NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

The Reach of Linear Protein-DNA Dimerizers

PubMed Central

Stafford, Ryan L.; Dervan, Peter B.

2008-01-01

A protein-DNA dimerizer constructed from a DNA-binding pyrrole-imidazole polyamide and the peptide FYPWMK facilitates binding of the natural transcription factor Exd to an adjacent DNA site. Previous dimerizers have been constructed with the peptide attached to an internal pyrrole monomer in an overall branched oligomer. Linear oligomers constructed by attaching the peptide to the polyamide C-terminus expand the range of protein-DNA dimerization to six additional DNA sites. Replacing the FYPWMK hexapeptide with a WM dipeptide, which was previously functional in branched compounds, does not lead to a functional linear dimerizer. Instead, inserting an additional lysine generates a minimal, linear WMK tripeptide conjugate that maintains the activity of the larger FYPWMK dimerizers in a single DNA-binding site orientation. These studies provide insight into the importance of linker length and composition, binding site spacing and orientation, and the protein-binding domain content that are important for the optimization of protein DNA-dimerizers suitable for biological experiments. PMID:17949089

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

NASA Astrophysics Data System (ADS)

Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

2014-09-01

DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

DNA-binding regulates site-specific ubiquitination of IRF-1.

PubMed

Landré, Vivien; Pion, Emmanuelle; Narayan, Vikram; Xirodimas, Dimitris P; Ball, Kathryn L

2013-02-01

Understanding the determinants for site-specific ubiquitination by E3 ligase components of the ubiquitin machinery is proving to be a challenge. In the present study we investigate the role of an E3 ligase docking site (Mf2 domain) in an intrinsically disordered domain of IRF-1 [IFN (interferon) regulatory factor-1], a short-lived IFNγ-regulated transcription factor, in ubiquitination of the protein. Ubiquitin modification of full-length IRF-1 by E3 ligases such as CHIP [C-terminus of the Hsc (heat-shock cognate) 70-interacting protein] and MDM2 (murine double minute 2), which dock to the Mf2 domain, was specific for lysine residues found predominantly in loop structures that extend from the DNA-binding domain, whereas no modification was detected in the more conformationally flexible C-terminal half of the protein. The E3 docking site was not available when IRF-1 was in its DNA-bound conformation and cognate DNA-binding sequences strongly suppressed ubiquitination, highlighting a strict relationship between ligase binding and site-specific modification at residues in the DNA-binding domain. Hyperubiquitination of a non-DNA-binding mutant supports a mechanism where an active DNA-bound pool of IRF-1 is protected from polyubiquitination and degradation.

Study of DNA binding sites using the Rényi parametric entropy measure.

PubMed

Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

2004-04-07

Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

High-Affinity Low-Capacity and Low-Affinity High-Capacity N-Acetyl-2-Aminofluorene (AAF) Macromolecular Binding Sites Are Revealed During the Growth Cycle of Adult Rat Hepatocytes in Primary Culture.

PubMed

Koch, Katherine S; Moran, Tom; Shier, W Thomas; Leffert, Hyam L

2018-05-01

Long-term cultures of primary adult rat hepatocytes were used to study the effects of N-acetyl-2-aminofluorene (AAF) on hepatocyte proliferation during the growth cycle; on the initiation of hepatocyte DNA synthesis in quiescent cultures; and, on hepatocyte DNA replication following the initiation of DNA synthesis. Scatchard analyses were used to identify the pharmacologic properties of radiolabeled AAF metabolite binding to hepatocyte macromolecules. Two classes of growth cycle-dependent AAF metabolite binding sites-a high-affinity low-capacity site (designated Site I) and a low-affinity high-capacity site (designated Site II)-associated with two spatially distinct classes of macromolecular targets, were revealed. Based upon radiolabeled AAF metabolite binding to purified hepatocyte genomic DNA or to DNA, RNA, proteins, and lipids from isolated nuclei, Site IDAY 4 targets (KD[APPARENT] ≈ 2-4×10-6 M and BMAX[APPARENT] ≈ 6 pmol/106 cells/24 h) were consistent with genomic DNA; and with AAF metabolized by a nuclear cytochrome P450. Based upon radiolabeled AAF binding to total cellular lysates, Site IIDAY 4 targets (KD[APPARENT] ≈ 1.5×10-3 M and BMAX[APPARENT] ≈ 350 pmol/106 cells/24 h) were consistent with cytoplasmic proteins; and with AAF metabolized by cytoplasmic cytochrome P450s. DNA synthesis was not inhibited by concentrations of AAF that saturated DNA binding in the neighborhood of the Site I KD. Instead, hepatocyte DNA synthesis inhibition required higher concentrations of AAF approaching the Site II KD. These observations raise the possibility that carcinogenic DNA adducts derived from AAF metabolites form below concentrations of AAF that inhibit replicative and repair DNA synthesis.

Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

2009-05-22

Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

PubMed

Salter, Jason D; Smith, Harold C

2018-05-23

The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

PubMed

Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

2007-05-01

The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

Replication of damaged DNA in vitro is blocked by p53

PubMed Central

Zhou, Jianmin; Prives, Carol

2003-01-01

The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

Specialized nucleoprotein structures at the origin of replication of bacteriophage lambda: localized unwinding of duplex DNA by a six-protein reaction.

PubMed Central

Dodson, M; Echols, H; Wickner, S; Alfano, C; Mensa-Wilmot, K; Gomes, B; LeBowitz, J; Roberts, J D; McMacken, R

1986-01-01

The O protein of bacteriophage lambda localizes the initiation of DNA replication to a unique site on the lambda genome, ori lambda. By means of electron microscopy, we infer that the binding of O to ori lambda initiates a series of protein addition and transfer reactions that culminate in localized unwinding of the origin DNA, generating a prepriming structure for the initiation of DNA replication. We can define three stages of this prepriming reaction, the first two of which we have characterized previously. First, dimeric O protein binds to multiple DNA binding sites and self-associates to form a nucleoprotein structure, the O-some. Second, lambda P and host DnaB proteins interact with the O-some to generate a larger complex that includes additional DNA from an A + T-rich region adjacent to the O binding sites. Third, the addition of the DnaJ, DnaK, and Ssb proteins and ATP results in an origin-specific unwinding reaction, probably catalyzed by the helicase activity of DnaB. The unwinding reaction is unidirectional, proceeding "rightward" from the origin. The minimal DNA sequence competent for unwinding consists of two O binding sites and the adjacent A + T-rich region to the right of the binding sites. We conclude that the lambda O protein localizes and initiates a six-protein sequential reaction responsible for but preceding the precise initiation of DNA replication. Specialized nucleoprotein structures similar to the O-some may be a general feature of DNA transactions requiring extraordinary precision in localization and control. Images PMID:3020552

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

PubMed Central

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

PubMed

Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

2013-09-01

Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

Generalized theory on the mechanism of site-specific DNA-protein interactions

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-05-01

We develop a generalized theoretical framework on the binding of transcription factor proteins (TFs) with specific sites on DNA that takes into account the interplay of various factors regarding overall electrostatic potential at the DNA-protein interface, occurrence of kinetic traps along the DNA sequence, presence of other roadblock protein molecules along DNA and crowded environment, conformational fluctuations in the DNA binding domains (DBDs) of TFs, and the conformational state of the DNA. Starting from a Smolochowski type theoretical framework on site-specific binding of TFs we logically build our model by adding the effects of these factors one by one. Our generalized two-step model suggests that the electrostatic attractive forces present inbetween the positively charged DBDs of TFs and the negatively charged phosphate backbone of DNA, along with the counteracting shielding effects of solvent ions, is the core factor that creates a fluidic type environment at the DNA-protein interface. This in turn facilitates various one-dimensional diffusion (1Dd) processes such as sliding, hopping and intersegmental transfers. These facilitating processes as well as flipping dynamics of conformational states of DBDs of TFs between stationary and mobile states can enhance the 1Dd coefficient on a par with three-dimensional diffusion (3Dd). The random coil conformation of DNA also plays critical roles in enhancing the site-specific association rate. The extent of enhancement over the 3Dd controlled rate seems to be directly proportional to the maximum possible 1Dd length. We show that the overall site-specific binding rate scales with the length of DNA in an asymptotic way. For relaxed DNA, the specific binding rate will be independent of the length of DNA as length increases towards infinity. For condensed DNA as in in vivo conditions, the specific binding rate depends on the length of DNA in a turnover way with a maximum. This maximum rate seems to scale with the maximum possible 1Dd length of TFs in a square root manner. Results suggest that 1Dd processes contribute much less to the enhancement of specific binding rate under in vivo conditions for condensed DNA. There exists a critical length of binding stretch of TFs beyond which the probability associated with the random occurrence of similar specific binding sites will be close to zero. TFs in natural systems from prokaryotes to eukaryotes seem to handle sequence-mediated kinetic traps via increasing the length of their recognition stretch or combinatorial binding. TFs overcome the hurdles of roadblocks via switching efficiently between sliding, hopping and intersegmental transfer modes. The site-specific binding rate as well as the maximum possible 1Dd length seem to be directly proportional to the square root of the probability (p R) of finding a nonspecific binding site to be free from dynamic roadblocks. Here p R seems to be a function of the number of nsbs available per DNA binding protein (ϕ) inside the living cell. It seems that p R  >  0.8 when ϕ  >  10 which is true for the Escherichia coli cell system.

TALE-PvuII fusion proteins--novel tools for gene targeting.

PubMed

Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

2013-01-01

Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity.

Trimeric association of Hox and TALE homeodomain proteins mediates Hoxb2 hindbrain enhancer activity.

PubMed

Jacobs, Y; Schnabel, C A; Cleary, M L

1999-07-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element.

Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.

PubMed

Odell, M; Shuman, S

1999-05-14

The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.

Footprinting reveals that nogalamycin and actinomycin shuffle between DNA binding sites.

PubMed Central

Fox, K R; Waring, M J

1986-01-01

The hypothesis that sequence-selective DNA-binding antibiotics locate their preferred binding sites by a process involving migration from nonspecific sites has been tested by footprinting with DNAase I. Footprinting patterns on the tyrT DNA fragment produced by nogalamycin and actinomycin change with time after mixing the antibiotic with the DNA. Sites of protection as well as enhanced cleavage are seen to develop in a fashion which is both temperature and concentration-dependent. At certain sites cutting is transiently enhanced, then blocked. Limited evidence for slow reaction with echinomycin and mithramycin is presented, but the kinetics of footprinting with daunomycin and distamycin appear instantaneous. The feasibility of adducing direct evidence for shuffling by footprinting seems to be governed by slow dissociation of the antibiotic-DNA complex. It may also be dependent upon the mode of binding, be it intercalative or non-intercalative in character. Images PMID:2421246

DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

DOE PAGES

Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

2014-08-23

Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

DNA-bending properties of TF1.

PubMed

Schneider, G J; Sayre, M H; Geiduschek, E P

1991-10-05

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TF1 dimer binding to one of its preferred sites in (5-hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TF1 and E. coli IHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding "arm" of TF1 are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TF1 binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TF1 is proposed. Under the assumptions of this analysis, the reduced affinity of TF1 for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TF1-DNA interaction has also been extended by hydroxyl radical (.OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TF1 strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten base-pairs of the two TF1 binding sites quantitatively diminishes, but does not abolish, TF1 binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TF1 dimer, considerably deforming the DNA B-helix in the process.

Dynamics of bleomycin interaction with a strongly bound hairpin DNA substrate, and implications for cleavage of the bound DNA.

PubMed

Bozeman, Trevor C; Nanjunda, Rupesh; Tang, Chenhong; Liu, Yang; Segerman, Zachary J; Zaleski, Paul A; Wilson, W David; Hecht, Sidney M

2012-10-31

Recent studies involving DNAs bound strongly by bleomycins have documented that such DNAs are degraded by the antitumor antibiotic with characteristics different from those observed when studying the cleavage of randomly chosen DNAs in the presence of excess Fe·BLM. In the present study, surface plasmon resonance has been used to characterize the dynamics of BLM B(2) binding to a strongly bound hairpin DNA, to define the effects of Fe(3+), salt, and temperature on BLM-DNA interaction. One strong primary DNA binding site, and at least one much weaker site, were documented. In contrast, more than one strong cleavage site was found, an observation also made for two other hairpin DNAs. Evidence is presented for BLM equilibration between the stronger and weaker binding sites in a way that renders BLM unavailable to other, less strongly bound DNAs. Thus, enhanced binding to a given site does not necessarily result in increased DNA degradation at that site; i.e., for strongly bound DNAs, the facility of DNA cleavage must involve other parameters in addition to the intrinsic rate of C-4' H atom abstraction from DNA sugars.

Unusual Characteristics of the DNA Binding Domain of Epigenetic Regulatory Protein MeCP2 Determine Its Binding Specificity

PubMed Central

2015-01-01

The protein MeCP2 mediates epigenetic regulation by binding methyl-CpG (mCpG) sites on chromatin. MeCP2 consists of six domains of which one, the methyl binding domain (MBD), binds mCpG sites in duplex DNA. We show that solution conditions with physiological or greater salt concentrations or the presence of nonspecific competitor DNA is necessary for the MBD to discriminate mCpG from CpG with high specificity. The specificity for mCpG over CpG is >100-fold under these solution conditions. In contrast, the MBD does not discriminate hydroxymethyl-CpG from CpG. The MBD is unusual among site-specific DNA binding proteins in that (i) specificity is not conferred by the enhanced affinity for the specific site but rather by suppression of its affinity for generic DNA, (ii) its specific binding to mCpG is highly electrostatic, and (iii) it takes up as well as displaces monovalent cations upon DNA binding. The MBD displays an unusually high affinity for single-stranded DNA independent of modification or sequence. In addition, the MBD forms a discrete dimer on DNA via a noncooperative binding pathway. Because the affinity of the second monomer is 1 order of magnitude greater than that of nonspecific binding, the MBD dimer is a unique molecular complex. The significance of these results in the context of neuronal function and development and MeCP2-related developmental disorders such as Rett syndrome is discussed. PMID:24828757

Analysis of LexA binding sites and transcriptomics in response to genotoxic stress in Leptospira interrogans.

PubMed

Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A

2016-02-18

We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Influence of quasi-specific sites on kinetics of target DNA search by a sequence-specific DNA-binding protein.

PubMed

Kemme, Catherine A; Esadze, Alexandre; Iwahara, Junji

2015-11-10

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such "quasi-specific" sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1's association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins.

Influence of Quasi-Specific Sites on Kinetics of Target DNA Search by a Sequence-Specific DNA-Binding Protein

PubMed Central

2015-01-01

Functions of transcription factors require formation of specific complexes at particular sites in cis-regulatory elements of genes. However, chromosomal DNA contains numerous sites that are similar to the target sequences recognized by transcription factors. The influence of such “quasi-specific” sites on functions of the transcription factors is not well understood at present by experimental means. In this work, using fluorescence methods, we have investigated the influence of quasi-specific DNA sites on the efficiency of target location by the zinc finger DNA-binding domain of the inducible transcription factor Egr-1, which recognizes a 9 bp sequence. By stopped-flow assays, we measured the kinetics of Egr-1’s association with a target site on 143 bp DNA in the presence of various competitor DNAs, including nonspecific and quasi-specific sites. The presence of quasi-specific sites on competitor DNA significantly decelerated the target association by the Egr-1 protein. The impact of the quasi-specific sites depended strongly on their affinity, their concentration, and the degree of their binding to the protein. To quantitatively describe the kinetic impact of the quasi-specific sites, we derived an analytical form of the apparent kinetic rate constant for the target association and used it for fitting to the experimental data. Our kinetic data with calf thymus DNA as a competitor suggested that there are millions of high-affinity quasi-specific sites for Egr-1 among the 3 billion bp of genomic DNA. This study quantitatively demonstrates that naturally abundant quasi-specific sites on DNA can considerably impede the target search processes of sequence-specific DNA-binding proteins. PMID:26502071

Thermodynamic characterization of binding Oxytricha nova single strand telomere DNA with the alpha protein N-terminal domain.

PubMed

Buczek, Pawel; Horvath, Martin P

2006-06-23

The Oxytricha nova telemere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (DeltaH), entropy (DeltaS), and dissociation constant (K(D-DNA)) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T(2)G(4)), d(T(4)G(4)), d(G(3)T(4)G(4)), and d(G(4)T(4)G(4)) each formed monovalent protein complexes. In the case of d(T(4)G(4)T(4)G(4)), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity "A site" has a dissociation constant, K(D-DNA(A)) = 13(+/-4) nM, while the low-affinity "B site" is characterized by K(D-DNA(B)) = 5600(+/-600) nM at 25 degrees C. Nucleotide substitution variants verified that the A site corresponds principally with the 3'-terminal portion of d(T(4)G(4)T(4)G(4)). The relative contributions of entropy (DeltaS) and enthalpy (DeltaH) for binding reactions were DNA length-dependent as was heat capacity (DeltaCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA-protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

Neisseria conserved protein DMP19 is a DNA mimic protein that prevents DNA binding to a hypothetical nitrogen-response transcription factor

PubMed Central

Wang, Hao-Ching; Ko, Tzu-Ping; Wu, Mao-Lun; Ku, Shan-Chi; Wu, Hsing-Ju; Wang, Andrew H.-J.

2012-01-01

DNA mimic proteins occupy the DNA binding sites of DNA-binding proteins, and prevent these sites from being accessed by DNA. We show here that the Neisseria conserved hypothetical protein DMP19 acts as a DNA mimic. The crystal structure of DMP19 shows a dsDNA-like negative charge distribution on the surface, suggesting that this protein should be added to the short list of known DNA mimic proteins. The crystal structure of another related protein, NHTF (Neisseria hypothetical transcription factor), provides evidence that it is a member of the xenobiotic-response element (XRE) family of transcriptional factors. NHTF binds to a palindromic DNA sequence containing a 5′-TGTNAN11TNACA-3′ recognition box that controls the expression of an NHTF-related operon in which the conserved nitrogen-response protein [i.e. (Protein-PII) uridylyltransferase] is encoded. The complementary surface charges between DMP19 and NHTF suggest specific charge–charge interaction. In a DNA-binding assay, we found that DMP19 can prevent NHTF from binding to its DNA-binding sites. Finally, we used an in situ gene regulation assay to provide evidence that NHTF is a repressor of its down-stream genes and that DMP19 can neutralize this effect. We therefore conclude that the interaction of DMP19 and NHTF provides a novel gene regulation mechanism in Neisseria spps. PMID:22373915

HMG I(Y) interferes with the DNA binding of NF-AT factors and the induction of the interleukin 4 promoter in T cells

PubMed Central

Klein-Hessling, Stefan; Schneider, Günter; Heinfling, Annette; Chuvpilo, Sergei; Serfling, Edgar

1996-01-01

HMG I(Y) proteins bind to double-stranded A+T oligonucleotides longer than three base pairs. Such motifs form part of numerous NF-AT-binding sites of lymphokine promoters, including the interleukin 4 (IL-4) promoter. NF-AT factors share short homologous peptide sequences in their DNA-binding domain with NF-κB factors and bind to certain NF-κB sites. It has been shown that HMG I(Y) proteins enhance NF-κB binding to the interferon β promoter and virus-mediated interferon β promoter induction. We show that HMG I(Y) proteins exert an opposite effect on the DNA binding of NF-AT factors and the induction of the IL-4 promoter in T lymphocytes. Introduction of mutations into a high-affinity HMG I(Y)-binding site of the IL-4 promoter, which decreased HMG I(Y)-binding to a NF-AT-binding sequence, the Pu-bB (or P) site, distinctly increased the induction of the IL-4 promoter in Jurkat T leukemia cells. High concentrations of HMG I(Y) proteins are able to displace NF-ATp from its binding to the Pu-bB site. High HMG I(Y) concentrations are typical for Jurkat cells and peripheral blood T lymphocytes, whereas El4 T lymphoma cells and certain T helper type 2 cell clones contain relatively low HMG I(Y) concentrations. Our results indicate that HMG I(Y) proteins do not cooperate, but instead compete with NF-AT factors for the binding to DNA even though NF-AT factors share some DNA-binding properties with NF-kB factors. This competition between HMG I(Y) and NF-AT proteins for DNA binding might be due to common contacts with minor groove nucleotides of DNA and may be one mechanism contributing to the selective IL-4 expression in certain T lymphocyte populations, such as T helper type 2 cells. PMID:8986808

Two-step interrogation then recognition of DNA binding site by Integration Host Factor: an architectural DNA-bending protein.

PubMed

Velmurugu, Yogambigai; Vivas, Paula; Connolly, Mitchell; Kuznetsov, Serguei V; Rice, Phoebe A; Ansari, Anjum

2018-02-28

The dynamics and mechanism of how site-specific DNA-bending proteins initially interrogate potential binding sites prior to recognition have remained elusive for most systems. Here we present these dynamics for Integration Host factor (IHF), a nucleoid-associated architectural protein, using a μs-resolved T-jump approach. Our studies show two distinct DNA-bending steps during site recognition by IHF. While the faster (∼100 μs) step is unaffected by changes in DNA or protein sequence that alter affinity by >100-fold, the slower (1-10 ms) step is accelerated ∼5-fold when mismatches are introduced at DNA sites that are sharply kinked in the specific complex. The amplitudes of the fast phase increase when the specific complex is destabilized and decrease with increasing [salt], which increases specificity. Taken together, these results indicate that the fast phase is non-specific DNA bending while the slow phase, which responds only to changes in DNA flexibility at the kink sites, is specific DNA kinking during site recognition. Notably, the timescales for the fast phase overlap with one-dimensional diffusion times measured for several proteins on DNA, suggesting that these dynamics reflect partial DNA bending during interrogation of potential binding sites by IHF as it scans DNA.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

PubMed Central

Arthur, A K; Höss, A; Fanning, E

1988-01-01

The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

The DnaK Chaperone Uses Different Mechanisms To Promote and Inhibit Replication of Vibrio cholerae Chromosome 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jha, Jyoti K.; Li, Mi; Ghirlando, Rodolfo

Replication of Vibrio cholerae chromosome 2 (Chr2) depends on molecular chaperone DnaK to facilitate binding of the initiator (RctB) to the replication origin. The binding occurs at two kinds of site, 12-mers and 39-mers, which promote and inhibit replication, respectively. Here we show that DnaK employs different mechanisms to enhance the two kinds of binding. We found that mutations inrctBthat reduce DnaK binding also reduce 12-mer binding and initiation. The initiation defect is suppressed by second-site mutations that increase 12-mer binding only marginally. Instead, they reduce replication inhibitory mechanisms: RctB dimerization and 39-mer binding. One suppressing change was in amore » dimerization domain which is folded similarly to the initiator of an iteron plasmid—the presumed progenitor of Chr2. In plasmids, DnaK promotes initiation by reducing dimerization. A different mutation was in the 39-mer binding domain of RctB and inactivated it, indicating an alternative suppression mechanism. Paradoxically, although DnaK increases 39-mer binding, the increase was also achieved by inactivating the DnaK binding site of RctB. This result suggests that the site inhibits the 39-mer binding domain (via autoinhibition) when prevented from binding DnaK. Taken together, our results reveal an important feature of the transition from plasmid to chromosome: the Chr2 initiator retains the plasmid-like dimerization domain and its control by chaperones but uses the chaperones in an unprecedented way to control the inhibitory 39-mer binding. IMPORTANCE The capacity of proteins to undergo remodeling provides opportunities to control their function. However, remodeling remains a poorly understood aspect of the structure-function paradigm due to its dynamic nature. Here we have studied remodeling of the initiator of replication ofVibrio choleraeChr2 by the molecular chaperone, DnaK. We show that DnaK binds to a site on the Chr2 initiator (RctB) that promotes initiation by reducing the initiator’s propensity to dimerize. Dimerization of the initiator of the putative plasmid progenitor of Chr2 is also reduced by DnaK, which promotes initiation. Paradoxically, the DnaK binding also promotes replication inhibition by reducing an autoinhibitory activity of RctB. In the plasmid-to-chromosome transition, it appears that the initiator has acquired an autoinhibitory activity and along with it a new chaperone activity that apparently helps to control replication inhibition independently of replication promotion.« less

TALE-PvuII Fusion Proteins – Novel Tools for Gene Targeting

PubMed Central

Yanik, Mert; Alzubi, Jamal; Lahaye, Thomas; Cathomen, Toni; Pingoud, Alfred; Wende, Wolfgang

2013-01-01

Zinc finger nucleases (ZFNs) consist of zinc fingers as DNA-binding module and the non-specific DNA-cleavage domain of the restriction endonuclease FokI as DNA-cleavage module. This architecture is also used by TALE nucleases (TALENs), in which the DNA-binding modules of the ZFNs have been replaced by DNA-binding domains based on transcription activator like effector (TALE) proteins. Both TALENs and ZFNs are programmable nucleases which rely on the dimerization of FokI to induce double-strand DNA cleavage at the target site after recognition of the target DNA by the respective DNA-binding module. TALENs seem to have an advantage over ZFNs, as the assembly of TALE proteins is easier than that of ZFNs. Here, we present evidence that variant TALENs can be produced by replacing the catalytic domain of FokI with the restriction endonuclease PvuII. These fusion proteins recognize only the composite recognition site consisting of the target site of the TALE protein and the PvuII recognition sequence (addressed site), but not isolated TALE or PvuII recognition sites (unaddressed sites), even at high excess of protein over DNA and long incubation times. In vitro, their preference for an addressed over an unaddressed site is > 34,000-fold. Moreover, TALE-PvuII fusion proteins are active in cellula with minimal cytotoxicity. PMID:24349308

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

The large terminase DNA packaging motor grips DNA with its ATPase domain for cleavage by the flexible nuclease domain

PubMed Central

Hilbert, Brendan J.; Hayes, Janelle A.; Stone, Nicholas P.; Xu, Rui-Gang

2017-01-01

Abstract Many viruses use a powerful terminase motor to pump their genome inside an empty procapsid shell during virus maturation. The large terminase (TerL) protein contains both enzymatic activities necessary for packaging in such viruses: the adenosine triphosphatase (ATPase) that powers DNA translocation and an endonuclease that cleaves the concatemeric genome at both initiation and completion of genome packaging. However, how TerL binds DNA during translocation and cleavage remains mysterious. Here we investigate DNA binding and cleavage using TerL from the thermophilic phage P74-26. We report the structure of the P74-26 TerL nuclease domain, which allows us to model DNA binding in the nuclease active site. We screened a large panel of TerL variants for defects in binding and DNA cleavage, revealing that the ATPase domain is the primary site for DNA binding, and is required for nuclease activity. The nuclease domain is dispensable for DNA binding but residues lining the active site guide DNA for cleavage. Kinetic analysis of DNA cleavage suggests flexible tethering of the nuclease domains during DNA cleavage. We propose that interactions with the procapsid during DNA translocation conformationally restrict the nuclease domain, inhibiting cleavage; TerL release from the capsid upon completion of packaging unlocks the nuclease domains to cleave DNA. PMID:28082398

Determinants of affinity and mode of DNA binding at the carboxy terminus of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1.

PubMed

Andera, L; Geiduschek, E P

1994-03-01

The role of the carboxy-terminal amino acids of the bacteriophage SPO1-encoded type II DNA-binding protein, TF1, in DNA binding was analyzed. Chain-terminating mutations truncating the normally 99-amino-acid TF1 at amino acids 96, 97, and 98 were constructed, as were missense mutations substituting cysteine, arginine, and serine for phenylalanine at amino acid 97 and tryptophan for lysine at amino acid 99. The binding of the resulting proteins to a synthetic 44-bp binding site in 5-(hydroxymethyl)uracil DNA, to binding sites in larger SPO1 [5-(hydroxymethyl)uracil-containing] DNA fragments, and to thymine-containing homologous DNA was analyzed by gel retardation and also by DNase I and hydroxy radical footprinting. We conclude that the C tail up to and including phenylalanine at amino acid 97 is essential for DNA binding and that the two C-terminal amino acids, 98 and 99, are involved in protein-protein interactions between TF1 dimers bound to DNA.

Interaction of Zn(II)bleomycin-A2 and Zn(II)peplomycin with a DNA hairpin containing the 5'-GT-3' binding site in comparison with the 5'-GC-3' binding site studied by NMR spectroscopy.

PubMed

Follett, Shelby E; Ingersoll, Azure D; Murray, Sally A; Reilly, Teresa M; Lehmann, Teresa E

2017-10-01

Bleomycins are a group of glycopeptide antibiotics synthesized by Streptomyces verticillus that are widely used for the treatment of various neoplastic diseases. These antibiotics have the ability to chelate a metal center, mainly Fe(II), and cause site-specific DNA cleavage. Bleomycins are differentiated by their C-terminal regions. Although this antibiotic family is a successful course of treatment for some types of cancers, it is known to cause pulmonary fibrosis. Previous studies have identified that bleomycin-related pulmonary toxicity is linked to the C-terminal region of these drugs. This region has been shown to closely interact with DNA. We examined the binding of Zn(II)peplomycin and Zn(II)bleomycin-A 2 to a DNA hairpin of sequence 5'-CCAGTATTTTTACTGG-3', containing the binding site 5'-GT-3', and compared the results with those obtained from our studies of the same MBLMs bound to a DNA hairpin containing the binding site 5'-GC-3'. We provide evidence that the DNA base sequence has a strong impact in the final structure of the drug-target complex.

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1

PubMed Central

Malina, Jaroslav; Scott, Peter; Brabec, Viktor

2015-01-01

Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617

Interference between Triplex and Protein Binding to Distal Sites on Supercoiled DNA.

PubMed

Noy, Agnes; Maxwell, Anthony; Harris, Sarah A

2017-02-07

We have explored the interdependence of the binding of a DNA triplex and a repressor protein to distal recognition sites on supercoiled DNA minicircles using MD simulations. We observe that the interaction between the two ligands through their influence on their DNA template is determined by a subtle interplay of DNA mechanics and electrostatics, that the changes in flexibility induced by ligand binding play an important role and that supercoiling can instigate additional ligand-DNA contacts that would not be possible in simple linear DNA sequences. Copyright © 2017. Published by Elsevier Inc.

The key DNA-binding residues in the C-terminal domain of Mycobacterium tuberculosis DNA gyrase A subunit (GyrA)

PubMed Central

Huang, You-Yi; Deng, Jiao-Yu; Gu, Jing; Zhang, Zhi-Ping; Maxwell, Anthony; Bi, Li-Jun; Chen, Yuan-Yuan; Zhou, Ya-Feng; Yu, Zi-Niu; Zhang, Xian-En

2006-01-01

As only the type II topoisomerase is capable of introducing negative supercoiling, DNA gyrase is involved in crucial cellular processes. Although the other domains of DNA gyrase are better understood, the mechanism of DNA binding by the C-terminal domain of the DNA gyrase A subunit (GyrA-CTD) is less clear. Here, we investigated the DNA-binding sites in the GyrA-CTD of Mycobacterium tuberculosis gyrase through site-directed mutagenesis. The results show that Y577, R691 and R745 are among the key DNA-binding residues in M.tuberculosis GyrA-CTD, and that the third blade of the GyrA-CTD is the main DNA-binding region in M.tuberculosis DNA gyrase. The substitutions of Y577A, D669A, R691A, R745A and G729W led to the loss of supercoiling and relaxation activities, although they had a little effect on the drug-dependent DNA cleavage and decatenation activities, and had no effect on the ATPase activity. Taken together, these results showed that the GyrA-CTD is essential to DNA gyrase of M.tuberculosis, and promote the idea that the M.tuberculosis GyrA-CTD is a new potential target for drug design. It is the first time that the DNA-binding sites in GyrA-CTD have been identified. PMID:17038336

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

PubMed Central

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-01-01

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

Structures of minute virus of mice replication initiator protein N-terminal domain: Insights into DNA nicking and origin binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tewary, Sunil K.; Liang, Lingfei; Lin, Zihan

Members of the Parvoviridae family all encode a non-structural protein 1 (NS1) that directs replication of single-stranded viral DNA, packages viral DNA into capsid, and serves as a potent transcriptional activator. Here we report the X-ray structure of the minute virus of mice (MVM) NS1 N-terminal domain at 1.45 Å resolution, showing that sites for dsDNA binding, ssDNA binding and cleavage, nuclear localization, and other functions are integrated on a canonical fold of the histidine-hydrophobic-histidine superfamily of nucleases, including elements specific for this Protoparvovirus but distinct from its Bocaparvovirus or Dependoparvovirus orthologs. High resolution structural analysis reveals a nickase activemore » site with an architecture that allows highly versatile metal ligand binding. The structures support a unified mechanism of replication origin recognition for homotelomeric and heterotelomeric parvoviruses, mediated by a basic-residue-rich hairpin and an adjacent helix in the initiator proteins and by tandem tetranucleotide motifs in the replication origins. - Highlights: • The structure of a parvovirus replication initiator protein has been determined; • The structure sheds light on mechanisms of ssDNA binding and cleavage; • The nickase active site is preconfigured for versatile metal ligand binding; • The binding site for the double-stranded replication origin DNA is identified; • A single domain integrates multiple functions in virus replication.« less

Trimeric Association of Hox and TALE Homeodomain Proteins Mediates Hoxb2 Hindbrain Enhancer Activity

PubMed Central

Jacobs, Yakop; Schnabel, Catherine A.; Cleary, Michael L.

1999-01-01

Pbx/exd proteins modulate the DNA binding affinities and specificities of Hox proteins and contribute to the execution of Hox-dependent developmental programs in arthropods and vertebrates. Pbx proteins also stably heterodimerize and bind DNA with Meis and Pknox1-Prep1, additional members of the TALE (three-amino-acid loop extension) superclass of homeodomain proteins that function on common genetic pathways with a subset of Hox proteins. In this study, we demonstrated that Pbx and Meis bind DNA as heterotrimeric complexes with Hoxb1 on a genetically defined Hoxb2 enhancer, r4, that mediates the cross-regulatory transcriptional effects of Hoxb1 in vivo. The DNA binding specificity of the heterotrimeric complex for r4 is mediated by a Pbx-Hox site in conjunction with a distal Meis site, which we showed to be required for ternary complex formation and Meis-enhanced transcription. Formation of heterotrimeric complexes in which all three homeodomains bind their cognate DNA sites is topologically facilitated by the ability of Pbx and Meis to interact through their amino termini and bind DNA without stringent half-site orientation and spacing requirements. Furthermore, Meis site mutation in the Hoxb2 enhancer phenocopies Pbx-Hox site mutation to abrogate enhancer-directed expression of a reporter transgene in the murine embryonic hindbrain, demonstrating that DNA binding by all three proteins is required for trimer function in vivo. Our data provide in vitro and in vivo evidence for the combinatorial regulation of Hox and TALE protein functions that are mediated, in part, by their interdependent DNA binding activities as ternary complexes. As a consequence, Hoxb1 employs Pbx and Meis-related proteins, as a pair of essential cofactors in a higher-order molecular complex, to mediate its transcriptional effects on an endogenous Hox response element. PMID:10373562

How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

PubMed Central

2017-01-01

Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

Sliding of proteins non-specifically bound to DNA: Brownian dynamics studies with coarse-grained protein and DNA models.

PubMed

Ando, Tadashi; Skolnick, Jeffrey

2014-12-01

DNA binding proteins efficiently search for their cognitive sites on long genomic DNA by combining 3D diffusion and 1D diffusion (sliding) along the DNA. Recent experimental results and theoretical analyses revealed that the proteins show a rotation-coupled sliding along DNA helical pitch. Here, we performed Brownian dynamics simulations using newly developed coarse-grained protein and DNA models for evaluating how hydrodynamic interactions between the protein and DNA molecules, binding affinity of the protein to DNA, and DNA fluctuations affect the one dimensional diffusion of the protein on the DNA. Our results indicate that intermolecular hydrodynamic interactions reduce 1D diffusivity by 30%. On the other hand, structural fluctuations of DNA give rise to steric collisions between the CG-proteins and DNA, resulting in faster 1D sliding of the protein. Proteins with low binding affinities consistent with experimental estimates of non-specific DNA binding show hopping along the CG-DNA. This hopping significantly increases sliding speed. These simulation studies provide additional insights into the mechanism of how DNA binding proteins find their target sites on the genome.

DNA-Templated Introduction of an Aldehyde Handle in Proteins.

PubMed

Kodal, Anne Louise B; Rosen, Christian B; Mortensen, Michael R; Tørring, Thomas; Gothelf, Kurt V

2016-07-15

Many medical and biotechnological applications rely on protein labeling, but a key challenge is the production of homogeneous and site-specific conjugates. This can rarely be achieved by simple residue-specific random labeling, but generally requires genetic engineering. Using site-selective DNA-templated reductive amination, we created DNA-protein conjugates with control over labeling stoichiometry and without genetic engineering. A guiding DNA strand with a metal-binding functionality facilitates site-selectivity by directing the coupling of a second reactive DNA strand in the vicinity of a protein metal-binding site. We demonstrate DNA-templated reductive amination for His6 -tagged proteins and metal-binding proteins, including IgG1 antibodies. We also used a cleavable linker between the DNA and the protein to remove the DNA and introduce a single aldehyde on the protein. This functions as a handle for further modifications with desired labels. In addition to directing the aldehyde positioning, the DNA provides a straightforward route for purification between reaction steps. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Twin hydroxymethyluracil-A base pair steps define the binding site for the DNA-binding protein TF1.

PubMed

Grove, A; Figueiredo, M L; Galeone, A; Mayol, L; Geiduschek, E P

1997-05-16

The DNA-bending protein TF1 is the Bacillus subtilis bacteriophage SPO1-encoded homolog of the bacterial HU proteins and the Escherichia coli integration host factor. We recently proposed that TF1, which binds with high affinity (Kd was approximately 3 nM) to preferred sites within the hydroxymethyluracil (hmU)-containing phage genome, identifies its binding sites based on sequence-dependent DNA flexibility. Here, we show that two hmU-A base pair steps coinciding with two previously proposed sites of DNA distortion are critical for complex formation. The affinity of TF1 is reduced 10-fold when both of these hmU-A base pair steps are replaced with A-hmU, G-C, or C-G steps; only modest changes in affinity result when substitutions are made at other base pairs of the TF1 binding site. Replacement of all hmU residues with thymine decreases the affinity of TF1 greatly; remarkably, the high affinity is restored when the two hmU-A base pair steps corresponding to previously suggested sites of distortion are reintroduced into otherwise T-containing DNA. T-DNA constructs with 3-base bulges spaced apart by 9 base pairs of duplex also generate nM affinity of TF1. We suggest that twin hmU-A base pair steps located at the proposed sites of distortion are key to target site selection by TF1 and that recognition is based largely, if not entirely, on sequence-dependent DNA flexibility.

Thermodynamic and structural insights into CSL-DNA complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedmann, David R.; Kovall, Rhett A.

The Notch pathway is an intercellular signaling mechanism that plays important roles in cell fates decisions throughout the developing and adult organism. Extracellular complexation of Notch receptors with ligands ultimately results in changes in gene expression, which is regulated by the nuclear effector of the pathway, CSL (C-promoter binding factor 1 (CBF-1), suppressor of hairless (Su(H)), lin-12 and glp-1 (Lag-1)). CSL is a DNA binding protein that is involved in both repression and activation of transcription from genes that are responsive to Notch signaling. One well-characterized Notch target gene is hairy and enhancer of split-1 (HES-1), which is regulated bymore » a promoter element consisting of two CSL binding sites oriented in a head-to-head arrangement. Although previous studies have identified in vivo and consensus binding sites for CSL, and crystal structures of these complexes have been determined, to date, a quantitative description of the energetics that underlie CSL-DNA binding is unknown. Here, we provide a thermodynamic and structural analysis of the interaction between CSL and the two individual sites that comprise the HES-1 promoter element. Our comprehensive studies that analyze binding as a function of temperature, salt, and pH reveal moderate, but distinct, differences in the affinities of CSL for the two HES-1 binding sites. Similarly, our structural results indicate that overall CSL binds both DNA sites in a similar manner; however, minor changes are observed in both the conformation of CSL and DNA. Taken together, our results provide a quantitative and biophysical basis for understanding how CSL interacts with DNA sites in vivo.« less

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

High precision and high yield fabrication of dense nanoparticle arrays onto DNA origami at statistically independent binding sites

NASA Astrophysics Data System (ADS)

Takabayashi, Sadao; Klein, William P.; Onodera, Craig; Rapp, Blake; Flores-Estrada, Juan; Lindau, Elias; Snowball, Lejmarc; Sam, Joseph T.; Padilla, Jennifer E.; Lee, Jeunghoon; Knowlton, William B.; Graugnard, Elton; Yurke, Bernard; Kuang, Wan; Hughes, William L.

2014-10-01

High precision, high yield, and high density self-assembly of nanoparticles into arrays is essential for nanophotonics. Spatial deviations as small as a few nanometers can alter the properties of near-field coupled optical nanostructures. Several studies have reported assemblies of few nanoparticle structures with controlled spacing using DNA nanostructures with variable yield. Here, we report multi-tether design strategies and attachment yields for homo- and hetero-nanoparticle arrays templated by DNA origami nanotubes. Nanoparticle attachment yield via DNA hybridization is comparable with streptavidin-biotin binding. Independent of the number of binding sites, >97% site-occupation was achieved with four tethers and 99.2% site-occupation is theoretically possible with five tethers. The interparticle distance was within 2 nm of all design specifications and the nanoparticle spatial deviations decreased with interparticle spacing. Modified geometric, binomial, and trinomial distributions indicate that site-bridging, steric hindrance, and electrostatic repulsion were not dominant barriers to self-assembly and both tethers and binding sites were statistically independent at high particle densities.High precision, high yield, and high density self-assembly of nanoparticles into arrays is essential for nanophotonics. Spatial deviations as small as a few nanometers can alter the properties of near-field coupled optical nanostructures. Several studies have reported assemblies of few nanoparticle structures with controlled spacing using DNA nanostructures with variable yield. Here, we report multi-tether design strategies and attachment yields for homo- and hetero-nanoparticle arrays templated by DNA origami nanotubes. Nanoparticle attachment yield via DNA hybridization is comparable with streptavidin-biotin binding. Independent of the number of binding sites, >97% site-occupation was achieved with four tethers and 99.2% site-occupation is theoretically possible with five tethers. The interparticle distance was within 2 nm of all design specifications and the nanoparticle spatial deviations decreased with interparticle spacing. Modified geometric, binomial, and trinomial distributions indicate that site-bridging, steric hindrance, and electrostatic repulsion were not dominant barriers to self-assembly and both tethers and binding sites were statistically independent at high particle densities. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr03069a

Identification of Nucleic Acid Binding Sites on Translin-Associated Factor X (TRAX) Protein

PubMed Central

Gupta, Gagan Deep; Kumar, Vinay

2012-01-01

Translin and TRAX proteins play roles in very important cellular processes such as DNA recombination, spatial and temporal expression of mRNA, and in siRNA processing. Translin forms a homomeric nucleic acid binding complex and binds to ssDNA and RNA. However, a mutant translin construct that forms homomeric complex lacking nucleic acid binding activity is able to form fully active heteromeric translin-TRAX complex when co-expressed with TRAX. A substantial progress has been made in identifying translin sites that mediate its binding activity, while TRAX was thought not to bind DNA or RNA on its own. We here for the first time demonstrate nucleic acid binding to TRAX by crosslinking radiolabeled ssDNA to heteromeric translin-TRAX complex using UV-laser. The TRAX and translin, photochemically crosslinked with ssDNA, were individually detected on SDS-PAGE. We mutated two motifs in TRAX and translin, designated B2 and B3, to help define the nucleic acid binding sites in the TRAX sequence. The most pronounced effect was observed in the mutants of B3 motif that impaired nucleic acid binding activity of the heteromeric complexes. We suggest that both translin and TRAX are binding competent and contribute to the nucleic acid binding activity. PMID:22427937

Structural Analysis of HMGD-DNA Complexes Reveal Influence of Intercalation on Sequence Selectivity and DNA Bending

PubMed Central

Churchill, Mair E.A.; Klass, Janet; Zoetewey, David L.

2010-01-01

The ubiquitous eukaryotic High-Mobility-Group-Box (HMGB) chromosomal proteins promote many chromatin-mediated cellular activities through their non-sequence-specific binding and bending of DNA. Minor groove DNA binding by the HMG box results in substantial DNA bending toward the major groove owing to electrostatic interactions, shape complementarity and DNA intercalation that occurs at two sites. Here, the structures of the complexes formed with DNA by a partially DNA intercalation-deficient mutant of Drosophila melanogaster HMGD have been determined by X-ray crystallography at a resolution of 2.85 Å. The six proteins and fifty base pairs of DNA in the crystal structure revealed a variety of bound conformations. All of the proteins bound in the minor groove, bridging DNA molecules, presumably because these DNA regions are easily deformed. The loss of the primary site of DNA intercalation decreased overall DNA bending and shape complementarity. However, DNA bending at the secondary site of intercalation was retained and most protein-DNA contacts were preserved. The mode of binding resembles the HMGB1-boxA-cisplatin-DNA complex, which also lacks a primary intercalating residue. This study provides new insights into the binding mechanisms used by HMG boxes to recognize varied DNA structures and sequences as well as modulate DNA structure and DNA bending. PMID:20800069

Non-B-Form DNA Is Enriched at Centromeres

PubMed Central

Henikoff, Steven

2018-01-01

Abstract Animal and plant centromeres are embedded in repetitive “satellite” DNA, but are thought to be epigenetically specified. To define genetic characteristics of centromeres, we surveyed satellite DNA from diverse eukaryotes and identified variation in <10-bp dyad symmetries predicted to adopt non-B-form conformations. Organisms lacking centromeric dyad symmetries had binding sites for sequence-specific DNA-binding proteins with DNA-bending activity. For example, human and mouse centromeres are depleted for dyad symmetries, but are enriched for non-B-form DNA and are associated with binding sites for the conserved DNA-binding protein CENP-B, which is required for artificial centromere function but is paradoxically nonessential. We also detected dyad symmetries and predicted non-B-form DNA structures at neocentromeres, which form at ectopic loci. We propose that centromeres form at non-B-form DNA because of dyad symmetries or are strengthened by sequence-specific DNA binding proteins. This may resolve the CENP-B paradox and provide a general basis for centromere specification. PMID:29365169

Electrostatic control of DNA intersegmental translocation by the ETS transcription factor ETV6.

PubMed

Vo, Tam; Wang, Shuo; Poon, Gregory M K; Wilson, W David

2017-08-11

To find their DNA target sites in complex solution environments containing excess heterogeneous DNA, sequence-specific DNA-binding proteins execute various translocation mechanisms known collectively as facilitated diffusion. For proteins harboring a single DNA contact surface, long-range translocation occurs by jumping between widely spaced DNA segments. We have configured biosensor-based surface plasmon resonance to directly measure the affinity and kinetics of this intersegmental jumping by the ETS-family transcription factor ETS variant 6 (ETV6). To isolate intersegmental target binding in a functionally defined manner, we pre-equilibrated ETV6 with excess salmon sperm DNA, a heterogeneous polymer, before exposing the nonspecifically bound protein to immobilized oligomeric DNA harboring a high-affinity ETV6 site. In this way, the mechanism of ETV6-target association could be toggled electrostatically through varying NaCl concentration in the bulk solution. Direct measurements of association and dissociation kinetics of the site-specific complex indicated that 1) freely diffusive binding by ETV6 proceeds through a nonspecific-like intermediate, 2) intersegmental jumping is rate-limited by dissociation from the nonspecific polymer, and 3) dissociation of the specific complex is independent of the history of complex formation. These results show that target searches by proteins with an ETS domain, such as ETV6, whose single DNA-binding domain cannot contact both source and destination sites simultaneously, are nonetheless strongly modulated by intersegmental jumping in heterogeneous site environments. Our findings establish biosensors as a general technique for directly and specifically measuring target site search by DNA-binding proteins via intersegmental translocation. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-08-01

The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

Shape-selective recognition of DNA abasic sites by metallohelices: inhibition of human AP endonuclease 1.

PubMed

Malina, Jaroslav; Scott, Peter; Brabec, Viktor

2015-06-23

Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

PubMed

Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

2016-11-02

Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

PubMed Central

Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

2011-01-01

Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

Discrete persistent-chain model for protein binding on DNA.

PubMed

Lam, Pui-Man; Zhen, Yi

2011-04-01

We describe and solve a discrete persistent-chain model of protein binding on DNA, involving an extra σ(i) at a site i of the DNA. This variable takes the value 1 or 0, depending on whether or not the site is occupied by a protein. In addition, if the site is occupied by a protein, there is an extra energy cost ɛ. For a small force, we obtain analytic expressions for the force-extension curve and the fraction of bound protein on the DNA. For higher forces, the model can be solved numerically to obtain force-extension curves and the average fraction of bound proteins as a function of applied force. Our model can be used to analyze experimental force-extension curves of protein binding on DNA, and hence deduce the number of bound proteins in the case of nonspecific binding. ©2011 American Physical Society

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Combining H/D exchange mass spectroscopy and computational docking reveals extended DNA-binding surface on uracil-DNA glycosylase

PubMed Central

Roberts, Victoria A.; Pique, Michael E.; Hsu, Simon; Li, Sheng; Slupphaug, Geir; Rambo, Robert P.; Jamison, Jonathan W.; Liu, Tong; Lee, Jun H.; Tainer, John A.; Ten Eyck, Lynn F.; Woods, Virgil L.

2012-01-01

X-ray crystallography provides excellent structural data on protein–DNA interfaces, but crystallographic complexes typically contain only small fragments of large DNA molecules. We present a new approach that can use longer DNA substrates and reveal new protein–DNA interactions even in extensively studied systems. Our approach combines rigid-body computational docking with hydrogen/deuterium exchange mass spectrometry (DXMS). DXMS identifies solvent-exposed protein surfaces; docking is used to create a 3-dimensional model of the protein–DNA interaction. We investigated the enzyme uracil-DNA glycosylase (UNG), which detects and cleaves uracil from DNA. UNG was incubated with a 30 bp DNA fragment containing a single uracil, giving the complex with the abasic DNA product. Compared with free UNG, the UNG–DNA complex showed increased solvent protection at the UNG active site and at two regions outside the active site: residues 210–220 and 251–264. Computational docking also identified these two DNA-binding surfaces, but neither shows DNA contact in UNG–DNA crystallographic structures. Our results can be explained by separation of the two DNA strands on one side of the active site. These non-sequence-specific DNA-binding surfaces may aid local uracil search, contribute to binding the abasic DNA product and help present the DNA product to APE-1, the next enzyme on the DNA-repair pathway. PMID:22492624

Role for a region of helically unstable DNA within the Epstein-Barr virus latent cycle origin of DNA replication oriP in origin function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polonskaya, Zhanna; Benham, Craig J.; Hearing, Janet

The minimal replicator of the Epstein-Barr virus (EBV) latent cycle origin of DNA replication oriP is composed of two binding sites for the Epstein-Barr virus nuclear antigen-1 (EBNA-1) and flanking inverted repeats that bind the telomere repeat binding factor TRF2. Although not required for minimal replicator activity, additional binding sites for EBNA-1 and TRF2 and one or more auxiliary elements located to the right of the EBNA-1/TRF2 sites are required for the efficient replication of oriP plasmids. Another region of oriP that is predicted to be destabilized by DNA supercoiling is shown here to be an important functional component ofmore » oriP. The ability of DNA fragments of unrelated sequence and possessing supercoiled-induced DNA duplex destabilized (SIDD) structures, but not fragments characterized by helically stable DNA, to substitute for this component of oriP demonstrates a role for the SIDD region in the initiation of oriP-plasmid DNA replication.« less

A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Xun; Guanga, Gerald P; Wan, Cheng

2012-11-13

MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G –5C –4 andmore » central C 0/G 0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.« less

Inhibition of HMGA2 binding to DNA by netropsin

PubMed Central

Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

2008-01-01

The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

PubMed Central

Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

2015-01-01

Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

Mitochondrial transcription terminator family members mTTF and mTerf5 have opposing roles in coordination of mtDNA synthesis.

PubMed

Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T

2013-01-01

All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis.

Mitochondrial Transcription Terminator Family Members mTTF and mTerf5 Have Opposing Roles in Coordination of mtDNA Synthesis

PubMed Central

Jõers, Priit; Lewis, Samantha C.; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J.; Jacobs, Howard T.

2013-01-01

All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965

Function and horizontal transfer of the small terminase subunit of the tailed bacteriophage Sf6 DNA packaging nanomotor

PubMed Central

Leavitt, Justin C.; Gilcrease, Eddie B.; Wilson, Kassandra; Casjens, Sherwood R.

2013-01-01

Bacteriophage Sf6 DNA packaging series initiate at many locations across a 2 kbp region. Our in vivo studies that show that Sf6 small terminase subunit (TerS) protein recognizes a specific packaging (pac) site near the center of this region, that this site lies within the portion of the Sf6 gene that encodes the DNA-binding domain of TerS protein, that this domain of the TerS protein is responsible for the imprecision in Sf6 packaging initiation, and that the DNA-binding domain of TerS must be covalently attached to the domain that interacts with the rest of the packaging motor. The TerS DNA-binding domain is self-contained in that it apparently does not interact closely with the rest of the motor and it binds to a recognition site that lies within the DNA that encodes the domain. This arrangement has allowed the horizontal exchange of terS genes among phages to be very successful. PMID:23562538

Two distinct modes of metal ion binding in the nuclease active site of a viral DNA-packaging terminase: insight into the two-metal-ion catalytic mechanism

PubMed Central

Zhao, Haiyan; Lin, Zihan; Lynn, Anna Y.; Varnado, Brittany; Beutler, John A.; Murelli, Ryan P.; Le Grice, Stuart F. J.; Tang, Liang

2015-01-01

Many dsDNA viruses encode DNA-packaging terminases, each containing a nuclease domain that resolves concatemeric DNA into genome-length units. Terminase nucleases resemble the RNase H-superfamily nucleotidyltransferases in folds, and share a two-metal-ion catalytic mechanism. Here we show that residue K428 of a bacteriophage terminase gp2 nuclease domain mediates binding of the metal cofactor Mg2+. A K428A mutation allows visualization, at high resolution, of a metal ion binding mode with a coupled-octahedral configuration at the active site, exhibiting an unusually short metal-metal distance of 2.42 Å. Such proximity of the two metal ions may play an essential role in catalysis by generating a highly positive electrostatic niche to enable formation of the negatively charged pentacovalent phosphate transition state, and provides the structural basis for distinguishing Mg2+ from Ca2+. Using a metal ion chelator β-thujaplicinol as a molecular probe, we observed a second mode of metal ion binding at the active site, mimicking the DNA binding state. Arrangement of the active site residues differs drastically from those in RNase H-like nucleases, suggesting a drifting of the active site configuration during evolution. The two distinct metal ion binding modes unveiled mechanistic details of the two-metal-ion catalysis at atomic resolution. PMID:26450964

Binding site size limit of the 2:1 pyrrole-imidazole polyamide-DNA motif.

