Sample records for dna chip analysis

  1. Microfluidic Devices for Forensic DNA Analysis: A Review.

    PubMed

    Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

    2016-08-05

    Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10-20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook.

  2. Microfluidic Devices for Forensic DNA Analysis: A Review

    PubMed Central

    Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

    2016-01-01

    Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10–20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook. PMID:27527231

  3. [Fabrications of a poly (methyl methacrylate) (PMMA) microfluidic chip-based DNA analysis device].

    PubMed

    Du, Xiao-Guang

    2009-12-01

    A DNA analysis device based on poly(methyl methacrylate) (PMMA) microfluidic chips was developed. A PMMA chip with cross microchannels was fabricated by a simple hot embossing. Microchannels were modified with a static adsorptive coating method using 2% hydroxyethyl cellulose. A high-voltage power unit, variable in the range 0-1 800 V, was used for on-chip DNA sample injection and gel electrophoretic separation. High speed, high resolution DNA analysis was obtained with the home-built PMMA chip in a sieving matrix containing 2% hydroxyethyl cellulose with a blue intercalating dye, TO-PRO-3 (TP3), by using diode laser induced fluorescence detection based on optical fibers with a 670 nm long-pass filter. The DNA analysis device was applied for the separation of phiX-174/HaeIII DNA digest sample with 11 fragments ranging from 72 to 1 353 bp. A separation efficiency of 1.14 x 10(6) plates/m was obtained for the 603 bp fragments, while the R of 271/281 bp fragments was 1.2. The device was characterized by simple design, low cost for fabrication and operation, reusable PMMA chips, and good reproducibility. A portable microfluidic device for DNA analysis can be developed for clinical diagnosis and disease screening.

  4. Analysis of Protein-DNA Interaction by Chromatin Immunoprecipitation and DNA Tiling Microarray (ChIP-on-chip).

    PubMed

    Gao, Hui; Zhao, Chunyan

    2018-01-01

    Chromatin immunoprecipitation (ChIP) has become the most effective and widely used tool to study the interactions between specific proteins or modified forms of proteins and a genomic DNA region. Combined with genome-wide profiling technologies, such as microarray hybridization (ChIP-on-chip) or massively parallel sequencing (ChIP-seq), ChIP could provide a genome-wide mapping of in vivo protein-DNA interactions in various organisms. Here, we describe a protocol of ChIP-on-chip that uses tiling microarray to obtain a genome-wide profiling of ChIPed DNA.

  5. Integrated microfluidic chip for rapid DNA digestion and time-resolved capillary electrophoresis analysis

    PubMed Central

    Lin, Che-Hsin; Wang, Yao-Nan; Fu, Lung-Ming

    2012-01-01

    An integrated microfluidic chip is proposed for rapid DNA digestion and time-resolved capillary electrophoresis (CE) analysis. The chip comprises two gel-filled chambers for DNA enrichment and purification, respectively, a T-form micromixer for DNA/restriction enzyme mixing, a serpentine channel for DNA digestion reaction, and a CE channel for on-line capillary electrophoresis analysis. The DNA and restriction enzyme are mixed electroomostically using a pinched-switching DC field. The experimental and numerical results show that a mixing performance of 97% is achieved within a distance of 1 mm from the T-junction when a driving voltage of 90 V/cm and a switching frequency of 4 Hz are applied. Successive mixing digestion and capillary electrophoresis operation clearly present the changes on digesting φx-174 DNA in different CE runs. The time-resolved electropherograms show that the proposed device enables a φx-174 DNA sample comprising 11 fragments to be concentrated and analyzed within 24 min. Overall, the results presented in this study show that the proposed microfluidic chip provides a rapid and effective tool for DNA digestion and CE analysis applications. PMID:22662085

  6. ChIP-seq.

    PubMed

    Kim, Tae Hoon; Dekker, Job

    2018-05-01

    Owing to its digital nature, ChIP-seq has become the standard method for genome-wide ChIP analysis. Using next-generation sequencing platforms (notably the Illumina Genome Analyzer), millions of short sequence reads can be obtained. The densities of recovered ChIP sequence reads along the genome are used to determine the binding sites of the protein. Although a relatively small amount of ChIP DNA is required for ChIP-seq, the current sequencing platforms still require amplification of the ChIP DNA by ligation-mediated PCR (LM-PCR). This protocol, which involves linker ligation followed by size selection, is the standard ChIP-seq protocol using an Illumina Genome Analyzer. The size-selected ChIP DNA is amplified by LM-PCR and size-selected for the second time. The purified ChIP DNA is then loaded into the Genome Analyzer. The ChIP DNA can also be processed in parallel for ChIP-chip results. © 2018 Cold Spring Harbor Laboratory Press.

  7. Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

    PubMed

    Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

    2008-03-01

    We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

  8. Research and development of biochip technologies in Taiwan

    NASA Astrophysics Data System (ADS)

    Ting, Solomon J.; Chiou, Arthur E. T.

    2000-07-01

    Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

  9. Functional integration of PCR amplification and capillary eletrophoresis in a microfabricated DNA analysis device

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woolley, A.T.; deMello, A.J.; Mathies, R.A.

    Microfabricated silicon PCR reactors and glass capillary electrophoresis (CE) chips have been successfully coupled to form an integrated DNA analysis system. This construct combines the rapid thermal cycling capabilities of microfabricated PCR devices (10{degree}C/s heating, 2.5{degree}C/s cooling) with the high-speed (<120 s) DNA separations provided by microfabricated CE chips. The PCR chamber and the CE chip were directly linked through a photolithographically fabricated channel filled with hydroxyethylcellulose sieving matrix. Electrophoretic injection directly from the PCR chamber through the cross injection channel was used as an `electrophoretic valve` to couple the PCR and CE devices on-chip. To demonstrate the functionality ofmore » this system, a 15 min PCR amplification of a {Beta}-globin target cloned in m13 was immediately followed by high-speed CE chip separation in under 120 s, providing a rapid PCR-CE analysis in under 20 min. A rapid assay for genomic Salmonella DNA was performed in under 45 min, demonstrating that challenging amplifications of diagnostically interesting targets can also be performed. Real-time monitoring of PCR target amplification in these integrated PCR-CE devices is also feasible. 33 refs., 6 figs.« less

  10. Comparison of the analytical and clinical performances of Abbott RealTime High Risk HPV, Hybrid Capture 2, and DNA Chip assays in gynecology patients.

    PubMed

    Park, Seungman; Kang, Youjin; Kim, Dong Geun; Kim, Eui-Chong; Park, Sung Sup; Seong, Moon-Woo

    2013-08-01

    The detection of high-risk (HR) HPV in cervical cancer screening is important for early diagnosis of cervical cancer or pre-cancerous lesions. We evaluated the analytical and clinical performances of 3 HR HPV assays in Gynecology patients. A total of 991 specimens were included in this study: 787 specimens for use with a Hybrid Capture 2 (HC2) and 204 specimens for a HPV DNA microarray (DNA Chip). All specimens were tested using an Abbott RealTime High Risk HPV assay (Real-time HR), PGMY PCR, and sequence analysis. Clinical sensitivities for severe abnormal cytology (severe than high-grade squamous intraepithelial lesion) were 81.8% for Real-time HR, 77.3% for HC2, and 66.7% for DNA Chip, and clinical sensitivities for severe abnormal histology (cervical intraepithelial neoplasia grade 2+) were 91.7% for HC2, 87.5% for Real-time HR, and 73.3% for DNA Chip. As compared to results of the sequence analysis, HC2, Real-time HR, and DNA Chip showed concordance rates of 94.3% (115/122), 90.0% (117/130), and 61.5% (16/26), respectively. The HC2 assay and Real-time HR assay showed comparable results to each other in both clinical and analytical performances, while the DNA Chip assay showed poor clinical and analytical performances. The Real-time HR assay can be a good alternative option for HR HPV testing with advantages of allowing full automation and simultaneous genotyping of HR types 16 and 18. Copyright © 2013 Elsevier Inc. All rights reserved.

  11. Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

    PubMed Central

    Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

    2016-01-01

    Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

  12. Applications and theory of electrokinetic enrichment in micro-nanofluidic chips.

    PubMed

    Chen, Xueye; Zhang, Shuai; Zhang, Lei; Yao, Zhen; Chen, Xiaodong; Zheng, Yue; Liu, Yanlin

    2017-09-01

    This review reports the progress on the recent development of electrokinetic enrichment in micro-nanofluidic chips. The governing equations of electrokinetic enrichment in micro-nanofluidic chips are given. Various enrichment applications including protein analysis, DNA analysis, bacteria analysis, viruses analysis and cell analysis are illustrated and discussed. The advantages and difficulties of each enrichment method are expatiated. This paper will provide a particularly convenient and valuable reference to those who intend to research the electrokinetic enrichment based on micro-nanofluidic chips.

  13. Microchip-based cell lysis and DNA extraction from sperm cells for application to forensic analysis.

    PubMed

    Bienvenue, Joan M; Duncalf, Natalie; Marchiarullo, Daniel; Ferrance, Jerome P; Landers, James P

    2006-03-01

    The current backlog of casework is among the most significant challenges facing crime laboratories at this time. While the development of next-generation microchip-based technology for expedited forensic casework analysis offers one solution to this problem, this will require the adaptation of manual, large-volume, benchtop chemistry to small volume microfluidic devices. Analysis of evidentiary materials from rape kits where semen or sperm cells are commonly found represents a unique set of challenges for on-chip cell lysis and DNA extraction that must be addressed for successful application. The work presented here details the development of a microdevice capable of DNA extraction directly from sperm cells for application to the analysis of sexual assault evidence. A variety of chemical lysing agents are assessed for inclusion in the extraction protocol and a method for DNA purification from sperm cells is described. Suitability of the extracted DNA for short tandem repeat (STR) analysis is assessed and genetic profiles shown. Finally, on-chip cell lysis methods are evaluated, with results from fluorescence visualization of cell rupture and DNA extraction from an integrated cell lysis and purification with subsequent STR amplification presented. A method for on-chip cell lysis and DNA purification is described, with considerations toward inclusion in an integrated microdevice capable of both differential cell sorting and DNA extraction. The results of this work demonstrate the feasibility of incorporating microchip-based cell lysis and DNA extraction into forensic casework analysis.

  14. ChIP-chip versus ChIP-seq: Lessons for experimental design and data analysis

    PubMed Central

    2011-01-01

    Background Chromatin immunoprecipitation (ChIP) followed by microarray hybridization (ChIP-chip) or high-throughput sequencing (ChIP-seq) allows genome-wide discovery of protein-DNA interactions such as transcription factor bindings and histone modifications. Previous reports only compared a small number of profiles, and little has been done to compare histone modification profiles generated by the two technologies or to assess the impact of input DNA libraries in ChIP-seq analysis. Here, we performed a systematic analysis of a modENCODE dataset consisting of 31 pairs of ChIP-chip/ChIP-seq profiles of the coactivator CBP, RNA polymerase II (RNA PolII), and six histone modifications across four developmental stages of Drosophila melanogaster. Results Both technologies produce highly reproducible profiles within each platform, ChIP-seq generally produces profiles with a better signal-to-noise ratio, and allows detection of more peaks and narrower peaks. The set of peaks identified by the two technologies can be significantly different, but the extent to which they differ varies depending on the factor and the analysis algorithm. Importantly, we found that there is a significant variation among multiple sequencing profiles of input DNA libraries and that this variation most likely arises from both differences in experimental condition and sequencing depth. We further show that using an inappropriate input DNA profile can impact the average signal profiles around genomic features and peak calling results, highlighting the importance of having high quality input DNA data for normalization in ChIP-seq analysis. Conclusions Our findings highlight the biases present in each of the platforms, show the variability that can arise from both technology and analysis methods, and emphasize the importance of obtaining high quality and deeply sequenced input DNA libraries for ChIP-seq analysis. PMID:21356108

  15. Gene expression analysis using a highly sensitive DNA microarray for colorectal cancer screening.

    PubMed

    Koga, Yoshikatsu; Yamazaki, Nobuyoshi; Takizawa, Satoko; Kawauchi, Junpei; Nomura, Osamu; Yamamoto, Seiichiro; Saito, Norio; Kakugawa, Yasuo; Otake, Yosuke; Matsumoto, Minori; Matsumura, Yasuhiro

    2014-01-01

    Half of all patients with small, right-sided, non-metastatic colorectal cancer (CRC) have negative results for the fecal occult blood test (FOBT). In the present study, the usefulness of CRC screening with a highly sensitive DNA microarray was evaluated in comparison with that by FOBT using fecal samples. A total of 53 patients with CRC and 61 healthy controls were divided into "training" and "validation sets". For the gene profiling, total RNA extracted from 0.5 g of feces was hybridized to a highly sensitive DNA chip. The expressions of 43 genes were significantly higher in the patients with CRC than in healthy controls (p<0.05). In the training set, the sensitivity and specificity of the DNA chip assay using six genes were 85.4% and 85.2%, respectively. On the other hand, in the validation set, the sensitivity and specificity of the DNA chip assay were 85.2% and 85.7%, respectively. The sensitivities of the DNA chip assay were higher than those of FOBT in cases of the small, right-sided, early-CRC, tumor invading up to the muscularis propria (i.e. surface tumor) subgroups. In particular, the sensitivities of the DNA chip assay in the surface tumor and early-CRC subgroups were significantly higher than those of FOBT (p=0.023 and 0.019, respectively.). Gene profiling assay using a highly sensitive DNA chip was more effective than FOBT at detecting patients with small, right-sided, surface tumor, and early-stage CRC.

  16. Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

    PubMed Central

    Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

    2007-01-01

    Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

  17. [GSTP1, APC and RASSF1 gene methylation in prostate cancer samples: comparative analysis of MS-HRM method and Infinium HumanMethylation450 BeadChip beadchiparray diagnostic value].

    PubMed

    Skorodumova, L O; Babalyan, K A; Sultanov, R; Vasiliev, A O; Govorov, A V; Pushkar, D Y; Prilepskaya, E A; Danilenko, S A; Generozov, E V; Larin, A K; Kostryukova, E S; Sharova, E I

    2016-11-01

    There is a clear need in molecular markers for prostate cancer (PC) risk stratification. Alteration of DNA methylation is one of processes that occur during ÐÑ progression. Methylation-sensitive PCR with high resolution melting curve analysis (MS-HRM) can be used for gene methylation analysis in routine laboratory practice. This method requires very small amounts of DNA for analysis. Numerous results have been accumulated on DNA methylation in PC samples analyzed by the Infinium HumanMethylation450 BeadChip (HM450). However, the consistency of MS-HRM results with chip hybridization results has not been examined yet. The aim of this study was to assess the consistency of results of GSTP1, APC and RASSF1 gene methylation analysis in ÐÑ biopsy samples obtained by MS-HRM and chip hybridization. The methylation levels of each gene determined by MS-HRM were statistically different in the group of PC tissue samples and the samples without signs of tumor growth. Chip hybridization data analysis confirmed the results obtained with the MS-HRM. Differences in methylation levels between tumor tissue and histologically intact tissue of each sample determined by MS-HRM and chip hybridization, were consistent with each other. Thus, we showed that the assessment of GSTP1, APC and RASSF1 gene methylation analysis using MS-HRM is suitable for the design of laboratory assays that will differentiate the PC tissue from the tissue without signs of tumor growth.

  18. Advances in on-chip photodetection for applications in miniaturized genetic analysis systems

    NASA Astrophysics Data System (ADS)

    Namasivayam, Vijay; Lin, Rongsheng; Johnson, Brian; Brahmasandra, Sundaresh; Razzacki, Zafar; Burke, David T.; Burns, Mark A.

    2004-01-01

    Microfabrication techniques have become increasingly popular in the development of next generation DNA analysis devices. Improved on-chip fluorescence detection systems may have applications in developing portable hand-held instruments for point-of-care diagnostics. Miniaturization of fluorescence detection involves construction of ultra-sensitive photodetectors that can be integrated onto a fluidic platform combined with the appropriate optical emission filters. We have previously demonstrated integration PIN photodiodes onto a microfabricated electrophoresis channel for separation and detection of DNA fragments. In this work, we present an improved detector structure that uses a PINN+ photodiode with an on-chip interference filter and a robust liquid barrier layer. This new design yields high sensitivity (detection limit of 0.9 ng µl-1 of DNA), low-noise (S/N ~ 100/1) and enhanced quantum efficiencies (>80%) over the entire visible spectrum. Applications of these photodiodes in various areas of DNA analysis such as microreactions (PCR), separations (electrophoresis) and microfluidics (drop sensing) are presented.

  19. A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

    PubMed Central

    Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

    2009-01-01

    DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

  20. Real-time PCR machine system modeling and a systematic approach for the robust design of a real-time PCR-on-a-chip system.

    PubMed

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design.

  1. Cohort analysis of a single nucleotide polymorphism on DNA chips.

    PubMed

    Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

    2004-11-15

    A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

  2. Rapid self-assembly of DNA on a microfluidic chip

    PubMed Central

    Zheng, Yao; Footz, Tim; Manage, Dammika P; Backhouse, Christopher James

    2005-01-01

    Background DNA self-assembly methods have played a major role in enabling methods for acquiring genetic information without having to resort to sequencing, a relatively slow and costly procedure. However, even self-assembly processes tend to be very slow when they rely upon diffusion on a large scale. Miniaturisation and integration therefore hold the promise of greatly increasing this speed of operation. Results We have developed a rapid method for implementing the self-assembly of DNA within a microfluidic system by electrically extracting the DNA from an environment containing an uncharged denaturant. By controlling the parameters of the electrophoretic extraction and subsequent analysis of the DNA we are able to control when the hybridisation occurs as well as the degree of hybridisation. By avoiding off-chip processing or long thermal treatments we are able to perform this hybridisation rapidly and can perform hybridisation, sizing, heteroduplex analysis and single-stranded conformation analysis within a matter of minutes. The rapidity of this analysis allows the sampling of transient effects that may improve the sensitivity of mutation detection. Conclusions We believe that this method will aid the integration of self-assembly methods upon microfluidic chips. The speed of this analysis also appears to provide information upon the dynamics of the self-assembly process. PMID:15717935

  3. [The development of reagents set in the format of DNA-chip for genetic typing of strains of Vibrio cholerae].

    PubMed

    Pudova, E A; Markelov, M L; Dedkov, V G; Tchekanova, T A; Sadjin, A I; Kirdiyashkina, N P; Bekova, M V; Deviyatkin, A A

    2014-05-01

    The necessity of development of methods of genic diagnostic of cholera is conditioned by continuation of the Seventh pandemic of cholera, taxonomic variability of strains of Vibrio cholerae involved into pandemic and also permanent danger of delivery of disease to the territory of the Russian Federation. The methods of genic diagnostic of cholera make it possible in a comparatively short time to maximally minutely characterize strains isolated from patients or their environment. The article presents information about working out reagents set for genetic typing of agents of cholera using DNA-chip. The makeup of DNA-chip included oligonucleotide probes making possible to differentiate strains of V. cholerae on serogroups and biovars and to determine their pathogenicity. The single DNA-chip makes it possible to genetically type up to 12 samples concurrently. At that, duration of analysis without accounting stage of DNA separation makes up to 5 hours. In the progress of work, 23 cholera and non-cholera strains were analyzed. The full compliance of DNA-chip typing results to previously known characteristics of strains. Hence, there is a reason to consider availability of further development of reagents set and possibility of its further application in laboratories of regional level and reference centers.

  4. ChIP-chip.

    PubMed

    Kim, Tae Hoon; Dekker, Job

    2018-05-01

    ChIP-chip can be used to analyze protein-DNA interactions in a region-wide and genome-wide manner. DNA microarrays contain PCR products or oligonucleotide probes that are designed to represent genomic sequences. Identification of genomic sites that interact with a specific protein is based on competitive hybridization of the ChIP-enriched DNA and the input DNA to DNA microarrays. The ChIP-chip protocol can be divided into two main sections: Amplification of ChIP DNA and hybridization of ChIP DNA to arrays. A large amount of DNA is required to hybridize to DNA arrays, and hybridization to a set of multiple commercial arrays that represent the entire human genome requires two rounds of PCR amplifications. The relative hybridization intensity of ChIP DNA and that of the input DNA is used to determine whether the probe sequence is a potential site of protein-DNA interaction. Resolution of actual genomic sites bound by the protein is dependent on the size of the chromatin and on the genomic distance between the probes on the array. As with expression profiling using gene chips, ChIP-chip experiments require multiple replicates for reliable statistical measure of protein-DNA interactions. © 2018 Cold Spring Harbor Laboratory Press.

  5. Optimization of multiplexed PCR on an integrated microfluidic forensic platform for rapid DNA analysis.

    PubMed

    Estes, Matthew D; Yang, Jianing; Duane, Brett; Smith, Stan; Brooks, Carla; Nordquist, Alan; Zenhausern, Frederic

    2012-12-07

    This study reports the design, prototyping, and assay development of multiplexed polymerase chain reaction (PCR) on a plastic microfluidic device. Amplification of 17 DNA loci is carried out directly on-chip as part of a system for continuous workflow processing from sample preparation (SP) to capillary electrophoresis (CE). For enhanced performance of on-chip PCR amplification, improved control systems have been developed making use of customized Peltier assemblies, valve actuators, software, and amplification chemistry protocols. Multiple enhancements to the microfluidic chip design have been enacted to improve the reliability of sample delivery through the various on-chip modules. This work has been enabled by the encapsulation of PCR reagents into a solid phase material through an optimized Solid Phase Encapsulating Assay Mix (SPEAM) bead-based hydrogel fabrication process. SPEAM bead technology is reliably coupled with precise microfluidic metering and dispensing for efficient amplification and subsequent DNA short tandem repeat (STR) fragment analysis. This provides a means of on-chip reagent storage suitable for microfluidic automation, with the long shelf-life necessary for point-of-care (POC) or field deployable applications. This paper reports the first high quality 17-plex forensic STR amplification from a reference sample in a microfluidic chip with preloaded solid phase reagents, that is designed for integration with up and downstream processing.

