

    2014-05-07

    In this paper, we report for the first time an electrochemical biosensor for single-step, reagentless, and picomolar detection of a sequence-specific DNA-binding protein using a double-stranded, electrode-bound DNA probe terminally modified with a redox active label close to the electrode surface. This new methodology is based upon local repression of electrolyte diffusion associated with protein-DNA binding that leads to reduction of the electrochemical response of the label. In the proof-of-concept study, the resulting electrochemical biosensor was quantitatively sensitive to the concentrations of the TATA binding protein (TBP, a model analyte) ranging from 40 pM to 25.4 nM with an estimated detection limit of ∼10.6 pM (∼80 to 400-fold improvement on the detection limit over previous electrochemical analytical systems).

  17. Structural basis of DNA bending and oriented heterodimer binding by the basic leucine zipper domains of Fos and Jun.

    PubMed

    Leonard, D A; Rajaram, N; Kerppola, T K

    1997-05-13

    Interactions among transcription factors that bind to separate sequence elements require bending of the intervening DNA and juxtaposition of interacting molecular surfaces in an appropriate orientation. Here, we examine the effects of single amino acid substitutions adjacent to the basic regions of Fos and Jun as well as changes in sequences flanking the AP-1 site on DNA bending. Substitution of charged amino acid residues at positions adjacent to the basic DNA-binding domains of Fos and Jun altered DNA bending. The change in DNA bending was directly proportional to the change in net charge for all heterodimeric combinations between these proteins. Fos and Jun induced distinct DNA bends at different binding sites. Exchange of a single base pair outside of the region contacted in the x-ray crystal structure altered DNA bending. Substitution of base pairs flanking the AP-1 site had converse effects on the opposite directions of DNA bending induced by homodimers and heterodimers. These results suggest that Fos and Jun induce DNA bending in part through electrostatic interactions between amino acid residues adjacent to the basic region and base pairs flanking the AP-1 site. DNA bending by Fos and Jun at inverted binding sites indicated that heterodimers bind to the AP-1 site in a preferred orientation. Mutation of a conserved arginine within the basic regions of Fos and transversion of the central C:G base pair in the AP-1 site to G:C had complementary effects on the orientation of heterodimer binding and DNA bending. The conformational variability of the Fos-Jun-AP-1 complex may contribute to its functional versatility at different promoters.

  18. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  19. footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

    PubMed

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2014-01-15

    Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

  20. Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

    PubMed

    Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

    2017-06-01

    The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

  1. Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

    PubMed

    Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

    2017-01-01

    The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

  2. Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

    PubMed

    Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

    2016-02-18

    We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tully, D.B.; Hillman, D.; Herbert, E.

    1986-05-01

    Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

  4. Design, synthesis and DNA interactions of a chimera between a platinum complex and an IHF mimicking peptide.

    PubMed

    Rao, Harita; Damian, Mariana S; Alshiekh, Alak; Elmroth, Sofi K C; Diederichsen, Ulf

    2015-12-28

    Conjugation of metal complexes with peptide scaffolds possessing high DNA binding affinity has shown to modulate their biological activities and to enhance their interaction with DNA. In this work, a platinum complex/peptide chimera was synthesized based on a model of the Integration Host Factor (IHF), an architectural protein possessing sequence specific DNA binding and bending abilities through its interaction with a minor groove. The model peptide consists of a cyclic unit resembling the minor grove binding subdomain of IHF, a positively charged lysine dendrimer for electrostatic interactions with the DNA phosphate backbone and a flexible glycine linker tethering the two units. A norvaline derived artificial amino acid was designed to contain a dimethylethylenediamine as a bidentate platinum chelating unit, and introduced into the IHF mimicking peptides. The interaction of the chimeric peptides with various DNA sequences was studied by utilizing the following experiments: thermal melting studies, agarose gel electrophoresis for plasmid DNA unwinding experiments, and native and denaturing gel electrophoresis to visualize non-covalent and covalent peptide-DNA adducts, respectively. By incorporation of the platinum metal center within the model peptide mimicking IHF we have attempted to improve its specificity and DNA targeting ability, particularly towards those sequences containing adjacent guanine residues.

  5. Circadian clock protein KaiC forms ATP-dependent hexameric rings and binds DNA.

    PubMed

    Mori, Tetsuya; Saveliev, Sergei V; Xu, Yao; Stafford, Walter F; Cox, Michael M; Inman, Ross B; Johnson, Carl H

    2002-12-24

    KaiC from Synechococcus elongatus PCC 7942 (KaiC) is an essential circadian clock protein in cyanobacteria. Previous sequence analyses suggested its inclusion in the RecADnaB superfamily. A characteristic of the proteins of this superfamily is that they form homohexameric complexes that bind DNA. We show here that KaiC also forms ring complexes with a central pore that can be visualized by electron microscopy. A combination of analytical ultracentrifugation and chromatographic analyses demonstrates that these complexes are hexameric. The association of KaiC molecules into hexamers depends on the presence of ATP. The KaiC sequence does not include the obvious DNA-binding motifs found in RecA or DnaB. Nevertheless, KaiC binds forked DNA substrates. These data support the inclusion of KaiC into the RecADnaB superfamily and have important implications for enzymatic activity of KaiC in the circadian clock mechanism that regulates global changes in gene expression patterns.

  6. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  7. Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

    PubMed

    Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

    2017-10-01

    Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

  8. BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

    PubMed Central

    Wang, Junbai; Batmanov, Kirill

    2015-01-01

    Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

  9. GBshape: a genome browser database for DNA shape annotations

    PubMed Central

    Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

    2015-01-01

    Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

  10. Coupled binding-bending-folding: The complex conformational dynamics of protein-DNA binding studied by atomistic molecular dynamics simulations.

    PubMed

    van der Vaart, Arjan

    2015-05-01

    Protein-DNA binding often involves dramatic conformational changes such as protein folding and DNA bending. While thermodynamic aspects of this behavior are understood, and its biological function is often known, the mechanism by which the conformational changes occur is generally unclear. By providing detailed structural and energetic data, molecular dynamics simulations have been helpful in elucidating and rationalizing protein-DNA binding. This review will summarize recent atomistic molecular dynamics simulations of the conformational dynamics of DNA and protein-DNA binding. A brief overview of recent developments in DNA force fields is given as well. Simulations have been crucial in rationalizing the intrinsic flexibility of DNA, and have been instrumental in identifying the sequence of binding events, the triggers for the conformational motion, and the mechanism of binding for a number of important DNA-binding proteins. Molecular dynamics simulations are an important tool for understanding the complex binding behavior of DNA-binding proteins. With recent advances in force fields and rapid increases in simulation time scales, simulations will become even more important for future studies. This article is part of a Special Issue entitled Recent developments of molecular dynamics. Copyright © 2014. Published by Elsevier B.V.

  11. Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

    PubMed

    Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

    2001-08-01

    DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

  12. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  13. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  14. Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

    PubMed

    Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

    2001-08-17

    Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

  15. G-Quadruplex Induction by the Hairpin Pyrrole-Imidazole Polyamide Dimer.

    PubMed

    Obata, Shunsuke; Asamitsu, Sefan; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-02-06

    The G-quadruplex (G4) is one type of higher-order structure of nucleic acids and is thought to play important roles in various biological events such as regulation of transcription and inhibition of DNA replication. Pyrrole-imidazole polyamides (PIPs) are programmable small molecules that can sequence-specifically bind with high affinity to the minor groove of double-stranded DNA (dsDNA). Herein, we designed head-to-head hairpin PIP dimers and their target dsDNA in a model G4-forming sequence. Using an electrophoresis mobility shift assay and transcription arrest assay, we found that PIP dimers could induce the structural change to G4 DNA from dsDNA through the recognition by one PIP dimer molecule of two duplex-binding sites flanking both ends of the G4-forming sequence. This induction ability was dependent on linker length. This is the first study to induce G4 formation using PIPs, which are known to be dsDNA binders. The results reported here suggest that selective G4 induction in native sequences may be achieved with PIP dimers by applying the same design strategy.

  16. Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

    PubMed Central

    Fox, K R; Grigg, G W

    1988-01-01

    DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

  17. Characterization of the DNA binding properties of polyomavirus capsid protein

    NASA Technical Reports Server (NTRS)

    Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

    1993-01-01

    The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

  18. Cations Form Sequence Selective Motifs within DNA Grooves via a Combination of Cation-Pi and Ion-Dipole/Hydrogen Bond Interactions

    PubMed Central

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl+) and the polarized first hydration shell waters of divalent cations (Mg2+, Ca2+) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves. PMID:23940752

  19. Cations form sequence selective motifs within DNA grooves via a combination of cation-pi and ion-dipole/hydrogen bond interactions.

    PubMed

    Stewart, Mikaela; Dunlap, Tori; Dourlain, Elizabeth; Grant, Bryce; McFail-Isom, Lori

    2013-01-01

    The fine conformational subtleties of DNA structure modulate many fundamental cellular processes including gene activation/repression, cellular division, and DNA repair. Most of these cellular processes rely on the conformational heterogeneity of specific DNA sequences. Factors including those structural characteristics inherent in the particular base sequence as well as those induced through interaction with solvent components combine to produce fine DNA structural variation including helical flexibility and conformation. Cation-pi interactions between solvent cations or their first hydration shell waters and the faces of DNA bases form sequence selectively and contribute to DNA structural heterogeneity. In this paper, we detect and characterize the binding patterns found in cation-pi interactions between solvent cations and DNA bases in a set of high resolution x-ray crystal structures. Specifically, we found that monovalent cations (Tl⁺) and the polarized first hydration shell waters of divalent cations (Mg²⁺, Ca²⁺) form cation-pi interactions with DNA bases stabilizing unstacked conformations. When these cation-pi interactions are combined with electrostatic interactions a pattern of specific binding motifs is formed within the grooves.

  20. Assessment of amsacrine binding with DNA using UV-visible, circular dichroism and Raman spectroscopic techniques.

    PubMed

    Jangir, Deepak Kumar; Dey, Sanjay Kumar; Kundu, Suman; Mehrotra, Ranjana

    2012-09-03

    Proper understanding of the mechanism of binding of drugs to their targets in cell is a fundamental requirement to develop new drug therapy regimen. Amsacrine is a rationally designed anticancer drug, used to treat leukemia and lymphoma. Binding with cellular DNA is a crucial step in its mechanism of cytotoxicity. Despite numerous studies, DNA binding properties of amsacrine are poorly understood. Its reversible binding with DNA does not permit X-ray crystallography or NMR spectroscopic evaluation of amsacrine-DNA complexes. In the present work, interaction of amsacrine with calf thymus DNA is investigated at physiological conditions. UV-visible, FT-Raman and circular dichroism spectroscopic techniques were employed to determine the binding mode, binding constant, sequence specificity and conformational effects of amsacrine binding to native calf thymus DNA. Our results illustrate that amsacrine interacts with DNA by and large through intercalation between base pairs. Binding constant of the amsacrine-DNA complex was found to be K=1.2±0.1×10(4) M(-1) which is indicative of moderate type of binding of amsacrine to DNA. Raman spectroscopic results suggest that amsacrine has a binding preference of intercalation between AT base pairs of DNA. Minor groove binding is also observed in amsacrine-DNA complexes. These results are in good agreement with in silico investigation of amsacrine binding to DNA and thus provide detailed insight into DNA binding properties of amsacrine, which could ultimately, renders its cytotoxic efficacy. Copyright © 2012 Elsevier B.V. All rights reserved.

  1. The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

    PubMed

    Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

    2016-11-02

    Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

    PubMed Central

    Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

    1987-01-01

    Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

  3. Fluorescent DNA-templated silver nanoclusters

    NASA Astrophysics Data System (ADS)

    Lin, Ruoqian

    Because of the ultra-small size and biocompatibility of silver nanoclusters, they have attracted much research interest for their applications in biolabeling. Among the many ways of synthesizing silver nanoclusters, DNA templated method is particularly attractive---the high tunability of DNA sequences provides another degree of freedom for controlling the chemical and photophysical properties. However, systematic studies about how DNA sequences and concentrations are controlling the photophysical properties are still lacking. The aim of this thesis is to investigate the binding mechanisms of silver clusters binding and single stranded DNAs. Here in this thesis, we report synthesis and characterization of DNA-templated silver nanoclusters and provide a systematic interrogation of the effects of DNA concentrations and sequences, including lengths and secondary structures. We performed a series of syntheses utilizing five different sequences to explore the optimal synthesis condition. By characterizing samples with UV-vis and fluorescence spectroscopy, we achieved the most proper reactants ratio and synthesis conditions. Two of them were chosen for further concentration dependence studies and sequence dependence studies. We found that cytosine-rich sequences are more likely to produce silver nanoclusters with stronger fluorescence signals; however, sequences with hairpin secondary structures are more capable in stabilizing silver nanoclusters. In addition, the fluorescence peak emission intensities and wavelengths of the DNA templated silver clusters have sequence dependent fingerprints. This potentially can be applied to sequence sensing in the future. However all the current conclusions are not warranted; there is still difficulty in formulating general rules in DNA strand design and silver nanocluster production. Further investigation of more sequences could solve these questions in the future.

  4. Herpes simplex virus DNA packaging sequences adopt novel structures that are specifically recognized by a component of the cleavage and packaging machinery.

    PubMed

    Adelman, K; Salmon, B; Baines, J D

    2001-03-13

    The product of the herpes simplex virus type 1 U(L)28 gene is essential for cleavage of concatemeric viral DNA into genome-length units and packaging of this DNA into viral procapsids. To address the role of U(L)28 in this process, purified U(L)28 protein was assayed for the ability to recognize conserved herpesvirus DNA packaging sequences. We report that DNA fragments containing the pac1 DNA packaging motif can be induced by heat treatment to adopt novel DNA conformations that migrate faster than the corresponding duplex in nondenaturing gels. Surprisingly, these novel DNA structures are high-affinity substrates for U(L)28 protein binding, whereas double-stranded DNA of identical sequence composition is not recognized by U(L)28 protein. We demonstrate that only one strand of the pac1 motif is responsible for the formation of novel DNA structures that are bound tightly and specifically by U(L)28 protein. To determine the relevance of the observed U(L)28 protein-pac1 interaction to the cleavage and packaging process, we have analyzed the binding affinity of U(L)28 protein for pac1 mutants previously shown to be deficient in cleavage and packaging in vivo. Each of the pac1 mutants exhibited a decrease in DNA binding by U(L)28 protein that correlated directly with the reported reduction in cleavage and packaging efficiency, thereby supporting a role for the U(L)28 protein-pac1 interaction in vivo. These data therefore suggest that the formation of novel DNA structures by the pac1 motif confers added specificity on recognition of DNA packaging sequences by the U(L)28-encoded component of the herpesvirus cleavage and packaging machinery.

  5. Modular probes for enriching and detecting complex nucleic acid sequences

    NASA Astrophysics Data System (ADS)

    Wang, Juexiao Sherry; Yan, Yan Helen; Zhang, David Yu

    2017-12-01

    Complex DNA sequences are difficult to detect and profile, but are important contributors to human health and disease. Existing hybridization probes lack the capability to selectively bind and enrich hypervariable, long or repetitive sequences. Here, we present a generalized strategy for constructing modular hybridization probes (M-Probes) that overcomes these challenges. We demonstrate that M-Probes can tolerate sequence variations of up to 7 nt at prescribed positions while maintaining single nucleotide sensitivity at other positions. M-Probes are also shown to be capable of sequence-selectively binding a continuous DNA sequence of more than 500 nt. Furthermore, we show that M-Probes can detect genes with triplet repeats exceeding a programmed threshold. As a demonstration of this technology, we have developed a hybrid capture method to determine the exact triplet repeat expansion number in the Huntington's gene of genomic DNA using quantitative PCR.

  6. Predicting and analyzing DNA-binding domains using a systematic approach to identifying a set of informative physicochemical and biochemical properties

    PubMed Central

    2011-01-01

    Background Existing methods of predicting DNA-binding proteins used valuable features of physicochemical properties to design support vector machine (SVM) based classifiers. Generally, selection of physicochemical properties and determination of their corresponding feature vectors rely mainly on known properties of binding mechanism and experience of designers. However, there exists a troublesome problem for designers that some different physicochemical properties have similar vectors of representing 20 amino acids and some closely related physicochemical properties have dissimilar vectors. Results This study proposes a systematic approach (named Auto-IDPCPs) to automatically identify a set of physicochemical and biochemical properties in the AAindex database to design SVM-based classifiers for predicting and analyzing DNA-binding domains/proteins. Auto-IDPCPs consists of 1) clustering 531 amino acid indices in AAindex into 20 clusters using a fuzzy c-means algorithm, 2) utilizing an efficient genetic algorithm based optimization method IBCGA to select an informative feature set of size m to represent sequences, and 3) analyzing the selected features to identify related physicochemical properties which may affect the binding mechanism of DNA-binding domains/proteins. The proposed Auto-IDPCPs identified m=22 features of properties belonging to five clusters for predicting DNA-binding domains with a five-fold cross-validation accuracy of 87.12%, which is promising compared with the accuracy of 86.62% of the existing method PSSM-400. For predicting DNA-binding sequences, the accuracy of 75.50% was obtained using m=28 features, where PSSM-400 has an accuracy of 74.22%. Auto-IDPCPs and PSSM-400 have accuracies of 80.73% and 82.81%, respectively, applied to an independent test data set of DNA-binding domains. Some typical physicochemical properties discovered are hydrophobicity, secondary structure, charge, solvent accessibility, polarity, flexibility, normalized Van Der Waals volume, pK (pK-C, pK-N, pK-COOH and pK-a(RCOOH)), etc. Conclusions The proposed approach Auto-IDPCPs would help designers to investigate informative physicochemical and biochemical properties by considering both prediction accuracy and analysis of binding mechanism simultaneously. The approach Auto-IDPCPs can be also applicable to predict and analyze other protein functions from sequences. PMID:21342579

  7. A duplex DNA-gold nanoparticle probe composed as a colorimetric biosensor for sequence-specific DNA-binding proteins.

    PubMed

    Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa

    2016-03-21

    Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.

  8. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  9. Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.

    PubMed

    Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C

    2017-03-21

    A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.

  10. Toward rules relating zinc finger protein sequences and DNA binding site preferences.

    PubMed

    Desjarlais, J R; Berg, J M

    1992-08-15

    Zinc finger proteins of the Cys2-His2 type consist of tandem arrays of domains, where each domain appears to contact three adjacent base pairs of DNA through three key residues. We have designed and prepared a series of variants of the central zinc finger within the DNA binding domain of Sp1 by using information from an analysis of a large data base of zinc finger protein sequences. Through systematic variations at two of the three contact positions (underlined), relatively specific recognition of sequences of the form 5'-GGGGN(G or T)GGG-3' has been achieved. These results provide the basis for rules that may develop into a code that will allow the design of zinc finger proteins with preselected DNA site specificity.

  11. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  12. Enantiospecific recognition of DNA sequences by a proflavine Tröger base.

    PubMed

    Bailly, C; Laine, W; Demeunynck, M; Lhomme, J

    2000-07-05

    The DNA interaction of a chiral Tröger base derived from proflavine was investigated by DNA melting temperature measurements and complementary biochemical assays. DNase I footprinting experiments demonstrate that the binding of the proflavine-based Tröger base is both enantio- and sequence-specific. The (+)-isomer poorly interacts with DNA in a non-sequence-selective fashion. In sharp contrast, the corresponding (-)-isomer recognizes preferentially certain DNA sequences containing both A. T and G. C base pairs, such as the motifs 5'-GTT. AAC and 5'-ATGA. TCAT. This is the first experimental demonstration that acridine-type Tröger bases can be used for enantiospecific recognition of DNA sequences. Copyright 2000 Academic Press.

  13. HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

    PubMed

    Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

    2018-03-01

    HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. Understanding the recognition mechanisms of Zα domain of human editing enzyme ADAR1 (hZα(ADAR1)) and various Z-DNAs from molecular dynamics simulation.

    PubMed

    Wang, Qianqian; Li, Lanlan; Wang, Xiaoting; Liu, Huanxiang; Yao, Xiaojun

    2014-11-01

    The Z-DNA-binding domain of human double-stranded RNA adenosine deaminase I (hZαADAR1) can specifically recognize the left-handed Z-DNA which preferentially occurs at alternating purine-pyrimidine repeats, especially the CG-repeats. The interactions of hZαADAR1 and Z-DNAs in different sequence contexts can affect many important biological functions including gene regulation and chromatin remodeling. Therefore it is of great necessity to fully understand their recognition mechanisms. However, most existing studies are aimed at the standard CG-repeat Z-DNA rather than the non-CG-repeats, and whether the molecular basis of hZαADAR1 binding to various Z-DNAs are identical or not is still unclear on the atomic level. Here, based on the recently determined crystal structures of three representative non-CG-repeat Z-DNAs (d(CACGTG)2, d(CGTACG)2 and d(CGGCCG)2) in complex with hZαADAR1, 40 ns molecular dynamics simulation together with binding free energy calculation were performed for each system. For comparison, the standard CG-repeat Z-DNA (d(CGCGCG)2) complexed with hZαADAR1 was also simulated. The consistent results demonstrate that nonpolar interaction is the driving force during the protein-DNA binding process, and that polar interaction mainly from helix α3 also provides important contributions. Five common hot-spot residues were identified, namely Lys169, Lys170, Asn173, Arg174 and Tyr177. Hydrogen bond analysis coupled with surface charge distribution further reveal the interfacial information between hZαADAR1 and Z-DNA in detail. All of the analysis illustrate that four complexes share the common key features and the similar binding modes irrespective of Z-DNA sequences, suggesting that Z-DNA recognition by hZαADAR1 is conformation-specific rather than sequence-specific. Additionally, by analyzing the conformational changes of hZαADAR1, we found that the binding of Z-DNA could effectively stabilize hZαADAR1 protein. Our study can provide some valuable information for better understanding the binding mechanism between hZαADAR1 or even other Z-DNA-binding protein and Z-DNA.

  15. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  16. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  17. Single-Molecule Counting of Point Mutations by Transient DNA Binding

    NASA Astrophysics Data System (ADS)

    Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

    2017-03-01

    High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

  18. Molecular sled sequences are common in mammalian proteins.

    PubMed

    Xiong, Kan; Blainey, Paul C

    2016-03-18

    Recent work revealed a new class of molecular machines called molecular sleds, which are small basic molecules that bind and slide along DNA with the ability to carry cargo along DNA. Here, we performed biochemical and single-molecule flow stretching assays to investigate the basis of sliding activity in molecular sleds. In particular, we identified the functional core of pVIc, the first molecular sled characterized; peptide functional groups that control sliding activity; and propose a model for the sliding activity of molecular sleds. We also observed widespread DNA binding and sliding activity among basic polypeptide sequences that implicate mammalian nuclear localization sequences and many cell penetrating peptides as molecular sleds. These basic protein motifs exhibit weak but physiologically relevant sequence-nonspecific DNA affinity. Our findings indicate that many mammalian proteins contain molecular sled sequences and suggest the possibility that substantial undiscovered sliding activity exists among nuclear mammalian proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Targeted DNA demethylation in human cells by fusion of a plant 5-methylcytosine DNA glycosylase to a sequence-specific DNA binding domain

    PubMed Central

    Parrilla-Doblas, Jara Teresa; Ariza, Rafael R.; Roldán-Arjona, Teresa

    2017-01-01

    ABSTRACT DNA methylation is a crucial epigenetic mark associated to gene silencing, and its targeted removal is a major goal of epigenetic editing. In animal cells, DNA demethylation involves iterative 5mC oxidation by TET enzymes followed by replication-dependent dilution and/or replication-independent DNA repair of its oxidized derivatives. In contrast, plants use specific DNA glycosylases that directly excise 5mC and initiate its substitution for unmethylated C in a base excision repair process. In this work, we have fused the catalytic domain of Arabidopsis ROS1 5mC DNA glycosylase (ROS1_CD) to the DNA binding domain of yeast GAL4 (GBD). We show that the resultant GBD-ROS1_CD fusion protein binds specifically a GBD-targeted DNA sequence in vitro. We also found that transient in vivo expression of GBD-ROS1_CD in human cells specifically reactivates transcription of a methylation-silenced reporter gene, and that such reactivation requires both ROS1_CD catalytic activity and GBD binding capacity. Finally, we show that reactivation induced by GBD-ROS1_CD is accompanied by decreased methylation levels at several CpG sites of the targeted promoter. All together, these results show that plant 5mC DNA glycosylases can be used for targeted active DNA demethylation in human cells. PMID:28277978

  20. CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

    PubMed

    Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

    2014-05-06

    In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

  1. Informative priors based on transcription factor structural class improve de novo motif discovery.

    PubMed

    Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

    2006-07-15

    An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

  2. HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

    PubMed Central

    Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

    1996-01-01

    HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

  3. Exploring the Interactions of the Dietary Plant Flavonoids Fisetin and Naringenin with G-Quadruplex and Duplex DNA, Showing Contrasting Binding Behavior: Spectroscopic and Molecular Modeling Approaches.