PubMed Central

Kelly, J J; Baird, E E; Dervan, P B

1996-01-01

Polyamides containing N-methylimidazole (Im) and N-methylpyrrole (Py) amino acids can be combined in antiparallel side-by-side dimeric complexes for sequence-specific recognition in the minor groove of DNA. Six polyamides containing three to eight rings bind DNA sites 5-10 bp in length, respectively. Quantitative DNase I footprint titration experiments demonstrate that affinity maximizes and is similar at ring sizes of five, six, and seven. Sequence specificity decreases as the length of the polyamides increases beyond five rings. These results provide useful guidelines for the design of new polyamides that bind longer DNA sites with enhanced affinity and specificity. Images Fig. 4 PMID:8692930

DNA-binding mechanism of the Escherichia coli Ada O6-alkylguanine–DNA alkyltransferase

PubMed Central

Verdemato, Philip E.; Brannigan, James A.; Damblon, Christian; Zuccotto, Fabio; Moody, Peter C. E.; Lian, Lu-Yun

2000-01-01

The C-terminal domain of the Escherichia coli Ada protein (Ada-C) aids in the maintenance of genomic integrity by efficiently repairing pre-mutagenic O6-alkylguanine lesions in DNA. Structural and thermodynamic studies were carried out to obtain a model of the DNA-binding process. Nuclear magnetic resonance (NMR) studies map the DNA-binding site to helix 5, and a loop region (residues 151–160) which form the recognition helix and the ‘wing’ of a helix–turn–wing motif, respectively. The NMR data also suggest the absence of a large conformational change in the protein upon binding to DNA. Hence, an O6-methylguanine (O6meG) lesion would be inaccessible to active site nucleophile Cys146 if the modified base remained stacked within the DNA duplex. The experimentally determined DNA-binding face of Ada-C was used in combination with homology modelling, based on the catabolite activator protein, and the accepted base-flipping mechanism, to construct a model of how Ada-C binds to DNA in a productive manner. To complement the structural studies, thermodynamic data were obtained which demonstrate that binding to unmethylated DNA was entropically driven, whilst the demethylation reaction provoked an exothermic heat change. Methylation of Cys146 leads to a loss of structural integrity of the DNA-binding subdomain. PMID:11000262

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

DNA mimic proteins: functions, structures, and bioinformatic analysis.

PubMed

Wang, Hao-Ching; Ho, Chun-Han; Hsu, Kai-Cheng; Yang, Jinn-Moon; Wang, Andrew H-J

2014-05-13

DNA mimic proteins have DNA-like negative surface charge distributions, and they function by occupying the DNA binding sites of DNA binding proteins to prevent these sites from being accessed by DNA. DNA mimic proteins control the activities of a variety of DNA binding proteins and are involved in a wide range of cellular mechanisms such as chromatin assembly, DNA repair, transcription regulation, and gene recombination. However, the sequences and structures of DNA mimic proteins are diverse, making them difficult to predict by bioinformatic search. To date, only a few DNA mimic proteins have been reported. These DNA mimics were not found by searching for functional motifs in their sequences but were revealed only by structural analysis of their charge distribution. This review highlights the biological roles and structures of 16 reported DNA mimic proteins. We also discuss approaches that might be used to discover new DNA mimic proteins.

Hemi-methylated DNA regulates DNA methylation inheritance through allosteric activation of H3 ubiquitylation by UHRF1.

PubMed

Harrison, Joseph S; Cornett, Evan M; Goldfarb, Dennis; DaRosa, Paul A; Li, Zimeng M; Yan, Feng; Dickson, Bradley M; Guo, Angela H; Cantu, Daniel V; Kaustov, Lilia; Brown, Peter J; Arrowsmith, Cheryl H; Erie, Dorothy A; Major, Michael B; Klevit, Rachel E; Krajewski, Krzysztof; Kuhlman, Brian; Strahl, Brian D; Rothbart, Scott B

2016-09-06

The epigenetic inheritance of DNA methylation requires UHRF1, a histone- and DNA-binding RING E3 ubiquitin ligase that recruits DNMT1 to sites of newly replicated DNA through ubiquitylation of histone H3. UHRF1 binds DNA with selectivity towards hemi-methylated CpGs (HeDNA); however, the contribution of HeDNA sensing to UHRF1 function remains elusive. Here, we reveal that the interaction of UHRF1 with HeDNA is required for DNA methylation but is dispensable for chromatin interaction, which is governed by reciprocal positive cooperativity between the UHRF1 histone- and DNA-binding domains. HeDNA recognition activates UHRF1 ubiquitylation towards multiple lysines on the H3 tail adjacent to the UHRF1 histone-binding site. Collectively, our studies are the first demonstrations of a DNA-protein interaction and an epigenetic modification directly regulating E3 ubiquitin ligase activity. They also define an orchestrated epigenetic control mechanism involving modifications both to histones and DNA that facilitate UHRF1 chromatin targeting, H3 ubiquitylation, and DNA methylation inheritance.

Stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1.

PubMed

Schneider, G J; Geiduschek, E P

1990-06-25

The stoichiometry of DNA binding by the bacteriophage SP01-encoded type II DNA-binding protein TF1 has been determined. 3H-Labeled TF1 was allowed to bind to a 32P-labeled DNA fragment containing a TF1 binding site. Multiple TF1-DNA complexes were resolved from each other and from unbound DNA by native gel electrophoresis. DNA-protein complexes were cut from polyacrylamide gels, and the amounts of 3H and 32P contained in each slice were measured. A ratio of 1.12 +/- 0.06 TF1 dimer/DNA molecule was calculated for the fastest-migrating TF1-DNA complex. We conclude that TF1 has a DNA-binding unit of one dimer. More slowly migrating complexes are apparently formed by serial addition of single TF1 dimers.

High-resolution physical and functional mapping of the template adjacent DNA binding site in catalytically active telomerase.

PubMed

Romi, Erez; Baran, Nava; Gantman, Marina; Shmoish, Michael; Min, Bosun; Collins, Kathleen; Manor, Haim

2007-05-22

Telomerase is a cellular reverse transcriptase, which utilizes an integral RNA template to extend single-stranded telomeric DNA. We used site-specific photocrosslinking to map interactions between DNA primers and the catalytic protein subunit (tTERT) of Tetrahymena thermophila telomerase in functional enzyme complexes. Our assays reveal contact of the single-stranded DNA adjacent to the primer-template hybrid and tTERT residue W187 at the periphery of the N-terminal domain. This contact was detected in complexes with three different registers of template in the active site, suggesting that it is maintained throughout synthesis of a complete telomeric repeat. Substitution of nearby residue Q168, but not W187, alters the K(m) for primer elongation, implying that it plays a role in the DNA recognition. These findings are the first to directly demonstrate the physical location of TERT-DNA contacts in catalytically active telomerase and to identify amino acid determinants of DNA binding affinity. Our data also suggest a movement of the TERT active site relative to the template-adjacent single-stranded DNA binding site within a cycle of repeat synthesis.

Synthesis and binding properties of new selective ligands for the nucleobase opposite the AP site.

PubMed

Abe, Yukiko; Nakagawa, Osamu; Yamaguchi, Rie; Sasaki, Shigeki

2012-06-01

DNA is continuously damaged by endogenous and exogenous factors such as oxidative stress or DNA alkylating agents. These damaged nucleobases are removed by DNA N-glycosylase and form apurinic/apyrimidinic sites (AP sites) as intermediates in the base excision repair (BER) pathway. AP sites are also representative DNA damages formed by spontaneous hydrolysis. The AP sites block DNA polymerase and a mismatch nucleobase is inserted opposite the AP sites by polymerization to cause acute toxicities and mutations. Thus, AP site specific compounds have attracted much attention for therapeutic and diagnostic purposes. In this study, we have developed nucleobase-polyamine conjugates as the AP site binding ligand by expecting that the nucleobase part would play a role in the specific recognition of the nucleobase opposite the AP site by the Watson-Crick base pair formation and that the polyamine part should contribute to the access of the ligand to the AP site by a non-specific interaction to the DNA phosphate backbone. The nucleobase conjugated with 3,3'-diaminodipropylamine (A-ligand, G-ligand, C-ligand, T-ligand and U-ligand) showed a specific stabilization of the duplex containing the AP site depending on the complementary combination with the nucleobase opposite the AP site; that is A-ligand to T, G-ligand to C, C-ligand to G, T- and U-ligand to A. The thermodynamic binding parameters clearly indicated that the specific stabilization is due to specific binding of the ligands to the complementary AP site. These results have suggested that the complementary base pairs of the Watson-Crick type are formed at the AP site. Copyright © 2012 Elsevier Ltd. All rights reserved.

Competition for DNA binding sites using Promega DNA IQ™ paramagnetic beads.

PubMed

Frégeau, Chantal J; De Moors, Anick

2012-09-01

The Promega DNA IQ™ system is easily amenable to automation and has been an integral part of standard operating procedures for many forensic laboratories including those of the Royal Canadian Mounted Police (RCMP) since 2004. Due to some failure to extract DNA from samples that should have produced DNA using our validated automated DNA IQ™-based protocol, the competition for binding sites on the DNA IQ™ magnetic beads was more closely examined. Heme from heavily blooded samples interfered slightly with DNA binding. Increasing the concentration of Proteinase K during lysis of these samples did not enhance DNA recovery. However, diluting the sample lysate following lysis prior to DNA extraction overcame the reduction in DNA yield and preserved portions of the lysates for subsequent manual or automated extraction. Dye/chemicals from black denim lysates competed for binding sites on the DNA IQ™ beads and significantly reduced DNA recovery. Increasing the size or number of black denim cuttings during lysis had a direct adverse effect on DNA yield from various blood volumes. The dilution approach was successful on these samples and permitted the extraction of high DNA yields. Alternatively, shortening the incubation time for cell lysis to 30 min instead of the usual overnight at 56 °C prevented competition from black denim dye/chemicals and increased DNA yields. Crown Copyright © 2011. Published by Elsevier Ireland Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Changela, Anita; DiGate, Russell J.; Mondragon, Alfonso

Escherichia coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5{prime} phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an eight-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is boundmore » along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding.« less

Evidence for glucocorticoid receptor binding to a site(s) in a remote region of the 5' flanking sequences of the human proopiomelanocortin gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tully, D.B.; Hillman, D.; Herbert, E.

1986-05-01

Glucocorticoids negatively regulate expression of the human proopiomelanocortin (POMC) gene. It has been postulated that this effect may be modulated by a direct interaction of the glucocorticoid receptor (GR) with DNA in the vicinity of the POMC promoter. In order to investigate interactions of GR with POMC DNA, DNA-cellulose competitive binding assays have been performed using isolated fragments of cloned POMC DNA to compete with calf thymus DNA-cellulose for binding of triamcinolone acetonide affinity-labelled GR prepared from HeLa S/sub 3/ cells. In these assays, two fragments isolated from the 5' flanking sequences of POMC DNA (Fragment 3,-1765 to -677 andmore » Fragment 4, -676 to +125 with respect to the mRNA cap site) have competed favorably, with Fragment 3 consistently competing more strongly than Fragment 4. Additional studies have been conducted utilizing a newly developed South-western Blot procedure in which specific /sup 32/P-labelled DNA fragments are allowed to bind to dexamethasone mesylate labelled GR immobilized on nitrocellulose filters. Results from these studies have also shown preferential binding by POMC DNA fragments 3 and 4. DNA footprinting and gene transfer experiments are now being conducted to further characterize the nature of GR interaction with POMC DNA.« less

Structure and DNA-binding of meiosis-specific protein Hop2

NASA Astrophysics Data System (ADS)

Zhou, Donghua; Moktan, Hem; Pezza, Roberto

2014-03-01

Here we report structure elucidation of the DNA binding domain of homologous pairing protein 2 (Hop2), which is important to gene diversity when sperms and eggs are produced. Together with another protein Mnd1, Hop2 enhances the strand invasion activity of recombinase Dmc1 by over 30 times, facilitating proper synapsis of homologous chromosomes. However, the structural and biochemical bases for the function of Hop2 and Mnd1 have not been well understood. As a first step toward such understanding, we recently solved the structure for the N-terminus of Hop2 (1-84) using solution NMR. This fragment shows a typical winged-head conformation with recognized DNA binding activity. DNA interacting sites were then investigated by chemical shift perturbations in a titration experiment. Information of these sites was used to guide protein-DNA docking with MD simulation, revealing that helix 3 is stably lodged in the DNA major groove and that wing 1 (connecting strands 2 and 3) transiently comes in contact with the minor groove in nanosecond time scale. Mutagenesis analysis further confirmed the DNA binding sites in this fragment of the protein.

A systematic analysis of factors localized to damaged chromatin reveals PARP-dependent recruitment of transcription factors

PubMed Central

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C.; Westbrook, Thomas F.; Harper, J. Wade; Elledge, Stephen J.

2015-01-01

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify new DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the ALS candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a PARP-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors and >70% of randomly tested transcription factors localized to sites of DNA damage and approximately 90% were PARP-dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding domain-dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP-dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. PMID:26004182

A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

PubMed

Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

2005-04-01

Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

Loss of Hda activity stimulates replication initiation from I-box, but not R4 mutant origins in Escherichia coli.

PubMed

Riber, Leise; Fujimitsu, Kazuyuki; Katayama, Tsutomu; Løbner-Olesen, Anders

2009-01-01

Initiation of chromosome replication in Escherichia coli is limited by the initiator protein DnaA associated with ATP. Within the replication origin, binding sites for DnaA associated with ATP or ADP (R boxes) and the DnaA(ATP) specific sites (I-boxes, tau-boxes and 6-mer sites) are found. We analysed chromosome replication of cells carrying mutations in conserved regions of oriC. Cells carrying mutations in DnaA-boxes I2, I3, R2, R3 and R5 as well as FIS and IHF binding sites resembled wild-type cells with respect to origin concentration. Initiation of replication in these mutants occurred in synchrony or with slight asynchrony only. Furthermore, lack of Hda stimulated initiation in all these mutants. The DnaA(ATP) containing complex that leads to initiation can therefore be formed in the absence of several of the origin DnaA binding sites including both DnaA(ATP) specific I-boxes. However, competition between I-box mutant and wild-type origins, revealed a positive role of I-boxes on initiation. On the other hand, mutations affecting DnaA-box R4 were found to be compromised for initiation and could not be augmented by an increase in cellular DnaA(ATP)/DnaA(ADP) ratio. Compared with the sites tested here, R4 therefore seems to contribute to initiation most critically.

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site

PubMed Central

Chan, I-San; Al-Sarraj, Taufik; Shahravan, S. Hesam; Fedorova, Anna V.; Shin, Jumi A.

2012-01-01

Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4-bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR), and that 5H-LR comprises two 4-bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explored how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP–DNA interactions at a number of full-sites that contain 5H-LR vs. either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo. PMID:22856882

The bZIP dimer localizes at DNA full-sites where each basic region can alternately translocate and bind to subsites at the half-site.

PubMed

Chan, I-San; Al-Sarraj, Taufik; Shahravan, S Hesam; Fedorova, Anna V; Shin, Jumi A

2012-08-21

Crystal structures of the GCN4 bZIP (basic region/leucine zipper) with the AP-1 or CRE site show how each GCN4 basic region binds to a 4 bp cognate half-site as a single DNA target; however, this may not always fully describe how bZIP proteins interact with their target sites. Previously, we showed that the GCN4 basic region interacts with all 5 bp in half-site TTGCG (termed 5H-LR) and that 5H-LR comprises two 4 bp subsites, TTGC and TGCG, which individually are also target sites of the basic region. In this work, we explore how the basic region interacts with 5H-LR when the bZIP dimer localizes to full-sites. Using AMBER molecular modeling, we simulated GCN4 bZIP complexes with full-sites containing 5H-LR to investigate in silico the interface between the basic region and 5H-LR. We also performed in vitro investigation of bZIP-DNA interactions at a number of full-sites that contain 5H-LR versus either subsite: we analyzed results from DNase I footprinting and electrophoretic mobility shift assay (EMSA) and from EMSA titrations to quantify binding affinities. Our computational and experimental results together support a highly dynamic DNA-binding model: when a bZIP dimer localizes to its target full-site, the basic region can alternately recognize either subsite as a distinct target at 5H-LR and translocate between the subsites, potentially by sliding and hopping. This model provides added insights into how α-helical DNA-binding domains of transcription factors can localize to their gene regulatory sequences in vivo.

Quantifying the Effect of DNA Packaging on Gene Expression Level

NASA Astrophysics Data System (ADS)

Kim, Harold

2010-10-01

Gene expression, the process by which the genetic code comes alive in the form of proteins, is one of the most important biological processes in living cells, and begins when transcription factors bind to specific DNA sequences in the promoter region upstream of a gene. The relationship between gene expression output and transcription factor input which is termed the gene regulation function is specific to each promoter, and predicting this gene regulation function from the locations of transcription factor binding sites is one of the challenges in biology. In eukaryotic organisms (for example, animals, plants, fungi etc), DNA is highly compacted into nucleosomes, 147-bp segments of DNA tightly wrapped around histone protein core, and therefore, the accessibility of transcription factor binding sites depends on their locations with respect to nucleosomes - sites inside nucleosomes are less accessible than those outside nucleosomes. To understand how transcription factor binding sites contribute to gene expression in a quantitative manner, we obtain gene regulation functions of promoters with various configurations of transcription factor binding sites by using fluorescent protein reporters to measure transcription factor input and gene expression output in single yeast cells. In this talk, I will show that the affinity of a transcription factor binding site inside and outside the nucleosome controls different aspects of the gene regulation function, and explain this finding based on a mass-action kinetic model that includes competition between nucleosomes and transcription factors.

[Features of binding of proflavine to DNA at different DNA-ligand concentration ratios].

PubMed

Berezniak, E G; gladkovskaia, N A; Khrebtova, A S; Dukhopel'nikov, E V; Zinchenko, A V

2009-01-01

The binding of proflavine to calf thymus DNA has been studied using the methods of differential scanning calorimetry and spectrophotometry. It was shown that proflavine can interact with DNA by at least 3 binding modes. At high DNA-ligand concentration ratios (P/D), proflavine intercalates into both GC- and AT-sites, with a preference to GC-rich sequences. At low P/D ratios proflavine interacts with DNA by the external binding mode. From spectrophotometric concentration dependences, the parameters of complexing of proflavine with DNA were calculated. Thermodynamic parameters of DNA melting were calculated from differential scanning calorimetry data.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

TF1, the bacteriophage SPO1-encoded type II DNA-binding protein, is essential for viral multiplication.

PubMed

Sayre, M H; Geiduschek, E P

1988-09-01

The lytic Bacillus subtilis bacteriophage SPO1 encodes an abundant, 99-amino-acid type II DNA-binding protein, transcription factor 1 (TF1). TF1 is special in this family of procaryotic chromatin-forming proteins in its preference for hydroxymethyluracil-containing DNA, such as SPO1 DNA, and in binding with high affinity to specific sites in the SPO1 chromosome. We constructed recessive null alleles of the TF1 gene and introduced them into SPO1 chromosomes. Segregation analysis with partially diploid phage heterozygous for TF1 showed that phage bearing only these null alleles was inviable. Deletion of the nine C-proximal amino acids of TF1 prohibited phage multiplication in vivo and abolished its site-specific DNA-binding activity in vitro.

Structures of apo IRF-3 and IRF-7 DNA binding domains: effect of loop L1 on DNA binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Ioannes, Pablo; Escalante, Carlos R.; Aggarwal, Aneel K.

2013-11-20

Interferon regulatory factors IRF-3 and IRF-7 are transcription factors essential in the activation of interferon-{beta} (IFN-{beta}) gene in response to viral infections. Although, both proteins recognize the same consensus IRF binding site AANNGAAA, they have distinct DNA binding preferences for sites in vivo. The X-ray structures of IRF-3 and IRF-7 DNA binding domains (DBDs) bound to IFN-{beta} promoter elements revealed flexibility in the loops (L1-L3) and the residues that make contacts with the target sequence. To characterize the conformational changes that occur on DNA binding and how they differ between IRF family members, we have solved the X-ray structures ofmore » IRF-3 and IRF-7 DBDs in the absence of DNA. We found that loop L1, carrying the conserved histidine that interacts with the DNA minor groove, is disordered in apo IRF-3 but is ordered in apo IRF-7. This is reflected in differences in DNA binding affinities when the conserved histidine in loop L1 is mutated to alanine in the two proteins. The stability of loop L1 in IRF-7 derives from a unique combination of hydrophobic residues that pack against the protein core. Together, our data show that differences in flexibility of loop L1 are an important determinant of differential IRF-DNA binding.« less

Physical signals for protein-DNA recognition

NASA Astrophysics Data System (ADS)

Cao, Xiao-Qin; Zeng, Jia; Yan, Hong

2009-09-01

This paper discovers consensus physical signals around eukaryotic splice sites, transcription start sites, and replication origin start and end sites on a genome-wide scale based on their DNA flexibility profiles calculated by three different flexibility models. These salient physical signals are localized highly rigid and flexible DNAs, which may play important roles in protein-DNA recognition by the sliding search mechanism. The found physical signals lead us to a detailed hypothetical view of the search process in which a DNA-binding protein first finds a genomic region close to the target site from an arbitrary starting location by three-dimensional (3D) hopping and intersegment transfer mechanisms for long distances, and subsequently uses the one-dimensional (1D) sliding mechanism facilitated by the localized highly rigid DNAs to accurately locate the target flexible binding site within 30 bp (base pair) short distances. Guided by these physical signals, DNA-binding proteins rapidly search the entire genome to recognize a specific target site from the 3D to 1D pathway. Our findings also show that current promoter prediction programs (PPPs) based on DNA physical properties may suffer from lots of false positives because other functional sites such as splice sites and replication origins have similar physical signals as promoters do.

Understanding the mechanisms of protein-DNA interactions

NASA Astrophysics Data System (ADS)

Lavery, Richard

2004-03-01

Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

Structural Studies of E. coli Topoisomerase III-DNA Complexes Reveal A Novel Type IA Topoisomerase-DNA Conformational Intermediate

PubMed Central

Changela, Anita; DiGate, Russell J.; Mondragón, Alfonso

2007-01-01

Summary E. coli DNA topoisomerase III belongs to the type IA family of DNA topoisomerases, which transiently cleave single-stranded DNA (ssDNA) via a 5′ phosphotyrosine intermediate. We have solved crystal structures of wild-type E. coli topoisomerase III bound to an 8-base ssDNA molecule in three different pH environments. The structures reveal the enzyme in three distinct conformational states while bound to DNA. One conformation resembles the one observed previously with a DNA-bound, catalytically inactive mutant of topoisomerase III where DNA binding realigns catalytic residues to form a functional active site. Another conformation represents a novel intermediate in which DNA is bound along the ssDNA-binding groove but does not enter the active site, which remains in a catalytically inactive, closed state. A third conformation shows an intermediate state where the enzyme is still in a closed state, but the ssDNA is starting to invade the active site. For the first time, the active site region in the presence of both the catalytic tyrosine and ssDNA substrate is revealed for a type IA DNA topoisomerase, although there is no evidence of ssDNA cleavage. Comparative analysis of the various conformational states suggests a sequence of domain movements undertaken by the enzyme upon substrate binding. PMID:17331537

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

Insights into finding a mismatch through the structure of a mispaired DNA bound by a rhodium intercalator

PubMed Central

Pierre, Valérie C.; Kaiser, Jens T.; Barton, Jacqueline K.

2007-01-01

We report the 1.1-Å resolution crystal structure of a bulky rhodium complex bound to two different DNA sites, mismatched and matched in the oligonucleotide 5′-(dCGGAAATTCCCG)2-3′. At the AC mismatch site, the structure reveals ligand insertion from the minor groove with ejection of both mismatched bases and elucidates how destabilized mispairs in DNA may be recognized. This unique binding mode contrasts with major groove intercalation, observed at a matched site, where doubling of the base pair rise accommodates stacking of the intercalator. Mass spectral analysis reveals different photocleavage products associated with the two binding modes in the crystal, with only products characteristic of mismatch binding in solution. This structure, illustrating two clearly distinct binding modes for a molecule with DNA, provides a rationale for the interrogation and detection of mismatches. PMID:17194756

End-specific strategies of attachment of long double stranded DNA onto gold-coated nanofiber arrays

NASA Astrophysics Data System (ADS)

Peckys, Diana B.; de Jonge, Niels; Simpson, Michael L.; McKnight, Timothy E.

2008-10-01

We report the effective and site-specific binding of long double stranded (ds)DNA to high aspect ratio carbon nanofiber arrays. The carbon nanofibers were first coated with a thin gold layer to provide anchorage for two controllable binding methods. One method was based on the direct binding of thiol end-labeled dsDNA. The second and enhanced method used amine end-labeled dsDNA bound with crosslinkers to a carboxyl-terminated self-assembled monolayer. The bound dsDNA was first visualized with a fluorescent, dsDNA-intercalating dye. The specific binding onto the carbon nanofiber was verified by a high resolution detection method using scanning electron microscopy in combination with the binding of neutravidin-coated fluorescent microspheres to the immobilized and biotinylated dsDNA. Functional activity of thiol end-labeled dsDNA on gold-coated nanofiber arrays was verified with a transcriptional assay, whereby Chinese hamster lung cells (V79) were impaled upon the DNA-modified nanofibers and scored for transgene expression of the tethered template. Thiol end-labeled dsDNA demonstrated significantly higher expression levels than nanofibers prepared with control dsDNA that lacked a gold-binding end-label. Employing these site-specific and robust techniques of immobilization of dsDNA onto nanodevices can be of advantage for the study of DNA/protein interactions and for gene delivery applications.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.

PubMed

Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel

2015-01-01

Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.

Identification of a Hydrophobic Cleft in the LytTR Domain of AgrA as a Locus for Small Molecule Interactions that Inhibit DNA Binding

PubMed Central

Leonard, Paul G.; Bezar, Ian F.; Sidote, David J.; Stock, Ann M.

2012-01-01

The AgrA transcription factor regulates the quorum-sensing response in Staphylococcus aureus, controlling the production of hemolysins and other virulence factors. AgrA binds to DNA via its C-terminal LytTR domain, a domain not found in humans but common in many pathogenic bacteria, making it a potential target for antimicrobial development. We have determined the crystal structure of the apo AgrA LytTR domain and screened a library of 500 fragment compounds to find inhibitors of AgrA DNA-binding activity. Using NMR, the binding site for five compounds has been mapped to a common locus at the C-terminal end of the LytTR domain, a site known to be important for DNA-binding activity. Three of these compounds inhibit AgrA DNA binding. These results provide the first evidence that LytTR domains can be targeted by small organic compounds. PMID:23181972

Novel DNA packaging recognition in the unusual bacteriophage N15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

Nonspecific DNA Binding and Bending by HUαβ: Interfaces of the Three Binding Modes Characterized by Salt Dependent Thermodynamics

PubMed Central

Koh, Junseock; Shkel, Irina; Saecker, Ruth M.; Record, M. Thomas

2011-01-01

Previous ITC and FRET studies demonstrated that Escherichia coli HUαβ binds nonspecifically to duplex DNA in three different binding modes: a tighter-binding 34 bp mode which interacts with DNA in large (>34 bp) gaps between bound proteins, reversibly bending it 140° and thereby increasing its flexibility, and two weaker, modestly cooperative small-site-size modes (10 bp, 6 bp) useful for filling gaps between bound proteins shorter than 34 bp. Here we use ITC to determine the thermodynamics of these binding modes as a function of salt concentration, and deduce that DNA in the 34 bp mode is bent around but not wrapped on the body of HU, in contrast to specific binding of IHF. Analyses of binding isotherms (8, 15, 34 bp DNA) and initial binding heats (34, 38, 160 bp DNA) reveal that all three modes have similar log-log salt concentration derivatives of the binding constants (Ski) even though their binding site sizes differ greatly; most probable values of Ski on 34 bp or larger DNA are − 7.5 ± 0.5. From the similarity of Ski values, we conclude that binding interfaces of all three modes involve the same region of the arms and saddle of HU. All modes are entropy-driven, as expected for nonspecific binding driven by the polyelectrolyte effect. The bent-DNA 34 bp mode is most endothermic, presumably because of the cost of HU-induced DNA bending, while the 6 bp mode is modestly exothermic at all salt concentrations examined. Structural models consistent with the observed Ski values are proposed. PMID:21513716

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Chlorella virus DNA ligase: nick recognition and mutational analysis.

PubMed

Sriskanda, V; Shuman, S

1998-01-15

Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.

Chemical shift changes provide evidence for overlapping single-stranded DNA- and XPA-binding sites on the 70 kDa subunit of human replication protein A.

PubMed

Daughdrill, Gary W; Buchko, Garry W; Botuyan, Maria V; Arrowsmith, Cheryl; Wold, Marc S; Kennedy, Michael A; Lowry, David F

2003-07-15

Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1-326 (hRPA70(1-326)), and a fragment of the human XPA protein, residues 98-219 (XPA-MBD). Intensity changes were observed for amide resonances in the (1)H-(15)N correlation spectrum of uniformly (15)N-labeled hRPA70(1-326) after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA70(1-326) fragment. The hRPA70(1-326) residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA70(1-326) suggests that a competitive binding mechanism mediates the formation of the RPA-XPA complex. To determine whether a ternary complex could form between hRPA70(1-326), XPA-MBD and ssDNA, a (1)H-(15)N correlation spectrum was acquired for uniformly (15)N-labeled hRPA70(1-326) after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA70(1-326) in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA70(1-326) suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA70(1-326) may be modulated by ssDNA.

Chemical shift changes provide evidence for overlapping single-stranded DNA- and XPA-binding sites on the 70 kDa subunit of human replication protein A

PubMed Central

Daughdrill, Gary W.; Buchko, Garry W.; Botuyan, Maria V.; Arrowsmith, Cheryl; Wold, Marc S.; Kennedy, Michael A.; Lowry, David F.

2003-01-01

Replication protein A (RPA) is a heterotrimeric single-stranded DNA- (ssDNA) binding protein that can form a complex with the xeroderma pigmentosum group A protein (XPA). This complex can preferentially recognize UV-damaged DNA over undamaged DNA and has been implicated in the stabilization of open complex formation during nucleotide excision repair. In this report, nuclear magnetic resonance (NMR) spectroscopy was used to investigate the interaction between a fragment of the 70 kDa subunit of human RPA, residues 1–326 (hRPA701–326), and a fragment of the human XPA protein, residues 98–219 (XPA-MBD). Intensity changes were observed for amide resonances in the 1H–15N correlation spectrum of uniformly 15N-labeled hRPA701–326 after the addition of unlabeled XPA-MBD. The intensity changes observed were restricted to an ssDNA-binding domain that is between residues 183 and 296 of the hRPA701–326 fragment. The hRPA701–326 residues with the largest resonance intensity reductions were mapped onto the structure of the ssDNA-binding domain to identify the binding surface with XPA-MBD. The XPA-MBD-binding surface showed significant overlap with an ssDNA-binding surface that was previously identified using NMR spectroscopy and X-ray crystallography. Overlapping XPA-MBD- and ssDNA-binding sites on hRPA701–326 suggests that a competitive binding mechanism mediates the formation of the RPA–XPA complex. To determine whether a ternary complex could form between hRPA701–326, XPA-MBD and ssDNA, a 1H–15N correlation spectrum was acquired for uniformly 15N-labeled hRPA701–326 after the simultaneous addition of unlabeled XPA-MBD and ssDNA. In this experiment, the same chemical shift perturbations were observed for hRPA701–326 in the presence of XPA-MBD and ssDNA as was previously observed in the presence of ssDNA alone. The ability of ssDNA to compete with XPA-MBD for an overlapping binding site on hRPA701–326 suggests that any complex formation between RPA and XPA that involves the interaction between XPA-MBD and hRPA701–326 may be modulated by ssDNA. PMID:12853635

Dynamic constitutional frameworks for DNA biomimetic recognition.

PubMed

Catana, Romina; Barboiu, Mihail; Moleavin, Ioana; Clima, Lilia; Rotaru, Alexandru; Ursu, Elena-Laura; Pinteala, Mariana

2015-02-07

Linear and cross-linked dynamic constitutional frameworks generated from reversibly interacting linear PEG/core constituents and cationic sites shed light on the dominant coiling versus linear DNA binding behaviours, closer to the histone DNA binding wrapping mechanism.

Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition.

PubMed

Jun, S; Wallen, R V; Goriely, A; Kalionis, B; Desplan, C

1998-11-10

Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix-turn-helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes.

Lune/eye gone, a Pax-like protein, uses a partial paired domain and a homeodomain for DNA recognition

PubMed Central

Jun, Susie; Wallen, Robert V.; Goriely, Anne; Kalionis, Bill; Desplan, Claude

1998-01-01

Pax proteins, characterized by the presence of a paired domain, play key regulatory roles during development. The paired domain is a bipartite DNA-binding domain that contains two helix–turn–helix domains joined by a linker region. Each of the subdomains, the PAI and RED domains, has been shown to be a distinct DNA-binding domain. The PAI domain is the most critical, but in specific circumstances, the RED domain is involved in DNA recognition. We describe a Pax protein, originally called Lune, that is the product of the Drosophila eye gone gene (eyg). It is unique among Pax proteins, because it contains only the RED domain. eyg seems to play a role both in the organogenesis of the salivary gland during embryogenesis and in the development of the eye. A high-affinity binding site for the Eyg RED domain was identified by using systematic evolution of ligands by exponential enrichment techniques. This binding site is related to a binding site previously identified for the RED domain of the Pax-6 5a isoform. Eyg also contains another DNA-binding domain, a Prd-class homeodomain (HD), whose palindromic binding site is similar to other Prd-class HDs. The ability of Pax proteins to use the PAI, RED, and HD, or combinations thereof, may be one mechanism that allows them to be used at different stages of development to regulate various developmental processes through the activation of specific target genes. PMID:9811867

Interrelations of secondary structure stability and DNA-binding affinity in the bacteriophage SPO1-encoded type II DNA-binding protein TF1.

PubMed

Andera, L; Spangler, C J; Galeone, A; Mayol, L; Geiduschek, E P

1994-02-11

TF1, a homodimeric DNA-binding and -bending protein with a preference for hydroxymethyluracil-containing DNA is the Bacillus subtilis-encoded homolog of the bacterial HU proteins and of the E. coli integration host factor. A temperature-sensitive mutation at amino acid 25 of TF1 (L25-->A) and two intragenic second site revertants at amino acids 15 (E15-->G) and 32 (L32-->I) were previously identified and their effects on virus development were examined. The DNA-binding properties of these proteins and the thermal stability of their secondary structures have now been analyzed. Amino acids 15 and 32 are far removed from the putative DNA-binding domains of TF1 but changes there exert striking effects on DNA affinity that correlate with effects on structure. The double mutant protein TF1-G15I32 binds to a preferred site in hydroxymethyluracil-containing DNA 40 times more tightly, denatures at higher temperature (delta tm = 21 degrees C), and also exchanges subunits much more slowly than does the wild-type protein. The L25-->A mutation makes TF1 secondary structure and DNA-binding highly salt concentration-dependent. The E15-->G mutation partly suppresses this effect: secondary structure of TF1-A25G15 is restored at 21 degrees C by 1 M NaCl or, at low NaCl concentration, by binding to DNA.

Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

PubMed Central

Ryden, T A; de Mars, M; Beemon, K

1993-01-01

Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

Structure of an XPF endonuclease with and without DNA suggests a model for substrate recognition

PubMed Central

Newman, Matthew; Murray-Rust, Judith; Lally, John; Rudolf, Jana; Fadden, Andrew; Knowles, Philip P; White, Malcolm F; McDonald, Neil Q

2005-01-01

The XPF/Mus81 structure-specific endonucleases cleave double-stranded DNA (dsDNA) within asymmetric branched DNA substrates and play an essential role in nucleotide excision repair, recombination and genome integrity. We report the structure of an archaeal XPF homodimer alone and bound to dsDNA. Superposition of these structures reveals a large domain movement upon binding DNA, indicating how the (HhH)2 domain and the nuclease domain are coupled to allow the recognition of double-stranded/single-stranded DNA junctions. We identify two nonequivalent DNA-binding sites and propose a model in which XPF distorts the 3′ flap substrate in order to engage both binding sites and promote strand cleavage. The model rationalises published biochemical data and implies a novel role for the ERCC1 subunit of eukaryotic XPF complexes. PMID:15719018

The Electronic Behavior of Zinc-Finger Protein Binding Sites in the Context of the DNA Extended Ladder Model

NASA Astrophysics Data System (ADS)

Oiwa, Nestor; Cordeiro, Claudette; Heermann, Dieter

2016-05-01

Instead of ATCG letter alignments, typically used in bioinformatics, we propose a new alignment method using the probability distribution function of the bottom of the occupied molecular orbital (BOMO), highest occupied molecular orbital (HOMO) and lowest unoccupied orbital (LUMO). We apply the technique to transcription factors with Cys2His2 zinc fingers. These transcription factors search for binding sites, probing for the electronic patterns at the minor and major DNA groves. The eukaryotic Cys2His2 zinc finger proteins bind to DNA ubiquitously at highly conserved domains. They are responsible for gene regulation and the spatial organization of DNA. To study and understand these zinc finger DNA-protein interactions, we use the extended ladder in the DNA model proposed by Zhu, Rasmussen, Balatsky & Bishop (2007) te{Zhu-2007}. Considering one single spinless electron in each nucleotide π-orbital along a double DNA chain (dDNA), we find a typical pattern for the bottom of BOMO, HOMO and LUMO along the binding sites. We specifically looked at two members of zinc finger protein family: specificity protein 1 (SP1) and early grown response 1 transcription factors (EGR1). When the valence band is filled, we find electrons in the purines along the nucleotide sequence, compatible with the electric charges of the binding amino acids in SP1 and EGR1 zinc finger.

Genetic variations in the DNA replication origins of human papillomavirus family correlate with their oncogenic potential.

PubMed

Yilmaz, Gulden; Biswas-Fiss, Esther E; Biswas, Subhasis B

2018-04-01

Human papillomaviruses (HPVs) encompass a large family of viruses that range from benign to highly carcinogenic. The crucial differences between benign and carcinogenic types of HPV remain unknown, except that the two HPV types differ in the frequency of DNA replication. We have systematically analyzed the mechanism of HPV DNA replication initiation in low-risk and high-risk HPVs. Our results demonstrate that HPV-encoded E2 initiator protein and its four binding sites in the replication origin play pivotal roles in determining the destiny of the HPV-infected cell. We have identified strain-specific single nucleotide variations in E2 binding sites found only in the high-risk HPVs. We have demonstrated that these variations result in attenuated formation of the E2-DNA complex. E2 binding to these sites is linked to the activation of the DNA replication origin as well as initiation of DNA replication. Both electrophoretic mobility shift assay and atomic force microscopy studies demonstrated that binding of E2 from either low- or high-risk HPVs with variant binding sequences lacked multimeric E2-DNA complex formation in vitro. These results provided a molecular basis of differential DNA replication in the two types of HPVs and pointed to a correlation with the development of cancer. Copyright © 2017. Published by Elsevier B.V.

Binding of the Zn2+ ion to ferric uptake regulation protein from E. coli and the competition with Fe2+ binding: a molecular modeling study of the effect on DNA binding and conformational changes of Fur

NASA Astrophysics Data System (ADS)

Jabour, Salih; Hamed, Mazen Y.

2009-04-01

The three dimensional structure of Ferric uptake regulation protein dimer from E. coli, determined by molecular modeling, was docked on a DNA fragment (iron box) and Zn2+ ions were added in two steps. The first step involved the binding of one Zn2+ ion to what is known as the zinc site which consists of the residues Cys 92, Cys 95, Asp 137, Asp141, Arg139, Glu 140, His 145 and His 143 with an average metal-Nitrogen distance of 2.5 Å and metal-oxygen distance of 3.1-3.2 Å. The second Zn2+ ion is bound to the iron activating site formed from the residues Ile 50, His 71, Asn 72, Gly 97, Asp 105 and Ala 109. The binding of the second Zn2+ ion strengthened the binding of the first ion as indicated by the shortening of the zinc-residue distances. Fe2+, when added to the complex consisting of 2Zn2+/Fur dimer/DNA, replaced the Zn2+ ion in the zinc site and when a second Fe2+ was added, it replaced the second zinc ion in the iron activating site. The binding of both zinc and iron ions induced a similar change in Fur conformations, but shifted residues closer to DNA in a different manner. This is discussed along with a possible role for the Zn2+ ion in the Fur dimer binding of DNA in its repressor activity.

Transcription and DNA Damage: Holding Hands or Crossing Swords?

PubMed

D'Alessandro, Giuseppina; d'Adda di Fagagna, Fabrizio

2017-10-27

Transcription has classically been considered a potential threat to genome integrity. Collision between transcription and DNA replication machinery, and retention of DNA:RNA hybrids, may result in genome instability. On the other hand, it has been proposed that active genes repair faster and preferentially via homologous recombination. Moreover, while canonical transcription is inhibited in the proximity of DNA double-strand breaks, a growing body of evidence supports active non-canonical transcription at DNA damage sites. Small non-coding RNAs accumulate at DNA double-strand break sites in mammals and other organisms, and are involved in DNA damage signaling and repair. Furthermore, RNA binding proteins are recruited to DNA damage sites and participate in the DNA damage response. Here, we discuss the impact of transcription on genome stability, the role of RNA binding proteins at DNA damage sites, and the function of small non-coding RNAs generated upon damage in the signaling and repair of DNA lesions. Copyright © 2016 Elsevier Ltd. All rights reserved.

Topography of the ISW2–nucleosome complex: insights into nucleosome spacing and chromatin remodeling

PubMed Central

Kagalwala, Mohamedi N; Glaus, Benjamin J; Dang, Weiwei; Zofall, Martin; Bartholomew, Blaine

2004-01-01

Linker DNA was found to be critical for the specific docking of ISW2 with nucleosomes as shown by mapping the physical contacts of ISW2 with nucleosomes at base-pair resolution. Hydroxyl radical footprinting revealed that ISW2 not only extensively interacts with the linker DNA, but also approaches the nucleosome from the side perpendicular to the axis of the DNA superhelix and contacts two disparate sites on the nucleosomal DNA from opposite sides of the superhelix. The topography of the ISW2–nucleosome was further delineated by finding which of the ISW2 subunits are proximal to specific sites within the linker and nucleosomal DNA regions by site-directed DNA photoaffinity labeling. Although ISW2 was shown to contact ∼63 bp of linker DNA, a minimum of 20 bp of linker DNA was required for stable binding of ISW2 to nucleosomes. The remaining ∼43 bp of flanking linker DNA promoted more efficient binding under competitive binding conditions and was functionally important for enhanced sliding of nucleosomes when ISW2 was significantly limiting. PMID:15131696

Crystal structure of the DNA-binding domain of the LysR-type transcriptional regulator CbnR in complex with a DNA fragment of the recognition-binding site in the promoter region.

PubMed

Koentjoro, Maharani Pertiwi; Adachi, Naruhiko; Senda, Miki; Ogawa, Naoto; Senda, Toshiya

2018-03-01

LysR-type transcriptional regulators (LTTRs) are among the most abundant transcriptional regulators in bacteria. CbnR is an LTTR derived from Cupriavidus necator (formerly Alcaligenes eutrophus or Ralstonia eutropha) NH9 and is involved in transcriptional activation of the cbnABCD genes encoding chlorocatechol degradative enzymes. CbnR interacts with a cbnA promoter region of approximately 60 bp in length that contains the recognition-binding site (RBS) and activation-binding site (ABS). Upon inducer binding, CbnR seems to undergo conformational changes, leading to the activation of the transcription. Since the interaction of an LTTR with RBS is considered to be the first step of the transcriptional activation, the CbnR-RBS interaction is responsible for the selectivity of the promoter to be activated. To understand the sequence selectivity of CbnR, we determined the crystal structure of the DNA-binding domain of CbnR in complex with RBS of the cbnA promoter at 2.55 Å resolution. The crystal structure revealed details of the interactions between the DNA-binding domain and the promoter DNA. A comparison with the previously reported crystal structure of the DNA-binding domain of BenM in complex with its cognate RBS showed several differences in the DNA interactions, despite the structural similarity between CbnR and BenM. These differences explain the observed promoter sequence selectivity between CbnR and BenM. Particularly, the difference between Thr33 in CbnR and Ser33 in BenM appears to affect the conformations of neighboring residues, leading to the selective interactions with DNA. Atomic coordinates and structure factors for the DNA-binding domain of Cupriavidus necatorNH9 CbnR in complex with RBS are available in the Protein Data Bank under the accession code 5XXP. © 2018 Federation of European Biochemical Societies.

Silver(I) complexes with DNA and RNA studied by Fourier transform infrared spectroscopy and capillary electrophoresis.

PubMed Central

Arakawa, H; Neault, J F; Tajmir-Riahi, H A

2001-01-01

Ag(I) is a strong nucleic acids binder and forms several complexes with DNA such as types I, II, and III. However, the details of the binding mode of silver(I) in the Ag-polynucleotides remains unknown. Therefore, it was of interest to examine the binding of Ag(I) with calf-thymus DNA and bakers yeast RNA in aqueous solutions at pH 7.1-6.6 with constant concentration of DNA or RNA and various concentrations of Ag(I). Fourier transform infrared spectroscopy and capillary electrophoresis were used to analyze the Ag(I) binding mode, the binding constant, and the polynucleotides' structural changes in the Ag-DNA and Ag-RNA complexes. The spectroscopic results showed that in the type I complex formed with DNA, Ag(I) binds to guanine N7 at low cation concentration (r = 1/80) and adenine N7 site at higher concentrations (r = 1/20 to 1/10), but not to the backbone phosphate group. At r = 1/2, type II complexes formed with DNA in which Ag(I) binds to the G-C and A-T base pairs. On the other hand, Ag(I) binds to the guanine N7 atom but not to the adenine and the backbone phosphate group in the Ag-RNA complexes. Although a minor alteration of the sugar-phosphate geometry was observed, DNA remained in the B-family structure, whereas RNA retained its A conformation. Scatchard analysis following capillary electrophoresis showed two binding sites for the Ag-DNA complexes with K(1) = 8.3 x 10(4) M(-1) for the guanine and K(2) = 1.5 x 10(4) M(-1) for the adenine bases. On the other hand, Ag-RNA adducts showed one binding site with K = 1.5 x 10(5) M(-1) for the guanine bases. PMID:11509371

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site.

PubMed

Claveria-Gimeno, Rafael; Lanuza, Pilar M; Morales-Chueca, Ignacio; Jorge-Torres, Olga C; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-31

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities.

The intervening domain from MeCP2 enhances the DNA affinity of the methyl binding domain and provides an independent DNA interaction site

PubMed Central

Claveria-Gimeno, Rafael; Lanuza, Pilar M.; Morales-Chueca, Ignacio; Jorge-Torres, Olga C.; Vega, Sonia; Abian, Olga; Esteller, Manel; Velazquez-Campoy, Adrian

2017-01-01

Methyl-CpG binding protein 2 (MeCP2) preferentially interacts with methylated DNA and it is involved in epigenetic regulation and chromatin remodelling. Mutations in MeCP2 are linked to Rett syndrome, the leading cause of intellectual retardation in girls and causing mental, motor and growth impairment. Unstructured regions in MeCP2 provide the plasticity for establishing interactions with multiple binding partners. We present a biophysical characterization of the methyl binding domain (MBD) from MeCP2 reporting the contribution of flanking domains to its structural stability and dsDNA interaction. The flanking disordered intervening domain (ID) increased the structural stability of MBD, modified its dsDNA binding profile from an entropically-driven moderate-affinity binding to an overwhelmingly enthalpically-driven high-affinity binding. Additionally, ID provided an additional site for simultaneously and autonomously binding an independent dsDNA molecule, which is a key feature linked to the chromatin remodelling and looping activity of MeCP2, as well as its ability to interact with nucleosomes replacing histone H1. The dsDNA interaction is characterized by an unusually large heat capacity linked to a cluster of water molecules trapped within the binding interface. The dynamics of disordered regions together with extrinsic factors are key determinants of MeCP2 global structural properties and functional capabilities. PMID:28139759

Electrochemical and spectroscopic studies of the interaction of proflavine with DNA.

PubMed

Aslanoglu, Mehmet

2006-03-01

The interaction of proflavine with herring sperm DNA has been investigated by cyclic voltammetry and UV-Vis spectroscopy as well as viscosity measurements. Shifts in the peak potentials in cyclic voltammetry, spectral changes in UV absorption titration, an increase in viscosity of DNA and the results of the effect of ionic strength on the binding constant strongly support the intercalation of proflavine into the DNA double helix. The binding constant for the interaction between proflavine and DNA was K = 2.32 (+/- 0.41) x 10(4) M(-1) and the binding site size was 2.07 (+/- 0.1) base pairs, estimated in voltammetric measurements. The value of the binding site size was determined to be closer to that expected for a planar intercalating agent. The standard Gibbs free-energy change is ca. -24.90 kJ/mol at 25 degrees C, indicating the spontaneity of the binding interaction. The binding constant determined by UV absorption measurements was K = 2.20 (+/- 0.48) x 10(4) M(-1), which is very close to the value determined by cyclic voltammetry assuming that the binding equilibrium is static.

Modeling the interactions of the nucleotide excision repair UvrA(2) dimer with DNA.

PubMed

Gantchev, Tsvetan G; Hunting, Darel J

2010-12-28

The UvrA protein initiates the DNA damage recognition process by the bacterial nucleotide excision repair (NER) system. Recently, crystallographic structures of holo-UvrA(2) dimers from two different microorganisms have been released (Protein Data Bank entries 2r6f , 2vf7 , and 2vf8 ). However, the details of the DNA binding by UvrA(2) and other peculiarities involved in the damage recognition process remain unknown. We have undertaken a molecular modeling approach to appraise the possible modes of DNA-UvrA(2) interaction using molecular docking and short-scale guided molecular dynamics [continuum field, constrained, and/or unrestricted simulated annealing (SA)], taking into account the three-dimensional location of a series of mutation-identified UvrA residues implicated in DNA binding. The molecular docking was based on the assumptions that the UvrA(2) dimer is preformed prior to DNA binding and that no major protein conformational rearrangements, except moderate domain reorientations, are required for binding of undamaged DNA. As a first approximation, DNA was treated as a rigid ligand. From the electrostatic relief of the ventral surface of UvrA(2), we initially identified three, noncollinear DNA binding paths. Each of the three resulting nucleoprotein complexes (C1, C2, and C3) was analyzed separately, including calculation of binding energies, the number and type of interaction residues (including mutated ones), and the predominant mode of translational and rotational motion of specific protein domains after SA to ensure improved DNA binding. The UvrA(2) dimer can accommodate DNA in all three orientations, albeit with different binding strengths. One of the UvrA(2)-DNA complexes (C1) fulfilled most of the requirements (high interaction energy, proximity of DNA to mutated residues, etc.) expected for a natural, high-affinity DNA binding site. This nucleoprotein presents a structural organization that is designed to clamp and bend double-stranded DNA. We examined the binding site in more detail by docking DNAs of significantly different (AT- vs CG-enriched) sequences and by submitting the complexes to DNA-unrestricted SA. It was found that in a manner independent of the DNA sequence and applied MD protocols, UvrA(2) favors binding of a bent and unwound undamaged DNA, with a kink positioned in the proximity of the Zn3 hairpins, anticollinearly aligned at the bottom of the ventral protein surface. It is further hypothesized that the Zn3 modules play an essential role in the damage recognition process and that the apparent existence of a family of DNA binding sites might be biologically relevant. Our data should prove to be useful in rational (structure-based) mutation studies.

Conformational and thermodynamic hallmarks of DNA operator site specificity in the copper sensitive operon repressor from Streptomyces lividans

PubMed Central

Tan, Benedict G.; Vijgenboom, Erik; Worrall, Jonathan A. R.

2014-01-01

Metal ion homeostasis in bacteria relies on metalloregulatory proteins to upregulate metal resistance genes and enable the organism to preclude metal toxicity. The copper sensitive operon repressor (CsoR) family is widely distributed in bacteria and controls the expression of copper efflux systems. CsoR operator sites consist of G-tract containing pseudopalindromes of which the mechanism of operator binding is poorly understood. Here, we use a structurally characterized CsoR from Streptomyces lividans (CsoRSl) together with three specific operator targets to reveal the salient features pertaining to the mechanism of DNA binding. We reveal that CsoRSl binds to its operator site through a 2-fold axis of symmetry centred on a conserved 5′-TAC/GTA-3′ inverted repeat. Operator recognition is stringently dependent not only on electropositive residues but also on a conserved polar glutamine residue. Thermodynamic and circular dichroic signatures of the CsoRSl–DNA interaction suggest selectivity towards the A-DNA-like topology of the G-tracts at the operator site. Such properties are enhanced on protein binding thus enabling the symmetrical binding of two CsoRSl tetramers. Finally, differential binding modes may exist in operator sites having more than one 5′-TAC/GTA-3′ inverted repeat with implications in vivo for a mechanism of modular control. PMID:24121681

Structure-affinity relationships for the binding of actinomycin D to DNA

NASA Astrophysics Data System (ADS)

Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

1997-03-01

Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function.

PubMed

Ciolkowski, Ingo; Wanke, Dierk; Birkenbihl, Rainer P; Somssich, Imre E

2008-09-01

WRKY transcription factors have been shown to play a major role in regulating, both positively and negatively, the plant defense transcriptome. Nearly all studied WRKY factors appear to have a stereotypic binding preference to one DNA element termed the W-box. How specificity for certain promoters is accomplished therefore remains completely unknown. In this study, we tested five distinct Arabidopsis WRKY transcription factor subfamily members for their DNA binding selectivity towards variants of the W-box embedded in neighboring DNA sequences. These studies revealed for the first time differences in their binding site preferences, which are partly dependent on additional adjacent DNA sequences outside of the TTGACY-core motif. A consensus WRKY binding site derived from these studies was used for in silico analysis to identify potential target genes within the Arabidopsis genome. Furthermore, we show that even subtle amino acid substitutions within the DNA binding region of AtWRKY11 strongly impinge on its binding activity. Additionally, all five factors were found localized exclusively to the plant cell nucleus and to be capable of trans-activating expression of a reporter gene construct in vivo.

Nuclear magnetic resonance-based model of a TF1/HmU-DNA complex.

PubMed

Silva, M V; Pasternack, L B; Kearns, D R

1997-12-15

Transcription factor 1 (TF1), a type II DNA-binding protein encoded by the Bacillus subtilis bacteriophage SPO1, has the capacity for sequence-selective DNA binding and a preference for 5-hydroxymethyl-2'-deoxyuridine (HmU)-containing DNA. In NMR studies of the TF1/HmU-DNA complex, intermolecular NOEs indicate that the flexible beta-ribbon and C-terminal alpha-helix are involved in the DNA-binding site of TF1, placing it in the beta-sheet category of DNA-binding proteins proposed to bind by wrapping two beta-ribbon "arms" around the DNA. Intermolecular and intramolecular NOEs were used to generate an energy-minimized model of the protein-DNA complex in which both DNA bending and protein structure changes are evident.

Designing of MIP based QCM sensor having thymine recognition sites based on biomimicking DNA approach.