  6. A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

    PubMed

    Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

    2008-04-01

    The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

  7. Digital LAMP in a sample self-digitization (SD) chip

    PubMed Central

    Herrick, Alison M.; Dimov, Ivan K.; Lee, Luke P.; Chiu, Daniel T.

    2012-01-01

    This paper describes the realization of digital loop-mediated DNA amplification (dLAMP) in a sample self-digitization (SD) chip. Digital DNA amplification has become an attractive technique to quantify absolute concentrations of DNA in a sample. While digital polymerase chain reaction is still the most widespread implementation, its use in resource—limited settings is impeded by the need for thermal cycling and robust temperature control. In such situations, isothermal protocols that can amplify DNA or RNA without thermal cycling are of great interest. Here, we showed the successful amplification of single DNA molecules in a stationary droplet array using isothermal digital loop-mediated DNA amplification. Unlike most (if not all) existing methods for sample discretization, our design allows for automated, loss-less digitization of sample volumes on-chip. We demonstrated accurate quantification of relative and absolute DNA concentrations with sample volumes of less than 2 μl. We assessed the homogeneity of droplet size during sample self-digitization in our device, and verified that the size variation was small enough such that straightforward counting of LAMP-active droplets sufficed for data analysis. We anticipate that the simplicity and robustness of our SD chip make it attractive as an inexpensive and easy-to-operate device for DNA amplification, for example in point-of-care settings. PMID:22399016

  8. Real-time PCR Machine System Modeling and a Systematic Approach for the Robust Design of a Real-time PCR-on-a-Chip System

    PubMed Central

    Lee, Da-Sheng

    2010-01-01

    Chip-based DNA quantification systems are widespread, and used in many point-of-care applications. However, instruments for such applications may not be maintained or calibrated regularly. Since machine reliability is a key issue for normal operation, this study presents a system model of the real-time Polymerase Chain Reaction (PCR) machine to analyze the instrument design through numerical experiments. Based on model analysis, a systematic approach was developed to lower the variation of DNA quantification and achieve a robust design for a real-time PCR-on-a-chip system. Accelerated lift testing was adopted to evaluate the reliability of the chip prototype. According to the life test plan, this proposed real-time PCR-on-a-chip system was simulated to work continuously for over three years with similar reproducibility in DNA quantification. This not only shows the robustness of the lab-on-a-chip system, but also verifies the effectiveness of our systematic method for achieving a robust design. PMID:22315563

  9. Optimization of applied voltages for on-chip concentration of DNA using nanoslit

    NASA Astrophysics Data System (ADS)

    Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

    2017-12-01

    On-chip sample concentration is an effective pretreatment to improve the detection sensitivity of lab-on-a-chip devices for biochemical analysis. In a previous study, we successfully achieved DNA sample concentration using a nanoslit fabricated in the microchannel of a device designed for DNA size separation. The nanoslit was a channel with a depth smaller than the diameter of a random coil-shaped DNA molecule. The concentration was achieved using the entropy trap at the boundary between the microchannel and the nanoslit. DNA molecules migrating toward the nanoslit owing to electrophoresis were trapped in front of the nanoslit and the concentration was enhanced over time. In this study, we successfully maximize the molecular concentration by optimizing the applied voltage for electrophoresis and verifying the effect of temperature. In addition, we propose a model formula that predicts the molecular concentration, the validity of which is confirmed through comparison with experimental results.

  10. Gene chips and arrays revealed: a primer on their power and their uses.

    PubMed

    Watson, S J; Akil, H

    1999-03-01

    This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

  11. Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

    PubMed

    Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

    2007-11-01

    Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

  12. Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

    PubMed

    Kumar Khanna, Vinod

    2007-01-01

    The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

  13. CE chips fabricated by injection molding and polyethylene/thermoplastic elastomer film packaging methods.

    PubMed

    Huang, Fu-Chun; Chen, Yih-Far; Lee, Gwo-Bin

    2007-04-01

    This study presents a new packaging method using a polyethylene/thermoplastic elastomer (PE/TPE) film to seal an injection-molded CE chip made of either poly(methyl methacrylate) (PMMA) or polycarbonate (PC) materials. The packaging is performed at atmospheric pressure and at room temperature, which is a fast, easy, and reliable bonding method to form a sealed CE chip for chemical analysis and biomedical applications. The fabrication of PMMA and PC microfluidic channels is accomplished by using an injection-molding process, which could be mass-produced for commercial applications. In addition to microfluidic CE channels, 3-D reservoirs for storing biosamples, and CE buffers are also formed during this injection-molding process. With this approach, a commercial CE chip can be of low cost and disposable. Finally, the functionality of the mass-produced CE chip is demonstrated through its successful separation of phiX174 DNA/HaeIII markers. Experimental data show that the S/N for the CE chips using the PE/TPE film has a value of 5.34, when utilizing DNA markers with a concentration of 2 ng/microL and a CE buffer of 2% hydroxypropyl-methylcellulose (HPMC) in Tris-borate-EDTA (TBE) with 1% YO-PRO-1 fluorescent dye. Thus, the detection limit of the developed chips is improved. Lastly, the developed CE chips are used for the separation and detection of PCR products. A mixture of an amplified antibiotic gene for Streptococcus pneumoniae and phiX174 DNA/HaeIII markers was successfully separated and detected by using the proposed CE chips. Experimental data show that these DNA samples were separated within 2 min. The study proposed a promising method for the development of mass-produced CE chips.

  14. Programmable lab-on-a-chip system for single cell analysis

    NASA Astrophysics Data System (ADS)

    Thalhammer, S.

    2009-05-01

    The collection, selection, amplification and detection of minimum genetic samples became a part of everyday life in medical and biological laboratories, to analyze DNA-fragments of pathogens, patient samples and traces on crime scenes. About a decade ago, a handful of researchers began discussing an intriguing idea. Could the equipment needed for everyday chemistry and biology procedures be shrunk to fit on a chip in the size of a fingernail? Miniature devices for, say, analysing DNA and proteins should be faster and cheaper than conventional versions. Lab-on-a-chip is an advanced technology that integrates a microfluidic system on a microscale chip device. The "laboratory" is created by means of channels, mixers, reservoirs, diffusion chambers, integrated electrodes, pumps, valves and more. With lab-ona- chip technology, complete laboratories on a square centimetre can be created. Here, a multifunctional programmable Lab-on-a-Chip driven by nanofluidics and controlled by surface acoustic waves (SAW) is presented. This system combines serial DNA-isolation-, amplification- and array-detection-process on a modified glass-platform. The fluid actuation is controlled via SAW by interdigital transducers implemented in the chemical modified chip surface. The chemical surface modification allows fluid handling in the sub-microliter range. Minute amount of sample material is extracted by laser-based microdissection out of e.g. histological sections at the single cell level. A few picogram of genetic material are isolated and transferred via a low-pressure transfer system (SPATS) onto the chip. Subsequently the genetic material inside single droplets, which behave like "virtual" beaker, is transported to the reaction and analysis centers on the chip surface via surface acoustic waves, mainly known as noise dumping filters in mobile phones. At these "biological reactors" the genetic material is processed, e.g. amplified via polymerase chain reaction methods, and genetically characterized.

  15. An integrated workflow for analysis of ChIP-chip data.

    PubMed

    Weigelt, Karin; Moehle, Christoph; Stempfl, Thomas; Weber, Bernhard; Langmann, Thomas

    2008-08-01

    Although ChIP-chip is a powerful tool for genome-wide discovery of transcription factor target genes, the steps involving raw data analysis, identification of promoters, and correlation with binding sites are still laborious processes. Therefore, we report an integrated workflow for the analysis of promoter tiling arrays with the Genomatix ChipInspector system. We compare this tool with open-source software packages to identify PU.1 regulated genes in mouse macrophages. Our results suggest that ChipInspector data analysis, comparative genomics for binding site prediction, and pathway/network modeling significantly facilitate and enhance whole-genome promoter profiling to reveal in vivo sites of transcription factor-DNA interactions.

  16. On-chip concentration of bacteria using a 3D dielectrophoretic chip and subsequent laser-based DNA extraction in the same chip

    NASA Astrophysics Data System (ADS)

    Cho, Yoon-Kyoung; Kim, Tae-hyeong; Lee, Jeong-Gun

    2010-06-01

    We report the on-chip concentration of bacteria using a dielectrophoretic (DEP) chip with 3D electrodes and subsequent laser-based DNA extraction in the same chip. The DEP chip has a set of interdigitated Au post electrodes with 50 µm height to generate a network of non-uniform electric fields for the efficient trapping by DEP. The metal post array was fabricated by photolithography and subsequent Ni and Au electroplating. Three model bacteria samples (Escherichia coli, Staphylococcus epidermidis, Streptococcus mutans) were tested and over 80-fold concentrations were achieved within 2 min. Subsequently, on-chip DNA extraction from the concentrated bacteria in the 3D DEP chip was performed by laser irradiation using the laser-irradiated magnetic bead system (LIMBS) in the same chip. The extracted DNA was analyzed with silicon chip-based real-time polymerase chain reaction (PCR). The total process of on-chip bacteria concentration and the subsequent DNA extraction can be completed within 10 min including the manual operation time.

  17. DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

    PubMed

    Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

    2003-03-01

    We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

  18. A label-free, fluorescence based assay for microarray

    NASA Astrophysics Data System (ADS)

    Niu, Sanjun

    DNA chip technology has drawn tremendous attention since it emerged in the mid 90's as a method that expedites gene sequencing by over 100-fold. DNA chip, also called DNA microarray, is a combinatorial technology in which different single-stranded DNA (ssDNA) molecules of known sequences are immobilized at specific spots. The immobilized ssDNA strands are called probes. In application, the chip is exposed to a solution containing ssDNA of unknown sequence, called targets, which are labeled with fluorescent dyes. Due to specific molecular recognition among the base pairs in the DNA, the binding or hybridization occurs only when the probe and target sequences are complementary. The nucleotide sequence of the target is determined by imaging the fluorescence from the spots. The uncertainty of background in signal detection and statistical error in data analysis, primarily due to the error in the DNA amplification process and statistical distribution of the tags in the target DNA, have become the fundamental barriers in bringing the technology into application for clinical diagnostics. Furthermore, the dye and tagging process are expensive, making the cost of DNA chips inhibitive for clinical testing. These limitations and challenges make it difficult to implement DNA chip methods as a diagnostic tool in a pathology laboratory. The objective of this dissertation research is to provide an alternative approach that will address the above challenges. In this research, a label-free assay is designed and studied. Polystyrene (PS), a commonly used polymeric material, serves as the fluorescence agent. Probe ssDNA is covalently immobilized on polystyrene thin film that is supported by a reflecting substrate. When this chip is exposed to excitation light, fluorescence light intensity from PS is detected as the signal. Since the optical constants and conformations of ssDNA and dsDNA (double stranded DNA) are different, the measured fluorescence from PS changes for the same intensity of excitation light. The fluorescence contrast is used to quantify the amount of probe-target hybridization. A mathematical model that considers multiple reflections and scattering is developed to explain the mechanism of the fluorescence contrast which depends on the thickness of the PS film. Scattering is the dominant factor that contributes to the contrast. The potential of this assay to detect single nucleotide polymorphism is also tested.

  19. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    PubMed

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip.

    PubMed

    Dongre, Chaitanya; van Weerd, Jasper; Besselink, Geert A J; Vazquez, Rebeca Martinez; Osellame, Roberto; Cerullo, Giulio; van Weeghel, Rob; van den Vlekkert, Hans H; Hoekstra, Hugo J W M; Pollnau, Markus

    2011-02-21

    We introduce a principle of parallel optical processing to an optofluidic lab-on-a-chip. During electrophoretic separation, the ultra-low limit of detection achieved with our set-up allows us to record fluorescence from covalently end-labeled DNA molecules. Different sets of exclusively color-labeled DNA fragments-otherwise rendered indistinguishable by spatio-temporal coincidence-are traced back to their origin by modulation-frequency-encoded multi-wavelength laser excitation, fluorescence detection with a single ultrasensitive, albeit color-blind photomultiplier, and Fourier analysis decoding. As a proof of principle, fragments obtained by multiplex ligation-dependent probe amplification from independent human genomic segments, associated with genetic predispositions to breast cancer and anemia, are simultaneously analyzed.

  1. Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

    PubMed

    Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

    2017-01-01

    A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

  2. A versatile quantitation platform based on platinum nanoparticles incorporated volumetric bar-chart chip for highly sensitive assays.

    PubMed

    Wang, Yuzhen; Zhu, Guixian; Qi, Wenjin; Li, Ying; Song, Yujun

    2016-11-15

    Platinum nanoparticles incorporated volumetric bar-chart chip (PtNPs-V-Chip) is able to be used for point-of-care tests by providing quantitative and visualized readout without any assistance from instruments, data processing, or graphic plotting. To improve the sensitivity of PtNPs-V-Chip, hybridization chain reaction was employed in this quantitation platform for highly sensitive assays that can detect as low as 16 pM Ebola Virus DNA, 0.01ng/mL carcinoembryonic antigen (CEA), and the 10 HER2-expressing cancer cells. Based on this amplified strategy, a 100-fold decrease of detection limit was achieved for DNA by improving the number of platinum nanoparticle catalyst for the captured analyte. This quantitation platform can also distinguish single base mismatch of DNA hybridization and observe the concentration threshold of CEA. The new strategy lays the foundation for this quantitation platform to be applied in forensic analysis, biothreat detection, clinical diagnostics and drug screening. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. ChIP-re-ChIP: Co-occupancy Analysis by Sequential Chromatin Immunoprecipitation.

    PubMed

    Beischlag, Timothy V; Prefontaine, Gratien G; Hankinson, Oliver

    2018-01-01

    Chromatin immunoprecipitation (ChIP) exploits the specific interactions between DNA and DNA-associated proteins. It can be used to examine a wide range of experimental parameters. A number of proteins bound at the same genomic location can identify a multi-protein chromatin complex where several proteins work together to regulate gene transcription or chromatin configuration. In many instances, this can be achieved using sequential ChIP; or simply, ChIP-re-ChIP. Whether it is for the examination of specific transcriptional or epigenetic regulators, or for the identification of cistromes, the ability to perform a sequential ChIP adds a higher level of power and definition to these analyses. In this chapter, we describe a simple and reliable method for the sequential ChIP assay.

  4. Droplet-based micro oscillating-flow PCR chip

    NASA Astrophysics Data System (ADS)

    Wang, Wei; Li, Zhi-Xin; Luo, Rong; Lü, Shu-Hai; Xu, Ai-Dong; Yang, Yong-Jun

    2005-08-01

    Polymerase chain reactions (PCR), thermally activated chemical reactions which are widely used for nucleic acid amplification, have recently received much attention in microelectromechanical systems and micro total analysis systems because a wide variety of DNA/RNA molecules can be enriched by PCR for further analyses. In the present work, a droplet-based micro oscillating-flow PCR chip was designed and fabricated by the silicon microfabrication technique. Three different temperature zones, which were stable at denaturation, extension and annealing temperatures and isolated from each other by a thin-wall linkage, were integrated with a single, simple and straight microchannel to form the chip's basic functional structure. The PCR mixture was injected into the chip as a single droplet and flowed through the three temperature zones in the main microchannel in an oscillating manner to achieve the temperature maintenance and transitions. The chip's thermal performance was theoretically analyzed and numerically simulated. The results indicated that the time needed for the temperature of the droplet to change to the target value is less than 1 s, and the root mean square error of temperature is less than 0.2 °C. A droplet of 1 µl PCR mixture with standard HPV (Human Papilloma Virus)-DNA sample inside was amplified by the present chip and the results were analyzed by slab gel electrophoresis with separation of DNA markers in parallel. The electrophoresis results demonstrated that the micro oscillating-flow PCR chip successfully amplified the HPV-DNA, with a processing time of about 15 min which is significantly reduced compared to that for the conventional PCR instrument.

  5. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    PubMed

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  6. Plasmonic SERS nanochips and nanoprobes for medical diagnostics and bio-energy applications

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Wang, Hsin-Neng; Crawford, Bridget M.; Fales, Andrew M.; Vo-Dinh, Tuan

    2017-02-01

    The development of rapid, easy-to-use, cost-effective, high accuracy, and high sensitive DNA detection methods for molecular diagnostics has been receiving increasing interest. Over the last five years, our laboratory has developed several chip-based DNA detection techniques including the molecular sentinel-on-chip (MSC), the multiplex MSC, and the inverse molecular sentinel-on-chip (iMS-on-Chip). In these techniques, plasmonic surface-enhanced Raman scattering (SERS) Nanowave chips were functionalized with DNA probes for single-step DNA detection. Sensing mechanisms were based on hybridization of target sequences and DNA probes, resulting in a distance change between SERS reporters and the Nanowave chip's gold surface. This distance change resulted in change in SERS intensity, thus indicating the presence and capture of the target sequences. Our techniques were single-step DNA detection techniques. Target sequences were detected by simple delivery of sample solutions onto DNA probe-functionalized Nanowave chips and SERS signals were measured after 1h - 2h incubation. Target sequence labeling or washing to remove unreacted components was not required, making the techniques simple, easy-to-use, and cost effective. The usefulness of the techniques for medical diagnostics was illustrated by the detection of genetic biomarkers for respiratory viral infection and of dengue virus 4 DNA.

  7. The GenoChip: A New Tool for Genetic Anthropology

    PubMed Central

    Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G.; Greenspan, Bennett; Spencer Wells, R.

    2013-01-01

    The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project’s new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics. PMID:23666864

  8. The GenoChip: a new tool for genetic anthropology.

    PubMed

    Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G; Greenspan, Bennett; Spencer Wells, R

    2013-01-01

    The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project's new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics.

  9. Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

    NASA Astrophysics Data System (ADS)

    Aravindran, S.; Sahilah, A. M.; Aminah, A.

    2014-09-01

    Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

  10. A multilevel Lab on chip platform for DNA analysis.

    PubMed

    Marasso, Simone Luigi; Giuri, Eros; Canavese, Giancarlo; Castagna, Riccardo; Quaglio, Marzia; Ferrante, Ivan; Perrone, Denis; Cocuzza, Matteo

    2011-02-01

    Lab-on-chips (LOCs) are critical systems that have been introduced to speed up and reduce the cost of traditional, laborious and extensive analyses in biological and biomedical fields. These ambitious and challenging issues ask for multi-disciplinary competences that range from engineering to biology. Starting from the aim to integrate microarray technology and microfluidic devices, a complex multilevel analysis platform has been designed, fabricated and tested (All rights reserved-IT Patent number TO2009A000915). This LOC successfully manages to interface microfluidic channels with standard DNA microarray glass slides, in order to implement a complete biological protocol. Typical Micro Electro Mechanical Systems (MEMS) materials and process technologies were employed. A silicon/glass microfluidic chip and a Polydimethylsiloxane (PDMS) reaction chamber were fabricated and interfaced with a standard microarray glass slide. In order to have a high disposable system all micro-elements were passive and an external apparatus provided fluidic driving and thermal control. The major microfluidic and handling problems were investigated and innovative solutions were found. Finally, an entirely automated DNA hybridization protocol was successfully tested with a significant reduction in analysis time and reagent consumption with respect to a conventional protocol.

  11. Digital PCR on a SlipChip.

    PubMed

    Shen, Feng; Du, Wenbin; Kreutz, Jason E; Fok, Alice; Ismagilov, Rustem F

    2010-10-21

    This paper describes a SlipChip to perform digital PCR in a very simple and inexpensive format. The fluidic path for introducing the sample combined with the PCR mixture was formed using elongated wells in the two plates of the SlipChip designed to overlap during sample loading. This fluidic path was broken up by simple slipping of the two plates that removed the overlap among wells and brought each well in contact with a reservoir preloaded with oil to generate 1280 reaction compartments (2.6 nL each) simultaneously. After thermal cycling, end-point fluorescence intensity was used to detect the presence of nucleic acid. Digital PCR on the SlipChip was tested quantitatively by using Staphylococcus aureus genomic DNA. As the concentration of the template DNA in the reaction mixture was diluted, the fraction of positive wells decreased as expected from the statistical analysis. No cross-contamination was observed during the experiments. At the extremes of the dynamic range of digital PCR the standard confidence interval determined using a normal approximation of the binomial distribution is not satisfactory. Therefore, statistical analysis based on the score method was used to establish these confidence intervals. The SlipChip provides a simple strategy to count nucleic acids by using PCR. It may find applications in research applications such as single cell analysis, prenatal diagnostics, and point-of-care diagnostics. SlipChip would become valuable for diagnostics, including applications in resource-limited areas after integration with isothermal nucleic acid amplification technologies and visual readout.

  12. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

    PubMed

    Raghav, Sunil Kumar; Deplancke, Bart

    2012-01-01

    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  13. Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

    PubMed

    Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

    2009-03-15

    Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

  14. The Optimization of Electrophoresis on a Glass Microfluidic Chip and its Application in Forensic Science.

    PubMed

    Han, Jun P; Sun, Jing; Wang, Le; Liu, Peng; Zhuang, Bin; Zhao, Lei; Liu, Yao; Li, Cai X

    2017-11-01

    Microfluidic chips offer significant speed, cost, and sensitivity advantages, but numerous parameters must be optimized to provide microchip electrophoresis detection. Experiments were conducted to study the factors, including sieving matrices (the concentration and type), surface modification, analysis temperature, and electric field strengths, which all impact the effectiveness of microchip electrophoresis detection of DNA samples. Our results showed that the best resolution for ssDNA was observed using 4.5% w/v (7 M urea) lab-fabricated LPA gel, dynamic wall coating of the microchannel, electrophoresis temperatures between 55 and 60°C, and electrical fields between 350 and 450 V/cm on the microchip-based capillary electrophoresis (μCE) system. One base-pair resolution could be achieved in the 19-cm-length microchannel. Furthermore, both 9947A standard genomic DNA and DNA extracted from blood spots were demonstrated to be successfully separated with well-resolved DNA peaks in 8 min. Therefore, the microchip electrophoresis system demonstrated good potential for rapid forensic DNA analysis. © 2017 American Academy of Forensic Sciences.