    PubMed

    Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta

    2016-09-01

    Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.

  4. A Feature-Based Approach to Modeling Protein–DNA Interactions

    PubMed Central

    Segal, Eran

    2008-01-01

    Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

  5. Novel DNA packaging recognition in the unusual bacteriophage N15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

    Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

  6. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  7. Using DNA mechanics to predict in vitro nucleosome positions and formation energies

    PubMed Central

    Morozov, Alexandre V.; Fortney, Karissa; Gaykalova, Daria A.; Studitsky, Vasily M.; Widom, Jonathan; Siggia, Eric D.

    2009-01-01

    In eukaryotic genomes, nucleosomes function to compact DNA and to regulate access to it both by simple physical occlusion and by providing the substrate for numerous covalent epigenetic tags. While competition with other DNA-binding factors and action of chromatin remodeling enzymes significantly affect nucleosome formation in vivo, nucleosome positions in vitro are determined by steric exclusion and sequence alone. We have developed a biophysical model, DNABEND, for the sequence dependence of DNA bending energies, and validated it against a collection of in vitro free energies of nucleosome formation and a set of in vitro nucleosome positions mapped at high resolution. We have also made a first ab initio prediction of nucleosomal DNA geometries, and checked its accuracy against the nucleosome crystal structure. We have used DNABEND to design both strong and weak histone- binding sequences, and measured the corresponding free energies of nucleosome formation. We find that DNABEND can successfully predict in vitro nucleosome positions and free energies, providing a physical explanation for the intrinsic sequence dependence of histone–DNA interactions. PMID:19509309

  8. Directed evolution of the TALE N-terminal domain for recognition of all 5' bases.

    PubMed

    Lamb, Brian M; Mercer, Andrew C; Barbas, Carlos F

    2013-11-01

    Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5'-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5' T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5' T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes.

  9. Molecular determinants of origin discrimination by Orc1 initiators in archaea.

    PubMed

    Dueber, Erin C; Costa, Alessandro; Corn, Jacob E; Bell, Stephen D; Berger, James M

    2011-05-01

    Unlike bacteria, many eukaryotes initiate DNA replication from genomic sites that lack apparent sequence conservation. These loci are identified and bound by the origin recognition complex (ORC), and subsequently activated by a cascade of events that includes recruitment of an additional factor, Cdc6. Archaeal organisms generally possess one or more Orc1/Cdc6 homologs, belonging to the Initiator clade of ATPases associated with various cellular activities (AAA(+)) superfamily; however, these proteins recognize specific sequences within replication origins. Atomic resolution studies have shown that archaeal Orc1 proteins contact double-stranded DNA through an N-terminal AAA(+) domain and a C-terminal winged-helix domain (WHD), but use remarkably few base-specific contacts. To investigate the biochemical effects of these associations, we mutated the DNA-interacting elements of the Orc1-1 and Orc1-3 paralogs from the archaeon Sulfolobus solfataricus, and tested their effect on origin binding and deformation. We find that the AAA(+) domain has an unpredicted role in controlling the sequence selectivity of DNA binding, despite an absence of base-specific contacts to this region. Our results show that both the WHD and ATPase region influence origin recognition by Orc1/Cdc6, and suggest that not only DNA sequence, but also local DNA structure help define archaeal initiator binding sites. © The Author(s) 2011. Published by Oxford University Press.

  10. A General Method for Discovering Inhibitors of Protein–DNA Interactions Using Photonic Crystal Biosensors

    PubMed Central

    Chan, Leo L.; Pineda, Maria; Heeres, James T.; Hergenrother, Paul J.; Cunningham, Brian T.

    2009-01-01

    Protein–DNA interactions are essential for fundamental cellular processes such as transcription, DNA damage repair, and apoptosis. As such, small molecule disruptors of these interactions could be powerful tools for investigation of these biological processes, and such compounds would have great potential as therapeutics. Unfortunately, there are few methods available for the rapid identification of compounds that disrupt protein–DNA interactions. Here we show that photonic crystal (PC) technology can be utilized to detect protein–DNA interactions, and can be used in a high-throughput screening mode to identify compounds that prevent protein–DNA binding. The PC technology is used to detect binding between protein–DNA interactions that are DNA-sequence-dependent (the bacterial toxin–antitoxin system MazEF) and those that are DNA-sequence-independent (the human apoptosis inducing factor (AIF)). The PC technology was further utilized in a screen for inhibitors of the AIF–DNA interaction, and through this screen aurin tricarboxylic acid was identified as the first in vitro inhibitor of AIF. The generality and simplicity of the photonic crystal method should enable this technology to find broad utility for identification of compounds that inhibit protein–DNA binding. PMID:18582039

  11. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  12. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  13. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  14. Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

    PubMed Central

    Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

    2015-01-01

    The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

  15. Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

    PubMed

    Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

    2017-08-01

    Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

  16. Comprehensive Interrogation of Natural TALE DNA Binding Modules and Transcriptional Repressor Domains

    PubMed Central

    Cong, Le; Zhou, Ruhong; Kuo, Yu-chi; Cunniff, Margaret; Zhang, Feng

    2012-01-01

    Transcription activator-like effectors (TALE) are sequence-specific DNA binding proteins that harbor modular, repetitive DNA binding domains. TALEs have enabled the creation of customizable designer transcriptional factors and sequence-specific nucleases for genome engineering. Here we report two improvements of the TALE toolbox for achieving efficient activation and repression of endogenous gene expression in mammalian cells. We show that the naturally occurring repeat variable diresidue (RVD) Asn-His (NH) has high biological activity and specificity for guanine, a highly prevalent base in mammalian genomes. We also report an effective TALE transcriptional repressor architecture for targeted inhibition of transcription in mammalian cells. These findings will improve the precision and effectiveness of genome engineering that can be achieved using TALEs. PMID:22828628

  17. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  18. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  19. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, Stanley; Richardson, Charles

    1997-01-01

    Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

  20. Cyclosporin A and FK-506 both affect DNA binding of regulatory nuclear proteins to the human interleukin-2 promoter.

    PubMed

    Baumann, G; Geisse, S; Sullivan, M

    1991-03-01

    The structurally unrelated immunosuppressive drugs cyclosporin A (Sandimmun) and FK-506 both interfere with the process of T-cell proliferation by blocking the transcription of the T-cell growth factor interleukin-2 (IL-2). Here we demonstrate that the transcriptional activation of this gene requires the binding of regulatory nuclear proteins to a promoter element with sequence similarity to the consensus binding site for NF-kappa B-related transcription factors. We present evidence that the binding by regulatory nuclear proteins to the kappa B element of the IL-2 promoter is affected negatively by cyclosporin A and FK-506 at concentrations paralleling their immunosuppressive activity in vivo. The decrease in DNA-protein complex formation induced by the immunosuppressive drugs correlates with a decrease in IL-2 production. FK-506 is 10 to 100 times more potent than cyclosporin A in its ability to inhibit sequence-specific DNA binding and IL-2 production. Our findings suggest that the actions of both drugs converge at the level of DNA-protein interaction.

  1. Real-time observation of DNA target interrogation and product release by the RNA-guided endonuclease CRISPR Cpf1 (Cas12a).

    PubMed

    Singh, Digvijay; Mallon, John; Poddar, Anustup; Wang, Yanbo; Tippana, Ramreddy; Yang, Olivia; Bailey, Scott; Ha, Taekjip

    2018-05-22

    CRISPR-Cas9, which imparts adaptive immunity against foreign genomic invaders in certain prokaryotes, has been repurposed for genome-engineering applications. More recently, another RNA-guided CRISPR endonuclease called Cpf1 (also known as Cas12a) was identified and is also being repurposed. Little is known about the kinetics and mechanism of Cpf1 DNA interaction and how sequence mismatches between the DNA target and guide-RNA influence this interaction. We used single-molecule fluorescence analysis and biochemical assays to characterize DNA interrogation, cleavage, and product release by three Cpf1 orthologs. Our Cpf1 data are consistent with the DNA interrogation mechanism proposed for Cas9. They both bind any DNA in search of protospacer-adjacent motif (PAM) sequences, verify the target sequence directionally from the PAM-proximal end, and rapidly reject any targets that lack a PAM or that are poorly matched with the guide-RNA. Unlike Cas9, which requires 9 bp for stable binding and ∼16 bp for cleavage, Cpf1 requires an ∼17-bp sequence match for both stable binding and cleavage. Unlike Cas9, which does not release the DNA cleavage products, Cpf1 rapidly releases the PAM-distal cleavage product, but not the PAM-proximal product. Solution pH, reducing conditions, and 5' guanine in guide-RNA differentially affected different Cpf1 orthologs. Our findings have important implications on Cpf1-based genome engineering and manipulation applications.

  2. UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Robasky, Kimberly; Bulyk, Martha L

    2011-01-01

    The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

  3. Thermodynamics-Based Models of Transcriptional Regulation by Enhancers: The Roles of Synergistic Activation, Cooperative Binding and Short-Range Repression

    PubMed Central

    He, Xin; Samee, Md. Abul Hassan; Blatti, Charles; Sinha, Saurabh

    2010-01-01

    Quantitative models of cis-regulatory activity have the potential to improve our mechanistic understanding of transcriptional regulation. However, the few models available today have been based on simplistic assumptions about the sequences being modeled, or heuristic approximations of the underlying regulatory mechanisms. We have developed a thermodynamics-based model to predict gene expression driven by any DNA sequence, as a function of transcription factor concentrations and their DNA-binding specificities. It uses statistical thermodynamics theory to model not only protein-DNA interaction, but also the effect of DNA-bound activators and repressors on gene expression. In addition, the model incorporates mechanistic features such as synergistic effect of multiple activators, short range repression, and cooperativity in transcription factor-DNA binding, allowing us to systematically evaluate the significance of these features in the context of available expression data. Using this model on segmentation-related enhancers in Drosophila, we find that transcriptional synergy due to simultaneous action of multiple activators helps explain the data beyond what can be explained by cooperative DNA-binding alone. We find clear support for the phenomenon of short-range repression, where repressors do not directly interact with the basal transcriptional machinery. We also find that the binding sites contributing to an enhancer's function may not be conserved during evolution, and a noticeable fraction of these undergo lineage-specific changes. Our implementation of the model, called GEMSTAT, is the first publicly available program for simultaneously modeling the regulatory activities of a given set of sequences. PMID:20862354

  4. The GAGA protein of Drosophila is phosphorylated by CK2.

    PubMed

    Bonet, Carles; Fernández, Irene; Aran, Xavier; Bernués, Jordi; Giralt, Ernest; Azorín, Fernando

    2005-08-19

    The GAGA factor of Drosophila is a sequence-specific DNA-binding protein that contributes to multiple processes from the regulation of gene expression to the structural organisation of heterochromatin and chromatin remodelling. GAGA is known to interact with various other proteins (tramtrack, pipsqueak, batman and dSAP18) and protein complexes (PRC1, NURF and FACT). GAGA functions are likely regulated at the level of post-translational modifications. Little is known, however, about its actual pattern of modification. It was proposed that GAGA can be O-glycosylated. Here, we report that GAGA519 isoform is a phosphoprotein that is phosphorylated by CK2 at the region of the DNA-binding domain. Our results indicate that phosphorylation occurs at S388 and, to a lesser extent, at S378. These two residues are located in a region of the DNA-binding domain that makes no direct contact with DNA, being dispensable for sequence-specific recognition. Phosphorylation at these sites does not abolish DNA binding but reduces the affinity of the interaction. These results are discussed in the context of the various functions and interactions that GAGA supports.

  5. Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

    PubMed

    Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

    2010-04-01

    The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

  6. GBshape: a genome browser database for DNA shape annotations.

    PubMed

    Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo

    2015-01-01

    Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

    NASA Technical Reports Server (NTRS)

    Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

    1992-01-01

    A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

  8. Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

    PubMed

    Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

    2018-03-01

    LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

  9. Modulating the DNA affinity of Elk-1 with computationally selected mutations.

    PubMed

    Park, Sheldon; Boder, Eric T; Saven, Jeffery G

    2005-04-22

    In order to regulate gene expression, transcription factors must first bind their target DNA sequences. The affinity of this binding is determined by both the network of interactions at the interface and the entropy change associated with the complex formation. To study the role of structural fluctuation in fine-tuning DNA affinity, we performed molecular dynamics simulations of two highly homologous proteins, Elk-1 and SAP-1, that exhibit different sequence specificity. Simulation studies show that several residues in Elk have significantly higher main-chain root-mean-square deviations than their counterparts in SAP. In particular, a single residue, D69, may contribute to Elk's lower DNA affinity for P(c-fos) by structurally destabilizing the carboxy terminus of the recognition helix. While D69 does not contact DNA directly, the increased mobility in the region may contribute to its weaker binding. We measured the ability of single point mutants of Elk to bind P(c-fos) in a reporter assay, in which D69 of wild-type Elk has been mutated to other residues with higher helix propensity in order to stabilize the local conformation. The gains in transcriptional activity and the free energy of binding suggested from these measurements correlate well with stability gains computed from helix propensity and charge-macrodipole interactions. The study suggests that residues that are distal to the binding interface may indirectly modulate the binding affinity by stabilizing the protein scaffold required for efficient DNA interaction.

  10. Yeast aconitase binds and provides metabolically coupled protection to mitochondrial DNA.

    PubMed

    Chen, Xin Jie; Wang, Xiaowen; Butow, Ronald A

    2007-08-21

    Aconitase (Aco1p) is a multifunctional protein: It is an enzyme of the tricarboxylic acid cycle. In animal cells, Aco1p also is a cytosolic protein binding to mRNAs to regulate iron metabolism. In yeast, Aco1p was identified as a component of mtDNA nucleoids. Here we show that yeast Aco1p protects mtDNA from excessive accumulation of point mutations and ssDNA breaks and suppresses reductive recombination of mtDNA. Aconitase binds to both ds- and ssDNA, with a preference for GC-containing sequences. Therefore, mitochondria are opportunistic organelles that seize proteins, such as metabolic enzymes, for construction of the nucleoid, an mtDNA maintenance/segregation apparatus.

  11. Sequence Discrimination by Alternatively Spliced Isoforms of a DNA Binding Zinc Finger Domain

    NASA Astrophysics Data System (ADS)

    Gogos, Joseph A.; Hsu, Tien; Bolton, Jesse; Kafatos, Fotis C.

    1992-09-01

    Two major developmentally regulated isoforms of the Drosophila chorion transcription factor CF2 differ by an extra zinc finger within the DNA binding domain. The preferred DNA binding sites were determined and are distinguished by an internal duplication of TAT in the site recognized by the isoform with the extra finger. The results are consistent with modular interactions between zinc fingers and trinucleotides and also suggest rules for recognition of AT-rich DNA sites by zinc finger proteins. The results show how modular finger interactions with trinucleotides can be used, in conjunction with alternative splicing, to alter the binding specificity and increase the spectrum of sites recognized by a DNA binding domain. Thus, CF2 may potentially regulate distinct sets of target genes during development.

  12. 5-Hydroxymethylcytosine in E-box motifs ACAT|GTG and ACAC|GTG increases DNA-binding of the B-HLH transcription factor TCF4.

    PubMed

    Khund-Sayeed, Syed; He, Ximiao; Holzberg, Timothy; Wang, Jun; Rajagopal, Divya; Upadhyay, Shriyash; Durell, Stewart R; Mukherjee, Sanjit; Weirauch, Matthew T; Rose, Robert; Vinson, Charles

    2016-09-12

    We evaluated DNA binding of the B-HLH family members TCF4 and USF1 using protein binding microarrays (PBMs) containing double-stranded DNA probes with cytosine on both strands or 5-methylcytosine (5mC) or 5-hydroxymethylcytosine (5hmC) on one DNA strand and cytosine on the second strand. TCF4 preferentially bound the E-box motif (CAN|NTG) with strongest binding to the 8-mer CAG|GTGGT. 5mC uniformly decreases DNA binding of both TCF4 and USF1. The bulkier 5hmC also inhibited USF1 binding to DNA. In contrast, 5hmC dramatically enhanced TCF4 binding to E-box motifs ACAT|GTG and ACAC|GTG, being better bound than any 8-mer containing cytosine. Examination of X-ray structures of the closely related TCF3 and USF1 bound to DNA suggests TCF3 can undergo a conformational shift to preferentially bind to 5hmC while the USF1 basic region is bulkier and rigid precluding a conformation shift to bind 5hmC. These results greatly expand the regulatory DNA sequence landscape bound by TCF4.

  13. Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

    PubMed

    Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

    2011-08-01

    Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

  14. DNA sequencing using polymerase substrate-binding kinetics

    PubMed Central

    Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

    2015-01-01

    Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

  15. Molecular Dynamics Simulations of DNA-Free and DNA-Bound TAL Effectors

    PubMed Central

    Wan, Hua; Hu, Jian-ping; Li, Kang-shun; Tian, Xu-hong; Chang, Shan

    2013-01-01

    TAL (transcriptional activator-like) effectors (TALEs) are DNA-binding proteins, containing a modular central domain that recognizes specific DNA sequences. Recently, the crystallographic studies of TALEs revealed the structure of DNA-recognition domain. In this article, molecular dynamics (MD) simulations are employed to study two crystal structures of an 11.5-repeat TALE, in the presence and absence of DNA, respectively. The simulated results indicate that the specific binding of RVDs (repeat-variable diresidues) with DNA leads to the markedly reduced fluctuations of tandem repeats, especially at the two ends. In the DNA-bound TALE system, the base-specific interaction is formed mainly by the residue at position 13 within a TAL repeat. Tandem repeats with weak RVDs are unfavorable for the TALE-DNA binding. These observations are consistent with experimental studies. By using principal component analysis (PCA), the dominant motions are open-close movements between the two ends of the superhelical structure in both DNA-free and DNA-bound TALE systems. The open-close movements are found to be critical for the recognition and binding of TALE-DNA based on the analysis of free energy landscape (FEL). The conformational analysis of DNA indicates that the 5′ end of DNA target sequence has more remarkable structural deformability than the other sites. Meanwhile, the conformational change of DNA is likely associated with the specific interaction of TALE-DNA. We further suggest that the arrangement of N-terminal repeats with strong RVDs may help in the design of efficient TALEs. This study provides some new insights into the understanding of the TALE-DNA recognition mechanism. PMID:24130757

  16. Investigation of arc repressor DNA-binding specificity by comparative molecular dynamics simulations.

    PubMed

    Song, Wei; Guo, Jun-Tao

    2015-01-01

    Transcription factors regulate gene expression through binding to specific DNA sequences. How transcription factors achieve high binding specificity is still not well understood. In this paper, we investigated the role of protein flexibility in protein-DNA-binding specificity by comparative molecular dynamics (MD) simulations. Protein flexibility has been considered as a key factor in molecular recognition, which is intrinsically a dynamic process involving fine structural fitting between binding components. In this study, we performed comparative MD simulations on wild-type and F10V mutant P22 Arc repressor in both free and complex conformations. The F10V mutant has lower DNA-binding specificity though both the bound and unbound main-chain structures between the wild-type and F10V mutant Arc are highly similar. We found that the DNA-binding motif of wild-type Arc is structurally more flexible than the F10V mutant in the unbound state, especially for the six DNA base-contacting residues in each dimer. We demonstrated that the flexible side chains of wild-type Arc lead to a higher DNA-binding specificity through forming more hydrogen bonds with DNA bases upon binding. Our simulations also showed a possible conformational selection mechanism for Arc-DNA binding. These results indicate the important roles of protein flexibility and dynamic properties in protein-DNA-binding specificity.

  17. RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

    PubMed Central

    Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

    1998-01-01

    Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

  18. Measuring DNA hybridization using fluorescent DNA-stabilized silver clusters to investigate mismatch effects on therapeutic oligonucleotides.

    PubMed

    de Bruin, Donny; Bossert, Nelli; Aartsma-Rus, Annemieke; Bouwmeester, Dirk

    2018-04-06

    Short nucleic acid oligomers have found a wide range of applications in experimental physics, biology and medicine, and show potential for the treatment of acquired and genetic diseases. These applications rely heavily on the predictability of hybridization through Watson-Crick base pairing to allow positioning on a nanometer scale, as well as binding to the target transcripts, but also off-target binding to transcripts with partial homology. These effects are of particular importance in the development of therapeutic oligonucleotides, where off-target effects caused by the binding of mismatched sequences need to be avoided. We employ a novel method of probing DNA hybridization using optically active DNA-stabilized silver clusters (Ag-DNA) to measure binding efficiencies through a change in fluorescence intensity. In this way we can determine their location-specific sensitivity to individual mismatches in the sequence. The results reveal a strong dependence of the hybridization on the location of the mismatch, whereby mismatches close to the edges and center show a relatively minor impact. In parallel, we propose a simple model for calculating the annealing ratios of mismatched DNA sequences, which supports our experimental results. The primary result shown in this work is a demonstration of a novel technique to measure DNA hybridization using fluorescent Ag-DNA. With this technique, we investigated the effect of mismatches on the hybridization efficiency, and found a significant dependence on the location of individual mismatches. These effects are strongly influenced by the length of the used oligonucleotides. The novel probe method based on fluorescent Ag-DNA functions as a reliable tool in measuring this behavior. As a secondary result, we formulated a simple model that is consistent with the experimental data.

  19. A Programmable DNA Double-Write Material: Synergy of Photolithography and Self-Assembly Nanofabrication.

    PubMed

    Song, Youngjun; Takahashi, Tsukasa; Kim, Sejung; Heaney, Yvonne C; Warner, John; Chen, Shaochen; Heller, Michael J

    2017-01-11

    We demonstrate a DNA double-write process that uses UV to pattern a uniquely designed DNA write material, which produces two distinct binding identities for hybridizing two different complementary DNA sequences. The process requires no modification to the DNA by chemical reagents and allows programmed DNA self-assembly and further UV patterning in the UV exposed and nonexposed areas. Multilayered DNA patterning with hybridization of fluorescently labeled complementary DNA sequences, biotin probe/fluorescent streptavidin complexes, and DNA patterns with 500 nm line widths were all demonstrated.

  20. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Cancer.gov

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of

  1. Non-Watson–Crick interactions between PNA and DNA inhibit the ATPase activity of bacteriophage T4 Dda helicase

    PubMed Central

    Tackett, Alan J.; Corey, David R.; Raney, Kevin D.

    2002-01-01

    Peptide nucleic acid (PNA) is a DNA mimic in which the nucleobases are linked by an N-(2-aminoethyl) glycine backbone. Here we report that PNA can interact with single-stranded DNA (ssDNA) in a non-sequence-specific fashion. We observed that a 15mer PNA inhibited the ssDNA-stimulated ATPase activity of a bacteriophage T4 helicase, Dda. Surprisingly, when a fluorescein-labeled 15mer PNA was used in binding studies no interaction was observed between PNA and Dda. However, fluorescence polarization did reveal non-sequence-specific interactions between PNA and ssDNA. Thus, the inhibition of ATPase activity of Dda appears to result from depletion of the available ssDNA due to non-Watson–Crick binding of PNA to ssDNA. Inhibition of the ssDNA-stimulated ATPase activity was observed for several PNAs of varying length and sequence. To study the basis for this phenomenon, we examined self-aggregation by PNAs. The 15mer PNA readily self-aggregates to the point of precipitation. Since PNAs are hydrophobic, they aggregate more than DNA or RNA, making the study of this phenomenon essential for understanding the properties of PNA. Non-sequence-specific interactions between PNA and ssDNA were observed at moderate concentrations of PNA, suggesting that such interactions should be considered for antisense and antigene applications. PMID:11842106

  2. DNA capture elements for rapid detection and identification of biological agents

    NASA Astrophysics Data System (ADS)

    Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva

    2004-08-01

    DNA capture elements (DCEs; aptamers) are artificial DNA sequences, from a random pool of sequences, selected for their specific binding to potential biological warfare agents. These sequences were selected by an affinity method using filters to which the target agent was attached and the DNA isolated and amplified by polymerase chain reaction (PCR) in an iterative, increasingly stringent, process. Reporter molecules were attached to the finished sequences. To date, we have made DCEs to Bacillus anthracis spores, Shiga toxin, Venezuelan Equine Encephalitis (VEE) virus, and Francisella tularensis. These DCEs have demonstrated specificity and sensitivity equal to or better than antibody.