PubMed

Diltemiz, S Emir; Hür, D; Ersöz, A; Denizli, A; Say, R

2009-11-15

Quartz crystal microbalance (QCM) sensors coated with molecular imprinted polymers (MIP) have been developed for the determination of thymine. In this method, methacryloylamidoadenine (MA-Ade) have used as a new monomer and thymine template for inspiration of DNA nucleobases interaction. The thymine can be simultaneously hydrogen binding to MA-Ade and fit into the shape-selective cavities. Thus, the interaction between nucleobases has an effect on the binding ability of the QCM sensors. The binding affinity of the thymine imprinted sensors has investigated by using the Langmuir isotherm. The thymine imprinted QCM electrodes have shown homogeneous binding sites for thymine (K(a): 1.0 x 10(5)M(-1)) while heterogeneous binding sites for uracil. On the other hand, recognition selectivity of the QCM sensor based on thymine imprinted polymer toward to uracil, ssDNA and ssRNA has been reported in this work.

A Systematic Analysis of Factors Localized to Damaged Chromatin Reveals PARP-Dependent Recruitment of Transcription Factors.

PubMed

Izhar, Lior; Adamson, Britt; Ciccia, Alberto; Lewis, Jedd; Pontano-Vaites, Laura; Leng, Yumei; Liang, Anthony C; Westbrook, Thomas F; Harper, J Wade; Elledge, Stephen J

2015-06-09

Localization to sites of DNA damage is a hallmark of DNA damage response (DDR) proteins. To identify DDR factors, we screened epitope-tagged proteins for localization to sites of chromatin damaged by UV laser microirradiation and found >120 proteins that localize to damaged chromatin. These include the BAF tumor suppressor complex and the amyotrophic lateral sclerosis (ALS) candidate protein TAF15. TAF15 contains multiple domains that bind damaged chromatin in a poly-(ADP-ribose) polymerase (PARP)-dependent manner, suggesting a possible role as glue that tethers multiple PAR chains together. Many positives were transcription factors; > 70% of randomly tested transcription factors localized to sites of DNA damage, and of these, ∼90% were PARP dependent for localization. Mutational analyses showed that localization to damaged chromatin is DNA-binding-domain dependent. By examining Hoechst staining patterns at damage sites, we see evidence of chromatin decompaction that is PARP dependent. We propose that PARP-regulated chromatin remodeling at sites of damage allows transient accessibility of DNA-binding proteins. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

2008-06-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

PubMed

Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

2017-07-01

FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Predicting conformational ensembles and genome-wide transcription factor binding sites from DNA sequences.

PubMed

Andrabi, Munazah; Hutchins, Andrew Paul; Miranda-Saavedra, Diego; Kono, Hidetoshi; Nussinov, Ruth; Mizuguchi, Kenji; Ahmad, Shandar

2017-06-22

DNA shape is emerging as an important determinant of transcription factor binding beyond just the DNA sequence. The only tool for large scale DNA shape estimates, DNAshape was derived from Monte-Carlo simulations and predicts four broad and static DNA shape features, Propeller twist, Helical twist, Minor groove width and Roll. The contributions of other shape features e.g. Shift, Slide and Opening cannot be evaluated using DNAshape. Here, we report a novel method DynaSeq, which predicts molecular dynamics-derived ensembles of a more exhaustive set of DNA shape features. We compared the DNAshape and DynaSeq predictions for the common features and applied both to predict the genome-wide binding sites of 1312 TFs available from protein interaction quantification (PIQ) data. The results indicate a good agreement between the two methods for the common shape features and point to advantages in using DynaSeq. Predictive models employing ensembles from individual conformational parameters revealed that base-pair opening - known to be important in strand separation - was the best predictor of transcription factor-binding sites (TFBS) followed by features employed by DNAshape. Of note, TFBS could be predicted not only from the features at the target motif sites, but also from those as far as 200 nucleotides away from the motif.

The Activation Domain of the Bovine Papillomavirus E2 Protein Mediates Association of DNA-Bound Dimers to form DNA Loops

NASA Astrophysics Data System (ADS)

Knight, Jonathan D.; Li, Rong; Botchan, Michael

1991-04-01

The E2 transactivator protein of bovine papillomavirus binds its specific DNA target sequence as a dimer. We have found that E2 dimers, performed in solution independent of DNA, exhibit substantial cooperativity of DNA binding as detected by both nitrocellulose filter retention and footprint analysis techniques. If the binding sites are widely spaced, E2 forms stable DNA loops visible by electron microscopy. When three widely separated binding sites reside on te DNA, E2 condenses the molecule into a bow-tie structure. This implies that each E2 dimer has at least two independent surfaces for multimerization. Two naturally occurring shorter forms of the protein, E2C and D8/E2, which function in vivo as repressors of transcription, do not form such loops. Thus, the looping function of E2 maps to the 161-amino acid activation domain. These results support the looping model of transcription activation by enhancers.

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene

PubMed Central

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-01-01

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30–60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. PMID:27006398

Metal Ion Binding at the Catalytic Site Induces Widely Distributed Changes in a Sequence Specific Protein–DNA Complex

PubMed Central

2016-01-01

Metal ion cofactors can alter the energetics and specificity of sequence specific protein–DNA interactions, but it is unknown if the underlying effects on structure and dynamics are local or dispersed throughout the protein–DNA complex. This work uses EcoRV endonuclease as a model, and catalytically inactive lanthanide ions, which replace the Mg2+ cofactor. Nuclear magnetic resonance (NMR) titrations indicate that four Lu3+ or two La3+ cations bind, and two new crystal structures confirm that Lu3+ binding is confined to the active sites. NMR spectra show that the metal-free EcoRV complex with cognate (GATATC) DNA is structurally distinct from the nonspecific complex, and that metal ion binding sites are not assembled in the nonspecific complex. NMR chemical shift perturbations were determined for 1H–15N amide resonances, for 1H–13C Ile-δ-CH3 resonances, and for stereospecifically assigned Leu-δ-CH3 and Val-γ-CH3 resonances. Many chemical shifts throughout the cognate complex are unperturbed, so metal binding does not induce major conformational changes. However, some large perturbations of amide and side chain methyl resonances occur as far as 34 Å from the metal ions. Concerted changes in specific residues imply that local effects of metal binding are propagated via a β-sheet and an α-helix. Both amide and methyl resonance perturbations indicate changes in the interface between subunits of the EcoRV homodimer. Bound metal ions also affect amide hydrogen exchange rates for distant residues, including a distant subdomain that contacts DNA phosphates and promotes DNA bending, showing that metal ions in the active sites, which relieve electrostatic repulsion between protein and DNA, cause changes in slow dynamics throughout the complex. PMID:27786446

Survey of protein–DNA interactions in Aspergillus oryzae on a genomic scale

PubMed Central

Wang, Chao; Lv, Yangyong; Wang, Bin; Yin, Chao; Lin, Ying; Pan, Li

2015-01-01

The genome-scale delineation of in vivo protein–DNA interactions is key to understanding genome function. Only ∼5% of transcription factors (TFs) in the Aspergillus genus have been identified using traditional methods. Although the Aspergillus oryzae genome contains >600 TFs, knowledge of the in vivo genome-wide TF-binding sites (TFBSs) in aspergilli remains limited because of the lack of high-quality antibodies. We investigated the landscape of in vivo protein–DNA interactions across the A. oryzae genome through coupling the DNase I digestion of intact nuclei with massively parallel sequencing and the analysis of cleavage patterns in protein–DNA interactions at single-nucleotide resolution. The resulting map identified overrepresented de novo TF-binding motifs from genomic footprints, and provided the detailed chromatin remodeling patterns and the distribution of digital footprints near transcription start sites. The TFBSs of 19 known Aspergillus TFs were also identified based on DNase I digestion data surrounding potential binding sites in conjunction with TF binding specificity information. We observed that the cleavage patterns of TFBSs were dependent on the orientation of TF motifs and independent of strand orientation, consistent with the DNA shape features of binding motifs with flanking sequences. PMID:25883143

Energetic basis for selective recognition of T*G mismatched base pairs in DNA by imidazole-rich polyamides.

PubMed

Lacy, Eilyn R; Nguyen, Binh; Le, Minh; Cox, Kari K; OHare, Caroline; Hartley, John A; Lee, Moses; Wilson, W David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T.G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T.G-polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T.G mismatch containing DNA hairpin duplex and a similar DNA with only Watson-Crick base pairs. Large negative binding enthalpies for all of the polyamide-DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T.G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T.G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T.G mismatch sites.

Energetic basis for selective recognition of T·G mismatched base pairs in DNA by imidazole-rich polyamides

PubMed Central

Lacy, Eilyn R.; Nguyen, Binh; Le, Minh; Cox, Kari K.; O'Hare, Caroline; Hartley, John A.; Lee, Moses; Wilson, W. David

2004-01-01

To complement available structure and binding results and to develop a detailed understanding of the basis for selective molecular recognition of T·G mismatches in DNA by imidazole containing polyamides, a full thermodynamic profile for formation of the T·G–polyamide complex has been determined. The amide-linked heterocycles f-ImImIm and f-PyImIm (where f is formamido group, Im is imidazole and Py is pyrrole) were studied by using biosensor-surface plasmon resonance (SPR) and isothermal titration calorimetry (ITC) with a T·G mismatch containing DNA hairpin duplex and a similar DNA with only Watson–Crick base pairs. Large negative binding enthalpies for all of the polyamide–DNA complexes indicate that the interactions are enthalpically driven. SPR results show slower complex formation and stronger binding of f-ImImIm to the T·G than to the match site. The thermodynamic analysis indicates that the enhanced binding to the T·G site is the result of better entropic contributions. Negative heat capacity changes for the complex are correlated with calculated solvent accessible surface area changes and indicate hydrophobic contributions to complex formation. DNase I footprinting analysis in a long DNA sequence provided supporting evidence that f-ImImIm binds selectively to T·G mismatch sites. PMID:15064359

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Monitoring Replication Protein A (RPA) dynamics in homologous recombination through site-specific incorporation of non-canonical amino acids

PubMed Central

Pokhrel, Nilisha; Origanti, Sofia; Davenport, Eric Parker; Gandhi, Disha; Kaniecki, Kyle; Mehl, Ryan A.; Greene, Eric C.; Dockendorff, Chris

2017-01-01

Abstract An essential coordinator of all DNA metabolic processes is Replication Protein A (RPA). RPA orchestrates these processes by binding to single-stranded DNA (ssDNA) and interacting with several other DNA binding proteins. Determining the real-time kinetics of single players such as RPA in the presence of multiple DNA processors to better understand the associated mechanistic events is technically challenging. To overcome this hurdle, we utilized non-canonical amino acids and bio-orthogonal chemistry to site-specifically incorporate a chemical fluorophore onto a single subunit of heterotrimeric RPA. Upon binding to ssDNA, this fluorescent RPA (RPAf) generates a quantifiable change in fluorescence, thus serving as a reporter of its dynamics on DNA in the presence of multiple other DNA binding proteins. Using RPAf, we describe the kinetics of facilitated self-exchange and exchange by Rad51 and mediator proteins during various stages in homologous recombination. RPAf is widely applicable to investigate its mechanism of action in processes such as DNA replication, repair and telomere maintenance. PMID:28934470

Acemannan increases NF-κB/DNA binding and IL-6/-8 expression by selectively binding Toll-like receptor-5 in human gingival fibroblasts.

PubMed

Thunyakitpisal, Pasutha; Ruangpornvisuti, Vithaya; Kengkwasing, Pattrawadee; Chokboribal, Jaroenporn; Sangvanich, Polkit

2017-04-01

Acemannan, an acetylated polymannose from Aloe vera, has immunomodulatory effects. We investigated whether acemannan induces IL-6 and -8 expression and NF-κB/DNA binding in human gingival fibroblasts. IL-6 and -8 expression levels were assessed via RT-PCR and ELISA. The NF-κB p50/p65-DNA binding was determined. The structures of acemannan mono-pentamers and Toll-like receptor 5 (TLR5) were simulated. The binding energies between acemannan and TLR5 were identified. We found that acemannan significantly stimulated IL-6/-8 expression at both the mRNA and protein level and significantly increased p50/DNA binding. Preincubation with an anti-TLR5 neutralizing antibody abolished acemannan-induced IL-6/-8 expression and p50/DNA binding, and co-incubation of acemannan with Bay11-7082, a specific NF- κB inhibitor, abolished IL-6/-8 expression. The computer modeling indicated that monomeric/dimeric single stranded acemannan molecules interacted with the TLR5 flagellin recognition sites with a high binding affinity. We conclude that acemannan induces IL-6/-8 expression, and p50/DNA binding in gingival fibroblasts, at least partly, via a TLR5/NF-κB-dependent signaling pathway. Furthermore, acemannan selectively binds with TLR5 ectodomain flagellin recognition sites. Copyright © 2017 Elsevier Ltd. All rights reserved.

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

PubMed

Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

1993-11-11

Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

Binding of nucleotides by T4 DNA ligase and T4 RNA ligase: optical absorbance and fluorescence studies.

PubMed Central

Cherepanov, A V; de Vries, S

2001-01-01

The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015

RNA from the 5' end of the R2 retrotransposon controls R2 protein binding to and cleavage of its DNA target site.

PubMed

Christensen, Shawn M; Ye, Junqiang; Eickbush, Thomas H

2006-11-21

Non-LTR retrotransposons insert into eukaryotic genomes by target-primed reverse transcription (TPRT), a process in which cleaved DNA targets are used to prime reverse transcription of the element's RNA transcript. Many of the steps in the integration pathway of these elements can be characterized in vitro for the R2 element because of the rigid sequence specificity of R2 for both its DNA target and its RNA template. R2 retrotransposition involves identical subunits of the R2 protein bound to different DNA sequences upstream and downstream of the insertion site. The key determinant regulating which DNA-binding conformation the protein adopts was found to be a 320-nt RNA sequence from near the 5' end of the R2 element. In the absence of this 5' RNA the R2 protein binds DNA sequences upstream of the insertion site, cleaves the first DNA strand, and conducts TPRT when RNA containing the 3' untranslated region of the R2 transcript is present. In the presence of the 320-nt 5' RNA, the R2 protein binds DNA sequences downstream of the insertion site. Cleavage of the second DNA strand by the downstream subunit does not appear to occur until after the 5' RNA is removed from this subunit. We postulate that the removal of the 5' RNA normally occurs during reverse transcription, and thus provides a critical temporal link to first- and second-strand DNA cleavage in the R2 retrotransposition reaction.

The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

PubMed Central

Bauer, Robert J.; Evans, Thomas C.; Lohman, Gregory J. S.

2016-01-01

DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site. PMID:26954034

The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase.

PubMed

Bauer, Robert J; Evans, Thomas C; Lohman, Gregory J S

2016-01-01

DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site.

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

On binding specificity of (6-4) photolyase to a T(6-4)T DNA photoproduct*

NASA Astrophysics Data System (ADS)

Jepsen, Katrine Aalbæk; Solov'yov, Ilia A.

2017-06-01

Different factors lead to DNA damage and if it is not repaired in due time, the damaged DNA could initiate mutagenesis and cancer. To avoid this deadly scenario, specific enzymes can scavenge and repair the DNA, but the enzymes have to bind first to the damaged sites. We have investigated this binding for a specific enzyme called (6-4) photolyase, which is capable of repairing certain UV-induced damage in DNA. Through molecular dynamics simulations we describe the binding between photolyase and the DNA and reveal that several charged amino acid residues in the enzyme, such as arginines and lysines turn out to be important. Especially R421 is crucial, as it keeps the DNA strands at the damaged site inside the repair pocket of the enzyme separated. DNA photolyase is structurally highly homologous to a protein called cryptochrome. Both proteins are biologically activated similarly, namely through flavin co-factor photoexcitation. It is, however, striking that cryptochrome cannot repair UV-damaged DNA. The present investigation allowed us to conclude on the small but, apparently, critical differences between photolyase and cryptochrome. The performed analysis gives insight into important factors that govern the binding of UV-damaged DNA and reveal why cryptochrome cannot have this functionality.

Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.

PubMed

Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George

2010-04-01

The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.

Study on the binding of procaine hydrochloride to DNA/DNA bases and the effect of CdS nanoparticles on the binding behavior.

PubMed

Ping, Gang; Lv, Gang; Gutmann, Sebastian; Chen, Chen; Zhang, Renyun; Wang, Xuemei

2006-01-01

The interaction between procaine hydrochloride and DNA/DNA bases in the absence and presence of cadmium sulfide (CdS) nanoparticles has been explored in this study by using differential pulse voltammetry, atomic force microscopy (AFM) and so on, which illustrates the different binding behaviors of procaine hydrochloride with different DNA bases. The results clearly indicate that the binding of purines to procaine hydrochloride is stronger than that of pyrimidines and the binding affinity is in the order of G > A > T > C. In addition, it was observed that the presence of CdS nanoparticles could remarkably enhance the probing sensitivity for the interaction between procaine hydrochloride and DNA/DNA bases. Furthermore, AFM study illustrates that procaine hydrochloride can bind to some specific sites of DNA chains, which indicates that procaine hydrochloride may interact with some special sequences of DNA.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

NASA Astrophysics Data System (ADS)

Lengyel, Iván M.; Morelli, Luis G.

2017-04-01

Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

USF-related transcription factor, HIV-TF1, stimulates transcription of human immunodeficiency virus-1.

PubMed

Maekawa, T; Sudo, T; Kurimoto, M; Ishii, S

1991-09-11

The transcription factor HIV-TF1, which binds to a region about 60 bp upstream from the enhancer of the human immunodeficiency virus-1 (HIV-1), was purified from human B cells. HIV-TF1 had a molecular weight of 39,000. Binding of HIV-TF1 to the HIV long terminal repeat (LTR) activated transcription from the HIV promoter in vitro. The HIV-TF1-binding site in HIV LTR was similar to the site recognized by upstream stimulatory factor (USF) in the adenovirus major late promoter. DNA-binding properties of HIV-TF1 suggested that HIV-TF1 might be identical or related to USF. Interestingly, treatment of purified HIV-TF1 by phosphatase greatly reduced its DNA-binding activity, suggesting that phosphorylation of HIV-TF1 was essential for DNA binding. The disruption of HIV-TF1-binding site induced a 60% decrease in the level of transcription from the HIV promoter in vivo. These results suggest that HIV-TF1 is involved in transcriptional regulation of HIV-1.

DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere

2006-01-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.

Timely binding of IHF and Fis to DARS2 regulates ATP–DnaA production and replication initiation

PubMed Central

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-01-01

In Escherichia coli, the ATP-bound form of DnaA (ATP–DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP–DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP–DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP–DnaA was fully active in replication initiation and underwent DnaA–ATP hydrolysis. ADP–DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP–DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP–DnaA production, thereby promoting timely initiation. Moreover, we show that IHF–DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP–DnaA and replication initiation in coordination with the cell cycle and growth phase. PMID:25378325

Context influences on TALE–DNA binding revealed by quantitative profiling

PubMed Central

Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

2015-01-01

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

Context influences on TALE-DNA binding revealed by quantitative profiling.

PubMed

Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

2015-06-11

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

Simultaneous fluorescence light-up and selective multicolor nucleobase recognition based on sequence-dependent strong binding of berberine to DNA abasic site.

PubMed

Wu, Fei; Shao, Yong; Ma, Kun; Cui, Qinghua; Liu, Guiying; Xu, Shujuan

2012-04-28

Label-free DNA nucleobase recognition by fluorescent small molecules has received much attention due to its simplicity in mutation identification and drug screening. However, sequence-dependent fluorescence light-up nucleobase recognition and multicolor emission with individual emission energy for individual nucleobases have been seldom realized. Herein, an abasic site (AP site) in a DNA duplex was employed as a binding field for berberine, one of isoquinoline alkaloids. Unlike weak binding of berberine to the fully matched DNAs without the AP site, strong binding of berberine to the AP site occurs and the berberine's fluorescence light-up behaviors are highly dependent on the target nucleobases opposite the AP site in which the targets thymine and cytosine produce dual emission bands, while the targets guanine and adenine only give a single emission band. Furthermore, more intense emissions are observed for the target pyrimidines than purines. The flanking bases of the AP site also produce some modifications of the berberine's emission behavior. The binding selectivity of berberine at the AP site is also confirmed by measurements of fluorescence resonance energy transfer, excited-state lifetime, DNA melting and fluorescence quenching by ferrocyanide and sodium chloride. It is expected that the target pyrimidines cause berberine to be stacked well within DNA base pairs near the AP site, which results in a strong resonance coupling of the electronic transitions to the particular vibration mode to produce the dual emissions. The fluorescent signal-on and emission energy-modulated sensing for nucleobases based on this fluorophore is substantially advantageous over the previously used fluorophores. We expect that this approach will be developed as a practical device for differentiating pyrimidines from purines by positioning an AP site toward a target that is available for readout by this alkaloid probe. This journal is © The Royal Society of Chemistry 2012

Facilitated dissociation of transcription factors from single DNA binding sites

PubMed Central

Kamar, Ramsey I.; Banigan, Edward J.; Erbas, Aykut; Giuntoli, Rebecca D.; Olvera de la Cruz, Monica; Johnson, Reid C.; Marko, John F.

2017-01-01

The binding of transcription factors (TFs) to DNA controls most aspects of cellular function, making the understanding of their binding kinetics imperative. The standard description of bimolecular interactions posits that TF off rates are independent of TF concentration in solution. However, recent observations have revealed that proteins in solution can accelerate the dissociation of DNA-bound proteins. To study the molecular basis of facilitated dissociation (FD), we have used single-molecule imaging to measure dissociation kinetics of Fis, a key Escherichia coli TF and major bacterial nucleoid protein, from single dsDNA binding sites. We observe a strong FD effect characterized by an exchange rate ∼1×104 M−1s−1, establishing that FD of Fis occurs at the single-binding site level, and we find that the off rate saturates at large Fis concentrations in solution. Although spontaneous (i.e., competitor-free) dissociation shows a strong salt dependence, we find that FD depends only weakly on salt. These results are quantitatively explained by a model in which partially dissociated bound proteins are susceptible to invasion by competitor proteins in solution. We also report FD of NHP6A, a yeast TF with structure that differs significantly from Fis. We further perform molecular dynamics simulations, which indicate that FD can occur for molecules that interact far more weakly than those that we have studied. Taken together, our results indicate that FD is a general mechanism assisting in the local removal of TFs from their binding sites and does not necessarily require cooperativity, clustering, or binding site overlap. PMID:28364020

Specificity of the weak binding between the phage SPO1 transcription-inhibitory protein, TF1, and SPO1 DNA.

PubMed

Johnson, G G; Geiduschek, E P

1977-04-05

The interaction of the phage SPO1 protein transcription factor 1 (TF1), with DNA has been analyzed by membrane filter binding and by sedimentation methods. Substantially specific binding of TF1 to helical SPO1 DNA can be demonstrated by nitrocellulose filter-binding assays at relatively low ionic strength (0.08). However, TF1-DNA complexes dissociate and reequilibrate relatively rapidly and this makes filter-binding assays unsuitable for quantitative measurements of binding equilibra. Accordingly, the sedimentation properties of TF1-DNA complexes have been explored and a short-column centrifugation assay has been elaborated for quantitative measurements. Preferential binding of TF1 to the hydroxymethyluracil-containing SPO1 DNA has also been demonstrated by short-column centrifugation. TF1 binds relatively weakly and somewhat cooperatively to SPO1 DNA at many sites; TF1-DNA complexes dissociate and reequilibrate rapidly. At 20 degrees C in 0.01 M phosphate, pH 7.5, 0.15 KC1, one molecule of TF1 can bind to approximately every 60 nucleotide pairs of SPO1 DNA.

Multivalent DNA-binding properties of the HMG-1 proteins.

PubMed Central

Maher, J F; Nathans, D

1996-01-01

HMG-I proteins are DNA-binding proteins thought to affect the formation and function of transcription complexes. Each protein contains three DNA-binding motifs, known as AT-hooks, that bind in the minor groove of AT tracts in DNA. Multiple AT-hooks within a polypeptide chain should contact multiple AT tracts, but the rules governing these interactions have not been defined. In this study, we demonstrate that high-affinity binding uses two or three appropriately spaced AT tracts as a single multivalent binding site. These principles have implications for binding to regulatory elements such as the interferon beta enhancer, TATA boxes, and serum response elements. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:8692884

Thermodynamic Characterization of Binding Oxytricha nova Single Strand Telomere DNA with the Alpha Protein N-terminal Domain

PubMed Central

Buczek, Pawel; Horvath, Martin P.

2010-01-01

The Oxytricha nova telomere binding protein alpha subunit binds single strand DNA and participates in a nucleoprotein complex that protects the very ends of chromosomes. To understand how the N-terminal, DNA binding domain of alpha interacts with DNA we measured the stoichiometry, enthalpy (ΔH), entropy (ΔS), and dissociation constant (KD-DNA) for binding telomere DNA fragments at different temperatures and salt concentrations using native gel electrophoresis and isothermal titration calorimetry (ITC). About 85% of the total free energy of binding corresponded with non-electrostatic interactions for all DNAs. Telomere DNA fragments d(T2G4), d(T4G4), d(G3T4G4), and d(G4T4G4) each formed monovalent protein complexes. In the case of d(T4G4T4G4), which has two tandemly repeated d(TTTTTGGGG) telomere motifs, two binding sites were observed. The high-affinity “A site” has a dissociation constant, KD-DNA(A)=13(±4) nM, while the low-affinity “B site” is characterized by KD-DNA(B)=5600(±600) nM at 25 °C. Nucleotide substitution variants verified that the A site corresponds principally with the 3′-terminal portion of d(T4G4T4G4). The relative contributions of entropy (ΔS) and enthalpy (ΔH) for binding reactions were DNA length-dependent as was heat capacity (ΔCp). These trends with respect to DNA length likely reflect structural transitions in the DNA molecule that are coupled with DNA–protein association. Results presented here are important for understanding early intermediates and subsequent stages in the assembly of the full telomere nucleoprotein complex and how binding events can prepare the telomere DNA for extension by telomerase, a critical event in telomere biology. PMID:16678852

PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

PubMed Central

Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

2016-01-01

Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

Theoretical modeling of masking DNA application in aptamer-facilitated biomarker discovery.

PubMed

Cherney, Leonid T; Obrecht, Natalia M; Krylov, Sergey N

2013-04-16

In aptamer-facilitated biomarker discovery (AptaBiD), aptamers are selected from a library of random DNA (or RNA) sequences for their ability to specifically bind cell-surface biomarkers. The library is incubated with intact cells, and cell-bound DNA molecules are separated from those unbound and amplified by the polymerase chain reaction (PCR). The partitioning/amplification cycle is repeated multiple times while alternating target cells and control cells. Efficient aptamer selection in AptaBiD relies on the inclusion of masking DNA within the cell and library mixture. Masking DNA lacks primer regions for PCR amplification and is typically taken in excess to the library. The role of masking DNA within the selection mixture is to outcompete any nonspecific binding sequences within the initial library, thus allowing specific DNA sequences (i.e., aptamers) to be selected more efficiently. Efficient AptaBiD requires an optimum ratio of masking DNA to library DNA, at which aptamers still bind specific binding sites but nonaptamers within the library do not bind nonspecific binding sites. Here, we have developed a mathematical model that describes the binding processes taking place within the equilibrium mixture of masking DNA, library DNA, and target cells. An obtained mathematical solution allows one to estimate the concentration of masking DNA that is required to outcompete the library DNA at a desirable ratio of bound masking DNA to bound library DNA. The required concentration depends on concentrations of the library and cells as well as on unknown cell characteristics. These characteristics include the concentration of total binding sites on the cell surface, N, and equilibrium dissociation constants, K(nsL) and K(nsM), for nonspecific binding of the library DNA and masking DNA, respectively. We developed a theory that allows the determination of N, K(nsL), and K(nsM) based on measurements of EC50 values for cells mixed separately with the library and masking DNA (EC50 is the concentration of fluorescently labeled DNA at which half of the maximum fluorescence signal from DNA-bound cells is reached). We also obtained expressions for signals from bound DNA (measured by flow cytometry) in terms of N, K(nsL), and K(nsM). These expressions can be used for the verification of N, K(nsL), and K(nsM) values found from EC50 measurements. The developed procedure was applied to MCF-7 breast cancer cells, and corresponding values of N, K(nsL), and K(nsM) were established for the first time. The concentration of masking DNA required for AptaBiD with MCF-7 breast cancer cells was also estimated.

LncRNA/DNA binding analysis reveals losses and gains and lineage specificity of genomic imprinting in mammals.

PubMed

Liu, Haihua; Shang, Xiaoxiao; Zhu, Hao

2017-05-15

Genomic imprinting is regulated by lncRNAs and is important for embryogenesis, physiology and behaviour in mammals. Aberrant imprinting causes diseases and disorders. Experimental studies have examined genomic imprinting primarily in humans and mice, thus leaving some fundamental issues poorly addressed. The cost of experimentally examining imprinted genes in many tissues in diverse species makes computational analysis of lncRNAs' DNA binding sites valuable. We performed lncRNA/DNA binding analysis in imprinting clusters from multiple mammalian clades and discovered the following: (i) lncRNAs and imprinting sites show significant losses and gains and distinct lineage-specificity; (ii) binding of lncRNAs to promoters of imprinted genes may occur widely throughout the genome; (iii) a considerable number of imprinting sites occur in only evolutionarily more derived species; and (iv) multiple lncRNAs may bind to the same imprinting sites, and some lncRNAs have multiple DNA binding motifs. These results suggest that the occurrence of abundant lncRNAs in mammalian genomes makes genomic imprinting a mechanism of adaptive evolution at the epigenome level. The data and program are available at the database LongMan at lncRNA.smu.edu.cn. zhuhao@smu.edu.cn. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Characterization of the DNA binding properties of polyomavirus capsid protein

NASA Technical Reports Server (NTRS)

Chang, D.; Cai, X.; Consigli, R. A.; Spooner, B. S. (Principal Investigator)

1993-01-01

The DNA binding properties of the polyomavirus structural proteins VP1, VP2, and VP3 were studied by Southwestern analysis. The major viral structural protein VP1 and host-contributed histone proteins of polyomavirus virions were shown to exhibit DNA binding activity, but the minor capsid proteins VP2 and VP3 failed to bind DNA. The N-terminal first five amino acids (Ala-1 to Lys-5) were identified as the VP1 DNA binding domain by genetic and biochemical approaches. Wild-type VP1 expressed in Escherichia coli (RK1448) exhibited DNA binding activity, but the N-terminal truncated VP1 mutants (lacking Ala-1 to Lys-5 and Ala-1 to Cys-11) failed to bind DNA. The synthetic peptide (Ala-1 to Cys-11) was also shown to have an affinity for DNA binding. Site-directed mutagenesis of the VP1 gene showed that the point mutations at Pro-2, Lys-3, and Arg-4 on the VP1 molecule did not affect DNA binding properties but that the point mutation at Lys-5 drastically reduced DNA binding affinity. The N-terminal (Ala-1 to Lys-5) region of VP1 was found to be essential and specific for DNA binding, while the DNA appears to be non-sequence specific. The DNA binding domain and the nuclear localization signal are located in the same N-terminal region.

Requirement for transient metal ions revealed through computational analysis for DNA polymerase going in reverse

PubMed Central

Perera, Lalith; Freudenthal, Bret D.; Beard, William A.; Shock, David D.; Pedersen, Lee G.; Wilson, Samuel H.

2015-01-01

DNA polymerases facilitate faithful insertion of nucleotides, a central reaction occurring during DNA replication and repair. DNA synthesis (forward reaction) is “balanced,” as dictated by the chemical equilibrium by the reverse reaction of pyrophosphorolysis. Two closely spaced divalent metal ions (catalytic and nucleotide-binding metals) provide the scaffold for these reactions. The catalytic metal lowers the pKa of O3′ of the growing primer terminus, and the nucleotide-binding metal facilitates substrate binding. Recent time-lapse crystallographic studies of DNA polymerases have identified an additional metal ion (product metal) associated with pyrophosphate formation, leading to the suggestion of its possible involvement in the reverse reaction. Here, we establish a rationale for a role of the product metal using quantum mechanical/molecular mechanical calculations of the reverse reaction in the confines of the DNA polymerase β active site. Additionally, site-directed mutagenesis identifies essential residues and metal-binding sites necessary for pyrophosphorolysis. The results indicate that the catalytic metal site must be occupied by a magnesium ion for pyrophosphorolysis to occur. Critically, the product metal site is occupied by a magnesium ion early in the pyrophosphorolysis reaction path but must be removed later. The proposed dynamic nature of the active site metal ions is consistent with crystallographic structures. The transition barrier for pyrophosphorolysis was estimated to be significantly higher than that for the forward reaction, consistent with kinetic activity measurements of the respective reactions. These observations provide a framework to understand how ions and active site changes could modulate the internal chemical equilibrium of a reaction that is central to genome stability. PMID:26351676

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System.

PubMed

Cooper, Lauren A; Stringer, Anne M; Wade, Joseph T

2018-04-17

In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo , for the type I-E system of Escherichia coli Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5' end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. IMPORTANCE Many bacterial and archaeal species encode CRISPR-Cas immunity systems that protect against invasion by foreign DNA. In the Escherichia coli CRISPR-Cas system, a protein complex, Cascade, binds 61-nucleotide (nt) CRISPR RNAs (crRNAs). The Cascade complex is directed to invading DNA molecules through base pairing between the crRNA and target DNA. This leads to recruitment of the Cas3 nuclease, which destroys the invading DNA molecule and promotes acquisition of new immunity elements. We made the first in vivo measurements of Cascade binding to DNA targets. Thus, we show that Cascade binding to DNA is highly promiscuous; endogenous E. coli crRNAs can direct Cascade binding to >100 chromosomal locations. In contrast, we show that targeted degradation and acquisition of new immunity elements require highly specific association of Cascade with DNA, limiting CRISPR-Cas function to the appropriate targets. Copyright © 2018 Cooper et al.

Programmable RNA recognition and cleavage by CRISPR/Cas9.

PubMed

O'Connell, Mitchell R; Oakes, Benjamin L; Sternberg, Samuel H; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A

2014-12-11

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA-DNA complementarity to identify target sites for sequence-specific double-stranded DNA (dsDNA) cleavage. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, known as the protospacer adjacent motif (PAM), next to and on the strand opposite the twenty-nucleotide target site in dsDNA. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in a large range of prokaryotic and eukaryotic cell types, and in whole organisms, but it has been thought to be incapable of targeting RNA. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalysed DNA cleavage. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous messenger RNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable transcript recognition without the need for tags.

Programmable RNA recognition and cleavage by CRISPR/Cas9

PubMed Central

O’Connell, Mitchell R.; Oakes, Benjamin L.; Sternberg, Samuel H.; East-Seletsky, Alexandra; Kaplan, Matias; Doudna, Jennifer A.

2014-01-01

The CRISPR-associated protein Cas9 is an RNA-guided DNA endonuclease that uses RNA:DNA complementarity to identify target sites for sequence-specific doublestranded DNA (dsDNA) cleavage1-5. In its native context, Cas9 acts on DNA substrates exclusively because both binding and catalysis require recognition of a short DNA sequence, the protospacer adjacent motif (PAM), next to and on the strand opposite the 20-nucleotide target site in dsDNA4-7. Cas9 has proven to be a versatile tool for genome engineering and gene regulation in many cell types and organisms8, but it has been thought to be incapable of targeting RNA5. Here we show that Cas9 binds with high affinity to single-stranded RNA (ssRNA) targets matching the Cas9-associated guide RNA sequence when the PAM is presented in trans as a separate DNA oligonucleotide. Furthermore, PAM-presenting oligonucleotides (PAMmers) stimulate site-specific endonucleolytic cleavage of ssRNA targets, similar to PAM-mediated stimulation of Cas9-catalyzed DNA cleavage7. Using specially designed PAMmers, Cas9 can be specifically directed to bind or cut RNA targets while avoiding corresponding DNA sequences, and we demonstrate that this strategy enables the isolation of a specific endogenous mRNA from cells. These results reveal a fundamental connection between PAM binding and substrate selection by Cas9, and highlight the utility of Cas9 for programmable and tagless transcript recognition. PMID:25274302

Structural and Functional Analysis of DDX41: a bispecific immune receptor for DNA and cyclic dinucleotide

PubMed Central

Omura, Hiroki; Oikawa, Daisuke; Nakane, Takanori; Kato, Megumi; Ishii, Ryohei; Ishitani, Ryuichiro; Tokunaga, Fuminori; Nureki, Osamu

2016-01-01

In the innate immune system, pattern recognition receptors (PRRs) specifically recognize ligands derived from bacteria or viruses, to trigger the responsible downstream pathways. DEAD box protein 41 (DDX41) is an intracellular PRR that triggers the downstream pathway involving the adapter STING, the kinase TBK1, and the transcription factor IRF3, to activate the type I interferon response. DDX41 is unique in that it recognizes two different ligands; i.e., double-stranded DNA (dsDNA) and cyclic dinucleotides (CDN), via its DEAD domain. However, the structural basis for the ligand recognition by the DDX41 DEAD domain has remained elusive. Here, we report two crystal structures of the DDX41 DEAD domain in apo forms, at 1.5 and 2.2 Å resolutions. A comparison of the two crystal structures revealed the flexibility in the ATP binding site, suggesting its formation upon ATP binding. Structure-guided functional analyses in vitro and in vivo demonstrated the overlapped binding surface for dsDNA and CDN, which is distinct from the ATP-binding site. We propose that the structural rearrangement of the ATP binding site is crucial for the release of ADP, enabling the fast turnover of DDX41 for the dsDNA/CDN-induced STING activation pathway. PMID:27721487

The Arabidopsis class I TCP transcription factor AtTCP11 is a developmental regulator with distinct DNA-binding properties due to the presence of a threonine residue at position 15 of the TCP domain.

PubMed

Viola, Ivana L; Uberti Manassero, Nora G; Ripoll, Rodrigo; Gonzalez, Daniel H

2011-04-01

The TCP domain is a DNA-binding domain present in plant transcription factors that modulate different processes. In the present study, we show that Arabidopsis class I TCP proteins are able to interact with a dyad-symmetric sequence composed of two GTGGG half-sites. TCP20 establishes symmetric interactions with the 5' half of each strand, whereas TCP11 interacts mainly with the 3' half. SELEX (systematic evolution of ligands by exponential enrichment) experiments with TCP15 and TCP20 indicated that these proteins have similar, although not identical, DNA-binding preferences and are able to interact with non-palindromic binding sites of the type GTGGGNCCNN. TCP11 shows a different DNA-binding specificity, with a preference for the sequence GTGGGCCNNN. The distinct DNA-binding properties of TCP11 are due to the presence of a threonine residue at position 15 of the TCP domain, a position that is occupied by an arginine residue in most TCP proteins. TCP11 also forms heterodimers with TCP15 that have increased DNA-binding efficiency. The expression in plants of a repressor form of TCP11 demonstrated that this protein is a developmental regulator that influences the growth of leaves, stems and petioles, and pollen development. The results suggest that changes in DNA-binding preferences may be one of the mechanisms through which class I TCP proteins achieve functional specificity.

Mapping the interactions of the single-stranded DNA binding protein of bacteriophage T4 (gp32) with DNA lattices at single nucleotide resolution: polynucleotide binding and cooperativity

PubMed Central

Jose, Davis; Weitzel, Steven E.; Baase, Walter A.; Michael, Miya M.; von Hippel, Peter H.

2015-01-01

We here use our site-specific base analog mapping approach to study the interactions and binding equilibria of cooperatively-bound clusters of the single-stranded DNA binding protein (gp32) of the T4 DNA replication complex with longer ssDNA (and dsDNA) lattices. We show that in cooperatively bound clusters the binding free energy appears to be equi-partitioned between the gp32 monomers of the cluster, so that all bind to the ssDNA lattice with comparable affinity, but also that the outer domains of the gp32 monomers at the ends of the cluster can fluctuate on and off the lattice and that the clusters of gp32 monomers can slide along the ssDNA. We also show that at very low binding densities gp32 monomers bind to the ssDNA lattice at random, but that cooperatively bound gp32 clusters bind preferentially at the 5′-end of the ssDNA lattice. We use these results and the gp32 monomer-binding results of the companion paper to propose a detailed model for how gp32 might bind to and interact with ssDNA lattices in its various binding modes, and also consider how these clusters might interact with other components of the T4 DNA replication complex. PMID:26275774

A Monofunctional Platinum Complex Coordinated to a Rhodium Metalloinsertor Selectively Binds Mismatched DNA in the Minor Groove

PubMed Central

Weidmann, Alyson G.; Barton, Jacqueline K.

2015-01-01

We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh—O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA non-classically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors. PMID:26397309

A monofunctional platinum complex coordinated to a rhodium metalloinsertor selectively binds mismatched DNA in the minor groove.

PubMed

Weidmann, Alyson G; Barton, Jacqueline K

2015-10-05

We report the synthesis and characterization of a bimetallic complex derived from a new family of potent and selective metalloinsertors containing an unusual Rh-O axial coordination. This complex incorporates a monofunctional platinum center containing only one labile site for coordination to DNA, rather than two, and coordinates DNA nonclassically through adduct formation in the minor groove. This conjugate displays bifunctional, interdependent binding of mismatched DNA via metalloinsertion at a mismatch as well as covalent platinum binding. DNA sequencing experiments revealed that the preferred site of platinum coordination is not the traditional N7-guanine site in the major groove, but rather N3-adenine in the minor groove. The complex also displays enhanced cytotoxicity in mismatch repair-deficient and mismatch repair-proficient human colorectal carcinoma cell lines compared to the chemotherapeutic cisplatin, and it triggers cell death via an apoptotic pathway, rather than the necrotic pathway induced by rhodium metalloinsertors.

Monitoring Replication Protein A (RPA) dynamics in homologous recombination through site-specific incorporation of non-canonical amino acids.

PubMed

Pokhrel, Nilisha; Origanti, Sofia; Davenport, Eric Parker; Gandhi, Disha; Kaniecki, Kyle; Mehl, Ryan A; Greene, Eric C; Dockendorff, Chris; Antony, Edwin

2017-09-19

An essential coordinator of all DNA metabolic processes is Replication Protein A (RPA). RPA orchestrates these processes by binding to single-stranded DNA (ssDNA) and interacting with several other DNA binding proteins. Determining the real-time kinetics of single players such as RPA in the presence of multiple DNA processors to better understand the associated mechanistic events is technically challenging. To overcome this hurdle, we utilized non-canonical amino acids and bio-orthogonal chemistry to site-specifically incorporate a chemical fluorophore onto a single subunit of heterotrimeric RPA. Upon binding to ssDNA, this fluorescent RPA (RPAf) generates a quantifiable change in fluorescence, thus serving as a reporter of its dynamics on DNA in the presence of multiple other DNA binding proteins. Using RPAf, we describe the kinetics of facilitated self-exchange and exchange by Rad51 and mediator proteins during various stages in homologous recombination. RPAf is widely applicable to investigate its mechanism of action in processes such as DNA replication, repair and telomere maintenance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

Site-directed mutagenesis study on DNA binding regions of the mouse homologue of Suppressor of Hairless, RBP-J kappa.

PubMed Central

Chung, C N; Hamaguchi, Y; Honjo, T; Kawaichi, M

1994-01-01

To map regions important for DNA binding of the mouse homologue of Suppressor of Hairless or RBP-J kappa protein, mutated mouse RBP-J kappa cDNAs were made by insertion of oligonucleotide linkers or base replacement. DNA binding assays using the mutated proteins expressed in COS cells showed that various mutations between 218 Arg and 227 Arg decreased the DNA binding activity drastically. The DNA binding activity was not affected by amino acid replacements within the integrase motif of the RBP-J kappa protein (230His-269His). Replacements between 291Arg and 323Tyr affected the DNA binding activity slightly but reproducibly. These results indicate that the region encompassing 218Arg-227Arg is critical for the DNA binding activity of RBP-J kappa. This region did not show any significant homology to motifs or domains of the previously described DNA binding proteins. Using a truncation mutant protein RBP-J kappa was shown to associate with DNA as a monomer. Images PMID:8065905

Thermodynamics of DNA target site recognition by homing endonucleases

PubMed Central

Eastberg, Jennifer H.; Smith, Audrey McConnell; Zhao, Lei; Ashworth, Justin; Shen, Betty W.; Stoddard, Barry L.

2007-01-01

The thermodynamic profiles of target site recognition have been surveyed for homing endonucleases from various structural families. Similar to DNA-binding proteins that recognize shorter target sites, homing endonucleases display a narrow range of binding free energies and affinities, mediated by structural interactions that balance the magnitude of enthalpic and entropic forces. While the balance of ΔH and TΔS are not strongly correlated with the overall extent of DNA bending, unfavorable ΔHbinding is associated with unstacking of individual base steps in the target site. The effects of deleterious basepair substitutions in the optimal target sites of two LAGLIDADG homing endonucleases, and the subsequent effect of redesigning one of those endonucleases to accommodate that DNA sequence change, were also measured. The substitution of base-specific hydrogen bonds in a wild-type endonuclease/DNA complex with hydrophobic van der Waals contacts in a redesigned complex reduced the ability to discriminate between sites, due to nonspecific ΔSbinding. PMID:17947319

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

Titration of DnaA protein by oriC DnaA-boxes increases dnaA gene expression in Escherichia coli.

PubMed Central

Hansen, F G; Koefoed, S; Sørensen, L; Atlung, T

1987-01-01

Binding of the DnaA protein to its binding sites, the DnaA-boxes (TTATCCACA), was measured by a simple physiological approach. The presence of extra DnaA-boxes in growing cells leads to a derepression of dnaA gene expression, measured as beta-galactosidase activity of a dnaA-lacZ fusion polypeptide. Different DnaA-boxes caused different degrees of derepression indicating that the DnaA protein requires sequences in addition to the DnaA-box for efficient binding. The DnaA-boxes in oriC might act cooperatively in binding of the DnaA protein. The derepressed levels of DnaA protein obtained in a strain carrying an oriC+-pBR322 chimera were very high and sufficient to activate oriC on the chimeric plasmid, which was maintained at a copy number more than three times that of pBR322. PMID:3034578

Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

PubMed

Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

2007-11-02

The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed Central

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-01-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

PubMed

Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

1995-03-01

A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

Programmable Oligomers Targeting 5′-GGGG-3′ in the Minor Groove of DNA and NF-κB Binding Inhibition

PubMed Central

Chenoweth, David M.; Poposki, Julie A.; Marques, Michael A.; Dervan, Peter B.

2009-01-01

A series of hairpin oligomers containing benzimidazole (Bi) and imidazopyridine (Ip) rings were synthesized and screened to target 5′-WGGGGW-3′, a core sequence in the DNA binding site of NF-κB, a prolific transcription factor important in biology and disease. Five Bi and Ip containing oligomers bound to the 5′-WGGGGW-3′ site with high affinity. One of the oligomers (Im-Im-Im-Im-γ-PyBi-PyBi-β-Dp) was able to inhibit DNA binding by the transcription factor NF-κB. PMID:17095230

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

SOS response in bacteria: Inhibitory activity of lichen secondary metabolites against Escherichia coli RecA protein.

PubMed

Bellio, Pierangelo; Di Pietro, Letizia; Mancini, Alisia; Piovano, Marisa; Nicoletti, Marcello; Brisdelli, Fabrizia; Tondi, Donatella; Cendron, Laura; Franceschini, Nicola; Amicosante, Gianfranco; Perilli, Mariagrazia; Celenza, Giuseppe

2017-06-15

RecA is a bacterial multifunctional protein essential to genetic recombination, error-prone replicative bypass of DNA damages and regulation of SOS response. The activation of bacterial SOS response is directly related to the development of intrinsic and/or acquired resistance to antimicrobials. Although recent studies directed towards RecA inactivation via ATP binding inhibition described a variety of micromolar affinity ligands, inhibitors of the DNA binding site are still unknown. Twenty-seven secondary metabolites classified as anthraquinones, depsides, depsidones, dibenzofurans, diphenyl-butenolides, paraconic acids, pseudo-depsidones, triterpenes and xanthones, were investigated for their ability to inhibit RecA from Escherichia coli. They were isolated in various Chilean regions from 14 families and 19 genera of lichens. The ATP hydrolytic activity of RecA was quantified detecting the generation of free phosphate in solution. The percentage of inhibition was calculated fixing at 100µM the concentration of the compounds. Deeper investigations were reserved to those compounds showing an inhibition higher than 80%. To clarify the mechanism of inhibition, the semi-log plot of the percentage of inhibition vs. ATP and vs. ssDNA, was evaluated. Only nine compounds showed a percentage of RecA inhibition higher than 80% (divaricatic, perlatolic, alpha-collatolic, lobaric, lichesterinic, protolichesterinic, epiphorellic acids, sphaerophorin and tumidulin). The half-inhibitory concentrations (IC 50 ) calculated for these compounds were ranging from 14.2µM for protolichesterinic acid to 42.6µM for sphaerophorin. Investigations on the mechanism of inhibition showed that all compounds behaved as uncompetitive inhibitors for ATP binding site, with the exception of epiphorellic acid which clearly acted as non-competitive inhibitor of the ATP site. Further investigations demonstrated that epiphorellic acid competitively binds the ssDNA binding site. Kinetic data were confirmed by molecular modelling binding predictions which shows that epiphorellic acid is expected to bind the ssDNA site into the L2 loop of RecA protein. In this paper the first RecA ssDNA binding site ligand is described. Our study sets epiphorellic acid as a promising hit for the development of more effective RecA inhibitors. In our drug discovery approach, natural products in general and lichen in particular, represent a successful source of active ligands and structural diversity. Copyright © 2017 Elsevier GmbH. All rights reserved.

How Cations Can Assist DNase I in DNA Binding and Hydrolysis

PubMed Central

Guéroult, Marc; Picot, Daniel; Abi-Ghanem, Joséphine; Hartmann, Brigitte; Baaden, Marc

2010-01-01

DNase I requires Ca2+ and Mg2+ for hydrolyzing double-stranded DNA. However, the number and the location of DNase I ion-binding sites remain unclear, as well as the role of these counter-ions. Using molecular dynamics simulations, we show that bovine pancreatic (bp) DNase I contains four ion-binding pockets. Two of them strongly bind Ca2+ while the other two sites coordinate Mg2+. These theoretical results are strongly supported by revisiting crystallographic structures that contain bpDNase I. One Ca2+ stabilizes the functional DNase I structure. The presence of Mg2+ in close vicinity to the catalytic pocket of bpDNase I reinforces the idea of a cation-assisted hydrolytic mechanism. Importantly, Poisson-Boltzmann-type electrostatic potential calculations demonstrate that the divalent cations collectively control the electrostatic fit between bpDNase I and DNA. These results improve our understanding of the essential role of cations in the biological function of bpDNase I. The high degree of conservation of the amino acids involved in the identified cation-binding sites across DNase I and DNase I-like proteins from various species suggests that our findings generally apply to all DNase I-DNA interactions. PMID:21124947

SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

PubMed Central

Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

2016-01-01

Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

Timely binding of IHF and Fis to DARS2 regulates ATP-DnaA production and replication initiation.

PubMed

Kasho, Kazutoshi; Fujimitsu, Kazuyuki; Matoba, Toshihiro; Oshima, Taku; Katayama, Tsutomu

2014-12-01

In Escherichia coli, the ATP-bound form of DnaA (ATP-DnaA) promotes replication initiation. During replication, the bound ATP is hydrolyzed to ADP to yield the ADP-bound form (ADP-DnaA), which is inactive for initiation. The chromosomal site DARS2 facilitates the regeneration of ATP-DnaA by catalyzing nucleotide exchange between free ATP and ADP bound to DnaA. However, the regulatory mechanisms governing this exchange reaction are unclear. Here, using in vitro reconstituted experiments, we show that two nucleoid-associated proteins, IHF and Fis, bind site-specifically to DARS2 to activate coordinately the exchange reaction. The regenerated ATP-DnaA was fully active in replication initiation and underwent DnaA-ATP hydrolysis. ADP-DnaA formed heteromultimeric complexes with IHF and Fis on DARS2, and underwent nucleotide dissociation more efficiently than ATP-DnaA. Consistently, mutant analyses demonstrated that specific binding of IHF and Fis to DARS2 stimulates the formation of ATP-DnaA production, thereby promoting timely initiation. Moreover, we show that IHF-DARS2 binding is temporally regulated during the cell cycle, whereas Fis only binds to DARS2 in exponentially growing cells. These results elucidate the regulation of ATP-DnaA and replication initiation in coordination with the cell cycle and growth phase. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

An asymmetric structure of the Bacillus subtilis replication terminator protein in complex with DNA.

PubMed

Vivian, J P; Porter, C J; Wilce, J A; Wilce, M C J

2007-07-13

In Bacillus subtilis, the termination of DNA replication via polar fork arrest is effected by a specific protein:DNA complex formed between the replication terminator protein (RTP) and DNA terminator sites. We report the crystal structure of a replication terminator protein homologue (RTP.C110S) of B. subtilis in complex with the high affinity component of one of its cognate DNA termination sites, known as the TerI B-site, refined at 2.5 A resolution. The 21 bp RTP:DNA complex displays marked structural asymmetry in both the homodimeric protein and the DNA. This is in contrast to the previously reported complex formed with a symmetrical TerI B-site homologue. The induced asymmetry is consistent with the complex's solution properties as determined using NMR spectroscopy. Concomitant with this asymmetry is variation in the protein:DNA binding pattern for each of the subunits of the RTP homodimer. It is proposed that the asymmetric "wing" positions, as well as other asymmetrical features of the RTP:DNA complex, are critical for the cooperative binding that underlies the mechanism of polar fork arrest at the complete terminator site.

Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

PubMed

Pessler, Frank; Hernandez, Nouria

2003-08-01

POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

Evolutionary transitions to new DNA methyltransferases through target site expansion and shrinkage.

PubMed

Rockah-Shmuel, Liat; Tawfik, Dan S

2012-12-01

DNA-binding and modifying proteins show high specificity but also exhibit a certain level of promiscuity. Such latent promiscuous activities comprise the starting points for new protein functions, but this hypothesis presents a paradox: a new activity can only evolve if it already exists. How then, do novel activities evolve? DNA methyltransferases, for example, are highly divergent in their target sites, but how transitions toward novel sites occur remains unknown. We performed laboratory evolution of the DNA methyltransferase M.HaeIII. We found that new target sites emerged primarily through expansion of the original site, GGCC, and the subsequent shrinkage of evolved expanded sites. Variants evolved for sites that are promiscuously methylated by M.HaeIII [GG((A)/(T))CC and GGCGCC] carried mutations in 'gate-keeper' residues. They could thereby methylate novel target sites such as GCGC and GGATCC that were neither selected for nor present in M.HaeIII. These 'generalist' intermediates were further evolved to obtain variants with novel target specificities. Our results demonstrate the ease by which new DNA-binding and modifying specificities evolve and the mechanism by which they occur at both the protein and DNA levels.

Looping and clustering model for the organization of protein-DNA complexes on the bacterial genome

NASA Astrophysics Data System (ADS)

Walter, Jean-Charles; Walliser, Nils-Ole; David, Gabriel; Dorignac, Jérôme; Geniet, Frédéric; Palmeri, John; Parmeggiani, Andrea; Wingreen, Ned S.; Broedersz, Chase P.