  15. Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale.

    PubMed

    Buhule, Olive D; Minster, Ryan L; Hawley, Nicola L; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T; Weeks, Daniel E

    2014-01-01

    Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After "removing" batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects.

  16. Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale

    PubMed Central

    Buhule, Olive D.; Minster, Ryan L.; Hawley, Nicola L.; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T.; Weeks, Daniel E.

    2014-01-01

    Background: Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Methods: Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Results: Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After “removing” batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Conclusion: Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects. PMID:25352862

  17. Gene Therapy for Fracture Repair

    DTIC Science & Technology

    2007-05-01

    Methods: We have adopted the Agilent rat oligomer chip to analyze our fracture RNA in our microarray analysis. This chip has 20,046 unique gene...signal during fluorescent labeling of the cDNA. This approach is highly advantageous for reducing the RNA input into the system, minimizing the numbers...perform the analysis on these extremely limited samples without pooling the RNA from multiple individuals. We are therefore able to analyze the

  18. Transcriptome Analysis of Lactococcus lactis in Coculture with Saccharomyces cerevisiae▿

    PubMed Central

    Maligoy, Mathieu; Mercade, Myriam; Cocaign-Bousquet, Muriel; Loubiere, Pascal

    2008-01-01

    The study of microbial interactions in mixed cultures remains an important conceptual and methodological challenge for which transcriptome analysis could prove to be the essential method for improving our understanding. However, the use of whole-genome DNA chips is often restricted to the pure culture of the species for which the chips were designed. In this study, massive cross-hybridization was observed between the foreign cDNA and the specific Lactococcus lactis DNA chip. A very simple method is proposed to considerably decrease this nonspecific hybridization, consisting of adding the microbial partner's DNA. A correlation was established between the resulting cross-hybridization and the phylogenetic distance between the microbial partners. The response of L. lactis to the presence of Saccharomyces cerevisiae was analyzed during the exponential growth phase in fermentors under defined growth conditions. Although no differences between growth kinetics were observed for the pure and the mixed cultures of L. lactis, the mRNA levels of 158 genes were significantly modified. More particularly, a strong reorientation of pyrimidine metabolism was observed when L. lactis was grown in mixed cultures. These changes in transcript abundance were demonstrated to be regulated by the ethanol produced by the yeast and were confirmed by an independent method (quantitative reverse transcription-PCR). PMID:17993564

  19. Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

    PubMed

    Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

    2009-11-01

    Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

  20. Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

    PubMed

    Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

    2006-09-05

    A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

  1. [The joint applications of DNA chips and single nucleotide polymorphisms in forensic science].

    PubMed

    Bai, Peng; Tian, Li; Zhou, Xue-ping

    2005-05-01

    DNA chip technology, being a new high-technology, shows its vigorous life and rapid growth. Single Nucleotide Polymorphisms (SNPs) is the most common diversity in the human genome. It provides suitable genetic markers which play a key role in disease linkage study, pharmacogenomics, forensic medicine, population evolution and immigration study. Their advantage such as being analyzed with DNA chips technology, is predicted to play an important role in the field of forensic medicine, especially in paternity test and individual identification. This report mainly reviews the characteristics of DNA chip and SNPs, and their joint applications in the practice of forensic medicine.

  2. A lab-on-chip for biothreat detection using single-molecule DNA mapping.

    PubMed

    Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

    2011-03-07

    Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

  3. Detection of M. tuberculosis using DNA chips combined with an image analysis system.

    PubMed

    Huang, T-S; Liu, Y-C; Bair, C-H; Sy, C-L; Chen, Y-S; Tu, H-Z; Chen, B-C

    2008-01-01

    To develop a packaged DNA chip assay (the DR. MTBC Screen assay) for direct detection of the Mycobacterium tuberculosis complex. We described a DNA chip assay based on the IS6110 gene that can be used for the detection of M. tuberculosis complex. Probes were spotted onto the polystyrene strips in the wells of 96-well microtitre plates and used for hybridisation with biotin-labelled amplicon to yield a pattern of visualised positive spots. The plate image was scanned, analysed and interpreted automatically. The results corresponded well with those obtained by conventional culture as well as clinical diagnosis, with sensitivity and specificity rates of respectively 83.8% and 94.2%, and 84.6% and 96.3%. We conclude that the DR. MTBC Screen assay can detect M. tuberculosis complex rapidly in respiratory specimens, readily adapts to routine work and provides a flexible choice to meet different cost-effectiveness and automation needs in TB-endemic countries. The cost for reagents is around US$10 per sample.

  4. Justification of rapid prototyping in the development cycle of thermoplastic-based lab-on-a-chip.

    PubMed

    Preywisch, Regina; Ritzi-Lehnert, Marion; Drese, Klaus S; Röser, Tina

    2011-11-01

    During the developmental cycle of lab-on-a-chip devices, various microstructuring techniques are required. While in the designing and assay implementation phase direct structuring or so-called rapid-prototyping methods such as milling or laser ablation are applied, replication methods like hot embossing or injection moulding are favourable for large quantity manufacturing. This work investigated the applicability of rapid-prototyping techniques for thermoplastic chip development in general, and the reproducibility of performances in dependency of the structuring technique. A previously published chip for prenatal diagnosis that preconcentrates DNA via electrokinetic trapping and field-amplified-sample-stacking and afterwards separates it in CGE was chosen as a model. The impact of structuring, sealing, and the integration of membranes on the mobility of the EOF, DNA preconcentration, and DNA separation was studied. Structuring methods were found to significantly change the location where preconcentration of DNA occurs. However, effects on the mobility of the EOF and the separation quality of DNA were not observed. Exchange of the membrane has no effect on the chip performance, whereas the sealing method impairs the separation of DNA within the chip. The overall assay performance is not significantly influenced by different structuring methods; thus, the application of rapid-prototyping methods during a chip development cycle is well justified. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Purification of nanogram-range immunoprecipitated DNA in ChIP-seq application.

    PubMed

    Zhong, Jian; Ye, Zhenqing; Lenz, Samuel W; Clark, Chad R; Bharucha, Adil; Farrugia, Gianrico; Robertson, Keith D; Zhang, Zhiguo; Ordog, Tamas; Lee, Jeong-Heon

    2017-12-21

    Chromatin immunoprecipitation-sequencing (ChIP-seq) is a widely used epigenetic approach for investigating genome-wide protein-DNA interactions in cells and tissues. The approach has been relatively well established but several key steps still require further improvement. As a part of the procedure, immnoprecipitated DNA must undergo purification and library preparation for subsequent high-throughput sequencing. Current ChIP protocols typically yield nanogram quantities of immunoprecipitated DNA mainly depending on the target of interest and starting chromatin input amount. However, little information exists on the performance of reagents used for the purification of such minute amounts of immunoprecipitated DNA in ChIP elution buffer and their effects on ChIP-seq data. Here, we compared DNA recovery, library preparation efficiency, and ChIP-seq results obtained with several commercial DNA purification reagents applied to 1 ng ChIP DNA and also investigated the impact of conditions under which ChIP DNA is stored. We compared DNA recovery of ten commercial DNA purification reagents and phenol/chloroform extraction from 1 to 50 ng of immunopreciptated DNA in ChIP elution buffer. The recovery yield was significantly different with 1 ng of DNA while similar in higher DNA amounts. We also observed that the low nanogram range of purified DNA is prone to loss during storage depending on the type of polypropylene tube used. The immunoprecipitated DNA equivalent to 1 ng of purified DNA was subject to DNA purification and library preparation to evaluate the performance of four better performing purification reagents in ChIP-seq applications. Quantification of library DNAs indicated the selected purification kits have a negligible impact on the efficiency of library preparation. The resulting ChIP-seq data were comparable with the dataset generated by ENCODE consortium and were highly correlated between the data from different purification reagents. This study provides comparative data on commercial DNA purification reagents applied to nanogram-range immunopreciptated ChIP DNA and evidence for the importance of storage conditions of low nanogram-range purified DNA. We verified consistent high performance of a subset of the tested reagents. These results will facilitate the improvement of ChIP-seq methodology for low-input applications.

  6. Robust Bioinformatics Recognition with VLSI Biochip Microsystem

    NASA Technical Reports Server (NTRS)

    Lue, Jaw-Chyng L.; Fang, Wai-Chi

    2006-01-01

    A microsystem architecture for real-time, on-site, robust bioinformatic patterns recognition and analysis has been proposed. This system is compatible with on-chip DNA analysis means such as polymerase chain reaction (PCR)amplification. A corresponding novel artificial neural network (ANN) learning algorithm using new sigmoid-logarithmic transfer function based on error backpropagation (EBP) algorithm is invented. Our results show the trained new ANN can recognize low fluorescence patterns better than the conventional sigmoidal ANN does. A differential logarithmic imaging chip is designed for calculating logarithm of relative intensities of fluorescence signals. The single-rail logarithmic circuit and a prototype ANN chip are designed, fabricated and characterized.

  7. Analysis of DNA-chip and antigen-chip data: studies of cancer, stem cells and autoimmune diseases

    NASA Astrophysics Data System (ADS)

    Domany, Eytan

    2005-07-01

    Biology has undergone a revolution during the past decade. Deciphering the human genome has opened new horizons, among which the advent of DNA microarrays has been perhaps the most significant. These miniature measuring devices report the levels at which tens of thousands of genes are expressed in a collection of cells of interest (such as tissue from a tumor). I describe here briefly this technology and present an example of how analysis of data obtained from such high throughput experiments provides insights of possible clinical and therapeutic relevance for Acute Lymphoblastic Leukemia. Next, I describe how gene expression data is used to deduce a new design principle, " Just In Case", used by stem cells. Finally I briefly review a different novel technology, of antigen chips, which provide a fingerprint of a subject's immune system and may become a predictive clinical tool. The work reviewed here was done in collaboration with numerous colleagues and students.

  8. Isotachophoresis for fractionation and recovery of cytoplasmic RNA and nucleus from single cells.

    PubMed

    Kuriyama, Kentaro; Shintaku, Hirofumi; Santiago, Juan G

    2015-07-01

    There is a substantial need for simultaneous analyses of RNA and DNA from individual single cells. Such analysis provides unique evidence of cell-to-cell differences and the correlation between gene expression and genomic mutation in highly heterogeneous cell populations. We present a novel microfluidic system that leverages isotachophoresis to fractionate and isolate cytoplasmic RNA and genomic DNA (gDNA) from single cells. The system uniquely enables independent, sequence-specific analyses of these critical markers. Our system uses a microfluidic chip with a simple geometry and four end-channel electrodes, and completes the entire process in <5 min, including lysis, purification, fractionation, and delivery to DNA and RNA output reservoirs, each containing high quality and purity aliquots with no measurable cross-contamination of cytoplasmic RNA versus gDNA. We demonstrate our system with simultaneous, sequence-specific quantitation using off-chip RT-qPCR and qPCR for simultaneous cytoplasmic RNA and gDNA analyses, respectively. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. Development of an Automated DNA Detection System Using an Electrochemical DNA Chip Technology

    NASA Astrophysics Data System (ADS)

    Hongo, Sadato; Okada, Jun; Hashimoto, Koji; Tsuji, Koichi; Nikaido, Masaru; Gemma, Nobuhiro

    A new compact automated DNA detection system Genelyzer™ has been developed. After injecting a sample solution into a cassette with a built-in electrochemical DNA chip, processes from hybridization reaction to detection and analysis are all operated fully automatically. In order to detect a sample DNA, electrical currents from electrodes due to an oxidization reaction of electrochemically active intercalator molecules bound to hybridized DNAs are detected. The intercalator is supplied as a reagent solution by a fluid supply unit of the system. The feasibility test proved that the simultaneous typing of six single nucleotide polymorphisms (SNPs) associated with a rheumatoid arthritis (RA) was carried out within two hours and that all the results were consistent with those by conventional typing methods. It is expected that this system opens a new way to a DNA testing such as a test for infectious diseases, a personalized medicine, a food inspection, a forensic application and any other applications.

  10. Plasma micro-nanotextured polymeric micromixer for DNA purification with high efficiency and dynamic range.

    PubMed

    Kastania, Athina S; Tsougeni, Katerina; Papadakis, George; Gizeli, Electra; Kokkoris, George; Tserepi, Angeliki; Gogolides, Evangelos

    2016-10-26

    We present a polymeric microfluidic chip capable of purifying DNA through solid phase extraction. It is designed to be used as a module of an integrated Lab-on-chip platform for pathogen detection, but it can also be used as a stand-alone device. The microfluidic channels are oxygen plasma micro-nanotextured, i.e. randomly roughened in the micro-nano scale, a process creating high surface area as well as high density of carboxyl groups (COOH). The COOH groups together with a buffer that contains polyethylene glycol (PEG), NaCl and ethanol are able to bind DNA on the microchannel surface. The chip design incorporates a mixer so that sample and buffer can be efficiently mixed on chip under continuous flow. DNA is subsequently eluted in water. The chip is able to isolate DNA with high recovery efficiency (96± 11%) in an extremely large dynamic range of prepurified Salmonella DNA as well as from Salmonella cell lysates that correspond to a range of 5 to 1.9 × 10 8  cells (0.263 fg to 2 × 500 ng). The chip was evaluated via absorbance measurements, polymerase chain reaction (PCR), and gel electrophoresis. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Microarrays Made Simple: "DNA Chips" Paper Activity

    ERIC Educational Resources Information Center

    Barnard, Betsy

    2006-01-01

    DNA microarray technology is revolutionizing biological science. DNA microarrays (also called DNA chips) allow simultaneous screening of many genes for changes in expression between different cells. Now researchers can obtain information about genes in days or weeks that used to take months or years. The paper activity described in this article…

  12. Helicase dependent OnChip-amplification and its use in multiplex pathogen detection.

    PubMed

    Andresen, Dennie; von Nickisch-Rosenegk, Markus; Bier, Frank F

    2009-05-01

    The need for fast, specific and sensitive multiparametric detection methods is an ever growing demand in molecular diagnostics. Here we report on a newly developed method, the helicase dependent OnChip amplification (OnChip-HDA). This approach integrates the analysis and detection in one single reaction thus leading to time and cost savings in multiparametric analysis. HDA is an isothermal amplification method that is not depending on thermocycling as known from PCR due to the helicases' ability to unwind DNA double-strands. We have combined the HDA with microarray based detection, making it suitable for multiplex detection. As an example we used the OnChip HDA in single and multiplex amplifications for the detection of the two pathogens N. gonorrhoeae and S. aureus directly on surface bound primers. We have successfully shown the OnChip-HDA and applied it for single- and duplex-detection of the pathogens N. gonorrhoeae and S. aureus. We have developed a new method, the OnChip-HDA for the multiplex detection of pathogens. Its simplicity in reaction setup and potential for miniaturization and multiparametric analysis is advantageous for the integration in miniaturized Lab on Chip systems, e.g. needed in point of care diagnostics.

  13. FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota

    PubMed Central

    Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R.; Peyret, Pierre; Forano, Evelyne

    2018-01-01

    Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen. PMID:29487591

  14. FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota.

    PubMed

    Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R; Peyret, Pierre; Forano, Evelyne

    2018-01-01

    Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen.

  15. DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

    PubMed

    Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

    2017-11-01

    This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

  16. Stability of the cancer target DDIAS is regulated by the CHIP/HSP70 pathway in lung cancer cells

    PubMed Central

    Won, Kyoung-Jae; Im, Joo-Young; Kim, Bo-Kyung; Ban, Hyun Seung; Jung, Young-Jin; Jung, Kyeong Eun; Won, Misun

    2017-01-01

    DNA damage-induced apoptosis suppressor (DDIAS) rescues lung cancer cells from apoptosis in response to DNA damage. DDIAS is transcriptionally activated by NFATc1 and EGF-mediated ERK5/MEF2B, leading to cisplatin resistance and cell invasion. Therefore, DDIAS is suggested as a therapeutic target for lung cancer. Here, we report that DDIAS stability is regulated by E3 U-box ubiquitin ligase carboxyl terminus of HSP70-interacting protein (CHIP)-mediated proteasomal degradation. We first isolated CHIP as an interacting partner of DDIAS by yeast two-hybrid screening. CHIP physically associated with both the N- and C-terminal regions of DDIAS, targeting it for proteasomal degradation and reducing the DDIAS half-life. CHIP overexpression analyses indicated that the tetratrico peptide repeat (TPR) domain and the U-box are required for DDIAS ubiquitination. It is likely that HSP70-bound DDIAS is recruited to the CHIP E3 ligase via the TPR domain, suggesting DDIAS as a client protein of HSP70. In addition, CHIP overexpression in lung cancer cells expressing high DDIAS levels induced significant growth inhibition by enhancing DDIAS degradation. Furthermore, simultaneous CHIP overexpression and DNA damage agent treatment caused a substantial increase in the apoptosis of lung cancer cells. Taken together, these findings indicate that the stability of the DDIAS protein is regulated by CHIP/HSP70-mediated proteasomal degradation and that CHIP overexpression stimulates the apoptosis of lung cancer cells in response to DNA-damaging agents. PMID:28079882

  17. Stability of the cancer target DDIAS is regulated by the CHIP/HSP70 pathway in lung cancer cells.

    PubMed

    Won, Kyoung-Jae; Im, Joo-Young; Kim, Bo-Kyung; Ban, Hyun Seung; Jung, Young-Jin; Jung, Kyeong Eun; Won, Misun

    2017-01-12

    DNA damage-induced apoptosis suppressor (DDIAS) rescues lung cancer cells from apoptosis in response to DNA damage. DDIAS is transcriptionally activated by NFATc1 and EGF-mediated ERK5/MEF2B, leading to cisplatin resistance and cell invasion. Therefore, DDIAS is suggested as a therapeutic target for lung cancer. Here, we report that DDIAS stability is regulated by E3 U-box ubiquitin ligase carboxyl terminus of HSP70-interacting protein (CHIP)-mediated proteasomal degradation. We first isolated CHIP as an interacting partner of DDIAS by yeast two-hybrid screening. CHIP physically associated with both the N- and C-terminal regions of DDIAS, targeting it for proteasomal degradation and reducing the DDIAS half-life. CHIP overexpression analyses indicated that the tetratrico peptide repeat (TPR) domain and the U-box are required for DDIAS ubiquitination. It is likely that HSP70-bound DDIAS is recruited to the CHIP E3 ligase via the TPR domain, suggesting DDIAS as a client protein of HSP70. In addition, CHIP overexpression in lung cancer cells expressing high DDIAS levels induced significant growth inhibition by enhancing DDIAS degradation. Furthermore, simultaneous CHIP overexpression and DNA damage agent treatment caused a substantial increase in the apoptosis of lung cancer cells. Taken together, these findings indicate that the stability of the DDIAS protein is regulated by CHIP/HSP70-mediated proteasomal degradation and that CHIP overexpression stimulates the apoptosis of lung cancer cells in response to DNA-damaging agents.

  18. Pulsatile plasma filtration and cell-free DNA amplification using a water-head-driven point-of-care testing chip.

    PubMed

    Lee, Yonghun; Kim, Dong-Min; Li, Zhenglin; Kim, Dong-Eun; Kim, Sung-Jin

    2018-03-13

    We demonstrate a microfiltration chip that separates blood plasma by using water-head-driven pulsatile pressures rather than any external equipment and use it for on-chip amplification of nucleic acids. The chip generates pulsatile pressures to significantly reduce filter clogging without hemolysis, and consists of an oscillator, a plasma-extraction pump, and filter units. The oscillator autonomously converts constant water-head pressure to pulsatile pressure, and the pump uses the pulsatile pressure to extract plasma through the filter. Because the pulsatile pressure can periodically clear blood cells from the filter surface, filter clogging can be effectively reduced. In this way, we achieve plasma extraction with 100% purity and 90% plasma recovery at 15% hematocrit. During a 10 min period, the volume of plasma extracted was 43 μL out of a 243 μL extraction volume at 15% hematocrit. We also studied the influence of the pore size and diameter of the filter, blood loading volume, oscillation period, and hematocrit level on the filtration performance. To demonstrate the utility of our chip for point-of-care testing (POCT) applications, we successfully implemented on-chip amplification of a nucleic acid (miDNA21) in plasma filtered from blood. We expect our chip to be useful not only for POCT applications but also for other bench-top analysis tools using blood plasma.

  19. Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

    PubMed

    Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

    2011-06-01

    This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

  20. Digital quantification of DNA via isothermal amplification on a self-driven microfluidic chip featuring hydrophilic film-coated polydimethylsiloxane.

    PubMed

    Ma, Yu-Dong; Chang, Wen-Hsin; Luo, Kang; Wang, Chih-Hung; Liu, Shih-Yuan; Yen, Wen-Hsiang; Lee, Gwo-Bin

    2018-01-15

    Loop-mediated isothermal amplification (LAMP) is a DNA amplification approach characterized by high sensitivity and specificity. In "digital LAMP", small quantities of both template DNA and reagents are encapsulated within a droplet or microwell, allowing for analysis of precious nucleic acid samples in shorter amounts of time relative to traditional DNA amplification protocols (e.g., PCR) with an improved limit of detection. In this study, an integrated, self-driven microfluidic chip was designed to carry out digital LAMP. The entire quantification process could be automatically performed on this chip via capillary forces enabled through microwells comprised of polydimethylsiloxane (PDMS) surfaces coated with a hydrophilic film; no external pumps were required. Moreover, digitized droplets could be separated from each other by normally-closed microvalves. The contact angle of the hydrophilic film-coated PDMS surface was only 14.3°. This is the first time that a rapid (30min) and simple method has been used to create hydrophilic PDMS surfaces that allow for digital LAMP to be performed in a self-driven microfluidic device. As a proof of concept, amplification of a gene specific to a vancomycin-resistant Enterococcus strain was performed on the developed microfluidic chip within 30min, and the limit of detection was only 11 copies with a volume of 30μL. This device may therefore become a promising tool for clinical diagnosis and point-of-care applications. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Andersen, G.L.; He, Z.; DeSantis, T.Z.

    Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

  2. Standardization of Spore Inactivation Method for PMA-PhyloChip Analysis

    NASA Technical Reports Server (NTRS)

    Schrader, Michael

    2011-01-01

    In compliance with the Committee on Space Research (COSPAR) planetary protection policy, National Aeronautics and Space Administration (NASA) monitors the total microbial burden of spacecraft as a means for minimizing the inadvertent transfer of viable contaminant microorganisms to extraterrestrial environments (forward contamination). NASA standard assay-based counts are used both as a proxy for relative surface cleanliness and to estimate overall microbial burden as well as to assess whether forward planetary protection risk criteria are met for a given mission, which vary by the planetary body to be explored and whether or not life detection missions are present. Despite efforts to reduce presence of microorganisms from spacecraft prior to launch, microbes have been isolated from spacecraft and associated surfaces within the extreme conditions of clean room facilities using state of the art molecular technologies. Development of a more sensitive method that will better enumerate all viable microorganisms from spacecraft and associated surfaces could support future life detection missions. Current culture-based (NASA standard spore assay) and nucleic-acid-based polymerase chain reaction (PCR) methods have significant shortcomings in this type of analysis. The overall goal of this project is to evaluate and validate a new molecular method based on the use of a deoxyribonucleic acid (DNA) intercalating agent propidium monoazide (PMA). This is used in combination with DNA microarray (PhyloChip) which has been shown to identify very low levels of organisms on spacecraft associated surfaces. PMA can only penetrate the membrane of dead cells. Once penetrated, it intercalates the DNA and, upon photolysis using visible light it produces stable DNA monoadducts. This allows DNA to be unavailable for further PCR analysis. The specific aim of this study is to standardize the spore inactivation method for PMA-PhyloChip analysis. We have used the bacterial spores Bacillus subtilis 168 (standard laboratory isolate) as a test organism.

  3. Application of the CometChip platform to assess DNA damage in field-collected blood samples from turtles.

    PubMed

    Sykora, Peter; Chiari, Ylenia; Heaton, Andrew; Moreno, Nickolas; Glaberman, Scott; Sobol, Robert W

    2018-05-01

    DNA damage has been linked to genomic instability and the progressive breakdown of cellular and organismal homeostasis, leading to the onset of disease and reduced longevity. Insults to DNA from endogenous sources include base deamination, base hydrolysis, base alkylation, and metabolism-induced oxidative damage that can lead to single-strand and double-strand DNA breaks. Alternatively, exposure to environmental pollutants, radiation or ultra-violet light, can also contribute to exogenously derived DNA damage. We previously validated a novel, high through-put approach to measure levels of DNA damage in cultured mammalian cells. This new CometChip Platform builds on the classical single cell gel electrophoresis or comet methodology used extensively in environmental toxicology and molecular biology. We asked whether the CometChip Platform could be used to measure DNA damage in samples derived from environmental field studies. To this end, we determined that nucleated erythrocytes from multiple species of turtle could be successfully evaluated in the CometChip Platform to quantify levels of DNA damage. In total, we compared levels of DNA damage in 40 animals from two species: the box turtle (Terrapene carolina) and the red-eared slider (Trachemys scripta elegans). Endogenous levels of DNA damage were identical between the two species, yet we did discover some sex-linked differences and changes in DNA damage accumulation. Based on these results, we confirm that the CometChip Platform allows for the measurement of DNA damage in a large number of samples quickly and accurately, and is particularly adaptable to environmental studies using field-collected samples. Environ. Mol. Mutagen. 59:322-333, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

  4. High-performance genetic analysis on microfabricated capillary array electrophoresis plastic chips fabricated by injection molding.

    PubMed

    Dang, Fuquan; Tabata, Osamu; Kurokawa, Masaya; Ewis, Ashraf A; Zhang, Lihua; Yamaoka, Yoshihisa; Shinohara, Shouji; Shinohara, Yasuo; Ishikawa, Mitsuru; Baba, Yoshinobu

    2005-04-01

    We have developed a novel technique for mass production of microfabricated capillary array electrophoresis (mu-CAE) plastic chips for high-speed, high-throughput genetic analysis. The mu-CAE chips, containing 10 individual separation channels of 50-microm width, 50-microm depth, and a 100-microm lane-to-lane spacing at the detection region and a sacrificial channel network, were fabricated on a poly(methyl methacrylate) substrate by injection molding and then bonded manually using a pressure-sensitive sealing tape within several seconds at room temperature. The conditions for injection molding and bonding were carefully characterized to yield mu-CAE chips with well-defined channel and injection structures. A CCD camera equipped with an image intensifier was used to monitor simultaneously the separation in a 10-channel array with laser-induced fluorescence detection. High-performance electrophoretic separations of phiX174 HaeIII DNA restriction fragments and PCR products related to the human beta-globin gene and SP-B gene (the surfactant protein B) have been demonstrated on mu-CAE plastic chips using a methylcellulose sieving matrix in individual channels. The current work demonstrated greatly simplified the fabrication process as well as a detection scheme for mu-CAE chips and will bring the low-cost mass production and application of mu-CAE plastic chips for genetic analysis.

  5. Droplet-Based Segregation and Extraction of Concentrated Samples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buie, C R; Buckley, P; Hamilton, J

    2007-02-23

    Microfluidic analysis often requires sample concentration and separation techniques to isolate and detect analytes of interest. Complex or scarce samples may also require an orthogonal separation and detection method or off-chip analysis to confirm results. To perform these additional steps, the concentrated sample plug must be extracted from the primary microfluidic channel with minimal sample loss and dilution. We investigated two extraction techniques; injection of immiscible fluid droplets into the sample stream (''capping'''') and injection of the sample into an immiscible fluid stream (''extraction''). From our results we conclude that capping is the more effective partitioning technique. Furthermore, this functionalitymore » enables additional off-chip post-processing procedures such as DNA/RNA microarray analysis, realtime polymerase chain reaction (RT-PCR), and culture growth to validate chip performance.« less

  6. Epigenome analysis of pluripotent stem cells

    PubMed Central

    Ricupero, Christopher L.; Swerdel, Mavis R.; Hart, Ronald P.

    2015-01-01

    Summary Mis-regulation of gene expression due to epigenetic abnormalities has been linked with complex genetic disorders, psychiatric illness and cancer. In addition, the dynamic epigenetic changes that occur in pluripotent stem cells are believed to impact regulatory networks essential for proper lineage development. Chromatin immunoprecipitation (ChIP) is a technique used to isolate and enrich chromatin fragments using antibodies against specific chromatin modifications, such as DNA binding proteins or covalent histone modifications. Until recently, many ChIP protocols required millions of cells for each immunoprecipitation. This severely limited analysis of rare cell populations or post-mitotic, differentiated cell lines. Here, we describe a low cell number ChIP protocol with next generation sequencing and analysis, that has the potential to uncover novel epigenetic regulatory pathways that were previously difficult or impossible to obtain. PMID:23546758

  7. Fully Integrated Microfluidic Device for Direct Sample-to-Answer Genetic Analysis

    NASA Astrophysics Data System (ADS)

    Liu, Robin H.; Grodzinski, Piotr

    Integration of microfluidics technology with DNA microarrays enables building complete sample-to-answer systems that are useful in many applications such as clinic diagnostics. In this chapter, a fully integrated microfluidic device [1] that consists of microfluidic mixers, valves, pumps, channels, chambers, heaters, and a DNA microarray sensor to perform DNA analysis of complex biological sample solutions is present. This device can perform on-chip sample preparation (including magnetic bead-based cell capture, cell preconcentration and purification, and cell lysis) of complex biological sample solutions (such as whole blood), polymerase chain reaction, DNA hybridization, and electrochemical detection. A few novel microfluidic techniques were developed and employed. A micromix-ing technique based on a cavitation microstreaming principle was implemented to enhance target cell capture from whole blood samples using immunomagnetic beads. This technique was also employed to accelerate DNA hybridization reaction. Thermally actuated paraffin-based microvalves were developed to regulate flows. Electrochemical pumps and thermopneumatic pumps were integrated on the chip to provide pumping of liquid solutions. The device is completely self-contained: no external pressure sources, fluid storage, mechanical pumps, or valves are necessary for fluid manipulation, thus eliminating possible sample contamination and simplifying device operation. Pathogenic bacteria detection from ~mL whole blood samples and single-nucleotide polymorphism analysis directly from diluted blood were demonstrated. The device provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus has a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

  8. Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

    DOEpatents

    Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

    2010-05-04

    A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

  9. The Ubiquitin Ligase CHIP Prevents SirT6 Degradation through Noncanonical Ubiquitination

    PubMed Central

    Ronnebaum, Sarah M.; Wu, Yaxu; McDonough, Holly

    2013-01-01

    The ubiquitin ligase CHIP (carboxyl terminus of Hsp70-interacting protein) regulates protein quality control, and CHIP deletion accelerates aging and reduces the life span in mice. Here, we reveal a mechanism for CHIP's influence on longevity by demonstrating that CHIP stabilizes the sirtuin family member SirT6, a lysine deacetylase/ADP ribosylase involved in DNA repair, metabolism, and longevity. In CHIP-deficient cells, SirT6 protein half-life is substantially reduced due to increased proteasome-mediated degradation, but CHIP overexpression in these cells increases SirT6 protein expression without affecting SirT6 transcription. CHIP noncanonically ubiquitinates SirT6 at K170, which stabilizes SirT6 and prevents SirT6 canonical ubiquitination by other ubiquitin ligases. In CHIP-depleted cells, SirT6 K170 mutation increases SirT6 half-life and prevents proteasome-mediated degradation. The global decrease in SirT6 expression in the absence of CHIP is associated with decreased SirT6 promoter occupancy, which increases histone acetylation and promotes downstream gene transcription in CHIP-depleted cells. Cells lacking CHIP are hypersensitive to DNA-damaging agents, but DNA repair and cell viability are rescued by enforced expression of SirT6. The discovery of this CHIP-SirT6 interaction represents a novel protein-stabilizing mechanism and defines an intersection between protein quality control and epigenetic regulation to influence pathways that regulate the biology of aging. PMID:24043303

  10. FUNDAMENTALS OF VITAMIN D HORMONE-REGULATED GENE EXPRESSION

    PubMed Central

    Pike, J. Wesley; Meyer, Mark B.

    2014-01-01

    Initial research focused upon several known genetic targets provided early insight into the mechanism of action of the vitamin D hormone (1,25-dihydroxyvitamin D3 (1,25(OH)2D3)). Recently, however, a series of technical advances involving the coupling of chromatin immunoprecipitation (ChIP) to unbiased methodologies that initially involved tiled DNA microarrays (ChIP-chip analysis) and now Next Generation DNA Sequencing techniques (ChIP-Seq analysis) has opened new avenues of research into the mechanisms through which 1,25(OH)2D3 regulates gene expression. In this review, we summarize briefly the results of this early work and then focus on more recent studies in which ChIP-chip and ChIP-seq analyses have been used to explore the mechanisms of 1,25(OH)2D3 action on a genome-wide scale providing specific target genes as examples. The results of this work have advanced our understanding of the mechanisms involved at both genetic and epigenetic levels and have revealed a series of new principles through which the vitamin D hormone functions to control the expression of genes. PMID:24239506

  11. Novel approach for deriving genome wide SNP analysis data from archived blood spots

    PubMed Central

    2012-01-01

    Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252

  12. Microfabricated plastic chips by hot embossing methods and their applications for DNA separation and detection

    NASA Astrophysics Data System (ADS)

    Lee, Gwo-Bin; Chen, Shu-Hui; Huang, Guan-Ruey; Lin, Yen-Heng; Sung, Wang-Chou

    2000-08-01

    Design and fabrication of microfluidic devices on polymethylmethacrylate (PMMA) substrates using novel microfabrication methods are described. The image of microfluidic devices is transferred from quartz master templates possessing inverse image of the devices to plastic plates by using hot embossing method. The micro channels on master templates are formed by the combination of metal etch mask and wet chemical etching. The micromachined quartz templates can be used repeatedly to fabricate cheap and disposable plastic devices. The reproducibility of the hot embossing method is evaluated after using 10 channels on different plastics. The relative standard deviation of the plastic channel profile from ones on quartz templates is less than 1%. In this study, the PMMA chips have been demonstrated as a micro capillary electrophoresis ((mu) -CE) device for DNA separation and detection. The capability of the fabricated chip for electrophoretic injection and separation is characterized via the analysis of DNA fragments (phi) X174. Results indicate that all of the 11 DNA fragments of the size marker could be identified in less than 3 minutes with relative standard deviations less than 0.4% and 8% for migration time and peak area, respectively. Moreover, with the use of near IR dye, fluorescence signals of the higher molecular weight fragments ($GTR 603 bp in length) could be detected at total DNA concentrations as low as 0.1 (mu) g/mL. In addition to DNA fragments (phi) X174, DNA sizing of hepatitis C viral (HCV) amplicon is also achieved using microchip electrophoresis fabricated on PMMA substrate.

  13. Microarrays (DNA Chips) for the Classroom Laboratory

    ERIC Educational Resources Information Center

    Barnard, Betsy; Sussman, Michael; BonDurant, Sandra Splinter; Nienhuis, James; Krysan, Patrick

    2006-01-01

    We have developed and optimized the necessary laboratory materials to make DNA microarray technology accessible to all high school students at a fraction of both cost and data size. The primary component is a DNA chip/array that students "print" by hand and then analyze using research tools that have been adapted for classroom use. The…

  14. Preparation of Low-Input and Ligation-Free ChIP-seq Libraries Using Template-Switching Technology.

    PubMed

    Bolduc, Nathalie; Lehman, Alisa P; Farmer, Andrew

    2016-10-10

    Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) has become the gold standard for mapping of transcription factors and histone modifications throughout the genome. However, for ChIP experiments involving few cells or targeting low-abundance transcription factors, the small amount of DNA recovered makes ligation of adapters very challenging. In this unit, we describe a ChIP-seq workflow that can be applied to small cell numbers, including a robust single-tube and ligation-free method for preparation of sequencing libraries from sub-nanogram amounts of ChIP DNA. An example ChIP protocol is first presented, resulting in selective enrichment of DNA-binding proteins and cross-linked DNA fragments immobilized on beads via an antibody bridge. This is followed by a protocol for fast and easy cross-linking reversal and DNA recovery. Finally, we describe a fast, ligation-free library preparation protocol, featuring DNA SMART technology, resulting in samples ready for Illumina sequencing. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

  15. Spike-In Normalization of ChIP Data Using DNA-DIG-Antibody Complex.

    PubMed

    Eberle, Andrea B

    2018-01-01

    Chromatin immunoprecipitation (ChIP) is a widely used method to determine the occupancy of specific proteins within the genome, helping to unravel the function and activity of specific genomic regions. In ChIP experiments, normalization of the obtained data by a suitable internal reference is crucial. However, particularly when comparing differently treated samples, such a reference is difficult to identify. Here, a simple method to improve the accuracy and reliability of ChIP experiments by the help of an external reference is described. An artificial molecule, composed of a well-defined digoxigenin (DIG) labeled DNA fragment in complex with an anti-DIG antibody, is synthesized and added to each chromatin sample before immunoprecipitation. During the ChIP procedure, the DNA-DIG-antibody complex undergoes the same treatments as the chromatin and is therefore purified and quantified together with the chromatin of interest. This external reference compensates for variability during the ChIP routine and improves the similarity between replicates, thereby emphasizing the biological differences between samples.

  16. Evaluation Of A Powder-Free DNA Extraction Method For Skeletal Remains.

    PubMed

    Harrel, Michelle; Mayes, Carrie; Gangitano, David; Hughes-Stamm, Sheree

    2018-02-07

    Bones are often recovered in forensic investigations, including missing persons and mass disasters. While traditional DNA extraction methods rely on grinding bone into powder prior to DNA purification, the TBone Ex buffer (DNA Chip Research Inc.) digests bone chips without powdering. In this study, six bones were extracted using the TBone Ex kit in conjunction with the PrepFiler ® BTA™ DNA extraction kit (Thermo Fisher Scientific) both manually and via an automated platform. Comparable amounts of DNA were recovered from a 50 mg bone chip using the TBone Ex kit and 50 mg of powdered bone with the PrepFiler ® BTA™ kit. However, automated DNA purification decreased DNA yield (p < 0.05). Nevertheless, short tandem repeat (STR) success was comparable across all methods tested. This study demonstrates that digestion of whole bone fragments is an efficient alternative to powdering bones for DNA extraction without compromising downstream STR profile quality. © 2018 American Academy of Forensic Sciences.

  17. Easy detection of multiple Alexandrium species using DNA chromatography chip.

    PubMed

    Nagai, Satoshi; Miyamoto, Shigehiko; Ino, Keita; Tajimi, Seisuke; Nishi, Hiromi; Tomono, Jun

    2016-01-01

    In this study, the Kaneka DNA chromatography chip (KDCC) for the Alexandrium species was successfully developed for simultaneous detection of five Alexandrium species. This method utilizes a DNA-DNA hybridization technology. In the PCR process, specifically designed tagged-primers are used, i.e. a forward primer consisting of a tag domain, which can conjugate with gold nanocolloids on the chip, and a primer domain, which can anneal/amplify the target sequence. However, the reverse primer consists of a tag domain, which can hybridize to the solid-phased capture probe on the chip, and a primer domain, which can anneal/amplify the target sequence. As a result, a red line that originates from gold nanocolloids appears as a positive signal on the chip, and the amplicon is detected visually by the naked eye. This technique is simple, because it is possible to visually detect the target species soon after (<5min) the application of 2μL of PCR amplicon and 65μL of development buffer to the sample pad of the chip. Further, this technique is relatively inexpensive and does not require expensive laboratory equipment, such as real-time Q-PCR machines or DNA microarray detectors, but a thermal cycler. Regarding the detection limit of KDCC for the five Alexandrium species, it varied among species and it was <0.1-10pg and equivalent to 5-500 copies of rRNA genes, indicating that the technique is sensitive enough for practical use to detect several cells of the target species from 1L of seawater. The detection sensitivity of KDCC was also evaluated with two different techniques, i.e. a multiplex-PCR and a digital DNA hybridization by digital DNA chip analyzer (DDCA), using natural plankton assemblages. There was no significant difference in the detection sensitivity among the three techniques, suggesting KDCC can be readily used to monitor the HAB species. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    PubMed

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  19. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip

    PubMed Central

    KAWAI, Kazuhiro; INADA, Mika; ITO, Keiko; HASHIMOTO, Koji; NIKAIDO, Masaru; HATA, Eiji; KATSUDA, Ken; KIKU, Yoshio; TAGAWA, Yuichi; HAYASHI, Tomohito

    2017-01-01

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program. PMID:29093278

  20. Static adsorptive coating of poly(methyl methacrylate) microfluidic chips for extended usage in DNA separations.

    PubMed

    Du, Xiao-Guang; Fang, Zhao-Lun

    2005-12-01

    A simple and robust static adsorptive (dynamic) coating process using 2% hydroxyethylcellulose was developed for surface modification of poly(methyl methacrylate) (PMMA) microfluidic chips for DNA separations, suitable for usage over extended periods, involving hundreds of runs. The coating medium was also used as a sieving matrix for the DNA separations following the coating process. Four consecutive static treatments, by simply filling the PMMA chip channels with sieving matrix once every day, were required for obtaining a stable coating and optimum performance. The performance of the coated chips at different phases of the coating process was studied by consecutive gel electrophoretic separations with LIF detection using a PhiX-174/HaeIII DNA digest sample. The coated chip, with daily renewal of the sieving matrix, showed high stability in performance during a 25-day period of systematic study, involving more than 100 individual runs. The performance of the coated chip also remained almost the same after 3 months of continuous usage, during which over 200 separations were performed. The average precision of migration time for the 603-bp fragment was 1.31% RSD (n = 6) during the 25-day study, with a separation efficiency of 6.5 x 10(4) plates (effective separation length 5.4 cm).

  1. Nonlinear matching measure for the analysis of on-off type DNA microarray images

    NASA Astrophysics Data System (ADS)

    Kim, Jong D.; Park, Misun; Kim, Jongwon

    2003-07-01

    In this paper, we propose a new nonlinear matching measure for automatic analysis of the on-off type DNA microarray images in which the hybridized spots are detected by the template matching method. The targeting spots of HPV DNA chips are designed for genotyping the human papilloma virus(HPV). The proposed measure is obtained by binarythresholding over the whole template region and taking the number of white pixels inside the spotted area. This measure is evaluated in terms of the accuracy of the estimated marker location to show better performance than the normalized covariance.