  3. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  4. Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

    PubMed

    Gantchev, Tsvetan G; Hunting, Darel J

    2010-12-28

    The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

  5. Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

    PubMed Central

    Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

    2010-01-01

    The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

  6. Regulation of the yeast RAD2 gene: DNA damage-dependent induction correlates with protein binding to regulatory sequences and their deletion influences survival.

    PubMed

    Siede, W; Friedberg, E C

    1992-03-01

    In the yeast Saccharomyces cerevisiae the RAD2 gene is absolutely required for damage-specific incision of DNA during nucleotide excision repair and is inducible by DNA-damaging agents. In the present study we correlated sensitivity to killing by DNA-damaging agents with the deletion of previously defined specific promoter elements. Deletion of the element DRE2 increased the UV sensitivity of cells in both the G1/early S and S/G2 phases of the cell cycle as well as in stationary phase. On the other hand, increased UV sensitivity associated with deletion of the sequence-related element DRE1 was restricted to cells irradiated in G1/S. Specific binding of protein(s) to the promoter elements DRE1 and DRE2 was observed under non-inducing conditions using gel retardation assays. Exposure of cells to DNA-damaging agents resulted in increased protein binding that was dependent on de novo protein synthesis.

  7. DNA polymerase having modified nucleotide binding site for DNA sequencing

    DOEpatents

    Tabor, S.; Richardson, C.

    1997-03-25

    A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

  8. NKX3.1 Genotype and IGF-1 Interact in Prostate Cancer Risk

    DTIC Science & Technology

    2009-05-01

    Steadman DJ, Giuffrida D, Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28...Gelmann EP. DNA-binding sequence of the human prostate-specific homeodomain protein NKX3.1. Nucleic Acids Res 2000;28:2389–95. 20. Wu X, Senechal K...3212836 /UG=Hs.21765 fatty acid desaturase 3 204733_at 5.74 gb:NM_002774.1 /DEF=Homo sapiens kallikrein 6 (neurosin, zyme) (KLK6), mRNA. /FEA=mRNA /GEN

  9. Sequence Dependencies of DNA Deformability and Hydration in the Minor Groove

    PubMed Central

    Yonetani, Yoshiteru; Kono, Hidetoshi

    2009-01-01

    Abstract DNA deformability and hydration are both sequence-dependent and are essential in specific DNA sequence recognition by proteins. However, the relationship between the two is not well understood. Here, systematic molecular dynamics simulations of 136 DNA sequences that differ from each other in their central tetramer revealed that sequence dependence of hydration is clearly correlated with that of deformability. We show that this correlation can be illustrated by four typical cases. Most rigid basepair steps are highly likely to form an ordered hydration pattern composed of one water molecule forming a bridge between the bases of distinct strands, but a few exceptions favor another ordered hydration composed of two water molecules forming such a bridge. Steps with medium deformability can display both of these hydration patterns with frequent transition. Highly flexible steps do not have any stable hydration pattern. A detailed picture of this correlation demonstrates that motions of hydration water molecules and DNA bases are tightly coupled with each other at the atomic level. These results contribute to our understanding of the entropic contribution from water molecules in protein or drug binding and could be applied for the purpose of predicting binding sites. PMID:19686662

  10. Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

    NASA Astrophysics Data System (ADS)

    Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

    2016-03-01

    DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

  11. RPA binds histone H3-H4 and functions in DNA replication-coupled nucleosome assembly.

    PubMed

    Liu, Shaofeng; Xu, Zhiyun; Leng, He; Zheng, Pu; Yang, Jiayi; Chen, Kaifu; Feng, Jianxun; Li, Qing

    2017-01-27

    DNA replication-coupled nucleosome assembly is essential to maintain genome integrity and retain epigenetic information. Multiple involved histone chaperones have been identified, but how nucleosome assembly is coupled to DNA replication remains elusive. Here we show that replication protein A (RPA), an essential replisome component that binds single-stranded DNA, has a role in replication-coupled nucleosome assembly. RPA directly binds free H3-H4. Assays using a synthetic sequence that mimics freshly unwound single-stranded DNA at replication fork showed that RPA promotes DNA-(H3-H4) complex formation immediately adjacent to double-stranded DNA. Further, an RPA mutant defective in H3-H4 binding exhibited attenuated nucleosome assembly on nascent chromatin. Thus, we propose that RPA functions as a platform for targeting histone deposition to replication fork, through which RPA couples nucleosome assembly with ongoing DNA replication. Copyright © 2017, American Association for the Advancement of Science.

  12. Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

    Cancer.gov

    The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

  13. TALE proteins search DNA using a rotationally decoupled mechanism.

    PubMed

    Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M

    2016-10-01

    Transcription activator-like effector (TALE) proteins are a class of programmable DNA-binding proteins used extensively for gene editing. Despite recent progress, however, little is known about their sequence search mechanism. Here, we use single-molecule experiments to study TALE search along DNA. Our results show that TALEs utilize a rotationally decoupled mechanism for nonspecific search, despite remaining associated with DNA templates during the search process. Our results suggest that the protein helical structure enables TALEs to adopt a loosely wrapped conformation around DNA templates during nonspecific search, facilitating rapid one-dimensional (1D) diffusion under a range of solution conditions. Furthermore, this model is consistent with a previously reported two-state mechanism for TALE search that allows these proteins to overcome the search speed-stability paradox. Taken together, our results suggest that TALE search is unique among the broad class of sequence-specific DNA-binding proteins and supports efficient 1D search along DNA.

  14. Directed evolution of the TALE N-terminal domain for recognition of all 5′ bases

    PubMed Central

    Lamb, Brian M.; Mercer, Andrew C.; Barbas, Carlos F.

    2013-01-01

    Transcription activator-like effector (TALE) proteins can be designed to bind virtually any DNA sequence. General guidelines for design of TALE DNA-binding domains suggest that the 5′-most base of the DNA sequence bound by the TALE (the N0 base) should be a thymine. We quantified the N0 requirement by analysis of the activities of TALE transcription factors (TALE-TF), TALE recombinases (TALE-R) and TALE nucleases (TALENs) with each DNA base at this position. In the absence of a 5′ T, we observed decreases in TALE activity up to >1000-fold in TALE-TF activity, up to 100-fold in TALE-R activity and up to 10-fold reduction in TALEN activity compared with target sequences containing a 5′ T. To develop TALE architectures that recognize all possible N0 bases, we used structure-guided library design coupled with TALE-R activity selections to evolve novel TALE N-terminal domains to accommodate any N0 base. A G-selective domain and broadly reactive domains were isolated and characterized. The engineered TALE domains selected in the TALE-R format demonstrated modularity and were active in TALE-TF and TALEN architectures. Evolved N-terminal domains provide effective and unconstrained TALE-based targeting of any DNA sequence as TALE binding proteins and designer enzymes. PMID:23980031

  15. Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

    PubMed

    Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

    2008-06-01

    The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

  16. The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

    PubMed

    Lerner, D R; Raikhel, N V

    1992-06-05

    Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

  17. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    PubMed

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Role of the Adenovirus DNA-Binding Protein in In Vitro Adeno-Associated Virus DNA Replication

    PubMed Central

    Ward, Peter; Dean, Frank B.; O’Donnell, Michael E.; Berns, Kenneth I.

    1998-01-01

    A basic question in adeno-associated virus (AAV) biology has been whether adenovirus (Ad) infection provided any function which directly promoted replication of AAV DNA. Previously in vitro assays for AAV DNA replication, using linear duplex AAV DNA as the template, uninfected or Ad-infected HeLa cell extracts, and exogenous AAV Rep protein, demonstrated that Ad infection provides a direct helper effect for AAV DNA replication. It was shown that the nature of this helper effect was to increase the processivity of AAV DNA replication. Left unanswered was the question of whether this effect was the result of cellular factors whose activity was enhanced by Ad infection or was the result of direct participation of Ad proteins in AAV DNA replication. In this report, we show that in the in vitro assay, enhancement of processivity occurs with the addition of either the Ad DNA-binding protein (Ad-DBP) or the human single-stranded DNA-binding protein (replication protein A [RPA]). Clearly Ad-DBP is present after Ad infection but not before, whereas the cellular level of RPA is not apparently affected by Ad infection. However, we have not measured possible modifications of RPA which might occur after Ad infection and affect AAV DNA replication. When the substrate for replication was an AAV genome inserted into a plasmid vector, RPA was not an effective substitute for Ad-DBP. Extracts supplemented with Ad-DBP preferentially replicated AAV sequences rather than adjacent vector sequences; in contrast, extracts supplemented with RPA preferentially replicated vector sequences. PMID:9420241

  19. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation | Center for Cancer Research

    Cancer.gov

    Dubbed "Tom's T" by Dhruba Chattoraj, the unusually conserved thymine at position +7 in bacteriophage P1 plasmid RepA DNA binding sites rises above repressor and acceptor sequence logos. The T appears to represent base flipping prior to helix opening in this DNA replication initation protein.

  20. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  1. Direct DNA binding by Brca1.

    PubMed

    Paull, T T; Cortez, D; Bowers, B; Elledge, S J; Gellert, M

    2001-05-22

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein-DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription.

  2. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  3. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  4. Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

    NASA Astrophysics Data System (ADS)

    Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

    1997-11-01

    We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

  5. Helix Unwinding and Base Flipping Enable Human MTERF1 to Terminate Mitochondrial Transcription

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yakubovskaya, E.; Mejia, E; Byrnes, J

    2010-01-01

    Defects in mitochondrial gene expression are associated with aging and disease. Mterf proteins have been implicated in modulating transcription, replication and protein synthesis. We have solved the structure of a member of this family, the human mitochondrial transcriptional terminator MTERF1, bound to dsDNA containing the termination sequence. The structure indicates that upon sequence recognition MTERF1 unwinds the DNA molecule, promoting eversion of three nucleotides. Base flipping is critical for stable binding and transcriptional termination. Additional structural and biochemical results provide insight into the DNA binding mechanism and explain how MTERF1 recognizes its target sequence. Finally, we have demonstrated that themore » mitochondrial pathogenic G3249A and G3244A mutations interfere with key interactions for sequence recognition, eliminating termination. Our results provide insight into the role of mterf proteins and suggest a link between mitochondrial disease and the regulation of mitochondrial transcription.« less

  6. Purification and DNA binding properties of the blaI gene product, repressor for the beta-lactamase gene, blaP, of Bacillus licheniformis.

    PubMed Central

    Grossman, M J; Lampen, J O

    1987-01-01

    The location of the repressor gene, blaI, for the beta-lactamase gene blaP of Bacillus licheniformis 749, on the 5' side of blaP, was confirmed by sequencing the bla region of the constitutive mutant 749/C. An amber stop codon, likely to result in a nonfunctional truncated repressor, was found at codon 32 of the 128 codon blaI open reading frame (ORF) located 5' to blaP. In order to study the DNA binding activity of the repressor, the structural gene for blaI, from strain 749, with its ribosome binding site was expressed using a two plasmid T7 RNA polymerase/promotor system (S. Tabor and C. C. Richardson. Proc. Natl. Acad. Sci. 82, 1074-1078 (1985). Heat induction of this system in Escherichia coli K38 resulted in the production of BlaI as 5-10% of the soluble cell protein. Repressor protein was then purified by ammonium sulfate fractionation and cation exchange chromatography. The sequence of the N-terminal 28 amino acid residues was determined and was as predicted from the DNA. Binding of BlaI to DNA was detected by the slower migration of protein DNA complexes during polyacrylamide gel electrophoresis. BlaI was shown to selectively bind DNA fragments carrying the promoter regions of blaI and blaP. Images PMID:3498148

  7. Sleep loss reduces the DNA-binding of BMAL1, CLOCK, and NPAS2 to specific clock genes in the mouse cerebral cortex.

    PubMed

    Mongrain, Valérie; La Spada, Francesco; Curie, Thomas; Franken, Paul

    2011-01-01

    We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), -6, -12, and -18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and -6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven.

  8. Sleep Loss Reduces the DNA-Binding of BMAL1, CLOCK, and NPAS2 to Specific Clock Genes in the Mouse Cerebral Cortex

    PubMed Central

    Curie, Thomas; Franken, Paul

    2011-01-01

    We have previously demonstrated that clock genes contribute to the homeostatic aspect of sleep regulation. Indeed, mutations in some clock genes modify the markers of sleep homeostasis and an increase in homeostatic sleep drive alters clock gene expression in the forebrain. Here, we investigate a possible mechanism by which sleep deprivation (SD) could alter clock gene expression by quantifying DNA-binding of the core-clock transcription factors CLOCK, NPAS2, and BMAL1 to the cis-regulatory sequences of target clock genes in mice. Using chromatin immunoprecipitation (ChIP), we first showed that, as reported for the liver, DNA-binding of CLOCK and BMAL1 to target clock genes changes in function of time-of-day in the cerebral cortex. Tissue extracts were collected at ZT0 (light onset), −6, −12, and −18, and DNA enrichment of E-box or E'-box containing sequences was measured by qPCR. CLOCK and BMAL1 binding to Cry1, Dbp, Per1, and Per2 depended on time-of-day, with maximum values reached at around ZT6. We then observed that SD, performed between ZT0 and −6, significantly decreased DNA-binding of CLOCK and BMAL1 to Dbp, consistent with the observed decrease in Dbp mRNA levels after SD. The DNA-binding of NPAS2 and BMAL1 to Per2 was also decreased by SD, although SD is known to increase Per2 expression in the cortex. DNA-binding to Per1 and Cry1 was not affected by SD. Our results show that the sleep-wake history can affect the clock molecular machinery directly at the level of chromatin binding thereby altering the cortical expression of Dbp and Per2 and likely other targets. Although the precise dynamics of the relationship between DNA-binding and mRNA expression, especially for Per2, remains elusive, the results also suggest that part of the reported circadian changes in DNA-binding of core clock components in tissues peripheral to the suprachiasmatic nuclei could, in fact, be sleep-wake driven. PMID:22039518

  9. Inferring coarse-grain histone-DNA interaction potentials from high-resolution structures of the nucleosome

    NASA Astrophysics Data System (ADS)

    Meyer, Sam; Everaers, Ralf

    2015-02-01

    The histone-DNA interaction in the nucleosome is a fundamental mechanism of genomic compaction and regulation, which remains largely unknown despite increasing structural knowledge of the complex. In this paper, we propose a framework for the extraction of a nanoscale histone-DNA force-field from a collection of high-resolution structures, which may be adapted to a larger class of protein-DNA complexes. We applied the procedure to a large crystallographic database extended by snapshots from molecular dynamics simulations. The comparison of the structural models first shows that, at histone-DNA contact sites, the DNA base-pairs are shifted outwards locally, consistent with locally repulsive forces exerted by the histones. The second step shows that the various force profiles of the structures under analysis derive locally from a unique, sequence-independent, quadratic repulsive force-field, while the sequence preferences are entirely due to internal DNA mechanics. We have thus obtained the first knowledge-derived nanoscale interaction potential for histone-DNA in the nucleosome. The conformations obtained by relaxation of nucleosomal DNA with high-affinity sequences in this potential accurately reproduce the experimental values of binding preferences. Finally we address the more generic binding mechanisms relevant to the 80% genomic sequences incorporated in nucleosomes, by computing the conformation of nucleosomal DNA with sequence-averaged properties. This conformation differs from those found in crystals, and the analysis suggests that repulsive histone forces are related to local stretch tension in nucleosomal DNA, mostly between adjacent contact points. This tension could play a role in the stability of the complex.

  10. Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

    PubMed

    Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

    2015-02-18

    HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Interaction of the Sliding Clamp β-Subunit and Hda, a DnaA-Related Protein

    PubMed Central

    Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

    2004-01-01

    In Escherichia coli, interactions between the replication initiation protein DnaA, the β subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and β proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with β in vitro. A new β-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified β-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind β. A 10-amino-acid peptide containing the E. coli Hda β-binding motif was shown to compete with Hda for binding to β in an Hda-β interaction assay. These results establish that the interaction of Hda with β is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication. PMID:15150238

  12. Interaction of the sliding clamp beta-subunit and Hda, a DnaA-related protein.

    PubMed

    Kurz, Mareike; Dalrymple, Brian; Wijffels, Gene; Kongsuwan, Kritaya

    2004-06-01

    In Escherichia coli, interactions between the replication initiation protein DnaA, the beta subunit of DNA polymerase III (the sliding clamp protein), and Hda, the recently identified DnaA-related protein, are required to convert the active ATP-bound form of DnaA to an inactive ADP-bound form through the accelerated hydrolysis of ATP. This rapid hydrolysis of ATP is proposed to be the main mechanism that blocks multiple initiations during cell cycle and acts as a molecular switch from initiation to replication. However, the biochemical mechanism for this crucial step in DNA synthesis has not been resolved. Using purified Hda and beta proteins in a plate binding assay and Ni-nitrilotriacetic acid pulldown analysis, we show for the first time that Hda directly interacts with beta in vitro. A new beta-binding motif, a hexapeptide with the consensus sequence QL[SP]LPL, related to the previously identified beta-binding pentapeptide motif (QL[SD]LF) was found in the amino terminus of the Hda protein. Mutants of Hda with amino acid changes in the hexapeptide motif are severely defective in their ability to bind beta. A 10-amino-acid peptide containing the E. coli Hda beta-binding motif was shown to compete with Hda for binding to beta in an Hda-beta interaction assay. These results establish that the interaction of Hda with beta is mediated through the hexapeptide sequence. We propose that this interaction may be crucial to the events that lead to the inactivation of DnaA and the prevention of excess initiation of rounds of replication.

  13. Quantitative determination of testosterone levels with biolayer interferometry.

    PubMed

    Zhang, Hao; Li, Wei; Luo, Hong; Xiong, Guangming; Yu, Yuanhua

    2017-10-01

    Natural and synthetic steroid hormones are widely spread in the environment and are considered as pollutants due to their endocrine activities, even at low concentrations, which are harmful to human health. To detect steroid hormones in the environment, a novel biosensor system was developed based on the principle of biolayer interferometry. Detection is based on changes in the interference pattern of white light reflected from the surface of an optical fiber with bound biomolecules. Monitoring interactions between molecules does not require radioactive, enzymatic, or fluorescent labels. Here, 2 double-stranded DNA fragments of operator 1 (OP1) and OP2 containing 10-bp palindromic sequences in chromosomal Comamonas testosteroni DNA (ATCC11996) were surface-immobilized to streptavidin sensors. Interference changes were detected when repressor protein RepA bound the DNA sequences. DNA-protein interactions were characterized and kinetic parameters were obtained. The dissociation constants between the OP1 and OP2 DNA sequences and RepA were 9.865 × 10 -9  M and 2.750 × 10 -8  M, respectively. The reactions showed high specifically and affinity. Because binding of the 10-bp palindromic sequence and RepA was affected by RepA-testosterone binding, the steroid could be quantitatively determined rapidly using the biosensor system. The mechanism of the binding assay was as follows. RepA could bind both OP1 and testosterone. RepA binding to testosterone changed the protein conformation, which influenced the binding between RepA and OP1. The percentage of the signal detected negative correlation with the testosterone concentration. A standard curve was obtained, and the correlation coefficient value was approximately 0.97. We could quantitatively determine testosterone levels between 2.13 and 136.63 ng/ml. Each sample could be quantitatively detected in 17 min. These results suggested that the specific interaction between double-stranded OP1 DNA and the RepA protein could be used to rapidly and quantitatively determine environmental testosterone levels by the biolayer interferometry technique. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lu, Xun; Guanga, Gerald P; Wan, Cheng

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

  15. LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

    PubMed

    Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

    2018-05-17

    Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

  16. CpG methylation increases the DNA binding of 9-aminoacridine carboxamide Pt analogues.

    PubMed

    Kava, Hieronimus W; Murray, Vincent

    2016-10-01

    This study investigated the effect of CpG methylation on the DNA binding of cisplatin analogues with an attached aminoacridine intercalator. DNA-targeted 9-aminoacridine carboxamide Pt complexes are known to bind at 5'-CpG sequences. Their binding to methylated and non-methylated 5'-CpG sequences was determined and compared with cisplatin. The damage profiles of each platinum compound were quantified via a polymerase stop assay with fluorescently labelled primers and capillary electrophoresis. Methylation at 5'-CpG was shown to significantly increase the binding intensity for the 9-aminoacridine carboxamide compounds, whereas no significant increase was found for cisplatin. 5'-CpG methylation had the largest effect on the 9-ethanolamine-acridine carboxamide Pt complex, followed by the 9-aminoacridine carboxamide Pt complex and the 7-fluoro complex. The methylation state of a cell's genome is important in maintaining normal gene expression, and is often aberrantly altered in cancer cells. An analogue of cisplatin which differentially targets methylated DNA may be able to improve its therapeutic activity, or alter its range of targets and evade the chemoresistance which hampers cisplatin efficacy in clinical use. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. An Improved Method for TAL Effectors DNA-Binding Sites Prediction Reveals Functional Convergence in TAL Repertoires of Xanthomonas oryzae Strains

    PubMed Central

    Pérez-Quintero, Alvaro L.; Rodriguez-R, Luis M.; Dereeper, Alexis; López, Camilo; Koebnik, Ralf; Szurek, Boris; Cunnac, Sebastien

    2013-01-01

    Transcription Activators-Like Effectors (TALEs) belong to a family of virulence proteins from the Xanthomonas genus of bacterial plant pathogens that are translocated into the plant cell. In the nucleus, TALEs act as transcription factors inducing the expression of susceptibility genes. A code for TALE-DNA binding specificity and high-resolution three-dimensional structures of TALE-DNA complexes were recently reported. Accurate prediction of TAL Effector Binding Elements (EBEs) is essential to elucidate the biological functions of the many sequenced TALEs as well as for robust design of artificial TALE DNA-binding domains in biotechnological applications. In this work a program with improved EBE prediction performances was developed using an updated specificity matrix and a position weight correction function to account for the matching pattern observed in a validation set of TALE-DNA interactions. To gain a systems perspective on the large TALE repertoires from X. oryzae strains, this program was used to predict rice gene targets for 99 sequenced family members. Integrating predictions and available expression data in a TALE-gene network revealed multiple candidate transcriptional targets for many TALEs as well as several possible instances of functional convergence among TALEs. PMID:23869221

  18. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  19. Bombyx mori Nucleopolyhedrovirus Encodes a DNA-Binding Protein Capable of Destabilizing Duplex DNA

    PubMed Central

    Mikhailov, Victor S.; Mikhailova, Alla L.; Iwanaga, Masashi; Gomi, Sumiko; Maeda, Susumu

    1998-01-01

    A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3′→5′ exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication. PMID:9525636

  20. Structural basis of DNA target recognition by the B3 domain of Arabidopsis epigenome reader VAL1

    PubMed Central

    Sasnauskas, Giedrius; Kauneckaitė, Kotryna; Siksnys, Virginijus

    2018-01-01

    Abstract Arabidopsis thaliana requires a prolonged period of cold exposure during winter to initiate flowering in a process termed vernalization. Exposure to cold induces epigenetic silencing of the FLOWERING LOCUS C (FLC) gene by Polycomb group (PcG) proteins. A key role in this epigenetic switch is played by transcriptional repressors VAL1 and VAL2, which specifically recognize Sph/RY DNA sequences within FLC via B3 DNA binding domains, and mediate recruitment of PcG silencing machinery. To understand the structural mechanism of site-specific DNA recognition by VAL1, we have solved the crystal structure of VAL1 B3 domain (VAL1-B3) bound to a 12 bp oligoduplex containing the canonical Sph/RY DNA sequence 5′-CATGCA-3′/5′-TGCATG-3′. We find that VAL1-B3 makes H-bonds and van der Waals contacts to DNA bases of all six positions of the canonical Sph/RY element. In agreement with the structure, in vitro DNA binding studies show that VAL1-B3 does not tolerate substitutions at any position of the 5′-TGCATG-3′ sequence. The VAL1-B3–DNA structure presented here provides a structural model for understanding the specificity of plant B3 domains interacting with the Sph/RY and other DNA sequences. PMID:29660015

  1. pUL34 binding near the human cytomegalovirus origin of lytic replication enhances DNA replication and viral growth.