2018-03-01

The bacterial genome is organized by a variety of associated proteins inside a structure called the nucleoid. These proteins can form complexes on DNA that play a central role in various biological processes, including chromosome segregation. A prominent example is the large ParB-DNA complex, which forms an essential component of the segregation machinery in many bacteria. ChIP-Seq experiments show that ParB proteins localize around centromere-like parS sites on the DNA to which ParB binds specifically, and spreads from there over large sections of the chromosome. Recent theoretical and experimental studies suggest that DNA-bound ParB proteins can interact with each other to condense into a coherent 3D complex on the DNA. However, the structural organization of this protein-DNA complex remains unclear, and a predictive quantitative theory for the distribution of ParB proteins on DNA is lacking. Here, we propose the looping and clustering model, which employs a statistical physics approach to describe protein-DNA complexes. The looping and clustering model accounts for the extrusion of DNA loops from a cluster of interacting DNA-bound proteins that is organized around a single high-affinity binding site. Conceptually, the structure of the protein-DNA complex is determined by a competition between attractive protein interactions and loop closure entropy of this protein-DNA cluster on the one hand, and the positional entropy for placing loops within the cluster on the other. Indeed, we show that the protein interaction strength determines the ‘tightness’ of the loopy protein-DNA complex. Thus, our model provides a theoretical framework for quantitatively computing the binding profiles of ParB-like proteins around a cognate (parS) binding site.

Identification of natural and artificial DNA substrates for the light-activated LOV-HTH transcription factor EL222

PubMed Central

Rivera-Cancel, Giomar; Motta-Mena, Laura B.; Gardner, Kevin H.

2012-01-01

Light-oxygen-voltage (LOV) domains serve as the photosensory modules for a wide range of plant and bacterial proteins, conferring blue light dependent regulation to effector activities as diverse as enzymes and DNA binding. LOV domains can also be engineered into a variety of exogenous targets, enabling similar regulation for new protein-based reagents. Common to these proteins is the ability for LOV domains to reversibly form a photochemical adduct between an internal flavin chromophore and the surrounding protein, using this to trigger conformational changes that affect output activity. Using the Erythrobacter litoralis protein EL222 model system which links LOV regulation to a helix-turn-helix (HTH) DNA binding domain, we demonstrated that the LOV domain binds and inhibits the HTH domain in the dark, releasing these interactions upon illumination [Nash et al. (2011) Proc. Natl. Acad. Sci. USA 108, 9449–9454]. Here we combine genomic and in vitro selection approaches to identify optimal DNA binding sites for EL222. Within the bacterial host, we observe binding several genomic sites using a 12 bp sequence consensus that is also found by in vitro selection methods. Sequence-specific alterations in the DNA consensus reduce EL222-binding affinity in a manner consistent with the expected binding mode: a protein dimer binding to two repeats. Finally, we demonstrate the light-dependent activation of transcription of two genes adjacent to an EL222 binding site. Taken together, these results shed light on the native function of EL222 and provide useful reagents for further basic and applications research of this versatile protein. PMID:23205774

Single-stranded DNA Binding by the Helix-Hairpin-Helix Domain of XPF Protein Contributes to the Substrate Specificity of the ERCC1-XPF Protein Complex*

PubMed Central

Das, Devashish; Faridounnia, Maryam; Kovacic, Lidija; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2017-01-01

The nucleotide excision repair protein complex ERCC1-XPF is required for incision of DNA upstream of DNA damage. Functional studies have provided insights into the binding of ERCC1-XPF to various DNA substrates. However, because no structure for the ERCC1-XPF-DNA complex has been determined, the mechanism of substrate recognition remains elusive. Here we biochemically characterize the substrate preferences of the helix-hairpin-helix (HhH) domains of XPF and ERCC-XPF and show that the binding to single-stranded DNA (ssDNA)/dsDNA junctions is dependent on joint binding to the DNA binding domain of ERCC1 and XPF. We reveal that the homodimeric XPF is able to bind various ssDNA sequences but with a clear preference for guanine-containing substrates. NMR titration experiments and in vitro DNA binding assays also show that, within the heterodimeric ERCC1-XPF complex, XPF specifically recognizes ssDNA. On the other hand, the HhH domain of ERCC1 preferentially binds dsDNA through the hairpin region. The two separate non-overlapping DNA binding domains in the ERCC1-XPF heterodimer jointly bind to an ssDNA/dsDNA substrate and, thereby, at least partially dictate the incision position during damage removal. Based on structural models, NMR titrations, DNA-binding studies, site-directed mutagenesis, charge distribution, and sequence conservation, we propose that the HhH domain of ERCC1 binds to dsDNA upstream of the damage, and XPF binds to the non-damaged strand within a repair bubble. PMID:28028171

Dimerization site 2 of the bacterial DNA-binding protein H-NS is required for gene silencing and stiffened nucleoprotein filament formation.

PubMed

Yamanaka, Yuki; Winardhi, Ricksen S; Yamauchi, Erika; Nishiyama, So-Ichiro; Sowa, Yoshiyuki; Yan, Jie; Kawagishi, Ikuro; Ishihama, Akira; Yamamoto, Kaneyoshi

2018-06-15

The bacterial nucleoid-associated protein H-NS is a DNA-binding protein, playing a major role in gene regulation. To regulate transcription, H-NS silences genes, including horizontally acquired foreign genes. Escherichia coli H-NS is 137 residues long and consists of two discrete and independent structural domains: an N-terminal oligomerization domain and a C-terminal DNA-binding domain, joined by a flexible linker. The N-terminal oligomerization domain is composed of two dimerization sites, dimerization sites 1 and 2, which are both required for H-NS oligomerization, but the exact role of dimerization site 2 in gene silencing is unclear. To this end, we constructed a whole set of single amino acid substitution variants spanning residues 2 to 137. Using a well-characterized H-NS target, the slp promoter of the glutamic acid-dependent acid resistance (GAD) cluster promoters, we screened for any variants defective in gene silencing. Focusing on the function of dimerization site 2, we analyzed four variants, I70C/I70A and L75C/L75A, which all could actively bind DNA but are defective in gene silencing. Atomic force microscopy analysis of DNA-H-NS complexes revealed that all of these four variants formed condensed complexes on DNA, whereas WT H-NS formed rigid and extended nucleoprotein filaments, a conformation required for gene silencing. Single-molecule stretching experiments confirmed that the four variants had lost the ability to form stiffened filaments. We conclude that dimerization site 2 of H-NS plays a key role in the formation of rigid H-NS nucleoprotein filament structures required for gene silencing. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

GBshape: a genome browser database for DNA shape annotations

PubMed Central

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J.; Parker, Stephen C.J.; Nuzhdin, Sergey V.; Tullius, Thomas D.; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. PMID:25326329

Effects of mutations at amino acid 61 in the arm of TF1 on its DNA-binding properties.

PubMed

Sayre, M H; Geiduschek, E P

1990-12-20

Transcription factor 1 (TF1) is the Bacillus subtilis phage SPO1-encoded member of the family of bacterial DNA-binding proteins that includes Escherichia coli HU and integration host factor (IHF). We have initiated a mutational analysis of the TF1 molecule to understand better its unique DNA-binding properties and to investigate its physiological function. We report here the consequences of mutating the putative DNA-binding "arms" of TF1. At position 61 in its primary sequence, TF1 contains a Phe residue in place of the Arg residue found in all other known members of the HU family. Substituting polar, uncharged residues for Phe61 substantially reduced the DNA-binding affinity and site-selectivity of TF1 in vitro, whereas the substitution of Tyr had no effect. Substituting Trp or Arg for Phe61 had little effect on the affinity of TF1 for SPO1 DNA, but altered the electrophoretic mobilities of protein-DNA complexes in non-denaturing gels. The Arg61 substitution increased the affinity of the protein for non-specific sites on thymine-containing DNA, thus reducing the natural preference of TF1 for (5-hydroxymethyluracil)-containing DNA. The Phe61-to-Arg mutation was also correlated with decreased phage yield and aberrant regulation of viral protein synthesis in vivo.

Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

PubMed

Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

2013-03-19

Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

Differences in DNA Binding Specificity of Floral Homeotic Protein Complexes Predict Organ-Specific Target Genes.

PubMed

Smaczniak, Cezary; Muiño, Jose M; Chen, Dijun; Angenent, Gerco C; Kaufmann, Kerstin

2017-08-01

Floral organ identities in plants are specified by the combinatorial action of homeotic master regulatory transcription factors. However, how these factors achieve their regulatory specificities is still largely unclear. Genome-wide in vivo DNA binding data show that homeotic MADS domain proteins recognize partly distinct genomic regions, suggesting that DNA binding specificity contributes to functional differences of homeotic protein complexes. We used in vitro systematic evolution of ligands by exponential enrichment followed by high-throughput DNA sequencing (SELEX-seq) on several floral MADS domain protein homo- and heterodimers to measure their DNA binding specificities. We show that specification of reproductive organs is associated with distinct binding preferences of a complex formed by SEPALLATA3 and AGAMOUS. Binding specificity is further modulated by different binding site spacing preferences. Combination of SELEX-seq and genome-wide DNA binding data allows differentiation between targets in specification of reproductive versus perianth organs in the flower. We validate the importance of DNA binding specificity for organ-specific gene regulation by modulating promoter activity through targeted mutagenesis. Our study shows that intrafamily protein interactions affect DNA binding specificity of floral MADS domain proteins. Differential DNA binding of MADS domain protein complexes plays a role in the specificity of target gene regulation. © 2017 American Society of Plant Biologists. All rights reserved.

Molecular docking studies of curcumin natural derivatives with DNA topoisomerase I and II-DNA complexes.

PubMed

Kumar, Anil; Bora, Utpal

2014-12-01

DNA topoisomerase I (topo I) and II (topo II) are essential enzymes that solve the topological problems of DNA by allowing DNA strands or double helices to pass through each other during cellular processes such as replication, transcription, recombination, and chromatin remodeling. Their critical roles make topoisomerases an attractive drug target against cancer. The present molecular docking study provides insights into the inhibition of topo I and II by curcumin natural derivatives. The binding modes suggested that curcumin natural derivatives docked at the site of DNA cleavage parallel to the axis of DNA base pairing. Cyclocurcumin and curcumin sulphate were predicted to be the most potent inhibitors amongst all the curcumin natural derivatives docked. The binding modes of cyclocurcumin and curcumin sulphate were similar to known inhibitors of topo I and II. Residues like Arg364, Asn722 and base A113 (when docked to topo I-DNA complex) and residues Asp479, Gln778 and base T9 (when docked to topo II-DNA complex) seem to play important role in the binding of curcumin natural derivatives at the site of DNA cleavage.

HMGB1-mediated DNA bending: Distinct roles in increasing p53 binding to DNA and the transactivation of p53-responsive gene promoters.

PubMed

Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva

2018-03-01

HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

PubMed Central

Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

2003-01-01

Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

PubMed

Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

2017-01-01

The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

Origin recognition is the predominant role for DnaA-ATP in initiation of chromosome replication.

PubMed

Grimwade, Julia E; Rozgaja, Tania A; Gupta, Rajat; Dyson, Kyle; Rao, Prassanna; Leonard, Alan C

2018-05-25

In all cells, initiation of chromosome replication depends on the activity of AAA+ initiator proteins that form complexes with replication origin DNA. In bacteria, the conserved, adenosine triphosphate (ATP)-regulated initiator protein, DnaA, forms a complex with the origin, oriC, that mediates DNA strand separation and recruitment of replication machinery. Complex assembly and origin activation requires DnaA-ATP, which differs from DnaA-ADP in its ability to cooperatively bind specific low affinity sites and also to oligomerize into helical filaments. The degree to which each of these activities contributes to the DnaA-ATP requirement for initiation is not known. In this study, we compared the DnaA-ATP dependence of initiation from wild-type Escherichia coli oriC and a synthetic origin (oriCallADP), whose multiple low affinity DnaA sites bind DnaA-ATP and DnaA-ADP similarly. OriCallADP was fully occupied and unwound by DnaA-ADP in vitro, and, in vivo, oriCallADP suppressed lethality of DnaA mutants defective in ATP binding and ATP-specific oligomerization. However, loss of preferential DnaA-ATP binding caused over-initiation and increased sensitivity to replicative stress. The findings indicate both DnaA-ATP and DnaA-ADP can perform most of the mechanical functions needed for origin activation, and suggest that a key reason for ATP-regulation of DnaA is to control replication initiation frequency.

Sensitive and accurate identification of protein–DNA binding events in ChIP-chip assays using higher order derivative analysis

PubMed Central

Barrett, Christian L.; Cho, Byung-Kwan

2011-01-01

Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353

The ATPase domain of the large terminase protein, gp17, from bacteriophage T4 binds DNA: implications to the DNA packaging mechanism.

PubMed

Alam, Tanfis I; Rao, Venigalla B

2008-03-07

Translocation of double-stranded DNA into a preformed capsid by tailed bacteriophages is driven by powerful motors assembled at the special portal vertex. The motor is thought to drive processive cycles of DNA binding, movement, and release to package the viral genome. In phage T4, there is evidence that the large terminase protein, gene product 17 (gp17), assembles into a multisubunit motor and translocates DNA by an inchworm mechanism. gp17 consists of two domains; an N-terminal ATPase domain (amino acids 1-360) that powers translocation of DNA, and a C-terminal nuclease domain (amino acids 361-610) that cuts concatemeric DNA to generate a headful-size viral genome. While the functional motifs of ATPase and nuclease have been well defined and the ATPase atomic structure has been solved, the DNA binding motif(s) responsible for viral DNA recognition, cutting, and translocation are unknown. Here we report the first evidence for the presence of a double-stranded DNA binding activity in the gp17 ATPase domain. Binding to DNA is sensitive to Mg(2+) and salt, but not the type of DNA used. DNA fragments as short as 20 bp can bind to the ATPase but preferential binding was observed to DNA greater than 1 kb. A high molecular weight ATPase-DNA complex was isolated by gel filtration, suggesting oligomerization of ATPase following DNA interaction. DNA binding was not observed with the full-length gp17, or the C-terminal nuclease domain. The small terminase protein, gp16, inhibited DNA binding, which was further accentuated by ATP. The presence of a DNA binding site in the ATPase domain and its binding properties implicate a role in the DNA packaging mechanism.

Structural basis of DNA folding and recognition in an AMP-DNA aptamer complex: distinct architectures but common recognition motifs for DNA and RNA aptamers complexed to AMP.

PubMed

Lin, C H; Patel, D J

1997-11-01

Structural studies by nuclear magnetic resonance (NMR) of RNA and DNA aptamer complexes identified through in vitro selection and amplification have provided a wealth of information on RNA and DNA tertiary structure and molecular recognition in solution. The RNA and DNA aptamers that target ATP (and AMP) with micromolar affinity exhibit distinct binding site sequences and secondary structures. We report below on the tertiary structure of the AMP-DNA aptamer complex in solution and compare it with the previously reported tertiary structure of the AMP-RNA aptamer complex in solution. The solution structure of the AMP-DNA aptamer complex shows, surprisingly, that two AMP molecules are intercalated at adjacent sites within a rectangular widened minor groove. Complex formation involves adaptive binding where the asymmetric internal bubble of the free DNA aptamer zippers up through formation of a continuous six-base mismatch segment which includes a pair of adjacent three-base platforms. The AMP molecules pair through their Watson-Crick edges with the minor groove edges of guanine residues. These recognition G.A mismatches are flanked by sheared G.A and reversed Hoogsteen G.G mismatch pairs. The AMP-DNA aptamer and AMP-RNA aptamer complexes have distinct tertiary structures and binding stoichiometries. Nevertheless, both complexes have similar structural features and recognition alignments in their binding pockets. Specifically, AMP targets both DNA and RNA aptamers by intercalating between purine bases and through identical G.A mismatch formation. The recognition G.A mismatch stacks with a reversed Hoogsteen G.G mismatch in one direction and with an adenine base in the other direction in both complexes. It is striking that DNA and RNA aptamers selected independently from libraries of 10(14) molecules in each case utilize identical mismatch alignments for molecular recognition with micromolar affinity within binding-site pockets containing common structural elements.

Cloning of an SNF2/SWI2-related protein that binds specifically to the SPH motifs of the SV40 enhancer and to the HIV-1 promoter.

PubMed

Sheridan, P L; Schorpp, M; Voz, M L; Jones, K A

1995-03-03

We have isolated a human cDNA clone encoding HIP116, a protein that binds to the SPH repeats of the SV40 enhancer and to the TATA/inhibitor region of the human immunodeficiency virus (HIV)-1 promoter. The predicted HIP116 protein is related to the yeast SNF2/SWI2 transcription factor and to other members of this extended family and contains seven domains similar to those found in the vaccinia NTP1 ATPase. Interestingly, HIP116 also contains a C3HC4 zinc-binding motif (RING finger) interspersed between the ATPase motifs in an arrangement similar to that found in the yeast RAD5 and RAD16 proteins. The HIP116 amino terminus is unique among the members of this family, and houses a specific DNA-binding domain. Antiserum raised against HIP116 recognizes a 116-kDa nuclear protein in Western blots and specifically supershifts SV40 and HIV-1 protein-DNA complexes in gel shift experiments. The binding site for HIP116 on the SV40 enhancer directly overlaps the site for TEF-1, and like TEF-1, binding of HIP116 to the SV40 enhancer is destroyed by mutations that inhibit SPH enhancer activity in vivo. Purified fractions of HIP116 display strong ATPase activity that is preferentially stimulated by SPH DNA and can be inhibited specifically by antibodies to HIP116. These findings suggest that HIP116 might affect transcription, directly or indirectly, by acting as a DNA binding site-specific ATPase.

Ferrate oxidation of Escherichia coli DNA polymerase-I. Identification of a methionine residue that is essential for DNA binding.

PubMed

Basu, A; Williams, K R; Modak, M J

1987-07-15

Treatment of Escherichia coli DNA polymerase-I with potassium ferrate (K2FeO4), a site-specific oxidizing agent for the phosphate group-binding sites of proteins, results in the irreversible inactivation of enzyme activity as judged by the loss of polymerization as well as 3'-5' exonuclease activity. A significant protection from ferrate-mediated inactivation is observed in the presence of DNA but not by substrate deoxynucleoside triphosphates. Furthermore, ferrate-treated enzyme also exhibits loss of template-primer binding activity, whereas its ability to bind substrate triphosphates is unaffected. In addition, comparative high pressure liquid chromatography tryptic peptide maps obtained before and after ferrate oxidation demonstrated that only five peptides of the more than 60 peptide peaks present in the tryptic digest underwent a major change in either peak position or intensity as a result of ferrate treatment. Amino acid analyses and/or sequencing identified four of these affected peaks as corresponding to peptides that span residues 324-340, 437-455, 456-464, and 512-518, respectively. However, only the last peptide, which has the sequence: Met-Trp-Pro-Asp-Leu-Gln-Lys, was significantly protected in the presence of DNA. This latter peptide was also the only peptide whose degree of oxidation correlated directly with the extent of inactivation of the enzyme. Amino acid analysis indicated that methionine 512 is the target site in this peptide for ferrate oxidation. Methionine 512, therefore, appears to be essential for the DNA-binding function of DNA polymerase-I from E. coli.

Max-E47, a Designed Minimalist Protein that Targets the E-Box DNA Site In Vivo and In Vitro

PubMed Central

Xu, Jing; Chen, Gang; De Jong, Antonia T.; Shahravan, S. Hesam; Shin, Jumi A.

2009-01-01

Max-E47 is a designed hybrid protein comprising the Max DNA-binding basic region and E47 HLH dimerization subdomain. In the yeast one-hybrid system (Y1H), Max-E47 shows strong transcriptional activation from the E-box site, 5'-CACGTG, targeted by the Myc/Max/Mad network of transcription factors; two mutants, Max-E47Y and Max-E47YF, activate more weakly from the E-box in the Y1H. Quantitative fluorescence anisotropy titrations to gain free energies of protein:DNA binding gave low nM Kd values for the native MaxbHLHZ, Max-E47, and the Y and YF mutants binding to the E-box site (14 nM, 15 nM, 9 nM, and 6 nM, respectively), with no detectable binding to a nonspecific control duplex. Because these minimalist, E-box-binding hybrids have no activation domain and no interactions with the c-MycbHLHZ, as shown by the yeast two-hybrid assay, they can potentially serve as dominant-negative inhibitors that suppress activation of E-box-responsive genes targeted by transcription factors including the c-Myc/Max complex. As proof-of-principle, we used our modified Y1H, which allows direct competition between two proteins vying for a DNA target, to show that Max-E47 effectively outcompetes the native MaxbHLHZ for the E-box; weaker competition is observed from the two mutants, consistent with Y1H results. These hybrids provide a minimalist scaffold for further exploration of the relationship between protein structure and DNA-binding function and may have applications as protein therapeutics or biochemical probes capable of targeting the E-box site. PMID:19449889

Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

2015-02-01

The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

PubMed

Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

2014-07-01

Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

Diethylpyrocarbonate and permanganate provide evidence for an unusual DNA conformation induced by binding of the antitumour antibiotics bleomycin and phleomycin.

PubMed Central

Fox, K R; Grigg, G W

1988-01-01

DNA structural changes induced by bleomycin have been investigated using diethylpyrocarbonate and permanganate as probes under conditions in which the antibiotic binds to, but does not cut the DNA. Diethyl-pyrocarbonate shows an enhanced reaction with adenines in the presence of the antibiotic in the sequences GTA greater than GCA greater than GAA, on the 3' side of the drug cutting site (GPy). Permanganate ions display an enhanced reactivity at the second pyrimidine of the sequence GPyPy. The results are consistent with a model in which bleomycin distorts the structure of the base pair on the 3' side of its binding site. Images PMID:2451809

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex*

PubMed Central

Douglas, Max E.

2016-01-01

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly (“G1-like”) and high affinity recruitment when CMG assembly takes place (“S-phase-like”). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. PMID:26719337

Isolation of a thyroid hormone-responsive gene by immunoprecipitation of thyroid hormone receptor-DNA complexes.

PubMed Central

Bigler, J; Eisenman, R N

1994-01-01

Thyroid hormone (T3) receptor (TR) is a ligand-dependent transcription factor that acts through specific binding sites in the promoter region of target genes. In order to identify new genes that are regulated by T3, we used anti-TR antiserum to immunoprecipitate TR-DNA complexes from GH4 cell nuclei that had previously been treated with a restriction enzyme. Screening of the immunopurified, cloned DNA for TR binding sites by electrophoretic mobility shift assay yielded 53 positive clones. A subset of these clones was specifically immunoprecipitated with anti-TR antiserum and may therefore represent biologically significant binding sites. One of these clones, clone 122, was characterized in detail. It includes sequences highly related to the NICER long terminal repeat-like element and contains three TR binding sites as determined by DNase I footprinting. Two of the clone 122 TR binding sites are located upstream of the TATA box, and one is located downstream. The TR binding site downstream from the promoter was necessary and sufficient to confer T3-dependent regulation in transient transfection experiments. Expression of a reporter construct under the control of the clone 122 promoter region was activated by TR in the absence of ligand and returned to basal levels after T3 addition. Clone 122 sequences hybridize to at least two different mRNAs of approximately 6 and 10 kb from GH4 cells. The levels of both of these mRNAs increased upon removal of T3. Our studies suggest that specific immunoprecipitation of chromatin allows identification of binding sites and target genes for transcription factors. Images PMID:7935476

Structure-based Analysis to Hu-DNA Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swinger,K.; Rice, P.

2007-01-01

HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

The transformed glucocorticoid receptor has a lower steroid-binding affinity than the nontransformed receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nemoto, Takayuki; Ohara-Nemoto, Yuko; Denis, M.

1990-02-20

High-salt treatment of cytosolic glucocorticoid receptor (GR) preparations reduces the steroid-binding ability of the receptor and induces the conversion of the receptor from a nontransformed (non-DNA-binding) 9S form to a transformed (DNA-binding) 4S entity. Therefore, the authors decided to investigate the possible relationship between these two phenomena. The binding of ({sup 3}H)triamcinolone acetonide (({sup 3}H)TA) to the 9S form was almost saturated at a concentration of 20 nM, whereas ({sup 3}H)TA was hardly bound to the 4S form at this concentration. The 4S form was efficiently labeled at 200 nM. Scatchard analysis of the GR showed the presence of twomore » types of binding sites. In the absence of molybdate, the ratio of the lower affinity site was increased, but the total number of binding sites was not modified. The GR with the low ({sup 3}H)TA-binding affinity bound to DNA-cellulose even in its unliganded state, whereas the form with the high affinity did not. These results indicate that the transformed GR has a reduced ({sup 3}H)TA-binding affinity as compared to the nontransformed GR. The steroid-binding domain (amino acids 477-777) and the DNA- and steroid-binding domains (amino acids 415-777) of the human GR were expressed in Escherichia coli as protein A fused proteins. Taken together, these results suggest that the component(s) associating with the nontransformed GR, possibly the heat shock protein hsp 90, play(s) an important role in stabilizing the GR in a high-affinity state for steroids.« less

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor

NASA Astrophysics Data System (ADS)

Zhang, Xirui; Daaboul, George G.; Spuhler, Philipp S.; Dröge, Peter; Ünlü, M. Selim

2016-03-01

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions. Electronic supplementary information (ESI) available: DNA sequences and nomenclature (Table 1S); SDS-PAGE assay of IHF stock solution (Fig. 1S); determination of the concentration of IHF stock solution by Bradford assay (Fig. 2S); equilibrium binding isotherm fitting results of other DNA sequences (Table 2S); calculation of dissociation constants (Fig. 3S, 4S; Table 2S); geometric model for quantitation of DNA bending angle induced by specific IHF binding (Fig. 4S); customized flow cell assembly (Fig. 5S); real-time measurement of average fluorophore height change by SSFM (Fig. 6S); summary of binding parameters obtained from additive isotherm model fitting (Table 3S); average surface densities of 10 dsDNA spots and bound IHF at equilibrium (Table 4S); effects of surface densities on the binding and bending of dsDNA (Tables 5S, 6S and Fig. 7S-10S). See DOI: 10.1039/c5nr06785e

DOE Office of Scientific and Technical Information (OSTI.GOV)

B Akabayov; C Richardson

Divalent metal ions are crucial as cofactors for a variety of intracellular enzymatic activities. Mg{sup 2+}, as an example, mediates binding of deoxyribonucleoside 5'-triphosphates followed by their hydrolysis in the active site of DNA polymerase. It is difficult to study the binding of Mg{sup 2+} to an active site because Mg{sup 2+} is spectroscopically silent and Mg{sup 2+} binds with low affinity to the active site of an enzyme. Therefore, we substituted Mg{sup 2+} with Mn{sup 2+}:Mn{sup 2+} that is not only visible spectroscopically but also provides full activity of the DNA polymerase of bacteriophage T7. In order to demonstratemore » that the majority of Mn{sup 2+} is bound to the enzyme, we have applied site-directed titration analysis of T7 DNA polymerase using X-ray near edge spectroscopy. Here we show how X-ray near edge spectroscopy can be used to distinguish between signal originating from Mn{sup 2+} that is free in solution and Mn{sup 2+} bound to the active site of T7 DNA polymerase. This method can be applied to other enzymes that use divalent metal ions as a cofactor.« less

The λ Integrase Site-specific Recombination Pathway

PubMed Central

LANDY, ARTHUR

2017-01-01

The site-specific recombinase encoded by bacteriophage λ (Int) is responsible for integrating and excising the viral chromosome into and out of the chromosome of its Escherichia coli host. Int carries out a reaction that is highly directional, tightly regulated, and depends upon an ensemble of accessory DNA bending proteins acting on 240 bp of DNA encoding 16 protein binding sites. This additional complexity enables two pathways, integrative and excisive recombination, whose opposite, and effectively irreversible, directions are dictated by different physiological and environmental signals. Int recombinase is a heterobivalent DNA binding protein and each of the four Int protomers, within a multiprotein 400 kDa recombinogenic complex, is thought to bind and, with the aid of DNA bending proteins, bridge one arm- and one core-type DNA site. In the 12 years since the publication of the last review focused solely on the λ site-specific recombination pathway in Mobile DNA II, there has been a great deal of progress in elucidating the molecular details of this pathway. The most dramatic advances in our understanding of the reaction have been in the area of X-ray crystallography where protein-DNA structures have now been determined for of all of the DNA-protein interfaces driving the Int pathway. Building on this foundation of structures, it has been possible to derive models for the assembly of components that determine the regulatory apparatus in the P-arm, and for the overall architectures that define excisive and integrative recombinogenic complexes. The most fundamental additional mechanistic insights derive from the application of hexapeptide inhibitors and single molecule kinetics. PMID:26104711

Quantitative characterization of conformational-specific protein-DNA binding using a dual-spectral interferometric imaging biosensor.

PubMed

Zhang, Xirui; Daaboul, George G; Spuhler, Philipp S; Dröge, Peter; Ünlü, M Selim

2016-03-14

DNA-binding proteins play crucial roles in the maintenance and functions of the genome and yet, their specific binding mechanisms are not fully understood. Recently, it was discovered that DNA-binding proteins recognize specific binding sites to carry out their functions through an indirect readout mechanism by recognizing and capturing DNA conformational flexibility and deformation. High-throughput DNA microarray-based methods that provide large-scale protein-DNA binding information have shown effective and comprehensive analysis of protein-DNA binding affinities, but do not provide information of DNA conformational changes in specific protein-DNA complexes. Building on the high-throughput capability of DNA microarrays, we demonstrate a quantitative approach that simultaneously measures the amount of protein binding to DNA and nanometer-scale DNA conformational change induced by protein binding in a microarray format. Both measurements rely on spectral interferometry on a layered substrate using a single optical instrument in two distinct modalities. In the first modality, we quantitate the amount of binding of protein to surface-immobilized DNA in each DNA spot using a label-free spectral reflectivity technique that accurately measures the surface densities of protein and DNA accumulated on the substrate. In the second modality, for each DNA spot, we simultaneously measure DNA conformational change using a fluorescence vertical sectioning technique that determines average axial height of fluorophores tagged to specific nucleotides of the surface-immobilized DNA. The approach presented in this paper, when combined with current high-throughput DNA microarray-based technologies, has the potential to serve as a rapid and simple method for quantitative and large-scale characterization of conformational specific protein-DNA interactions.

RecA binding to a single double-stranded DNA molecule: A possible role of DNA conformational fluctuations

PubMed Central

Leger, J. F.; Robert, J.; Bourdieu, L.; Chatenay, D.; Marko, J. F.

1998-01-01

Most genetic regulatory mechanisms involve protein–DNA interactions. In these processes, the classical Watson–Crick DNA structure sometimes is distorted severely, which in turn enables the precise recognition of the specific sites by the protein. Despite its key importance, very little is known about such deformation processes. To address this general question, we have studied a model system, namely, RecA binding to double-stranded DNA. Results from micromanipulation experiments indicate that RecA binds strongly to stretched DNA; based on this observation, we propose that spontaneous thermal stretching fluctuations may play a role in the binding of RecA to DNA. This has fundamental implications for the protein–DNA binding mechanism, which must therefore rely in part on a combination of flexibility and thermal fluctuations of the DNA structure. We also show that this mechanism is sequence sensitive. Theoretical simulations support this interpretation of our experimental results, and it is argued that this is of broad relevance to DNA–protein interactions. PMID:9770480

CasA mediates Cas3-catalyzed target degradation during CRISPR RNA-guided interference.

PubMed

Hochstrasser, Megan L; Taylor, David W; Bhat, Prashant; Guegler, Chantal K; Sternberg, Samuel H; Nogales, Eva; Doudna, Jennifer A

2014-05-06

In bacteria, the clustered regularly interspaced short palindromic repeats (CRISPR)-associated (Cas) DNA-targeting complex Cascade (CRISPR-associated complex for antiviral defense) uses CRISPR RNA (crRNA) guides to bind complementary DNA targets at sites adjacent to a trinucleotide signature sequence called the protospacer adjacent motif (PAM). The Cascade complex then recruits Cas3, a nuclease-helicase that catalyzes unwinding and cleavage of foreign double-stranded DNA (dsDNA) bearing a sequence matching that of the crRNA. Cascade comprises the CasA-E proteins and one crRNA, forming a structure that binds and unwinds dsDNA to form an R loop in which the target strand of the DNA base pairs with the 32-nt RNA guide sequence. Single-particle electron microscopy reconstructions of dsDNA-bound Cascade with and without Cas3 reveal that Cascade positions the PAM-proximal end of the DNA duplex at the CasA subunit and near the site of Cas3 association. The finding that the DNA target and Cas3 colocalize with CasA implicates this subunit in a key target-validation step during DNA interference. We show biochemically that base pairing of the PAM region is unnecessary for target binding but critical for Cas3-mediated degradation. In addition, the L1 loop of CasA, previously implicated in PAM recognition, is essential for Cas3 activation following target binding by Cascade. Together, these data show that the CasA subunit of Cascade functions as an essential partner of Cas3 by recognizing DNA target sites and positioning Cas3 adjacent to the PAM to ensure cleavage.

Pseudomonas aeruginosa AmrZ Binds to Four Sites in the algD Promoter, Inducing DNA-AmrZ Complex Formation and Transcriptional Activation.

PubMed

Xu, Binjie; Soukup, Randal J; Jones, Christopher J; Fishel, Richard; Wozniak, Daniel J

2016-10-01

During late stages of cystic fibrosis pulmonary infections, Pseudomonas aeruginosa often overproduces the exopolysaccharide alginate, protecting the bacterial community from host immunity and antimicrobials. The transcription of the alginate biosynthesis operon is under tight control by a number of factors, including AmrZ, the focus of this study. Interestingly, multiple transcription factors interact with the far-upstream region of this promoter (PalgD), in which one AmrZ binding site has been identified previously. The mechanisms of AmrZ binding and subsequent activation remain unclear and require more-detailed investigation. In this study, in-depth examinations elucidated four AmrZ binding sites, and their disruption eliminated AmrZ binding and promoter activation. Furthermore, our in vitro fluorescence resonance energy transfer experiments suggest that AmrZ holds together multiple binding sites in PalgD and thereafter induces the formation of higher-order DNA-AmrZ complexes. To determine the importance of interactions between those AmrZ oligomers in the cell, a DNA phasing experiment was performed. PalgD transcription was significantly impaired when the relative phase between AmrZ binding sites was reversed (5 bp), while a full-DNA-turn insertion (10 bp) restored promoter activity. Taken together, the investigations presented here provide a deeper mechanistic understanding of AmrZ-mediated binding to PalgD IMPORTANCE: Overproduction of the exopolysaccharide alginate provides protection to Pseudomonas aeruginosa against antimicrobial treatments and is associated with chronic P. aeruginosa infections in the lungs of cystic fibrosis patients. In this study, we combined a variety of microbiological, genetic, biochemical, and biophysical approaches to investigate the activation of the alginate biosynthesis operon promoter by a key transcription factor named AmrZ. This study has provided important new information on the mechanism of activation of this extremely complex promoter. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Fluorescence studies with DNA probes: dynamic aspects of DNA structure and DNA-protein interactions

NASA Astrophysics Data System (ADS)

Millar, David P.; Carver, Theodore E.

1994-08-01

Time-resolved fluorescence measurements of optical probes incorporated at specific sites in DNA provides a new approach to studies of DNA structure and DNA:protein interactions. This approach can be used to study complex multi-state behavior, such as the folding of DNA into alternative higher order structures or the transfer of DNA between multiple binding sites on a protein. In this study, fluorescence anisotropy decay of an internal dansyl probe attached to 17/27-mer oligonucleotides was used to monitor the distribution of DNA 3' termini bound at either the polymerase of 3' to 5' exonuclease sites of the Klenow fragment of DNA polymerase I. Partitioning of the primer terminus between the two active sites of the enzyme resulted in a heterogeneous probe environment, reflected in the associative behavior of the fluorescence anisotropy decay. Analysis of the anisotropy decay with a two state model of solvent-exposed and protein-associated dansyl probes was used to determine the fraction of DNA bound at each site. We examined complexes of Klenow fragment with DNAs containing various base mismatches. Single mismatches at the primer terminus caused a 3-fold increase in the equilibrium partitioning of DNA into the exonuclease site, while two or more consecutive G:G mismatches caused the DNA to bind exclusively at the exonuclease site, with a partitioning constant at least 250- fold greater than that of the corresponding matched DNA sequence. Internal single mismatches located up to four bases from the primer terminus produced larger effects than the same mismatch at the primer terminus. These results provide insight into the recognition mechanisms that enable DNA polymerases to proofread misincorporated bases during DNA replication.

AtSPX1 affects the AtPHR1-DNA-binding equilibrium by binding monomeric AtPHR1 in solution.

PubMed

Qi, Wanjun; Manfield, Iain W; Muench, Stephen P; Baker, Alison

2017-10-23

Phosphorus is an essential macronutrient for plant growth and is deficient in ∼50% of agricultural soils. The transcription factor phosphate starvation response 1 (PHR1) plays a central role in regulating the expression of a subset of phosphate starvation-induced (PSI) genes through binding to a cis -acting DNA element termed P1BS (PHR1-binding sequences). In Arabidopsis and rice, activity of AtPHR1/OsPHR2 is regulated in part by their downstream target SPX ( S yg1, P ho81, X pr1) proteins through protein-protein interaction. Here, we provide kinetic and affinity data for interaction between AtPHR1 and P1BS sites. Using surface plasmon resonance, a tandem P1BS sequence showed ∼50-fold higher affinity for MBPAtdPHR1 (a fusion protein comprising the DNA-binding domain and coiled-coil domain of AtPHR1 fused to maltose-binding protein) than a single site. The affinity difference was largely reflected in a much slower dissociation rate from the 2× P1BS-binding site, suggesting an important role for protein co-operativity. Injection of AtSPX1 in the presence of phosphate or inositol hexakisphosphate (InsP6) failed to alter the MBPAtdPHR1-P1BS dissociation rate, while pre-mixing of these two proteins in the presence of either 5 mM Pi or 500 µM InsP6 resulted in a much lower DNA-binding signal from MBPAtdPHR1. These data suggest that, in the Pi-restored condition, AtSPX1 can bind to monomeric AtPHR1 in solution and therefore regulate PSI gene expression by tuning the AtPHR1-DNA-binding equilibrium. This Pi-dependent regulation of AtPHR1-DNA-binding equilibrium also generates a negative feedback loop on the expression of AtSPX1 itself, providing a tight control of PSI gene expression. © 2017 The Author(s).

Identification of Specific DNA Binding Residues in the TCP Family of Transcription Factors in Arabidopsis[W

PubMed Central

Aggarwal, Pooja; Das Gupta, Mainak; Joseph, Agnel Praveen; Chatterjee, Nirmalya; Srinivasan, N.; Nath, Utpal

2010-01-01

The TCP transcription factors control multiple developmental traits in diverse plant species. Members of this family share an ∼60-residue-long TCP domain that binds to DNA. The TCP domain is predicted to form a basic helix-loop-helix (bHLH) structure but shares little sequence similarity with canonical bHLH domain. This classifies the TCP domain as a novel class of DNA binding domain specific to the plant kingdom. Little is known about how the TCP domain interacts with its target DNA. We report biochemical characterization and DNA binding properties of a TCP member in Arabidopsis thaliana, TCP4. We have shown that the 58-residue domain of TCP4 is essential and sufficient for binding to DNA and possesses DNA binding parameters comparable to canonical bHLH proteins. Using a yeast-based random mutagenesis screen and site-directed mutants, we identified the residues important for DNA binding and dimer formation. Mutants defective in binding and dimerization failed to rescue the phenotype of an Arabidopsis line lacking the endogenous TCP4 activity. By combining structure prediction, functional characterization of the mutants, and molecular modeling, we suggest a possible DNA binding mechanism for this class of transcription factors. PMID:20363772

Dimerization-induced corepressor binding and relaxed DNA-binding specificity are critical for PML/RARA-induced immortalization

PubMed Central

Zhou, Jun; Pérès, Laurent; Honoré, Nicole; Nasr, Rihab; Zhu, Jun; de Thé, Hugues

2006-01-01

The pathogenesis of acute promyelocytic leukemia involves the transcriptional repression of master genes of myeloid differentiation by the promyelocytic leukemia–retinoic acid receptor α (PML/RARA) oncogene. PML-enforced RARA homodimerization allows the tighter binding of corepressors, silencing RARA target genes. In addition, homodimerization dramatically extends the spectrum of DNA-binding sites of the fusion protein compared with those of normal RARA. Yet, any contribution of these two properties of PML/RARA to differentiation arrest and immortalization of primary mouse hematopoietic progenitors was unknown. We demonstrate that dimerization-induced silencing mediator of retinoid and thyroid receptors (SMRT)-enhanced binding and relaxed DNA-binding site specificity are both required for efficient immortalization. Thus, enforced RARA dimerization is critical not only for triggering transcriptional repression but also for extending the repertoire of target genes. Our studies exemplify how dimerization-induced gain of functions converts an unessential transcription factor into a dominant oncogenic protein. PMID:16757557

Reverse transcription of phage RNA and its fragment directed by synthetic heteropolymeric primers

PubMed Central

Frolova, L. Yu.; Metelyev, V. G.; Ratmanova, K. I.; Smirnov, V. D.; Shabarova, Z. A.; Prokofyev, M. A.; Berzin, V. M.; Jansone, I. V.; Gren, E. J.; Kisselev, L. L.

1977-01-01

DNA synthesis catalysed by RNA-directed DNA-polymerase (reverse transcriptase) was found to proceed on the RNA template of an MS2 phage in the presence of heteropolymeric synthetic octa- and nonadeoxyribonucleotide primers complementary to the intercistronic region (coat protein binding site) and the region of the coat protein cistron, respectively. The product of synthesis consists of discrete DNA fractions of different length, including transcripts longer than 1,000 nucleotides. The coat protein inhibits DNA synthesis if it is initiated at its binding site, but has no effect on DNA synthesis initiated at the coat protein cistron. It has been suggested that, in this system, the initiation of DNA synthesis by synthetic primers is topographically specific. The MS2 coat protein binding site (an RNA fragment of 59 nucleotides) serves as a template for polydeoxyribonucleotide synthesis in the presence of octanucleotide primer and reverse transcriptase. The product of synthesis is homogenous and its length corresponds to the length of the template. The effective and complete copying of the fragment having a distinct secondary structure proves that the secondary structure does not interfere, in principle, with RNA being a template in the system of reverse transcription. PMID:71713

Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

PubMed Central

Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

2015-01-01

CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

Genome-Wide Cell Type-Specific Mapping of In Vivo Chromatin Protein Binding Using an FLP-Inducible DamID System in Drosophila.

PubMed

Pindyurin, Alexey V

2017-01-01

A thorough study of the genome-wide binding patterns of chromatin proteins is essential for understanding the regulatory mechanisms of genomic processes in eukaryotic nuclei, including DNA replication, transcription, and repair. The DNA adenine methyltransferase identification (DamID) method is a powerful tool to identify genomic binding sites of chromatin proteins. This method does not require fixation of cells and the use of specific antibodies, and has been used to generate genome-wide binding maps of more than a hundred different proteins in Drosophila tissue culture cells. Recent versions of inducible DamID allow performing cell type-specific profiling of chromatin proteins even in small samples of Drosophila tissues that contain heterogeneous cell types. Importantly, with these methods sorting of cells of interest or their nuclei is not necessary as genomic DNA isolated from the whole tissue can be used as an input. Here, I describe in detail an FLP-inducible DamID method, namely generation of suitable transgenic flies, activation of the Dam transgenes by the FLP recombinase, isolation of DNA from small amounts of dissected tissues, and subsequent identification of the DNA binding sites of the chromatin proteins.

MotifMark: Finding regulatory motifs in DNA sequences.

PubMed

Hassanzadeh, Hamid Reza; Kolhe, Pushkar; Isbell, Charles L; Wang, May D

2017-07-01

The interaction between proteins and DNA is a key driving force in a significant number of biological processes such as transcriptional regulation, repair, recombination, splicing, and DNA modification. The identification of DNA-binding sites and the specificity of target proteins in binding to these regions are two important steps in understanding the mechanisms of these biological activities. A number of high-throughput technologies have recently emerged that try to quantify the affinity between proteins and DNA motifs. Despite their success, these technologies have their own limitations and fall short in precise characterization of motifs, and as a result, require further downstream analysis to extract useful and interpretable information from a haystack of noisy and inaccurate data. Here we propose MotifMark, a new algorithm based on graph theory and machine learning, that can find binding sites on candidate probes and rank their specificity in regard to the underlying transcription factor. We developed a pipeline to analyze experimental data derived from compact universal protein binding microarrays and benchmarked it against two of the most accurate motif search methods. Our results indicate that MotifMark can be a viable alternative technique for prediction of motif from protein binding microarrays and possibly other related high-throughput techniques.

An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

PubMed

Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

1995-04-11

SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

In vitro DNA binding studies of Aspartame, an artificial sweetener.

PubMed

Kashanian, Soheila; Khodaei, Mohammad Mehdi; Kheirdoosh, Fahimeh

2013-03-05

A number of small molecules bind directly and selectively to DNA, by inhibiting replication, transcription or topoisomerase activity. In this work the interaction of native calf thymus DNA (CT-DNA) with Aspartame (APM), an artificial sweeteners was studied at physiological pH. DNA binding study of APM is useful to understand APM-DNA interaction mechanism and to provide guidance for the application and design of new and safer artificial sweeteners. The interaction was investigated using spectrophotometric, spectrofluorometric competition experiment and circular dichroism (CD). Hypochromism and red shift are shown in UV absorption band of APM. A strong fluorescence quenching reaction of DNA to APM was observed and the binding constants (Kf) of DNA with APM and corresponding number of binding sites (n) were calculated at different temperatures. Thermodynamic parameters, enthalpy changes (ΔH) and entropy changes (ΔS) were calculated to be +181kJmol(-1) and +681Jmol(-1)K(-1) according to Van't Hoff equation, which indicated that reaction is predominantly entropically driven. Moreover, spectrofluorometric competition experiment and circular dichroism (CD) results are indicative of non-intercalative DNA binding nature of APM. We suggest that APM interacts with calf thymus DNA via groove binding mode with an intrinsic binding constant of 5×10(+4)M(-1). Copyright © 2013 Elsevier B.V. All rights reserved.

Tetramerization and interdomain flexibility of the replication initiation controller YabA enables simultaneous binding to multiple partners

PubMed Central

Felicori, Liza; Jameson, Katie H.; Roblin, Pierre; Fogg, Mark J.; Garcia-Garcia, Transito; Ventroux, Magali; Cherrier, Mickaël V.; Bazin, Alexandre; Noirot, Philippe; Wilkinson, Anthony J.; Molina, Franck; Terradot, Laurent; Noirot-Gros, Marie-Françoise

2016-01-01

YabA negatively regulates initiation of DNA replication in low-GC Gram-positive bacteria. The protein exerts its control through interactions with the initiator protein DnaA and the sliding clamp DnaN. Here, we combined X-ray crystallography, X-ray scattering (SAXS), modeling and biophysical approaches, with in vivo experimental data to gain insight into YabA function. The crystal structure of the N-terminal domain (NTD) of YabA solved at 2.7 Å resolution reveals an extended α-helix that contributes to an intermolecular four-helix bundle. Homology modeling and biochemical analysis indicates that the C-terminal domain (CTD) of YabA is a small Zn-binding domain. Multi-angle light scattering and SAXS demonstrate that YabA is a tetramer in which the CTDs are independent and connected to the N-terminal four-helix bundle via flexible linkers. While YabA can simultaneously interact with both DnaA and DnaN, we found that an isolated CTD can bind to either DnaA or DnaN, individually. Site-directed mutagenesis and yeast-two hybrid assays identified DnaA and DnaN binding sites on the YabA CTD that partially overlap and point to a mutually exclusive mode of interaction. Our study defines YabA as a novel structural hub and explains how the protein tetramer uses independent CTDs to bind multiple partners to orchestrate replication initiation in the bacterial cell. PMID:26615189

Curated collection of yeast transcription factor DNA binding specificity data reveals novel structural and gene regulatory insights

PubMed Central

2011-01-01

Background Transcription factors (TFs) play a central role in regulating gene expression by interacting with cis-regulatory DNA elements associated with their target genes. Recent surveys have examined the DNA binding specificities of most Saccharomyces cerevisiae TFs, but a comprehensive evaluation of their data has been lacking. Results We analyzed in vitro and in vivo TF-DNA binding data reported in previous large-scale studies to generate a comprehensive, curated resource of DNA binding specificity data for all characterized S. cerevisiae TFs. Our collection comprises DNA binding site motifs and comprehensive in vitro DNA binding specificity data for all possible 8-bp sequences. Investigation of the DNA binding specificities within the basic leucine zipper (bZIP) and VHT1 regulator (VHR) TF families revealed unexpected plasticity in TF-DNA recognition: intriguingly, the VHR TFs, newly characterized by protein binding microarrays in this study, recognize bZIP-like DNA motifs, while the bZIP TF Hac1 recognizes a motif highly similar to the canonical E-box motif of basic helix-loop-helix (bHLH) TFs. We identified several TFs with distinct primary and secondary motifs, which might be associated with different regulatory functions. Finally, integrated analysis of in vivo TF binding data with protein binding microarray data lends further support for indirect DNA binding in vivo by sequence-specific TFs. Conclusions The comprehensive data in this curated collection allow for more accurate analyses of regulatory TF-DNA interactions, in-depth structural studies of TF-DNA specificity determinants, and future experimental investigations of the TFs' predicted target genes and regulatory roles. PMID:22189060

Protein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease.

PubMed Central

Yeung, A T; Mattes, W B; Grossman, L

1986-01-01

An examination has been made into the nature of the nucleoprotein complexes formed during the incision reaction catalyzed by the Escherichia coli UvrABC endonuclease when acting on a pyrimidine dimer-containing fd RF-I DNA species. The complexes of proteins and DNA form in unique stages. The first stage of binding involves an ATP-stimulated interaction of the UvrA protein with duplex DNA containing pyrimidine dimer sites. The UvrB protein significantly stabilizes the UvrA-pyrimidine dimer containing DNA complex which, in turn, provides a foundation for the binding of UvrC to activate the UvrABC endonuclease. The binding of one molecule of UvrC to each UvrAB-damaged DNA complex is needed to catalyze incision in the vicinity of pyrimidine dimer sites. The UvrABC-DNA complex persists after the incision event suggesting that the lack of UvrABC turnover may be linked to other activities in the excision-repair pathway beyond the initial incision reaction. PMID:3960727

Atomistic Molecular Dynamics Simulations of Mitochondrial DNA Polymerase γ: Novel Mechanisms of Function and Pathogenesis.

PubMed

Euro, Liliya; Haapanen, Outi; Róg, Tomasz; Vattulainen, Ilpo; Suomalainen, Anu; Sharma, Vivek

2017-03-07

DNA polymerase γ (Pol γ) is a key component of the mitochondrial DNA replisome and an important cause of neurological diseases. Despite the availability of its crystal structures, the molecular mechanism of DNA replication, the switch between polymerase and exonuclease activities, the site of replisomal interactions, and functional effects of patient mutations that do not affect direct catalysis have remained elusive. Here we report the first atomistic classical molecular dynamics simulations of the human Pol γ replicative complex. Our simulation data show that DNA binding triggers remarkable changes in the enzyme structure, including (1) completion of the DNA-binding channel via a dynamic subdomain, which in the apo form blocks the catalytic site, (2) stabilization of the structure through the distal accessory β-subunit, and (3) formation of a putative transient replisome-binding platform in the "intrinsic processivity" subdomain of the enzyme. Our data indicate that noncatalytic mutations may disrupt replisomal interactions, thereby causing Pol γ-associated neurodegenerative disorders.

GBshape: a genome browser database for DNA shape annotations.

PubMed

Chiu, Tsu-Pei; Yang, Lin; Zhou, Tianyin; Main, Bradley J; Parker, Stephen C J; Nuzhdin, Sergey V; Tullius, Thomas D; Rohs, Remo

2015-01-01

Many regulatory mechanisms require a high degree of specificity in protein-DNA binding. Nucleotide sequence does not provide an answer to the question of why a protein binds only to a small subset of the many putative binding sites in the genome that share the same core motif. Whereas higher-order effects, such as chromatin accessibility, cooperativity and cofactors, have been described, DNA shape recently gained attention as another feature that fine-tunes the DNA binding specificities of some transcription factor families. Our Genome Browser for DNA shape annotations (GBshape; freely available at http://rohslab.cmb.usc.edu/GBshape/) provides minor groove width, propeller twist, roll, helix twist and hydroxyl radical cleavage predictions for the entire genomes of 94 organisms. Additional genomes can easily be added using the GBshape framework. GBshape can be used to visualize DNA shape annotations qualitatively in a genome browser track format, and to download quantitative values of DNA shape features as a function of genomic position at nucleotide resolution. As biological applications, we illustrate the periodicity of DNA shape features that are present in nucleosome-occupied sequences from human, fly and worm, and we demonstrate structural similarities between transcription start sites in the genomes of four Drosophila species. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Computational characterization of DNA/peptide/nanotube self assembly for bioenergy applications

NASA Astrophysics Data System (ADS)

Ortiz, Vanessa; Araki, Ruriko; Collier, Galen

2012-02-01

Multi-enzyme pathways have become a subject of increasing interest for their role in the engineering of biomimetic systems for applications including biosensors, bioelectronics, and bioenergy. The efficiencies found in natural metabolic pathways partially arise from biomolecular self-assembly of the component enzymes in an effort to avoid transport limitations. The ultimate goal of this effort is to design and build biofuel cells with efficiencies similar to those of native systems by introducing biomimetic structures that immobilize multiple enzymes in specific orientations on a bioelectrode. To achieve site-specific immobilization, the specificity of DNA-binding domains is exploited with an approach that allows any redox enzyme to be modified to site-specifically bind to double stranded (ds) DNA while retaining activity. Because of its many desirable properties, the bioelectrode of choice is single-wall carbon nanotubes (SWNTs), but little is known about dsDNA/SWNT assembly and how this might affect the activity of the DNA-binding domains. Here we evaluate the feasibility of the proposed assembly by performing atomistic molecular dynamics simulations to look at the stability and conformations adopted by dsDNA when bound to a SWNT. We also evaluate the effects of the presence of a SWNT on the stability of the complex formed by a DNA-binding domain and DNA.

Determining the Specificity of Cascade Binding, Interference, and Primed Adaptation In Vivo in the Escherichia coli Type I-E CRISPR-Cas System

PubMed Central

Cooper, Lauren A.; Stringer, Anne M.