  2. Integration of Biological Specificity with Solid-State Devices for Selective Chemical Sensing

    DTIC Science & Technology

    2016-01-29

    materials onto a single sensor chip. We demonstrate a path to combine a large number of DNA aptamers with nanoscale device arrays to achieve integrated...solid-state, sensor chips with specificity. 15. SUBJECT TERMS DNA sensors aptamers chemiresistors nanosensors LSER specificity vapor 16. SECURITY...and engineering. In particular, DNA and RNA aptamers are a class of man- made receptors with a high degree of specificity that rivals proteins. DNA

  3. Analysis pipelines and packages for Infinium HumanMethylation450 BeadChip (450k) data

    PubMed Central

    Morris, Tiffany J.; Beck, Stephan

    2015-01-01

    The Illumina HumanMethylation450 BeadChip has become a popular platform for interrogating DNA methylation in epigenome-wide association studies (EWAS) and related projects as well as resource efforts such as the International Cancer Genome Consortium (ICGC) and the International Human Epigenome Consortium (IHEC). This has resulted in an exponential increase of 450k data in recent years and triggered the development of numerous integrated analysis pipelines and stand-alone packages. This review will introduce and discuss the currently most popular pipelines and packages and is particularly aimed at new 450k users. PMID:25233806

  4. Single cell HaloChip assay on paper for point-of-care diagnosis.

    PubMed

    Ma, Liyuan; Qiao, Yong; Jones, Ross; Singh, Narendra; Su, Ming

    2016-11-01

    This article describes a paper-based low cost single cell HaloChip assay that can be used to assess drug- and radiation-induced DNA damage at point-of-care. Printing ink on paper effectively blocks fluorescence of paper materials, provides high affinity to charged polyelectrolytes, and prevents penetration of water in paper. After exposure to drug or ionizing radiation, cells are patterned on paper to create discrete and ordered single cell arrays, embedded inside an agarose gel, lysed with alkaline solution to allow damaged DNA fragments to diffuse out of nucleus cores, and form diffusing halos in the gel matrix. After staining DNA with a fluorescent dye, characteristic halos formed around cells, and the level of DNA damage can be quantified by determining sizes of halos and nucleus with an image processing program based on MATLAB. With its low fabrication cost and easy operation, this HaloChip on paper platform will be attractive to rapidly and accurately determine DNA damage for point-of-care evaluation of drug efficacy and radiation condition. Graphical Abstract Single cell HaloChip on paper.

  5. Integration of Genome-Wide Computation DRE Search, AhR ChIP-chip and Gene Expression Analyses of TCDD-Elicited Responses in the Mouse Liver

    PubMed Central

    2011-01-01

    Background The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor (TF) that mediates responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Integration of TCDD-induced genome-wide AhR enrichment, differential gene expression and computational dioxin response element (DRE) analyses further elucidate the hepatic AhR regulatory network. Results Global ChIP-chip and gene expression analyses were performed on hepatic tissue from immature ovariectomized mice orally gavaged with 30 μg/kg TCDD. ChIP-chip analysis identified 14,446 and 974 AhR enriched regions (1% false discovery rate) at 2 and 24 hrs, respectively. Enrichment density was greatest in the proximal promoter, and more specifically, within ± 1.5 kb of a transcriptional start site (TSS). AhR enrichment also occurred distal to a TSS (e.g. intergenic DNA and 3' UTR), extending the potential gene expression regulatory roles of the AhR. Although TF binding site analyses identified over-represented DRE sequences within enriched regions, approximately 50% of all AhR enriched regions lacked a DRE core (5'-GCGTG-3'). Microarray analysis identified 1,896 number of TCDD-responsive genes (|fold change| ≥ 1.5, P1(t) > 0.999). Integrating this gene expression data with our ChIP-chip and DRE analyses only identified 625 differentially expressed genes that involved an AhR interaction at a DRE. Functional annotation analysis of differentially regulated genes associated with AhR enrichment identified overrepresented processes related to fatty acid and lipid metabolism and transport, and xenobiotic metabolism, which are consistent with TCDD-elicited steatosis in the mouse liver. Conclusions Details of the AhR regulatory network have been expanded to include AhR-DNA interactions within intragenic and intergenic genomic regions. Moreover, the AhR can interact with DNA independent of a DRE core suggesting there are alternative mechanisms of AhR-mediated gene regulation. PMID:21762485

  6. On-Chip Fluorescence Switching System for Constructing a Rewritable Random Access Data Storage Device.

    PubMed

    Nguyen, Hoang Hiep; Park, Jeho; Hwang, Seungwoo; Kwon, Oh Seok; Lee, Chang-Soo; Shin, Yong-Beom; Ha, Tai Hwan; Kim, Moonil

    2018-01-10

    We report the development of on-chip fluorescence switching system based on DNA strand displacement and DNA hybridization for the construction of a rewritable and randomly accessible data storage device. In this study, the feasibility and potential effectiveness of our proposed system was evaluated with a series of wet experiments involving 40 bits (5 bytes) of data encoding a 5-charactered text (KRIBB). Also, a flexible data rewriting function was achieved by converting fluorescence signals between "ON" and "OFF" through DNA strand displacement and hybridization events. In addition, the proposed system was successfully validated on a microfluidic chip which could further facilitate the encoding and decoding process of data. To the best of our knowledge, this is the first report on the use of DNA hybridization and DNA strand displacement in the field of data storage devices. Taken together, our results demonstrated that DNA-based fluorescence switching could be applicable to construct a rewritable and randomly accessible data storage device through controllable DNA manipulations.

  7. Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

    PubMed

    Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

    2012-04-01

    The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

  8. Comparison of the performance of Ion Torrent chips in noninvasive prenatal trisomy detection.

    PubMed

    Wang, Yanlin; Wen, Zujia; Shen, Jiawei; Cheng, Weiwei; Li, Jun; Qin, Xiaolan; Ma, Duan; Shi, Yongyong

    2014-07-01

    Semiconductor high-throughput sequencing, represented by Ion Torrent PGM/Proton, proves to be feasible in the noninvasive prenatal diagnosis of fetal aneuploidies. It is commendable that, with less data and relevant cost also, an accurate result can be achieved owing to the high sensitivity and specificity of such kind of technology. We conducted a comparative analysis of the performance of four different Ion chips in detecting fetal chromosomal aneuploidies. Eight maternal plasma DNA samples, including four pregnancies with normal fetuses and four with trisomy 21 fetuses, were sequenced on Ion Torrent 314/316/318/PI chips, respectively. Results such as read mapped ratio, correlation coefficient and phred quality score were calculated and parallelly compared. All samples were correctly classified even with low-throughput chip, and, among the four chips, the 316 chip had the highest read mapped ratio, correlation coefficient, mean read length and phred quality score. All chips were well consistent with each other. Our results showed that all Ion chips are applicable in noninvasive prenatal fetal aneuploidy diagnosis. We recommend researchers or clinicians to use the appropriate chip with barcoding technology on the basis of the sample number.

  9. P53 Mutation Analysis to Predict Tumor Response in Patients Undergoing Neoadjuvant Treatment for Locally Advanced Breast Cancer

    DTIC Science & Technology

    2006-10-01

    then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary

  10. Chromatin immunoprecipitation of mouse embryos.

    PubMed

    Voss, Anne K; Dixon, Mathew P; McLennan, Tamara; Kueh, Andrew J; Thomas, Tim

    2012-01-01

    During prenatal development, a large number of different cell types are formed, the vast majority of which contain identical genetic material. The basis of the great variety in cell phenotype and function is the differential expression of the approximately 25,000 genes in the mammalian genome. Transcriptional activity is regulated at many levels by proteins, including members of the basal transcriptional apparatus, DNA-binding transcription factors, and chromatin-binding proteins. Importantly, chromatin structure dictates the availability of a specific genomic locus for transcriptional activation as well as the efficiency, with which transcription can occur. Chromatin immunoprecipitation (ChIP) is a method to assess if chromatin modifications or proteins are present at a specific locus. ChIP involves the cross linking of DNA and associated proteins and immunoprecipitation using specific antibodies to DNA-associated proteins followed by examination of the co-precipitated DNA sequences or proteins. In the last few years, ChIP has become an essential technique for scientists studying transcriptional regulation and chromatin structure. Using ChIP on mouse embryos, we can document the presence or absence of specific proteins and chromatin modifications at genomic loci in vivo during mammalian development. Here, we describe a ChIP technique adapted for mouse embryos.

  11. Microfluidic magnetic fluidized bed for DNA analysis in continuous flow mode.

    PubMed

    Hernández-Neuta, Iván; Pereiro, Iago; Ahlford, Annika; Ferraro, Davide; Zhang, Qiongdi; Viovy, Jean-Louis; Descroix, Stéphanie; Nilsson, Mats

    2018-04-15

    Magnetic solid phase substrates for biomolecule manipulation have become a valuable tool for simplification and automation of molecular biology protocols. However, the handling of magnetic particles inside microfluidic chips for miniaturized assays is often challenging due to inefficient mixing, aggregation, and the advanced instrumentation required for effective actuation. Here, we describe the use of a microfluidic magnetic fluidized bed approach that enables dynamic, highly efficient and simplified magnetic bead actuation for DNA analysis in a continuous flow platform with minimal technical requirements. We evaluate the performance of this approach by testing the efficiency of individual steps of a DNA assay based on padlock probes and rolling circle amplification. This assay comprises common nucleic acid analysis principles, such as hybridization, ligation, amplification and restriction digestion. We obtained efficiencies of up to 90% for these reactions with high throughput processing up to 120μL of DNA dilution at flow rates ranging from 1 to 5μL/min without compromising performance. The fluidized bed was 20-50% more efficient than a commercially available solution for microfluidic manipulation of magnetic beads. Moreover, to demonstrate the potential of this approach for integration into micro-total analysis systems, we optimized the production of a low-cost polymer based microarray and tested its analytical performance for integrated single-molecule digital read-out. Finally, we provide the proof-of-concept for a single-chamber microfluidic chip that combines the fluidized bed with the polymer microarray for a highly simplified and integrated magnetic bead-based DNA analyzer, with potential applications in diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Considerations on Experimental Design and Data Analysis of Chromatin Immunoprecipitation Experiments.

    PubMed

    Jordán-Pla, Antonio; Visa, Neus

    2018-01-01

    Arguably one of the most valuable techniques to study chromatin organization, ChIP is the method of choice to map the contacts established between proteins and genomic DNA. Ever since its inception, more than 30 years ago, ChIP has been constantly evolving, improving, and expanding its capabilities and reach. Despite its widespread use by many laboratories across a wide variety of disciplines, ChIP assays can be sometimes challenging to design, and are often sensitive to variations in practical implementation.In this chapter, we provide a general overview of the ChIP method and its most common variations, with a special focus on ChIP-seq. We try to address some of the most important aspects that need to be taken into account in order to design and perform experiments that generate the most reproducible, high-quality data. Some of the main topics covered include the use of properly characterized antibodies, alternatives to chromatin preparation, the need for proper controls, and some recommendations about ChIP-seq data analysis.

  13. Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

    DTIC Science & Technology

    2006-07-28

    manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

  14. DNA Microarray for Rapid Detection and Identification of Food and Water Borne Bacteria: From Dry to Wet Lab.

    PubMed

    Ranjbar, Reza; Behzadi, Payam; Najafi, Ali; Roudi, Raheleh

    2017-01-01

    A rapid, accurate, flexible and reliable diagnostic method may significantly decrease the costs of diagnosis and treatment. Designing an appropriate microarray chip reduces noises and probable biases in the final result. The aim of this study was to design and construct a DNA Microarray Chip for a rapid detection and identification of 10 important bacterial agents. In the present survey, 10 unique genomic regions relating to 10 pathogenic bacterial agents including Escherichia coli (E.coli), Shigella boydii, Sh.dysenteriae, Sh.flexneri, Sh.sonnei, Salmonella typhi, S.typhimurium, Brucella sp., Legionella pneumophila, and Vibrio cholera were selected for designing specific long oligo microarray probes. For this reason, the in-silico operations including utilization of the NCBI RefSeq database, Servers of PanSeq and Gview, AlleleID 7.7 and Oligo Analyzer 3.1 was done. On the other hand, the in-vitro part of the study comprised stages of robotic microarray chip probe spotting, bacterial DNAs extraction and DNA labeling, hybridization and microarray chip scanning. In wet lab section, different tools and apparatus such as Nexterion® Slide E, Qarray mini spotter, NimbleGen kit, TrayMix TM S4, and Innoscan 710 were used. A DNA microarray chip including 10 long oligo microarray probes was designed and constructed for detection and identification of 10 pathogenic bacteria. The DNA microarray chip was capable to identify all 10 bacterial agents tested simultaneously. The presence of a professional bioinformatician as a probe designer is needed to design appropriate multifunctional microarray probes to increase the accuracy of the outcomes.

  15. Electrochemical detection of methylated DNA on a microfluidic chip with nanoelectrokinetic pre-concentration.

    PubMed

    Hong, Sung A; Kim, Yong-June; Kim, Sung Jae; Yang, Sung

    2018-06-01

    DNA methylation is considered to be a promising marker for the early diagnosis and prognosis of cancer. However, direct detection of the methylated DNAs in clinically relevant samples is still challenging because of its extremely low concentration (~fM). Here, an integrated microfluidic chip is reported, which is capable of pre-concentrating the methylated DNAs using ion concentration polarization (ICP) and electrochemically detecting the pre-concentrated DNAs on a single chip. The proposed chip is the first demonstration of an electrochemical detection of both level and concentration of the methylated DNAs by integrating a DNA pre-concentration unit without gene amplification. Using the proposed chip, 500 fM to 500 nM of methylated DNAs is pre-concentrated by almost 100-fold in 10 min, resulting in a drastic improvement of the electrochemical detection threshold down to the fM level. The proposed chip is able to measure not only the DNA concentration, but also the level of methylation using human urine sample by performing a consecutive electrochemical sensing on a chip. For clinical application, the level as well as the concentration of methylation of glutathione-S transferase-P1 (GSTP1) and EGF-containing fibulin-like extracellular matrix protein 1 (EFEMP1), which are known to be closely associated with prostate cancer diagnosis, are electrochemically detected in human urine spiked with these genes. The developed chip shows a limit of detection (LoD) of 7.9 pM for GSTP1 and 11.8 pM for EFEMP1 and is able to detect the level of methylation in a wide range from 10% to 100% with the concentration variation from 50 pM to 500 nM. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. On-chip wavelength multiplexed detection of cancer DNA biomarkers in blood

    PubMed Central

    Cai, H.; Stott, M. A.; Ozcelik, D.; Parks, J. W.; Hawkins, A. R.; Schmidt, H.

    2016-01-01

    We have developed an optofluidic analysis system that processes biomolecular samples starting from whole blood and then analyzes and identifies multiple targets on a silicon-based molecular detection platform. We demonstrate blood filtration, sample extraction, target enrichment, and fluorescent labeling using programmable microfluidic circuits. We detect and identify multiple targets using a spectral multiplexing technique based on wavelength-dependent multi-spot excitation on an antiresonant reflecting optical waveguide chip. Specifically, we extract two types of melanoma biomarkers, mutated cell-free nucleic acids —BRAFV600E and NRAS, from whole blood. We detect and identify these two targets simultaneously using the spectral multiplexing approach with up to a 96% success rate. These results point the way toward a full front-to-back chip-based optofluidic compact system for high-performance analysis of complex biological samples. PMID:28058082

  17. Design and integration of an all-in-one biomicrofluidic chip

    PubMed Central

    Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping

    2008-01-01

    We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370

  18. Recombinant drugs-on-a-chip: The usage of capillary electrophoresis and trends in miniaturized systems - A review.

    PubMed

    Morbioli, Giorgio Gianini; Mazzu-Nascimento, Thiago; Aquino, Adriano; Cervantes, Cesar; Carrilho, Emanuel

    2016-09-07

    We present here a critical review covering conventional analytical tools of recombinant drug analysis and discuss their evolution towards miniaturized systems foreseeing a possible unique recombinant drug-on-a-chip device. Recombinant protein drugs and/or pro-drug analysis require sensitive and reproducible analytical techniques for quality control to ensure safety and efficacy of drugs according to regulatory agencies. The versatility of miniaturized systems combined with their low-cost could become a major trend in recombinant drugs and bioprocess analysis. Miniaturized systems are capable of performing conventional analytical and proteomic tasks, allowing for interfaces with other powerful techniques, such as mass spectrometry. Microdevices can be applied during the different stages of recombinant drug processing, such as gene isolation, DNA amplification, cell culture, protein expression, protein separation, and analysis. In addition, organs-on-chips have appeared as a viable alternative to testing biodrug pharmacokinetics and pharmacodynamics, demonstrating the capabilities of the miniaturized systems. The integration of individual established microfluidic operations and analytical tools in a single device is a challenge to be overcome to achieve a unique recombinant drug-on-a-chip device. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. A microfluidic flow injection system for DNA assay with fluids driven by an on-chip integrated pump based on capillary and evaporation effects.

    PubMed

    Xu, Zhang-Run; Zhong, Chong-Hui; Guan, Yan-Xia; Chen, Xu-Wei; Wang, Jian-Hua; Fang, Zhao-Lun

    2008-10-01

    A miniaturized flow injection analysis (FIA) system integrating a micropump on a microfluidic chip based on capillary and evaporation effects was developed. The pump was made by fixing a filter paper plug with a vent tube at the channel end, it requires no peripheral equipment and provides steady flow in the microl min(-1) range for FIA operation. Valve-free sample injection was achieved at nanolitre level using an array of slotted vials. The practical applicability of the system was demonstrated by DNA assay with laser-induced fluorescence (LIF) detection. A precision of 1.6% RSD (10.0 ng microl(-1), n=15) was achieved with a sampling throughput of 76 h(-1) and sample consumption of 95 nl.

  20. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  1. Miniaturized devices towards an integrated lab-on-a-chip platform for DNA diagnostics

    NASA Astrophysics Data System (ADS)

    Kaprou, G.; Papadakis, G.; Kokkoris, G.; Papadopoulos, V.; Kefala, I.; Papageorgiou, D.; Gizeli, E.; Tserepi, A.

    2015-06-01

    Microfluidics is an emerging technology enabling the development of Lab-on-a-chip (LOC) systems for clinical diagnostics, drug discovery and screening, food safety and environmental analysis. LOC systems integrate and scale down one or several laboratory functions on a single chip of a few mm2 to cm2 in size, and account for many advantages on biochemical analyses, such as low sample and reagent consumption, low cost, reduced analysis time, portability and point-of-need compatibility. Currently, available nucleic acid diagnostic tests take advantage of Polymerase Chain Reaction (PCR) that allows exponential amplification of portions of nucleic acid sequences that can be used as indicators for the identification of various diseases. Here, we present a comparison between static chamber and continuous flow miniaturized PCR devices, in terms of energy consumption for devices fabricated on the same material stack, with identical sample volume and channel dimensions. The comparison is implemented by a computational study coupling heat transfer in both solid and fluid, mass conservation of species, and joule heating. Based on the conclusions of this study, we develop low-cost and fast DNA amplification devices for both PCR and isothermal amplification, and we implement them in the detection of mutations related to breast cancer. The devices are fabricated by mass production amenable technologies on printed circuit board (PCB) substrates, where copper facilitates the incorporation of on-chip microheaters, defining the thermal zones necessary for PCR or isothermal amplification methods.

  2. A label-free impedimetric DNA sensing chip integrated with AC electroosmotic stirring.

    PubMed

    Wu, Ching-Chou; Yang, Dong-Jie

    2013-05-15

    AC electroosmosis (ACEO) flow and label-free electrochemical impedance spectroscopy are employed to increase the hybridization rate and specifically detect target DNA (tDNA) concentrations. A low-ionic-strength solution, 6.1μS/cm 1mM Tris (pH 9.3), was used to produce ACEO and proved the feasibility of hybridization. Adequate voltage parameters for the simultaneous ACEO driving and DNA hybridization in the 1mM Tris solution were 1.5 Vpp and 200Hz. Moreover, an electrode set with a 1:4 ring width-to-disk diameter ratio exhibited a larger ACEO velocity above the disk electrode surface to improve collecting efficiency. The ACEO-integrated DNA sensing chips could reach 90% saturation hybridization within 117s. The linear range and detection limit of the sensors was 10aM-10pM and 10aM, respectively. The label-free impedimetric DNA sensing chips with integrated ACEO stirring can perform rapid hybridization and highly-sensitive detections to specifically measure tDNA concentrations. Copyright © 2013 Elsevier B.V. All rights reserved.

  3. Multifunctional System-on-Glass for Lab-on-Chip applications.

    PubMed

    Petrucci, G; Caputo, D; Lovecchio, N; Costantini, F; Legnini, I; Bozzoni, I; Nascetti, A; de Cesare, G

    2017-07-15

    Lab-on-Chip are miniaturized systems able to perform biomolecular analysis in shorter time and with lower reagent consumption than a standard laboratory. Their miniaturization interferes with the multiple functions that the biochemical procedures require. In order to address this issue, our paper presents, for the first time, the integration on a single glass substrate of different thin film technologies in order to develop a multifunctional platform suitable for on-chip thermal treatments and on-chip detection of biomolecules. The proposed System on-Glass hosts thin metal films acting as heating sources; hydrogenated amorphous silicon diodes acting both as temperature sensors to monitor the temperature distribution and photosensors for the on-chip detection and a ground plane ensuring that the heater operation does not affect the photodiode currents. The sequence of the technological steps, the deposition temperatures of the thin films and the parameters of the photolithographic processes have been optimized in order to overcome all the issues of the technological integration. The device has been designed, fabricated and tested for the implementation of DNA amplification through the Polymerase Chain Reaction (PCR) with thermal cycling among three different temperatures on a single site. The glass has been connected to an electronic system that drives the heaters and controls the temperature and light sensors. It has been optically and thermally coupled with another glass hosting a microfluidic network made in polydimethylsiloxane that includes thermally actuated microvalves and a PCR process chamber. The successful DNA amplification has been verified off-chip by using a standard fluorometer. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-a-chip Agilent DNA 1000 platform.

    PubMed

    Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš

    2016-01-01

    Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.

  5. Development of micropump-actuated negative pressure pinched injection for parallel electrophoresis on array microfluidic chip.