    PubMed

    Slayton, Mark; Hossain, Tanvir; Biegalke, Bonita J

    2018-05-01

    The human cytomegalovirus (HCMV) UL34 gene encodes sequence-specific DNA-binding proteins (pUL34) which are required for viral replication. Interactions of pUL34 with DNA binding sites represses transcription of two viral immune evasion genes, US3 and US9. 12 additional predicted pUL34-binding sites are present in the HCMV genome (strain AD169) with three binding sites concentrated near the HCMV origin of lytic replication (oriLyt). We used ChIP-seq analysis of pUL34-DNA interactions to confirm that pUL34 binds to the oriLyt region during infection. Mutagenesis of the UL34-binding sites in an oriLyt-containing plasmid significantly reduced viral-mediated oriLyt-dependent DNA replication. Mutagenesis of these sites in the HCMV genome reduced the replication efficiencies of the resulting viruses. Protein-protein interaction analyses demonstrated that pUL34 interacts with the viral proteins IE2, UL44, and UL84, that are essential for viral DNA replication, suggesting that pUL34-DNA interactions in the oriLyt region are involved in the DNA replication cascade. Copyright © 2018 Elsevier Inc. All rights reserved.

  2. MFP1 is a thylakoid-associated, nucleoid-binding protein with a coiled-coil structure

    PubMed Central

    Jeong, Sun Yong; Rose, Annkatrin; Meier, Iris

    2003-01-01

    Plastid DNA, like bacterial and mitochondrial DNA, is organized into protein–DNA complexes called nucleoids. Plastid nucleoids are believed to be associated with the inner envelope in developing plastids and the thylakoid membranes in mature chloroplasts, but the mechanism for this re-localization is unknown. Here, we present the further characterization of the coiled-coil DNA-binding protein MFP1 as a protein associated with nucleoids and with the thylakoid membranes in mature chloroplasts. MFP1 is located in plastids in both suspension culture cells and leaves and is attached to the thylakoid membranes with its C-terminal DNA-binding domain oriented towards the stroma. It has a major DNA-binding activity in mature Arabidopsis chloroplasts and binds to all tested chloroplast DNA fragments without detectable sequence specificity. Its expression is tightly correlated with the accumulation of thylakoid membranes. Importantly, it is associated in vivo with nucleoids, suggesting a function for MFP1 at the interface between chloroplast nucleoids and the developing thylakoid membrane system. PMID:12930969

  3. Recombinant antibody mediated delivery of organelle-specific DNA pH sensors along endocytic pathways

    NASA Astrophysics Data System (ADS)

    Modi, Souvik; Halder, Saheli; Nizak, Clément; Krishnan, Yamuna

    2013-12-01

    DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications.DNA has been used to build nanomachines with potential in cellulo and in vivo applications. However their different in cellulo applications are limited by the lack of generalizable strategies to deliver them to precise intracellular locations. Here we describe a new molecular design of DNA pH sensors with response times that are nearly 20 fold faster. Further, by changing the sequence of the pH sensitive domain of the DNA sensor, we have been able to tune their pH sensitive regimes and create a family of DNA sensors spanning ranges from pH 4 to 7.6. To enable a generalizable targeting methodology, this new sensor design also incorporates a `handle' domain. We have identified, using a phage display screen, a set of three recombinant antibodies (scFv) that bind sequence specifically to the handle domain. Sequence analysis of these antibodies revealed several conserved residues that mediate specific interactions with the cognate DNA duplex. We also found that all three scFvs clustered into different branches indicating that their specificity arises from mutations in key residues. When one of these scFvs is fused to a membrane protein (furin) that traffics via the cell surface, the scFv-furin chimera binds the `handle' and ferries a family of DNA pH sensors along the furin endocytic pathway. Post endocytosis, all DNA nanodevices retain their functionality in cellulo and provide spatiotemporal pH maps of retrogradely trafficking furin inside living cells. This new molecular technology of DNA-scFv-protein chimeras can be used to site-specifically complex DNA nanostructures for bioanalytical applications. Electronic supplementary information (ESI) available: Detailed description of all oligonucleotide sequences used in this study; list of figures that support claims from the main text. Mainly these show sensor sequences, phage display results, scFv purification and binding data, cell images clamped at different pH and co-localization studies with endocytic tracers. See DOI: 10.1039/c3nr03769j

  4. Modulation of DNA-Polyamide Interaction by β-alanine Substitutions: A Study of Positional Effects on Binding Affinity, Kinetics and Thermodynamics

    PubMed Central

    Wang, Shuo; Aston, Karl; Koeller, Kevin J.; Harris, G. Davis; Rath, Nigam P.

    2014-01-01

    Hairpin polyamides (PAs) are an important class of sequence-specific DNA minor groove binders, and frequently employ a flexible motif, β-alanine (β), to reduce the molecular rigidity to maintain the DNA recognition register. To better understand the diverse effects β can have on DNA-PA binding affinity, selectivity, and especially kinetics, which have rarely been reported, we have initiated a detailed study for an eight-heterocyclic hairpin PA and its β derivatives with their cognate and mutant sequences. With these derivatives, all internal pyrroles of the parent PA are systematically substituted with single or double βs. A set of complementary experiments have been conducted to evaluate the molecular interactions in detail: UV-melting, biosensor-surface plasmon resonance, circular dichroism and isothermal titration calorimetry. The β substitutions generally weaken the binding affinities of these PAs with cognate DNA, and have large and diverse influences on PA binding kinetics in a position- and number-dependent manner. The DNA base mutations have also shown positional effects on binding of a single PA. Besides the β substitutions, the monocationic Dp group [3-(dimethylamino) propylamine] in parent PA has been modified into a dicationic Ta group (3, 3'-Diamino-N-methyldipropylamine) to minimize the frequently observed PA aggregation with ITC experiments. The results clearly show that the Ta modification not only maintains the DNA binding mode and affinity of PA, but also significantly reduces PA aggregation and allows the complete thermodynamic signature of eight-ring hairpin PA to be determined for the first time. This combined set of results significantly extends our understanding of the energetic basis of specific DNA recognition by PAs. PMID:25141096

  5. Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

    PubMed Central

    Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

    2018-01-01

    Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

  6. Patterns of Viral DNA Integration in Cells Transformed by Wild Type or DNA-Binding Protein Mutants of Adenovirus Type 5 and Effect of Chemical Carcinogens on Integration

    PubMed Central

    Dorsch-Häsler, Karoline; Fisher, Paul B.; Weinstein, I. Bernard; Ginsberg, Harold S.

    1980-01-01

    The integration pattern of viral DNA was studied in a number of cell lines transformed by wild-type adenovirus type 5 (Ad5 WT) and two mutants of the DNA-binding protein gene, H5ts125 and H5ts107. The effect of chemical carcinogens on the integration of viral DNA was also investigated. Liquid hybridization (C0t) analyses showed that rat embryo cells transformed by Ad5 WT usually contained only the left-hand end of the viral genome, whereas cell lines transformed by H5ts125 or H5ts107 at either the semipermissive (36°C) or nonpermissive (39.5°C) temperature often contained one to five copies of all or most of the entire adenovirus genome. The arrangement of the integrated adenovirus DNA sequences was determined by cleavage of transformed cell DNA with restriction endonucleases XbaI, EcoRI, or HindIII followed by transfer of separated fragments to nitrocellulose paper and hybridization according to the technique of E. M. Southern (J. Mol. Biol. 98: 503-517, 1975). It was found that the adenovirus genome is integrated as a linear sequence covalently linked to host cell DNA; that the viral DNA is integrated into different host DNA sequences in each cell line studied; that in cell lines that contain multiple copies of the Ad5 genome the viral DNA sequences can be integrated in a single set of host cell DNA sequences and not as concatemers; and that chemical carcinogens do not alter the extent or pattern of viral DNA integration. Images PMID:6246266

  7. The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

    PubMed Central

    Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

    2013-01-01

    To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

  8. Conflict RNA modification, host-parasite co-evolution, and the origins of DNA and DNA-binding proteins1.

    PubMed

    McLaughlin, Paul J; Keegan, Liam P

    2014-08-01

    Nearly 150 different enzymatically modified forms of the four canonical residues in RNA have been identified. For instance, enzymes of the ADAR (adenosine deaminase acting on RNA) family convert adenosine residues into inosine in cellular dsRNAs. Recent findings show that DNA endonuclease V enzymes have undergone an evolutionary transition from cleaving 3' to deoxyinosine in DNA and ssDNA to cleaving 3' to inosine in dsRNA and ssRNA in humans. Recent work on dsRNA-binding domains of ADARs and other proteins also shows that a degree of sequence specificity is achieved by direct readout in the minor groove. However, the level of sequence specificity observed is much less than that of DNA major groove-binding helix-turn-helix proteins. We suggest that the evolution of DNA-binding proteins following the RNA to DNA genome transition represents the major advantage that DNA genomes have over RNA genomes. We propose that a hypothetical RNA modification, a RRAR (ribose reductase acting on genomic dsRNA) produced the first stretches of DNA in RNA genomes. We discuss why this is the most satisfactory explanation for the origin of DNA. The evolution of this RNA modification and later steps to DNA genomes are likely to have been driven by cellular genome co-evolution with viruses and intragenomic parasites. RNA modifications continue to be involved in host-virus conflicts; in vertebrates, edited cellular dsRNAs with inosine-uracil base pairs appear to be recognized as self RNA and to suppress activation of innate immune sensors that detect viral dsRNA.

  9. Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

    PubMed

    Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

    2017-06-22

    DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

  10. Extending the language of DNA molecular recognition by polyamides: unexpected influence of imidazole and pyrrole arrangement on binding affinity and specificity.

    PubMed

    Buchmueller, Karen L; Staples, Andrew M; Howard, Cameron M; Horick, Sarah M; Uthe, Peter B; Le, N Minh; Cox, Kari K; Nguyen, Binh; Pacheco, Kimberly A O; Wilson, W David; Lee, Moses

    2005-01-19

    Pyrrole (Py) and imidazole (Im) polyamides can be designed to target specific DNA sequences. The effect that the pyrrole and imidazole arrangement, plus DNA sequence, have on sequence specificity and binding affinity has been investigated using DNA melting (DeltaT(M)), circular dichroism (CD), and surface plasmon resonance (SPR) studies. SPR results obtained from a complete set of triheterocyclic polyamides show a dramatic difference in the affinity of f-ImPyIm for its cognate DNA (K(eq) = 1.9 x 10(8) M(-1)) and f-PyPyIm for its cognate DNA (K(eq) = 5.9 x 10(5) M(-1)), which could not have been anticipated prior to characterization of these compounds. Moreover, f-ImPyIm has a 10-fold greater affinity for CGCG than distamycin A has for its cognate, AATT. To understand this difference, the triamide dimers are divided into two structural groupings: central and terminal pairings. The four possible central pairings show decreasing selectivity and affinity for their respective cognate sequences: -ImPy > -PyPy- > -PyIm- approximately -ImIm-. These results extend the language of current design motifs for polyamide sequence recognition to include the use of "words" for recognizing two adjacent base pairs, rather than "letters" for binding to single base pairs. Thus, polyamides designed to target Watson-Crick base pairs should utilize the strength of -ImPy- and -PyPy- central pairings. The f/Im and f/Py terminal groups yielded no advantage for their respective C/G or T/A base pairs. The exception is with the -ImPy- central pairing, for which f/Im has a 10-fold greater affinity for C/G than f/Py has for T/A.

  11. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  12. Demonstrating Interactions of Transcription Factors with DNA by Electrophoretic Mobility Shift Assay.

    PubMed

    Yousaf, Nasim; Gould, David

    2017-01-01

    Confirming the binding of a transcription factor with a particular DNA sequence may be important in characterizing interactions with a synthetic promoter. Electrophoretic mobility shift assay is a powerful approach to demonstrate the specific DNA sequence that is bound by a transcription factor and also to confirm the specific transcription factor involved in the interaction. In this chapter we describe a method we have successfully used to demonstrate interactions of endogenous transcription factors with sequences derived from endogenous and synthetic promoters.

  13. Effective DNA Inhibitors of Cathepsin G by In Vitro Selection

    PubMed Central

    Gatto, Barbara; Vianini, Elena; Lucatello, Lorena; Sissi, Claudia; Moltrasio, Danilo; Pescador, Rodolfo; Porta, Roberto; Palumbo, Manlio

    2008-01-01

    Cathepsin G (CatG) is a chymotrypsin-like protease released upon degranulation of neutrophils. In several inflammatory and ischaemic diseases the impaired balance between CatG and its physiological inhibitors leads to tissue destruction and platelet aggregation. Inhibitors of CatG are suitable for the treatment of inflammatory diseases and procoagulant conditions. DNA released upon the death of neutrophils at injury sites binds CatG. Moreover, short DNA fragments are more inhibitory than genomic DNA. Defibrotide, a single stranded polydeoxyribonucleotide with antithrombotic effect is also a potent CatG inhibitor. Given the above experimental evidences we employed a selection protocol to assess whether DNA inhibition of CatG may be ascribed to specific sequences present in defibrotide DNA. A Selex protocol was applied to identify the single-stranded DNA sequences exhibiting the highest affinity for CatG, the diversity of a combinatorial pool of oligodeoxyribonucleotides being a good representation of the complexity found in defibrotide. Biophysical and biochemical studies confirmed that the selected sequences bind tightly to the target enzyme and also efficiently inhibit its catalytic activity. Sequence analysis carried out to unveil a motif responsible for CatG recognition showed a recurrence of alternating TG repeats in the selected CatG binders, adopting an extended conformation that grants maximal interaction with the highly charged protein surface. This unprecedented finding is validated by our results showing high affinity and inhibition of CatG by specific DNA sequences of variable length designed to maximally reduce pairing/folding interactions. PMID:19325843

  14. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    PubMed

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  15. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  16. [Epigenome: what we learned from Rett syndrome, a neurological disease caused by mutation of a methyl-CpG binding protein].

    PubMed

    Kubota, Takeo

    2013-01-01

    Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).

  17. hPDI: a database of experimental human protein-DNA interactions.

    PubMed

    Xie, Zhi; Hu, Shaohui; Blackshaw, Seth; Zhu, Heng; Qian, Jiang

    2010-01-15

    The human protein DNA Interactome (hPDI) database holds experimental protein-DNA interaction data for humans identified by protein microarray assays. The unique characteristics of hPDI are that it contains consensus DNA-binding sequences not only for nearly 500 human transcription factors but also for >500 unconventional DNA-binding proteins, which are completely uncharacterized previously. Users can browse, search and download a subset or the entire data via a web interface. This database is freely accessible for any academic purposes. http://bioinfo.wilmer.jhu.edu/PDI/.

  18. Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

    PubMed Central

    Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

    2012-01-01

    DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

  19. The impact of base stacking on the conformations and electrostatics of single-stranded DNA.

    PubMed

    Plumridge, Alex; Meisburger, Steve P; Andresen, Kurt; Pollack, Lois

    2017-04-20

    Single-stranded DNA (ssDNA) is notable for its interactions with ssDNA binding proteins (SSBs) during fundamentally important biological processes including DNA repair and replication. Previous work has begun to characterize the conformational and electrostatic properties of ssDNA in association with SSBs. However, the conformational distributions of free ssDNA have been difficult to determine. To capture the vast array of ssDNA conformations in solution, we pair small angle X-ray scattering with novel ensemble fitting methods, obtaining key parameters such as the size, shape and stacking character of strands with different sequences. Complementary ion counting measurements using inductively coupled plasma atomic emission spectroscopy are employed to determine the composition of the ion atmosphere at physiological ionic strength. Applying this combined approach to poly dA and poly dT, we find that the global properties of these sequences are very similar, despite having vastly different propensities for single-stranded helical stacking. These results suggest that a relatively simple mechanism for the binding of ssDNA to non-specific SSBs may be at play, which explains the disparity in binding affinities observed for these systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. Why double-stranded RNA resists condensation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.

    2014-09-15

    The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less

  1. Intramolecular control of transcriptional activity by the NK2-specific domain in NK-2 homeodomain proteins

    PubMed Central

    Watada, Hirotaka; Mirmira, Raghavendra G.; Kalamaras, Julie; German, Michael S.

    2000-01-01

    The developmentally important homeodomain transcription factors of the NK-2 class contain a highly conserved region, the NK2-specific domain (NK2-SD). The function of this domain, however, remains unknown. The primary structure of the NK2-SD suggests that it might function as an accessory DNA-binding domain or as a protein–protein interaction interface. To assess the possibility that the NK2-SD may contribute to DNA-binding specificity, we used a PCR-based approach to identify a consensus DNA-binding sequences for Nkx2.2, an NK-2 family member involved in pancreas and central nervous system development. The consensus sequence (TCTAAGTGAGCTT) is similar to the known binding sequences for other NK-2 homeodomain proteins, but we show that the NK2-SD does not contribute significantly to specific DNA binding to this sequence. To determine whether the NK2-SD contributes to transactivation, we used GAL4-Nkx2.2 fusion constructs to map a powerful transcriptional activation domain in the C-terminal region beyond the conserved NK2-SD. Interestingly, this C-terminal region functions as a transcriptional activator only in the absence of an intact NK2-SD. The NK2-SD also can mask transactivation from the paired homeodomain transcription factor Pax6, but it has no effect on transcription by itself. These results demonstrate that the NK2-SD functions as an intramolecular regulator of the C-terminal activation domain in Nkx2.2 and support a model in which interactions through the NK2-SD regulate the ability of NK-2-class proteins to activate specific genes during development. PMID:10944215

  2. A variable DNA recognition site organization establishes the LiaR-mediated cell envelope stress response of enterococci to daptomycin

    DOE PAGES

    Davlieva, Milya; Shi, Yiwen; Leonard, Paul G.; ...

    2015-04-19

    LiaR is a ‘master regulator’ of the cell envelope stress response in enterococci and many other Gram-positive organisms. Mutations to liaR can lead to antibiotic resistance to a variety of antibiotics including the cyclic lipopeptide daptomycin. LiaR is phosphorylated in response to membrane stress to regulate downstream target operons. Using DNA footprinting of the regions upstream of the liaXYZ and liaFSR operons we show that LiaR binds an extended stretch of DNA that extends beyond the proposed canonical consensus sequence suggesting a more complex level of regulatory control of target operons. We go on to determine the biochemical and structuralmore » basis for increased resistance to daptomycin by the adaptive mutation to LiaR (D191N) first identified from the pathogen Enterococcus faecalis S613. LiaR D191N increases oligomerization of LiaR to form a constitutively activated tetramer that has high affinity for DNA even in the absence of phosphorylation leading to increased resistance. The crystal structures of the LiaR DNA binding domain complexed to the putative consensus sequence as well as an adjoining secondary sequence show that upon binding, LiaR induces DNA bending that is consistent with increased recruitment of RNA polymerase to the transcription start site and upregulation of target operons.« less

  3. Conformational and mechanical changes of DNA upon transcription factor binding detected by a QCM and transmission line model.

    PubMed

    de-Carvalho, Jorge; Rodrigues, Rogério M M; Tomé, Brigitte; Henriques, Sílvia F; Mira, Nuno P; Sá-Correia, Isabel; Ferreira, Guilherme N M

    2014-04-21

    A novel quartz crystal microbalance (QCM) analytical method is developed based on the transmission line model (TLM) algorithm to analyze the binding of transcription factors (TFs) to immobilized DNA oligoduplexes. The method is used to characterize the mechanical properties of biological films through the estimation of the film dynamic shear moduli, G and G, and the film thickness. Using the Saccharomyces cerevisiae transcription factor Haa1 (Haa1DBD) as a biological model two sensors were prepared by immobilizing DNA oligoduplexes, one containing the Haa1 recognition element (HRE(wt)) and another with a random sequence (HRE(neg)) used as a negative control. The immobilization of DNA oligoduplexes was followed in real time and we show that DNA strands initially adsorb with low or non-tilting, laying flat close to the surface, which then lift-off the surface leading to final film tilting angles of 62.9° and 46.7° for HRE(wt) and HRE(neg), respectively. Furthermore we show that the binding of Haa1DBD to HRE(wt) leads to a more ordered and compact film, and forces a 31.7° bending of the immobilized HRE(wt) oligoduplex. This work demonstrates the suitability of the QCM to monitor the specific binding of TFs to immobilized DNA sequences and provides an analytical methodology to study protein-DNA biophysics and kinetics.

  4. TRF1 and TRF2 use different mechanisms to find telomeric DNA but share a novel mechanism to search for protein partners at telomeres.

    PubMed

    Lin, Jiangguo; Countryman, Preston; Buncher, Noah; Kaur, Parminder; E, Longjiang; Zhang, Yiyun; Gibson, Greg; You, Changjiang; Watkins, Simon C; Piehler, Jacob; Opresko, Patricia L; Kad, Neil M; Wang, Hong

    2014-02-01

    Human telomeres are maintained by the shelterin protein complex in which TRF1 and TRF2 bind directly to duplex telomeric DNA. How these proteins find telomeric sequences among a genome of billions of base pairs and how they find protein partners to form the shelterin complex remains uncertain. Using single-molecule fluorescence imaging of quantum dot-labeled TRF1 and TRF2, we study how these proteins locate TTAGGG repeats on DNA tightropes. By virtue of its basic domain TRF2 performs an extensive 1D search on nontelomeric DNA, whereas TRF1's 1D search is limited. Unlike the stable and static associations observed for other proteins at specific binding sites, TRF proteins possess reduced binding stability marked by transient binding (∼ 9-17 s) and slow 1D diffusion on specific telomeric regions. These slow diffusion constants yield activation energy barriers to sliding ∼ 2.8-3.6 κ(B)T greater than those for nontelomeric DNA. We propose that the TRF proteins use 1D sliding to find protein partners and assemble the shelterin complex, which in turn stabilizes the interaction with specific telomeric DNA. This 'tag-team proofreading' represents a more general mechanism to ensure a specific set of proteins interact with each other on long repetitive specific DNA sequences without requiring external energy sources.

  5. HMMBinder: DNA-Binding Protein Prediction Using HMM Profile Based Features.

    PubMed

    Zaman, Rianon; Chowdhury, Shahana Yasmin; Rashid, Mahmood A; Sharma, Alok; Dehzangi, Abdollah; Shatabda, Swakkhar

    2017-01-01

    DNA-binding proteins often play important role in various processes within the cell. Over the last decade, a wide range of classification algorithms and feature extraction techniques have been used to solve this problem. In this paper, we propose a novel DNA-binding protein prediction method called HMMBinder. HMMBinder uses monogram and bigram features extracted from the HMM profiles of the protein sequences. To the best of our knowledge, this is the first application of HMM profile based features for the DNA-binding protein prediction problem. We applied Support Vector Machines (SVM) as a classification technique in HMMBinder. Our method was tested on standard benchmark datasets. We experimentally show that our method outperforms the state-of-the-art methods found in the literature.

  6. Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

    PubMed

    Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

    2018-01-09

    Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins

    PubMed Central

    Kemme, Catherine A.; Marquez, Rolando; Luu, Ross H.

    2017-01-01

    Abstract Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. PMID:28486614

  8. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  9. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  10. Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

    PubMed Central

    Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

    2012-01-01

    Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

  11. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  12. A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria.

    PubMed Central

    Diffley, J F; Stillman, B

    1991-01-01

    ABF2 (ARS-binding factor 2), a small, basic DNA-binding protein that binds specifically to the autonomously replicating sequence ARS1, is located primarily in the mitochondria of the yeast Saccharomyces cerevisiae. The abundance of ABF2 and the phenotype of abf2- null mutants argue that this protein plays a key role in the structure, maintenance, and expression of the yeast mitochondrial genome. The predicted amino acid sequence of ABF2 is closely related to the high-mobility group proteins HMG1 and HMG2 from vertebrate cell nuclei and to several other DNA-binding proteins. Additionally, ABF2 and the other HMG-related proteins are related to a globular domain from the heat shock protein hsp70 family. ABF2 interacts with DNA both nonspecifically and in a specific manner within regulatory regions, suggesting a mechanism whereby it may aid in compacting the mitochondrial genome without interfering with expression. Images PMID:1881919

  13. The DNA-encoded nucleosome organization of a eukaryotic genome.

    PubMed

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  14. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  15. Common fold in helix–hairpin–helix proteins

    PubMed Central

    Shao, Xuguang; Grishin, Nick V.