2018-01-01

ABSTRACT In clustered regularly interspaced short palindromic repeat (CRISPR)-Cas (CRISPR-associated) immunity systems, short CRISPR RNAs (crRNAs) are bound by Cas proteins, and these complexes target invading nucleic acid molecules for degradation in a process known as interference. In type I CRISPR-Cas systems, the Cas protein complex that binds DNA is known as Cascade. Association of Cascade with target DNA can also lead to acquisition of new immunity elements in a process known as primed adaptation. Here, we assess the specificity determinants for Cascade-DNA interaction, interference, and primed adaptation in vivo, for the type I-E system of Escherichia coli. Remarkably, as few as 5 bp of crRNA-DNA are sufficient for association of Cascade with a DNA target. Consequently, a single crRNA promotes Cascade association with numerous off-target sites, and the endogenous E. coli crRNAs direct Cascade binding to >100 chromosomal sites. In contrast to the low specificity of Cascade-DNA interactions, >18 bp are required for both interference and primed adaptation. Hence, Cascade binding to suboptimal, off-target sites is inert. Our data support a model in which the initial Cascade association with DNA targets requires only limited sequence complementarity at the crRNA 5′ end whereas recruitment and/or activation of the Cas3 nuclease, a prerequisite for interference and primed adaptation, requires extensive base pairing. PMID:29666291

Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

PubMed Central

Hoffmann, Jana; Altenbuchner, Josef

2015-01-01

A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

A map of human PRDM9 binding provides evidence for novel behaviors of PRDM9 and other zinc-finger proteins in meiosis

PubMed Central

Noor, Nudrat; Bitoun, Emmanuelle; Tumian, Afidalina; Imbeault, Michael; Chapman, J Ross; Aricescu, A Radu

2017-01-01

PRDM9 binding localizes almost all meiotic recombination sites in humans and mice. However, most PRDM9-bound loci do not become recombination hotspots. To explore factors that affect binding and subsequent recombination outcomes, we mapped human PRDM9 binding sites in a transfected human cell line and measured PRDM9-induced histone modifications. These data reveal varied DNA-binding modalities of PRDM9. We also find that human PRDM9 frequently binds promoters, despite their low recombination rates, and it can activate expression of a small number of genes including CTCFL and VCX. Furthermore, we identify specific sequence motifs that predict consistent, localized meiotic recombination suppression around a subset of PRDM9 binding sites. These motifs strongly associate with KRAB-ZNF protein binding, TRIM28 recruitment, and specific histone modifications. Finally, we demonstrate that, in addition to binding DNA, PRDM9's zinc fingers also mediate its multimerization, and we show that a pair of highly diverged alleles preferentially form homo-multimers. PMID:29072575

Release of specific proteins from nuclei of HL-60 and MOLT-4 cells by antitumor drugs having affinity to nucleic acids.

PubMed

Lassota, P; Melamed, M R; Darzynkiewicz, Z

The binding sites for mitoxantrone (MIT), Ametantrone (AMT), doxorubicin (DOX), actinomycin D (AMD) and ethidium bromide (EB) in nuclei from exponentially growing and differentiating human promyelocytic HL-60 and lymphocytic leukemic MOLT-4 cells were studied by gel electrophoresis of proteins selectively released during titration of these nuclei with the drugs. Each drug at different drug: DNA binding ratios resulted in a characteristic pattern of protein elution and/or retention. For example, in nuclei from exponentially growing HL-60 cells, MIT affected 44 nuclear proteins that were different from those affected by EB; of these 29 were progressively released at increasing MIT:DNA ratios, 11 were transiently released (i.e. only at a low MIT:DNA ratio) and 4 entrapped. Patterns of proteins displaced from nuclei of exponentially growing HL-60 cells differed from those of cells undergoing myeloid differentiation as well as from those of exponentially growing MOLT-4 cells. The first effects were seen at a binding density of approximately one drug molecule per 10-50 base pairs of DNA. The observed selective displacement of proteins may reflect drug-altered affinity of the binding sites for those proteins, for example due to a change of nucleic acid or protein conformation upon binding the ligand. The data show that the binding site(s) for each of the ligands studied is different and the differences correlate with variability in chemical structure between the ligands. The nature of the drug-affected proteins may provide clues regarding antitumor or cytotoxic mechanisms of drug action.

Informative priors based on transcription factor structural class improve de novo motif discovery.

PubMed

Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

2006-07-15

An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

PubMed

Isalan, M; Klug, A; Choo, Y

2001-07-01

DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

Energetics of drug-DNA interactions.

PubMed

Chaires, J B

1997-01-01

Understanding the thermodynamics of drug binding to DNA is of both practical and fundamental interest. The practical interest lies in the contribution that thermodynamics can make to the rational design process for the development of new DNA targeted drugs. Thermodynamics offer key insights into the molecular forces that drive complex formation that cannot be obtained by structural or computational studies alone. The fundamental interest in these interactions lies in what they can reveal about the general problems of parsing and predicting ligand binding free energies. For these problems, drug-DNA interactions offer several distinct advantages, among them being that the structures of many drug-DNA complexes are known at high resolution and that such structures reveal that in many cases the drug acts as a rigid body, with little conformational change upon binding. Complete thermodynamic profiles (delta G, delta H, delta S, delta Cp) for numerous drug-DNA interactions have been obtained, with the help of high-sensitivity microcalorimetry. The purpose of this article is to offer a perspective on the interpretation of these thermodynamics parameters, and in particular how they might be correlated with known structural features. Obligatory conformational changes in the DNA to accommodate intercalators and the loss of translational and rotational freedom upon complex formation both present unfavorable free energy barriers for binding. Such barriers must be overcome by favorable free energy contributions from the hydrophobic transfer of ligand from solution into the binding site, polyelectrolyte contributions from coupled ion release, and molecular interactions (hydrogen and ionic bonds, van der Waals interactions) that form within the binding site. Theoretical and semiempirical tools that allow estimates of these contributions to be made will be discussed, and their use in dissecting experimental data illustrated. This process, even at the current level of approximation, can shed considerable light on the drug-DNA binding process.

Identification of Critical Residues for the Tight Binding of Both Correct and Incorrect Nucleotides to Human DNA Polymerase λ

PubMed Central

Brown, Jessica A.; Pack, Lindsey R.; Sherrer, Shanen M.; Kshetry, Ajay K.; Newmister, Sean A.; Fowler, Jason D.; Taylor, John-Stephen; Suo, Zucai

2010-01-01

DNA polymerase λ (Pol λ) is a novel X-family DNA polymerase that shares 34% sequence identity with DNA polymerase β (Pol β). Pre-steady state kinetic studies have shown that the Pol λ•DNA complex binds both correct and incorrect nucleotides 130-fold tighter on average than the Pol β•DNA complex, although, the base substitution fidelity of both polymerases is 10−4 to 10−5. To better understand Pol λ’s tight nucleotide binding affinity, we created single- and double-substitution mutants of Pol λ to disrupt interactions between active site residues and an incoming nucleotide or a template base. Single-turnover kinetic assays showed that Pol λ binds to an incoming nucleotide via cooperative interactions with active site residues (R386, R420, K422, Y505, F506, A510, and R514). Disrupting protein interactions with an incoming correct or incorrect nucleotide impacted binding with each of the common structural moieties in the following order: triphosphate ≫ base > ribose. In addition, the loss of Watson-Crick hydrogen bonding between the nucleotide and template base led to a moderate increase in the Kd. The fidelity of Pol λ was maintained predominantly by a single residue, R517, which has minor groove interactions with the DNA template. PMID:20851705

ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells

PubMed Central

Seitz, Patrick; Pezeshgi Modarres, Hassan; Borgeaud, Sandrine; Bulushev, Roman D.; Steinbock, Lorenz J.; Radenovic, Aleksandra; Dal Peraro, Matteo; Blokesch, Melanie

2014-01-01

The DNA uptake of naturally competent bacteria has been attributed to the action of DNA uptake machineries resembling type IV pilus complexes. However, the protein(s) for pulling the DNA across the outer membrane of Gram-negative bacteria remain speculative. Here we show that the competence protein ComEA binds incoming DNA in the periplasm of naturally competent Vibrio cholerae cells thereby promoting DNA uptake, possibly through ratcheting and entropic forces associated with ComEA binding. Using comparative modeling and molecular simulations, we projected the 3D structure and DNA-binding site of ComEA. These in silico predictions, combined with in vivo and in vitro validations of wild-type and site-directed modified variants of ComEA, suggested that ComEA is not solely a DNA receptor protein but plays a direct role in the DNA uptake process. Furthermore, we uncovered that ComEA homologs of other bacteria (both Gram-positive and Gram-negative) efficiently compensated for the absence of ComEA in V. cholerae, suggesting that the contribution of ComEA in the DNA uptake process might be conserved among naturally competent bacteria. PMID:24391524

NFκB- and AP-1-mediated DNA looping regulates matrix metalloproteinase-9 transcription in TNF-α-treated human leukemia U937 cells.

PubMed

Chen, Ying-Jung; Chang, Long-Sen

2015-10-01

The aim of this study is to explore the spatial association of critical genomic elements in the effect of TNF-α on matrix metalloproteinase-9 (MMP-9) expression in human leukemia U937 cells. TNF-α up-regulated MMP-9 protein expression and mRNA level in U937 cells, and Akt-mediated-NFκB/p65 activation and JNK-mediated c-Jun activation were proven to be involved in TNF-α-induced MMP-9 up-regulation. Promoter luciferase activity assay revealed that NFκB (nt-600) and AP-1 (nt-79) binding sites were crucial for TNF-α-induced transcription of MMP-9 gene. The results of a chromatin immunoprecipitation assay indicated that TNF-α reduced histone deacetylase-1 (HDAC-1) recruitment but increased p300 (a histone acetyltransferase) recruitment to MMP-9 promoter regions surrounding NFκB and AP-1 binding sites. Consistently, TNF-α increased enrichment of the acetylated histone H3 mark on MMP-9 promoter regions. DNA affinity purification assay revealed that p300 and HDAC1 could bind oligonucleotides containing AP-1/c-Jun and NFκB/p65 binding sites. Chromosome conformation capture assay showed that TNF-α stimulated chromosomal loops in the MMP-9 promoter via NFκB/p65 and AP-1/c-Jun. The p300-associated acetyltransferase activity was crucial for p65/c-Jun-mediated DNA looping, and inhibition of HDAC activity increased the level of DNA looping. Reduction in the level of DNA looping eliminated all TNF-α-stimulated MMP-9 up-regulation. Taken together, our data suggest that p65/c-Jun-mediated DNA looping is involved in TNF-α-induced MMP-9 up-regulation and that the recruitment of p300 or HDAC1 to NFκB and AP-1 binding sites modifies the level of DNA looping. Copyright © 2015 Elsevier B.V. All rights reserved.

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, Stanley; Richardson, Charles

1997-01-01

Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.

In vitro selection of zinc fingers with altered DNA-binding specificity.

PubMed

Jamieson, A C; Kim, S H; Wells, J A

1994-05-17

We have used random mutagenesis and phage display to alter the DNA-binding specificity of Zif268, a transcription factor that contains three zinc finger domains. Four residues in the helix of finger 1 of Zif268 that potentially mediate DNA binding were identified from an X-ray structure of the Zif268-DNA complex. A library was constructed in which these residues were randomly mutated and the Zif268 variants were fused to a truncated version of the gene III coat protein on the surface of M13 filamentous phage particles. The phage displayed the mutant proteins in a monovalent fashion and were sorted by repeated binding and elution from affinity matrices containing different DNA sequences. When the matrix contained the natural nine base pair operator sequence 5'-GCG-TGG-GCG-3', native-like zinc fingers were isolated. New finger 1 variants were found by sorting with two different operators in which the singly modified triplets, GTG and TCG, replaced the native finger 1 triplet, GCG. Overall, the selected finger 1 variants contained a preponderance of polar residues at the four sites. Interestingly, the net charge of the four residues in any selected finger never derived more that one unit from neutrality despite the fact that about half the variants contained three or four charged residues over the four sites. Measurements of the dissociation constants for two of these purified finger 1 variants by gel-shift assay showed their specificities to vary over a 10-fold range, with the greatest affinity being for the DNA binding site for which they were sorted.(ABSTRACT TRUNCATED AT 250 WORDS)

DNA-binding study of anticancer drug cytarabine by spectroscopic and molecular docking techniques.

PubMed

Shahabadi, Nahid; Falsafi, Monireh; Maghsudi, Maryam

2017-01-02

The interaction of anticancer drug cytarabine with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multispectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove-binding mode, while the binding constant of UV-vis and the number of binding sites were 4.0 ± 0.2 × 10 4 L mol -1 and 1.39, respectively. The fluorimetric studies showed that the reaction between the drugs with CT-DNA is exothermic. Circular dichroism spectroscopy was employed to measure the conformational change of DNA in the presence of cytarabine. Furthermore, the drug induces detectable changes in its viscosity for DNA interaction. The molecular modeling results illustrated that cytarabine strongly binds to groove of DNA by relative binding energy of docked structure -20.61 KJ mol -1 . This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the interaction of small molecular pollutants and drugs with biomacromolecules for clarifying the molecular mechanism of toxicity or side effect in vivo.

Characterization and modification of phage T7 DNA polymerase for use in DNA sequencing; Progress report, June 1, 1990--May 31, 1993

DOE Office of Scientific and Technical Information (OSTI.GOV)

Richardson, C.C.

1993-12-31

This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less

Solution structure and intramolecular exchange of methyl-cytosine binding domain protein 4 (MBD4) on DNA suggests a mechanism to scan for mCpG/TpG mismatches

PubMed Central

Walavalkar, Ninad M.; Cramer, Jason M.; Buchwald, William A.; Scarsdale, J. Neel; Williams, David C.

2014-01-01

Unlike other members of the methyl-cytosine binding domain (MBD) family, MBD4 serves as a potent DNA glycosylase in DNA mismatch repair specifically targeting mCpG/TpG mismatches arising from spontaneous deamination of methyl-cytosine. The protein contains an N-terminal MBD (MBD4MBD) and a C-terminal glycosylase domain (MBD4GD) separated by a long linker. This arrangement suggests that the MBD4MBD either directly augments enzymatic catalysis by the MBD4GD or targets the protein to regions enriched for mCpG/TpG mismatches. Here we present structural and dynamic studies of MBD4MBD bound to dsDNA. We show that MBD4MBD binds with a modest preference formCpG as compared to mismatch, unmethylated and hydroxymethylated DNA. We find that while MBD4MBD exhibits slow exchange between molecules of DNA (intermolecular exchange), the domain exhibits fast exchange between two sites in the same molecule of dsDNA (intramolecular exchange). Introducing a single-strand defect between binding sites does not greatly reduce the intramolecular exchange rate, consistent with a local hopping mechanism for moving along the DNA. These results support a model in which the MBD4MBD4 targets the intact protein to mCpG islands and promotes scanning by rapidly exchanging between successive mCpG sites which facilitates repair of nearby mCpG/TpG mismatches by the glycosylase domain. PMID:25183517

Surface salt bridges modulate DNA wrapping by the type II DNA-binding protein TF1.

PubMed

Grove, Anne

2003-07-29

The histone-like protein HU is involved in compaction of the bacterial genome. Up to 37 bp of DNA may be wrapped about some HU homologues in a process that has been proposed to depend on a linked disruption of surface salt bridges that liberates cationic side chains for interaction with the DNA. Despite significant sequence conservation between HU homologues, binding sites from 9 to 37 bp have been reported. TF1, an HU homologue that is encoded by Bacillus subtilis bacteriophage SPO1, has nM affinity for 37 bp preferred sites in DNA with 5-hydroxymethyluracil (hmU) in place of thymine. On the basis of electrophoretic mobility shift assays, we show that TF1-DNA complex formation is associated with a net release of only approximately 0.5 cations. The structure of TF1 suggests that Asp13 can form a dehydrated surface salt bridge with Lys23; substitution of Asp13 with Ala increases the net release of cations to approximately 1. These data are consistent with complex formation linked to disruption of surface salt bridges. Substitution of Glu90 with Ala, which would expose Lys87 predicted to contact DNA immediately distal to a proline-mediated DNA kink, causes an increase in affinity and an abrogation of the preference for hmU-containing DNA. We propose that hmU preference is due to finely tuned interactions at the sites of kinking that expose a differential flexibility of hmU- and T-containing DNA. Our data further suggest that the difference in binding site size for HU homologues is based on a differential ability to stabilize the DNA kinks.

Recognition of AT-Rich DNA Binding Sites by the MogR Repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shen, Aimee; Higgins, Darren E.; Panne, Daniel

2009-07-22

The MogR transcriptional repressor of the intracellular pathogen Listeria monocytogenes recognizes AT-rich binding sites in promoters of flagellar genes to downregulate flagellar gene expression during infection. We describe here the 1.8 A resolution crystal structure of MogR bound to the recognition sequence 5' ATTTTTTAAAAAAAT 3' present within the flaA promoter region. Our structure shows that MogR binds as a dimer. Each half-site is recognized in the major groove by a helix-turn-helix motif and in the minor groove by a loop from the symmetry-related molecule, resulting in a 'crossover' binding mode. This oversampling through minor groove interactions is important for specificity.more » The MogR binding site has structural features of A-tract DNA and is bent by approximately 52 degrees away from the dimer. The structure explains how MogR achieves binding specificity in the AT-rich genome of L. monocytogenes and explains the evolutionary conservation of A-tract sequence elements within promoter regions of MogR-regulated flagellar genes.« less

Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

PubMed Central

Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

2003-01-01

Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.

PubMed

Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong

2006-07-07

We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

The role of monovalent cations in the ATPase reaction of DNA gyrase.

PubMed

Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

2015-04-01

Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K(+), is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K(+) ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na(+) ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites.

AP1 Keeps Chromatin Poised for Action | Center for Cancer Research

Cancer.gov

The human genome harbors gene-encoding DNA, the blueprint for building proteins that regulate cellular function. Embedded across the genome, in non-coding regions, are DNA elements to which regulatory factors bind. The interaction of regulatory factors with DNA at these sites modifies gene expression to modulate cell activity. In cells, DNA exists in a complex with proteins called chromatin that compacts the DNA in the nucleus, strongly restricting access to DNA sequences. As a result, regulatory factors only interact with a small subset of their potential binding elements in a given cell to regulate genes. How factors recognize and select sites in chromatin across the genome is not well understood -- but several discoveries in CCR’s Laboratory of Receptor Biology and Gene Expression (LRBGE) have shed light on the mechanisms that direct factors to DNA.

Comparison of specific binding sites for Escherichia coli RNA polymerase with naturally occurring hairpin regions in single-stranded DNA of coliphage M13. [Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Niyogi, S.K.; Mitra, S.

Escherichia coli RNA polymerase binds specifically to the single-stranded circular DNA of coliphage M13 in the presence of a saturating concentration of the bacterial DNA binding protein presumably as an essential step in the synthesis of the RNA primer required for synthesizing the complementary DNA strand in parental replicative-form DNA. The RNA polymerase-protected DNA regions were isolated after extensive digestion with pancreatic DNase, S1 endonuclease of Aspergillus oryzae, and exonuclease I of E. coli. The physicochemical properties of the RNA polymerase-protected segments (called PI and PII) were compared with those of the naturally occurring hairpin regions.

Recruitment of Mcm10 to Sites of Replication Initiation Requires Direct Binding to the Minichromosome Maintenance (MCM) Complex.

PubMed

Douglas, Max E; Diffley, John F X

2016-03-11

Mcm10 is required for the initiation of eukaryotic DNA replication and contributes in some unknown way to the activation of the Cdc45-MCM-GINS (CMG) helicase. How Mcm10 is localized to sites of replication initiation is unclear, as current models indicate that direct binding to minichromosome maintenance (MCM) plays a role, but the details and functional importance of this interaction have not been determined. Here, we show that purified Mcm10 can bind both DNA-bound double hexamers and soluble single hexamers of MCM. The binding of Mcm10 to MCM requires the Mcm10 C terminus. Moreover, the binding site for Mcm10 on MCM includes the Mcm2 and Mcm6 subunits and overlaps that for the loading factor Cdt1. Whether Mcm10 recruitment to replication origins depends on CMG helicase assembly has been unclear. We show that Mcm10 recruitment occurs via two modes: low affinity recruitment in the absence of CMG assembly ("G1-like") and high affinity recruitment when CMG assembly takes place ("S-phase-like"). Mcm10 that cannot bind directly to MCM is defective in both modes of recruitment and is unable to support DNA replication. These findings indicate that Mcm10 is localized to replication initiation sites by directly binding MCM through the Mcm10 C terminus. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The Fanconi anemia associated protein FAAP24 uses two substrate specific binding surfaces for DNA recognition

PubMed Central

Wienk, Hans; Slootweg, Jack C.; Speerstra, Sietske; Kaptein, Robert; Boelens, Rolf; Folkers, Gert E.

2013-01-01

To maintain the integrity of the genome, multiple DNA repair systems exist to repair damaged DNA. Recognition of altered DNA, including bulky adducts, pyrimidine dimers and interstrand crosslinks (ICL), partially depends on proteins containing helix-hairpin-helix (HhH) domains. To understand how ICL is specifically recognized by the Fanconi anemia proteins FANCM and FAAP24, we determined the structure of the HhH domain of FAAP24. Although it resembles other HhH domains, the FAAP24 domain contains a canonical hairpin motif followed by distorted motif. The HhH domain can bind various DNA substrates; using nuclear magnetic resonance titration experiments, we demonstrate that the canonical HhH motif is required for double-stranded DNA (dsDNA) binding, whereas the unstructured N-terminus can interact with single-stranded DNA. Both DNA binding surfaces are used for binding to ICL-like single/double-strand junction-containing DNA substrates. A structural model for FAAP24 bound to dsDNA has been made based on homology with the translesion polymerase iota. Site-directed mutagenesis, sequence conservation and charge distribution support the dsDNA-binding model. Analogous to other HhH domain-containing proteins, we suggest that multiple FAAP24 regions together contribute to binding to single/double-strand junction, which could contribute to specificity in ICL DNA recognition. PMID:23661679

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akabayov, B.; Akabayov, S; Lee , S

Gene 5 of bacteriophage T7 encodes a DNA polymerase (gp5) responsible for the replication of the phage DNA. Gp5 polymerizes nucleotides with low processivity, dissociating after the incorporation of 1 to 50 nucleotides. Thioredoxin (trx) of Escherichia coli binds tightly (Kd = 5 nM) to a unique segment in the thumb subdomain of gp5 and increases processivity. We have probed the molecular basis for the increase in processivity. A single-molecule experiment reveals differences in rates of enzymatic activity and processivity between gp5 and gp5/trx. Small angle X-ray scattering studies combined with nuclease footprinting reveal two conformations of gp5, one inmore » the free state and one upon binding to trx. Comparative analysis of the DNA binding clefts of DNA polymerases and DNA binding proteins show that the binding surface contains more hydrophobic residues than other DNA binding proteins. The balanced composition between hydrophobic and charged residues of the binding site allows for efficient sliding of gp5/trx on the DNA. We propose a model for trx-induced conformational changes in gp5 that enhance the processivity by increasing the interaction of gp5 with DNA.« less

Crystal Structure of the Pseudomonas aeruginosa Virulence Factor Regulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordes, Timothy J.; Worzalla, Gregory A.; Ginster, Aaron M.

2012-09-07

Virulence factor regulator (Vfr) enhances Pseudomonas aeruginosa pathogenicity through its role as a global transcriptional regulator. The crystal structure of Vfr shows that it is a winged-helix DNA-binding protein like its homologue cyclic AMP receptor protein (CRP). In addition to an expected primary cyclic AMP-binding site, a second ligand-binding site is nestled between the N-terminal domain and the C-terminal helix-turn-helix domain. Unlike CRP, Vfr is a symmetric dimer in the absence of DNA. Removal of seven disordered N-terminal residues of Vfr prvents the growth of P. aeruginosa.

Binding Linkage in a Telomere DNA–Protein Complex at the Ends of Oxytricha nova Chromosomes

PubMed Central

Buczek, Pawel; Orr, Rochelle S.; Pyper, Sean R.; Shum, Mili; Ota, Emily Kimmel Irene; Gerum, Shawn E.; Horvath, Martin P.

2005-01-01

Alpha and beta protein subunits of the telomere end binding protein from Oxytricha nova (OnTEBP) combine with telomere single strand DNA to form a protective cap at the ends of chromosomes. We tested how protein–protein interactions seen in the co-crystal structure relate to DNA binding through use of fusion proteins engineered as different combinations of domains and subunits derived from OnTEBP. Joining alpha and beta resulted in a protein that bound single strand telomere DNA with high affinity (KD-DNA=1.4 nM). Another fusion protein, constructed without the C-terminal protein–protein interaction domain of alpha, bound DNA with 200-fold diminished affinity (KD-DNA=290 nM) even though the DNA-binding domains of alpha and beta were joined through a peptide linker. Adding back the alpha C-terminal domain as a separate protein restored high-affinity DNA binding. The binding behaviors of these fusion proteins and the native protein subunits are consistent with cooperative linkage between protein-association and DNA-binding equilibria. Linking DNA–protein stability to protein–protein contacts at a remote site may provide a trigger point for DNA–protein disassembly during telomere replication when the single strand telomere DNA must exchange between a very stable OnTEBP complex and telomerase. PMID:15967465

One recognition sequence, seven restriction enzymes, five reaction mechanisms

PubMed Central

Gowers, Darren M.; Bellamy, Stuart R.W.; Halford, Stephen E.

2004-01-01

The diversity of reaction mechanisms employed by Type II restriction enzymes was investigated by analysing the reactions of seven endonucleases at the same DNA sequence. NarI, KasI, Mly113I, SfoI, EgeI, EheI and BbeI cleave DNA at several different positions in the sequence 5′-GGCGCC-3′. Their reactions on plasmids with one or two copies of this sequence revealed five distinct mechanisms. These differ in terms of the number of sites the enzyme binds, and the number of phosphodiester bonds cleaved per turnover. NarI binds two sites, but cleaves only one bond per DNA-binding event. KasI also cuts only one bond per turnover but acts at individual sites, preferring intact to nicked sites. Mly113I cuts both strands of its recognition sites, but shows full activity only when bound to two sites, which are then cleaved concertedly. SfoI, EgeI and EheI cut both strands at individual sites, in the manner historically considered as normal for Type II enzymes. Finally, BbeI displays an absolute requirement for two sites in close physical proximity, which are cleaved concertedly. The range of reaction mechanisms for restriction enzymes is thus larger than commonly imagined, as is the number of enzymes needing two recognition sites. PMID:15226412

Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

PubMed

Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

2005-12-27

Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

Physical constraints determine the logic of bacterial promoter architectures

PubMed Central

Ezer, Daphne; Zabet, Nicolae Radu; Adryan, Boris

2014-01-01

Site-specific transcription factors (TFs) bind to their target sites on the DNA, where they regulate the rate at which genes are transcribed. Bacterial TFs undergo facilitated diffusion (a combination of 3D diffusion around and 1D random walk on the DNA) when searching for their target sites. Using computer simulations of this search process, we show that the organization of the binding sites, in conjunction with TF copy number and binding site affinity, plays an important role in determining not only the steady state of promoter occupancy, but also the order at which TFs bind. These effects can be captured by facilitated diffusion-based models, but not by standard thermodynamics. We show that the spacing of binding sites encodes complex logic, which can be derived from combinations of three basic building blocks: switches, barriers and clusters, whose response alone and in higher orders of organization we characterize in detail. Effective promoter organizations are commonly found in the E. coli genome and are highly conserved between strains. This will allow studies of gene regulation at a previously unprecedented level of detail, where our framework can create testable hypothesis of promoter logic. PMID:24476912

Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2013-08-01

The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

PubMed Central

Kosturko, L D; Daub, E; Murialdo, H

1989-01-01

The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

RING finger and WD repeat domain 3 (RFWD3) associates with replication protein A (RPA) and facilitates RPA-mediated DNA damage response.

PubMed

Liu, Shangfeng; Chu, Jessica; Yucer, Nur; Leng, Mei; Wang, Shih-Ya; Chen, Benjamin P C; Hittelman, Walter N; Wang, Yi

2011-06-24

DNA damage response is crucial for maintaining genomic integrity and preventing cancer by coordinating the activation of checkpoints and the repair of damaged DNA. Central to DNA damage response are the two checkpoint kinases ATM and ATR that phosphorylate a wide range of substrates. RING finger and WD repeat domain 3 (RFWD3) was initially identified as a substrate of ATM/ATR from a proteomic screen. Subsequent studies showed that RFWD3 is an E3 ubiquitin ligase that ubiquitinates p53 in vitro and positively regulates p53 levels in response to DNA damage. We report here that RFWD3 associates with replication protein A (RPA), a single-stranded DNA-binding protein that plays essential roles in DNA replication, recombination, and repair. Binding of RPA to single-stranded DNA (ssDNA), which is generated by DNA damage and repair, is essential for the recruitment of DNA repair factors to damaged sites and the activation of checkpoint signaling. We show that RFWD3 is physically associated with RPA and rapidly localizes to sites of DNA damage in a RPA-dependent manner. In vitro experiments suggest that the C terminus of RFWD3, which encompass the coiled-coil domain and the WD40 domain, is necessary for binding to RPA. Furthermore, DNA damage-induced phosphorylation of RPA and RFWD3 is dependent upon each other. Consequently, loss of RFWD3 results in the persistent foci of DNA damage marker γH2AX and the repair protein Rad51 in damaged cells. These findings suggest that RFWD3 is recruited to sites of DNA damage and facilitates RPA-mediated DNA damage signaling and repair.

Wnt-Mediated Repression via Bipartite DNA Recognition by TCF in the Drosophila Hematopoietic System

PubMed Central

Zhang, Chen U.; Blauwkamp, Timothy A.; Burby, Peter E.; Cadigan, Ken M.

2014-01-01

The Wnt/β-catenin signaling pathway plays many important roles in animal development, tissue homeostasis and human disease. Transcription factors of the TCF family mediate many Wnt transcriptional responses, promoting signal-dependent activation or repression of target gene expression. The mechanism of this specificity is poorly understood. Previously, we demonstrated that for activated targets in Drosophila, TCF/Pangolin (the fly TCF) recognizes regulatory DNA through two DNA binding domains, with the High Mobility Group (HMG) domain binding HMG sites and the adjacent C-clamp domain binding Helper sites. Here, we report that TCF/Pangolin utilizes a similar bipartite mechanism to recognize and regulate several Wnt-repressed targets, but through HMG and Helper sites whose sequences are distinct from those found in activated targets. The type of HMG and Helper sites is sufficient to direct activation or repression of Wnt regulated cis-regulatory modules, and protease digestion studies suggest that TCF/Pangolin adopts distinct conformations when bound to either HMG-Helper site pair. This repressive mechanism occurs in the fly lymph gland, the larval hematopoietic organ, where Wnt/β-catenin signaling controls prohemocytic differentiation. Our study provides a paradigm for direct repression of target gene expression by Wnt/β-catenin signaling and allosteric regulation of a transcription factor by DNA. PMID:25144371

EMSA Analysis of DNA Binding By Rgg Proteins

PubMed Central

LaSarre, Breah; Federle, Michael J.

2016-01-01

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function (e.g. interruption of DNA-binding in some cases). PMID:27430004

EMSA Analysis of DNA Binding By Rgg Proteins.

PubMed

LaSarre, Breah; Federle, Michael J

2013-08-20

In bacteria, interaction of various proteins with DNA is essential for the regulation of specific target gene expression. Electrophoretic mobility shift assay (EMSA) is an in vitro approach allowing for the visualization of these protein-DNA interactions. Rgg proteins comprise a family of transcriptional regulators widespread among the Firmicutes. Some of these proteins function independently to regulate target gene expression, while others have now been demonstrated to function as effectors of cell-to-cell communication, having regulatory activities that are modulated via direct interaction with small signaling peptides. EMSA analysis can be used to assess DNA binding of either type of Rgg protein. EMSA analysis of Rgg protein activity has facilitated in vitro confirmation of regulatory targets, identification of precise DNA binding sites via DNA probe mutagenesis, and characterization of the mechanism by which some cognate signaling peptides modulate Rgg protein function ( e.g. interruption of DNA-binding in some cases).

Quest for the binding mode of tetrabromobisphenol A with Calf thymus DNA

NASA Astrophysics Data System (ADS)

Wang, Yan-Qing; Zhang, Hong-Mei; Cao, Jian

2014-10-01

The binding interaction of tetrabromobisphenol A with Calf thymus DNA was studied by multi-spectroscopic and molecular modeling methods. The UV-vis study revealed that an obvious interaction between tetrabromobisphenol A and Calf thymus DNA happened. The π-π∗ transitions and the electron cloud of tetrabromobisphenol A might be changed by entering the groove of Calf thymus DNA. From the fluorescence spectral and thermodynamics studies, it was concluded that the hydrogen bonds and hydrophobic force played a major role in the binding of tetrabromobisphenol A to Calf thymus DNA. The molecular modeling study showed that the possible sites of tetrabromobisphenol A in the groove of DNA. Circular dichroism study also depicted that tetrabromobisphenol A bond to DNA. These above results would further advance our knowledge on the molecular mechanism of the binding interactions of brominated flame-retardants with nucleic acid.

DNA-Damage Response RNA-Binding Proteins (DDRBPs): Perspectives from a New Class of Proteins and Their RNA Targets.

PubMed

Dutertre, Martin; Vagner, Stéphan

2017-10-27

Upon DNA damage, cells trigger an early DNA-damage response (DDR) involving DNA repair and cell cycle checkpoints, and late responses involving gene expression regulation that determine cell fate. Screens for genes involved in the DDR have found many RNA-binding proteins (RBPs), while screens for novel RBPs have identified DDR proteins. An increasing number of RBPs are involved in early and/or late DDR. We propose to call this new class of actors of the DDR, which contain an RNA-binding activity, DNA-damage response RNA-binding proteins (DDRBPs). We then discuss how DDRBPs contribute not only to gene expression regulation in the late DDR but also to early DDR signaling, DNA repair, and chromatin modifications at DNA-damage sites through interactions with both long and short noncoding RNAs. Copyright © 2016 Elsevier Ltd. All rights reserved.

The Agrobacterium tumefaciens Transcription Factor BlcR Is Regulated via Oligomerization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pan, Yi; Fiscus, Valena; Meng, Wuyi

2012-02-08

The Agrobacterium tumefaciens BlcR is a member of the emerging isocitrate lyase transcription regulators that negatively regulates metabolism of {gamma}-butyrolactone, and its repressing function is relieved by succinate semialdehyde (SSA). Our crystal structure showed that BlcR folded into the DNA- and SSA-binding domains and dimerized via the DNA-binding domains. Mutational analysis identified residues, including Phe{sup 147}, that are important for SSA association; BlcR{sup F147A} existed as tetramer. Two BlcR dimers bound to target DNA and in a cooperative manner, and the distance between the two BlcR-binding sequences in DNA was critical for BlcR-DNA association. Tetrameric BlcR{sup F147A} retained DNA bindingmore » activity, and importantly, this activity was not affected by the distance separating the BlcR-binding sequences in DNA. SSA did not dissociate tetrameric BlcR{sup F147A} or BlcR{sup F147A}-DNA. As well as in the SSA-binding site, Phe{sup 147} is located in a structurally flexible loop that may be involved in BlcR oligomerization. We propose that SSA regulates BlcR DNA-binding function via oligomerization.« less

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

PubMed

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

Information analysis of sequences that bind the replication initiator RepA | Center for Cancer Research

Cancer.gov

The tall letters represent the highly conserved bases in DNA binding sites of several prokaryotic repressors and activators. Conservation is strongest where major grooves of the double helical DNA (represented by crests of a cosine wave) face the protein. This shows that conservation analysis alone can be used to predict the face of DNA that contacts the proteins.

Single-strand DNA binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs

PubMed Central

Pandita, Raj K.; Chow, Tracy T.; Udayakumar, Durga; Bain, Amanda L.; Cubeddu, Liza; Hunt, Clayton R.; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E.; Khanna, Kum Kum; Shay, Jerry W.; Pandita, Tej K.

2015-01-01

Proliferating mammalian stem and cancer cells express telomerase (TERT) in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA binding protein SSB1, which has a critical role in DNA double-strand break repair. Here we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacted with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduced TERT interaction with telomeres and lead to G-overhang loss. While SSB1 was recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relied upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. PMID:25589350

AmrZ Beta-Sheet Residues Are Essential for DNA Binding and Transcriptional Control of Pseudomonas aeruginosa Virulence Genes ▿ †

PubMed Central

Waligora, Elizabeth A.; Ramsey, Deborah M.; Pryor, Edward E.; Lu, Haiping; Hollis, Thomas; Sloan, Gina P.; Deora, Rajendar; Wozniak, Daniel J.

2010-01-01

AmrZ is a putative ribbon-helix-helix (RHH) transcriptional regulator. RHH proteins utilize residues within the β-sheet for DNA binding, while the α-helices promote oligomerization. AmrZ is of interest due to its dual roles as a transcriptional activator and as a repressor, regulating genes encoding virulence factors associated with both chronic and acute Pseudomonas aeruginosa infection. In this study, cross-linking revealed that AmrZ forms oligomers in solution but that the amino terminus, containing an unordered region and a β-sheet, were not required for oligomerization. The first 12 unordered residues (extended amino terminus) contributed minimally to DNA binding. Mutagenesis of the AmrZ β-sheet demonstrated that residues 18, 20, and 22 were essential for DNA binding at both activation and repressor sites, suggesting that AmrZ utilizes a similar mechanism for binding to these sites. Mice infected with amrZ mutants exhibited reduced bacterial burden, morbidity, and mortality. Direct in vivo competition assays showed a 5-fold competitive advantage for the wild type over an isogenic amrZ mutant. Finally, the reduced infection phenotype of the amrZ-null strain was similar to that of a strain expressing a DNA-binding-deficient AmrZ variant, indicating that DNA binding and transcriptional regulation by AmrZ is responsible for the in vivo virulence defect. These recent infection data, along with previously identified AmrZ-regulated virulence factors, suggest the necessity of AmrZ transcriptional regulation for optimal virulence during acute infection. PMID:20709902

Structure of the endonuclease IV homologue from Thermotoga maritima in the presence of active-site divalent metal ions

PubMed Central

Tomanicek, Stephen J.; Hughes, Ronny C.; Ng, Joseph D.; Coates, Leighton

2010-01-01

The most frequent lesion in DNA is at apurinic/apyrimidinic (AP) sites resulting from DNA-base losses. These AP-site lesions can stall DNA replication and lead to genome instability if left unrepaired. The AP endonucleases are an important class of enzymes that are involved in the repair of AP-site intermediates during damage-general DNA base-excision repair pathways. These enzymes hydrolytically cleave the 5′-phosphodiester bond at an AP site to generate a free 3′-­hydroxyl group and a 5′-terminal sugar phosphate using their AP nuclease activity. Specifically, Thermotoga maritima endonuclease IV is a member of the second conserved AP endonuclease family that includes Escherichia coli endonuclease IV, which is the archetype of the AP endonuclease superfamily. In order to more fully characterize the AP endonuclease family of enzymes, two X-­ray crystal structures of the T. maritima endonuclease IV homologue were determined in the presence of divalent metal ions bound in the active-site region. These structures of the T. maritima endonuclease IV homologue further revealed the use of the TIM-barrel fold and the trinuclear metal binding site as important highly conserved structural elements that are involved in DNA-binding and AP-site repair processes in the AP endonuclease superfamily. PMID:20823514

Spectroscopic and electrochemical studies of the interaction between oleuropein, the major bio-phenol in olives, and salmon sperm DNA

NASA Astrophysics Data System (ADS)

Mohamadi, Maryam; Afzali, Daryoush; Esmaeili-Mahani, Saeed; Mostafavi, Ali; Torkzadeh-Mahani, Masoud

2015-09-01

Interaction of oleuropein, the major bio-phenol in olive leaf and fruit, with salmon sperm double-stranded DNA was investigated by employing electronic absorption titrations, fluorescence quenching spectroscopy, competitive fluorescence spectroscopy, thermal denaturation and voltammetric studies. Titration of oleuropein with the DNA caused a hypochromism accompanied with a red shift indicating an intercalative mode of interaction. Binding constant of 1.4 × 104 M-1 was obtained for this interaction. From the curves of fluorescence titration of oleuropein with the DNA, binding constant and binding sites were calculated to be 8.61 × 103 M-1 and 1.05, respectively. Competitive studies with ethidium bromide (a well-known DNA intercalator) showed that the bio-phenol could take the place of ethidium bromide in the DNA intercalation sites. The interaction of oleuropein with DNA was also studied electrochemically. In the presence of the DNA, the anodic and cathodic peak currents of oleuropein decreased accompanied with increases in peak-to-peak potential separation and formal potential, indicating the intercalation of oleuropein into the DNA double helix. Moreover, melting temperature of the DNA was found to increase in the presence of oleuropein, indicating the stabilization of the DNA double helix due to an intercalative interaction.

Dynamics of TBP binding to the TATA box

NASA Astrophysics Data System (ADS)

Schluesche, Peter; Heiss, Gregor; Meisterernst, Michael; Lamb, Don C.

2008-02-01

Gene expression is highly controlled and regulated in living cells. One of the first steps in gene transcription is recognition of the promoter site by the TATA box Binding Protein (TBP). TBP recruits other transcriptions factors and eventually the RNA polymerase II to transcribe the DNA in mRNA. We developed a single pair Förster Resonance Energy Transfer (spFRET) assay to investigate the mechanism of gene regulation. Here, we apply this assay to investigate the initial binding process of TBP to the adenovirus major late (AdML) promoter site. From the spFRET measurements, we were able to identify two conformations of the TBP-DNA complex that correspond to TBP bound in the correct and the opposite orientation. Increased incubation times or the presence of the transcription factor TFIIA improved the alignment of TBP on the promoter site. Binding of TBP to the TATA box shows a rich dynamics with abrupt transitions between multiple FRET states. A frame-wise histogram analysis revealed the presence of at least six discrete states, showing that TBP binding is more complicated than previously thought. Hence, the spFRET assay is very sensitive to the conformation of the TBP-DNA complex and is very promising tool for investigating the pathway of TBP binding in detail.

Identification of the target DNA sequence and characterization of DNA binding features of HlyU, and suggestion of a redox switch for hlyA expression in the human pathogen Vibrio cholerae from in silico studies.

PubMed

Mukherjee, Debadrita; Pal, Aritrika; Chakravarty, Devlina; Chakrabarti, Pinak

2015-02-18

HlyU, a transcriptional regulator common in many Vibrio species, activates the hemolysin gene hlyA in Vibrio cholerae, the rtxA1 operon in Vibrio vulnificus and the genes of plp-vah1 and rtxACHBDE gene clusters in Vibrio anguillarum. The protein is also proposed to be a potential global virulence regulator for V. cholerae and V. vulnificus. Mechanisms of gene control by HlyU in V. vulnificus and V. anguillarum are reported. However, detailed elucidation of the interaction of HlyU in V. cholerae with its target DNA at the molecular level is not available. Here we report a 17-bp imperfect palindrome sequence, 5'-TAATTCAGACTAAATTA-3', 173 bp upstream of hlyA promoter, as the binding site of HlyU. This winged helix-turn-helix protein binds necessarily as a dimer with the recognition helices contacting the major grooves and the β-sheet wings, the minor grooves. Such interactions enhance hlyA promoter activity in vivo. Mutations affecting dimerization as well as those in the DNA-protein interface hamper DNA binding and transcription regulation. Molecular dynamic simulations show hydrogen bonding patterns involving residues at the mutation sites and confirmed their importance in DNA binding. On binding to HlyU, DNA deviates by ∼68º from linearity. Dynamics also suggest a possible redox control in HlyU. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genome-wide Expression Profiling, In Vivo DNA Binding Analysis, and Probabilistic Motif Prediction Reveal Novel Abf1 Target Genes during Fermentation, Respiration, and Sporulation in Yeast

PubMed Central

Schlecht, Ulrich; Erb, Ionas; Demougin, Philippe; Robine, Nicolas; Borde, Valérie; van Nimwegen, Erik; Nicolas, Alain

2008-01-01

The autonomously replicating sequence binding factor 1 (Abf1) was initially identified as an essential DNA replication factor and later shown to be a component of the regulatory network controlling mitotic and meiotic cell cycle progression in budding yeast. The protein is thought to exert its functions via specific interaction with its target site as part of distinct protein complexes, but its roles during mitotic growth and meiotic development are only partially understood. Here, we report a comprehensive approach aiming at the identification of direct Abf1-target genes expressed during fermentation, respiration, and sporulation. Computational prediction of the protein's target sites was integrated with a genome-wide DNA binding assay in growing and sporulating cells. The resulting data were combined with the output of expression profiling studies using wild-type versus temperature-sensitive alleles. This work identified 434 protein-coding loci as being transcriptionally dependent on Abf1. More than 60% of their putative promoter regions contained a computationally predicted Abf1 binding site and/or were bound by Abf1 in vivo, identifying them as direct targets. The present study revealed numerous loci previously unknown to be under Abf1 control, and it yielded evidence for the protein's variable DNA binding pattern during mitotic growth and meiotic development. PMID:18305101

COUP-TF (chicken ovalbumin upstream promoter transcription factor)-interacting protein 1 (CTIP1) is a sequence-specific DNA binding protein.

PubMed Central

Avram, Dorina; Fields, Andrew; Senawong, Thanaset; Topark-Ngarm, Acharawan; Leid, Mark

2002-01-01

Chicken ovalbumin upstream promoter transcription factor (COUP-TF)-interacting proteins 1 and 2 [CTIP1/Evi9/B cell leukaemia (Bcl) l1a and CTIP2/Bcl11b respectively] are highly related C(2)H(2) zinc finger proteins that are abundantly expressed in brain and the immune system, and are associated with immune system malignancies. A selection procedure was employed to isolate high-affinity DNA binding sites for CTIP1. The core binding site on DNA identified in these studies, 5'-GGCCGG-3' (upper strand), is highly related to the canonical GC box and was bound by a CTIP1 oligomeric complex(es) in vitro. Furthermore, both CTIP1 and CTIP2 repressed transcription of a reporter gene harbouring a multimerized CTIP binding site, and this repression was neither reversed by trichostatin A (an inhibitor of known class I and II histone deacetylases) nor stimulated by co-transfection of a COUP-TF family member. These results demonstrate that CTIP1 is a sequence-specific DNA binding protein and a bona fide transcriptional repressor that is capable of functioning independently of COUP-TF family members. These findings may be relevant to the physiological and/or pathological action(s) of CTIPs in cells that do not express COUP-TF family members, such as cells of the haematopoietic and immune systems. PMID:12196208

footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

PubMed

Sebastian, Alvaro; Contreras-Moreira, Bruno

2014-01-15

Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

DNA polymerase having modified nucleotide binding site for DNA sequencing

DOEpatents

Tabor, S.; Richardson, C.

1997-03-25

A modified gene encoding a modified DNA polymerase is disclosed. The modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase. 6 figs.

Investigations on the Interactions of 5-Fluorouracil with Herring Sperm DNA: Steady State/Time Resolved and Molecular Modeling Studies

NASA Astrophysics Data System (ADS)

Chinnathambi, Shanmugavel; Karthikeyan, Subramani; Velmurugan, Devadasan; Hanagata, Nobutaka; Aruna, Prakasarao; Ganesan, Singaravelu

2015-04-01

In the present study, the interaction of 5-Fluorouracil with herring sperm DNA is reported using spectroscopic and molecular modeling techniques. This binding study of 5-FU with hs-DNA is of paramount importance in understanding chemico-biological interactions for drug design, pharmacy and biochemistry without altering the original structure. The challenge of the study was to find the exact binding mode of the drug 5-Fluorouracil with hs-DNA. From the absorption studies, a hyperchromic effect was observed for the herring sperm DNA in the presence of 5-Fluorouracil and a binding constant of 6.153 × 103 M-1 for 5-Fluorouracil reveals the existence of weak interaction between the 5-Fluorouracil and herring sperm DNA. Ethidium bromide loaded herring sperm DNA showed a quenching in the fluorescence intensity after the addition of 5-Fluorouracil. The binding constants for 5-Fluorouracil stranded DNA and competitive bindings of 5-FU interacting with DNA-EB systems were examined by fluorescence spectra. The Stern-Volmer plots and fluorescence lifetime results confirm the static quenching nature of the drug-DNA complex. The binding constant Kb was 2.5 × 104 L mol-1 and the number of binding sites are 1.17. The 5-FU on DNA system was calculated using double logarithmic plot. From the Forster nonradiative energy transfer study it has been found that the distance of 5-FU from DNA was 4.24 nm. In addition to the spectroscopic results, the molecular modeling studies also revealed the major groove binding as well as the partial intercalation mode of binding between the 5-Fluorouracil and herring sperm DNA. The binding energy and major groove binding as -6.04 kcal mol-1 and -6.31 kcal mol-1 were calculated from the modeling studies. All the testimonies manifested that binding modes between 5-Fluorouracil and DNA were evidenced to be groove binding and in partial intercalative mode.

The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans.

PubMed

Biggar, Kyle K; Storey, Kenneth B

2018-01-01

In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans . Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G 1 arrest for the duration of stress survival.

The evaluation of anoxia responsive E2F DNA binding activity in the red eared slider turtle, Trachemys scripta elegans

PubMed Central

Biggar, Kyle K.

2018-01-01

In many cases, the DNA-binding activity of a transcription factor does not change, while its transcriptional activity is greatly influenced by the make-up of bound proteins. In this study, we assessed the protein composition and DNA-binding ability of the E2F transcription factor complex to provide insight into cell cycle control in an anoxia tolerant turtle through the use of a modified ELISA protocol. This modification also permits the use of custom DNA probes that are tailored to a specific DNA binding region, introducing the ability to design capture probes for non-model organisms. Through the use of EMSA and ELISA DNA binding assays, we have successfully determined the in vitro DNA binding activity and complex dynamics of the Rb/E2F cell cycle regulatory mechanisms in an anoxic turtle, Trachemys scripta elegans. Repressive cell cycle proteins (E2F4, Rb, HDAC4 and Suv39H1) were found to significantly increase at E2F DNA-binding sites upon anoxic exposure in anoxic turtle liver. The lack of p130 involvement in the E2F DNA-bound complex indicates that anoxic turtle liver may maintain G1 arrest for the duration of stress survival. PMID:29770276

Novel structural features drive DNA binding properties of Cmr, a CRP family protein in TB complex mycobacteria.

PubMed

Ranganathan, Sridevi; Cheung, Jonah; Cassidy, Michael; Ginter, Christopher; Pata, Janice D; McDonough, Kathleen A

2018-01-09

Mycobacterium tuberculosis (Mtb) encodes two CRP/FNR family transcription factors (TF) that contribute to virulence, Cmr (Rv1675c) and CRPMt (Rv3676). Prior studies identified distinct chromosomal binding profiles for each TF despite their recognizing overlapping DNA motifs. The present study shows that Cmr binding specificity is determined by discriminator nucleotides at motif positions 4 and 13. X-ray crystallography and targeted mutational analyses identified an arginine-rich loop that expands Cmr's DNA interactions beyond the classical helix-turn-helix contacts common to all CRP/FNR family members and facilitates binding to imperfect DNA sequences. Cmr binding to DNA results in a pronounced asymmetric bending of the DNA and its high level of cooperativity is consistent with DNA-facilitated dimerization. A unique N-terminal extension inserts between the DNA binding and dimerization domains, partially occluding the site where the canonical cAMP binding pocket is found. However, an unstructured region of this N-terminus may help modulate Cmr activity in response to cellular signals. Cmr's multiple levels of DNA interaction likely enhance its ability to integrate diverse gene regulatory signals, while its novel structural features establish Cmr as an atypical CRP/FNR family member. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA wrapping and distortion by an oligomeric homeodomain protein.

PubMed

Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

2008-10-31

Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

Synthesis, structure, DNA/protein binding, and cytotoxic activity of a rhodium(III) complex with 2,6-bis(2-benzimidazolyl)pyridine.

PubMed

Esteghamat-Panah, Roya; Hadadzadeh, Hassan; Farrokhpour, Hossein; Simpson, Jim; Abdolmaleki, Amir; Abyar, Fatemeh

2017-02-15

A new mononuclear rhodium(III) complex, [Rh(bzimpy)Cl 3 ] (bzimpy = 2,6-bis(2-benzimidazolyl)pyridine), was synthesized and characterized by elemental analysis and spectroscopic methods. The molecular structure of the complex was confirmed by single-crystal X-ray crystallography. The interaction of the complex with fish sperm DNA (FS-DNA) was investigated by UV spectroscopy, emission titration, and viscosity measurement in order to evaluate the possible DNA-binding mode and to calculate the corresponding DNA-binding constant. The results reveal that the Rh(III) complex interacts with DNA through groove binding mode with a binding affinity on the order of 10 4 . In addition, the binding of the Rh(III) complex to bovine serum albumin (BSA) was monitored by UV-Vis and fluorescence emission spectroscopy at different temperatures. The mechanism of the complex interaction was found to be static quenching. The thermodynamic parameters (ΔH, ΔS, and ΔG) obtained from the fluorescence spectroscopy data show that van der Waals interactions and hydrogen bonds play a major role in the binding of the Rh(III) complex to BSA. For the comparison of the DNA- and BSA-binding affinities of the free bzimpy ligand with its Rh(III) complex, the absorbance titration and fluorescence quenching experiments of the free bzimpy ligand with DNA and BSA were carried out. Competitive experiments using eosin Y and ibuprofen as site markers indicated that the complex was mainly located in the hydrophobic cavity of site I of the protein. These experimental results were confirmed by the results of molecular docking. Finally, the in vitro cytotoxicity properties of the Rh(III) complex against the MCF-7, K562, and HT-29 cell lines were evaluated and compared with those of the free ligand (bzimpy). It was found that the complexation process improved the anticancer activity significantly. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Systematic prediction of control proteins and their DNA binding sites

PubMed Central

Sorokin, Valeriy; Severinov, Konstantin; Gelfand, Mikhail S.

2009-01-01

We present here the results of a systematic bioinformatics analysis of control (C) proteins, a class of DNA-binding regulators that control time-delayed transcription of their own genes as well as restriction endonuclease genes in many type II restriction-modification systems. More than 290 C protein homologs were identified and DNA-binding sites for ∼70% of new and previously known C proteins were predicted by a combination of phylogenetic footprinting and motif searches in DNA upstream of C protein genes. Additional analysis revealed that a large proportion of C protein genes are translated from leaderless RNA, which may contribute to time-delayed nature of genetic switches operated by these proteins. Analysis of genetic contexts of newly identified C protein genes revealed that they are not exclusively associated with restriction-modification genes; numerous instances of associations with genes originating from mobile genetic elements were observed. These instances might be vestiges of ancient horizontal transfers and indicate that during evolution ancestral restriction-modification system genes were the sites of mobile elements insertions. PMID:19056824

Protein Cofactors Are Essential for High-Affinity DNA Binding by the Nuclear Factor κB RelA Subunit.

PubMed

Mulero, Maria Carmen; Shahabi, Shandy; Ko, Myung Soo; Schiffer, Jamie M; Huang, De-Bin; Wang, Vivien Ya-Fan; Amaro, Rommie E; Huxford, Tom; Ghosh, Gourisankar

2018-05-22

Transcription activator proteins typically contain two functional domains: a DNA binding domain (DBD) that binds to DNA with sequence specificity and an activation domain (AD) whose established function is to recruit RNA polymerase. In this report, we show that purified recombinant nuclear factor κB (NF-κB) RelA dimers bind specific κB DNA sites with an affinity significantly lower than that of the same dimers from nuclear extracts of activated cells, suggesting that additional nuclear cofactors might facilitate DNA binding by the RelA dimers. Additionally, recombinant RelA binds DNA with relatively low affinity at a physiological salt concentration in vitro. The addition of p53 or RPS3 (ribosomal protein S3) increases RelA:DNA binding affinity 2- to >50-fold depending on the protein and ionic conditions. These cofactor proteins do not form stable ternary complexes, suggesting that they stabilize the RelA:DNA complex through dynamic interactions. Surprisingly, the RelA-DBD alone fails to bind DNA under the same solution conditions even in the presence of cofactors, suggesting an important role of the RelA-AD in DNA binding. Reduced RelA:DNA binding at a physiological ionic strength suggests that multiple cofactors might be acting simultaneously to mitigate the electrolyte effect and stabilize the RelA:DNA complex in vivo. Overall, our observations suggest that the RelA-AD and multiple cofactor proteins function cooperatively to prime the RelA-DBD and stabilize the RelA:DNA complex in cells. Our study provides a mechanism for nuclear cofactor proteins in NF-κB-dependent gene regulation.