    PubMed

    Li, Bowei; Jiang, Lei; Xie, Hua; Gao, Yan; Qin, Jianhua; Lin, Bingcheng

    2009-09-01

    A micropump-actuated negative pressure pinched injection method is developed for parallel electrophoresis on a multi-channel LIF detection system. The system has a home-made device that could individually control 16-port solenoid valves and a high-voltage power supply. The laser beam is excitated and distributes to the array separation channels for detection. The hybrid Glass-PDMS microfluidic chip comprises two common reservoirs, four separation channels coupled to their respective pneumatic micropumps and two reference channels. Due to use of pressure as a driving force, the proposed method has no sample bias effect for separation. There is only one high-voltage supply needed for separation without relying on the number of channels, which is significant for high-throughput analysis, and the time for sample loading is shortened to 1 s. In addition, the integrated micropumps can provide the versatile interface for coupling with other function units to satisfy the complicated demands. The performance is verified by separation of DNA marker and Hepatitis B virus DNA samples. And this method is also expected to show the potential throughput for the DNA analysis in the field of disease diagnosis.

  6. A Spiking Strategy for ChIP-chip Data Normalization in S. cerevisiae.

    PubMed

    Jeronimo, Célia; Robert, François

    2017-01-01

    Chromatin immunoprecipitation coupled to DNA microarrays (ChIP-chip) is widely used in the chromatin field, notably to map the position of histone variants or histone modifications along the genome. Often, the position and the occupancy of these epigenetic marks are to be compared between different experiments. It is now increasingly recognized that such cross-sample comparison is better done using externally added exogenous controls for normalization but no such method has been described for ChIP-chip. Here we describe a spiking normalization strategy that makes use of phiX174 phage DNA as a spiked control for normalization of ChIP-chip signals across different experiments.

  7. Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

    PubMed Central

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-01-01

    Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

  8. Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

    PubMed

    McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

    2009-06-16

    As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

  9. A versatile electrowetting-based digital microfluidic platform for quantitative homogeneous and heterogeneous bio-assays

    NASA Astrophysics Data System (ADS)

    Vergauwe, Nicolas; Witters, Daan; Ceyssens, Frederik; Vermeir, Steven; Verbruggen, Bert; Puers, Robert; Lammertyn, Jeroen

    2011-05-01

    Electrowetting-on-dielectric (EWOD) lab-on-a-chip systems have already proven their potential within a broad range of bio-assays. Nevertheless, research on the analytical performance of those systems is limited, yet crucial for a further breakthrough in the diagnostic field. Therefore, this paper presents the intrinsic possibilities of an EWOD lab-on-a-chip as a versatile platform for homogeneous and heterogeneous bio-assays with high analytical performance. Both droplet dispensing and splitting cause variations in droplet size, thereby directly influencing the assay's performance. The extent to which they influence the performance is assessed by a theoretical sensitivity analysis, which allows the definition of a basic framework for the reduction of droplet size variability. Taking advantage of the optimized droplet manipulations, both homogeneous and heterogeneous bio-assays are implemented in the EWOD lab-on-a-chip to demonstrate the analytical capabilities and versatility of the device. A fully on-chip enzymatic assay is realized with high analytical performance. It demonstrates the promising capabilities of an EWOD lab-on-a-chip in food-related and medical applications, such as nutritional and blood analyses. Further, a magnetic bio-assay for IgE detection using superparamagnetic nanoparticles is presented whereby the nanoparticles are used as solid carriers during the bio-assay. Crucial elements are the precise manipulation of the superparamagnetic nanoparticles with respect to dispensing and separation. Although the principle of using nano-carriers is demonstrated for protein detection, it can be easily extended to a broader range of bio-related applications like DNA sensing. In heterogeneous bio-assays the chip surface is actively involved during the execution of the bio-assay. Through immobilization of specific biological compounds like DNA, proteins and cells a reactive chip surface is realized, which enhances the bio-assay performance. To demonstrate this potential, on-chip adhesion islands are fabricated to immobilize MCF-7 human breast cancer cells. Viability studies are performed to assess the functionalization efficiency.

  10. Report on the Infinium 450k methylation array analysis workshop: April 20, 2012 UCL, London, UK.

    PubMed

    Morris, Tiffany; Lowe, Robert

    2012-08-01

    A new platform for DNA methylome analysis is Illumina's Infinium HumanMethylation450. This technology is an extension of the previous HumanMethylation27 BeadChip and allows the methylation status of 12 samples per chip and 4 to 8 chips (total of 48 to 96 samples) to be assessed simultaneously for more than 480,000 cytosines across the genome. The platform incorporates two different probe types using different assay designs (InfiniumI and InfiniumII). Although this has allowed the assessment of more CpG sites, it has also introduced technical variation between the two probe types, which has complicated the analysis process. Many groups are working on normalization methods and analysis pipelines while many others are struggling to make sense of their new data sets. This motivated the organization of a meeting held at University College London that focused solely on the analysis methods and problems related to this new platform. The meeting was attended by 125 computational and bench scientists from 11 countries. There were 10 speakers, a small poster session and a discussion session.

  11. Monte Carlo Modeling-Based Digital Loop-Mediated Isothermal Amplification on a Spiral Chip for Absolute Quantification of Nucleic Acids.

    PubMed

    Xia, Yun; Yan, Shuangqian; Zhang, Xian; Ma, Peng; Du, Wei; Feng, Xiaojun; Liu, Bi-Feng

    2017-03-21

    Digital loop-mediated isothermal amplification (dLAMP) is an attractive approach for absolute quantification of nucleic acids with high sensitivity and selectivity. Theoretical and numerical analysis of dLAMP provides necessary guidance for the design and analysis of dLAMP devices. In this work, a mathematical model was proposed on the basis of the Monte Carlo method and the theories of Poisson statistics and chemometrics. To examine the established model, we fabricated a spiral chip with 1200 uniform and discrete reaction chambers (9.6 nL) for absolute quantification of pathogenic DNA samples by dLAMP. Under the optimized conditions, dLAMP analysis on the spiral chip realized quantification of nucleic acids spanning over 4 orders of magnitude in concentration with sensitivity as low as 8.7 × 10 -2 copies/μL in 40 min. The experimental results were consistent with the proposed mathematical model, which could provide useful guideline for future development of dLAMP devices.

  12. In situ synthesis of protein arrays.

    PubMed

    He, Mingyue; Stoevesandt, Oda; Taussig, Michael J

    2008-02-01

    In situ or on-chip protein array methods use cell free expression systems to produce proteins directly onto an immobilising surface from co-distributed or pre-arrayed DNA or RNA, enabling protein arrays to be created on demand. These methods address three issues in protein array technology: (i) efficient protein expression and availability, (ii) functional protein immobilisation and purification in a single step and (iii) protein on-chip stability over time. By simultaneously expressing and immobilising many proteins in parallel on the chip surface, the laborious and often costly processes of DNA cloning, expression and separate protein purification are avoided. Recently employed methods reviewed are PISA (protein in situ array) and NAPPA (nucleic acid programmable protein array) from DNA and puromycin-mediated immobilisation from mRNA.

  13. Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data processing.

    PubMed

    Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

    2016-10-01

    Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

  14. Clinical Significance of an HPV DNA Chip Test with Emphasis on HPV-16 and/or HPV-18 Detection in Korean Gynecological Patients.

    PubMed

    Yeo, Min-Kyung; Lee, Ahwon; Hur, Soo Young; Park, Jong Sup

    2016-07-01

    Human papillomavirus (HPV) is a major risk factor for cervical cancer. We evaluated the clinical significance of the HPV DNA chip genotyping assay (MyHPV chip, Mygene Co.) compared with the Hybrid Capture 2 (HC2) chemiluminescent nucleic acid hybridization kit (Digene Corp.) in 867 patients. The concordance rate between the MyHPV chip and HC2 was 79.4% (kappa coefficient, κ = 0.55). The sensitivity and specificity of both HPV tests were very similar (approximately 85% and 50%, respectively). The addition of HPV result (either MyHPV chip or HC2) to cytology improved the sensitivity (95%, each) but reduced the specificity (approximately 30%, each) compared with the HPV test or cytology alone. Based on the MyHPV chip results, the odds ratio (OR) for ≥ high-grade squamous intraepithelial lesions (HSILs) was 9.9 in the HPV-16/18 (+) group and 3.7 in the non-16/18 high-risk (HR)-HPV (+) group. Based on the HC2 results, the OR for ≥ HSILs was 5.9 in the HR-HPV (+) group. When considering only patients with cytological diagnoses of "negative for intraepithelial lesion or malignancy" and "atypical squamous cell or atypical glandular cell," based on the MyHPV chip results, the ORs for ≥ HSILs were 6.8 and 11.7, respectively, in the HPV-16/18 (+) group. The sensitivity and specificity of the MyHPV chip test are similar to the HC2. Detecting HPV-16/18 with an HPV DNA chip test, which is commonly used in many Asian countries, is useful in assessing the risk of high-grade cervical lesions.

  15. Analysis pipelines and packages for Infinium HumanMethylation450 BeadChip (450k) data.

    PubMed

    Morris, Tiffany J; Beck, Stephan

    2015-01-15

    The Illumina HumanMethylation450 BeadChip has become a popular platform for interrogating DNA methylation in epigenome-wide association studies (EWAS) and related projects as well as resource efforts such as the International Cancer Genome Consortium (ICGC) and the International Human Epigenome Consortium (IHEC). This has resulted in an exponential increase of 450k data in recent years and triggered the development of numerous integrated analysis pipelines and stand-alone packages. This review will introduce and discuss the currently most popular pipelines and packages and is particularly aimed at new 450k users. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Sensitive and accurate identification of protein–DNA binding events in ChIP-chip assays using higher order derivative analysis

    PubMed Central

    Barrett, Christian L.; Cho, Byung-Kwan

    2011-01-01

    Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353

  17. Micro flow-through PCR in a PMMA chip fabricated by KrF excimer laser.

    PubMed

    Yao, Liying; Liu, Baoan; Chen, Tao; Liu, Shibing; Zuo, Tiechuan

    2005-09-01

    As the third PCR technology, micro flow-through PCR chip can amplify DNA specifically in an exponential fashion in vitro. Nowadays many academies in the world have successfully amplified DNA using their own-made flow-through PCR chip. In this paper, the ablation principle of PMMA at 248 nm excimer laser was studied, then a PMMA based flow-through PCR chip with 20 cycles was fabricated by excimer laser at 19 kv and 18 mm/min. The chip was bonded together with another cover chip at 105( composite function)C, 160 N and 20 minutes. In the end, it was integrated with electrical thermal thin films and Pt 100 temperature sensors. The temperature controllers was built standard PID digital temperature controller, the temperature control precision was +/- 0.2( composite function)C. The temperature grads between the three temperature zones were 16.5 and 22.2( composite function)C respectively, the gaps between the temperature zones could realize heat insulation.

  18. Chromatin immunoprecipitation assays: application of ChIP-on-chip for defining dynamic transcriptional mechanisms in bone cells.

    PubMed

    van der Deen, Margaretha; Hassan, Mohammad Q; Pratap, Jitesh; Teplyuk, Nadiya M; Young, Daniel W; Javed, Amjad; Zaidi, Sayyed K; Lian, Jane B; Montecino, Martin; Stein, Janet L; Stein, Gary S; van Wijnen, Andre J

    2008-01-01

    Normal cell growth and differentiation of bone cells requires the sequential expression of cell type specific genes to permit lineage specification and development of cellular phenotypes. Transcriptional activation and repression of distinct sets of genes support the anabolic functions of osteoblasts and the catabolic properties of osteoclasts. Furthermore, metastasis of tumors to the bone environment is controlled by transcriptional mechanisms. Insights into the transcriptional regulation of genes in bone cells may provide a conceptual basis for improved therapeutic approaches to treat bone fractures, genetic osteopathologies, and/or cancer metastases to bone. Chromatin immunoprecipitation (ChIP) is a powerful technique to establish in vivo binding of transcription factors to the promoters of genes that are either activated or repressed in bone cells. Combining ChIP with genomic microarray analysis, colloquially referred to as "ChIP-on-chip," has become a valuable method for analysis of endogenous protein/DNA interactions. This technique permits assessment of chromosomal binding sites for transcription factors or the location of histone modifications at a genomic scale. This chapter discusses protocols for performing chromatin immunoprecipitation experiments, with a focus on ChIP-on-chip analysis. The information presented is based on the authors' experience with defining interactions of Runt-related (RUNX) transcription factors with bone-related genes within the context of the native nucleosomal organization of intact osteoblastic cells.

  19. The development and validation of EpiComet-Chip, a modified high-throughput comet assay for the assessment of DNA methylation status.

    PubMed

    Townsend, Todd A; Parrish, Marcus C; Engelward, Bevin P; Manjanatha, Mugimane G

    2017-08-01

    DNA damage and alterations in global DNA methylation status are associated with multiple human diseases and are frequently correlated with clinically relevant information. Therefore, assessing DNA damage and epigenetic modifications, including DNA methylation, is critical for predicting human exposure risk of pharmacological and biological agents. We previously developed a higher-throughput platform for the single cell gel electrophoresis (comet) assay, CometChip, to assess DNA damage and genotoxic potential. Here, we utilized the methylation-dependent endonuclease, McrBC, to develop a modified alkaline comet assay, "EpiComet," which allows single platform evaluation of genotoxicity and global DNA methylation [5-methylcytosine (5-mC)] status of single-cell populations under user-defined conditions. Further, we leveraged the CometChip platform to create an EpiComet-Chip system capable of performing quantification across simultaneous exposure protocols to enable unprecedented speed and simplicity. This system detected global methylation alterations in response to exposures which included chemotherapeutic and environmental agents. Using EpiComet-Chip on 63 matched samples, we correctly identified single-sample hypermethylation (≥1.5-fold) at 87% (20/23), hypomethylation (≥1.25-fold) at 100% (9/9), with a 4% (2/54) false-negative rate (FNR), and 10% (4/40) false-positive rate (FPR). Using a more stringent threshold to define hypermethylation (≥1.75-fold) allowed us to correctly identify 94% of hypermethylation (17/18), but increased our FPR to 16% (7/45). The successful application of this novel technology will aid hazard identification and risk characterization of FDA-regulated products, while providing utility for investigating epigenetic modes of action of agents in target organs, as the assay is amenable to cultured cells or nucleated cells from any tissue. Environ. Mol. Mutagen. 58:508-521, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Rapid Automated Sample Preparation for Biological Assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shusteff, M

    Our technology utilizes acoustic, thermal, and electric fields to separate out contaminants such as debris or pollen from environmental samples, lyse open cells, and extract the DNA from the lysate. The objective of the project is to optimize the system described for a forensic sample, and demonstrate its performance for integration with downstream assay platforms (e.g. MIT-LL's ANDE). We intend to increase the quantity of DNA recovered from the sample beyond the current {approx}80% achieved using solid phase extraction methods. Task 1: Develop and test an acoustic filter for cell extraction. Task 2: Develop and test lysis chip. Task 3:more » Develop and test DNA extraction chip. All chips have been fabricated based on the designs laid out in last month's report.« less

  1. Magnetoresistive DNA chips based on ac field focusing of magnetic labels

    NASA Astrophysics Data System (ADS)

    Ferreira, H. A.; Cardoso, F. A.; Ferreira, R.; Cardoso, S.; Freitas, P. P.

    2006-04-01

    A study was made on the sensitivity of a magnetoresistive DNA-chip platform being developed for cystic fibrosis diagnostics. The chip, comprised of an array of 2.5×80 μm2 U-shaped spin-valve sensors integrated within current line structures for magnetic label manipulation, enabled the detection at 30 Hz of 250 nm magnetic nanoparticles from 100 pM down to the pM range (or a target DNA concentration of 500 pM). It was observed that the sensor response increased linearly with label concentration. Noise spectra obtained for these sensors showed a thermal noise of 10-17 V2/Hz with a 1/f knee at 50 kHz at a 1 mA sense current, showing that lower detection limits are possible.

  2. Real-time and label-free ring-resonator monitoring of solid-phase recombinase polymerase amplification.

    PubMed

    Sabaté Del Río, Jonathan; Steylaerts, Tim; Henry, Olivier Y F; Bienstman, Peter; Stakenborg, Tim; Van Roy, Wim; O'Sullivan, Ciara K

    2015-11-15

    In this work we present the use of a silicon-on-insulator (SOI) chip featuring an array of 64 optical ring resonators used as refractive index sensors for real-time and label-free DNA detection. Single ring functionalisation was achieved using a click reaction after precise nanolitre spotting of specific hexynyl-terminated DNA capture probes to link to an azido-silanised chip surface. To demonstrate detectability using the ring resonators and to optimise conditions for solid-phase amplification, hybridisation between short 25-mer single stranded DNA (ssDNA) fragments and a complementary capture probe immobilised on the surface of the ring resonators was carried out and detected through the shift in the resonant wavelength. Using the optimised conditions demonstrated via the solid-phase hybridisation, a 144-bp double stranded DNA (dsDNA) was then detected directly using recombinase and polymerase proteins through on-chip target amplification and solid-phase elongation of immobilised forward primers on specific rings, at a constant temperature of 37°C and in less than 60min, achieving a limit of detection of 7.8·10(-13)M (6·10(5) copies in 50µL). The use of an automatic liquid handler injection instrument connected to an integrated resealable chip interface (RCI) allowed programmable multiple injection protocols. Air plugs between different solutions were introduced to prevent intermixing and a proportional-integral-derivative (PID) temperature controller minimised temperature based drifts. Published by Elsevier B.V.

  3. Droplet Microfluidics for Compartmentalized Cell Lysis and Extension of DNA from Single-Cells

    NASA Astrophysics Data System (ADS)

    Zimny, Philip; Juncker, David; Reisner, Walter

    Current single cell DNA analysis methods suffer from (i) bias introduced by the need for molecular amplification and (ii) limited ability to sequence repetitive elements, resulting in (iii) an inability to obtain information regarding long range genomic features. Recent efforts to circumvent these limitations rely on techniques for sensing single molecules of DNA extracted from single-cells. Here we demonstrate a droplet microfluidic approach for encapsulation and biochemical processing of single-cells inside alginate microparticles. In our approach, single-cells are first packaged inside the alginate microparticles followed by cell lysis, DNA purification, and labeling steps performed off-chip inside this microparticle system. The alginate microparticles are then introduced inside a micro/nanofluidic system where the alginate is broken down via a chelating buffer, releasing long DNA molecules which are then extended inside nanofluidic channels for analysis via standard mapping protocols.

  4. Progress in the application of DNA microarrays.

    PubMed Central

    Lobenhofer, E K; Bushel, P R; Afshari, C A; Hamadeh, H K

    2001-01-01

    Microarray technology has been applied to a variety of different fields to address fundamental research questions. The use of microarrays, or DNA chips, to study the gene expression profiles of biologic samples began in 1995. Since that time, the fundamental concepts behind the chip, the technology required for making and using these chips, and the multitude of statistical tools for analyzing the data have been extensively reviewed. For this reason, the focus of this review will be not on the technology itself but on the application of microarrays as a research tool and the future challenges of the field. PMID:11673116

  5. An accessible micro-capillary electrophoresis device using surface-tension-driven flow

    PubMed Central

    Mohanty, Swomitra K.; Warrick, Jay; Gorski, Jack; Beebe, David J.

    2010-01-01

    We present a rapidly fabricated micro-capillary electrophoresis chip that utilizes surface-tension-driven flow for sample injection and extraction of DNA. Surface-tension-driven flow (i.e. passive pumping) injects a fixed volume of sample that can be predicted mathematically. Passive pumping eliminates the need for tubing, valves, syringe pumps, and other equipment typically needed for interfacing with microelectrophoresis chips. This method requires a standard micropipette to load samples before separation, and remove the resulting bands after analysis. The device was made using liquid phase photopolymerization to rapidly fabricate the chip without the need of special equipment typically associated with the construction of microelectrophoresis chips (e.g. cleanroom). Batch fabrication time for the device presented here was 1.5 h including channel coating time to suppress electroosmotic flow. Devices were constructed out of poly-isobornyl acrylate and glass. A standard microscope with a UV source was used for sample detection. Separations were demonstrated using Promega BenchTop 100 bp ladder in hydroxyl ethyl cellulose (HEC) and oligonucleotides of 91 and 118 bp were used to characterize sample injection and extraction of DNA bands. The end result was an inexpensive micro-capillary electrophoresis device that uses tools (e.g. micropipette, electrophoretic power supplies, and microscopes) already present in most labs for sample manipulation and detection, making it more accessible for potential end users. PMID:19425002

  6. ChIP and ChIP-Related Techniques: Expanding the Fields of Application and Improving ChIP Performance.

    PubMed

    Visa, Neus; Jordán-Pla, Antonio

    2018-01-01

    Protein-DNA interactions in vivo can be detected and quantified by chromatin immunoprecipitation (ChIP). ChIP has been instrumental for the advancement of epigenetics and has set the groundwork for the development of a number of ChIP-related techniques that have provided valuable information about the organization and function of genomes. Here, we provide an introduction to ChIP and discuss the applications of ChIP in different research areas. We also review some of the strategies that have been devised to improve ChIP performance.

  7. ChAMP: updated methylation analysis pipeline for Illumina BeadChips.

    PubMed

    Tian, Yuan; Morris, Tiffany J; Webster, Amy P; Yang, Zhen; Beck, Stephan; Feber, Andrew; Teschendorff, Andrew E

    2017-12-15

    The Illumina Infinium HumanMethylationEPIC BeadChip is the new platform for high-throughput DNA methylation analysis, effectively doubling the coverage compared to the older 450 K array. Here we present a significantly updated and improved version of the Bioconductor package ChAMP, which can be used to analyze EPIC and 450k data. Many enhanced functionalities have been added, including correction for cell-type heterogeneity, network analysis and a series of interactive graphical user interfaces. ChAMP is a BioC package available from https://bioconductor.org/packages/release/bioc/html/ChAMP.html. a.teschendorff@ucl.ac.uk or s.beck@ucl.ac.uk or a.feber@ucl.ac.uk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  8. Purification and preconcentration of genomic DNA from whole cell lysates using photoactivated polycarbonate (PPC) microfluidic chips

    PubMed Central

    Witek, Małgorzata A.; Llopis, Shawn D.; Wheatley, Abigail; McCarley, Robin L.; Soper, Steven A.