    2000-01-01

    Helix–hairpin–helix (HhH) is a widespread motif involved in non-sequence-specific DNA binding. The majority of HhH motifs function as DNA-binding modules, however, some of them are used to mediate protein–protein interactions or have acquired enzymatic activity by incorporating catalytic residues (DNA glycosylases). From sequence and structural analysis of HhH-containing proteins we conclude that most HhH motifs are integrated as a part of a five-helical domain, termed (HhH)2 domain here. It typically consists of two consecutive HhH motifs that are linked by a connector helix and displays pseudo-2-fold symmetry. (HhH)2 domains show clear structural integrity and a conserved hydrophobic core composed of seven residues, one residue from each α-helix and each hairpin, and deserves recognition as a distinct protein fold. In addition to known HhH in the structures of RuvA, RadA, MutY and DNA-polymerases, we have detected new HhH motifs in sterile alpha motif and barrier-to-autointegration factor domains, the α-subunit of Escherichia coli RNA-polymerase, DNA-helicase PcrA and DNA glyco­s­y­lases. Statistically significant sequence similarity of HhH motifs and pronounced structural conservation argue for homology between (HhH)2 domains in different protein families. Our analysis helps to clarify how non-symmetric protein motifs bind to the double helix of DNA through the formation of a pseudo-2-fold symmetric (HhH)2 functional unit. PMID:10908318

  16. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    PubMed

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  17. Poxvirus uracil-DNA glycosylase-An unusual member of the family I uracil-DNA glycosylases: Poxvirus Uracil-DNA Glycosylase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schormann, Norbert; Zhukovskaya, Natalia; Bedwell, Gregory

    We report that uracil-DNA glycosylases are ubiquitous enzymes, which play a key role repairing damages in DNA and in maintaining genomic integrity by catalyzing the first step in the base excision repair pathway. Within the superfamily of uracil-DNA glycosylases family I enzymes or UNGs are specific for recognizing and removing uracil from DNA. These enzymes feature conserved structural folds, active site residues and use common motifs for DNA binding, uracil recognition and catalysis. Within this family the enzymes of poxviruses are unique and most remarkable in terms of amino acid sequences, characteristic motifs and more importantly for their novel non-enzymaticmore » function in DNA replication. UNG of vaccinia virus, also known as D4, is the most extensively characterized UNG of the poxvirus family. D4 forms an unusual heterodimeric processivity factor by attaching to a poxvirus-specific protein A20, which also binds to the DNA polymerase E9 and recruits other proteins necessary for replication. D4 is thus integrated in the DNA polymerase complex, and its DNA-binding and DNA scanning abilities couple DNA processivity and DNA base excision repair at the replication fork. In conclusion, the adaptations necessary for taking on the new function are reflected in the amino acid sequence and the three-dimensional structure of D4. We provide an overview of the current state of the knowledge on the structure-function relationship of D4.« less

  18. DNA Shape Dominates Sequence Affinity in Nucleosome Formation

    NASA Astrophysics Data System (ADS)

    Freeman, Gordon S.; Lequieu, Joshua P.; Hinckley, Daniel M.; Whitmer, Jonathan K.; de Pablo, Juan J.

    2014-10-01

    Nucleosomes provide the basic unit of compaction in eukaryotic genomes, and the mechanisms that dictate their position at specific locations along a DNA sequence are of central importance to genetics. In this Letter, we employ molecular models of DNA and proteins to elucidate various aspects of nucleosome positioning. In particular, we show how DNA's histone affinity is encoded in its sequence-dependent shape, including subtle deviations from the ideal straight B-DNA form and local variations of minor groove width. By relying on high-precision simulations of the free energy of nucleosome complexes, we also demonstrate that, depending on DNA's intrinsic curvature, histone binding can be dominated by bending interactions or electrostatic interactions. More generally, the results presented here explain how sequence, manifested as the shape of the DNA molecule, dominates molecular recognition in the problem of nucleosome positioning.

  19. Tumorigenic Potential of Transit Amplifying Prostate Cells

    DTIC Science & Technology

    2012-06-01

    by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

  20. DEPPDB - DNA electrostatic potential properties database. Electrostatic properties of genome DNA elements.

    PubMed

    Osypov, Alexander A; Krutinin, Gleb G; Krutinina, Eugenia A; Kamzolova, Svetlana G

    2012-04-01

    Electrostatic properties of genome DNA are important to its interactions with different proteins, in particular, related to transcription. DEPPDB - DNA Electrostatic Potential (and other Physical) Properties Database - provides information on the electrostatic and other physical properties of genome DNA combined with its sequence and annotation of biological and structural properties of genomes and their elements. Genomes are organized on taxonomical basis, supporting comparative and evolutionary studies. Currently, DEPPDB contains all completely sequenced bacterial, viral, mitochondrial, and plastids genomes according to the NCBI RefSeq, and some model eukaryotic genomes. Data for promoters, regulation sites, binding proteins, etc., are incorporated from established DBs and literature. The database is complemented by analytical tools. User sequences calculations are available. Case studies discovered electrostatics complementing DNA bending in E.coli plasmid BNT2 promoter functioning, possibly affecting host-environment metabolic switch. Transcription factors binding sites gravitate to high potential regions, confirming the electrostatics universal importance in protein-DNA interactions beyond the classical promoter-RNA polymerase recognition and regulation. Other genome elements, such as terminators, also show electrostatic peculiarities. Most intriguing are gene starts, exhibiting taxonomic correlations. The necessity of the genome electrostatic properties studies is discussed.

  1. Extended HSR/CARD domain mediates AIRE binding to DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maslovskaja, Julia, E-mail: julia.maslovskaja@ut.ee; Saare, Mario; Liiv, Ingrid

    Autoimmune regulator (AIRE) activates the transcription of many genes in an unusual promiscuous and stochastic manner. The mechanism by which AIRE binds to the chromatin and DNA is not fully understood, and the regulatory elements that AIRE target genes possess are not delineated. In the current study, we demonstrate that AIRE activates the expression of transiently transfected luciferase reporters that lack defined promoter regions, as well as intron and poly(A) signal sequences. Our protein-DNA interaction experiments with mutated AIRE reveal that the intact homogeneously staining region/caspase recruitment domain (HSR/CARD) and amino acids R113 and K114 are key elements involved inmore » AIRE binding to DNA. - Highlights: • Promoter and mRNA processing elements are not important for AIRE to activate gene expression from reporter plasmids. • AIRE protein fragment aa 1–138 mediates direct binding to DNA. • Integrity of the HSR/CARD domain is needed for AIRE binding to DNA.« less

  2. Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

    PubMed Central

    Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

    1992-01-01

    The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

  3. Role of promoter DNA sequence variations on the binding of EGR1 transcription factor.

    PubMed

    Mikles, David C; Schuchardt, Brett J; Bhat, Vikas; McDonald, Caleb B; Farooq, Amjad

    2014-05-01

    In response to a wide variety of stimuli such as growth factors and hormones, EGR1 transcription factor is rapidly induced and immediately exerts downstream effects central to the maintenance of cellular homeostasis. Herein, our biophysical analysis reveals that DNA sequence variations within the target gene promoters tightly modulate the energetics of binding of EGR1 and that nucleotide substitutions at certain positions are much more detrimental to EGR1-DNA interaction than others. Importantly, the reduction in binding affinity poorly correlates with the loss of enthalpy and gain of entropy-a trend indicative of a complex interplay between underlying thermodynamic factors due to the differential role of water solvent upon nucleotide substitution. We also provide a rationale for the physical basis of the effect of nucleotide substitutions on the EGR1-DNA interaction at atomic level. Taken together, our study bears important implications on understanding the molecular determinants of a key protein-DNA interaction at the cross-roads of human health and disease. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. A DNA-binding protein from Candida albicans that binds to the RPG box of Saccharomyces cerevisiae and the telomeric repeat sequence of C. albicans.

    PubMed

    Ishii, N; Yamamoto, M; Lahm, H W; Iizumi, S; Yoshihara, F; Nakayama, H; Arisawa, M; Aoki, Y

    1997-02-01

    Electromobility shift assays with a DNA probe containing the Saccharomyces cerevisiae ENO1 RPG box identified a specific DNA-binding protein in total protein extracts of Candida albicans. The protein, named Rbf1p (RPG-box-binding protein 1), bound to other S. cerevisiae RPG boxes, although the nucleotide recognition profile was not completely the same as that of S. cerevisiae Rap 1p (repressor-activator protein 1), an RPG-box-binding protein. The repetitive sequence of the C. albicans chromosomal telomere also competed with RPG-box binding to Rbf1p. For further analysis, we purified Rbf1p 57,600-fold from C. albicans total protein extracts, raised mAbs against the purified protein and immunologically cloned the gene, whose ORF specified a protein of 527 aa. The bacterially expressed protein showed RPG-box-binding activity with the same profile as that of the purified one. The Rbf1p, containing two glutamine-rich regions that are found in many transcription factors, showed transcriptional activation capability in S. cerevisiae and was predominantly observed in nuclei. These results suggest that Rbf1p is a transcription factor with telomere-binding activity in C. albicans.

  5. Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

    PubMed Central

    2016-01-01

    Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

  6. Single-molecule DNA unzipping reveals asymmetric modulation of a transcription factor by its binding site sequence and context

    PubMed Central

    Rudnizky, Sergei; Khamis, Hadeel; Malik, Omri; Squires, Allison H; Meller, Amit; Melamed, Philippa

    2018-01-01

    Abstract Most functional transcription factor (TF) binding sites deviate from their ‘consensus’ recognition motif, although their sites and flanking sequences are often conserved across species. Here, we used single-molecule DNA unzipping with optical tweezers to study how Egr-1, a TF harboring three zinc fingers (ZF1, ZF2 and ZF3), is modulated by the sequence and context of its functional sites in the Lhb gene promoter. We find that both the core 9 bp bound to Egr-1 in each of the sites, and the base pairs flanking them, modulate the affinity and structure of the protein–DNA complex. The effect of the flanking sequences is asymmetric, with a stronger effect for the sequence flanking ZF3. Characterization of the dissociation time of Egr-1 revealed that a local, mechanical perturbation of the interactions of ZF3 destabilizes the complex more effectively than a perturbation of the ZF1 interactions. Our results reveal a novel role for ZF3 in the interaction of Egr-1 with other proteins and the DNA, providing insight on the regulation of Lhb and other genes by Egr-1. Moreover, our findings reveal the potential of small changes in DNA sequence to alter transcriptional regulation, and may shed light on the organization of regulatory elements at promoters. PMID:29253225

  7. enoLOGOS: a versatile web tool for energy normalized sequence logos

    PubMed Central

    Workman, Christopher T.; Yin, Yutong; Corcoran, David L.; Ideker, Trey; Stormo, Gary D.; Benos, Panayiotis V.

    2005-01-01

    enoLOGOS is a web-based tool that generates sequence logos from various input sources. Sequence logos have become a popular way to graphically represent DNA and amino acid sequence patterns from a set of aligned sequences. Each position of the alignment is represented by a column of stacked symbols with its total height reflecting the information content in this position. Currently, the available web servers are able to create logo images from a set of aligned sequences, but none of them generates weighted sequence logos directly from energy measurements or other sources. With the advent of high-throughput technologies for estimating the contact energy of different DNA sequences, tools that can create logos directly from binding affinity data are useful to researchers. enoLOGOS generates sequence logos from a variety of input data, including energy measurements, probability matrices, alignment matrices, count matrices and aligned sequences. Furthermore, enoLOGOS can represent the mutual information of different positions of the consensus sequence, a unique feature of this tool. Another web interface for our software, C2H2-enoLOGOS, generates logos for the DNA-binding preferences of the C2H2 zinc-finger transcription factor family members. enoLOGOS and C2H2-enoLOGOS are accessible over the web at . PMID:15980495

  8. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  9. Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

    PubMed

    Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

    2018-05-22

    Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

  10. Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

    2013-11-20

    Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

  11. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    PubMed

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  12. Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

    PubMed Central

    Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

    2013-01-01

    The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

  13. MeDReaders: a database for transcription factors that bind to methylated DNA.

    PubMed

    Wang, Guohua; Luo, Ximei; Wang, Jianan; Wan, Jun; Xia, Shuli; Zhu, Heng; Qian, Jiang; Wang, Yadong

    2018-01-04

    Understanding the molecular principles governing interactions between transcription factors (TFs) and DNA targets is one of the main subjects for transcriptional regulation. Recently, emerging evidence demonstrated that some TFs could bind to DNA motifs containing highly methylated CpGs both in vitro and in vivo. Identification of such TFs and elucidation of their physiological roles now become an important stepping-stone toward understanding the mechanisms underlying the methylation-mediated biological processes, which have crucial implications for human disease and disease development. Hence, we constructed a database, named as MeDReaders, to collect information about methylated DNA binding activities. A total of 731 TFs, which could bind to methylated DNA sequences, were manually curated in human and mouse studies reported in the literature. In silico approaches were applied to predict methylated and unmethylated motifs of 292 TFs by integrating whole genome bisulfite sequencing (WGBS) and ChIP-Seq datasets in six human cell lines and one mouse cell line extracted from ENCODE and GEO database. MeDReaders database will provide a comprehensive resource for further studies and aid related experiment designs. The database implemented unified access for users to most TFs involved in such methylation-associated binding actives. The website is available at http://medreader.org/. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

    PubMed

    Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

    2014-03-06

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  15. DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

    NASA Astrophysics Data System (ADS)

    Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

    2014-03-01

    The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

  16. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  17. Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

    PubMed

    Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

    1997-05-16

    The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

  18. Ferrate oxidation of Escherichia coli DNA polymerase-I. Identification of a methionine residue that is essential for DNA binding.

    PubMed

    Basu, A; Williams, K R; Modak, M J

    1987-07-15

    Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.

  19. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Damian, Luminita, E-mail: luminitadamian@microcal.eu.com; Universite de Toulouse, UPS, IPBS, F-31077 Toulouse; IUB, School of Engineering and Science, D-28727 Bremen

    Is single-strand DNA translatable? Since the 60s, the question still remains whether or not DNA could be directly translated into protein. Some discrepancies in the results were reported about functional translation of single-strand DNA but all results converged on a similar behavior of RNA and ssDNA in the initiation step. Isothermal Titration Calorimetry method was used to determine thermodynamic constants of interaction between single-strand DNA and S30 extract of Escherichia coli. Our results showed that the binding was not affected by the nature of the template tested and the dissociation constants were in the same range when ssDNA (K{sub d}more » = 3.62 {+-} 2.1 x 10{sup -8} M) or the RNA corresponding sequence (K{sub d} = 2.7 {+-} 0.82 x 10{sup -8} M) bearing SD/ATG sequences were used. The binding specificity was confirmed by antibiotic interferences which block the initiation complex formation. These results suggest that the limiting step in translation of ssDNA is the elongation process.« less

  20. Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

    PubMed Central

    Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

    2003-01-01

    Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

  1. Sequence Based Prediction of DNA-Binding Proteins Based on Hybrid Feature Selection Using Random Forest and Gaussian Naïve Bayes

    PubMed Central

    Lou, Wangchao; Wang, Xiaoqing; Chen, Fan; Chen, Yixiao; Jiang, Bo; Zhang, Hua

    2014-01-01

    Developing an efficient method for determination of the DNA-binding proteins, due to their vital roles in gene regulation, is becoming highly desired since it would be invaluable to advance our understanding of protein functions. In this study, we proposed a new method for the prediction of the DNA-binding proteins, by performing the feature rank using random forest and the wrapper-based feature selection using forward best-first search strategy. The features comprise information from primary sequence, predicted secondary structure, predicted relative solvent accessibility, and position specific scoring matrix. The proposed method, called DBPPred, used Gaussian naïve Bayes as the underlying classifier since it outperformed five other classifiers, including decision tree, logistic regression, k-nearest neighbor, support vector machine with polynomial kernel, and support vector machine with radial basis function. As a result, the proposed DBPPred yields the highest average accuracy of 0.791 and average MCC of 0.583 according to the five-fold cross validation with ten runs on the training benchmark dataset PDB594. Subsequently, blind tests on the independent dataset PDB186 by the proposed model trained on the entire PDB594 dataset and by other five existing methods (including iDNA-Prot, DNA-Prot, DNAbinder, DNABIND and DBD-Threader) were performed, resulting in that the proposed DBPPred yielded the highest accuracy of 0.769, MCC of 0.538, and AUC of 0.790. The independent tests performed by the proposed DBPPred on completely a large non-DNA binding protein dataset and two RNA binding protein datasets also showed improved or comparable quality when compared with the relevant prediction methods. Moreover, we observed that majority of the selected features by the proposed method are statistically significantly different between the mean feature values of the DNA-binding and the non DNA-binding proteins. All of the experimental results indicate that the proposed DBPPred can be an alternative perspective predictor for large-scale determination of DNA-binding proteins. PMID:24475169

  2. Label-free technology for the amplified detection of microRNA based on the allosteric hairpin DNA switch and hybridization chain reaction.

    PubMed

    Cai, Sheng; Cao, Zhijuan; Lau, Choiwan; Lu, Jianzhong

    2014-11-21

    By using the allosteric hairpin DNA switch, a novel assay for the detection of microRNA (miRNA) let-7a via a hybridization chain reaction (HCR) was introduced. Briefly, the hairpin DNA switch probe is a single-stranded DNA consisting of a streptavidin (SA) aptamer sequence, a target binding sequence and a certain sequence that acts as a trigger of the HCR. In the presence of target let-7a, the hairpin DNA switch would open and expose the stem region sequences, where a part of this sequence acts as initiator sequence strands for the HCR and triggers a cascade of hybridization events that yields nicked double helices analogous to alternating copolymers, another part is the SA aptamer sequence which activates its binding affinity to SA on SA-coated magnetic particles. The hybridization event could be sensitively detected via an instantaneous derivatization reaction between a special chemiluminescence (CL) reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG) and the guanine nucleotides within the target, the hairpin DNA switch probe, and HCR helices to form an unstable CL intermediate for the generation of light. Our results show that the coupling of the hairpin DNA switch probe and the HCR for the amplified detection of let-7a achieves a better performance (e.g. wide linear response range: 0.1-1000 fmol, low detection limit: 0.1 fmol, and high specificity). Furthermore, this approach could be easily applied to the detection of let-7a in human lung cells, and extended to detect other types of miRNA and proteins such as PDGF based on aptamers. We believe such advancements will represent a significant step towards improved diagnostics and more personalized medical treatment.

  3. Strong positive cooperativity in binding to the A3T3 repeat by Hoechst 33258 derivatives attaching the quinoline units at the end of a branched linker.

    PubMed

    Koda, Hironori; Brazier, John Alan; Onishi, Ippei; Sasaki, Shigeki

    2015-08-01

    Hoechst 33258 derivatives with additional interacting moieties attached at the ends of branched linkers were synthesized, and their DNA binding properties were investigated with regard to the A3T3 repeat by measuring fluorescence spectra. The binding property of the ligand was investigated by fluorescence titration, and the titration data were analyzed using the McGhee-von Hippel method. Ligand 6Q with the quinolin-6-yloxyacetyl group and Ligand IQ with isoquinolin-6-yloxyacetyl group at the ends of the branched linkers exhibit highly positive cooperativity for the DNA having 5 A3T3 sites with 3 base-insertions between them with sequence selectivity. The strategy developed in this study may be generally applicable for designing ligands for repetitive DNA sequences. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Crystal structure of MboIIA methyltransferase.

    PubMed

    Osipiuk, Jerzy; Walsh, Martin A; Joachimiak, Andrzej

    2003-09-15

    DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 A resolution the crystal structure of a beta-class DNA MTase MboIIA (M.MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M.MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules in the asymmetric unit which we propose to resemble the dimer when M.MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M.RsrI. However, the cofactor-binding pocket in M.MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.

  5. Promoter scanning of the Human COX-2 gene with 8-ring polyamides: unexpected weakening of polyamide-DNA binding and selectivity by replacing an internal N-Me-pyrrole with β-alanine

    PubMed Central

    Aston, Karl; Ramos, Joseph P.; Koeller, Kevin J.; Nanjunda, Rupesh; He, Gaofei

    2012-01-01

    Rules for polyamide DNA recognition have proved invaluable for the design of sequence-selective DNA-binding agents in cell-free systems. However, these rules are not fully transferrable to predicting activity in cells, tissues or animals, and additional refinements to our understanding of DNA recognition would help biomedical studies. Similar complexities are encountered when using internal β-alanines as polyamide building blocks in place of N-methyl pyrrole; β-alanines were introduced in polyamide designs to maintain good hydrogen bonding registry with the target DNA, especially for long polyamides or those with several GC bp (P.B. Dervan, A.R. Urbach, Essays Contemp. Chem. (2001) 327–339). Thus, to clarify important subtleties of molecular recognition, we studied the effects of replacing a single pyrrole with β-alanine in 8-ring polyamides designed against the Ets-1 transcription factor. Replacement of a single internal N-methylpyrrole with β-alanine to generate a β/Im pairing in two 8-ring polyamides causes a decrease in DNA binding affinity by two orders of magnitude and decreases DNA binding selectivity, contrary to expectations based on the literature. Measurements were made by fluorescence spectroscopy, quantitative DNA footprinting and surface plasmon resonance, with these vastly different techniques showing excellent agreement. Furthermore, results were validated for a range of DNA substrates from small hairpins to long dsDNA sequences. Docking studies helped show that β-alanine does not make efficient hydrophobic contacts with the rest of the polyamide or nearby DNA, in contrast to pyrrole. These results help refine design principles and expectations for polyamide-DNA recognition. PMID:23023196

  6. Overproduction, purification, and ATPase activity of the Escherichia coli RuvB protein involved in DNA repair.

    PubMed Central

    Iwasaki, H; Shiba, T; Makino, K; Nakata, A; Shinagawa, H

    1989-01-01

    The ruvA and ruvB genes of Escherichia coli constitute an operon which belongs to the SOS regulon. Genetic evidence suggests that the products of the ruv operon are involved in DNA repair and recombination. To begin biochemical characterization of these proteins, we developed a plasmid system that overproduced RuvB protein to 20% of total cell protein. Starting from the overproducing system, we purified RuvB protein. The purified RuvB protein behaved like a monomer in gel filtration chromatography and had an apparent relative molecular mass of 38 kilodaltons in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, which agrees with the value predicted from the DNA sequence. The amino acid sequence of the amino-terminal region of the purified protein was analyzed, and the sequence agreed with the one deduced from the DNA sequence. Since the deduced sequence of RuvB protein contained the consensus sequence for ATP-binding proteins, we examined the ATP-binding and ATPase activities of the purified RuvB protein. RuvB protein had a stronger affinity to ADP than to ATP and weak ATPase activity. The results suggest that the weak ATPase activity of RuvB protein is at least partly due to end product inhibition by ADP. Images PMID:2529252

  7. Implications of the dependence of the elastic properties of DNA on nucleotide sequence.

    PubMed

    Olson, Wilma K; Swigon, David; Coleman, Bernard D

    2004-07-15

    Recent advances in structural biochemistry have provided evidence that not only the geometric properties but also the elastic moduli of duplex DNA are strongly dependent on nucleotide sequence in a way that is not accounted for by classical rod models of the Kirchhoff type. A theory of sequence-dependent DNA elasticity is employed here to calculate the dependence of the equilibrium configurations of circular DNA on the binding of ligands that can induce changes in intrinsic twist at a single base-pair step. Calculations are presented of the influence on configurations of the assumed values and distribution along the DNA of intrinsic roll and twist and a modulus coupling roll to twist. Among the results obtained are the following. For minicircles formed from intrinsically straight DNA, the distribution of roll-twist coupling strongly affects the dependence of the total elastic energy Psi on the amount alpha of imposed untwisting, and that dependence can be far from quadratic. (In fact, for a periodic distribution of roll-twist coupling with a period equal to the intrinsic helical repeat length, Psi can be essentially independent of alpha for -90 degrees < alpha <90 degrees.) When the minicircle is homogeneous and without roll-twist coupling, but with uniform positive intrinsic roll, the point at which Psi attains its minimum value shifts towards negative values of alpha. It is remarked that there are cases in which one can relate graphs of Psi versus alpha to the 'effective values' of bending and twisting moduli and helical repeat length obtained from measurements of equilibrium distributions of topoisomers and probabilities of ring closure. For a minicircle formed from DNA that has an 'S' shape when stress-free, the graphs of Psi versus alpha have maxima at alpha = 0. As the binding of a twisting agent to such a minicircle results in a net decrease in Psi, the affinity of the twisting agent for binding to the minicircle is greater than its affinity for binding to unconstrained DNA with the same sequence.

  8. Structural Determinants of DNA Binding by a P. falciparum ApiAP2 Transcriptional Regulator

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lindner, Scott E.; De Silva, Erandi K.; Keck, James L.