Molecular Control of Polyene Macrolide Biosynthesis

PubMed Central

Santos-Aberturas, Javier; Vicente, Cláudia M.; Guerra, Susana M.; Payero, Tamara D.; Martín, Juan F.; Aparicio, Jesús F.

2011-01-01

Control of polyene macrolide production in Streptomyces natalensis is mediated by the transcriptional activator PimM. This regulator, which combines an N-terminal PAS domain with a C-terminal helix-turn-helix motif, is highly conserved among polyene biosynthetic gene clusters. PimM, truncated forms of the protein without the PAS domain (PimMΔPAS), and forms containing just the DNA-binding domain (DBD) (PimMDBD) were overexpressed in Escherichia coli as GST-fused proteins. GST-PimM binds directly to eight promoters of the pimaricin cluster, as demonstrated by electrophoretic mobility shift assays. Assays with truncated forms of the protein revealed that the PAS domain does not mediate specificity or the distinct recognition of target genes, which rely on the DBD domain, but significantly reduces binding affinity up to 500-fold. Transcription start points were identified by 5′-rapid amplification of cDNA ends, and the binding regions of PimMDBD were investigated by DNase I protection studies. In all cases, binding took place covering the −35 hexamer box of each promoter, suggesting an interaction of PimM and RNA polymerase to cause transcription activation. Information content analysis of the 16 sequences protected in target promoters was used to deduce the structure of the PimM-binding site. This site displays dyad symmetry, spans 14 nucleotides, and adjusts to the consensus TVGGGAWWTCCCBA. Experimental validation of this binding site was performed by using synthetic DNA duplexes. Binding of PimM to the promoter region of one of the polyketide synthase genes from the Streptomyces nodosus amphotericin cluster containing the consensus binding site was also observed, thus proving the applicability of the findings reported here to other antifungal polyketides. PMID:21187288

Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

PubMed Central

Glinsky, Gennadi V.

2015-01-01

Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

The Staphylococcus aureus pSK41 plasmid-encoded ArtA protein is a master regulator of plasmid transmission genes and contains a RHH motif used in alternate DNA-binding modes.

PubMed

Ni, Lisheng; Jensen, Slade O; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M; Guan, Fiona H X; Brown, Melissa H; Skurray, Ronald A; Firth, Neville; Schumacher, Maria A

2009-11-01

Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon-helix-helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes.

The Staphylococcus aureus pSK41 plasmid-encoded ArtA protein is a master regulator of plasmid transmission genes and contains a RHH motif used in alternate DNA-binding modes

PubMed Central

Ni, Lisheng; Jensen, Slade O.; Ky Tonthat, Nam; Berg, Tracey; Kwong, Stephen M.; Guan, Fiona H. X.; Brown, Melissa H.; Skurray, Ronald A.; Firth, Neville; Schumacher, Maria A.

2009-01-01

Plasmids harbored by Staphylococcus aureus are a major contributor to the spread of bacterial multi-drug resistance. Plasmid conjugation and partition are critical to the dissemination and inheritance of such plasmids. Here, we demonstrate that the ArtA protein encoded by the S. aureus multi-resistance plasmid pSK41 is a global transcriptional regulator of pSK41 genes, including those involved in conjugation and segregation. ArtA shows no sequence homology to any structurally characterized DNA-binding protein. To elucidate the mechanism by which it specifically recognizes its DNA site, we obtained the structure of ArtA bound to its cognate operator, ACATGACATG. The structure reveals that ArtA is representative of a new family of ribbon–helix–helix (RHH) DNA-binding proteins that contain extended, N-terminal basic motifs. Strikingly, unlike most well-studied RHH proteins ArtA binds its cognate operators as a dimer. However, we demonstrate that it is also able to recognize an atypical operator site by binding as a dimer-of-dimers and the extended N-terminal regions of ArtA were shown to be essential for this dimer-of-dimer binding mode. Thus, these data indicate that ArtA is a master regulator of genes critical for both horizontal and vertical transmission of pSK41 and that it can recognize DNA utilizing alternate binding modes. PMID:19759211

Genome-wide DNA methylation measurements in prostate tissues uncovers novel prostate cancer diagnostic biomarkers and transcription factor binding patterns.

PubMed

Kirby, Marie K; Ramaker, Ryne C; Roberts, Brian S; Lasseigne, Brittany N; Gunther, David S; Burwell, Todd C; Davis, Nicholas S; Gulzar, Zulfiqar G; Absher, Devin M; Cooper, Sara J; Brooks, James D; Myers, Richard M

2017-04-17

Current diagnostic tools for prostate cancer lack specificity and sensitivity for detecting very early lesions. DNA methylation is a stable genomic modification that is detectable in peripheral patient fluids such as urine and blood plasma that could serve as a non-invasive diagnostic biomarker for prostate cancer. We measured genome-wide DNA methylation patterns in 73 clinically annotated fresh-frozen prostate cancers and 63 benign-adjacent prostate tissues using the Illumina Infinium HumanMethylation450 BeadChip array. We overlaid the most significantly differentially methylated sites in the genome with transcription factor binding sites measured by the Encyclopedia of DNA Elements consortium. We used logistic regression and receiver operating characteristic curves to assess the performance of candidate diagnostic models. We identified methylation patterns that have a high predictive power for distinguishing malignant prostate tissue from benign-adjacent prostate tissue, and these methylation signatures were validated using data from The Cancer Genome Atlas Project. Furthermore, by overlaying ENCODE transcription factor binding data, we observed an enrichment of enhancer of zeste homolog 2 binding in gene regulatory regions with higher DNA methylation in malignant prostate tissues. DNA methylation patterns are greatly altered in prostate cancer tissue in comparison to benign-adjacent tissue. We have discovered patterns of DNA methylation marks that can distinguish prostate cancers with high specificity and sensitivity in multiple patient tissue cohorts, and we have identified transcription factors binding in these differentially methylated regions that may play important roles in prostate cancer development.

The role of monovalent cations in the ATPase reaction of DNA gyrase

PubMed Central

Hearnshaw, Stephen James; Chung, Terence Tsz-Hong; Stevenson, Clare Elizabeth Mary; Maxwell, Anthony; Lawson, David Mark

2015-01-01

Four new crystal structures of the ATPase domain of the GyrB subunit of Escherichia coli DNA gyrase have been determined. One of these, solved in the presence of K+, is the highest resolution structure reported so far for this domain and, in conjunction with the three other structures, reveals new insights into the function of this domain. Evidence is provided for the existence of two monovalent cation-binding sites: site 1, which preferentially binds a K+ ion that interacts directly with the α-phosphate of ATP, and site 2, which preferentially binds an Na+ ion and the functional significance of which is not clear. The crystallographic data are corroborated by ATPase data, and the structures are compared with those of homologues to investigate the broader conservation of these sites. PMID:25849408

Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

PubMed

Cave, John W; Xia, Li; Caudy, Michael

2011-01-01

In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

Intragenic DNA methylation and BORIS-mediated cancer-specific splicing contribute to the Warburg effect

PubMed Central

Singh, Smriti; Narayanan, Sathiya Pandi; Biswas, Kajal; Gupta, Amit; Ahuja, Neha; Yadav, Sandhya; Panday, Rajendra Kumar; Samaiya, Atul; Sharan, Shyam K.

2017-01-01

Aberrant alternative splicing and epigenetic changes are both associated with various cancers, but epigenetic regulation of alternative splicing in cancer is largely unknown. Here we report that the intragenic DNA methylation-mediated binding of Brother of Regulator of Imprinted Sites (BORIS) at the alternative exon of Pyruvate Kinase (PKM) is associated with cancer-specific splicing that promotes the Warburg effect and breast cancer progression. Interestingly, the inhibition of DNA methylation, BORIS depletion, or CRISPR/Cas9-mediated deletion of the BORIS binding site leads to a splicing switch from cancer-specific PKM2 to normal PKM1 isoform. This results in the reversal of the Warburg effect and the inhibition of breast cancer cell growth, which may serve as a useful approach to inhibit the growth of breast cancer cells. Importantly, our results show that in addition to PKM splicing, BORIS also regulates the alternative splicing of several genes in a DNA methylation-dependent manner. Our findings highlight the role of intragenic DNA methylation and DNA binding protein BORIS in cancer-specific splicing and its role in tumorigenesis. PMID:29073069

The monomeric form of Neisseria DNA mimic protein DMP19 prevents DNA from binding to the histone-like HU protein

PubMed Central

Ko, Tzu-Ping; Liao, Yi-Ting; Hsu, Kai-Cheng

2017-01-01

DNA mimicry is a direct and effective strategy by which the mimic competes with DNA for the DNA binding sites on other proteins. Until now, only about a dozen proteins have been shown to function via this strategy, including the DNA mimic protein DMP19 from Neisseria meningitides. We have shown previously that DMP19 dimer prevents the operator DNA from binding to the transcription factor NHTF. Here, we provide new evidence that DMP19 monomer can also interact with the Neisseria nucleoid-associated protein HU. Using BS3 crosslinking, gel filtration and isothermal titration calorimetry assays, we found that DMP19 uses its monomeric form to interact with the Neisseria HU dimer. Crosslinking conjugated mass spectrometry was used to investigate the binding mode of DMP19 monomer and HU dimer. Finally, an electrophoretic mobility shift assay (EMSA) confirmed that the DNA binding affinity of HU is affected by DMP19. These results showed that DMP19 is bifunctional in the gene regulation of Neisseria through its variable oligomeric forms. PMID:29220372

Determination of the DNA-binding characteristics of ethidium bromide, proflavine, and cisplatin by flow injection analysis: usefulness in studies on antitumor drugs.

PubMed

Alonso, A; Almendral, M J; Curto, Y; Criado, J J; Rodríguez, E; Manzano, J L

2006-08-15

Flow injection analysis was used to study the reactions occurring between DNA and certain compounds that bind to its double helix, deforming this and even breaking it, such that some of them (e.g., cisplatin) are endowed with antitumoral activity. Use of this technique in the merging zones and stopped-flow modes afforded data on the binding parameters and the kinetic characteristics of the process. The first compound studied was ethidium bromide (EtdBr), used as a fluorescent marker because its fluorescence is enhanced when it binds to DNA. The DNA-EtdBr binding parameters, the apparent intrinsic binding constant (0.31+/-0.02 microM(-1)), and the maximum number of binding sites per nucleotide (0.327+/-0.009) were determined. The modification introduced in these parameters by the presence of proflavine (Prf), a classic competitive inhibitor of the binding of EtdBr to the DNA double helix, was also studied, determining the value of the intrinsic binding constant of Prf (K(Prf) = 0.119+/-9x10(-3) microM(-1)). Finally, we determined the binding parameters between DNA and EtdBr in the presence of the antitumor agent cisplatin, a noncompetitive inhibitor of such binding. This provided information about the binding mechanism as well as the duration and activity of the binding of the compound in its pharmacological use.

Beyond the binding site: in vivo identification of tbx2, smarca5 and wnt5b as molecular targets of CNBP during embryonic development.

PubMed

Armas, Pablo; Margarit, Ezequiel; Mouguelar, Valeria S; Allende, Miguel L; Calcaterra, Nora B

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates.

Beyond the Binding Site: In Vivo Identification of tbx2, smarca5 and wnt5b as Molecular Targets of CNBP during Embryonic Development

PubMed Central

Mouguelar, Valeria S.; Allende, Miguel L.; Calcaterra, Nora B.

2013-01-01

CNBP is a nucleic acid chaperone implicated in vertebrate craniofacial development, as well as in myotonic dystrophy type 2 (DM2) and sporadic inclusion body myositis (sIBM) human muscle diseases. CNBP is highly conserved among vertebrates and has been implicated in transcriptional regulation; however, its DNA binding sites and molecular targets remain elusive. The main goal of this work was to identify CNBP DNA binding sites that might reveal target genes involved in vertebrate embryonic development. To accomplish this, we used a recently described yeast one-hybrid assay to identify DNA sequences bound in vivo by CNBP. Bioinformatic analyses revealed that these sequences are G-enriched and show high frequency of putative G-quadruplex DNA secondary structure. Moreover, an in silico approach enabled us to establish the CNBP DNA-binding site and to predict CNBP putative targets based on gene ontology terms and synexpression with CNBP. The direct interaction between CNBP and candidate genes was proved by EMSA and ChIP assays. Besides, the role of CNBP upon the identified genes was validated in loss-of-function experiments in developing zebrafish. We successfully confirmed that CNBP up-regulates tbx2b and smarca5, and down-regulates wnt5b gene expression. The highly stringent strategy used in this work allowed us to identify new CNBP target genes functionally important in different contexts of vertebrate embryonic development. Furthermore, it represents a novel approach toward understanding the biological function and regulatory networks involving CNBP in the biology of vertebrates. PMID:23667590

Direct Binding to Replication Protein A (RPA)-coated Single-stranded DNA Allows Recruitment of the ATR Activator TopBP1 to Sites of DNA Damage*

PubMed Central

Acevedo, Julyana; Yan, Shan; Michael, W. Matthew

2016-01-01

A critical event for the ability of cells to tolerate DNA damage and replication stress is activation of the ATR kinase. ATR activation is dependent on the BRCT (BRCA1 C terminus) repeat-containing protein TopBP1. Previous work has shown that recruitment of TopBP1 to sites of DNA damage and stalled replication forks is necessary for downstream events in ATR activation; however, the mechanism for this recruitment was not known. Here, we use protein binding assays and functional studies in Xenopus egg extracts to show that TopBP1 makes a direct interaction, via its BRCT2 domain, with RPA-coated single-stranded DNA. We identify a point mutant that abrogates this interaction and show that this mutant fails to accumulate at sites of DNA damage and that the mutant cannot activate ATR. These data thus supply a mechanism for how the critical ATR activator, TopBP1, senses DNA damage and stalled replication forks to initiate assembly of checkpoint signaling complexes. PMID:27129245

The role of differing probe and target strand lengths in DNA microarrays investigated via Monte Carlo molecular simulation

NASA Astrophysics Data System (ADS)

Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.

2018-02-01

DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.

DNA Mismatch Binding and Antiproliferative Activity of Rhodium Metalloinsertors

PubMed Central

Ernst, Russell J.; Song, Hang; Barton, Jacqueline K.

2009-01-01

Deficiencies in mismatch repair (MMR) are associated with carcinogenesis. Rhodium metalloinsertors bind to DNA base mismatches with high specificity and inhibit cellular proliferation preferentially in MMR-deficient cells versus MMR-proficient cells. A family of chrysenequinone diimine complexes of rhodium with varying ancillary ligands that serve as DNA metalloinsertors has been synthesized, and both DNA mismatch binding affinities and antiproliferative activities against the human colorectal carcinoma cell lines HCT116N and HCT116O, an isogenic model system for MMR deficiency, have been determined. DNA photocleavage experiments reveal that all complexes bind to the mismatch sites with high specificities; DNA binding affinities to oligonucleotides containing single base CA and CC mismatches, obtained through photocleavage titration or competition, vary from 104 to 108 M−1 for the series of complexes. Significantly, binding affinities are found to be inversely related to ancillary ligand size and directly related to differential inhibition of the HCT116 cell lines. The observed trend in binding affinity is consistent with the metalloinsertion mode where the complex binds from the minor groove with ejection of mismatched base pairs. The correlation between binding affinity and targeting of the MMR-deficient cell line suggests that rhodium metalloinsertors exert their selective biological effects on MMR-deficient cells through mismatch binding in vivo. PMID:19175313

Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

PubMed Central

Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

2016-01-01

Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

The human mitochondrial single-stranded DNA-binding protein displays distinct kinetics and thermodynamics of DNA binding and exchange

PubMed Central

Qian, Yufeng; Johnson, Kenneth A.

2017-01-01

The human mitochondrial ssDNA-binding protein (mtSSB) is a homotetrameric protein, involved in mtDNA replication and maintenance. Although mtSSB is structurally similar to SSB from Escherichia coli (EcoSSB), it lacks the C-terminal disordered domain, and little is known about the biophysics of mtSSB–ssDNA interactions. Here, we characterized the kinetics and thermodynamics of mtSSB binding to ssDNA by equilibrium titrations and stopped-flow kinetic measurements. We show that the mtSSB tetramer can bind to ssDNA in two distinct binding modes: (SSB)30 and (SSB)60, defined by DNA binding site sizes of 30 and 60 nucleotides, respectively. We found that the binding mode is modulated by magnesium ion and NaCl concentration, but unlike EcoSSB, the mtSSB does not show negative intersubunit cooperativity. Global fitting of both the equilibrium and kinetic data afforded estimates for the rate and equilibrium constants governing the formation of (SSB)60 and (SSB)30 complexes and for the transitions between the two binding modes. We found that the mtSSB tetramer binds to ssDNA with a rate constant near the diffusion limit (2 × 109 m−1 s−1) and that longer DNA (≥60 nucleotides) rapidly wraps around all four monomers, as revealed by FRET assays. We also show that the mtSSB tetramer can directly transfer from one ssDNA molecule to another via an intermediate with two DNA molecules bound to the mtSSB. In conclusion, our results indicate that human mtSSB shares many physicochemical properties with EcoSSB and that the differences may be explained by the lack of an acidic, disordered C-terminal tail in human mtSSB protein. PMID:28615444

Modulated photophysics of a cationic DNA-staining dye inside protein bovine serum albumin: Study of binding interaction and structural changes of protein

NASA Astrophysics Data System (ADS)

Samanta, Anuva; Jana, Sankar; Ray, Debarati; Guchhait, Nikhil

2014-03-01

The binding affinity of cationic DNA-staining dye, propidium iodide, with transport protein, bovine serum albumin, has been explored using UV-vis absorption, fluorescence, and circular dichroism spectroscopy. Steady state and time resolved fluorescence studies authenticate that fluorescence quenching of bovine serum albumin by propidium iodide is due to bovine serum albumin-propidium iodide complex formation. Thermodynamic parameters obtained from temperature dependent spectral studies cast light on binding interaction between the probe and protein. Site marker competitive binding has been encountered using phenylbutazone and flufenamic acid for site I and site II, respectively. Energy transfer efficiency and distance between bovine serum albumin and propidium iodide have been determined using Förster mechanism. Structural stabilization or destabilization of protein by propidium iodide has been investigated by urea denaturation study. The circular dichroism study as well as FT-IR measurement demonstrates some configurational changes of the protein in presence of the dye. Docking studies support the experimental data thereby reinforcing the binding site of the probe to the subdomain IIA of bovine serum albumin.

DNA binding by the ribosomal DNA transcription factor rrn3 is essential for ribosomal DNA transcription.

PubMed

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H; Rothblum, Katrina; Schneider, David A; Rothblum, Lawrence I

2013-03-29

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382-400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I.

DNA Binding by the Ribosomal DNA Transcription Factor Rrn3 Is Essential for Ribosomal DNA Transcription*

PubMed Central

Stepanchick, Ann; Zhi, Huijun; Cavanaugh, Alice H.; Rothblum, Katrina; Schneider, David A.; Rothblum, Lawrence I.

2013-01-01

The human homologue of yeast Rrn3 is an RNA polymerase I-associated transcription factor that is essential for ribosomal DNA (rDNA) transcription. The generally accepted model is that Rrn3 functions as a bridge between RNA polymerase I and the transcription factors bound to the committed template. In this model Rrn3 would mediate an interaction between the mammalian Rrn3-polymerase I complex and SL1, the rDNA transcription factor that binds to the core promoter element of the rDNA. In the course of studying the role of Rrn3 in recruitment, we found that Rrn3 was in fact a DNA-binding protein. Analysis of the sequence of Rrn3 identified a domain with sequence similarity to the DNA binding domain of heat shock transcription factor 2. Randomization, or deletion, of the amino acids in this region in Rrn3, amino acids 382–400, abrogated its ability to bind DNA, indicating that this domain was an important contributor to DNA binding by Rrn3. Control experiments demonstrated that these mutant Rrn3 constructs were capable of interacting with both rpa43 and SL1, two other activities demonstrated to be essential for Rrn3 function. However, neither of these Rrn3 mutants was capable of functioning in transcription in vitro. Moreover, although wild-type human Rrn3 complemented a yeast rrn3-ts mutant, the DNA-binding site mutant did not. These results demonstrate that DNA binding by Rrn3 is essential for transcription by RNA polymerase I. PMID:23393135

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Interaction studies of resistomycin from Streptomyces aurantiacus AAA5 with calf thymus DNA and bovine serum albumin

NASA Astrophysics Data System (ADS)

Vijayabharathi, R.; Sathyadevi, P.; Krishnamoorthy, P.; Senthilraja, D.; Brunthadevi, P.; Sathyabama, S.; Priyadarisini, V. Brindha

2012-04-01

Resistomycin, a secondary metabolite produced by Streptomyces aurantiacus AAA5. The binding interaction of resistomycin with calf thymus DNA (CT DNA) and bovine serum albumin (BSA) was investigated by spectrophotometry, spectrofluorimetry, circular dichroism (CD) and synchronous fluorescence techniques under physiological conditions in vitro. Absorption spectral studies along with the fluorescence competition with ethidium bromide measurements and circular dichroism clearly suggest that the resistomycin bind with CT DNA relatively strong via groove binding. BSA interaction results revealed that the drug was found to quench the fluorescence intensity of the protein through a static quenching mechanism. The number of binding sites 'n' and apparent binding constant 'K' calculated according to the Scatchard equation exhibit a good binding property to bovine serum albumin protein. In addition, the results observed from synchronous fluorescence measurements clearly demonstrate the occurrence of conformational changes of BSA upon addition of the test compound.

Structural Insights into the Assembly of the Adeno-associated Virus Type 2 Rep68 Protein on the Integration Site AAVS1*

PubMed Central

Musayev, Faik N.; Zarate-Perez, Francisco; Bishop, Clayton; Burgner, John W.; Escalante, Carlos R.

2015-01-01

Adeno-associated virus (AAV) is the only eukaryotic virus with the property of establishing latency by integrating site-specifically into the human genome. The integration site known as AAVS1 is located in chromosome 19 and contains multiple GCTC repeats that are recognized by the AAV non-structural Rep proteins. These proteins are multifunctional, with an N-terminal origin-binding domain (OBD) and a helicase domain joined together by a short linker. As a first step to understand the process of site-specific integration, we proceeded to characterize the recognition and assembly of Rep68 onto the AAVS1 site. We first determined the x-ray structure of AAV-2 Rep68 OBD in complex with the AAVS1 DNA site. Specificity is achieved through the interaction of a glycine-rich loop that binds the major groove and an α-helix that interacts with a downstream minor groove on the same face of the DNA. Although the structure shows a complex with three OBD molecules bound to the AAVS1 site, we show by using analytical centrifugation and electron microscopy that the full-length Rep68 forms a heptameric complex. Moreover, we determined that a minimum of two direct repeats is required to form a stable complex and to melt DNA. Finally, we show that although the individual domains bind DNA poorly, complex assembly requires oligomerization and cooperation between its OBD, helicase, and the linker domains. PMID:26370092

BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

DTIC Science & Technology

2007-12-01

mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to play a...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task...the above construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two

BAF57 Modulation of Androgen Receptor Action and Prostate Cancer Progression

DTIC Science & Technology

2006-12-01

has fine mapped the AR binding site on BAF57 to the N-terminus (proline-rich region). Furthermore, the DBD and hinge region of AR also appear to...Accomplishments of Task 1: BAF57 binds to DNA binding domain ( DBD ) and hinge region of AR As outlined in the initial proposal, the first task was to...construct are the well-characterized zinc finger DNA binding domain ( DBD ) and the hinge region. Given the significant role of these two domains in AR

PRODORIC2: the bacterial gene regulation database in 2018

PubMed Central

Dudek, Christian-Alexander; Hartlich, Juliane; Brötje, David; Jahn, Dieter

2018-01-01

Abstract Bacteria adapt to changes in their environment via differential gene expression mediated by DNA binding transcriptional regulators. The PRODORIC2 database hosts one of the largest collections of DNA binding sites for prokaryotic transcription factors. It is the result of the thoroughly redesigned PRODORIC database. PRODORIC2 is more intuitive and user-friendly. Besides significant technical improvements, the new update offers more than 1000 new transcription factor binding sites and 110 new position weight matrices for genome-wide pattern searches with the Virtual Footprint tool. Moreover, binding sites deduced from high-throughput experiments were included. Data for 6 new bacterial species including bacteria of the Rhodobacteraceae family were added. Finally, a comprehensive collection of sigma- and transcription factor data for the nosocomial pathogen Clostridium difficile is now part of the database. PRODORIC2 is publicly available at http://www.prodoric2.de. PMID:29136200

Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

PubMed Central

Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

2001-01-01

Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

Searching for statistically significant regulatory modules.

PubMed

Bailey, Timothy L; Noble, William Stafford

2003-10-01

The regulatory machinery controlling gene expression is complex, frequently requiring multiple, simultaneous DNA-protein interactions. The rate at which a gene is transcribed may depend upon the presence or absence of a collection of transcription factors bound to the DNA near the gene. Locating transcription factor binding sites in genomic DNA is difficult because the individual sites are small and tend to occur frequently by chance. True binding sites may be identified by their tendency to occur in clusters, sometimes known as regulatory modules. We describe an algorithm for detecting occurrences of regulatory modules in genomic DNA. The algorithm, called mcast, takes as input a DNA database and a collection of binding site motifs that are known to operate in concert. mcast uses a motif-based hidden Markov model with several novel features. The model incorporates motif-specific p-values, thereby allowing scores from motifs of different widths and specificities to be compared directly. The p-value scoring also allows mcast to only accept motif occurrences with significance below a user-specified threshold, while still assigning better scores to motif occurrences with lower p-values. mcast can search long DNA sequences, modeling length distributions between motifs within a regulatory module, but ignoring length distributions between modules. The algorithm produces a list of predicted regulatory modules, ranked by E-value. We validate the algorithm using simulated data as well as real data sets from fruitfly and human. http://meme.sdsc.edu/MCAST/paper

Interplay between CedA, rpoB and double stranded DNA: A step towards understanding CedA mediated cell division in E. coli.

PubMed

Sharma, Pankaj; Tomar, Anil Kumar; Kundu, Bishwajit

2018-02-01

Cell division is compromised in DnaAcos mutant E. coli cells due to chromosome over-replication. In these cells, CedA acts as a regulatory protein and initiates cell division by a hitherto unknown mechanism. CedA, a double stranded DNA binding protein, interacts with various subunits of RNA polymerase complex, including rpoB. To reveal how this concert between CedA, rpoB and DNA brings about cell division in E. coli, we performed biophysical and in silico analysis and obtained mechanistic insights. Interaction between CedA and rpoB was shown by circular dichroism spectrometry and in silico docking experiments. Further, CedA and rpoB were allowed to interact individually to a selected DNA and their binding was monitored by fluorescence spectroscopy. The binding constants of these interactions as determined by BioLayer Interferometry clearly show that rpoB binds to DNA with higher affinity (K D2 =<1.0E-12M) as compared to CedA (K D2 =9.58E-09M). These findings were supported by docking analysis where 12 intermolecular H-bonds were formed in rpoB-DNA complex as compared to 4 in CedA-DNA complex. Based on our data we propose that in E. coli cells chromosome over-replication signals CedA to recruit rpoB to specific DNA site(s), which initiates transcription of cell division regulatory elements. Copyright © 2017 Elsevier B.V. All rights reserved.

Construction and properties of a temperature-sensitive mutation in the gene for the bacteriophage SPO1 DNA-binding protein TF1.

PubMed

Sayre, M H; Geiduschek, E P

1990-08-01

The Bacillus subtilis bacteriophage SPO1 encodes the DNA-binding protein TF1, a homolog of the ubiquitous type II DNA-binding proteins that are components of bacterial chromatin. The known three-dimensional structure of a related protein was used in devising a scheme of site-directed mutagenesis that led to the creation of a temperature-sensitive mutation in the TF1 gene. At the nonpermissive temperature, this mutation disrupted the temporal regulation of viral protein synthesis and processing, altered the kinetics of accumulation of at least one viral transcript, and prohibited the production of infective progeny phage. We suggest that TF1 function is required to shut off the expression of several early-middle and middle viral genes and that TF1 plays a role in phage head morphogenesis. Spontaneous second-site mutations of the temperature-sensitive mutant TF1 allele that suppressed its associated phenotypes were analyzed. These suppressor mutations conferred greater amino acid sequence homology with the type II DNA-binding protein from the thermophile Bacillus stearothermophilus.

Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

PubMed

Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

2016-04-20

Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

What controls the hybridization thermodynamics of spherical nucleic acids?

PubMed

Randeria, Pratik S; Jones, Matthew R; Kohlstedt, Kevin L; Banga, Resham J; Olvera de la Cruz, Monica; Schatz, George C; Mirkin, Chad A

2015-03-18

The hybridization of free oligonucleotides to densely packed, oriented arrays of DNA modifying the surfaces of spherical nucleic acid (SNA)-gold nanoparticle conjugates occurs with negative cooperativity; i.e., each binding event destabilizes subsequent binding events. DNA hybridization is thus an ever-changing function of the number of strands already hybridized to the particle. Thermodynamic quantification of this behavior reveals a 3 orders of magnitude decrease in the binding constant for the capture of a free oligonucleotide by an SNA conjugate as the fraction of pre-hybridized strands increases from 0 to ∼30%. Increasing the number of pre-hybridized strands imparts an increasing enthalpic penalty to hybridization that makes binding more difficult, while simultaneously decreasing the entropic penalty to hybridization, which makes binding more favorable. Hybridization of free DNA to an SNA is thus governed by both an electrostatic barrier as the SNA accumulates charge with additional binding events and an effect consistent with allostery, where hybridization at certain sites on an SNA modify the binding affinity at a distal site through conformational changes to the remaining single strands. Leveraging these insights allows for the design of conjugates that hybridize free strands with significantly higher efficiencies, some of which approach 100%.

Probing the target search of DNA-binding proteins in mammalian cells using TetR as model searcher

NASA Astrophysics Data System (ADS)

Normanno, Davide; Boudarène, Lydia; Dugast-Darzacq, Claire; Chen, Jiji; Richter, Christian; Proux, Florence; Bénichou, Olivier; Voituriez, Raphaël; Darzacq, Xavier; Dahan, Maxime

2015-07-01

Many cellular functions rely on DNA-binding proteins finding and associating to specific sites in the genome. Yet the mechanisms underlying the target search remain poorly understood, especially in the case of the highly organized mammalian cell nucleus. Using as a model Tet repressors (TetRs) searching for a multi-array locus, we quantitatively analyse the search process in human cells with single-molecule tracking and single-cell protein-DNA association measurements. We find that TetRs explore the nucleus and reach their target by 3D diffusion interspersed with transient interactions with non-cognate sites, consistent with the facilitated diffusion model. Remarkably, nonspecific binding times are broadly distributed, underlining a lack of clear delimitation between specific and nonspecific interactions. However, the search kinetics is not determined by diffusive transport but by the low association rate to nonspecific sites. Altogether, our results provide a comprehensive view of the recruitment dynamics of proteins at specific loci in mammalian cells.

Studies on the interaction of a synthetic nitro-flavone derivative with DNA: A multi-spectroscopic and molecular docking approach.

PubMed

Mitra, A; Saikh, F; Das, J; Ghosh, S; Ghosh, R

2018-05-22

Interaction of a ligand with DNA is often the basis of drug action of many molecules. Flavones are important in this regard as their structural features confer them the ability to bind to DNA. 2-(4-Nitrophenyl)-4H-chromen-4-one (4NCO) is an important biologically active synthetic flavone derivative. We are therefore interested in studying its interaction with DNA. Absorption spectroscopy studies included standard and reverse titration, effect of ionic strength on titration, determination of stoichiometry of binding and thermal denaturation. Spectrofluorimetry techniques included fluorimetric titration, quenching studies and fluorescence displacement assay. Assessment of relative viscosity and estimation of thermodynamic parameters from CD spectral studies were also undertaken. Furthermore, molecular docking analyses were also done with different short DNA sequences. The fluorescent flavone 4NCO reversibly interacted with DNA through partial intercalation as well as minor-groove binding. The binding constant and the number of binding sites were of the order 10 4  M -1 and 1 respectively. The binding stoichiometry with DNA was found to be 1:1. The nature of the interaction of 4NCO with DNA was hydrophobic in nature and the process of binding was spontaneous, endothermic and entropy-driven. The flavone also showed a preference for binding to GC rich sequences. The study presents a profile for structural and thermodynamic parameters, for the binding of 4NCO with DNA. DNA is an important target for ligands that are effective against cell proliferative disorders. In this regard, the molecule 4NCO is important since it can exert its biological activity through its DNA binding ability and can be a potential drug candidate. Copyright © 2018 Elsevier B.V. All rights reserved.

Real-space and real-time dynamics of CRISPR-Cas9 visualized by high-speed atomic force microscopy.

PubMed

Shibata, Mikihiro; Nishimasu, Hiroshi; Kodera, Noriyuki; Hirano, Seiichi; Ando, Toshio; Uchihashi, Takayuki; Nureki, Osamu

2017-11-10

The CRISPR-associated endonuclease Cas9 binds to a guide RNA and cleaves double-stranded DNA with a sequence complementary to the RNA guide. The Cas9-RNA system has been harnessed for numerous applications, such as genome editing. Here we use high-speed atomic force microscopy (HS-AFM) to visualize the real-space and real-time dynamics of CRISPR-Cas9 in action. HS-AFM movies indicate that, whereas apo-Cas9 adopts unexpected flexible conformations, Cas9-RNA forms a stable bilobed structure and interrogates target sites on the DNA by three-dimensional diffusion. These movies also provide real-time visualization of the Cas9-mediated DNA cleavage process. Notably, the Cas9 HNH nuclease domain fluctuates upon DNA binding, and subsequently adopts an active conformation, where the HNH active site is docked at the cleavage site in the target DNA. Collectively, our HS-AFM data extend our understanding of the action mechanism of CRISPR-Cas9.

Recognition of DNA abasic site nanocavity by fluorophore-switched probe: Suitable for all sequence environments

NASA Astrophysics Data System (ADS)

Wang, Ying; Hu, Yuehua; Wu, Tao; Zhang, Lihua; Liu, Hua; Zhou, Xiaoshun; Shao, Yong

2016-01-01

Removal of a damaged base in DNA produces an abasic site (AP site) nanocavity. If left un-repaired in vivo by the specific enzyme, this nanocavity will result in nucleotide mutation in the following DNA replication. Therefore, selective recognition of AP site nanocavity by small molecules is important for identification of such DNA damage and development of genetic drugs. In this work, we investigate the fluorescence behavior of isoquinoline alkaloids including palmatine (PAL), berberine (BER), epiberberine (EPI), jatrorrhizine (JAT), coptisine (COP), coralyne (COR), worenine (WOR), berberrubine (BEU), sanguinarine (SAN), chelerythrine (CHE), and nitidine (NIT) upon binding with the AP nanocavity. PAL is screened out as the most efficient fluorophore-switched probe to recognize the AP nanocavity over the fully matched DNA. Its fluorescence enhancement occurs for all of the AP nanocavity sequence environments, which has not been achieved by the previously used probes. The bridged π conjugation effect should partially contribute to the AP nanocavity-specific fluorescence, as opposed to the solvent effect. Due to the strong binding with the AP nanocavity, PAL will find wide applications in the DNA damage recognition and sensor development.

A Comparison Study for DNA Motif Modeling on Protein Binding Microarray.

PubMed

Wong, Ka-Chun; Li, Yue; Peng, Chengbin; Wong, Hau-San

2016-01-01

Transcription factor binding sites (TFBSs) are relatively short (5-15 bp) and degenerate. Identifying them is a computationally challenging task. In particular, protein binding microarray (PBM) is a high-throughput platform that can measure the DNA binding preference of a protein in a comprehensive and unbiased manner; for instance, a typical PBM experiment can measure binding signal intensities of a protein to all possible DNA k-mers (k = 8∼10). Since proteins can often bind to DNA with different binding intensities, one of the major challenges is to build TFBS (also known as DNA motif) models which can fully capture the quantitative binding affinity data. To learn DNA motif models from the non-convex objective function landscape, several optimization methods are compared and applied to the PBM motif model building problem. In particular, representative methods from different optimization paradigms have been chosen for modeling performance comparison on hundreds of PBM datasets. The results suggest that the multimodal optimization methods are very effective for capturing the binding preference information from PBM data. In particular, we observe a general performance improvement if choosing di-nucleotide modeling over mono-nucleotide modeling. In addition, the models learned by the best-performing method are applied to two independent applications: PBM probe rotation testing and ChIP-Seq peak sequence prediction, demonstrating its biological applicability.

DIRECT BINDING OF GLYCERALDEHYDE 3-PHOSPHATE DEHYDROGENASE TO TELOMERIC DNA PROTECTS TELOMERES AGAINST CHEMOTHERAPY-INDUCED RAPID DEGRADATION

PubMed Central

Demarse, Neil A.; Ponnusamy, Suriyan; Spicer, Eleanor K.; Apohan, Elif; Baatz, John E.; Ogretmen, Besim; Davies, Christopher

2009-01-01

GAPDH (glyceraldehyde 3-phosphate dehydrogenase) is a glycolytic enzyme that displays several non-glycolytic activities, including the maintenance and/or protection of telomeres. In this study, we determined the molecular mechanism and biological role of the interaction between GAPDH and human telomeric DNA. Using gel shift assays, we show that recombinant GAPDH binds directly with high affinity (Kd = 45 nM) to a single-stranded oligonucleotide comprising three telomeric DNA repeats and that nucleotides T1, G5 and G6 of the TTAGGG repeat are essential for binding. The stoichiometry of the interaction is 2:1 (DNA: GAPDH), and GAPDH appears to form a high-molecular weight complex when bound to the oligonucleotide. Mutation of Asp32 and Cys149, which are localized to the NAD-binding site and the active site center of GAPDH, respectively, produced mutants that almost completely lost their telomere-binding functions both in vitro and in situ (in A549 human lung cancer cells). Treatment of A549 cells with the chemotherapeutic agents gemcitabine and doxorubicin resulted in increased nuclear localization of expressed wild-type GAPDH, where it protected telomeres against rapid degradation, concomitant with increased resistance to the growth inhibitory effects of these drugs. The non-DNA-binding mutants of GAPDH also localized to the nucleus when expressed in A549 cells, but did not confer any significant protection of telomeres against chemotherapy-induced degradation or growth inhibition, and this occurred without the involvement of caspase activation or apoptosis regulation. Overall, these data demonstrate that GAPDH binds telomeric DNA directly in vitro and may have a biological role in the protection of telomeres against rapid degradation in response to chemotherapeutic agents in A549 human lung cancer cells. PMID:19800890

Dissociation free-energy profiles of specific and nonspecific DNA-protein complexes.

PubMed

Yonetani, Yoshiteru; Kono, Hidetoshi

2013-06-27

DNA-binding proteins recognize DNA sequences with at least two different binding modes: specific and nonspecific. Experimental structures of such complexes provide us a static view of the bindings. However, it is difficult to reveal further mechanisms of their target-site search and recognition only from static information because the transition process between the bound and unbound states is not clarified by static information. What is the difference between specific and nonspecific bindings? Here we performed adaptive biasing force molecular dynamics simulations with the specific and nonspecific structures of DNA-Lac repressor complexes to investigate the dissociation process. The resultant free-energy profiles showed that the specific complex has a sharp, deep well consistent with tight binding, whereas the nonspecific complex has a broad, shallow well consistent with loose binding. The difference in the well depth, ~5 kcal/mol, was in fair agreement with the experimentally obtained value and was found to mainly come from the protein conformational difference, particularly in the C-terminal tail. Also, the free-energy profiles were found to be correlated with changes in the number of protein-DNA contacts and that of surface water molecules. The derived protein spatial distributions around the DNA indicate that any large dissociation occurs rarely, regardless of the specific and nonspecific sites. Comparison of the free-energy barrier for sliding [~8.7 kcal/mol; Furini J. Phys. Chem. B 2010, 114, 2238] and that for dissociation (at least ~16 kcal/mol) calculated in this study suggests that sliding is much preferred to dissociation.

A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

PubMed Central

Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

1992-01-01

Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

Anti-DNA antibodies--quintessential biomarkers of SLE.

PubMed

Pisetsky, David S

2016-02-01

Antibodies that recognize and bind to DNA (anti-DNA antibodies) are serological hallmarks of systemic lupus erythematosus (SLE) and key markers for diagnosis and disease activity. In addition to common use in the clinic, anti-DNA antibody testing now also determines eligibility for clinical trials, raising important questions about the nature of the antibody-antigen interaction. At present, no 'gold standard' for serological assessment exists, and anti-DNA antibody binding can be measured with a variety of assay formats, which differ in the nature of the DNA substrates and in the conditions for binding and detection of antibodies. A mechanism called monogamous bivalency--in which high avidity results from simultaneous interaction of IgG Fab sites with a single polynucleotide chain--determines anti-DNA antibody binding; this mechanism might affect antibody detection in different assay formats. Although anti-DNA antibodies can promote pathogenesis by depositing in the kidney or driving cytokine production, they are not all alike, pathologically, and anti-DNA antibody expression does not necessarily correlate with active disease. Levels of anti-DNA antibodies in patients with SLE can vary over time, distinguishing anti-DNA antibodies from other pathogenic antinuclear antibodies. Elucidation of the binding specificities and the pathogenic roles of anti-DNA antibodies in SLE should enable improvements in the design of informative assays for both clinical and research purposes.

Trigger Factor and DnaK possess overlapping substrate pools and binding specificities.

PubMed

Deuerling, Elke; Patzelt, Holger; Vorderwülbecke, Sonja; Rauch, Thomas; Kramer, Günter; Schaffitzel, Elke; Mogk, Axel; Schulze-Specking, Agnes; Langen, Hanno; Bukau, Bernd

2003-03-01

Ribosome-associated Trigger Factor (TF) and the DnaK chaperone system assist the folding of newly synthesized proteins in Escherichia coli. Here, we show that DnaK and TF share a common substrate pool in vivo. In TF-deficient cells, deltatig, depleted for DnaK and DnaJ the amount of aggregated proteins increases with increasing temperature, amounting to 10% of total soluble protein (approximately 340 protein species) at 37 degrees C. A similar population of proteins aggregated in DnaK depleted tig+ cells, albeit to a much lower extent. Ninety-four aggregated proteins isolated from DnaK- and DnaJ-depleted deltatig cells were identified by mass spectrometry and found to include essential cytosolic proteins. Four potential in vivo substrates were screened for chaperone binding sites using peptide libraries. Although TF and DnaK recognize different binding motifs, 77% of TF binding peptides also associated with DnaK. In the case of the nascent polypeptides TF and DnaK competed for binding, however, with competitive advantage for TF. In vivo, the loss of TF is compensated by the induction of the heat shock response and thus enhanced levels of DnaK. In summary, our results demonstrate that the co-operation of the two mechanistically distinct chaperones in protein folding is based on their overlap in substrate specificities.

In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

PubMed

Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

2018-01-01

DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

Applications of DNA Nanomechanical Devices to Molecular Biology and to Programmed Dynamic Motion

NASA Astrophysics Data System (ADS)

Liu, Chunhua

Not merely is DNA a favorable genetic material, but an effective supermolecular subunit for nanoconstruction as well. In structural DNA nanotechnology, rigid branched DNA motifs have been combined with sticky-ended cohesion to build DNA objects, arrays and devices for functional purposes. Reciprocating devices are key features in macroscopic machines. In Chapter II, I report the construction of two reciprocal PX-JX2 devices, wherein the control strands leading to the PX state in one device lead to the JX2 state in the other device, and vice versa. The formation, transformation and reciprocal motions of these two devices are confirmed utilizing gel electrophoresis, and atomic force microscopy. This system is likely to be of use for molecular robotic applications where reciprocal motions are of value in addition its inherent contribution to molecular choreography and molecular aesthetics. Recently, several DNA-based nanomechanical devices have been developed as an attractive tool for fine measurements on nanoscale objects. In Chapter III, I have constructed a device wherein two DNA triple crossover (TX) molecules are connected by a shaft, similar to a previous device that measured the amount of work that can be performed by integration host factor [Shen, W., Bruist, M., Goodman, S. & Seeman, N. C., Angew. Chemie Int. Ed. 43, 4750-4752 (2004)]. In the present case, the binding site on the shaft contains the sequence recognized by apo-SoxR, the apo-form of a protein that is a redox-sensing transcriptional activator; previous data suggest that it distorts its binding site by an amount that corresponds to about two base pairs. A pair of dyes reports the fluorescence resonance energy transfer (FRET) signal between the two TX domains, reflecting changes in the shape of the device upon binding the protein. The TX domains are used to amplify the signal expected from a relatively small distortion of the DNA binding site. From FRET analysis of apo-SoxR binding, the effect of apo-SoxR on the original TX device is similar to the effect of shortening the TX device by 2-bp. It is estimated that apo-SoxR can do 3.2-6.1 Kcal/mol of work on the DNA target site.

Screening for Protein-DNA Interactions by Automatable DNA-Protein Interaction ELISA

PubMed Central

Schüssler, Axel; Kolukisaoglu, H. Üner; Koch, Grit; Wallmeroth, Niklas; Hecker, Andreas; Thurow, Kerstin; Zell, Andreas; Harter, Klaus; Wanke, Dierk

2013-01-01

DNA-binding proteins (DBPs), such as transcription factors, constitute about 10% of the protein-coding genes in eukaryotic genomes and play pivotal roles in the regulation of chromatin structure and gene expression by binding to short stretches of DNA. Despite their number and importance, only for a minor portion of DBPs the binding sequence had been disclosed. Methods that allow the de novo identification of DNA-binding motifs of known DBPs, such as protein binding microarray technology or SELEX, are not yet suited for high-throughput and automation. To close this gap, we report an automatable DNA-protein-interaction (DPI)-ELISA screen of an optimized double-stranded DNA (dsDNA) probe library that allows the high-throughput identification of hexanucleotide DNA-binding motifs. In contrast to other methods, this DPI-ELISA screen can be performed manually or with standard laboratory automation. Furthermore, output evaluation does not require extensive computational analysis to derive a binding consensus. We could show that the DPI-ELISA screen disclosed the full spectrum of binding preferences for a given DBP. As an example, AtWRKY11 was used to demonstrate that the automated DPI-ELISA screen revealed the entire range of in vitro binding preferences. In addition, protein extracts of AtbZIP63 and the DNA-binding domain of AtWRKY33 were analyzed, which led to a refinement of their known DNA-binding consensi. Finally, we performed a DPI-ELISA screen to disclose the DNA-binding consensus of a yet uncharacterized putative DBP, AtTIFY1. A palindromic TGATCA-consensus was uncovered and we could show that the GATC-core is compulsory for AtTIFY1 binding. This specific interaction between AtTIFY1 and its DNA-binding motif was confirmed by in vivo plant one-hybrid assays in protoplasts. Thus, the value and applicability of the DPI-ELISA screen for de novo binding site identification of DBPs, also under automatized conditions, is a promising approach for a deeper understanding of gene regulation in any organism of choice. PMID:24146751

Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

PubMed Central

Pastor, N; Pardo, L; Weinstein, H

1997-01-01

The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

Role of Nucleoid Associated Proteins in Stabilizing Supercoils

NASA Astrophysics Data System (ADS)

Dahlke, Katelyn; Sing, Charles

Nucleoid associated proteins (NAPs) play an important role in prokaryotic cells by manipulating the shape and structure of the DNA. These NAPs act by bending or twisting DNA, and there are indications that NAPs bind preferentially to DNA that is already bent or twisted. We hypothesize that these binding behaviors strongly impact the stability and structure of DNA. We use coarse-grained simulation of NAPs and DNA that allow us to achieve the time and length scales where DNA supercoiling occurs. Supercoils are twist-induced structures that are the result of relaxing highly-twisted DNA by inducing higher degrees of bending and writhe. We are able to reproduce experimental observations, such as the extension of a DNA molecule as a function of force, linking number, and NAP concentration. Building upon these test cases, we allow the binding and unbinding energy of the simulated NAPs to be a function of the bending angle of the DNA at the site of binding (ΔEB (θ)). Consequently, NAPs localize along the contour of the supercoil, and this binding preference is capable of stabilizing supercoils that form within the nucleoid. National Institute Of General Medical Sciences of the National Institutes of Health under Award Number T32GM070421.

The influence of repressor DNA binding site architecture on transcriptional control.

PubMed

Park, Dan M; Kiley, Patricia J

2014-08-26

How the architecture of DNA binding sites dictates the extent of repression of promoters is not well understood. Here, we addressed the importance of the number and information content of the three direct repeats (DRs) in the binding and repression of the icdA promoter by the phosphorylated form of the global Escherichia coli repressor ArcA (ArcA-P). We show that decreasing the information content of the two sites with the highest information (DR1 and DR2) eliminated ArcA binding to all three DRs and ArcA repression of icdA. Unexpectedly, we also found that DR3 occupancy functions principally in repression, since mutation of this low-information-content site both eliminated DNA binding to DR3 and significantly weakened icdA repression, despite the fact that binding to DR1 and DR2 was intact. In addition, increasing the information content of any one of the three DRs or addition of a fourth DR increased ArcA-dependent repression but perturbed signal-dependent regulation of repression. Thus, our data show that the information content and number of DR elements are critical architectural features for maintaining a balance between high-affinity binding and signal-dependent regulation of icdA promoter function in response to changes in ArcA-P levels. Optimization of such architectural features may be a common strategy to either dampen or enhance the sensitivity of DNA binding among the members of the large OmpR/PhoB family of regulators as well as other transcription factors. In Escherichia coli, the response regulator ArcA maintains homeostasis of redox carriers under O2-limiting conditions through a comprehensive repression of carbon oxidation pathways that require aerobic respiration to recycle redox carriers. Although a binding site architecture comprised of a variable number of sequence recognition elements has been identified within the promoter regions of ArcA-repressed operons, it is unclear how this variable architecture dictates transcriptional regulation. By dissecting the role of multiple sequence elements within the icdA promoter, we provide insight into the design principles that allow ArcA to repress transcription within diverse promoter contexts. Our data suggest that the arrangement of recognition elements is tailored to achieve sufficient repression of a given promoter while maintaining appropriate signal-dependent regulation of repression, providing insight into how diverse binding site architectures link changes in O2 with the fine-tuning of carbon oxidation pathway levels. Copyright © 2014 Park and Kiley.

Direct measurement of torque and twist generated by a dye binding to DNA

NASA Astrophysics Data System (ADS)

Gore, Jeff; Bryant, Zev; Bustamante, Carlos

2004-03-01

Many biologically important chemicals and proteins change the twist of DNA upon binding. We have used magnetic tweezers to directly measure the torque and twist generated when ethidium bromide binds and unbinds to DNA. One end of the DNA is bound specifically to a glass coverslip and the opposite end is held away from the surface by a paramagnetic bead. Attached to the middle of the DNA is a second fluorescent bead whose position can be tracked with high angular and temporal resolution. On one side of the fluorescent bead binding site we have engineered a single strand nick that acts like a free swivel. Addition of ethidium bromide then powered rotation of the central fluorescent bead. After the ethidium bromide was bound we used magnesium to compete out the intercalated ethidium bromide, thus inducing a rotation in the opposite direction. We studied the torque generation, energetics, and kinetics associated with ethidium bromide binding and unbinding by tracking the rotation of the fluorescent bead. This system is a demonstration of a reversible chemically powered DNA-based rotary motor. We also expect that this technique will be useful in studying proteins that bind to or rotate DNA, including recA, polymerases, and topoisomerases.

Fis protein induced λF-DNA bending observed by single-pair fluorescence resonance energy transfer

NASA Astrophysics Data System (ADS)

Chi-Cheng, Fu; Wunshain, Fann; Yuan Hanna, S.

2006-03-01

Fis, a site-specific DNA binding protein, regulates many biological processes including recombination, transcription, and replication in E.coli. Fis induced DNA bending plays an important role in regulating these functions and bending angle range from ˜50 to 95 dependent on the DNA sequence. For instance, the average bending angle of λF-DNA (26 bp, 8.8nm long, contained λF binding site on the center) measured by gel mobility shift assays was ˜ 94 . But the traditional method cannot provide information about the dynamics and the angle distribution. In this study, λF-DNA was labeled with donor (Alexa Fluor 546) and acceptor (Alexa Fluor 647) dyes on its two 5' ends and the donor-acceptor distances were measured using single-pair fluorescence resonance energy transfer (sp-FRET) with and without the present of Fis protein. Combing with structure information of Fis-DNA complex, the sp-FRET results are used to estimate the protein induced DNA bending angle distribution and dynamics.

Tumorigenic Potential of Transit Amplifying Prostate Cells

DTIC Science & Technology

2012-06-01

by ChIP-Seq showed that in both the human prostate cell line LNCaP and in mouse prostate, NKX3.1 bound DNA fragments are significantly enriched in...progression. Cancer Cell. 2010;17(5):443–454. 29. Steadman DJ, Giuffrida D, Gelmann EP. DNA - binding sequence of the human prostate-specific...bind nucleosomal DNA and destabilize nucleosomes thereby allowing other transcription factors to access their sites (7),(8). BODY Aim 1: To

Mutational analysis of human RNA polymerase II subunit 5 (RPB5): the residues critical for interactions with TFIIF subunit RAP30 and hepatitis B virus X protein.

PubMed

Le, Thi Thu Thuy; Zhang, Shijun; Hayashi, Naoyuki; Yasukawa, Mami; Delgermaa, Luvsanjav; Murakami, Seishi

2005-09-01

RNA polymerase II (RNAPII) subunit 5 (RPB5) is positioned close to DNA downstream of the initiation site and is the site of interaction with several regulators. Hepatitis B virus X protein (HBx) binds the central part of RPB5 to modulate activated transcription, and TFIIF subunit RAP30 interacts with the same part of RPB5 that is critical for the association between TFIIF and RNAPII. However the residues necessary for these interactions remain unknown. Here we report systematic mutagenesis of the central part of RPB5 using two-step alanine scanning libraries to pinpoint critical residues for its binding to RAP30 in the TFIIF complex and/or to HBx, and identified these residues in both mammalian cells and in an in vitro binding assay. Four residues, F76, I104, T111 and S113, are critical for both TFIIF- and HBx-binding, indicating the overlapping nature of the sites of interaction. In addition, V74 and N98 are required for HBx-binding, and T56 and L58 are needed for RAP30-binding. Interestingly the residues exposed to solvent, T111 and S113, are very close to the DNA, implying that two factors may modulate the interaction between DNA and RPB5.