    2006-01-01

    We discuss the use of a photoactivated polycarbonate (PPC) microfluidic chip for the solid-phase, reversible immobilization (SPRI) and purification of genomic DNA (gDNA) from whole cell lysates. The surface of polycarbonate was activated by UV radiation resulting in a photo-oxidation reaction, which produced a channel surface containing carboxylate groups. The gDNA was selectively captured on this photoactivated surface in an immobilization buffer, which consisted of 3% polyethylene glycol, 0.4 M NaCl and 70% ethanol. The methodology reported herein is similar to conventional SPRI in that surface-confined carboxylate groups are used for the selective immobilization of DNA; however, no magnetic beads or a magnetic field are required. As observed by UV spectroscopy, a load of ∼7.6 ± 1.6 µg/ml of gDNA was immobilized onto the PPC bed. The recovery of DNA following purification was estimated to be 85 ± 5%. The immobilization and purification assay using this PPC microchip could be performed within ∼25 min as follows: (i) DNA immobilization ∼6 min, (ii) chip washout with ethanol 10 min, and (iii) drying and gDNA desorption ∼6 min. The PPC microchip could also be used for subsequent assays with no substantial loss in recovery, no observable carryover and no need for ‘reactivation’ of the PC surface with UV light. PMID:16757572

  9. Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

    NASA Astrophysics Data System (ADS)

    Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang

    2013-09-01

    A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL-1 to 10 ng mL-1. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

  10. Structure of the human gastric bacterial community in relation to Helicobacter pylori status.

    PubMed

    Maldonado-Contreras, Ana; Goldfarb, Kate C; Godoy-Vitorino, Filipa; Karaoz, Ulas; Contreras, Mónica; Blaser, Martin J; Brodie, Eoin L; Dominguez-Bello, Maria G

    2011-04-01

    The human stomach is naturally colonized by Helicobacter pylori, which, when present, dominates the gastric bacterial community. In this study, we aimed to characterize the structure of the bacterial community in the stomach of patients of differing H. pylori status. We used a high-density 16S rRNA gene microarray (PhyloChip, Affymetrix, Inc.) to hybridize 16S rRNA gene amplicons from gastric biopsy DNA of 10 rural Amerindian patients from Amazonas, Venezuela, and of two immigrants to the United States (from South Asia and Africa, respectively). H. pylori status was determined by PCR amplification of H. pylori glmM from gastric biopsy samples. Of the 12 patients, 8 (6 of the 10 Amerindians and the 2 non-Amerindians) were H. pylori glmM positive. Regardless of H. pylori status, the PhyloChip detected Helicobacteriaceae DNA in all patients, although with lower relative abundance in patients who were glmM negative. The G2-chip taxonomy analysis of PhyloChip data indicated the presence of 44 bacterial phyla (of which 16 are unclassified by the Taxonomic Outline of the Bacteria and Archaea taxonomy) in a highly uneven community dominated by only four phyla: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Positive H. pylori status was associated with increased relative abundance of non-Helicobacter bacteria from the Proteobacteria, Spirochetes and Acidobacteria, and with decreased abundance of Actinobacteria, Bacteroidetes and Firmicutes. The PhyloChip detected richness of low abundance phyla, and showed marked differences in the structure of the gastric bacterial community according to H. pylori status.

  11. Carbodiimide-mediated immobilization of acidic biomolecules on reversed-charge zwitterionic sensor chip surfaces.

    PubMed

    Risse, Fabian; Gedig, Erk T; Gutmann, Jochen S

    2018-04-30

    The carbodiimide-mediated amine coupling of protein ligands to sensor chips coated with anionic polycarboxylate hydrogels, such as carboxymethyl dextran, is the predominant covalent immobilization procedure utilized in optical biosensors, namely surface plasmon resonance (SPR) biosensors. Usually, electrostatic interactions at a slightly acidic pH and low ionic strength are employed to efficiently accumulate neutral and basic ligands on the chip surface, which are then covalently coupled by surface-bound active N-hydroxysuccinimide (NHS) esters. Unfortunately, this approach is not suitable for acidic proteins or other ligands with low isoelectric points (IEPs), such as nucleic acids, because the charge density of the polycarboxylates is greatly reduced at acidic pH or because electrostatic attraction cannot be achieved. To overcome these drawbacks, we have established a charge-reversal approach that allows the preconcentration of acidic proteins above their IEPs. A precisely controlled amount of tertiary amines is applied to reverse the previous anionic surface charge while maintaining carbodiimide compatibility with future protein immobilization. The mechanism of this reversed-charge immobilization approach was demonstrated employing protein A as a model protein and using attenuated total reflectance Fourier transform infrared spectroscopy, dynamic contact angle measurements, colorimetric quantification, and SPR analysis to characterize surface derivatization. Furthermore, even though it had previously proven impossible to preconcentrate DNA electrostatically and to covalently couple it to polyanionic chip surfaces, we demonstrated that our approach allowed DNA to be preconcentrated and immobilized in good yields. Graphical abstract Principle of the covalent immobilization of acidic ligands on reversed-charge zwitterionic sensor chip surfaces.

  12. Structure of the human gastric bacterial community in relation to Helicobacter pylori status

    PubMed Central

    Maldonado-Contreras, Ana; Goldfarb, Kate C; Godoy-Vitorino, Filipa; Karaoz, Ulas; Contreras, Mónica; Blaser, Martin J; Brodie, Eoin L; Dominguez-Bello, Maria G

    2011-01-01

    The human stomach is naturally colonized by Helicobacter pylori, which, when present, dominates the gastric bacterial community. In this study, we aimed to characterize the structure of the bacterial community in the stomach of patients of differing H. pylori status. We used a high-density 16S rRNA gene microarray (PhyloChip, Affymetrix, Inc.) to hybridize 16S rRNA gene amplicons from gastric biopsy DNA of 10 rural Amerindian patients from Amazonas, Venezuela, and of two immigrants to the United States (from South Asia and Africa, respectively). H. pylori status was determined by PCR amplification of H. pylori glmM from gastric biopsy samples. Of the 12 patients, 8 (6 of the 10 Amerindians and the 2 non-Amerindians) were H. pylori glmM positive. Regardless of H. pylori status, the PhyloChip detected Helicobacteriaceae DNA in all patients, although with lower relative abundance in patients who were glmM negative. The G2-chip taxonomy analysis of PhyloChip data indicated the presence of 44 bacterial phyla (of which 16 are unclassified by the Taxonomic Outline of the Bacteria and Archaea taxonomy) in a highly uneven community dominated by only four phyla: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Positive H. pylori status was associated with increased relative abundance of non-Helicobacter bacteria from the Proteobacteria, Spirochetes and Acidobacteria, and with decreased abundance of Actinobacteria, Bacteroidetes and Firmicutes. The PhyloChip detected richness of low abundance phyla, and showed marked differences in the structure of the gastric bacterial community according to H. pylori status. PMID:20927139

  13. Ultra-High-Speed DNA Fragment Separations Using Microfabricated Capillary Array Electrophoresis Chips

    NASA Astrophysics Data System (ADS)

    Woolley, Adam T.; Mathies, Richard A.

    1994-11-01

    Capillary electrophoresis arrays have been fabricated on planar glass substrates by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns were etched in a glass substrate, and then capillaries were formed by thermally bonding the etched substrate to a second glass slide. High-resolution electrophoretic separations of φX174 Hae III DNA restriction fragments have been performed with these chips using a hydroxyethyl cellulose sieving matrix in the channels. DNA fragments were fluorescently labeled with dye in the running buffer and detected with a laser-excited, confocal fluorescence system. The effects of variations in the electric field, procedures for injection, and sizes of separation and injection channels (ranging from 30 to 120 μm) have been explored. By use of channels with an effective length of only 3.5 cm, separations of φX174 Hae III DNA fragments from ≈70 to 1000 bp are complete in only 120 sec. We have also demonstrated high-speed sizing of PCR-amplified HLA-DQα alleles. This work establishes methods for high-speed, high-throughput DNA separations on capillary array electrophoresis chips.

  14. THE MELTING MECHANISM OF DNA TETHERED TO A SURFACE

    PubMed Central

    QAMHIEH, KHAWLA; WONG, KA-YIU; LYNCH, GILLIAN C.; PETTITT, B. MONTGOMERY

    2009-01-01

    The details of melting of DNA immobilized on a chip or nanoparticle determines the sensitivity and operating characteristics of many analytical and synthetic biotechnological devices. Yet, little is known about the differences in how the DNA melting occurs between a homogeneous solution and that on a chip. We used molecular dynamics simulations to explore possible pathways for DNA melting on a chip. Simulation conditions were chosen to ensure that melting occurred in a submicrosecond timescale. The temperature was set to 400 K and the NaCl concentration was set to 0.1 M. We found less symmetry than in the solution case where for oligomeric double-stranded nucleic acids both ends melted with roughly equal probability. On a prepared silica surface we found melting is dominated by fraying from the end away from the surface. Strand separation was hindered by nonspecific surface adsorption at this temperature. At elevated temperatures the melted DNA was attracted to even uncharged organically coated surfaces demonstrating surface fouling. While hybridization is not the simple reverse of melting, this simulation has implications for the kinetics of hybridization. PMID:19802357

  15. Ultralocalized thermal reactions in subnanoliter droplets-in-air.

    PubMed

    Salm, Eric; Guevara, Carlos Duarte; Dak, Piyush; Dorvel, Brian Ross; Reddy, Bobby; Alam, Muhammad Ashraf; Bashir, Rashid

    2013-02-26

    Miniaturized laboratory-on-chip systems promise rapid, sensitive, and multiplexed detection of biological samples for medical diagnostics, drug discovery, and high-throughput screening. Within miniaturized laboratory-on-chips, static and dynamic droplets of fluids in different immiscible media have been used as individual vessels to perform biochemical reactions and confine the products. Approaches to perform localized heating of these individual subnanoliter droplets can allow for new applications that require parallel, time-, and space-multiplex reactions on a single integrated circuit. Our method positions droplets on an array of individual silicon microwave heaters on chip to precisely control the temperature of droplets-in-air, allowing us to perform biochemical reactions, including DNA melting and detection of single base mismatches. We also demonstrate that ssDNA probe molecules can be placed on heaters in solution, dried, and then rehydrated by ssDNA target molecules in droplets for hybridization and detection. This platform enables many applications in droplets including hybridization of low copy number DNA molecules, lysing of single cells, interrogation of ligand-receptor interactions, and rapid temperature cycling for amplification of DNA molecules.

  16. DNA transformation via local heat shock

    NASA Astrophysics Data System (ADS)

    Li, Sha; Meadow Anderson, L.; Yang, Jui-Ming; Lin, Liwei; Yang, Haw

    2007-07-01

    This work describes transformation of foreign DNA into bacterial host cells by local heat shock using a microfluidic system with on-chip, built-in platinum heaters. Plasmid DNA encoding ampicillin resistance and a fluorescent protein can be effectively transformed into the DH5α chemically competent E. coli using this device. Results further demonstrate that only one-thousandth of volume is required to obtain transformation efficiencies as good as or better than conventional practices. As such, this work complements other lab-on-a-chip technologies for potential gene cloning/therapy and protein expression applications.

  17. Single molecule actuation and detection on a lab-on-a-chip magnetoresistive platform

    NASA Astrophysics Data System (ADS)

    Chaves, R. C.; Bensimon, D.; Freitas, P. P.

    2011-03-01

    On-chip magnetic tweezers based on current loops were integrated with magnetoresistive sensors. Magnetic forces up to 1.0±0.3pN are produced to actuate on DNA anchored to the surface of a flow cell and labeled with micrometer-sized magnetic beads. The levitation of the beads stretches the immobilized DNA. The relative position of the magnetic beads is monitored using spin-valve sensors. A bead vertical displacement resolution of 60nm is derived for DNA molecular motor activity in a tweezer steady current regime.

  18. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  19. A microfluidic chip containing a molecularly imprinted polymer and a DNA aptamer for voltammetric determination of carbofuran.

    PubMed

    Li, Shuhuai; Li, Jianping; Luo, Jinhui; Xu, Zhi; Ma, Xionghui

    2018-05-11

    An electrochemical microfluidic chip is described for the determination of the insecticide carbofuran. It is making use of a molecularly imprinted film (MIP) and a DNA aptamer as dual recognition units. The analyte (carbofuran) is transported to the MIP and captured at the identification site in the channel. Then, carbofuran is eluted with carbinol-acetic acid and transported to the DNA aptamer on the testing position of the chip. It is captured again, this time by the aptamer, and detected by differential pulse voltammetry (DPV). The dual recognition (by aptamer and MIP) results in outstanding selectivity. Additionally, graphene oxide-supported gold nanoparticles (GO-AuNPs) were used to improve the sensitivity of electrochemical detector. DPV response is linear in the 0.2 to 50 nM carbofuran concentration range at a potential of -1.2 V, with a 67 pM detection limit. The method has attractive features such as its potential for high throughput, high degree of automation, and high integration. Conceivably, the method may be extended to other analytes for which appropriate MIPs and aptamers are available. Graphical abstract Schematic of an electrochemical microfluidic chip for carbofuran detection based on a molecularly imprinted film (MIP) and a DNA aptamer as dual recognition units. In the chip, targets were recognized by MIP and aptamer, respectively. It shows promising potential for the design of electrochemical devices with high throughput, high automation, and high integration.

  20. DNA Clutch Probes for Circulating Tumor DNA Analysis.

    PubMed

    Das, Jagotamoy; Ivanov, Ivaylo; Sargent, Edward H; Kelley, Shana O

    2016-08-31

    Progress toward the development of minimally invasive liquid biopsies of disease is being bolstered by breakthroughs in the analysis of circulating tumor DNA (ctDNA): DNA released from cancer cells into the bloodstream. However, robust, sensitive, and specific methods of detecting this emerging analyte are lacking. ctDNA analysis has unique challenges, since it is imperative to distinguish circulating DNA from normal cells vs mutation-bearing sequences originating from tumors. Here we report the electrochemical detection of mutated ctDNA in samples collected from cancer patients. By developing a strategy relying on the use of DNA clutch probes (DCPs) that render specific sequences of ctDNA accessible, we were able to readout the presence of mutated ctDNA. DCPs prevent reassociation of denatured DNA strands: they make one of the two strands of a dsDNA accessible for hybridization to a probe, and they also deactivate other closely related sequences in solution. DCPs ensure thereby that only mutated sequences associate with chip-based sensors detecting hybridization events. The assay exhibits excellent sensitivity and specificity in the detection of mutated ctDNA: it detects 1 fg/μL of a target mutation in the presence of 100 pg/μL of wild-type DNA, corresponding to detecting mutations at a level of 0.01% relative to wild type. This approach allows accurate analysis of samples collected from lung cancer and melanoma patients. This work represents the first detection of ctDNA without enzymatic amplification.

  1. Course 10: Three Lectures on Biological Networks

    NASA Astrophysics Data System (ADS)

    Magnasco, M. O.

    1 Enzymatic networks. Proofreading knots: How DNA topoisomerases disentangle DNA 1.1 Length scales and energy scales 1.2 DNA topology 1.3 Topoisomerases 1.4 Knots and supercoils 1.5 Topological equilibrium 1.6 Can topoisomerases recognize topology? 1.7 Proposal: Kinetic proofreading 1.8 How to do it twice 1.9 The care and proofreading of knots 1.10 Suppression of supercoils 1.11 Problems and outlook 1.12 Disquisition 2 Gene expression networks. Methods for analysis of DNA chip experiments 2.1 The regulation of gene expression 2.2 Gene expression arrays 2.3 Analysis of array data 2.4 Some simplifying assumptions 2.5 Probeset analysis 2.6 Discussion 3 Neural and gene expression networks: Song-induced gene expression in the canary brain 3.1 The study of songbirds 3.2 Canary song 3.3 ZENK 3.4 The blush 3.5 Histological analysis 3.6 Natural vs. artificial 3.7 The Blush II: gAP 3.8 Meditation

  2. Multienzyme-nanoparticles amplification for sensitive virus genotyping in microfluidic microbeads array using Au nanoparticle probes and quantum dots as labels.

    PubMed

    Zhang, He; Liu, Lian; Li, Cheuk-Wing; Fu, Huayang; Chen, Yao; Yang, Mengsu

    2011-11-15

    A novel microfluidic device with microbeads array was developed and sensitive genotyping of human papillomavirus was demonstrated using a multiple-enzyme labeled oligonucleotide-Au nanoparticle bioconjugate as the detection tool. This method utilizes microbeads as sensing platform that was functionalized with the capture probes and modified electron rich proteins, and uses the horseradish peroxidase (HRP)-functionalized gold nanoparticles as label with a secondary DNA probe. The functionalized microbeads were independently introduced into the arrayed chambers using the loading chip slab. A single channel was used to generate weir structures to confine the microbeads and make the beads array accessible by microfluidics. Through "sandwich" hybridization, the enzyme-functionalized Au nanoparticles labels were brought close to the surface of microbeads. The oxidation of biotin-tyramine by hydrogen peroxide resulted in the deposition of multiple biotin moieties onto the surface of beads. This deposition is markedly increased in the presence of immobilized electron rich proteins. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Enhanced detection sensitivity was achieved where the large surface area of Au nanoparticle carriers increased the amount HRP bound per sandwiched hybridization. The on-chip genotyping method could discriminate as low as 1fmol/L (10zmol/chip, SNR>3) synthesized HPV oligonucleotides DNA. The chip-based signal enhancement of the amplified assay resulted in 1000 times higher sensitivity than that of off-chip test. In addition, this on-chip format could discriminate and genotype 10copies/μL HPV genomic DNA using the PCR products. These results demonstrated that this on-chip approach can achieve highly sensitive detection and genotyping of target DNA and can be further developed for detection of disease-related biomolecules at the lowest level at their earliest incidence. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Single cell digital polymerase chain reaction on self-priming compartmentalization chip

    PubMed Central

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

  4. Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

    PubMed

    Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

    2017-01-01

    Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

  5. Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    NASA Astrophysics Data System (ADS)

    Langer, Andreas; Schräml, Michael; Strasser, Ralf; Daub, Herwin; Myers, Thomas; Heindl, Dieter; Rant, Ulrich

    2015-07-01

    The engineering of high-performance enzymes for future sequencing and PCR technologies as well as the development of many anticancer drugs requires a detailed analysis of DNA/RNA synthesis processes. However, due to the complex molecular interplay involved, real-time methodologies have not been available to obtain comprehensive information on both binding parameters and enzymatic activities. Here we introduce a chip-based method to investigate polymerases and their interactions with nucleic acids, which employs an electrical actuation of DNA templates on microelectrodes. Two measurement modes track both the dynamics of the induced switching process and the DNA extension simultaneously to quantitate binding kinetics, dissociation constants and thermodynamic energies. The high sensitivity of the method reveals previously unidentified tight binding states for Taq and Pol I (KF) DNA polymerases. Furthermore, the incorporation of label-free nucleotides can be followed in real-time and changes in the DNA polymerase conformation (finger closing) during enzymatic activity are observable.

  6. Large-scale analysis of antisense transcription in wheat using the Affymetrix GeneChip Wheat Genome Array

    USDA-ARS?s Scientific Manuscript database

    Natural antisense transcripts (NATs) are transcripts of the opposite DNA strand to the sense-strand either at the same locus (cis-encoded) or a different locus (trans-encoded). They can affect gene expression at multiple stages including transcription, RNA processing and transport, and translation....

  7. Chip-Based Sensors for Disease Diagnosis

    NASA Astrophysics Data System (ADS)

    Fang, Zhichao

    Nucleic acid analysis is one of the most important disease diagnostic approaches in medical practice, and has been commonly used in cancer biomarker detection, bacterial speciation and many other fields in laboratory. Currently, the application of powerful research methods for genetic analysis, including the polymerase chain reaction (PCR), DNA sequencing, and gene expression profiling using fluorescence microarrays, are not widely used in hospitals and extended-care units due to high-cost, long detection times, and extensive sample preparation. Bioassays, especially chip-based electrochemical sensors, may be suitable for the next generation of rapid, sensitive, and multiplexed detection tools. Herein, we report three different microelectrode platforms with capabilities enabled by nano- and microtechnology: nanoelectrode ensembles (NEEs), nanostructured microelectrodes (NMEs), and hierarchical nanostructured microelectrodes (HNMEs), all of which are able to directly detect unpurified RNA in clinical samples without enzymatic amplification. Biomarkers that are cancer and infectious disease relevant to clinical medicine were chosen to be the targets. Markers were successfully detected with clinically-relevant sensitivity. Using peptide nucleic acids (PNAs) as probes and an electrocatalytic reporter system, NEEs were able to detect prostate cancer-related gene fusions in tumor tissue samples with 100 ng of RNA. The development of NMEs improved the sensitivity of the assay further to 10 aM of DNA target, and multiplexed detection of RNA sequences of different prostate cancer-related gene fusion types was achieved on the chip-based NMEs platform. An HNMEs chip integrated with a bacterial lysis device was able to detect as few as 25 cfu bacteria in 30 minutes and monitor the detection in real time. Bacterial detection could also be performed in neat urine samples. The development of these versatile clinical diagnostic tools could be extended to the detection of various cancers, genetic, and infectious diseases.

  8. Quantized correlation coefficient for measuring reproducibility of ChIP-chip data.

    PubMed

    Peng, Shouyong; Kuroda, Mitzi I; Park, Peter J

    2010-07-27

    Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip) is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. We develop the Quantized correlation coefficient (QCC) that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization), a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.

  9. On-Chip Synthesis of Protein Microarrays from DNA Microarrays Via Coupled In Vitro Transcription and Translation for Surface Plasmon Resonance Imaging Biosensor Applications

    PubMed Central

    Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.