    2010-11-05

    Putative transcription factors have only recently been identified in the Plasmodium spp., with the major family of regulators comprising the Apicomplexan Apetala2 (AP2) proteins. To better understand the DNA-binding mechanisms of these transcriptional regulators, we characterized the structure and in vitro function of an AP2 DNA-binding domain from a prototypical Apicomplexan AP2 protein, PF14{_}0633 from Plasmodium falciparum. The X-ray crystal structure of the PF14{_}0633 AP2 domain bound to DNA reveals a {beta}-sheet fold that binds the DNA major groove through base-specific and backbone contacts; a prominent {alpha}-helix supports the {beta}-sheet structure. Substitution of predicted DNA-binding residues with alanine weakened ormore » eliminated DNA binding in solution. In contrast to plant AP2 domains, the PF14{_}0633 AP2 domain dimerizes upon binding to DNA through a domain-swapping mechanism in which the {alpha}-helices of the AP2 domains pack against the {beta}-sheets of the dimer mates. DNA-induced dimerization of PF14{_}0633 may be important for tethering two distal DNA loci together in the nucleus and/or for inducing functional rearrangements of its domains to facilitate transcriptional regulation. Consistent with a multisite binding mode, at least two copies of the consensus sequence recognized by PF14{_}0633 are present upstream of a previously identified group of sporozoite-stage genes. Taken together, these findings illustrate how Plasmodium has adapted the AP2 DNA-binding domain for genome-wide transcriptional regulation.« less

  9. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

    PubMed Central

    Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

    1995-01-01

    Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

  10. A purified transcription factor (TIF-IB) binds to essential sequences of the mouse rDNA promoter.

    PubMed Central

    Clos, J; Buttgereit, D; Grummt, I

    1986-01-01

    A transcription factor that is specific for mouse rDNA has been partially purified from Ehrlich ascites cells. This factor [designated transcription initiation factor (TIF)-IB] is required for accurate in vitro synthesis of mouse rRNA in addition to RNA polymerase I and another regulatory factor, TIF-IA. TIF-IB activity is present in extracts both from growing and nongrowing cells in comparable amounts. Prebinding competition experiments with wild-type and mutant templates suggest that TIF-IB interacts with the core control element of the rDNA promoter, which is located immediately upstream of the initiation site. The specific binding of TIF-IB to the RNA polymerase I promoter is demonstrated by exonuclease III protection experiments. The 3' border of the sequences protected by TIF-IB is shown to be on the coding strand at position -21 and on the noncoding strand at position -7. The results suggest that direct binding of TIF-IB to sequences in the core promoter element is the mechanism by which this factor imparts promoter selectivity to RNA polymerase I. Images PMID:3456157

  11. Structure and Sequence Search on Aptamer-Protein Docking

    NASA Astrophysics Data System (ADS)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  12. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  13. Violation of an Evolutionarily Conserved Immunoglobulin Diversity Gene Sequence Preference Promotes Production of dsDNA-Specific IgG Antibodies

    PubMed Central

    Silva-Sanchez, Aaron; Liu, Cun Ren; Vale, Andre M.; Khass, Mohamed; Kapoor, Pratibha; Elgavish, Ada; Ivanov, Ivaylo I.; Ippolito, Gregory C.; Schelonka, Robert L.; Schoeb, Trenton R.; Burrows, Peter D.; Schroeder, Harry W.

    2015-01-01

    Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3), which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH) gene segment sequence content by reading frame (RF) is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1), which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies. PMID:25706374

  14. An ultrasensitive label-free biosensor for assaying of sequence-specific DNA-binding protein based on amplifying fluorescent conjugated polymer.

    PubMed

    Liu, Xingfen; Ouyang, Lan; Cai, Xiaohui; Huang, Yanqin; Feng, Xiaomiao; Fan, Quli; Huang, Wei

    2013-03-15

    Sensitive, reliable, and simple detection of sequence-specific DNA-binding proteins (DBP) is of paramount importance in the area of proteomics, genomics, and biomedicine. We describe herein a novel fluorescent-amplified strategy for ultrasensitive, visual, quantitative, and "turn-on" detection of DBP. A Förster resonance energy transfer (FRET) assay utilizing a cationic conjugated polymer (CCP) and an intercalating dye was designed to detect a key transcription factor, nuclear factor-kappa B (NF-κB), the model target. A series of label-free DNA probes bearing one or two protein-binding sites (PBS) were used to identify the target protein specifically. The binding DBP protects the probe from digestion by exonuclease III, resulting in high efficient FRET due to the high affinity between the intercalating dye and duplex DNA, as well as strong electrostatic interactions between the CCP and DNA probe. By using label-free hairpin DNA or double-stranded DNA containing two PBS as probe, we could detect as low as 1 pg/μL of NF-κB in HeLa nuclear extracts, which is 10000-fold more sensitive than the previously reported methods. The approach also allows naked-eye detection by observing fluorescent color of solutions with the assistance of a hand-held UV lamp. Additionally, a less than 10% relative standard deviation was obtained, which offers a new platform for superior precision, low-cost, and simple detection of DBP. The features of our optical biosensor shows promising potential for early diagnosis of many diseases and high-throughput screening of new drugs targeted to DNA-binding proteins. Copyright © 2012 Elsevier B.V. All rights reserved.

  15. A maximum entropy model for chromatin structure

    NASA Astrophysics Data System (ADS)

    Farre, Pau; Emberly, Eldon; Emberly Group Team

    The DNA inside the nucleus of eukaryotic cells shows a variety of conserved structures at different length scales These structures are formed by interactions between protein complexes that bind to the DNA and regulate gene activity. Recent high throughput sequencing techniques allow for the measurement both of the genome wide contact map of the folded DNA within a cell (HiC) and where various proteins are bound to the DNA (ChIP-seq). In this talk I will present a maximum-entropy method capable of both predicting HiC contact maps from binding data, and binding data from HiC contact maps. This method results in an intuitive Ising-type model that is able to predict how altering the presence of binding factors can modify chromosome conformation, without the need of polymer simulations.

  16. The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

    PubMed Central

    Fanning, T; Singer, M

    1987-01-01

    Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

  17. A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.

    PubMed

    Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

    2016-01-01

    Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

  18. Crystal Structure of the Minimalist Max-E47 Protein Chimera

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.

    Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less

  19. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  20. Effect of NaeI-L43K mutation on protein dynamics and DNA conformation: Insights from molecular dynamics simulations.

    PubMed

    Ramachandrakurup, Sreelakshmi; Ramakrishnan, Vigneshwar

    2017-09-01

    Protein-DNA interactions are an important class of biomolecular interactions inside the cell. Delineating the mechanisms of protein-DNA interactions and more specifically, how proteins search and bind to their specific cognate sequences has been the quest of many in the scientific community. Restriction enzymes have served as useful model systems to this end. In this work, we have investigated using molecular dynamics simulations the effect of L43K mutation on NaeI, a type IIE restriction enzyme. NaeI has two domains, the Topo and the Endo domains, each binding to identical strands of DNA sequences (GCCGGC) 2 . The binding of the DNA to the Topo domain is thought to enhance the binding and cleavage of DNA at the Endo domain. Interestingly, it has been found that the mutation of an amino acid that is distantly-located from the DNA cleavage site (L43K) converts the restriction endonuclease to a topoisomerase. Our investigations reveal that the L43K mutation not only induces local structural changes (as evidenced by changes in hydrogen bond propensities and differences in the percentage of secondary structure assignments of the residues in the ligase-like domain) but also alters the overall protein dynamics and DNA conformation which probably leads to the loss of specific cleavage of the recognition site. In a larger context, our study underscores the importance of considering the role of distantly-located amino acids in understanding protein-DNA interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

    NASA Astrophysics Data System (ADS)

    Knight, Jonathan D.; Li, Rong; Botchan, Michael

    1991-04-01

    The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

  2. Principles of regulatory information conservation between mouse and human.

    PubMed

    Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

    2014-11-20

    To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

  3. Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics

    NASA Astrophysics Data System (ADS)

    Verona, Massimiliano Donato; Verdolino, Vincenzo; Palazzesi, Ferruccio; Corradini, Roberto

    2017-02-01

    Peptide Nucleic Acids (PNAs) can efficiently target DNA or RNA acting as chemical tools for gene regulation. Their backbone modification and functionalization is often used to increase the affinity for a particular sequence improving selectivity. The understanding of the trading forces that lead the single strand PNA to bind the DNA or RNA sequence is preparatory for any further rational design, but a clear and unique description of this process is still not complete. In this paper we report further insights into this subject, by a computational investigation aiming at the characterization of the conformations of a single strand PNA and how these can be correlated to its capability in binding DNA/RNA. Employing Metadynamics we were able to better define conformational pre-organizations of the single strand PNA and γ-modified PNA otherwise unrevealed through classical molecular dynamics. Our simulations driven on backbone modified PNAs lead to the conclusion that this γ-functionalization affects the single strand preorganization and targeting properties to the DNA/RNA, in agreement with circular dichroism (CD) spectra obtained for this class of compounds. MD simulations on PNA:RNA dissociation and association mechanisms allowed to reveal the critical role of central bases and preorganization in the binding process.

  4. N-acyl homoserine lactone binding to the CarR receptor determines quorum-sensing specificity in Erwinia.

    PubMed

    Welch, M; Todd, D E; Whitehead, N A; McGowan, S J; Bycroft, B W; Salmond, G P

    2000-02-15

    Quorum sensing via an N-acyl homoserine lactone (HSL) pheromone controls the biosynthesis of a carbapenem antibiotic in Erwinia carotovora. Transcription of the carbapenem biosynthetic genes is dependent on the LuxR-type activator protein, CarR. Equilibrium binding of a range of HSL molecules, which are thought to activate CarR to bind to its DNA target sequence, was examined using fluorescence quenching, DNA bandshift analysis, limited proteolysis and reporter gene assays. CarR bound the most physiologically relevant ligand, N-(3-oxohexanoyl)-L-homoserine lactone, with a stoichiometry of two molecules of ligand per dimer of protein and a dissociation constant of 1.8 microM, in good agreement with the concentration of HSL required to activate carbapenem production in vivo. In the presence of HSL, CarR formed a very high molecular weight complex with its target DNA, indicating that the ligand causes the protein to multimerize. Chemical cross-linking analysis supported this interpretation. Our data show that the ability of a given HSL to facilitate CarR binding to its target DNA sequence is directly proportional to the affinity of the HSL for the protein.

  5. Focus on PNA Flexibility and RNA Binding using Molecular Dynamics and Metadynamics.

    PubMed

    Verona, Massimiliano Donato; Verdolino, Vincenzo; Palazzesi, Ferruccio; Corradini, Roberto

    2017-02-17

    Peptide Nucleic Acids (PNAs) can efficiently target DNA or RNA acting as chemical tools for gene regulation. Their backbone modification and functionalization is often used to increase the affinity for a particular sequence improving selectivity. The understanding of the trading forces that lead the single strand PNA to bind the DNA or RNA sequence is preparatory for any further rational design, but a clear and unique description of this process is still not complete. In this paper we report further insights into this subject, by a computational investigation aiming at the characterization of the conformations of a single strand PNA and how these can be correlated to its capability in binding DNA/RNA. Employing Metadynamics we were able to better define conformational pre-organizations of the single strand PNA and γ-modified PNA otherwise unrevealed through classical molecular dynamics. Our simulations driven on backbone modified PNAs lead to the conclusion that this γ-functionalization affects the single strand preorganization and targeting properties to the DNA/RNA, in agreement with circular dichroism (CD) spectra obtained for this class of compounds. MD simulations on PNA:RNA dissociation and association mechanisms allowed to reveal the critical role of central bases and preorganization in the binding process.

  6. DNA-binding regulates site-specific ubiquitination of IRF-1.

    PubMed

    Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

    2013-02-01

    Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

  7. Generalized theory on the mechanism of site-specific DNA-protein interactions

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-05-01

    We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

  8. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  9. Fusion of GFP to the M.EcoKI DNA methyltransferase produces a new probe of Type I DNA restriction and modification enzymes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, Kai; Roberts, Gareth A.; Stephanou, Augoustinos S.

    2010-07-23

    Research highlights: {yields} Successful fusion of GFP to M.EcoKI DNA methyltransferase. {yields} GFP located at C-terminal of sequence specificity subunit does not later enzyme activity. {yields} FRET confirms structural model of M.EcoKI bound to DNA. -- Abstract: We describe the fusion of enhanced green fluorescent protein to the C-terminus of the HsdS DNA sequence-specificity subunit of the Type I DNA modification methyltransferase M.EcoKI. The fusion expresses well in vivo and assembles with the two HsdM modification subunits. The fusion protein functions as a sequence-specific DNA methyltransferase protecting DNA against digestion by the EcoKI restriction endonuclease. The purified enzyme shows Foerstermore » resonance energy transfer to fluorescently-labelled DNA duplexes containing the target sequence and to fluorescently-labelled ocr protein, a DNA mimic that binds to the M.EcoKI enzyme. Distances determined from the energy transfer experiments corroborate the structural model of M.EcoKI.« less

  10. Highly parallel single-molecule amplification approach based on agarose droplet polymerase chain reaction for efficient and cost-effective aptamer selection.

    PubMed

    Zhang, Wei Yun; Zhang, Wenhua; Liu, Zhiyuan; Li, Cong; Zhu, Zhi; Yang, Chaoyong James

    2012-01-03

    We have developed a novel method for efficiently screening affinity ligands (aptamers) from a complex single-stranded DNA (ssDNA) library by employing single-molecule emulsion polymerase chain reaction (PCR) based on the agarose droplet microfluidic technology. In a typical systematic evolution of ligands by exponential enrichment (SELEX) process, the enriched library is sequenced first, and tens to hundreds of aptamer candidates are analyzed via a bioinformatic approach. Possible candidates are then chemically synthesized, and their binding affinities are measured individually. Such a process is time-consuming, labor-intensive, inefficient, and expensive. To address these problems, we have developed a highly efficient single-molecule approach for aptamer screening using our agarose droplet microfluidic technology. Statistically diluted ssDNA of the pre-enriched library evolved through conventional SELEX against cancer biomarker Shp2 protein was encapsulated into individual uniform agarose droplets for droplet PCR to generate clonal agarose beads. The binding capacity of amplified ssDNA from each clonal bead was then screened via high-throughput fluorescence cytometry. DNA clones with high binding capacity and low K(d) were chosen as the aptamer and can be directly used for downstream biomedical applications. We have identified an ssDNA aptamer that selectively recognizes Shp2 with a K(d) of 24.9 nM. Compared to a conventional sequencing-chemical synthesis-screening work flow, our approach avoids large-scale DNA sequencing and expensive, time-consuming DNA synthesis of large populations of DNA candidates. The agarose droplet microfluidic approach is thus highly efficient and cost-effective for molecular evolution approaches and will find wide application in molecular evolution technologies, including mRNA display, phage display, and so on. © 2011 American Chemical Society

  11. cgDNAweb: a web interface to the cgDNA sequence-dependent coarse-grain model of double-stranded DNA.

    PubMed

    De Bruin, Lennart; Maddocks, John H

    2018-06-14

    The sequence-dependent statistical mechanical properties of fragments of double-stranded DNA is believed to be pertinent to its biological function at length scales from a few base pairs (or bp) to a few hundreds of bp, e.g. indirect read-out protein binding sites, nucleosome positioning sequences, phased A-tracts, etc. In turn, the equilibrium statistical mechanics behaviour of DNA depends upon its ground state configuration, or minimum free energy shape, as well as on its fluctuations as governed by its stiffness (in an appropriate sense). We here present cgDNAweb, which provides browser-based interactive visualization of the sequence-dependent ground states of double-stranded DNA molecules, as predicted by the underlying cgDNA coarse-grain rigid-base model of fragments with arbitrary sequence. The cgDNAweb interface is specifically designed to facilitate comparison between ground state shapes of different sequences. The server is freely available at cgDNAweb.epfl.ch with no login requirement.

  12. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

    PubMed

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

    2015-11-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

  13. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

    PubMed Central

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

    2015-01-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

  14. Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

    PubMed

    Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

    2016-04-20

    Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Prediction of TF target sites based on atomistic models of protein-DNA complexes

    PubMed Central

    Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

    2008-01-01

    Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

  16. Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

    PubMed Central

    Gupta, Gagan Deep; Kumar, Vinay

    2012-01-01

    Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

  17. Genome-wide inference of transcription factor-DNA binding specificity in cell regeneration using a combination strategy.

    PubMed

    Wang, Xiaofeng; Zhang, Aiqun; Ren, Weizheng; Chen, Caiyu; Dong, Jiahong

    2012-11-01

    The cell growth, development, and regeneration of tissue and organ are associated with a large number of gene regulation events, which are mediated in part by transcription factors (TFs) binding to cis-regulatory elements involved in the genome. Predicting the binding affinity and inferring the binding specificity of TF-DNA interactions at the genomic level would be fundamentally helpful for our understanding of the molecular mechanism and biological implication underlying sequence-specific TF-DNA recognition. In this study, we report the development of a combination method to characterize the interaction behavior of a 11-mer oligonucleotide segment and its mutations with the Gcn4p protein, a homodimeric, basic leucine zipper TF, and to predict the binding affinity and specificity of potential Gcn4p binders in the genome-wide scale. In this procedure, a position-mutated energy matrix is created based on molecular modeling analysis of native and mutated Gcn4p-DNA complex structures to describe the position-independent interaction energy profile of Gcn4p with different nucleotide types at each position of the oligonucleotide, and the energy terms extracted from the matrix and their interactives are then correlated with experimentally measured affinities of 19268 distinct oligonucleotides using statistical modeling methodology. Subsequently, the best one of built regression models is successfully applied to screen those of potential high-affinity Gcn4p binders from the complete genome. The findings arising from this study are briefly listed below: (i) The 11 positions of oligonucleotides are highly interactive and non-additive in contribution to Gcn4p-DNA binding affinity; (ii) Indirect conformational effects upon nucleotide mutations as well as associated subtle changes in interfacial atomic contacts, but not the direct nonbonded interactions, are primarily responsible for the sequence-specific recognition; (iii) The intrinsic synergistic effects among the sequence positions of oligonucleotides determine Gcn4p-DNA binding affinity and specificity; (iv) Linear regression models in conjunction with variable selection seem to perform fairly well in capturing the internal dependences hidden in the Gcn4p-DNA system, albeit ignoring nonlinear factors may lead the models to systematically underestimate and overestimate high- and low-affinity samples, respectively. © 2012 John Wiley & Sons A/S.

  18. Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

    PubMed Central

    Fox, K R; Waring, M J

    1986-01-01

    The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

  19. Insights into the structural features and stability of peptide nucleic acid with a D-prolyl-2-aminocyclopentane carboxylic acid backbone that binds to DNA and RNA.

    PubMed

    Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin

    2018-06-12

    Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.

  20. Proteopedia: 3D Visualization and Annotation of Transcription Factor-DNA Readout Modes

    ERIC Educational Resources Information Center

    Dantas Machado, Ana Carolina; Saleebyan, Skyler B.; Holmes, Bailey T.; Karelina, Maria; Tam, Julia; Kim, Sharon Y.; Kim, Keziah H.; Dror, Iris; Hodis, Eran; Martz, Eric; Compeau, Patricia A.; Rohs, Remo

    2012-01-01

    3D visualization assists in identifying diverse mechanisms of protein-DNA recognition that can be observed for transcription factors and other DNA binding proteins. We used Proteopedia to illustrate transcription factor-DNA readout modes with a focus on DNA shape, which can be a function of either nucleotide sequence (Hox proteins) or base pairing…

  1. Potential role of DNA methylation as a facilitator of target search processes for transcription factors through interplay with methyl-CpG-binding proteins.

    PubMed

    Kemme, Catherine A; Marquez, Rolando; Luu, Ross H; Iwahara, Junji

    2017-07-27

    Eukaryotic genomes contain numerous non-functional high-affinity sequences for transcription factors. These sequences potentially serve as natural decoys that sequester transcription factors. We have previously shown that the presence of sequences similar to the target sequence could substantially impede association of the transcription factor Egr-1 with its targets. In this study, using a stopped-flow fluorescence method, we examined the kinetic impact of DNA methylation of decoys on the search process of the Egr-1 zinc-finger protein. We analyzed its association with an unmethylated target site on fluorescence-labeled DNA in the presence of competitor DNA duplexes, including Egr-1 decoys. DNA methylation of decoys alone did not affect target search kinetics. In the presence of the MeCP2 methyl-CpG-binding domain (MBD), however, DNA methylation of decoys substantially (∼10-30-fold) accelerated the target search process of the Egr-1 zinc-finger protein. This acceleration did not occur when the target was also methylated. These results suggest that when decoys are methylated, MBD proteins can block them and thereby allow Egr-1 to avoid sequestration in non-functional locations. This effect may occur in vivo for DNA methylation outside CpG islands (CGIs) and could facilitate localization of some transcription factors within regulatory CGIs, where DNA methylation is rare. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved

    PubMed Central

    Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.

    2016-01-01

    DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945

  3. In vitro selection of DNA elements highly responsive to the human T-cell lymphotropic virus type I transcriptional activator, Tax.

    PubMed

    Paca-Uccaralertkun, S; Zhao, L J; Adya, N; Cross, J V; Cullen, B R; Boros, I M; Giam, C Z

    1994-01-01

    The human T-cell lymphotropic virus type I (HTLV-I) transactivator, Tax, the ubiquitous transcriptional factor cyclic AMP (cAMP) response element-binding protein (CREB protein), and the 21-bp repeats in the HTLV-I transcriptional enhancer form a ternary nucleoprotein complex (L. J. Zhao and C. Z. Giam, Proc. Natl. Acad. Sci. USA 89:7070-7074, 1992). Using an antibody directed against the COOH-terminal region of Tax along with purified Tax and CREB proteins, we selected DNA elements bound specifically by the Tax-CREB complex in vitro. Two distinct but related groups of sequences containing the cAMP response element (CRE) flanked by long runs of G and C residues in the 5' and 3' regions, respectively, were preferentially recognized by Tax-CREB. In contrast, CREB alone binds only to CRE motifs (GNTGACG[T/C]) without neighboring G- or C-rich sequences. The Tax-CREB-selected sequences bear a striking resemblance to the 5' or 3' two-thirds of the HTLV-I 21-bp repeats and are highly inducible by Tax. Gel electrophoretic mobility shift assays, DNA transfection, and DNase I footprinting analyses indicated that the G- and C-rich sequences flanking the CRE motif are crucial for Tax-CREB-DNA ternary complex assembly and Tax transactivation but are not in direct contact with the Tax-CREB complex. These data show that Tax recruits CREB to form a multiprotein complex that specifically recognizes the viral 21-bp repeats. The expanded DNA binding specificity of Tax-CREB and the obligatory role the ternary Tax-CREB-DNA complex plays in transactivation reveal a novel mechanism for regulating the transcriptional activity of leucine zipper proteins like CREB.

  4. Effect of Base Sequence "Defects" on the Electrostatic Potential of Dissolved DNA

    NASA Astrophysics Data System (ADS)

    Adams, Scott V.; Wagner, Katrina; Kephart, Thomas S.; Edwards, Glenn

    1997-11-01

    An analytical model of the electrostatic potential surrounding dissolved DNA has been developed. The model consists of an all-atom, mathematically helical structure for DNA, in which the atoms are arranged in infinite lines of discrete point charges on concentric cylindrical surfaces. The surrounding solvent and counterions are treated with the Debye-Huckel approximation (Wagner et al., Biophysical Journal 73, 21-30, 1997). Variation in the electrostatic potential due to structural differences between A, B, and Z conformations and homopolymer base sequence is apparent. The most recent modification to the model exploits the principle of superposition to calculate the potential of DNA with a base sequence containing `defects.' That is, the base sequence is no longer uniform along the polymer. Differences between the potential of homopolymer DNA and the potential of DNA containing base `defects' are immediately obvious. These results may aid in understanding the role of electrostatics in base-sequence specificity exhibited by DNA-binding proteins.

  5. Exploiting hydrogen bonding interactions to probe smaller linear and cyclic diamines binding to G-quadruplexes: a DFT and molecular dynamics study.