Dynamic Changes in Nucleosome Occupancy Are Not Predictive of Gene Expression Dynamics but Are Linked to Transcription and Chromatin Regulators

PubMed Central

Huebert, Dana J.; Kuan, Pei-Fen; Keleş, Sündüz

2012-01-01

The response to stressful stimuli requires rapid, precise, and dynamic gene expression changes that must be coordinated across the genome. To gain insight into the temporal ordering of genome reorganization, we investigated dynamic relationships between changing nucleosome occupancy, transcription factor binding, and gene expression in Saccharomyces cerevisiae yeast responding to oxidative stress. We applied deep sequencing to nucleosomal DNA at six time points before and after hydrogen peroxide treatment and revealed many distinct dynamic patterns of nucleosome gain and loss. The timing of nucleosome repositioning was not predictive of the dynamics of downstream gene expression change but instead was linked to nucleosome position relative to transcription start sites and specific cis-regulatory elements. We measured genome-wide binding of the stress-activated transcription factor Msn2p over time and found that Msn2p binds different loci with different dynamics. Nucleosome eviction from Msn2p binding sites was common across the genome; however, we show that, contrary to expectation, nucleosome loss occurred after Msn2p binding and in fact required Msn2p. This negates the prevailing model that nucleosomes obscuring Msn2p sites regulate DNA access and must be lost before Msn2p can bind DNA. Together, these results highlight the complexities of stress-dependent chromatin changes and their effects on gene expression. PMID:22354995

Interaction of small molecules with double-stranded RNA: spectroscopic, viscometric, and calorimetric study of hoechst and proflavine binding to PolyCG structures.

PubMed

Sinha, Rangana; Hossain, Maidul; Kumar, Gopinatha Suresh

2009-04-01

Design and synthesis of new small molecules binding to double-stranded RNA necessitate complete understanding of the molecular aspects of the binding of many existing molecules. Toward this goal, in this work we evaluated the biophysical aspects of the interaction of a DNA intercalator (proflavine) and a minor groove binder (hoechst 33258) with two polymorphic forms of polyCG, namely, the right-handed Watson-Crick base paired A-form and the left-handed Hoogsteen base paired H(L)-form, by absorption, fluorescence, and viscometry experiments. The energetics of the interaction of these molecules with the RNA structures has also been elucidated by isothermal titration calorimetry (ITC). Results suggest that proflavine strongly intercalates in both forms of polyCG, whereas hoechst shows mainly groove-binding modes. The binding of both drugs to both forms of RNA resulted in significant conformational change to the RNA structure with the bound molecules being placed in the chiral RNA helix. ITC profiles for both proflavine and hoechst show two binding sites. Binding of proflavine to both forms of RNA is endothermic and entropy driven in the first site and exothermic and enthalpy driven in the second site, whereas hoechst binding to both forms of RNA is exothermic and enthalpy driven in the first site and endothermic and entropy driven in the second site. This study suggests that the binding affinity characteristics and energetics of interaction of these DNA binding molecules with the RNA conformations are significantly different and may serve as data for future development of effective structure-selective RNA-based drugs.

DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase*

PubMed Central

Graham, Brian W.; Tao, Yeqing; Dodge, Katie L.; Thaxton, Carly T.; Olaso, Danae; Young, Nicolas L.; Marshall, Alan G.

2016-01-01

The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5–30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. PMID:27044751

A domain of the Klenow fragment of Escherichia coli DNA polymerase I has polymerase but no exonuclease activity.

PubMed

Freemont, P S; Ollis, D L; Steitz, T A; Joyce, C M

1986-09-01

The Klenow fragment of DNA polymerase I from Escherichia coli has two enzymatic activities: DNA polymerase and 3'-5' exonuclease. The crystal structure showed that the fragment is folded into two distinct domains. The smaller domain has a binding site for deoxynucleoside monophosphate and a divalent metal ion that is thought to identify the 3'-5' exonuclease active site. The larger C-terminal domain contains a deep cleft that is believed to bind duplex DNA. Several lines of evidence suggested that the large domain also contains the polymerase active site. To test this hypothesis, we have cloned the DNA coding for the large domain into an expression system and purified the protein product. We find that the C-terminal domain has polymerase activity (albeit at a lower specific activity than the native Klenow fragment) but no measurable 3'-5' exonuclease activity. These data are consistent with the hypothesis that each of the three enzymatic activities of DNA polymerase I from E. coli resides on a separate protein structural domain.

PRP19 Transforms into a Sensor of RPA-ssDNA after DNA Damage and Drives ATR Activation via a Ubiquitin-Mediated Circuitry

PubMed Central

Maréchal, Alexandre; Wu, Ching-Shyi; Yazinski, Stephanie A.; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E.; Jin, Jianping; Zou, Lee

2014-01-01

Summary PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). While the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 binds RPA directly and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ATR kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, the recovery of stalled replication forks, and the progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. PMID:24332808

Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: Advances toward treatment of hepatitis B virus infections

NASA Astrophysics Data System (ADS)

Shahabadi, Nahid; Falsafi, Monireh

The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33 ± 0.2 × 104 L mol-1and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH = 34.4 kJ mol-1; ΔS = 184.32 J mol-1 K-1). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol-1. This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo.

DNA Double-Strand Breaks Coupled with PARP1 and HNRNPA2B1 Binding Sites Flank Coordinately Expressed Domains in Human Chromosomes

PubMed Central

Fedoseeva, Daria M.; Sosin, Dmitri V.; Grachev, Sergei A.; Serebraykova, Marina V.; Romanenko, Svetlana A.; Vorobieva, Nadezhda V.; Kravatsky, Yuri V.

2013-01-01

Genome instability plays a key role in multiple biological processes and diseases, including cancer. Genome-wide mapping of DNA double-strand breaks (DSBs) is important for understanding both chromosomal architecture and specific chromosomal regions at DSBs. We developed a method for precise genome-wide mapping of blunt-ended DSBs in human chromosomes, and observed non-random fragmentation and DSB hot spots. These hot spots are scattered along chromosomes and delimit protected 50–250 kb DNA domains. We found that about 30% of the domains (denoted forum domains) possess coordinately expressed genes and that PARP1 and HNRNPA2B1 specifically bind DNA sequences at the forum domain termini. Thus, our data suggest a novel type of gene regulation: a coordinated transcription or silencing of gene clusters delimited by DSB hot spots as well as PARP1 and HNRNPa2B1 binding sites. PMID:23593027

DNA-Binding Properties of African Swine Fever Virus pA104R, a Histone-Like Protein Involved in Viral Replication and Transcription.

PubMed

Frouco, Gonçalo; Freitas, Ferdinando B; Coelho, João; Leitão, Alexandre; Martins, Carlos; Ferreira, Fernando

2017-06-15

African swine fever virus (ASFV) codes for a putative histone-like protein (pA104R) with extensive sequence homology to bacterial proteins that are implicated in genome replication and packaging. Functional characterization of purified recombinant pA104R revealed that it binds to single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) over a wide range of temperatures, pH values, and salt concentrations and in an ATP-independent manner, with an estimated binding site size of about 14 to 16 nucleotides. Using site-directed mutagenesis, the arginine located in pA104R's DNA-binding domain, at position 69, was found to be relevant for efficient DNA-binding activity. Together, pA104R and ASFV topoisomerase II (pP1192R) display DNA-supercoiling activity, although none of the proteins by themselves do, indicating that the two cooperate in this process. In ASFV-infected cells, A104R transcripts were detected from 2 h postinfection (hpi) onward, reaching a maximum concentration around 16 hpi. pA104R was detected from 12 hpi onward, localizing with viral DNA replication sites and being found exclusively in the Triton-insoluble fraction. Small interfering RNA (siRNA) knockdown experiments revealed that pA104R plays a critical role in viral DNA replication and gene expression, with transfected cells showing lower viral progeny numbers (up to a reduction of 82.0%), lower copy numbers of viral genomes (-78.3%), and reduced transcription of a late viral gene (-47.6%). Taken together, our results strongly suggest that pA104R participates in the modulation of viral DNA topology, probably being involved in viral DNA replication, transcription, and packaging, emphasizing that ASFV mutants lacking the A104R gene could be used as a strategy to develop a vaccine against ASFV. IMPORTANCE Recently reintroduced in Europe, African swine fever virus (ASFV) causes a fatal disease in domestic pigs, causing high economic losses in affected countries, as no vaccine or treatment is currently available. Remarkably, ASFV is the only known mammalian virus that putatively codes for a histone-like protein (pA104R) that shares extensive sequence homology with bacterial histone-like proteins. In this study, we characterized the DNA-binding properties of pA104R, analyzed the functional importance of two conserved residues, and showed that pA104R and ASFV topoisomerase II cooperate and display DNA-supercoiling activity. Moreover, pA104R is expressed during the late phase of infection and accumulates in viral DNA replication sites, and its downregulation revealed that pA104R is required for viral DNA replication and transcription. These results suggest that pA104R participates in the modulation of viral DNA topology and genome packaging, indicating that A104R deletion mutants may be a good strategy for vaccine development against ASFV. Copyright © 2017 American Society for Microbiology.

Binding sites for abundant nuclear factors modulate RNA polymerase I-dependent enhancer function in Saccharomyces cerevisiae.

PubMed

Kang, J J; Yokoi, T J; Holland, M J

1995-12-01

The 190-base pair (bp) rDNA enhancer within the intergenic spacer sequences of Saccharomyces cerevisiae rRNA cistrons activates synthesis of the 35S-rRNA precursor about 20-fold in vivo (Mestel,, R., Yip, M., Holland, J. P., Wang, E., Kang, J., and Holland, M. J. (1989) Mol. Cell. Biol. 9, 1243-1254). We now report identification and analysis of transcriptional activities mediated by three cis-acting sites within a 90-bp portion of the rDNA enhancer designated the modulator region. In vivo, these sequences mediated termination of transcription by RNA polymerase I and potentiated the activity of the rDNA enhancer element. Two trans-acting factors, REB1 and REB2, bind independently to sites within the modulator region (Morrow, B. E., Johnson, S. P., and Warner, J. R. (1989) J. Biol. Chem. 264, 9061-9068). We show that REB2 is identical to the ABF1 protien. Site-directed mutagenesis of REB1 and ABF1 binding sites demonstrated uncoupling of RNA polymerase I-dependent termination from transcriptional activation in vivo. We conclude that REB1 and ABF1 are required for RNA polymerase I-dependent termination and enhancer function, respectively, Since REB1 and ABF1 proteins also regulate expression of class II genes and other nuclear functions, our results suggest further similarities between RNA polymerase I and II regulatory mechanisms. Two rDNA enhancers flanking a rDNA minigene stimulated RNA polymerase I transcription in a "multiplicative" fashion. Deletion mapping analysis showed that similar cis-acting sequences were required for enhancer function when positioned upstream or downstream from a rDNA minigene.

( sup 3 H)-DOB(4-bromo-2,5-dimethoxyphenylisopropylamine) and ( sup 3 H) ketanserin label two affinity states of the cloned human 5-hydroxytryptamine2 receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Branchek, T.; Adham, N.; Macchi, M.

1990-11-01

The binding properties of the 5-hydroxytryptamine2 (5-HT2) receptor have been the subject of much interest and debate in recent years. The hallucinogenic amphetamine derivative 4-bromo-2,5-dimethoxyphenylisopropylamine (DOB) has been shown to bind to a small number of binding sites with properties very similar to (3H)ketanserin-labeled 5-HT2 receptors, but with much higher agonist affinities. Some researchers have interpreted this as evidence for the existence of a new subtype of 5-HT2 receptor (termed 5-HT2A), whereas others have interpreted these data as indicative of agonist high affinity and agonist low affinity states for the 5-HT2 receptor. In this investigation, a cDNA clone encoding themore » serotonin 5-HT2 receptor was transiently transfected into monkey kidney Cos-7 cells and stably transfected into mouse fibroblast L-M(TK-) cells. In both systems, expression of this single serotonin receptor cDNA led to the appearance of both (3H)DOB and (3H)ketanserin binding sites with properties that matched their binding characteristics in mammalian brain homogenates. Addition of guanosine 5'-(beta, gamma-imido) triphosphate (Gpp(NH)p) to this system caused a rightward shift and steepening of agonist competition curves for (3H) ketanserin binding, converting a two-site binding curve to a single low affinity binding state. Gpp(NH)p addition also caused a 50% decrease in the number of high affinity (3H)DOB binding sites, with no change in the dissociation constant of the remaining high affinity states. These data on a single human 5-HT2 receptor cDNA expressed in two different transfection host cells indicate that (3H)DOB and (3H)ketanserin binding reside on the same gene product, apparently interacting with agonist and antagonist conformations of a single human 5-HT2 receptor protein.« less

[125I]-GR231118: a high affinity radioligand to investigate neuropeptide Y Y1 and Y4 receptors

PubMed Central

Dumont, Yvan; Quirion, Rémi

2000-01-01

GR231118 (also known as 1229U91 and GW1229), a purported Y1 antagonist and Y4 agonist was radiolabelled using the chloramine T method. [125I]-GR231118 binding reached equilibrium within 10 min at room temperature and remained stable for at least 4 h. Saturation binding experiments showed that [125I]-GR231118 binds with very high affinity (Kd of 0.09–0.24 nM) in transfected HEK293 cells with the rat Y1 and Y4 receptor cDNA and in rat brain membrane homogenates. No specific binding sites could be detected in HEK293 cells transfected with the rat Y2 or Y5 receptor cDNA demonstrating the absence of significant affinity of GR231118 for these two receptor classes. Competition binding experiments revealed that specific [125I]-GR231118 binding in rat brain homogenates is most similar to that observed in HEK293 cells transfected with the rat Y1, but not rat Y4, receptor cDNA. Autoradiographic studies demonstrated that [125I]-GR231118 binding sites were fully inhibited by the Y1 antagonist BIBO3304 in most areas of the rat brain. Interestingly, high percentage of [125I]-GR231118/BIBO3304-insensitive binding sites were detected in few areas. These [125I]-GR231118/BIBO3304-insensitive binding sites likely represent labelling to the Y4 receptor subtype. In summary, [125I]-GR231118 is a new radiolabelled probe to investigate the Y1 and Y4 receptors; its major advantage being its high affinity. Using highly selective Y1 antagonists such as BIBO3304 or BIBP3226 it is possible to block the binding of [125I]-GR231118 to the Y1 receptor allowing for the characterization and visualization of the purported Y4 subtype. PMID:10694200

Rapid on-site/in-situ detection of heavy metal ions in environmental water using a structure-switching DNA optical biosensor.

PubMed

Long, Feng; Zhu, Anna; Shi, Hanchang; Wang, Hongchen; Liu, Jingquan

2013-01-01

A structure-switching DNA optical biosensor for rapid on-site/in situ detection of heavy metal ions is reported. Mercury ions (Hg²⁺), highly toxic and ubiquitous pollutants, were selected as model target. In this system, fluorescence-labeled DNA containing T-T mismatch structure was introduced to bind with DNA probes immobilized onto the sensor surface. In the presence of Hg²⁺, some of the fluorescence-labeled DNAs bind with Hg²⁺ to form T-Hg²⁺-T complexes through the folding of themselves into a hairpin structure and dehybridization from the sensor surface, which leads to decrease in fluorescence signal. The total analysis time for a single sample was less than 10 min with detection limit of 1.2 nM. The rapid on-site/in situ determination of Hg²⁺ was readily performed in natural water. This sensing strategy can be extended in principle to other metal ions by substituting the T-Hg²⁺-T complexes with other specificity structures that selectively bind to other analytes.

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

NASA Astrophysics Data System (ADS)

D'Aquino, J. Alejandro; Ringe, Dagmar

2006-08-01

The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

Mutational analyses of Aquifex pyrophilus DNA ligase define essential domains for self-adenylation and DNA binding activity.

PubMed

Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S

2001-04-15

We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.

Characterization of the interaction of yeast enolase with polynucleotides.

PubMed

al-Giery, A G; Brewer, J M

1992-09-23

Yeast enolase is inhibited under certain conditions by DNA. The enzyme binds to single-stranded DNA-cellulose. Inhibition was used for routine characterization of the interaction. The presence of the substrate 2-phospho-D-glycerate reduces inhibition and binding. Both yeast enolase isozymes behave similarly. Impure yeast enolase was purified by adsorption onto a single-stranded DNA-cellulose column followed by elution with substrate. Interaction with RNA, double-stranded DNA, or degraded DNA results in less inhibition, suggesting that yeast enolase preferentially binds single-stranded DNA. However, yeast enolase is not a DNA-unwinding protein. The enzyme is inhibited by the short synthetic oligodeoxynucleotides G6, G8 and G10 but not T8 or T6, suggesting some base specificity in the interaction. The interaction is stronger at more acid pH values, with an apparent pK of 5.6. The interaction is prevented by 0.3 M KCl, suggesting that electrostatic factors are important. Histidine or lysine reverse the inhibition at lower concentrations, while phosphate is still more effective. Binding of single-stranded DNA to enolase reduces the reaction of protein histidyl residues with diethylpyrocarbonate. The inhibition of yeast enolase by single-stranded DNA is not total, and suggests the active site is not directly involved in the interaction. Binding of substrate may induce a conformational change in the enzyme that interferes with DNA binding and vice versa.

Two residues in the basic region of the yeast transcription factor Yap8 are crucial for its DNA-binding specificity.

PubMed

Amaral, Catarina; Pimentel, Catarina; Matos, Rute G; Arraiano, Cecília M; Matzapetakis, Manolis; Rodrigues-Pousada, Claudina

2013-01-01

In Saccharomyces cerevisiae, the transcription factor Yap8 is a key determinant in arsenic stress response. Contrary to Yap1, another basic region-leucine zipper (bZIP) yeast regulator, Yap8 has a very restricted DNA-binding specificity and only orchestrates the expression of ACR2 and ACR3 genes. In the DNA-binding basic region, Yap8 has three distinct amino acids residues, Leu26, Ser29 and Asn31, at sites of highly conserved positions in the other Yap family of transcriptional regulators and Pap1 of Schizosaccharomyces pombe. To evaluate whether these residues are relevant to Yap8 specificity, we first built a homology model of the complex Yap8bZIP-DNA based on Pap1-DNA crystal structure. Several Yap8 mutants were then generated in order to confirm the contribution of the residues predicted to interact with DNA. Using bioinformatics analysis together with in vivo and in vitro approaches, we have identified several conserved residues critical for Yap8-DNA binding. Moreover, our data suggest that Leu26 is required for Yap8 binding to DNA and that this residue together with Asn31, hinder Yap1 response element recognition by Yap8, thus narrowing its DNA-binding specificity. Furthermore our results point to a role of these two amino acids in the stability of the Yap8-DNA complex.

Identification and positional distribution analysis of transcription factor binding sites for genes from the wheat fl-cDNA sequences.

PubMed

Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui

2017-06-01

The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.

Toward rules relating zinc finger protein sequences and DNA binding site preferences.

PubMed

Desjarlais, J R; Berg, J M

1992-08-15

Zinc finger proteins of the Cys2-His2 type consist of tandem arrays of domains, where each domain appears to contact three adjacent base pairs of DNA through three key residues. We have designed and prepared a series of variants of the central zinc finger within the DNA binding domain of Sp1 by using information from an analysis of a large data base of zinc finger protein sequences. Through systematic variations at two of the three contact positions (underlined), relatively specific recognition of sequences of the form 5'-GGGGN(G or T)GGG-3' has been achieved. These results provide the basis for rules that may develop into a code that will allow the design of zinc finger proteins with preselected DNA site specificity.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9.

PubMed

Sternberg, Samuel H; Redding, Sy; Jinek, Martin; Greene, Eric C; Doudna, Jennifer A

2014-03-06

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

DNA interrogation by the CRISPR RNA-guided endonuclease Cas9

NASA Astrophysics Data System (ADS)

Sternberg, Samuel H.; Redding, Sy; Jinek, Martin; Greene, Eric C.; Doudna, Jennifer A.

2014-03-01

The clustered regularly interspaced short palindromic repeats (CRISPR)-associated enzyme Cas9 is an RNA-guided endonuclease that uses RNA-DNA base-pairing to target foreign DNA in bacteria. Cas9-guide RNA complexes are also effective genome engineering agents in animals and plants. Here we use single-molecule and bulk biochemical experiments to determine how Cas9-RNA interrogates DNA to find specific cleavage sites. We show that both binding and cleavage of DNA by Cas9-RNA require recognition of a short trinucleotide protospacer adjacent motif (PAM). Non-target DNA binding affinity scales with PAM density, and sequences fully complementary to the guide RNA but lacking a nearby PAM are ignored by Cas9-RNA. Competition assays provide evidence that DNA strand separation and RNA-DNA heteroduplex formation initiate at the PAM and proceed directionally towards the distal end of the target sequence. Furthermore, PAM interactions trigger Cas9 catalytic activity. These results reveal how Cas9 uses PAM recognition to quickly identify potential target sites while scanning large DNA molecules, and to regulate scission of double-stranded DNA.

Structure and mechanism of the phage T4 recombination mediator protein UvsY

DOE PAGES

Gajewski, Stefan; Waddell, Michael Brett; Vaithiyalingam, Sivaraja; ...

2016-03-07

The UvsY recombination mediator protein is critical for efficient homologous recombination in bacteriophage T4 and is the functional analog of the eukaryotic Rad52 protein. During T4 homologous recombination, the UvsX recombinase has to compete with the prebound gp32 single-stranded binding protein for DNA-binding sites and UvsY stimulates this filament nucleation event. We report here the crystal structure of UvsY in four similar open-barrel heptameric assemblies and provide structural and biophysical insights into its function. The UvsY heptamer was confirmed in solution by centrifugation and light scattering, and thermodynamic analyses revealed that the UvsY–ssDNA interaction occurs within the assembly via twomore » distinct binding modes. Using surface plasmon resonance, we also examined the binding of UvsY to both ssDNA and the ssDNA–gp32 complex. These analyses confirmed that ssDNA can bind UvsY and gp32 independently and also as a ternary complex. They also showed that residues located on the rim of the heptamer are required for optimal binding to ssDNA, thus identifying the putative ssDNA-binding surface. We propose a model in which UvsY promotes a helical ssDNA conformation that disfavors the binding of gp32 and initiates the assembly of the ssDNA–UvsX filament.« less

Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

2013-01-01

Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

TRX-LOGOS - a graphical tool to demonstrate DNA information content dependent upon backbone dynamics in addition to base sequence.

PubMed

Fortin, Connor H; Schulze, Katharina V; Babbitt, Gregory A

2015-01-01

It is now widely-accepted that DNA sequences defining DNA-protein interactions functionally depend upon local biophysical features of DNA backbone that are important in defining sites of binding interaction in the genome (e.g. DNA shape, charge and intrinsic dynamics). However, these physical features of DNA polymer are not directly apparent when analyzing and viewing Shannon information content calculated at single nucleobases in a traditional sequence logo plot. Thus, sequence logos plots are severely limited in that they convey no explicit information regarding the structural dynamics of DNA backbone, a feature often critical to binding specificity. We present TRX-LOGOS, an R software package and Perl wrapper code that interfaces the JASPAR database for computational regulatory genomics. TRX-LOGOS extends the traditional sequence logo plot to include Shannon information content calculated with regard to the dinucleotide-based BI-BII conformation shifts in phosphate linkages on the DNA backbone, thereby adding a visual measure of intrinsic DNA flexibility that can be critical for many DNA-protein interactions. TRX-LOGOS is available as an R graphics module offered at both SourceForge and as a download supplement at this journal. To demonstrate the general utility of TRX logo plots, we first calculated the information content for 416 Saccharomyces cerevisiae transcription factor binding sites functionally confirmed in the Yeastract database and matched to previously published yeast genomic alignments. We discovered that flanking regions contain significantly elevated information content at phosphate linkages than can be observed at nucleobases. We also examined broader transcription factor classifications defined by the JASPAR database, and discovered that many general signatures of transcription factor binding are locally more information rich at the level of DNA backbone dynamics than nucleobase sequence. We used TRX-logos in combination with MEGA 6.0 software for molecular evolutionary genetics analysis to visually compare the human Forkhead box/FOX protein evolution to its binding site evolution. We also compared the DNA binding signatures of human TP53 tumor suppressor determined by two different laboratory methods (SELEX and ChIP-seq). Further analysis of the entire yeast genome, center aligned at the start codon, also revealed a distinct sequence-independent 3 bp periodic pattern in information content, present only in coding region, and perhaps indicative of the non-random organization of the genetic code. TRX-LOGOS is useful in any situation in which important information content in DNA can be better visualized at the positions of phosphate linkages (i.e. dinucleotides) where the dynamic properties of the DNA backbone functions to facilitate DNA-protein interaction.

Effect of NaeI-L43K mutation on protein dynamics and DNA conformation: Insights from molecular dynamics simulations.

PubMed

Ramachandrakurup, Sreelakshmi; Ramakrishnan, Vigneshwar

2017-09-01

Protein-DNA interactions are an important class of biomolecular interactions inside the cell. Delineating the mechanisms of protein-DNA interactions and more specifically, how proteins search and bind to their specific cognate sequences has been the quest of many in the scientific community. Restriction enzymes have served as useful model systems to this end. In this work, we have investigated using molecular dynamics simulations the effect of L43K mutation on NaeI, a type IIE restriction enzyme. NaeI has two domains, the Topo and the Endo domains, each binding to identical strands of DNA sequences (GCCGGC) 2 . The binding of the DNA to the Topo domain is thought to enhance the binding and cleavage of DNA at the Endo domain. Interestingly, it has been found that the mutation of an amino acid that is distantly-located from the DNA cleavage site (L43K) converts the restriction endonuclease to a topoisomerase. Our investigations reveal that the L43K mutation not only induces local structural changes (as evidenced by changes in hydrogen bond propensities and differences in the percentage of secondary structure assignments of the residues in the ligase-like domain) but also alters the overall protein dynamics and DNA conformation which probably leads to the loss of specific cleavage of the recognition site. In a larger context, our study underscores the importance of considering the role of distantly-located amino acids in understanding protein-DNA interactions. Copyright © 2017 Elsevier Inc. All rights reserved.

From carpet bombing to cruise missiles: the 'second-order' mechanisms used by transcription factors to ensure specific DNA binding in vivo.

PubMed

Kodadek, T

1995-05-01

Transcription factors generally have only modest specificity for their target sites, yet must find them in a sea of non-specific DNA. Some transcription factors are expressed at very high levels, to ensure that, despite losses to non-specific binding, the promoter is still occupied (the carpet-bombing strategy). Others increase their binding specificity by collaborating with other factors in a variety of ways.

Functional diversification of ROK-family transcriptional regulators of sugar catabolism in the Thermotogae phylum

PubMed Central

Kazanov, Marat D.; Li, Xiaoqing; Gelfand, Mikhail S.; Osterman, Andrei L.; Rodionov, Dmitry A.

2013-01-01

Large and functionally heterogeneous families of transcription factors have complex evolutionary histories. What shapes specificities toward effectors and DNA sites in paralogous regulators is a fundamental question in biology. Bacteria from the deep-branching lineage Thermotogae possess multiple paralogs of the repressor, open reading frame, kinase (ROK) family regulators that are characterized by carbohydrate-sensing domains shared with sugar kinases. We applied an integrated genomic approach to study functions and specificities of regulators from this family. A comparative analysis of 11 Thermotogae genomes revealed novel mechanisms of transcriptional regulation of the sugar utilization networks, DNA-binding motifs and specific functions. Reconstructed regulons for seven groups of ROK regulators were validated by DNA-binding assays using purified recombinant proteins from the model bacterium Thermotoga maritima. All tested regulators demonstrated specific binding to their predicted cognate DNA sites, and this binding was inhibited by specific effectors, mono- or disaccharides from their respective sugar catabolic pathways. By comparing ligand-binding domains of regulators with structurally characterized kinases from the ROK family, we elucidated signature amino acid residues determining sugar-ligand regulator specificity. Observed correlations between signature residues and the sugar-ligand specificities provide the framework for structure functional classification of the entire ROK family. PMID:23209028

Terminating DNA Tile Assembly with Nanostructured Caps.

PubMed

Agrawal, Deepak K; Jiang, Ruoyu; Reinhart, Seth; Mohammed, Abdul M; Jorgenson, Tyler D; Schulman, Rebecca

2017-10-24

Precise control over the nucleation, growth, and termination of self-assembly processes is a fundamental tool for controlling product yield and assembly dynamics. Mechanisms for altering these processes programmatically could allow the use of simple components to self-assemble complex final products or to design processes allowing for dynamic assembly or reconfiguration. Here we use DNA tile self-assembly to develop general design principles for building complexes that can bind to a growing biomolecular assembly and terminate its growth by systematically characterizing how different DNA origami nanostructures interact with the growing ends of DNA tile nanotubes. We find that nanostructures that present binding interfaces for all of the binding sites on a growing facet can bind selectively to growing ends and stop growth when these interfaces are presented on either a rigid or floppy scaffold. In contrast, nucleation of nanotubes requires the presentation of binding sites in an arrangement that matches the shape of the structure's facet. As a result, it is possible to build nanostructures that can terminate the growth of existing nanotubes but cannot nucleate a new structure. The resulting design principles for constructing structures that direct nucleation and termination of the growth of one-dimensional nanostructures can also serve as a starting point for programmatically directing two- and three-dimensional crystallization processes using nanostructure design.

Stable nanoconjugates of transferrin with alloyed quaternary nanocrystals Ag-In-Zn-S as a biological entity for tumor recognition.

PubMed

Matysiak-Brynda, Edyta; Bujak, Piotr; Augustin, Ewa; Kowalczyk, Agata; Mazerska, Zofia; Pron, Adam; Nowicka, Anna M

2018-01-18

One way to limit the negative effects of anti-tumor drugs on healthy cells is targeted therapy employing functionalized drug carriers. Here we present a biocompatible and stable nanoconjugate of transferrin anchored to Ag-In-Zn-S quantum dots modified with 11-mercaptoundecanoic acid (Tf-QD) as a drug carrier versus typical anticancer drug, doxorubicin. Detailed investigations of Tf-QD nanoconjugates without and with doxorubicin by fluorescence studies and cytotoxic measurements showed that the biological activity of both the transferrin and doxorubicin was fully retained in the nanoconjugate. In particular, the intercalation capabilities of free doxorubicin versus ctDNA remained essentially intact upon its binding to the nanoconjugate. In order to evaluate these capabilities, we studied the binding constant of doxorubicin attached to Tf-QDs with ctDNA as well as the binding site size on the ctDNA molecule. The binding constant slightly decreased compared to that of free doxorubicin while the binding site size, describing the number of consecutive DNA lattice residues involved in the binding, increased. It was also demonstrated that the QDs alone and in the form of a nanoconjugate with Tf were not cytotoxic towards human non-small cell lung carcinoma (H460 cell line) and the tumor cell sensitivity of the DOX-Tf-QD nanoconjugate was comparable to that of doxorubicin alone.

Mycobacterium tuberculosis cAMP Receptor Protein (Rv3676) Differs from the Escherichia coli Paradigm in Its cAMP Binding and DNA Binding Properties and Transcription Activation Properties*

PubMed Central

Stapleton, Melanie; Haq, Ihtshamul; Hunt, Debbie M.; Arnvig, Kristine B.; Artymiuk, Peter J.; Buxton, Roger S.; Green, Jeffrey

2010-01-01

The pathogen Mycobacterium tuberculosis produces a burst of cAMP upon infection of macrophages. Bacterial cyclic AMP receptor proteins (CRP) are transcription factors that respond to cAMP by binding at target promoters when cAMP concentrations increase. Rv3676 (CRPMt) is a CRP family protein that regulates expression of genes (rpfA and whiB1) that are potentially involved in M. tuberculosis persistence and/or emergence from the dormant state. Here, the CRPMt homodimer is shown to bind two molecules of cAMP (one per protomer) at noninteracting sites. Furthermore, cAMP binding by CRPMt was relatively weak, entropy driven, and resulted in a relatively small enhancement in DNA binding. Tandem CRPMt-binding sites (CRP1 at −58.5 and CRP2 at −37.5) were identified at the whiB1 promoter (PwhiB1). In vitro transcription reactions showed that CRP1 is an activating site and that CRP2, which was only occupied in the presence of cAMP or at high CRPMt concentrations in the absence of cAMP, is a repressing site. Binding of CRPMt to CRP1 was not essential for open complex formation but was required for transcription activation. Thus, these data suggest that binding of CRPMt to the PwhiB1 CRP1 site activates transcription at a step after open complex formation. In contrast, high cAMP concentrations allowed occupation of both CRP1 and CRP2 sites, resulting in inhibition of open complex formation. Thus, M. tuberculosis CRP has evolved several distinct characteristics, compared with the Escherichia coli CRP paradigm, to allow it to regulate gene expression against a background of high concentrations of cAMP. PMID:20028978

Binding of sulphonated indigo derivatives to RepA-WH1 inhibits DNA-induced protein amyloidogenesis

PubMed Central

Gasset-Rosa, Fátima; Maté, María Jesús; Dávila-Fajardo, Cristina; Bravo, Jerónimo; Giraldo, Rafael

2008-01-01

The quest for inducers and inhibitors of protein amyloidogenesis is of utmost interest, since they are key tools to understand the molecular bases of proteinopathies such as Alzheimer, Parkinson, Huntington and Creutzfeldt–Jakob diseases. It is also expected that such molecules could lead to valid therapeutic agents. In common with the mammalian prion protein (PrP), the N-terminal Winged-Helix (WH1) domain of the pPS10 plasmid replication protein (RepA) assembles in vitro into a variety of amyloid nanostructures upon binding to different specific dsDNA sequences. Here we show that di- (S2) and tetra-sulphonated (S4) derivatives of indigo stain dock at the DNA recognition interface in the RepA-WH1 dimer. They compete binding of RepA to its natural target dsDNA repeats, found at the repA operator and at the origin of replication of the plasmid. Calorimetry points to the existence of a major site, with micromolar affinity, for S4-indigo in RepA-WH1 dimers. As revealed by electron microscopy, in the presence of inducer dsDNA, both S2/S4 stains inhibit the assembly of RepA-WH1 into fibres. These results validate the concept that DNA can promote protein assembly into amyloids and reveal that the binding sites of effector molecules can be targeted to inhibit amyloidogenesis. PMID:18285361

In vivo estradiol-dependent dephosphorylation of the repressor MDBP-2-H1 correlates with the loss of in vitro preferential binding to methylated DNA.

PubMed Central

Bruhat, A; Jost, J P

1995-01-01

We have previously shown that estradiol treatment of roosters resulted in a rapid loss of binding activity of the repressor MDBP-2-H1 (a member of the histone H1 family) to methylated DNA that was not due to a decrease in MDBP-2-H1 concentration. Here we demonstrate that MDBP-2-H1 from rooster liver nuclear extracts is a phosphoprotein. Phosphoamino acid analysis reveals that the phosphorylation occurs exclusively on serine residues. Two-dimensional gel electrophoresis and tryptic phosphopeptide analysis show that MDBP-2-H1 is phosphorylated at several sites. Treatment of roosters with estradiol triggers a dephosphorylation of at least two sites in the protein. Phosphatase treatment of purified rooster MDBP-2-H1 combined with gel mobility shift assay indicates that phosphorylation of MDBP-2-H1 is essential for the binding to methylated DNA and that the dephosphorylation can occur on the protein bound to methylated DNA causing its release from DNA. Thus, these results suggest that in vivo modification of the phosphorylation status of MDBP-2-H1 caused by estradiol treatment may be a key step for the down regulation of its binding to methylated DNA. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:7731964

Crystal Structure of the Minimalist Max-E47 Protein Chimera

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahmadpour, Faraz; Ghirlando, Rodolfo; De Jong, Antonia T.

Max-E47 is a protein chimera generated from the fusion of the DNA-binding basic region of Max and the dimerization region of E47, both members of the basic region/helix-loop-helix (bHLH) superfamily of transcription factors. Like native Max, Max-E47 binds with high affinity and specificity to the E-box site, 5'-CACGTG, both in vivo and in vitro. We have determined the crystal structure of Max-E47 at 1.7 Å resolution, and found that it associates to form a well-structured dimer even in the absence of its cognate DNA. Analytical ultracentrifugation confirms that Max-E47 is dimeric even at low micromolar concentrations, indicating that the Max-E47more » dimer is stable in the absence of DNA. Circular dichroism analysis demonstrates that both non-specific DNA and the E-box site induce similar levels of helical secondary structure in Max-E47. These results suggest that Max-E47 may bind to the E-box following the two-step mechanism proposed for other bHLH proteins. In this mechanism, a rapid step where protein binds to DNA without sequence specificity is followed by a slow step where specific protein:DNA interactions are fine-tuned, leading to sequence-specific recognition. Collectively, these results show that the designed Max-E47 protein chimera behaves both structurally and functionally like its native counterparts.« less

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

PubMed

Alniss, Hasan; Zamiri, Bita; Khalaj, Melisa; Pearson, Christopher E; Macgregor, Robert B

2018-01-22

An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K + . The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules. Copyright © 2018 Elsevier Inc. All rights reserved.

Modulated photophysics of a cationic DNA-staining dye inside protein bovine serum albumin: study of binding interaction and structural changes of protein.

PubMed

Samanta, Anuva; Jana, Sankar; Ray, Debarati; Guchhait, Nikhil

2014-01-01

The binding affinity of cationic DNA-staining dye, propidium iodide, with transport protein, bovine serum albumin, has been explored using UV-vis absorption, fluorescence, and circular dichroism spectroscopy. Steady state and time resolved fluorescence studies authenticate that fluorescence quenching of bovine serum albumin by propidium iodide is due to bovine serum albumin-propidium iodide complex formation. Thermodynamic parameters obtained from temperature dependent spectral studies cast light on binding interaction between the probe and protein. Site marker competitive binding has been encountered using phenylbutazone and flufenamic acid for site I and site II, respectively. Energy transfer efficiency and distance between bovine serum albumin and propidium iodide have been determined using Förster mechanism. Structural stabilization or destabilization of protein by propidium iodide has been investigated by urea denaturation study. The circular dichroism study as well as FT-IR measurement demonstrates some configurational changes of the protein in presence of the dye. Docking studies support the experimental data thereby reinforcing the binding site of the probe to the subdomain IIA of bovine serum albumin. Copyright © 2013 Elsevier B.V. All rights reserved.

The naphthoquinone diospyrin is an inhibitor of DNA gyrase with a novel mechanism of action.

PubMed

Karkare, Shantanu; Chung, Terence T H; Collin, Frederic; Mitchenall, Lesley A; McKay, Adam R; Greive, Sandra J; Meyer, Jacobus J M; Lall, Namrita; Maxwell, Anthony

2013-02-15

Tuberculosis and other bacterial diseases represent a significant threat to human health. The DNA topoisomerases are excellent targets for chemotherapy, and DNA gyrase in particular is a well-validated target for antibacterial agents. Naphthoquinones (e.g. diospyrin and 7-methyljuglone) have been shown to have therapeutic potential, particularly against Mycobacterium tuberculosis. We have found that these compounds are inhibitors of the supercoiling reaction catalyzed by M. tuberculosis gyrase and other gyrases. Our evidence strongly suggests that the compounds bind to the N-terminal domain of GyrB, which contains the ATPase active site, but are not competitive inhibitors of the ATPase reaction. We propose that naphthoquinones bind to GyrB at a novel site close to the ATPase site. This novel mode of action could be exploited to develop new antibacterial agents.

The Naphthoquinone Diospyrin Is an Inhibitor of DNA Gyrase with a Novel Mechanism of Action*

PubMed Central

Karkare, Shantanu; Chung, Terence T. H.; Collin, Frederic; Mitchenall, Lesley A.; McKay, Adam R.; Greive, Sandra J.; Meyer, Jacobus J. M.; Lall, Namrita; Maxwell, Anthony

2013-01-01

Tuberculosis and other bacterial diseases represent a significant threat to human health. The DNA topoisomerases are excellent targets for chemotherapy, and DNA gyrase in particular is a well-validated target for antibacterial agents. Naphthoquinones (e.g. diospyrin and 7-methyljuglone) have been shown to have therapeutic potential, particularly against Mycobacterium tuberculosis. We have found that these compounds are inhibitors of the supercoiling reaction catalyzed by M. tuberculosis gyrase and other gyrases. Our evidence strongly suggests that the compounds bind to the N-terminal domain of GyrB, which contains the ATPase active site, but are not competitive inhibitors of the ATPase reaction. We propose that naphthoquinones bind to GyrB at a novel site close to the ATPase site. This novel mode of action could be exploited to develop new antibacterial agents. PMID:23275348

A high-resolution structure of the DNA-binding domain of AhrC, the arginine repressor/activator protein from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Baumberg, Simon; Stockley, Peter G.

2007-11-01

The structure of the winged helix–turn–helix DNA-binding domain of AhrC has been determined at 1.0 Å resolution. The largely hydrophobic β-wing shows high B factors and may mediate the dimer interface in operator complexes. In Bacillus subtilis the concentration of l-arginine is controlled by the transcriptional regulator AhrC, which interacts with 18 bp DNA operator sites called ARG boxes in the promoters of arginine biosynthetic and catabolic operons. AhrC is a 100 kDa homohexamer, with each subunit having two domains. The C-terminal domains form the core, mediating intersubunit interactions and binding of the co-repressor l-arginine, whilst the N-terminal domains containmore » a winged helix–turn–helix DNA-binding motif and are arranged around the periphery. The N-terminal domain of AhrC has been expressed, purified and characterized and it has been shown that the fragment still binds DNA operators as a recombinant monomer. The DNA-binding domain has also been crystallized and the crystal structure refined to 1.0 Å resolution is presented.« less

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

Nucleosome mobilization by ISW2 requires the concerted action of the ATPase and SLIDE domains

PubMed Central

Hota, Swetansu K.; Bhardwaj, Saurabh K.; Deindl, Sebastian; Lin, Yuan-chi; Zhuang, Xiaowei; Bartholomew, Blaine

2013-01-01

The ISWI family of ATP-dependent chromatin remodelers represses transcription by changing nucleosome positioning. The interactions with extranucleosomal DNA and the requirement of a minimal length of extranucleosomal DNA by ISWI mediate the spacing of nucleosomes. ISW2 from Saccharomyces cerevisiae, a member of the ISWI family, has a conserved domain called SLIDE (SANT-like ISWI domain), whose binding to extranucleosomal DNA ~19 bp from the edge of nucleosomes is required for efficiently pushing DNA into nucleosomes and maintaining the unidirectional movement of nucleosomes, as reported here. Loss of SLIDE binding does not perturb ATPase domain binding to the SHL2 site of nucleosomes or its initial movement of DNA inside of nucleosomes. ISW2 has therefore two distinct roles in mobilizing nucleosomes, with the ATPase domain translocating and moving DNA inside nucleosomes, and the SLIDE domain facilitating the entry of linker DNA into nucleosomes. PMID:23334290

DNA-Binding Kinetics Determines the Mechanism of Noise-Induced Switching in Gene Networks

PubMed Central

Tse, Margaret J.; Chu, Brian K.; Roy, Mahua; Read, Elizabeth L.

2015-01-01

Gene regulatory networks are multistable dynamical systems in which attractor states represent cell phenotypes. Spontaneous, noise-induced transitions between these states are thought to underlie critical cellular processes, including cell developmental fate decisions, phenotypic plasticity in fluctuating environments, and carcinogenesis. As such, there is increasing interest in the development of theoretical and computational approaches that can shed light on the dynamics of these stochastic state transitions in multistable gene networks. We applied a numerical rare-event sampling algorithm to study transition paths of spontaneous noise-induced switching for a ubiquitous gene regulatory network motif, the bistable toggle switch, in which two mutually repressive genes compete for dominant expression. We find that the method can efficiently uncover detailed switching mechanisms that involve fluctuations both in occupancies of DNA regulatory sites and copy numbers of protein products. In addition, we show that the rate parameters governing binding and unbinding of regulatory proteins to DNA strongly influence the switching mechanism. In a regime of slow DNA-binding/unbinding kinetics, spontaneous switching occurs relatively frequently and is driven primarily by fluctuations in DNA-site occupancies. In contrast, in a regime of fast DNA-binding/unbinding kinetics, switching occurs rarely and is driven by fluctuations in levels of expressed protein. Our results demonstrate how spontaneous cell phenotype transitions involve collective behavior of both regulatory proteins and DNA. Computational approaches capable of simulating dynamics over many system variables are thus well suited to exploring dynamic mechanisms in gene networks. PMID:26488666

Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications

NASA Technical Reports Server (NTRS)

Hu, Shaowen; Cucinotta, Francis A.

2010-01-01

Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.

The TubR-centromere complex adopts a double-ring segrosome structure in Type III partition systems.

PubMed

Martín-García, Bárbara; Martín-González, Alejandro; Carrasco, Carolina; Hernández-Arriaga, Ana M; Ruíz-Quero, Rubén; Díaz-Orejas, Ramón; Aicart-Ramos, Clara; Moreno-Herrero, Fernando; Oliva, María A

2018-05-14

In prokaryotes, the centromere is a specialized segment of DNA that promotes the assembly of the segrosome upon binding of the Centromere Binding Protein (CBP). The segrosome structure exposes a specific surface for the interaction of the CBP with the motor protein that mediates DNA movement during cell division. Additionally, the CBP usually controls the transcriptional regulation of the segregation system as a cell cycle checkpoint. Correct segrosome functioning is therefore indispensable for accurate DNA segregation. Here, we combine biochemical reconstruction and structural and biophysical analysis to bring light to the architecture of the segrosome complex in Type III partition systems. We present the particular features of the centromere site, tubC, of the model system encoded in Clostridium botulinum prophage c-st. We find that the split centromere site contains two different iterons involved in the binding and spreading of the CBP, TubR. The resulting nucleoprotein complex consists of a novel double-ring structure that covers part of the predicted promoter. Single molecule data provides a mechanism for the formation of the segrosome structure based on DNA bending and unwinding upon TubR binding.

The Verrucomicrobia LexA-Binding Motif: Insights into the Evolutionary Dynamics of the SOS Response.

PubMed

Erill, Ivan; Campoy, Susana; Kılıç, Sefa; Barbé, Jordi

2016-01-01

The SOS response is the primary bacterial mechanism to address DNA damage, coordinating multiple cellular processes that include DNA repair, cell division, and translesion synthesis. In contrast to other regulatory systems, the composition of the SOS genetic network and the binding motif of its transcriptional repressor, LexA, have been shown to vary greatly across bacterial clades, making it an ideal system to study the co-evolution of transcription factors and their regulons. Leveraging comparative genomics approaches and prior knowledge on the core SOS regulon, here we define the binding motif of the Verrucomicrobia, a recently described phylum of emerging interest due to its association with eukaryotic hosts. Site directed mutagenesis of the Verrucomicrobium spinosum recA promoter confirms that LexA binds a 14 bp palindromic motif with consensus sequence TGTTC-N4-GAACA. Computational analyses suggest that recognition of this novel motif is determined primarily by changes in base-contacting residues of the third alpha helix of the LexA helix-turn-helix DNA binding motif. In conjunction with comparative genomics analysis of the LexA regulon in the Verrucomicrobia phylum, electrophoretic shift assays reveal that LexA binds to operators in the promoter region of DNA repair genes and a mutagenesis cassette in this organism, and identify previously unreported components of the SOS response. The identification of tandem LexA-binding sites generating instances of other LexA-binding motifs in the lexA gene promoter of Verrucomicrobia species leads us to postulate a novel mechanism for LexA-binding motif evolution. This model, based on gene duplication, successfully addresses outstanding questions in the intricate co-evolution of the LexA protein, its binding motif and the regulatory network it controls.

Stimulation of ribosomal RNA gene promoter by transcription factor Sp1 involves active DNA demethylation by Gadd45-NER pathway.

PubMed

Rajput, Pallavi; Pandey, Vijaya; Kumar, Vijay

2016-08-01

The well-studied Pol II transcription factor Sp1 has not been investigated for its regulatory role in rDNA transcription. Here, we show that Sp1 bound to specific sites on rDNA and localized into the nucleoli during the G1 phase of cell cycle to activate rDNA transcription. It facilitated the recruitment of Pol I pre-initiation complex and impeded the binding of nucleolar remodeling complex (NoRC) to rDNA resulting in the formation of euchromatin active state. More importantly, Sp1 also orchestrated the site-specific binding of Gadd45a-nucleotide excision repair (NER) complex resulting in active demethylation and transcriptional activation of rDNA. Interestingly, knockdown of Sp1 impaired rDNA transcription due to reduced engagement of the Gadd45a-NER complex and hypermethylation of rDNA. Thus, the present study unveils a novel role of Sp1 in rDNA transcription involving promoter demethylation. Copyright © 2016 Elsevier B.V. All rights reserved.

Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

PubMed Central

van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

2016-01-01

Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol pathogenicity chromosome may be partially transcriptionally autonomous, but there are also extensive transcriptional connections between core and accessory chromosomes. PMID:27855160

The Influence of Spatial Variation in Chromatin Density Determined by X-Ray Tomograms on the Time to Find DNA Binding Sites

PubMed Central

Larabell, Carolyn A.; Le Gros, Mark A.; McQueen, David M.; Peskin, Charles S.

2014-01-01

In this work, we examine how volume exclusion caused by regions of high chromatin density might influence the time required for proteins to find specific DNA binding sites. The spatial variation of chromatin density within mouse olfactory sensory neurons is determined from soft X-ray tomography reconstructions of five nuclei. We show that there is a division of the nuclear space into regions of low-density euchromatin and high-density heterochromatin. Volume exclusion experienced by a diffusing protein caused by this varying density of chromatin is modeled by a repulsive potential. The value of the potential at a given point in space is chosen to be proportional to the density of chromatin at that location. The constant of proportionality, called the volume exclusivity, provides a model parameter that determines the strength of volume exclusion. Numerical simulations demonstrate that the mean time for a protein to locate a binding site localized in euchromatin is minimized for a finite, nonzero volume exclusivity. For binding sites in heterochromatin, the mean time is minimized when the volume exclusivity is zero (the protein experiences no volume exclusion). An analytical theory is developed to explain these results. The theory suggests that for binding sites in euchromatin there is an optimal level of volume exclusivity that balances a reduction in the volume searched in finding the binding site, with the height of effective potential barriers the protein must cross during the search process. PMID:23955281

The Chromodomain of Tf1 Integrase Promotes Binding to cDNA and Mediates Target Site Selection▿ †

PubMed Central

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D.; Levin, Henry L.

2009-01-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDΔ, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDΔ caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting. PMID:19109383

The chromodomain of Tf1 integrase promotes binding to cDNA and mediates target site selection.

PubMed

Chatterjee, Atreyi Ghatak; Leem, Young Eun; Kelly, Felice D; Levin, Henry L

2009-03-01

The long terminal repeat (LTR) retrotransposon Tf1 of Schizosaccharomyces pombe integrates specifically into the promoters of pol II-transcribed genes. Its integrase (IN) contains a C-terminal chromodomain related to the chromodomains that bind to the N-terminal tail of histone H3. Although we have been unable to detect an interaction between histone tails and the chromodomain of Tf1 IN, it is possible that the chromodomain plays a role in directing IN to its target sites. To test this idea, we generated transposons with single amino acid substitutions in highly conserved residues of the chromodomain and created a chromodomain-deleted mutant. The mutations, V1290A, Y1292A, W1305A, and CHDDelta, substantially reduced transposition activity in vivo. Blotting assays showed that there was little or no reduction in the levels of IN or cDNA. By measuring the homologous recombination between cDNA and the plasmid copy of Tf1, we found that two of the mutations did not reduce the import of cDNA into the nucleus, while another caused a 33% reduction. Chromatin immunoprecipitation assays revealed that CHDDelta caused an approximately threefold reduction in the binding of IN to the downstream LTR of the cDNA. These data indicate that the chromodomain contributed directly to integration. We therefore tested whether the chromodomain contributed to selecting insertion sites. Results of a target plasmid assay showed that the deletion of the chromodomain resulted in a drastic reduction in the preference for pol II promoters. Collectively, these data indicate that the chromodomain promotes binding of cDNA and plays a key role in efficient targeting.

Metal-Induced Stabilization and Activation of Plasmid Replication Initiator RepB

PubMed Central

Ruiz-Masó, José A.; Bordanaba-Ruiseco, Lorena; Sanz, Marta; Menéndez, Margarita; del Solar, Gloria

2016-01-01

Initiation of plasmid rolling circle replication (RCR) is catalyzed by a plasmid-encoded Rep protein that performs a Tyr- and metal-dependent site-specific cleavage of one DNA strand within the double-strand origin (dso) of replication. The crystal structure of RepB, the initiator protein of the streptococcal plasmid pMV158, constitutes the first example of a Rep protein structure from RCR plasmids. It forms a toroidal homohexameric ring where each RepB protomer consists of two domains: the C-terminal domain involved in oligomerization and the N-terminal domain containing the DNA-binding and endonuclease activities. Binding of Mn2+ to the active site is essential for the catalytic activity of RepB. In this work, we have studied the effects of metal binding on the structure and thermostability of full-length hexameric RepB and each of its separate domains by using different biophysical approaches. The analysis of the temperature-induced changes in RepB shows that the first thermal transition, which occurs at a range of temperatures physiologically relevant for the pMV158 pneumococcal host, represents an irreversible conformational change that affects the secondary and tertiary structure of the protein, which becomes prone to self-associate. This transition, which is also shown to result in loss of DNA binding capacity and catalytic activity of RepB, is confined to its N-terminal domain. Mn2+ protects the protein from undergoing this detrimental conformational change and the observed protection correlates well with the high-affinity binding of the cation to the active site, as substituting one of the metal-ligands at this site impairs both the protein affinity for Mn2+and the Mn2+-driven thermostabilization effect. The level of catalytic activity of the protein, especially in the case of full-length RepB, cannot be explained based only on the high-affinity binding of Mn2+ at the active site and suggests the existence of additional, lower-affinity metal binding site(s), missing in the separate catalytic domain, that must also be saturated for maximal activity. The molecular bases of the thermostabilizing effect of Mn2+ on the N-terminal domain of the protein as well as the potential location of additional metal binding sites in the entire RepB are discussed. PMID:27709114

DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

PubMed

Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

2017-10-01

Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Photochemical and DFT studies on DNA-binding ability and antibacterial activity of lanthanum(III)-phenanthroline complex

NASA Astrophysics Data System (ADS)

Niroomand, Sona; Khorasani-Motlagh, Mozhgan; Noroozifar, Meissam; Jahani, Shohreh; Moodi, Asieh

2017-02-01

The binding of the lanthanum(III) complex containing 1,10-phenanthroline (phen), [La(phen)3Cl3·OH2], to DNA is investigated by absorption and emission methods. This complex shows absorption decreasing in a charge transfer band, and fluorescence decrement when it binds to DNA. Electronic absorption spectroscopy (UV-Vis), fluorescence spectra, iodide quenching experiments, salt effect and viscosity measurements, ethidium bromide (EB) competition test, circular dichroism (CD) spectra as well as variable temperature experiments indicate that the La(III) complex binds to fish salmon (FS) DNA, presumably via groove binding mode. The binding constants (Kb) of the La(III) complex with DNA is (2.55 ± 0.02) × 106 M-1. Furthermore, the binding site size, n, the Stern-Volmer constant KSV and thermodynamic parameters; enthalpy change (ΔH0) and entropy change (ΔS0) and Gibb's free energy (ΔG0), are calculated according to relevant fluorescent data and the Van't Hoff equation. The La(III) complex has been screened for its antibacterial activities by the disc diffusion method. Also, in order to supplement the experimental findings, DFT computation and NBO analysis are carried out.