    PubMed

    Kanti Si, Mrinal; Sen, Anik; Ganguly, Bishwajit

    2017-05-10

    G-quadruplexes are formed by the association of four guanine bases through Hoogsteen hydrogen bonding in guanine-rich sequences of DNA and exist in the telomere as well as in promoter regions of certain oncogenes. The sequences of G-quadruplex-DNA are targets for the design of molecules that can bind and can be developed as anti-cancer drugs. The linear and cyclic protonated diamines have been explored to bind to G-quadruplex-DNA through hydrogen bonding interactions. The quadruplex-DNA binders exploit π-stacking and hydrogen bonding interactions with the phosphate backbone of loops and grooves. In this study, linear and cyclic protonated diamines showed remarkable binding affinity for G-tetrads using hydrogen bonding interactions. The DFT M06-2X/6-31G(d)//B3LYP/6-31+G(d) level of theory showed that the cyclic ee-1,2-CHDA (equatorial-equatorial form of 1,2-disubstituted cyclohexadiamine di-cation) binds to the G-tetrads very strongly (∼70.0 kcal mol -1 ), with a much higher binding energy than the linear protonated diamines. The binding affinity of ligands for G-tetrads with counterions has also been examined. The binding preference of these small ligands for G-tetrads is higher than for DNA-duplex. The binding affinity of an intercalated acridine-based ligand (BRACO-19) for G-quadruplexes has been examined and the binding energy is relatively lower than that for the 1,2 disubstituted cyclohexadiamine di-cation with G-tetrads. The atoms-in-molecules (AIM) analysis reveals that the hydrogen bonding interactions between the organic systems with G-tetrads are primarily electrostatic in nature. The molecular dynamics simulations performed using a classical force field (GROMACS) also supported the phosphate backbone sites of G-quadruplex-DNA to bind to these diamines. To mimic the structural pattern of BRACO-19, the designed inhibitor N,2-bis-2(3,4-aminocyclohexyl) acetamide (9) examined possesses two 1,2-CHDA moieties linked through an acetamide group. The molecular dynamics results showed that the designed molecule 9 can efficiently bind to the base-pairs and the phosphate backbone of G quadruplex-DNA using H-bonding interactions. The binding affinity calculated for the intercalated acridine-based drug (BRACO-19) with G-quadruplexes is weaker compared to ee-1,2-CHDA. These ligands deliver a different binding motif (hydrogen bonding) compared to the reported G-quadruplex binders of π-delocalized systems and will kindle interest in examining such scaffolds to stabilize DNA.

  6. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  7. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  8. Molecular basis of splotch and Waardenburg Pax-3 mutations.

    PubMed Central

    Chalepakis, G; Goulding, M; Read, A; Strachan, T; Gruss, P

    1994-01-01

    Pax genes control certain aspects of development, as mutations result in (semi)dominant defects apparent during embryogenesis. Pax-3 has been associated with the mouse mutant splotch (Sp) and the human Waardenburg syndrome type 1 (WS1). We have examined the molecular basis of splotch and WS1 by studying the effect of mutations on DNA binding, using a defined target sequence. Pax-3 contains two different types of functional DNA-binding domains, a paired domain and a homeodomain. Mutational analysis of Pax-3 reveals different modes of DNA binding depending on the presence of these domains. A segment of Pax-3 located between the two DNA-binding domains, including a conserved octapeptide, participates in protein homodimerization. Pax-3 mutations found in splotch alleles and WS1 individuals change DNA binding and, in the case of a protein product of the Sp allele, dimerization. These findings were taken as a basis to define the molecular nature of the mutants. Images PMID:7909605

  9. Computational Design of DNA-Binding Proteins.

    PubMed

    Thyme, Summer; Song, Yifan

    2016-01-01

    Predicting the outcome of engineered and naturally occurring sequence perturbations to protein-DNA interfaces requires accurate computational modeling technologies. It has been well established that computational design to accommodate small numbers of DNA target site substitutions is possible. This chapter details the basic method of design used in the Rosetta macromolecular modeling program that has been successfully used to modulate the specificity of DNA-binding proteins. More recently, combining computational design and directed evolution has become a common approach for increasing the success rate of protein engineering projects. The power of such high-throughput screening depends on computational methods producing multiple potential solutions. Therefore, this chapter describes several protocols for increasing the diversity of designed output. Lastly, we describe an approach for building comparative models of protein-DNA complexes in order to utilize information from homologous sequences. These models can be used to explore how nature modulates specificity of protein-DNA interfaces and potentially can even be used as starting templates for further engineering.

  10. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  11. Investigation of the mechanism of meiotic DNA cleavage by VMA1-derived endonuclease uncovers a meiotic alteration in chromatin structure around the target site.

    PubMed

    Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

    2006-06-01

    VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.

  12. Investigation of the Mechanism of Meiotic DNA Cleavage by VMA1-Derived Endonuclease Uncovers a Meiotic Alteration in Chromatin Structure around the Target Site

    PubMed Central

    Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu

    2006-01-01

    VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746

  13. AtSPX1 affects the AtPHR1-DNA-binding equilibrium by binding monomeric AtPHR1 in solution.

    PubMed

    Qi, Wanjun; Manfield, Iain W; Muench, Stephen P; Baker, Alison

    2017-10-23

    Phosphorus is an essential macronutrient for plant growth and is deficient in ∼50% of agricultural soils. The transcription factor phosphate starvation response 1 (PHR1) plays a central role in regulating the expression of a subset of phosphate starvation-induced (PSI) genes through binding to a cis -acting DNA element termed P1BS (PHR1-binding sequences). In Arabidopsis and rice, activity of AtPHR1/OsPHR2 is regulated in part by their downstream target SPX ( S yg1, P ho81, X pr1) proteins through protein-protein interaction. Here, we provide kinetic and affinity data for interaction between AtPHR1 and P1BS sites. Using surface plasmon resonance, a tandem P1BS sequence showed ∼50-fold higher affinity for MBPAtdPHR1 (a fusion protein comprising the DNA-binding domain and coiled-coil domain of AtPHR1 fused to maltose-binding protein) than a single site. The affinity difference was largely reflected in a much slower dissociation rate from the 2× P1BS-binding site, suggesting an important role for protein co-operativity. Injection of AtSPX1 in the presence of phosphate or inositol hexakisphosphate (InsP6) failed to alter the MBPAtdPHR1-P1BS dissociation rate, while pre-mixing of these two proteins in the presence of either 5 mM Pi or 500 µM InsP6 resulted in a much lower DNA-binding signal from MBPAtdPHR1. These data suggest that, in the Pi-restored condition, AtSPX1 can bind to monomeric AtPHR1 in solution and therefore regulate PSI gene expression by tuning the AtPHR1-DNA-binding equilibrium. This Pi-dependent regulation of AtPHR1-DNA-binding equilibrium also generates a negative feedback loop on the expression of AtSPX1 itself, providing a tight control of PSI gene expression. © 2017 The Author(s).

  14. Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

    PubMed Central

    Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

    2013-01-01

    DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

  15. A DNA sequence element that advances replication origin activation time in Saccharomyces cerevisiae.

    PubMed

    Pohl, Thomas J; Kolor, Katherine; Fangman, Walton L; Brewer, Bonita J; Raghuraman, M K

    2013-11-06

    Eukaryotic origins of DNA replication undergo activation at various times in S-phase, allowing the genome to be duplicated in a temporally staggered fashion. In the budding yeast Saccharomyces cerevisiae, the activation times of individual origins are not intrinsic to those origins but are instead governed by surrounding sequences. Currently, there are two examples of DNA sequences that are known to advance origin activation time, centromeres and forkhead transcription factor binding sites. By combining deletion and linker scanning mutational analysis with two-dimensional gel electrophoresis to measure fork direction in the context of a two-origin plasmid, we have identified and characterized a 19- to 23-bp and a larger 584-bp DNA sequence that are capable of advancing origin activation time.

  16. Protein-binding aptamer assisted signal amplification for the detection of influenza A (H1N1) DNA sequences based on quantum dot fluorescence polarization analysis.

    PubMed

    Zhang, Juanni; Tian, Jianniao; He, Yanlong; Chen, Sheng; Jiang, Yixuan; Zhao, Yanchun; Zhao, Shulin

    2013-09-07

    We report a fluorescence polarization platform for H1N1 detection based on the construction of a DNA functional QD fluorescence polarization probe and a bi-functional protein binding aptamer (Apt-DNA). The assay has a linear range from 10 nM to 100 nM with a detection limit of 3.45 nM and is selective over the mismatched bases.

  17. QueTAL: a suite of tools to classify and compare TAL effectors functionally and phylogenetically

    PubMed Central

    Pérez-Quintero, Alvaro L.; Lamy, Léo; Gordon, Jonathan L.; Escalon, Aline; Cunnac, Sébastien; Szurek, Boris; Gagnevin, Lionel

    2015-01-01

    Transcription Activator-Like (TAL) effectors from Xanthomonas plant pathogenic bacteria can bind to the promoter region of plant genes and induce their expression. DNA-binding specificity is governed by a central domain made of nearly identical repeats, each determining the recognition of one base pair via two amino acid residues (a.k.a. Repeat Variable Di-residue, or RVD). Knowing how TAL effectors differ from each other within and between strains would be useful to infer functional and evolutionary relationships, but their repetitive nature precludes reliable use of traditional alignment methods. The suite QueTAL was therefore developed to offer tailored tools for comparison of TAL effector genes. The program DisTAL considers each repeat as a unit, transforms a TAL effector sequence into a sequence of coded repeats and makes pair-wise alignments between these coded sequences to construct trees. The program FuncTAL is aimed at finding TAL effectors with similar DNA-binding capabilities. It calculates correlations between position weight matrices of potential target DNA sequence predicted from the RVD sequence, and builds trees based on these correlations. The programs accurately represented phylogenetic and functional relationships between TAL effectors using either simulated or literature-curated data. When using the programs on a large set of TAL effector sequences, the DisTAL tree largely reflected the expected species phylogeny. In contrast, FuncTAL showed that TAL effectors with similar binding capabilities can be found between phylogenetically distant taxa. This suite will help users to rapidly analyse any TAL effector genes of interest and compare them to other available TAL genes and should improve our understanding of TAL effectors evolution. It is available at http://bioinfo-web.mpl.ird.fr/cgi-bin2/quetal/quetal.cgi. PMID:26284082

  18. Light-modulated abundance of an mRNA encoding a calmodulin-regulated, chromatin-associated NTPase in pea

    NASA Technical Reports Server (NTRS)

    Hsieh, H. L.; Tong, C. G.; Thomas, C.; Roux, S. J.

    1996-01-01

    A CDNA encoding a 47 kDa nucleoside triphosphatase (NTPase) that is associated with the chromatin of pea nuclei has been cloned and sequenced. The translated sequence of the cDNA includes several domains predicted by known biochemical properties of the enzyme, including five motifs characteristic of the ATP-binding domain of many proteins, several potential casein kinase II phosphorylation sites, a helix-turn-helix region characteristic of DNA-binding proteins, and a potential calmodulin-binding domain. The deduced primary structure also includes an N-terminal sequence that is a predicted signal peptide and an internal sequence that could serve as a bipartite-type nuclear localization signal. Both in situ immunocytochemistry of pea plumules and immunoblots of purified cell fractions indicate that most of the immunodetectable NTPase is within the nucleus, a compartment proteins typically reach through nuclear pores rather than through the endoplasmic reticulum pathway. The translated sequence has some similarity to that of human lamin C, but not high enough to account for the earlier observation that IgG against human lamin C binds to the NTPase in immunoblots. Northern blot analysis shows that the NTPase MRNA is strongly expressed in etiolated plumules, but only poorly or not at all in the leaf and stem tissues of light-grown plants. Accumulation of NTPase mRNA in etiolated seedlings is stimulated by brief treatments with both red and far-red light, as is characteristic of very low-fluence phytochrome responses. Southern blotting with pea genomic DNA indicates the NTPase is likely to be encoded by a single gene.

  19. In vitro selection of zinc fingers with altered DNA-binding specificity.

    PubMed

    Jamieson, A C; Kim, S H; Wells, J A

    1994-05-17

    We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.

    PubMed

    Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A

    1999-12-20

    The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.

  1. Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie

    2010-10-08

    Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

  2. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  3. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  4. DNA Photo Lithography with Cinnamate-based Photo-Bio-Nano-Glue

    NASA Astrophysics Data System (ADS)

    Feng, Lang; Li, Minfeng; Romulus, Joy; Sha, Ruojie; Royer, John; Wu, Kun-Ta; Xu, Qin; Seeman, Nadrian; Weck, Marcus; Chaikin, Paul

    2013-03-01

    We present a technique to make patterned functional surfaces, using a cinnamate photo cross-linker and photolithography. We have designed and modified a complementary set of single DNA strands to incorporate a pair of opposing cinnamate molecules. On exposure to 360nm UV, the cinnamate makes a highly specific covalent bond permanently linking only the complementary strands containing the cinnamates. We have studied this specific and efficient crosslinking with cinnamate-containing DNA in solution and on particles. UV addressability allows us to pattern surfaces functionally. The entire surface is coated with a DNA sequence A incorporating cinnamate. DNA strands A'B with one end containing a complementary cinnamated sequence A' attached to another sequence B, are then hybridized to the surface. UV photolithography is used to bind the A'B strand in a specific pattern. The system is heated and the unbound DNA is washed away. The pattern is then observed by thermo-reversibly hybridizing either fluorescently dyed B' strands complementary to B, or colloids coated with B' strands. Our techniques can be used to reversibly and/or permanently bind, via DNA linkers, an assortment of molecules, proteins and nanostructures. Potential applications range from advanced self-assembly, such as templated self-replication schemes recently reported, to designed physical and chemical patterns, to high-resolution multi-functional DNA surfaces for genetic detection or DNA computing.

  5. Binding modes and pathway of RHPS4 to human telomeric G-quadruplex and duplex DNA probed by all-atom molecular dynamics simulations with explicit solvent.

    PubMed

    Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun

    2017-07-19

    RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.

  6. Improved detection of DNA-binding proteins via compression technology on PSSM information.

    PubMed

    Wang, Yubo; Ding, Yijie; Guo, Fei; Wei, Leyi; Tang, Jijun

    2017-01-01

    Since the importance of DNA-binding proteins in multiple biomolecular functions has been recognized, an increasing number of researchers are attempting to identify DNA-binding proteins. In recent years, the machine learning methods have become more and more compelling in the case of protein sequence data soaring, because of their favorable speed and accuracy. In this paper, we extract three features from the protein sequence, namely NMBAC (Normalized Moreau-Broto Autocorrelation), PSSM-DWT (Position-specific scoring matrix-Discrete Wavelet Transform), and PSSM-DCT (Position-specific scoring matrix-Discrete Cosine Transform). We also employ feature selection algorithm on these feature vectors. Then, these features are fed into the training SVM (support vector machine) model as classifier to predict DNA-binding proteins. Our method applys three datasets, namely PDB1075, PDB594 and PDB186, to evaluate the performance of our approach. The PDB1075 and PDB594 datasets are employed for Jackknife test and the PDB186 dataset is used for the independent test. Our method achieves the best accuracy in the Jacknife test, from 79.20% to 86.23% and 80.5% to 86.20% on PDB1075 and PDB594 datasets, respectively. In the independent test, the accuracy of our method comes to 76.3%. The performance of independent test also shows that our method has a certain ability to be effectively used for DNA-binding protein prediction. The data and source code are at https://doi.org/10.6084/m9.figshare.5104084.

  7. Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

    PubMed

    Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

    2011-08-09

    The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

  8. Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

    NASA Astrophysics Data System (ADS)

    Ray, Sujay

    Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We observed a linear increase in the steady-state stability of the GQ against RPA-mediated unfolding with increasing number of layers or decreasing loop length. The stability demonstrated by different GQ structures varied by at least three orders of magnitude. Finally, we studied another protein-GQ system where a protein complex works synergistically with a GQ to suppress DNA damage signals by preventing RPA to bind to telomeric DNA. Human telomeres that terminate with a single-stranded 3' G-overhang can be recognized as a DNA damage site by RPA. The protection of telomere-1 (POT1) and POT1-interacting protein (TPP1) heterodimer, binds specifically to telomeric DNA and protects it against RPA binding. Using model telomeric DNA, we studied the competition between POT1/TPP1 and RPA to access telomeric GQs in vitro. Under physiological salt and pH conditions, POT1/TPP1 stably load to a minimal DNA sequence adjacent to a folded GQ and unfolds the anti-parallel GQ as the parallel conformation remains folded. We showed that GQ formation of telomeres enhances the ability of POT1/TPP1 to block RPA's access to telomeres by two orders of magnitude and contributes to suppress DNA damage signals.

  9. One recognition sequence, seven restriction enzymes, five reaction mechanisms

    PubMed Central

    Gowers, Darren M.; Bellamy, Stuart R.W.; Halford, Stephen E.

    2004-01-01

    The diversity of reaction mechanisms employed by Type II restriction enzymes was investigated by analysing the reactions of seven endonucleases at the same DNA sequence. NarI, KasI, Mly113I, SfoI, EgeI, EheI and BbeI cleave DNA at several different positions in the sequence 5′-GGCGCC-3′. Their reactions on plasmids with one or two copies of this sequence revealed five distinct mechanisms. These differ in terms of the number of sites the enzyme binds, and the number of phosphodiester bonds cleaved per turnover. NarI binds two sites, but cleaves only one bond per DNA-binding event. KasI also cuts only one bond per turnover but acts at individual sites, preferring intact to nicked sites. Mly113I cuts both strands of its recognition sites, but shows full activity only when bound to two sites, which are then cleaved concertedly. SfoI, EgeI and EheI cut both strands at individual sites, in the manner historically considered as normal for Type II enzymes. Finally, BbeI displays an absolute requirement for two sites in close physical proximity, which are cleaved concertedly. The range of reaction mechanisms for restriction enzymes is thus larger than commonly imagined, as is the number of enzymes needing two recognition sites. PMID:15226412

  10. Xeroderma pigmentosum complementation group C protein (XPC) serves as a general sensor of damaged DNA

    PubMed Central

    Shell, Steven M.; Hawkins, Edward K.; Tsai, Miaw-Sheue; Hlaing, Aye Su; Rizzo, Carmelo J.; Chazin, Walter J.

    2013-01-01

    The xeroderma pigmentosum complementation group C protein (XPC) serves as the primary initiating factor in the global genome nucleotide excision repair pathway (GG-NER). Recent reports suggest XPC also stimulates repair of oxidative lesions by base excision repair. However, whether XPC distinguishes among various types of DNA lesions remains unclear. Although the DNA binding properties of XPC have been studied by several groups, there is a lack of consensus over whether XPC discriminates between DNA damaged by lesions associated with NER activity versus those that are not. In this study we report a high-throughput fluorescence anisotropy assay used to measure the DNA binding affinity of XPC for a panel of DNA substrates containing a range of chemical lesions in a common sequence. Our results demonstrate that while XPC displays a preference for binding damaged DNA, the identity of the lesion has little effect on the binding affinity of XPC. Moreover, XPC was equally capable of binding to DNA substrates containing lesions not repaired by GG-NER. Our results support an indirect read-out model for sensing the presence of lesions by human XPC and suggest XPC may act as a general sensor of damaged DNA capable of recognizing DNA containing lesions not repaired by NER. PMID:24051049

  11. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

    PubMed Central

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

    2015-01-01

    Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

  12. DNA sequence templates adjacent nucleosome and ORC sites at gene amplification origins in Drosophila

    PubMed Central

    Liu, Jun; Zimmer, Kurt; Rusch, Douglas B.; Paranjape, Neha; Podicheti, Ram; Tang, Haixu; Calvi, Brian R.

    2015-01-01

    Eukaryotic origins of DNA replication are bound by the origin recognition complex (ORC), which scaffolds assembly of a pre-replicative complex (pre-RC) that is then activated to initiate replication. Both pre-RC assembly and activation are strongly influenced by developmental changes to the epigenome, but molecular mechanisms remain incompletely defined. We have been examining the activation of origins responsible for developmental gene amplification in Drosophila. At a specific time in oogenesis, somatic follicle cells transition from genomic replication to a locus-specific replication from six amplicon origins. Previous evidence indicated that these amplicon origins are activated by nucleosome acetylation, but how this affects origin chromatin is unknown. Here, we examine nucleosome position in follicle cells using micrococcal nuclease digestion with Ilumina sequencing. The results indicate that ORC binding sites and other essential origin sequences are nucleosome-depleted regions (NDRs). Nucleosome position at the amplicons was highly similar among developmental stages during which ORC is or is not bound, indicating that being an NDR is not sufficient to specify ORC binding. Importantly, the data suggest that nucleosomes and ORC have opposite preferences for DNA sequence and structure. We propose that nucleosome hyperacetylation promotes pre-RC assembly onto adjacent DNA sequences that are disfavored by nucleosomes but favored by ORC. PMID:26227968

  13. Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

    The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

  14. In silico evidence for sequence-dependent nucleosome sliding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lequieu, Joshua; Schwartz, David C.; de Pablo, Juan J.

    Nucleosomes represent the basic building block of chromatin and provide an important mechanism by which cellular processes are controlled. The locations of nucleosomes across the genome are not random but instead depend on both the underlying DNA sequence and the dynamic action of other proteins within the nucleus. These processes are central to cellular function, and the molecular details of the interplay between DNA sequence and nudeosome dynamics remain poorly understood. In this work, we investigate this interplay in detail by relying on a molecular model, which permits development of a comprehensive picture of the underlying free energy surfaces andmore » the corresponding dynamics of nudeosome repositioning. The mechanism of nudeosome repositioning is shown to be strongly linked to DNA sequence and directly related to the binding energy of a given DNA sequence to the histone core. It is also demonstrated that chromatin remodelers can override DNA-sequence preferences by exerting torque, and the histone H4 tail is then identified as a key component by which DNA-sequence, histone modifications, and chromatin remodelers could in fact be coupled.« less

  15. Structural basis of DNA sequence recognition by the response regulator PhoP in Mycobacterium tuberculosis.

    PubMed

    He, Xiaoyuan; Wang, Liqin; Wang, Shuishu

    2016-04-15

    The transcriptional regulator PhoP is an essential virulence factor in Mycobacterium tuberculosis, and it presents a target for the development of new anti-tuberculosis drugs and attenuated tuberculosis vaccine strains. PhoP binds to DNA as a highly cooperative dimer by recognizing direct repeats of 7-bp motifs with a 4-bp spacer. To elucidate the PhoP-DNA binding mechanism, we determined the crystal structure of the PhoP-DNA complex. The structure revealed a tandem PhoP dimer that bound to the direct repeat. The surprising tandem arrangement of the receiver domains allowed the four domains of the PhoP dimer to form a compact structure, accounting for the strict requirement of a 4-bp spacer and the highly cooperative binding of the dimer. The PhoP-DNA interactions exclusively involved the effector domain. The sequence-recognition helix made contact with the bases of the 7-bp motif in the major groove, and the wing interacted with the adjacent minor groove. The structure provides a starting point for the elucidation of the mechanism by which PhoP regulates the virulence of M. tuberculosis and guides the design of screening platforms for PhoP inhibitors.

  16. May the Best Molecule Win: Competition ESI Mass Spectrometry

    PubMed Central

    Laughlin, Sarah; Wilson, W. David

    2015-01-01

    Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

  17. Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

    PubMed Central

    2015-01-01

    The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

  18. Programmable Oligomers Targeting 5′-GGGG-3′ in the Minor Groove of DNA and NF-κB Binding Inhibition

    PubMed Central

    Chenoweth, David M.; Poposki, Julie A.; Marques, Michael A.; Dervan, Peter B.

    2009-01-01

    A series of hairpin oligomers containing benzimidazole (Bi) and imidazopyridine (Ip) rings were synthesized and screened to target 5′-WGGGGW-3′, a core sequence in the DNA binding site of NF-κB, a prolific transcription factor important in biology and disease. Five Bi and Ip containing oligomers bound to the 5′-WGGGGW-3′ site with high affinity. One of the oligomers (Im-Im-Im-Im-γ-PyBi-PyBi-β-Dp) was able to inhibit DNA binding by the transcription factor NF-κB. PMID:17095230

  19. High-Mobility Group Chromatin Proteins 1 and 2 Functionally Interact with Steroid Hormone Receptors To Enhance Their DNA Binding In Vitro and Transcriptional Activity in Mammalian Cells

    PubMed Central

    Boonyaratanakornkit, Viroj; Melvin, Vida; Prendergast, Paul; Altmann, Magda; Ronfani, Lorenza; Bianchi, Marco E.; Taraseviciene, Laima; Nordeen, Steven K.; Allegretto, Elizabeth A.; Edwards, Dean P.