Computational Modeling Approach in Probing the Effects of Cytosine Methylation on the Transcription Factor Binding to DNA.

PubMed

Tenayuca, John; Cousins, Kimberley; Yang, Shumei; Zhang, Lubo

2017-01-01

Cytosine methylation at CpG dinucleotides is a chief mechanism in epigenetic modification of gene expression patterns. Previous studies demonstrated that increased CpG methylation of Sp1 sites at -268 and -346 of protein kinase C ε promoter repressed the gene expression. The present study investigated the impact of CpG methylation on the Sp1 binding via molecular modeling and electrophoretic mobility shift assay. Each of the Sp1 sites contain two CpGs. Methylation of either CpG lowered the binding affinity of Sp1, whereas methylation of both CpGs produced a greater decrease in the binding affinity. Computation of van der Waals (VDW) energy of Sp1 in complex with the Sp1 sites demonstrated increased VDW values from one to two sites of CpG methylation. Molecular modeling indicated that single CpG methylation caused underwinding of the DNA fragment, with the phosphate groups at C1, C4 and C5 reoriented from their original positions. Methylation of both CpGs pinched the minor groove and increased the helical twist concomitant with a shallow, hydrophobic major groove. Additionally, double methylation eliminated hydrogen bonds on recognition helix residues located at positions -1 and 1, which were essential for interaction with O6/N7 of G-bases. Bonding from linker residues Arg565, Lys595 and Lys596 were also reduced. Methylation of single or both CpGs significantly affected hydrogen bonding from all three Sp1 DNA binding domains, demonstrating that the consequences of cytosine modification extend beyond the neighboring nucleotides. The results indicate that cytosine methylation causes subtle structural alterations in Sp1 binding sites consequently resulting in inhibition of side chain interactions critical for specific base recognition and reduction of the binding affinity of Sp1. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Understanding Transcription Factor Regulation by Integrating Gene Expression and DNase I Hypersensitive Sites.

PubMed

Wang, Guohua; Wang, Fang; Huang, Qian; Li, Yu; Liu, Yunlong; Wang, Yadong

2015-01-01

Transcription factors are proteins that bind to DNA sequences to regulate gene transcription. The transcription factor binding sites are short DNA sequences (5-20 bp long) specifically bound by one or more transcription factors. The identification of transcription factor binding sites and prediction of their function continue to be challenging problems in computational biology. In this study, by integrating the DNase I hypersensitive sites with known position weight matrices in the TRANSFAC database, the transcription factor binding sites in gene regulatory region are identified. Based on the global gene expression patterns in cervical cancer HeLaS3 cell and HelaS3-ifnα4h cell (interferon treatment on HeLaS3 cell for 4 hours), we present a model-based computational approach to predict a set of transcription factors that potentially cause such differential gene expression. Significantly, 6 out 10 predicted functional factors, including IRF, IRF-2, IRF-9, IRF-1 and IRF-3, ICSBP, belong to interferon regulatory factor family and upregulate the gene expression levels responding to the interferon treatment. Another factor, ISGF-3, is also a transcriptional activator induced by interferon alpha. Using the different transcription factor binding sites selected criteria, the prediction result of our model is consistent. Our model demonstrated the potential to computationally identify the functional transcription factors in gene regulation.

A rhodium(III) complex for high-affinity DNA base-pair mismatch recognition

PubMed Central

Junicke, Henrik; Hart, Jonathan R.; Kisko, Jennifer; Glebov, Oleg; Kirsch, Ilan R.; Barton, Jacqueline K.

2003-01-01

A rhodium(III) complex, rac-[Rh(bpy)2phzi]3+ (bpy, 2,2′-bipyridine; phzi, benzo[a]phenazine-5,6-quinone diimine) has been designed as a sterically demanding intercalator targeted to destabilized mismatched sites in double-helical DNA. The complex is readily synthesized by condensation of the phenazine quinone with the corresponding diammine complex. Upon photoactivation, the complex promotes direct strand scission at single-base mismatch sites within the DNA duplex. As with the parent mismatch-specific reagent, [Rh(bpy)2(chrysi)]3+ [chrysene-5,6-quinone diimine (chrysi)], mismatch selectivity depends on the helix destabilization associated with mispairing. Unlike the parent chrysi complex, the phzi analogue binds and cleaves with high affinity and efficiency. The specific binding constants for CA, CC, and CT mismatches within a 31-mer oligonucleotide duplex are 0.3, 1, and 6 × 107 M−1, respectively; site-specific photocleavage is evident at nanomolar concentrations. Moreover, the specificity, defined as the ratio in binding affinities for mispaired vs. well paired sites, is maintained. The increase in affinity is attributed to greater stability in the mismatched site associated with stacking by the heterocyclic aromatic ligand. The high-affinity complex is also applied in the differential cleavage of DNA obtained from cell lines deficient in mismatch repair vs. those proficient in mismatch repair. Agreement is found between photocleavage by the mismatch-specific probes and deficiency in mismatch repair. This mismatch-specific targeting, therefore, offers a potential strategy for new chemotherapeutic design. PMID:12610209

Custom-Designed Molecular Scissors for Site-Specific Manipulation of the Plant and Mammalian Genomes

NASA Astrophysics Data System (ADS)

Kandavelou, Karthikeyan; Chandrasegaran, Srinivasan

Zinc finger nucleases (ZFNs) are custom-designed molecular scissors, engineered to cut at specific DNA sequences. ZFNs combine the zinc finger proteins (ZFPs) with the nonspecific cleavage domain of the FokI restriction enzyme. The DNA-binding specificity of ZFNs can be easily altered experimentally. This easy manipulation of the ZFN recognition specificity enables one to deliver a targeted double-strand break (DSB) to a genome. The targeted DSB stimulates local gene targeting by several orders of magnitude at that specific cut site via homologous recombination (HR). Thus, ZFNs have become an important experimental tool to make site-specific and permanent alterations to genomes of not only plants and mammals but also of many other organisms. Engineering of custom ZFNs involves many steps. The first step is to identify a ZFN site at or near the chosen chromosomal target within the genome to which ZFNs will bind and cut. The second step is to design and/or select various ZFP combinations that will bind to the chosen target site with high specificity and affinity. The DNA coding sequence for the designed ZFPs are then assembled by polymerase chain reaction (PCR) using oligonucleotides. The third step is to fuse the ZFP constructs to the FokI cleavage domain. The ZFNs are then expressed as proteins by using the rabbit reticulocyte in vitro transcription/translation system and the protein products assayed for their DNA cleavage specificity.

Dissociation from DNA of Type III Restriction–Modification enzymes during helicase-dependent motion and following endonuclease activity

PubMed Central

Tóth, Júlia; van Aelst, Kara; Salmons, Hannah; Szczelkun, Mark D.

2012-01-01

DNA cleavage by the Type III Restriction–Modification (RM) enzymes requires the binding of a pair of RM enzymes at two distant, inversely orientated recognition sequences followed by helicase-catalysed ATP hydrolysis and long-range communication. Here we addressed the dissociation from DNA of these enzymes at two stages: during long-range communication and following DNA cleavage. First, we demonstrated that a communicating species can be trapped in a DNA domain without a recognition site, with a non-specific DNA association lifetime of ∼200 s. If free DNA ends were present the lifetime became too short to measure, confirming that ends accelerate dissociation. Secondly, we observed that Type III RM enzymes can dissociate upon DNA cleavage and go on to cleave further DNA molecules (they can ‘turnover’, albeit inefficiently). The relationship between the observed cleavage rate and enzyme concentration indicated independent binding of each site and a requirement for simultaneous interaction of at least two enzymes per DNA to achieve cleavage. In light of various mechanisms for helicase-driven motion on DNA, we suggest these results are most consistent with a thermally driven random 1D search model (i.e. ‘DNA sliding’). PMID:22523084

DNA Interactions Probed by Hydrogen-Deuterium Exchange (HDX) Fourier Transform Ion Cyclotron Resonance Mass Spectrometry Confirm External Binding Sites on the Minichromosomal Maintenance (MCM) Helicase.

PubMed

Graham, Brian W; Tao, Yeqing; Dodge, Katie L; Thaxton, Carly T; Olaso, Danae; Young, Nicolas L; Marshall, Alan G; Trakselis, Michael A

2016-06-10

The archaeal minichromosomal maintenance (MCM) helicase from Sulfolobus solfataricus (SsoMCM) is a model for understanding structural and mechanistic aspects of DNA unwinding. Although interactions of the encircled DNA strand within the central channel provide an accepted mode for translocation, interactions with the excluded strand on the exterior surface have mostly been ignored with regard to DNA unwinding. We have previously proposed an extension of the traditional steric exclusion model of unwinding to also include significant contributions with the excluded strand during unwinding, termed steric exclusion and wrapping (SEW). The SEW model hypothesizes that the displaced single strand tracks along paths on the exterior surface of hexameric helicases to protect single-stranded DNA (ssDNA) and stabilize the complex in a forward unwinding mode. Using hydrogen/deuterium exchange monitored by Fourier transform ion cyclotron resonance MS, we have probed the binding sites for ssDNA, using multiple substrates targeting both the encircled and excluded strand interactions. In each experiment, we have obtained >98.7% sequence coverage of SsoMCM from >650 peptides (5-30 residues in length) and are able to identify interacting residues on both the interior and exterior of SsoMCM. Based on identified contacts, positively charged residues within the external waist region were mutated and shown to generally lower DNA unwinding without negatively affecting the ATP hydrolysis. The combined data globally identify binding sites for ssDNA during SsoMCM unwinding as well as validating the importance of the SEW model for hexameric helicase unwinding. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

The prokaryotic enhancer binding protein NTRC has an ATPase activity which is phosphorylation and DNA dependent.

PubMed Central

Austin, S; Dixon, R

1992-01-01

The prokaryotic activator protein NTRC binds to enhancer-like elements and activates transcription in response to nitrogen limitation by catalysing open complex formation by sigma 54 RNA polymerase holoenzyme. Formation of open complexes requires the phosphorylated form of NTRC and the reaction is ATP dependent. We find that NTRC has an ATPase activity which is activated by phosphorylation and is strongly stimulated by the presence of DNA containing specific NTRC binding sites. Images PMID:1534752

DNA Binding Mode Transitions of Escherichia coli HUαβ: Evidence for Formation of a Bent DNA – Protein Complex on Intact, Linear Duplex DNA

PubMed Central

Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas

2008-01-01

Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548

Mechanism of DNA-binding enhancement by the human T-cell leukaemia virus transactivator Tax.

PubMed

Baranger, A M; Palmer, C R; Hamm, M K; Giebler, H A; Brauweiler, A; Nyborg, J K; Schepartz, A

1995-08-17

Tax protein activates transcription of the human T-cell leukaemia virus type I (HTLV-I) genome through three imperfect cyclic AMP-responsive element (CRE) target sites located within the viral promoter. Previous work has shown that Tax interacts with the bZIP element of proteins that bind the CRE target site to promote peptide dimerization, suggesting an association between Tax and bZIP coiled coil. Here we show that the site of interaction with Tax is not the coiled coil, but the basic segment. This interaction increases the stability of the GCN4 bZIP dimer by 1.7 kcal mol-1 and the DNA affinity of the dimer by 1.9 kcal mol-1. The differential effect of Tax on several bZip-DNA complexes that differ in peptide sequence or DNA conformation suggests a model for Tax action based on stabilization of a distinct DNA-bound protein structure. This model may explain how Tax interacts with transcription factors of considerable sequence diversity to alter patterns of gene expression.

Zuotin, a putative Z-DNA binding protein in Saccharomyces cerevisiae

NASA Technical Reports Server (NTRS)

Zhang, S.; Lockshin, C.; Herbert, A.; Winter, E.; Rich, A.

1992-01-01

A putative Z-DNA binding protein, named zuotin, was purified from a yeast nuclear extract by means of a Z-DNA binding assay using [32P]poly(dG-m5dC) and [32P]oligo(dG-Br5dC)22 in the presence of B-DNA competitor. Poly(dG-Br5dC) in the Z-form competed well for the binding of a zuotin containing fraction, but salmon sperm DNA, poly(dG-dC) and poly(dA-dT) were not effective. Negatively supercoiled plasmid pUC19 did not compete, whereas an otherwise identical plasmid pUC19(CG), which contained a (dG-dC)7 segment in the Z-form was an excellent competitor. A Southwestern blot using [32P]poly(dG-m5dC) as a probe in the presence of MgCl2 identified a protein having a molecular weight of 51 kDa. The 51 kDa zuotin was partially sequenced at the N-terminal and the gene, ZUO1, was cloned, sequenced and expressed in Escherichia coli; the expressed zuotin showed similar Z-DNA binding activity, but with lower affinity than zuotin that had been partially purified from yeast. Zuotin was deduced to have a number of potential phosphorylation sites including two CDC28 (homologous to the human and Schizosaccharomyces pombe cdc2) phosphorylation sites. The hexapeptide motif KYHPDK was found in zuotin as well as in several yeast proteins, DnaJ of E.coli, csp29 and csp32 proteins of Drosophila and the small t and large T antigens of the polyoma virus. A 60 amino acid segment of zuotin has similarity to several histone H1 sequences. Disruption of ZUO1 in yeast resulted in a slow growth phenotype.

Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface.

PubMed

Moody, Colleen L; Tretyachenko-Ladokhina, Vira; Laue, Thomas M; Senear, Donald F; Cocco, Melanie J

2011-08-09

The cytidine repressor (CytR) is a member of the LacR family of bacterial repressors with distinct functional features. The Escherichia coli CytR regulon comprises nine operons whose palindromic operators vary in both sequence and, most significantly, spacing between the recognition half-sites. This suggests a strong likelihood that protein folding would be coupled to DNA binding as a mechanism to accommodate the variety of different operator architectures to which CytR is targeted. Such coupling is a common feature of sequence-specific DNA-binding proteins, including the LacR family repressors; however, there are no significant structural rearrangements upon DNA binding within the three-helix DNA-binding domains (DBDs) studied to date. We used nuclear magnetic resonance (NMR) spectroscopy to characterize the CytR DBD free in solution and to determine the high-resolution structure of a CytR DBD monomer bound specifically to one DNA half-site of the uridine phosphorylase (udp) operator. We find that the free DBD populates multiple distinct conformations distinguished by up to four sets of NMR peaks per residue. This structural heterogeneity is previously unknown in the LacR family. These stable structures coalesce into a single, more stable udp-bound form that features a three-helix bundle containing a canonical helix-turn-helix motif. However, this structure differs from all other LacR family members whose structures are known with regard to the packing of the helices and consequently their relative orientations. Aspects of CytR activity are unique among repressors; we identify here structural properties that are also distinct and that might underlie the different functional properties. © 2011 American Chemical Society

Direct Correlation of DNA Binding and Single Protein Domain Motion via Dual Illumination Fluorescence Microscopy

PubMed Central

2015-01-01

We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes. PMID:25204359

Mechanism of the formation of the RecA-ssDNA nucleoprotein filament structure: a coarse-grained approach.

PubMed

Mukherjee, Goutam; Pal, Arumay; Levy, Yaakov

2017-11-21

In prokaryotes, the RecA protein catalyzes the repair and strand exchange of double-stranded DNA. RecA binds to single-stranded DNA (ssDNA) and forms a presynaptic complex in which the protein polymerizes around the ssDNA to form a right-handed helical nucleoprotein filament structure. In the present work, the mechanism for the formation of the RecA-ssDNA filament structure is modeled using coarse-grained molecular dynamics simulations. Information from the X-ray structure was used to model the protein itself but not its interactions; the interactions between the protein and the ssDNA were modeled solely by electrostatic, aromatic, and repulsive energies. For the present study, the monomeric, dimeric, and trimeric units of RecA and 4, 8, and 11 NT-long ssDNA, respectively, were studied. Our results indicate that monomeric RecA is not sufficient for nucleoprotein filament formation; rather, dimeric RecA is the elementary binding unit, with higher multimeric units of RecA facilitating filament formation. Our results reveal that loop region flexibility at the primary binding site of RecA is essential for it to bind the incoming ssDNA, that the aromatic residues present in the loop region play an important role in ssDNA binding, and that ATP may play a role in guiding the ssDNA by changing the electrostatic potential of the RecA protein.

Searching target sites on DNA by proteins: Role of DNA dynamics under confinement

PubMed Central

Mondal, Anupam; Bhattacherjee, Arnab

2015-01-01

DNA-binding proteins (DBPs) rapidly search and specifically bind to their target sites on genomic DNA in order to trigger many cellular regulatory processes. It has been suggested that the facilitation of search dynamics is achieved by combining 3D diffusion with one-dimensional sliding and hopping dynamics of interacting proteins. Although, recent studies have advanced the knowledge of molecular determinants that affect one-dimensional search efficiency, the role of DNA molecule is poorly understood. In this study, by using coarse-grained simulations, we propose that dynamics of DNA molecule and its degree of confinement due to cellular crowding concertedly regulate its groove geometry and modulate the inter-communication with DBPs. Under weak confinement, DNA dynamics promotes many short, rotation-decoupled sliding events interspersed by hopping dynamics. While this results in faster 1D diffusion, associated probability of missing targets by jumping over them increases. In contrast, strong confinement favours rotation-coupled sliding to locate targets but lacks structural flexibility to achieve desired specificity. By testing under physiological crowding, our study provides a plausible mechanism on how DNA molecule may help in maintaining an optimal balance between fast hopping and rotation-coupled sliding dynamics, to locate target sites rapidly and form specific complexes precisely. PMID:26400158

The effects of cytosine methylation on general transcription factors

NASA Astrophysics Data System (ADS)

Jin, Jianshi; Lian, Tengfei; Gu, Chan; Yu, Kai; Gao, Yi Qin; Su, Xiao-Dong

2016-07-01

DNA methylation on CpG sites is the most common epigenetic modification. Recently, methylation in a non-CpG context was found to occur widely on genomic DNA. Moreover, methylation of non-CpG sites is a highly controlled process, and its level may vary during cellular development. To study non-CpG methylation effects on DNA/protein interactions, we have chosen three human transcription factors (TFs): glucocorticoid receptor (GR), brain and muscle ARNT-like 1 (BMAL1) - circadian locomotor output cycles kaput (CLOCK) and estrogen receptor (ER) with methylated or unmethylated DNA binding sequences, using single-molecule and isothermal titration calorimetry assays. The results demonstrated that these TFs interact with methylated DNA with different effects compared with their cognate DNA sequences. The effects of non-CpG methylation on transcriptional regulation were validated by cell-based luciferase assay at protein level. The mechanisms of non-CpG methylation influencing DNA-protein interactions were investigated by crystallographic analyses and molecular dynamics simulation. With BisChIP-seq assays in HEK-293T cells, we found that GR can recognize highly methylated sites within chromatin in cells. Therefore, we conclude that non-CpG methylation of DNA can provide a mechanism for regulating gene expression through directly affecting the binding of TFs.

Selective inhibition of CTCF binding by iAs directs TET-mediated reprogramming of 5-hydroxymethylation patterns in iAs-transformed cells

PubMed Central

Rea, Matthew; Gripshover, Tyler; Fondufe-Mittendorf, Yvonne

2017-01-01

Methylation at cytosine (5mC) is a fundamental epigenetic DNA modification recently associated with iAs-mediated carcinogenesis. In contrast, the role of 5-hydroxymethylcytosine (5hmC), the oxidation product of 5mC in iAs-mediated carcinogenesis is unknown. Here we assess the hydroxymethylome in iAs-transformed cells, showing that dynamic modulation of hydroxymethylated DNA is associated with specific transcriptional networks. Moreover, this pathologic iAs-mediated carcinogenesis is characterized by a shift toward a higher hydroxymethylation pattern genome-wide. At specific promoters, hydroxymethylation correlated with increased gene expression. Furthermore, this increase in hydroxymethylation occurs concurrently with an upregulation of ten-eleven translocation (TET) enzymes that oxidize 5-methylcytosine (5mC) in DNA. To gain an understanding into how iAs might impact TET expression, we found that iAs inhibits the binding of CTCF at the proximal, weak CTCF binding sites of the TET1 and TET2 gene promoters and enhances CTCF binding at the stronger distal binding site. Further analyses suggest that this distal site acts as an enhancer, thus high CTCF occupancy at the enhancer region of TET1 and TET2 possibly drives their high expression in iAs-transformed cells. These results have major implications in understanding the impact of differential CTCF binding, genome architecture and its consequences in iAs-mediated pathogenesis. PMID:29175454

Experimental and molecular docking studies on DNA binding interaction of adefovir dipivoxil: advances toward treatment of hepatitis B virus infections.

PubMed

Shahabadi, Nahid; Falsafi, Monireh

2014-05-05

The toxic interaction of adefovir dipivoxil with calf thymus DNA (CT-DNA) was investigated in vitro under simulated physiological conditions by multi-spectroscopic techniques and molecular modeling study. The fluorescence spectroscopy and UV absorption spectroscopy indicated drug interacted with CT-DNA in a groove binding mode. The binding constant of UV-visible and the number of binding sites were 3.33±0.2×10(4) L mol(-1)and 0.99, respectively. The fluorimetric studies showed that the reaction between the drug and CT-DNA is exothermic (ΔH=34.4 kJ mol(-1); ΔS=184.32 J mol(-1) K(-1)). Circular dichroism spectroscopy (CD) was employed to measure the conformational change of CT-DNA in the presence of adefovir dipivoxil, which verified the groove binding mode. Furthermore, the drug induces detectable changes in its viscosity. The molecular modeling results illustrated that adefovir strongly binds to groove of DNA by relative binding energy of docked structure -16.83 kJ mol(-1). This combination of multiple spectroscopic techniques and molecular modeling methods can be widely used in the investigation on the toxic interaction of small molecular pollutants and drugs with bio macromolecules, which contributes to clarify the molecular mechanism of toxicity or side effect in vivo. Copyright © 2014 Elsevier B.V. All rights reserved.

Measurements of nonlinear Hall-driven reconnection in the reversed field pinch

NASA Astrophysics Data System (ADS)

Tharp, Timothy D.

Complex organisms are able to develop because of the complex regulatory systems that control their gene expression. The first step in this regulation, transcription initiation, is controlled by transcription factors. Transcription factors are modular proteins composed of two distinct domains, the DNA binding domain and the regulatory domain. These molecules are involved in a plethora of important biological processes including embryogenesis, development, cell health, and cancer. Tissue enriched transcription factors Nkx-2.5 and Gata4 are involved in cardiac development and cardiac health. In this thesis the DNA binding specificity of Nkx-2.5 will be analyzed using a high throughput double stranded DNA platform called Cognate Site Identifier (CSI) arrays (Chapter 2). The full DNA binding specificity of Nkx-2.5 and Nkx-2.5 mutants will be visualized using Sequence Specificity Landscapes (SSLs). In Chapter 3, the definition of binding specificity will be investigated by evaluating a number of different DNA binding folds by CSI and SSLs. CSI and SSLs will also be used to evaluate different pyrrole/imidazole hairpin polyamides in order to better characterize these small molecule DNA binding domains. CSI and SSL data will be applied to the genome in order to explain the biological function an artificial transcription factor. Chapter 4 will discuss the mechanism of nonspecific DNA binding. The historical means of predicting DNA binding will be challenged by utilizing high throughput experiments. The effect of salt concentration on both specific and nonspecific binding will also be investigated. Finally, in Chapter 5, a generation of Protein DNA Dimerizer will be discussed. A PDD that regulates transcription on genomic DNA by binding cooperatively with the heart IF Gata4 will be characterized. These studies provide understanding of, and a means to control, how transcription factors sample the endless sea of DNA in the genome in order to regulate gene expression with such wonderful specificity.

Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

PubMed

Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

2018-06-02

Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

Compartmentalized self-replication (CSR) selection of Thermococcus litoralis Sh1B DNA polymerase for diminished uracil binding.

PubMed

Tubeleviciute, Agne; Skirgaila, Remigijus

2010-08-01

The thermostable archaeal DNA polymerase Sh1B from Thermococcus litoralis has a typical uracil-binding pocket, which in nature plays an essential role in preventing the accumulation of mutations caused by cytosine deamination to uracil and subsequent G-C base pair transition to A-T during the genomic DNA replication. The uracil-binding pocket recognizes and binds uracil base in a template strand trapping the polymerase. Since DNA replication stops, the repair systems have a chance to correct the promutagenic event. Archaeal family B DNA polymerases are employed in various PCR applications. Contrary to nature, in PCR the uracil-binding property of archaeal polymerases is disadvantageous and results in decreased DNA amplification yields and lowered sensitivity. Furthermore, in diagnostics qPCR, RT-qPCR and end-point PCR are performed using dNTP mixtures, where dTTP is partially or fully replaced by dUTP. Uracil-DNA glycosylase treatment and subsequent heating of the samples is used to degrade the DNA containing uracil and prevent carryover contamination, which is the main concern in diagnostic laboratories. A thermostable archaeal DNA polymerase with the abolished uracil binding would be a highly desirable and commercially interesting product. An attempt to disable uracil binding in DNA polymerase Sh1B from T. litoralis by generating site-specific mutants did not yield satisfactory results. However, a combination of random mutagenesis of the whole polymerase gene and compartmentalized self-replication was successfully used to select variants of thermostable Sh1B polymerase capable of performing PCR with dUTP instead of dTTP.

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes

PubMed Central

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P.

2016-01-01

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes. PMID:27574114

Inhibition of nuclear factor kappaB proteins-platinated DNA interactions correlates with cytotoxic effectiveness of the platinum complexes.

PubMed

Brabec, Viktor; Kasparkova, Jana; Kostrhunova, Hana; Farrell, Nicholas P

2016-08-30

Nuclear DNA is the target responsible for anticancer activity of platinum anticancer drugs. Their activity is mediated by altered signals related to programmed cell death and the activation of various signaling pathways. An example is activation of nuclear factor kappaB (NF-κB). Binding of NF-κB proteins to their consensus sequences in DNA (κB sites) is the key biochemical activity responsible for the biological functions of NF-κB. Using gel-mobility-shift assays and surface plasmon resonance spectroscopy we examined the interactions of NF-κB proteins with oligodeoxyribonucleotide duplexes containing κB site damaged by DNA adducts of three platinum complexes. These complexes markedly differed in their toxic effects in tumor cells and comprised highly cytotoxic trinuclear platinum(II) complex BBR3464, less cytotoxic conventional cisplatin and ineffective transplatin. The results indicate that structurally different DNA adducts of these platinum complexes exhibit a different efficiency to affect the affinity of the platinated DNA (κB sites) to NF-κB proteins. Our results support the hypothesis that structural perturbations induced in DNA by platinum(II) complexes correlate with their higher efficiency to inhibit binding of NF-κB proteins to their κB sites and cytotoxicity as well. However, the full generalization of this hypothesis will require to evaluate a larger series of platinum(II) complexes.

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family.

PubMed

Dai, Qi; Ren, Aiming; Westholm, Jakub O; Duan, Hong; Patel, Dinshaw J; Lai, Eric C

2015-01-01

Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain ("BEN-solo" factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. © 2015 Dai et al.; Published by Cold Spring Harbor Laboratory Press.

Common and distinct DNA-binding and regulatory activities of the BEN-solo transcription factor family

PubMed Central

Dai, Qi; Ren, Aiming; Westholm, Jakub O.; Duan, Hong; Patel, Dinshaw J.

2015-01-01

Recently, the BEN (BANP, E5R, and NAC1) domain was recognized as a new class of conserved DNA-binding domain. The fly genome encodes three proteins that bear only a single BEN domain (“BEN-solo” factors); namely, Insensitive (Insv), Bsg25A (Elba1), and CG9883 (Elba2). Insv homodimers preferentially bind CCAATTGG palindromes throughout the genome to mediate transcriptional repression, whereas Bsg25A and Elba2 heterotrimerize with their obligate adaptor, Elba3 (i.e., the ELBA complex), to recognize a CCAATAAG motif in the Fab-7 insulator. While these data suggest distinct DNA-binding properties of BEN-solo proteins, we performed reporter assays that indicate that both Bsg25A and Elba2 can individually recognize Insv consensus sites efficiently. We confirmed this by solving the structure of Bsg25A complexed to the Insv site, which showed that key aspects of the BEN:DNA recognition strategy are similar between these proteins. We next show that both Insv and ELBA proteins are competent to mediate transcriptional repression via Insv consensus sequences but that the ELBA complex appears to be selective for the ELBA site. Reciprocally, genome-wide analysis reveals that Insv exhibits significant cobinding to class I insulator elements, indicating that it may also contribute to insulator function. Indeed, we observed abundant Insv binding within the Hox complexes with substantial overlaps with class I insulators, many of which bear Insv consensus sites. Moreover, Insv coimmunoprecipitates with the class I insulator factor CP190. Finally, we observed that Insv harbors exclusive activity among fly BEN-solo factors with respect to regulation of Notch-mediated cell fate choices in the peripheral nervous system. This in vivo activity is recapitulated by BEND6, a mammalian BEN-solo factor that conserves the Notch corepressor function of Insv but not its capacity to bind Insv consensus sites. Altogether, our data define an array of common and distinct biochemical and functional properties of this new family of transcription factors. PMID:25561495

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

PubMed

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

Prediction of TF target sites based on atomistic models of protein-DNA complexes

PubMed Central

Angarica, Vladimir Espinosa; Pérez, Abel González; Vasconcelos, Ana T; Collado-Vides, Julio; Contreras-Moreira, Bruno

2008-01-01

Background The specific recognition of genomic cis-regulatory elements by transcription factors (TFs) plays an essential role in the regulation of coordinated gene expression. Studying the mechanisms determining binding specificity in protein-DNA interactions is thus an important goal. Most current approaches for modeling TF specific recognition rely on the knowledge of large sets of cognate target sites and consider only the information contained in their primary sequence. Results Here we describe a structure-based methodology for predicting sequence motifs starting from the coordinates of a TF-DNA complex. Our algorithm combines information regarding the direct and indirect readout of DNA into an atomistic statistical model, which is used to estimate the interaction potential. We first measure the ability of our method to correctly estimate the binding specificities of eight prokaryotic and eukaryotic TFs that belong to different structural superfamilies. Secondly, the method is applied to two homology models, finding that sampling of interface side-chain rotamers remarkably improves the results. Thirdly, the algorithm is compared with a reference structural method based on contact counts, obtaining comparable predictions for the experimental complexes and more accurate sequence motifs for the homology models. Conclusion Our results demonstrate that atomic-detail structural information can be feasibly used to predict TF binding sites. The computational method presented here is universal and might be applied to other systems involving protein-DNA recognition. PMID:18922190

Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

DOE Office of Scientific and Technical Information (OSTI.GOV)

D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

2005-01-01

The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

Topological Interaction by Entanglement of DNA

NASA Astrophysics Data System (ADS)

Feng, Lang; Sha, Ruojie; Seeman, Nadrian; Chaikin, Paul

2012-02-01

We find and study a new type of interaction between colloids, Topological Interaction by Entanglement of DNA (TIED), due to concatenation of loops formed by palindromic DNA. Consider a particle coated with palindromic DNA of sequence ``P1.'' Below the DNA hybridization temperature (Tm), loops of the self-complementary DNA form on the particle surface. Direct hybridization with similar particle covered with a different sequence P2 do not occur. However when particles are held together at T > Tm, then cooled to T < Tm, some of the loops entangle and link, similar to a Olympic Gel. We quantitatively observe and measure this topological interaction between colloids in a ˜5^o C temperature window, ˜6^o C lower than direct binding of complementary DNA with similar strength and introduce the concept of entanglement binding free energy. To prove our interaction to be topological, we unknot the purely entangled binding sites between colloids by adding Topoisomerase I which unconcatenates our loops. This research suggests novel history dependent ways of binding particles and serves as a new design tool in colloidal self-assembly.

PRP19 transforms into a sensor of RPA-ssDNA after DNA damage and drives ATR activation via a ubiquitin-mediated circuitry.

PubMed

Maréchal, Alexandre; Li, Ju-Mei; Ji, Xiao Ye; Wu, Ching-Shyi; Yazinski, Stephanie A; Nguyen, Hai Dang; Liu, Shizhou; Jiménez, Amanda E; Jin, Jianping; Zou, Lee

2014-01-23

PRP19 is a ubiquitin ligase involved in pre-mRNA splicing and the DNA damage response (DDR). Although the role for PRP19 in splicing is well characterized, its role in the DDR remains elusive. Through a proteomic screen for proteins that interact with RPA-coated single-stranded DNA (RPA-ssDNA), we identified PRP19 as a sensor of DNA damage. PRP19 directly binds RPA and localizes to DNA damage sites via RPA, promoting RPA ubiquitylation in a DNA-damage-induced manner. PRP19 facilitates the accumulation of ATRIP, the regulatory partner of the ataxia telangiectasia mutated and Rad3-related (ATR) kinase, at DNA damage sites. Depletion of PRP19 compromised the phosphorylation of ATR substrates, recovery of stalled replication forks, and progression of replication forks on damaged DNA. Importantly, PRP19 mutants that cannot bind RPA or function as an E3 ligase failed to support the ATR response, revealing that PRP19 drives ATR activation by acting as an RPA-ssDNA-sensing ubiquitin ligase during the DDR. Copyright © 2014 Elsevier Inc. All rights reserved.

Nucleosome stability and accessibility of its DNA to proteins.

PubMed

Prinsen, Peter; Schiessel, Helmut

2010-12-01

In this paper we present a theoretical description of the accessibility of nucleosomal DNA to proteins. We reassess the classical analysis of Polach and Widom (1995) who demonstrated that proteins (in their case restriction enzymes) gain access to buried binding sites inside a nucleosome through spontaneous unwrapping of DNA from the protein spool. We introduce a straightforward nucleosome model the predictions of which show good agreement with experimental data. By fitting the model to the data we obtain the values of two quantities: the adsorption energy to the histone octamer per length of DNA and the extra length that the DNA needs to unwrap beyond the binding site of an enzyme before the enzyme can act as effectively as on bare DNA. Our results indicate that the effective binding energy is surprisingly low which suggests that the nucleosomal parameters are tuned such that two large energies, the DNA bending energy and the pure adsorption energy, nearly cancel. This paper is based on a lecture presented at the summer school "DNA and Chromosomes 2009: Physical and Biological Applications". We follow the lecture as closely as possible which is why we spend more time than usual on issues that are already well-known in the field, and why we discuss some well-known results from a different perspective. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Cooperative interplay of let-7 mimic and HuR with MYC RNA.

PubMed

Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

2015-01-01

Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

Mutants of Cre recombinase with improved accuracy

PubMed Central

Eroshenko, Nikolai; Church, George M.

2013-01-01

Despite rapid advances in genome engineering technologies, inserting genes into precise locations in the human genome remains an outstanding problem. It has been suggested that site-specific recombinases can be adapted towards use as transgene delivery vectors. The specificity of recombinases can be altered either with directed evolution or via fusions to modular DNA-binding domains. Unfortunately, both wildtype and altered variants often have detectable activities at off-target sites. Here we use bacterial selections to identify mutations in the dimerization surface of Cre recombinase (R32V, R32M, and 303GVSdup) that improve the accuracy of recombination. The mutants are functional in bacteria, in human cells, and in vitro (except for 303GVSdup, which we did not purify), and have improved selectivity against both model off-target sites and the entire E. coli genome. We propose that destabilizing binding cooperativity may be a general strategy for improving the accuracy of dimeric DNA-binding proteins. PMID:24056590

Spectroscopic detection of etoposide binding to chromatin components: The role of histone proteins

NASA Astrophysics Data System (ADS)

Chamani, Elham; Rabbani-Chadegani, Azra; Zahraei, Zohreh

2014-12-01

Chromatin has been introduced as a main target for most anticancer drugs. Etoposide is known as a topoisomerase II inhibitor, but its effect on chromatin components is unknown. This report, for the first time, describes the effect of etoposide on DNA, histones and DNA-histones complex in the structure of nucleosomes employing thermal denaturation, fluorescence, UV absorbance and circular dichroism spectroscopy techniques. The results showed that the binding of etoposide decreased UV absorbance and fluorescence emission intensity, altered secondary structure of chromatin and hypochromicity was occurred in thermal denaturation profiles. The drug exhibited higher affinity to chromatin compared to DNA. Quenching of drug chromophores with tyrosine residues of histones indicated that globular domain of histones is the site of etoposide binding. Moreover, the binding of etoposide to histones altered their secondary structure accompanied with hypochromicity revealing compaction of histones in the presence of the drug. From the results it is concludes that apart from topoisomerase II, chromatin components especially its protein moiety can be introduced as a new site of etoposide binding and histone proteins especially H1 play a fundamental role in this process and anticancer activity of etoposide.

Molecular mechanism of DNA association with single-stranded DNA binding protein

PubMed Central

Maffeo, Christopher

2017-01-01

Abstract During DNA replication, the single-stranded DNA binding protein (SSB) wraps single-stranded DNA (ssDNA) with high affinity to protect it from degradation and prevent secondary structure formation. Although SSB binds ssDNA tightly, it can be repositioned along ssDNA to follow the advancement of the replication fork. Using all-atom molecular dynamics simulations, we characterized the molecular mechanism of ssDNA association with SSB. Placed in solution, ssDNA–SSB assemblies were observed to change their structure spontaneously; such structural changes were suppressed in the crystallographic environment. Repeat simulations of the SSB–ssDNA complex under mechanical tension revealed a multitude of possible pathways for ssDNA to come off SSB punctuated by prolonged arrests at reproducible sites at the SSB surface. Ensemble simulations of spontaneous association of short ssDNA fragments with SSB detailed a three-dimensional map of local affinity to DNA; the equilibrium amount of ssDNA bound to SSB was found to depend on the electrolyte concentration but not on the presence of the acidic tips of the SSB tails. Spontaneous formation of ssDNA bulges and their diffusive motion along SSB surface was directly observed in multiple 10-µs-long simulations. Such reptation-like motion was confined by DNA binding to high-affinity spots, suggesting a two-step mechanism for SSB diffusion. PMID:29059392

Chemical probes of the conformation of DNA modified by cis-diamminedichloroplatinum(II)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marrot, L.; Leng, M.

The purpose of this work was to analyze at the nucleotide level the distortions induced by the binding of cis-diamminedichloroplatinum(II) (cis-DDP) to DNA by means of chemical probes. In order to test the chemical probes, experiments were first carried out on two platinated oligonucleotides. It has been verified by circular dichroism and gel electrophoresis that the binding of cis-DDP to an AG or to a GTG site within a double-stranded oligonucleotide distorts the double helix. The reactivity of the oligonucleotide platinated at the GTG site with chloroacetaldehyde, diethyl pyrocarbonate, and osmium tetraoxide, respectively, suggests a local denaturation of the doublemore » helix. The 5'G residue and the T residue within the adduct are no longer paired, while the 3'G residue is paired. The double helix is more distorted (but not denatured) at the 5' side of the adduct than at the 3' side. The reactivities of the chemical probes with six platinated DNA restriction fragments show that even at a relatively high level of platination only a few base pairs are unpaired but the double helix is largely distorted. No local denaturation has been detected at the GG sites separated from the nearest GG or AG sites by at least three base pairs. The AG sites separated from the nearest AG or GG sites by at least three base pairs do not denature the double helix locally when they are in the sequences puAG/pyTC. It is suggested that the distortion within these sequences is induced by adducts located further away along the DNA fragments, these sequences not being the major sites for the binding of cis-DDP.« less

Functional analysis of CedA based on its structure: residues important in binding of DNA and RNA polymerase and in the cell division regulation

PubMed Central

Abe, Yoshito; Fujisaki, Naoki; Miyoshi, Takanori; Watanabe, Noriko; Katayama, Tsutomu; Ueda, Tadashi

2016-01-01

DnaAcos, a mutant of the initiator DnaA, causes overinitiation of chromosome replication in Escherichia coli, resulting in inhibition of cell division. CedA was found to be a multi-copy suppressor which represses the dnaAcos inhibition of cell division. However, functional mechanism of CedA remains elusive except for previously indicated possibilities in binding to DNA and RNA polymerase. In this study, we searched for the specific sites of CedA in binding of DNA and RNA polymerase and in repression of cell division inhibition. First, DNA sequence to which CedA preferentially binds was determined. Next, the several residues and β4 region in CedA C-terminal domain was suggested to specifically interact with the DNA. Moreover, we found that the flexible N-terminal region was required for tight binding to longer DNA as well as interaction with RNA polymerase. Based on these results, several cedA mutants were examined in ability for repressing dnaAcos cell division inhibition. We found that the N-terminal region was dispensable and that Glu32 in the C-terminal domain was required for the repression. These results suggest that CedA has multiple roles and residues with different functions are positioned in the two regions. PMID:26400504

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

Theoretical estimates of exposure timescales of protein binding sites on DNA regulated by nucleosome kinetics.

PubMed

Parmar, Jyotsana J; Das, Dibyendu; Padinhateeri, Ranjith

2016-02-29

It is being increasingly realized that nucleosome organization on DNA crucially regulates DNA-protein interactions and the resulting gene expression. While the spatial character of the nucleosome positioning on DNA has been experimentally and theoretically studied extensively, the temporal character is poorly understood. Accounting for ATPase activity and DNA-sequence effects on nucleosome kinetics, we develop a theoretical method to estimate the time of continuous exposure of binding sites of non-histone proteins (e.g. transcription factors and TATA binding proteins) along any genome. Applying the method to Saccharomyces cerevisiae, we show that the exposure timescales are determined by cooperative dynamics of multiple nucleosomes, and their behavior is often different from expectations based on static nucleosome occupancy. Examining exposure times in the promoters of GAL1 and PHO5, we show that our theoretical predictions are consistent with known experiments. We apply our method genome-wide and discover huge gene-to-gene variability of mean exposure times of TATA boxes and patches adjacent to TSS (+1 nucleosome region); the resulting timescale distributions have non-exponential tails. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Type III restriction endonucleases are heterotrimeric: comprising one helicase–nuclease subunit and a dimeric methyltransferase that binds only one specific DNA

PubMed Central

Butterer, Annika; Pernstich, Christian; Smith, Rachel M.; Sobott, Frank; Szczelkun, Mark D.; Tóth, Júlia

2014-01-01

Fundamental aspects of the biochemistry of Type III restriction endonucleases remain unresolved despite being characterized by numerous research groups in the past decades. One such feature is the subunit stoichiometry of these hetero-oligomeric enzyme complexes, which has important implications for the reaction mechanism. In this study, we present a series of results obtained by native mass spectrometry and size exclusion chromatography with multi-angle light scattering consistent with a 1:2 ratio of Res to Mod subunits in the EcoP15I, EcoPI and PstII complexes as the main holoenzyme species and a 1:1 stoichiometry of specific DNA (sDNA) binding by EcoP15I and EcoPI. Our data are also consistent with a model where ATP hydrolysis activated by recognition site binding leads to release of the enzyme from the site, dissociation from the substrate via a free DNA end and cleavage of the DNA. These results are discussed critically in the light of the published literature, aiming to resolve controversies and discuss consequences in terms of the reaction mechanism. PMID:24510100

Single-strand DNA-binding protein SSB1 facilitates TERT recruitment to telomeres and maintains telomere G-overhangs.

PubMed

Pandita, Raj K; Chow, Tracy T; Udayakumar, Durga; Bain, Amanda L; Cubeddu, Liza; Hunt, Clayton R; Shi, Wei; Horikoshi, Nobuo; Zhao, Yong; Wright, Woodring E; Khanna, Kum Kum; Shay, Jerry W; Pandita, Tej K

2015-03-01

Proliferating mammalian stem and cancer cells express telomerase [telomerase reverse transcriptase (TERT)] in an effort to extend chromosomal G-overhangs and maintain telomere ends. Telomerase-expressing cells also have higher levels of the single-stranded DNA-binding protein SSB1, which has a critical role in DNA double-strand break (DSB) repair. Here, we report that SSB1 binds specifically to G-strand telomeric DNA in vitro and associates with telomeres in vivo. SSB1 interacts with the TERT catalytic subunit and regulates its interaction with telomeres. Deletion of SSB1 reduces TERT interaction with telomeres and leads to G-overhang loss. Although SSB1 is recruited to DSB sites, we found no corresponding change in TERT levels at these sites, implying that SSB1-TERT interaction relies upon a specific chromatin structure or context. Our findings offer an explanation for how telomerase is recruited to telomeres to facilitate G-strand DNA extension, a critical step in maintaining telomere ends and cell viability in all cancer cells. Cancer Res; 75(5); 858-69. ©2015 AACR. ©2015 American Association for Cancer Research.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

iDNA-Prot: Identification of DNA Binding Proteins Using Random Forest with Grey Model

PubMed Central

Lin, Wei-Zhong; Fang, Jian-An; Xiao, Xuan; Chou, Kuo-Chen

2011-01-01

DNA-binding proteins play crucial roles in various cellular processes. Developing high throughput tools for rapidly and effectively identifying DNA-binding proteins is one of the major challenges in the field of genome annotation. Although many efforts have been made in this regard, further effort is needed to enhance the prediction power. By incorporating the features into the general form of pseudo amino acid composition that were extracted from protein sequences via the “grey model” and by adopting the random forest operation engine, we proposed a new predictor, called iDNA-Prot, for identifying uncharacterized proteins as DNA-binding proteins or non-DNA binding proteins based on their amino acid sequences information alone. The overall success rate by iDNA-Prot was 83.96% that was obtained via jackknife tests on a newly constructed stringent benchmark dataset in which none of the proteins included has pairwise sequence identity to any other in a same subset. In addition to achieving high success rate, the computational time for iDNA-Prot is remarkably shorter in comparison with the relevant existing predictors. Hence it is anticipated that iDNA-Prot may become a useful high throughput tool for large-scale analysis of DNA-binding proteins. As a user-friendly web-server, iDNA-Prot is freely accessible to the public at the web-site on http://icpr.jci.edu.cn/bioinfo/iDNA-Prot or http://www.jci-bioinfo.cn/iDNA-Prot. Moreover, for the convenience of the vast majority of experimental scientists, a step-by-step guide is provided on how to use the web-server to get the desired results. PMID:21935457

Indicine N-oxide binds to tubulin at a distinct site and inhibits the assembly of microtubules: a mechanism for its cytotoxic activity.

PubMed

Appadurai, Prakash; Rathinasamy, Krishnan

2014-02-10

Indicine N-oxide, a pyrrolizidine alkaloid present in the plant Heliotropium indicum had shown promising cytotoxic activity in various tumor models. The compound exhibited severe toxicity to hepatocytes and bone marrow cells. The present work was aimed to evaluate the molecular mechanism of the toxicity of indicine N-oxide. We found that indicine N-oxide inhibited the proliferation of various cancer cell lines in a concentration dependent manner with IC50 ranging from 46 to 100 μM. At the half maximal inhibitory concentration it blocked the cell cycle progression at mitosis without significantly altering the organization of the spindle and interphase microtubules. The toxicities of the compound at higher concentrations are attributed to its severe depolymerizing effect on both the interphase and spindle microtubules. Binding studies using purified goat brain tubulin indicated that indicine N-oxide binds to tubulin at a distinct site not shared by colchicine or taxol. It decreased the polymer mass of both purified tubulin and MAP-rich tubulin. It was found to induce cleavage of DNA using pUC18 plasmid. The interactions of indicine N-oxide on DNA were also confirmed by computational analysis; which predicted its binding site at the minor groove of DNA. These studies bring to light that the toxicities of indicine N-oxide were due to its DNA damaging effects and depolymerization of microtubules. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

LexA Binds to Transcription Regulatory Site of Cell Division Gene ftsZ in Toxic Cyanobacterium Microcystis aeruginosa.

PubMed

Honda, Takashi; Morimoto, Daichi; Sako, Yoshihiko; Yoshida, Takashi

2018-05-17

Previously, we showed that DNA replication and cell division in toxic cyanobacterium Microcystis aeruginosa are coordinated by transcriptional regulation of cell division gene ftsZ and that an unknown protein specifically bound upstream of ftsZ (BpFz; DNA-binding protein to an upstream site of ftsZ) during successful DNA replication and cell division. Here, we purified BpFz from M. aeruginosa strain NIES-298 using DNA-affinity chromatography and gel-slicing combined with gel electrophoresis mobility shift assay (EMSA). The N-terminal amino acid sequence of BpFz was identified as TNLESLTQ, which was identical to that of transcription repressor LexA from NIES-843. EMSA analysis using mutant probes showed that the sequence GTACTAN 3 GTGTTC was important in LexA binding. Comparison of the upstream regions of lexA in the genomes of closely related cyanobacteria suggested that the sequence TASTRNNNNTGTWC could be a putative LexA recognition sequence (LexA box). Searches for TASTRNNNNTGTWC as a transcriptional regulatory site (TRS) in the genome of M. aeruginosa NIES-843 showed that it was present in genes involved in cell division, photosynthesis, and extracellular polysaccharide biosynthesis. Considering that BpFz binds to the TRS of ftsZ during normal cell division, LexA may function as a transcriptional activator of genes related to cell reproduction in M. aeruginosa, including ftsZ. This may be an example of informality in the control of bacterial cell division.

Arabidopsis SEPALLATA proteins differ in cooperative DNA-binding during the formation of floral quartet-like complexes

PubMed Central

Jetha, Khushboo; Theißen, Günter; Melzer, Rainer

2014-01-01

The SEPALLATA (SEP) genes of Arabidopsis thaliana encode MADS-domain transcription factors that specify the identity of all floral organs. The four Arabidopsis SEP genes function in a largely yet not completely redundant manner. Here, we analysed interactions of the SEP proteins with DNA. All of the proteins were capable of forming tetrameric quartet-like complexes on DNA fragments carrying two sequence elements termed CArG-boxes. Distances between the CArG-boxes for strong cooperative DNA-binding were in the range of 4–6 helical turns. However, SEP1 also bound strongly to CArG-box pairs separated by smaller or larger distances, whereas SEP2 preferred large and SEP4 preferred small inter-site distances for binding. Cooperative binding of SEP3 was comparatively weak for most of the inter-site distances tested. All SEP proteins constituted floral quartet-like complexes together with the floral homeotic proteins APETALA3 (AP3) and PISTILLATA (PI) on the target genes AP3 and SEP3. Our results suggest an important part of an explanation for why the different SEP proteins have largely, but not completely redundant functions in determining floral organ identity: they may bind to largely overlapping, but not identical sets of target genes that differ in the arrangement and spacing of the CArG-boxes in their cis-regulatory regions. PMID:25183521

An efficient method to transcription factor binding sites imputation via simultaneous completion of multiple matrices with positional consistency.

PubMed

Guo, Wei-Li; Huang, De-Shuang

2017-08-22

Transcription factors (TFs) are DNA-binding proteins that have a central role in regulating gene expression. Identification of DNA-binding sites of TFs is a key task in understanding transcriptional regulation, cellular processes and disease. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) enables genome-wide identification of in vivo TF binding sites. However, it is still difficult to map every TF in every cell line owing to cost and biological material availability, which poses an enormous obstacle for integrated analysis of gene regulation. To address this problem, we propose a novel computational approach, TFBSImpute, for predicting additional TF binding profiles by leveraging information from available ChIP-seq TF binding data. TFBSImpute fuses the dataset to a 3-mode tensor and imputes missing TF binding signals via simultaneous completion of multiple TF binding matrices with positional consistency. We show that signals predicted by our method achieve overall similarity with experimental data and that TFBSImpute significantly outperforms baseline approaches, by assessing the performance of imputation methods against observed ChIP-seq TF binding profiles. Besides, motif analysis shows that TFBSImpute preforms better in capturing binding motifs enriched in observed data compared with baselines, indicating that the higher performance of TFBSImpute is not simply due to averaging related samples. We anticipate that our approach will constitute a useful complement to experimental mapping of TF binding, which is beneficial for further study of regulation mechanisms and disease.

Heterodimerization of Msx and Dlx homeoproteins results in functional antagonism.

PubMed

Zhang, H; Hu, G; Wang, H; Sciavolino, P; Iler, N; Shen, M M; Abate-Shen, C

1997-05-01

Protein-protein interactions are known to be essential for specifying the transcriptional activities of homeoproteins. Here we show that representative members of the Msx and Dlx homeoprotein families form homo- and heterodimeric complexes. We demonstrate that dimerization by Msx and Dlx proteins is mediated through their homeodomains and that the residues required for this interaction correspond to those necessary for DNA binding. Unlike most other known examples of homeoprotein interactions, association of Msx and Dlx proteins does not promote cooperative DNA binding; instead, dimerization and DNA binding are mutually exclusive activities. In particular, we show that Msx and Dlx proteins interact independently and noncooperatively with homeodomain DNA binding sites and that dimerization is specifically blocked by the presence of such DNA sites. We further demonstrate that the transcriptional properties of Msx and Dlx proteins display reciprocal inhibition. Specifically, Msx proteins act as transcriptional repressors and Dlx proteins act as activators, while in combination, Msx and Dlx proteins counteract each other's transcriptional activities. Finally, we show that the expression patterns of representative Msx and Dlx genes (Msx1, Msx2, Dlx2, and Dlx5) overlap in mouse embryogenesis during limb bud and craniofacial development, consistent with the potential for their protein products to interact in vivo. Based on these observations, we propose that functional antagonism through heterodimer formation provides a mechanism for regulating the transcriptional actions of Msx and Dlx homeoproteins in vivo.

Isolation and characterization of the DNA-binding protein (DBP) of the Autographa californica multiple nucleopolyhedrovirus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.

2008-01-20

DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less

DNA Physical Properties and Nucleosome Positions Are Major Determinants of HIV-1 Integrase Selectivity

PubMed Central

Naughtin, Monica; Haftek-Terreau, Zofia; Xavier, Johan; Meyer, Sam; Silvain, Maud; Jaszczyszyn, Yan; Levy, Nicolas; Miele, Vincent; Benleulmi, Mohamed Salah; Ruff, Marc; Parissi, Vincent; Vaillant, Cédric; Lavigne, Marc

2015-01-01

Retroviral integrases (INs) catalyse the integration of the reverse transcribed viral DNA into the host cell genome. This process is selective, and chromatin has been proposed to be a major factor regulating this step in the viral life cycle. However, the precise underlying mechanisms are still under investigation. We have developed a new in vitro integration assay using physiologically-relevant, reconstituted genomic acceptor chromatin and high-throughput determination of nucleosome positions and integration sites, in parallel. A quantitative analysis of the resulting data reveals a chromatin-dependent redistribution of the integration sites and establishes a link between integration sites and nucleosome positions. The co-activator LEDGF/p75 enhanced integration but did not modify the integration sites under these conditions. We also conducted an in cellulo genome-wide comparative study of nucleosome positions and human immunodeficiency virus type-1 (HIV-1) integration sites identified experimentally in vivo. These studies confirm a preferential integration in nucleosome-covered regions. Using a DNA mechanical energy model, we show that the physical properties of DNA probed by IN binding are important in determining IN selectivity. These novel in vitro and in vivo approaches confirm that IN has a preference for integration into a nucleosome, and suggest the existence of two levels of IN selectivity. The first depends on the physical properties of the target DNA and notably, the energy required to fit DNA into the IN catalytic pocket. The second depends on the DNA deformation associated with DNA wrapping around a nucleosome. Taken together, these results indicate that HIV-1 IN is a shape-readout DNA binding protein. PMID:26075397

Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

PubMed Central

Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

2012-01-01

The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346