    1998-01-01

    We previously reported that the chromatin high-mobility group protein 1 (HMG-1) enhances the sequence-specific DNA binding activity of progesterone receptor (PR) in vitro, thus providing the first evidence that HMG-1 may have a coregulatory role in steroid receptor-mediated gene transcription. Here we show that HMG-1 and the highly related HMG-2 stimulate DNA binding by other steroid receptors, including estrogen, androgen, and glucocorticoid receptors, but have no effect on DNA binding by several nonsteroid nuclear receptors, including retinoid acid receptor (RAR), retinoic X receptor (RXR), and vitamin D receptor (VDR). As highly purified recombinant full-length proteins, all steroid receptors tested exhibited weak binding affinity for their optimal palindromic hormone response elements (HREs), and the addition of purified HMG-1 or -2 substantially increased their affinity for HREs. Purified RAR, RXR, and VDR also exhibited little to no detectable binding to their cognate direct repeat HREs but, in contrast to results with steroid receptors, the addition of HMG-1 or HMG-2 had no stimulatory effect. Instead, the addition of purified RXR enhanced RAR and VDR DNA binding through a heterodimerization mechanism and HMG-1 or HMG-2 had no further effect on DNA binding by RXR-RAR or RXR-VDR heterodimers. HMG-1 and HMG-2 (HMG-1/-2) themselves do not bind to progesterone response elements, but in the presence of PR they were detected as part of an HMG-PR-DNA ternary complex. HMG-1/-2 can also interact transiently in vitro with PR in the absence of DNA; however, no direct protein interaction was detected with VDR. These results, taken together with the fact that PR can bend its target DNA and that HMG-1/-2 are non-sequence-specific DNA binding proteins that recognize DNA structure, suggest that HMG-1/-2 are recruited to the PR-DNA complex by the combined effect of transient protein interaction and DNA bending. In transient-transfection assays, coexpression of HMG-1 or HMG-2 increased PR-mediated transcription in mammalian cells by as much as 7- to 10-fold without altering the basal promoter activity of target reporter genes. This increase in PR-mediated gene activation by coexpression of HMG-1/-2 was observed in different cell types and with different target promoters, suggesting a generality to the functional interaction between HMG-1/-2 and PR in vivo. Cotransfection of HMG-1 also increased reporter gene activation mediated by other steroid receptors, including glucocorticoid and androgen receptors, but it had a minimal influence on VDR-dependent transcription in vivo. These results support the conclusion that HMG-1/-2 are coregulatory proteins that increase the DNA binding and transcriptional activity of the steroid hormone class of receptors but that do not functionally interact with certain nonsteroid classes of nuclear receptors. PMID:9671457

  20. Systematic Evaluation of the Dependence of Deoxyribozyme Catalysis on Random Region Length

    PubMed Central

    Velez, Tania E.; Singh, Jaydeep; Xiao, Ying; Allen, Emily C.; Wong, On Yi; Chandra, Madhavaiah; Kwon, Sarah C.; Silverman, Scott K.

    2012-01-01

    Functional nucleic acids are DNA and RNA aptamers that bind targets, or they are deoxyribozymes and ribozymes that have catalytic activity. These functional DNA and RNA sequences can be identified from random-sequence pools by in vitro selection, which requires choosing the length of the random region. Shorter random regions allow more complete coverage of sequence space but may not permit the structural complexity necessary for binding or catalysis. In contrast, longer random regions are sampled incompletely but may allow adoption of more complicated structures that enable function. In this study, we systematically examined random region length (N20 through N60) for two particular deoxyribozyme catalytic activities, DNA cleavage and tyrosine-RNA nucleopeptide linkage formation. For both activities, we previously identified deoxyribozymes using only N40 regions. In the case of DNA cleavage, here we found that shorter N20 and N30 regions allowed robust catalytic function, either by DNA hydrolysis or by DNA deglycosylation and strand scission via β-elimination, whereas longer N50 and N60 regions did not lead to catalytically active DNA sequences. Follow-up selections with N20, N30, and N40 regions revealed an interesting interplay of metal ion cofactors and random region length. Separately, for Tyr-RNA linkage formation, N30 and N60 regions provided catalytically active sequences, whereas N20 was unsuccessful, and the N40 deoxyribozymes were functionally superior (in terms of rate and yield) to N30 and N60. Collectively, the results indicate that with future in vitro selection experiments for DNA and RNA catalysts, and by extension for aptamers, random region length should be an important experimental variable. PMID:23088677

  1. Understanding the structural and dynamic consequences of DNA epigenetic modifications: Computational insights into cytosine methylation and hydroxymethylation

    PubMed Central

    Carvalho, Alexandra T P; Gouveia, Leonor; Kanna, Charan Raju; Wärmländer, Sebastian K T S; Platts, Jamie A; Kamerlin, Shina Caroline Lynn

    2014-01-01

    We report a series of molecular dynamics (MD) simulations of up to a microsecond combined simulation time designed to probe epigenetically modified DNA sequences. More specifically, by monitoring the effects of methylation and hydroxymethylation of cytosine in different DNA sequences, we show, for the first time, that DNA epigenetic modifications change the molecule's dynamical landscape, increasing the propensity of DNA toward different values of twist and/or roll/tilt angles (in relation to the unmodified DNA) at the modification sites. Moreover, both the extent and position of different modifications have significant effects on the amount of structural variation observed. We propose that these conformational differences, which are dependent on the sequence environment, can provide specificity for protein binding. PMID:25625845

  2. Vital Roles of the Second DNA-binding Site of Rad52 Protein in Yeast Homologous Recombination*

    PubMed Central

    Arai, Naoto; Kagawa, Wataru; Saito, Kengo; Shingu, Yoshinori; Mikawa, Tsutomu; Kurumizaka, Hitoshi; Shibata, Takehiko

    2011-01-01

    RecA/Rad51 proteins are essential in homologous DNA recombination and catalyze the ATP-dependent formation of D-loops from a single-stranded DNA and an internal homologous sequence in a double-stranded DNA. RecA and Rad51 require a “recombination mediator” to overcome the interference imposed by the prior binding of single-stranded binding protein/replication protein A to the single-stranded DNA. Rad52 is the prototype of recombination mediators, and the human Rad52 protein has two distinct DNA-binding sites: the first site binds to single-stranded DNA, and the second site binds to either double- or single-stranded DNA. We previously showed that yeast Rad52 extensively stimulates Rad51-catalyzed D-loop formation even in the absence of replication protein A, by forming a 2:1 stoichiometric complex with Rad51. However, the precise roles of Rad52 and Rad51 within the complex are unknown. In the present study, we constructed yeast Rad52 mutants in which the amino acid residues corresponding to the second DNA-binding site of the human Rad52 protein were replaced with either alanine or aspartic acid. We found that the second DNA-binding site is important for the yeast Rad52 function in vivo. Rad51-Rad52 complexes consisting of these Rad52 mutants were defective in promoting the formation of D-loops, and the ability of the complex to associate with double-stranded DNA was specifically impaired. Our studies suggest that Rad52 within the complex associates with double-stranded DNA to assist Rad51-mediated homologous pairing. PMID:21454474

  3. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  4. Scarabaecin, a novel cysteine-containing antifungal peptide from the rhinoceros beetle, Oryctes rhinoceros.

    PubMed

    Tomie, Tetsuya; Ishibashi, Jun; Furukawa, Seiichi; Kobayashi, Satoe; Sawahata, Ryoko; Asaoka, Ai; Tagawa, Michito; Yamakawa, Minoru

    2003-07-25

    A novel antifungal peptide, scarabaecin (4080Da), was isolated from the coconut rhinoceros beetle, Oryctes rhinoceros. Scarabaecin cDNA was cloned by reverse transcriptase-polymerase chain reactions (RT-PCR) using a primer based on the N-terminal amino acid sequence. The amino acid sequence deduced from scarabaecin cDNA showed no significant similarity to those of reported proteins. Chemically synthesized scarabaecin indicated antifungal activity against phytopathogenic fungi such as Pyricularia oryzae, Rhizoctonia solani, and Botrytis cinerea, but not against phytopathogenic bacteria. It showed weak activity against Bauberia bassiana, an insect pathogenic fungus, and Staphylococcus aureus, a pathogenic bacterium. Scarabaecin showed chitin binding property and its K(d) was 1.315 microM. A comparison of putative chitin-binding domains among scarabaecin, invertebrate, and plant chitin-binding proteins suggests that scarabaecin is a new member of chitin-binding antimicrobial proteins.

  5. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding Domain I in mismatch recognition.

    PubMed Central

    Lee, Susan D.; Surtees, Jennifer A.; Alani, Eric

    2007-01-01

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. In this study we showed that the msh2Δ1 mutation, containing a complete deletion of the conserved mismatch recognition Domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Δ1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of Domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that Domain I in MSH2 contributed a non-specific DNA binding activity while Domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA-binding. These observations reveal distinct requirements for the MSH2 DNA binding Domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding. PMID:17157869

  6. Saccharomyces cerevisiae MSH2-MSH3 and MSH2-MSH6 complexes display distinct requirements for DNA binding domain I in mismatch recognition.

    PubMed

    Lee, Susan D; Surtees, Jennifer A; Alani, Eric

    2007-02-09

    In eukaryotic mismatch repair (MMR) MSH2-MSH6 initiates the repair of base-base and small insertion/deletion mismatches while MSH2-MSH3 repairs larger insertion/deletion mismatches. Here, we show that the msh2Delta1 mutation, containing a complete deletion of the conserved mismatch recognition domain I of MSH2, conferred a separation of function phenotype with respect to MSH2-MSH3 and MSH2-MSH6 functions. Strains bearing the msh2Delta1 mutation were nearly wild-type in MSH2-MSH6-mediated MMR and in suppressing recombination between DNA sequences predicted to form mismatches recognized by MSH2-MSH6. However, these strains were completely defective in MSH2-MSH3-mediated MMR and recombination functions. This information encouraged us to analyze the contributions of domain I to the mismatch binding specificity of MSH2-MSH3 in genetic and biochemical assays. We found that domain I in MSH2 contributed a non-specific DNA binding activity while domain I of MSH3 appeared important for mismatch binding specificity and for suppressing non-specific DNA binding. These observations reveal distinct requirements for the MSH2 DNA binding domain I in the repair of DNA mismatches and suggest that the binding of MSH2-MSH3 to mismatch DNA involves protein-DNA contacts that appear very different from those required for MSH2-MSH6 mismatch binding.

  7. Crystal structure of MboIIA methyltransferase.

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osipiuk, J.; Walsh, M. A.; Joachimiak, A.

    2003-09-15

    DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules inmore » the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.« less

  8. Sequence-selective DNA cleavage by a chimeric metallopeptide.

    PubMed

    Kovacic, Roger T; Welch, Joel T; Franklin, Sonya J

    2003-06-04

    A chimeric metallopeptide derived from the sequences of two structurally superimposable motifs was designed as an artificial nuclease. Both DNA recognition and nuclease activity have been incorporated into a small peptide sequence. P3W, a 33-mer peptide comprising helices alpha2 and alpha3 from the engrailed homeodomain and the consensus EF-hand Ca-binding loop binds one equivalent of lanthanides or calcium and folds upon metal binding. The conditional formation constants (in the presence of 50 mM Tris) of P3W for Eu(III) (K(a) = (2.1 +/- 0.1) x 10(5) M(-1)) and Ce(IV) (K(a) = (2.6 +/- 0.1) x 10(5) M(-1)) are typical of isolated EF-hand peptides. Circular dichroism studies show that 1:1 CeP3W is 26% alpha-helical and EuP3W is up to 40% alpha-helical in the presence of excess metal. The predicted helicity of the folded peptide based on helix length and end effects is about 50%, showing the metallopeptides are significantly folded. EuP3W has considerably more secondary structure than our previously reported chimeras (Welch, J. T.; Sirish, M.; Lindstrom, K. M.; Franklin, S. J. Inorg. Chem. 2001, 40, 1982-1984). Eu(III)P3W and Ce(IV)P3W nick supercoiled DNA at pH 6.9, although EuP3W is more active at pH 8. CeP3W cleaves linearized, duplex DNA as well as supercoiled plasmid. The cleavage of a 5'-(32)P-labeled 121-mer DNA fragment was followed by polyacrylamide gel electrophoresis. The cleavage products are 3'-OPO(3) termini exclusively, suggesting a regioselective or multistep mechanism. In contrast, uncomplexed Ce(IV) and Eu(III) ions produce both 3'-OPO(3) and 3'-OH, and no evidence of 4'-oxidative cleavage termini with either metal. The complementary 3'-(32)P-labeled oligonucleotide experiment also showed both 5'-OPO(3) and 5'-OH termini were produced by the free ions, whereas CeP3W produces only 5'-OPO(3) termini. In addition to apparent regioselectivity, the metallopeptides cut DNA with modest sequence discrimination, which suggests that the HTH motif binds DNA as a folded domain and thus cleaves selected sequences. The de novo artificial nuclease LnP3W represents the first small, underivatized peptide that is both active as a nuclease and sequence selective.

  9. Rapid amplification of 5' complementary DNA ends (5' RACE).

    PubMed

    2005-08-01

    This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

  10. Direct uptake and degradation of DNA by lysosomes

    PubMed Central

    Fujiwara, Yuuki; Kikuchi, Hisae; Aizawa, Shu; Furuta, Akiko; Hatanaka, Yusuke; Konya, Chiho; Uchida, Kenko; Wada, Keiji; Kabuta, Tomohiro

    2013-01-01

    Lysosomes contain various hydrolases that can degrade proteins, lipids, nucleic acids and carbohydrates. We recently discovered “RNautophagy,” an autophagic pathway in which RNA is directly taken up by lysosomes and degraded. A lysosomal membrane protein, LAMP2C, a splice variant of LAMP2, binds to RNA and acts as a receptor for this pathway. In the present study, we show that DNA is also directly taken up by lysosomes and degraded. Like RNautophagy, this autophagic pathway, which we term “DNautophagy,” is dependent on ATP. The cytosolic sequence of LAMP2C also directly interacts with DNA, and LAMP2C functions as a receptor for DNautophagy, in addition to RNautophagy. Similarly to RNA, DNA binds to the cytosolic sequences of fly and nematode LAMP orthologs. Together with the findings of our previous study, our present findings suggest that RNautophagy and DNautophagy are evolutionarily conserved systems in Metazoa. PMID:23839276

  11. COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

    PubMed Central

    Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

    2002-01-01

    Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

  12. Novel DNA Motif Binding Activity Observed In Vivo With an Estrogen Receptor α Mutant Mouse

    PubMed Central

    Li, Leping; Grimm, Sara A.; Winuthayanon, Wipawee; Hamilton, Katherine J.; Pockette, Brianna; Rubel, Cory A.; Pedersen, Lars C.; Fargo, David; Lanz, Rainer B.; DeMayo, Francesco J.; Schütz, Günther; Korach, Kenneth S.

    2014-01-01

    Estrogen receptor α (ERα) interacts with DNA directly or indirectly via other transcription factors, referred to as “tethering.” Evidence for tethering is based on in vitro studies and a widely used “KIKO” mouse model containing mutations that prevent direct estrogen response element DNA- binding. KIKO mice are infertile, due in part to the inability of estradiol (E2) to induce uterine epithelial proliferation. To elucidate the molecular events that prevent KIKO uterine growth, regulation of the pro-proliferative E2 target gene Klf4 and of Klf15, a progesterone (P4) target gene that opposes the pro-proliferative activity of KLF4, was evaluated. Klf4 induction was impaired in KIKO uteri; however, Klf15 was induced by E2 rather than by P4. Whole uterine chromatin immunoprecipitation-sequencing revealed enrichment of KIKO ERα binding to hormone response elements (HREs) motifs. KIKO binding to HRE motifs was verified using reporter gene and DNA-binding assays. Because the KIKO ERα has HRE DNA-binding activity, we evaluated the “EAAE” ERα, which has more severe DNA-binding domain mutations, and demonstrated a lack of estrogen response element or HRE reporter gene induction or DNA-binding. The EAAE mouse has an ERα null–like phenotype, with impaired uterine growth and transcriptional activity. Our findings demonstrate that the KIKO mouse model, which has been used by numerous investigators, cannot be used to establish biological functions for ERα tethering, because KIKO ERα effectively stimulates transcription using HRE motifs. The EAAE-ERα DNA-binding domain mutant mouse demonstrates that ERα DNA-binding is crucial for biological and transcriptional processes in reproductive tissues and that ERα tethering may not contribute to estrogen responsiveness in vivo. PMID:24713037

  13. Manipulative interplay of two adozelesin molecules with d(ATTAAT)₂achieving ligand-stacked Watson-Crick and Hoogsteen base-paired duplex adducts.

    PubMed

    Hopton, Suzanne R; Thompson, Andrew S

    2011-05-17

    Previous structural studies of the cyclopropapyrroloindole (CPI) antitumor antibiotics have shown that these ligands bind covalently edge-on into the minor groove of double-stranded DNA. Reversible covalent modification of the DNA via N3 of adenine occurs in a sequence-specific fashion. Early nuclear magnetic resonance and molecular modeling studies with both mono- and bis-alkylating ligands indicated that the ligands fit tightly within the minor groove, causing little distortion of the helix. In this study, we propose a new binding model for several of the CPI-based analogues, in which the aromatic secondary rings form π-stacked complexes within the minor groove. One of the adducts, formed with adozelesin and the d(ATTAAT)(2) sequence, also demonstrates the ability of these ligands to manipulate the DNA of the binding site, resulting in a Hoogsteen base-paired adduct. Although this type of base pairing has been previously observed with the bisfunctional CPI analogue bizelesin, this is the first time that such an observation has been made with a monoalkylating nondimeric analogue. Together, these results provide a new model for the design of CPI-based antitumor antibiotics, which also has a significant bearing on other structurally related and structurally unrelated minor groove-binding ligands. They indicate the dynamic nature of ligand-DNA interactions, demonstrating both DNA conformational flexibility and the ability of two DNA-bound ligands to interact to form stable covalent modified complexes.

  14. Solution structure of CEH-37 homeodomain of the nematode Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moon, Sunjin; Lee, Yong Woo; Kim, Woo Taek

    Highlights: •We have determined solution structures of CEH-37 homedomain. •CEH-37 HD has a compact α-helical structure with HTH DNA binding motif. •Solution structure of CEH-37 HD shares its molecular topology with that of the homeodomain proteins. •Residues in the N-terminal region and HTH motif are important in binding to Caenorhabditis elegans telomeric DNA. •CEH-37 could play an important role in telomere function via DNA binding. -- Abstract: The nematode Caenorhabditis elegans protein CEH-37 belongs to the paired OTD/OTX family of homeobox-containing homeodomain proteins. CEH-37 shares sequence similarity with homeodomain proteins, although it specifically binds to double-stranded C. elegans telomeric DNA,more » which is unusual to homeodomain proteins. Here, we report the solution structure of CEH-37 homeodomain and molecular interaction with double-stranded C. elegans telomeric DNA using nuclear magnetic resonance (NMR) spectroscopy. NMR structure shows that CEH-37 homeodomain is composed of a flexible N-terminal region and three α-helices with a helix-turn-helix (HTH) DNA binding motif. Data from size-exclusion chromatography and fluorescence spectroscopy reveal that CEH-37 homeodomain interacts strongly with double-stranded C. elegans telomeric DNA. NMR titration experiments identified residues responsible for specific binding to nematode double-stranded telomeric DNA. These results suggest that C. elegans homeodomain protein, CEH-37 could play an important role in telomere function via DNA binding.« less

  15. Genetic and epigenetic mutations affect the DNA binding capability of human ZFP57 in transient neonatal diabetes type 1

    PubMed Central

    Baglivo, Ilaria; Esposito, Sabrina; De Cesare, Lucia; Sparago, Angela; Anvar, Zahra; Riso, Vincenzo; Cammisa, Marco; Fattorusso, Roberto; Grimaldi, Giovanna; Riccio, Andrea; Pedone, Paolo V.

    2013-01-01

    In the mouse, ZFP57 contains three classical Cys2His2 zinc finger domains (ZF) and recognizes the methylated TGCmetCGC target sequence using the first and the second ZFs. In this study, we demonstrate that the human ZFP57 (hZFP57) containing six Cys2His2 ZFs, binds the same methylated sequence through the third and the fourth ZFs, and identify the aminoacids critical for DNA interaction. In addition, we present evidences indicating that hZFP57 mutations and hypomethylation of the TNDM1 ICR both associated with Transient Neonatal Diabetes Mellitus type 1 result in loss of hZFP57 binding to the TNDM1 locus, likely causing PLAGL1 activation. PMID:23499433

  16. Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

    PubMed Central

    Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

    2012-01-01

    X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

  17. Gadd45a Is an RNA Binding Protein and Is Localized in Nuclear Speckles

    PubMed Central

    Sytnikova, Yuliya A.; Kubarenko, Andriy V.; Schäfer, Andrea; Weber, Alexander N. R.; Niehrs, Christof

    2011-01-01

    Background The Gadd45 proteins play important roles in growth control, maintenance of genomic stability, DNA repair, and apoptosis. Recently, Gadd45 proteins have also been implicated in epigenetic gene regulation by promoting active DNA demethylation. Gadd45 proteins have sequence homology with the L7Ae/L30e/S12e RNA binding superfamily of ribosomal proteins, which raises the question if they may interact directly with nucleic acids. Principal Findings Here we show that Gadd45a binds RNA but not single- or double stranded DNA or methylated DNA in vitro. Sucrose density gradient centrifugation experiments demonstrate that Gadd45a is present in high molecular weight particles, which are RNase sensitive. Gadd45a displays RNase-sensitive colocalization in nuclear speckles with the RNA helicase p68 and the RNA binding protein SC35. A K45A point mutation defective in RNA binding was still active in DNA demethylation. This suggests that RNA binding is not absolutely essential for demethylation of an artificial substrate. A point mutation at G39 impared RNA binding, nuclear speckle localization and DNA demethylation, emphasizing its relevance for Gadd45a function. Significance The results implicate RNA in Gadd45a function and suggest that Gadd45a is associated with a ribonucleoprotein particle. PMID:21249130

  18. Solution structure of the DNA-binding domain of RPA from Saccharomyces cerevisiae and its interaction with single-stranded DNA and SV40 T antigen

    PubMed Central

    Park, Chin-Ju; Lee, Joon-Hwa; Choi, Byong-Seok

    2005-01-01

    Replication protein A (RPA) is a three-subunit complex with multiple roles in DNA metabolism. DNA-binding domain A in the large subunit of human RPA (hRPA70A) binds to single-stranded DNA (ssDNA) and is responsible for the species-specific RPA–T antigen (T-ag) interaction required for Simian virus 40 replication. Although Saccharomyces cerevisiae RPA70A (scRPA70A) shares high sequence homology with hRPA70A, the two are not functionally equivalent. To elucidate the similarities and differences between these two homologous proteins, we determined the solution structure of scRPA70A, which closely resembled the structure of hRPA70A. The structure of ssDNA-bound scRPA70A, as simulated by residual dipolar coupling-based homology modeling, suggested that the positioning of the ssDNA is the same for scRPA70A and hRPA70A, although the conformational changes that occur in the two proteins upon ssDNA binding are not identical. NMR titrations of hRPA70A with T-ag showed that the T-ag binding surface is separate from the ssDNA-binding region and is more neutral than the corresponding part of scRPA70A. These differences might account for the species-specific nature of the hRPA70A–T-ag interaction. Our results provide insight into how these two homologous RPA proteins can exhibit functional differences, but still both retain their ability to bind ssDNA. PMID:16043636

  19. Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Cucinotta, Francis A.

    2010-01-01

    Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

  20. Evidence for a Pneumocystis carinii Flo8-like transcription factor: insights into organism adhesion.

    PubMed

    Kottom, Theodore J; Limper, Andrew H

    2016-02-01

    Pneumocystis carinii (Pc) adhesion to alveolar epithelial cells is well established and is thought to be a prerequisite for the initiation of Pneumocystis pneumonia. Pc binding events occur in part through the major Pc surface glycoprotein Msg, as well as an integrin-like molecule termed PcInt1. Recent data from the Pc sequencing project also demonstrate DNA sequences homologous to other genes important in Candida spp. binding to mammalian host cells, as well as organism binding to polystyrene surfaces and in biofilm formation. One of these genes, flo8, a transcription factor needed for downstream cAMP/PKA-pathway-mediated activation of the major adhesion/flocculin Flo11 in yeast, was cloned from a Pc cDNA library utilizing a partial sequence available in the Pc genome database. A CHEF blot of Pc genomic DNA yielded a single band providing evidence this gene is present in the organism. BLASTP analysis of the predicted protein demonstrated 41 % homology to the Saccharomyces cerevisiae Flo8. Northern blotting demonstrated greatest expression at pH 6.0-8.0, pH comparable to reported fungal biofilm milieu. Western blot and immunoprecipitation assays of PcFlo8 protein in isolated cyst and tropic life forms confirmed the presence of the cognate protein in these Pc life forms. Heterologous expression of Pcflo8 cDNA in flo8Δ-deficient yeast strains demonstrated that the Pcflo8 was able to restore yeast binding to polystyrene and invasive growth of yeast flo8Δ cells. Furthermore, Pcflo8 promoted yeast binding to HEK293 human epithelial cells, strengthening its functional classification as a Flo8 transcription factor. Taken together, these data suggest that PcFlo8 is expressed by Pc and may exert activity in organism adhesion and biofilm formation.

Top