    2012-01-01

    Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370

  10. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  11. Application of Microchip for Biomarker Analysis

    NASA Astrophysics Data System (ADS)

    Kataoka, Masatoshi; Yatsushiro, Shouki; Yamamura, Shouhei; Abe, Hiroko

    Microchip technologies have received considerable attention, due to their competitive advantages, especially in regards to reduced sample and reagent consumption, analysis time, and easy operation. This approach has been successfully used to analyze DNA, amino acids, proteins, and carbohydrates. In the present study, we showed the potential of microchip technologies for the biomarker analysis, blood carbohydrate analysis on microchip electrophoresis, quantitative analysis of protein with antigen-antibody reaction on microchip, and the detection of malaria-infected erythrocyte with a cell microarray chip.

  12. Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and MethylationEPIC data processing.

    PubMed

    Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

    2016-12-18

    Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

  13. Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

    PubMed

    Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

    2018-02-02

    Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

  14. Development of an Integrated Chip for Automatic Tracking and Positioning Manipulation for Single Cell Lysis

    PubMed Central

    Young, Chao-Wang; Hsieh, Jia-Ling; Ay, Chyung

    2012-01-01

    This study adopted a microelectromechanical fabrication process to design a chip integrated with electroosmotic flow and dielectrophoresis force for single cell lysis. Human histiocytic lymphoma U937 cells were driven rapidly by electroosmotic flow and precisely moved to a specific area for cell lysis. By varying the frequency of AC power, 15 V AC at 1 MHz of frequency configuration achieved 100% cell lysing at the specific area. The integrated chip could successfully manipulate single cells to a specific position and lysis. The overall successful rate of cell tracking, positioning, and cell lysis is 80%. The average speed of cell driving was 17.74 μm/s. This technique will be developed for DNA extraction in biomolecular detection. It can simplify pre-treatment procedures for biotechnological analysis of samples. PMID:22736957

  15. Development of an integrated chip for automatic tracking and positioning manipulation for single cell lysis.

    PubMed

    Young, Chao-Wang; Hsieh, Jia-Ling; Ay, Chyung

    2012-01-01

    This study adopted a microelectromechanical fabrication process to design a chip integrated with electroosmotic flow and dielectrophoresis force for single cell lysis. Human histiocytic lymphoma U937 cells were driven rapidly by electroosmotic flow and precisely moved to a specific area for cell lysis. By varying the frequency of AC power, 15 V AC at 1 MHz of frequency configuration achieved 100% cell lysing at the specific area. The integrated chip could successfully manipulate single cells to a specific position and lysis. The overall successful rate of cell tracking, positioning, and cell lysis is 80%. The average speed of cell driving was 17.74 μm/s. This technique will be developed for DNA extraction in biomolecular detection. It can simplify pre-treatment procedures for biotechnological analysis of samples.

  16. Global Mapping of Transcription Factor Binding Sites by Sequencing Chromatin Surrogates: a Perspective on Experimental Design, Data Analysis, and Open Problems.

    PubMed

    Wei, Yingying; Wu, George; Ji, Hongkai

    2013-05-01

    Mapping genome-wide binding sites of all transcription factors (TFs) in all biological contexts is a critical step toward understanding gene regulation. The state-of-the-art technologies for mapping transcription factor binding sites (TFBSs) couple chromatin immunoprecipitation (ChIP) with high-throughput sequencing (ChIP-seq) or tiling array hybridization (ChIP-chip). These technologies have limitations: they are low-throughput with respect to surveying many TFs. Recent advances in genome-wide chromatin profiling, including development of technologies such as DNase-seq, FAIRE-seq and ChIP-seq for histone modifications, make it possible to predict in vivo TFBSs by analyzing chromatin features at computationally determined DNA motif sites. This promising new approach may allow researchers to monitor the genome-wide binding sites of many TFs simultaneously. In this article, we discuss various experimental design and data analysis issues that arise when applying this approach. Through a systematic analysis of the data from the Encyclopedia Of DNA Elements (ENCODE) project, we compare the predictive power of individual and combinations of chromatin marks using supervised and unsupervised learning methods, and evaluate the value of integrating information from public ChIP and gene expression data. We also highlight the challenges and opportunities for developing novel analytical methods, such as resolving the one-motif-multiple-TF ambiguity and distinguishing functional and non-functional TF binding targets from the predicted binding sites. The online version of this article (doi:10.1007/s12561-012-9066-5) contains supplementary material, which is available to authorized users.

  17. Droplet-based microfluidic analysis and screening of single plant cells.

    PubMed

    Yu, Ziyi; Boehm, Christian R; Hibberd, Julian M; Abell, Chris; Haseloff, Jim; Burgess, Steven J; Reyna-Llorens, Ivan

    2018-01-01

    Droplet-based microfluidics has been used to facilitate high-throughput analysis of individual prokaryote and mammalian cells. However, there is a scarcity of similar workflows applicable to rapid phenotyping of plant systems where phenotyping analyses typically are time-consuming and low-throughput. We report on-chip encapsulation and analysis of protoplasts isolated from the emergent plant model Marchantia polymorpha at processing rates of >100,000 cells per hour. We use our microfluidic system to quantify the stochastic properties of a heat-inducible promoter across a population of transgenic protoplasts to demonstrate its potential for assessing gene expression activity in response to environmental conditions. We further demonstrate on-chip sorting of droplets containing YFP-expressing protoplasts from wild type cells using dielectrophoresis force. This work opens the door to droplet-based microfluidic analysis of plant cells for applications ranging from high-throughput characterisation of DNA parts to single-cell genomics to selection of rare plant phenotypes.

  18. Comparison of Four Human Papillomavirus Genotyping Methods: Next-generation Sequencing, INNO-LiPA, Electrochemical DNA Chip, and Nested-PCR.

    PubMed

    Nilyanimit, Pornjarim; Chansaenroj, Jira; Poomipak, Witthaya; Praianantathavorn, Kesmanee; Payungporn, Sunchai; Poovorawan, Yong

    2018-03-01

    Human papillomavirus (HPV) infection causes cervical cancer, thus necessitating early detection by screening. Rapid and accurate HPV genotyping is crucial both for the assessment of patients with HPV infection and for surveillance studies. Fifty-eight cervicovaginal samples were tested for HPV genotypes using four methods in parallel: nested-PCR followed by conventional sequencing, INNO-LiPA, electrochemical DNA chip, and next-generation sequencing (NGS). Seven HPV genotypes (16, 18, 31, 33, 45, 56, and 58) were identified by all four methods. Nineteen HPV genotypes were detected by NGS, but not by nested-PCR, INNO-LiPA, or electrochemical DNA chip. Although NGS is relatively expensive and complex, it may serve as a sensitive HPV genotyping method. Because of its highly sensitive detection of multiple HPV genotypes, NGS may serve as an alternative for diagnostic HPV genotyping in certain situations. © The Korean Society for Laboratory Medicine

  19. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

    NASA Astrophysics Data System (ADS)

    Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

    2011-09-01

    Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells.

  20. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

    PubMed Central

    Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

    2011-01-01

    Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. PMID:21974603

  1. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins.

    PubMed

    Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R

    2011-09-01

    Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. © 2011 American Institute of Physics

  2. Integrated microfluidic systems for cell lysis, mixing/pumping and DNA amplification

    NASA Astrophysics Data System (ADS)

    Lee, Chia-Yen; Lee, Gwo-Bin; Lin, Jr-Lung; Huang, Fu-Chun; Liao, Chia-Sheng

    2005-06-01

    The present paper reports a fully automated microfluidic system for the DNA amplification process by integrating an electroosmotic pump, an active micromixer and an on-chip temperature control system. In this DNA amplification process, the cell lysis is initially performed in a micro cell lysis reactor. Extracted DNA samples, primers and reagents are then driven electroosmotically into a mixing region where they are mixed by the active micromixer. The homogeneous mixture is then thermally cycled in a micro-PCR (polymerase chain reaction) chamber to perform DNA amplification. Experimental results show that the proposed device can successfully automate the sample pretreatment operation for DNA amplification, thereby delivering significant time and effort savings. The new microfluidic system, which facilitates cell lysis, sample driving/mixing and DNA amplification, could provide a significant contribution to ongoing efforts to miniaturize bio-analysis systems by utilizing a simple fabrication process and cheap materials.

  3. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids.

    PubMed

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.

  4. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids

    PubMed Central

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005

  5. On-chip electrical detection of parallel loop-mediated isothermal amplification with DG-BioFETs for the detection of foodborne bacterial pathogens

    USDA-ARS?s Scientific Manuscript database

    The use of field effect transistors (FETs) as the transduction element for the detection of DNA amplification reactions will enable portable and inexpensive nucleic acid analysis. Transistors used as biological sensors,or BioFETs, minimize the cost and size of detection platforms by leveraging fabri...

  6. [Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

    PubMed

    Iván, Kristóf; Maráz, Anna

    2015-12-20

    Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

  7. Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

    NASA Technical Reports Server (NTRS)

    Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

    2004-01-01

    There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

  8. Open microfluidic gel electrophoresis: Rapid and low cost separation and analysis of DNA at the nanoliter scale.

    PubMed

    Gutzweiler, Ludwig; Gleichmann, Tobias; Tanguy, Laurent; Koltay, Peter; Zengerle, Roland; Riegger, Lutz

    2017-07-01

    Gel electrophoresis is one of the most applied and standardized tools for separation and analysis of macromolecules and their fragments in academic research and in industry. In this work we present a novel approach for conducting on-demand electrophoretic separations of DNA molecules in open microfluidic (OM) systems on planar polymer substrates. The approach combines advantages of slab gel, capillary- and chip-based methods offering low consumable costs (<0.1$) circumventing cost-intensive microfluidic chip fabrication, short process times (5 min per analysis) and high sensitivity (4 ng/μL dsDNA) combined with reasonable resolution (17 bases). The open microfluidic separation system comprises two opposing reservoirs of 2-4 μL in volume, a semi-contact written gel line acting as separation channel interconnecting the reservoirs and sample injected into the line via non-contact droplet dispensing and thus enabling the precise control of the injection plug and sample concentration. Evaporation is prevented by covering aqueous structures with PCR-grade mineral oil while maintaining surface temperature at 15°C. The liquid gel line exhibits a semi-circular cross section of adaptable width (∼200-600 μm) and height (∼30-80 μm) as well as a typical length of 15-55 mm. Layout of such liquid structures is adaptable on-demand not requiring time consuming and repetitive fabrication steps. The approach was successfully demonstrated by the separation of a standard label-free DNA ladder (100-1000 bp) at 100 V/cm via in-line staining and laser induced fluorescent end-point detection using an automated prototype. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. An integrated semiconductor device enabling non-optical genome sequencing.

    PubMed

    Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

    2011-07-20

    The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

  10. Lab on a chip genotyping for Brucella spp. based on 15-loci multi locus VNTR analysis.

    PubMed

    De Santis, Riccardo; Ciammaruconi, Andrea; Faggioni, Giovanni; D'Amelio, Raffaele; Marianelli, Cinzia; Lista, Florigio

    2009-04-07

    Brucellosis is an important zoonosis caused by the genus Brucella. In addition Brucella represents potential biological warfare agents due to the high contagious rates for humans and animals. Therefore, the strain typing epidemiological tool may be crucial for tracing back source of infection in outbreaks and discriminating naturally occurring outbreaks versus bioterroristic event. A Multiple Locus Variable-number tandem repeats (VNTR) Analysis (MLVA) assay based on 15 polymorphic markers was previously described. The obtained MLVA band profiles may be resolved by techniques ranging from low cost manual agarose gels to the more expensive capillary electrophoresis sequencing. In this paper a rapid, accurate and reproducible system, based on the Lab on a chip technology was set up for Brucella spp. genotyping. Seventeen DNA samples of Brucella strains isolated in Sicily, previously genotyped, and twelve DNA samples, provided by MLVA Brucella VNTR ring trial, were analyzed by MLVA-15 on Agilent 2100. The DNA fragment sizes produced by Agilent, compared with those expected, showed discrepancies; therefore, in order to assign the correct alleles to the Agilent DNA fragment sizes, a conversion table was produced. In order to validate the system twelve unknown DNA samples were analyzed by this method obtaining a full concordance with the VNTR ring trial results. In this paper we described a rapid and specific detection method for the characterization of Brucella isolates. The comparison of the MLVA typing data produced by Agilent system with the data obtained by standard sequencing or ethidium bromide slab gel electrophoresis showed a general concordance of the results. Therefore this platform represents a fair compromise among costs, speed and specificity compared to any conventional molecular typing technique.

  11. Real-time Tracking of DNA Fragment Separation by Smartphone.

    PubMed

    Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

    2017-06-01

    Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

  12. Programming Cell Adhesion for On-Chip Sequential Boolean Logic Functions.

    PubMed

    Qu, Xiangmeng; Wang, Shaopeng; Ge, Zhilei; Wang, Jianbang; Yao, Guangbao; Li, Jiang; Zuo, Xiaolei; Shi, Jiye; Song, Shiping; Wang, Lihua; Li, Li; Pei, Hao; Fan, Chunhai

    2017-08-02

    Programmable remodelling of cell surfaces enables high-precision regulation of cell behavior. In this work, we developed in vitro constructed DNA-based chemical reaction networks (CRNs) to program on-chip cell adhesion. We found that the RGD-functionalized DNA CRNs are entirely noninvasive when interfaced with the fluidic mosaic membrane of living cells. DNA toehold with different lengths could tunably alter the release kinetics of cells, which shows rapid release in minutes with the use of a 6-base toehold. We further demonstrated the realization of Boolean logic functions by using DNA strand displacement reactions, which include multi-input and sequential cell logic gates (AND, OR, XOR, and AND-OR). This study provides a highly generic tool for self-organization of biological systems.

  13. A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

    PubMed

    Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

    2015-07-07

    Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

  14. Nucleic acid extraction techniques and application to the microchip.

    PubMed

    Price, Carol W; Leslie, Daniel C; Landers, James P

    2009-09-07

    As recently as the early 1990s, DNA purification was time-consuming, requiring the use of toxic, hazardous reagents. The advent of solid phase extraction techniques and the availability of commercial kits for quick and reliable DNA extraction has relegated those early techniques largely to the history books. High quality DNA can now be extracted from whole blood, serum, saliva, urine, stool, cerebral spinal fluid, tissues, and cells in less time without sacrificing recovery. Having achieved such a radical change in the methodology of DNA extraction, focus has shifted to adapting these methods to a miniaturized system, or "lab-on-a-chip" (A. Manz, N. Graber and H. M. Widmer, Sens. Actuators, B, 1990, 1, 244-248). Manz et al.'s concept of a "miniaturized total chemical analysis system" (microTAS) involved a silicon chip that incorporated sample pretreatment, separation and detection. This review will focus on the first of these steps, sample pretreatment in the form of DNA purification. The intention of this review is to provide an overview of the fundamentals of nucleic acid purification and solid phase extraction (SPE) and to discuss specific microchip DNA extraction successes and challenges. In order to fully appreciate the advances in DNA purification, a brief review of the history of DNA extraction is provided so that the reader has an understanding of the impact that the development of SPE techniques have had. This review will highlight the different methods of nucleic acid extraction (Table 1), including relevant citations, but without an exhaustive summary of the literature. A recent review by Wen et al. (J. Wen, L. A. Legendre, J. M. Bienvenue and J. P. Landers, Anal. Chem., 2008, 80, 6472-6479) covers solid phase extraction methods with a greater focus on their incorporation into integrated microfluidic systems.

  15. Analytical study of a microfludic DNA amplification chip using water cooling effect.

    PubMed

    Chen, Jyh Jian; Shen, Chia Ming; Ko, Yu Wei

    2013-04-01

    A novel continuous-flow polymerase chain reaction (PCR) chip has been analyzed in our work. Two temperature zones are controlled by two external controllers and the other temperature zone at the chip center is controlled by the flow rate of the fluid inside a channel under the glass chip. By employing a water cooling channel at the chip center, the sequence of denaturation, annealing, and extension can be created due to the forced convection effect. The required annealing temperature of PCR less than 313 K can also be demonstrated in this chip. The Poly(methyl methacrylate) (PMMA) cooling channel with the thin aluminum cover is utilized to enhance the temperature uniformity. The size of this chip is 76 mm × 26 mm × 3 mm. This device represents the first demonstration of water cooling thermocycling within continuous-flow PCR microfluidics. The commercial software CFD-ACE+(TM) is utilized to determine the distances between the heating assemblies within the chip. We investigate the influences of various chip materials, operational parameters of the cooling channel and geometric parameters of the chip on the temperature uniformity on the chip surface. Concerning the temperature uniformity of the working zones and the lowest temperature at the annealing zone, the air gap spacing of 1 mm and the cooling channel thicknesses of 1 mm of the PMMA channel with an aluminum cover are recommended in our design. The hydrophobic surface of the PDMS channel was modified by filling it with 20 % Tween 20 solution and then adding bovine serum albumin (BSA) solution to the PCR mixture. DNA fragments with different lengths (372 bp and 478 bp) are successfully amplified with the device.

  16. Diagnostic value of protein chips constructed by lung-cancer-associated markers selected by the T7 phage display library.

    PubMed

    Li, Hong-Mei; Guo, Kang; Yu, Zhuang; Feng, Rui; Xu, Ping

    2015-07-01

    Traditional diagnostic technology with tumor biomarkers is inefficient, expensive and requires a large number of serum samples. The purpose of this study was to construct human lung cancer protein chips with new lung cancer biomarkers screened by the T7-phage display library, and improve the early diagnosis rate of lung cancer. A T7-phage cDNA display library was constructed of fresh samples from 30 lung cancer patients. With biopanning and high-throughput screening, we gained the immunogenic phage clones from the cDNA library. The insert of selected phage was blasted at GeneBank for alignment to find the exact or the most similar known genes. Protein chips were then constructed and used to assay their expression level in lung cancer serum from 217 cases of lung cancer groups:80 cases of benign lung disease and 220 healthy controls. After four rounds of Biopanning and two rounds of enzyme-linked immunosorbent assay, 12 phage monoclonal samples were selected from 2880 phage monoclonal samples. After blasting at GeneBank, six similar genes were used to construct diagnostic protein chips. The protein chips were then used to assay expression level in lung cancer serum. The expression level of six genes in lung cancer groups was significantly higher than those in the other two groups (P < 0.05). In this study, we successfully constructed diagnostic protein chips with biomarkers selected from the lung cancer T7-phage cDNA library, which can be used for the early screening of lung cancer patients.

  17. First all-in-one diagnostic tool for DNA intelligence: genome-wide inference of biogeographic ancestry, appearance, relatedness, and sex with the Identitas v1 Forensic Chip.

    PubMed

    Keating, Brendan; Bansal, Aruna T; Walsh, Susan; Millman, Jonathan; Newman, Jonathan; Kidd, Kenneth; Budowle, Bruce; Eisenberg, Arthur; Donfack, Joseph; Gasparini, Paolo; Budimlija, Zoran; Henders, Anjali K; Chandrupatla, Hareesh; Duffy, David L; Gordon, Scott D; Hysi, Pirro; Liu, Fan; Medland, Sarah E; Rubin, Laurence; Martin, Nicholas G; Spector, Timothy D; Kayser, Manfred

    2013-05-01

    When a forensic DNA sample cannot be associated directly with a previously genotyped reference sample by standard short tandem repeat profiling, the investigation required for identifying perpetrators, victims, or missing persons can be both costly and time consuming. Here, we describe the outcome of a collaborative study using the Identitas Version 1 (v1) Forensic Chip, the first commercially available all-in-one tool dedicated to the concept of developing intelligence leads based on DNA. The chip allows parallel interrogation of 201,173 genome-wide autosomal, X-chromosomal, Y-chromosomal, and mitochondrial single nucleotide polymorphisms for inference of biogeographic ancestry, appearance, relatedness, and sex. The first assessment of the chip's performance was carried out on 3,196 blinded DNA samples of varying quantities and qualities, covering a wide range of biogeographic origin and eye/hair coloration as well as variation in relatedness and sex. Overall, 95 % of the samples (N = 3,034) passed quality checks with an overall genotype call rate >90 % on variable numbers of available recorded trait information. Predictions of sex, direct match, and first to third degree relatedness were highly accurate. Chip-based predictions of biparental continental ancestry were on average ~94 % correct (further support provided by separately inferred patrilineal and matrilineal ancestry). Predictions of eye color were 85 % correct for brown and 70 % correct for blue eyes, and predictions of hair color were 72 % for brown, 63 % for blond, 58 % for black, and 48 % for red hair. From the 5 % of samples (N = 162) with <90 % call rate, 56 % yielded correct continental ancestry predictions while 7 % yielded sufficient genotypes to allow hair and eye color prediction. Our results demonstrate that the Identitas v1 Forensic Chip holds great promise for a wide range of applications including criminal investigations, missing person investigations, and for national security purposes.

  18. Nanofluidic Lab-On-Chip Technology for DNA Identification

    DTIC Science & Technology

    2013-09-30

    samples Fluorescently labeled (FAM tag) DNA oligomers (10, 20, and 50 bases long) were purchased with standard desalting and additional HPLC purification...A.2 DNA samples: DNA oligomers (10, 20, 50 nt long) were purchased with standard desalting and additional HPLC purification for the 50 base

  19. Pulsatile release of biomolecules from polydimethylsiloxane (PDMS) chips with hydrolytically degradable seals.

    PubMed

    Intra, Janjira; Glasgow, Justin M; Mai, Hoang Q; Salem, Aliasger K

    2008-05-08

    We demonstrate, for the first time, a robust novel polydimethylsiloxane (PDMS) chip that can provide controlled pulsatile release of DNA based molecules, proteins and oligonucleotides without external stimuli or triggers. The PDMS chip with arrays of wells was constructed by replica molding. Poly(lactic acid-co-glycolic acid) (PLGA) polymer films of varying composition and thickness were used as seals to the wells. The composition, molecular weight and thickness of the PLGA films were all parameters used to control the degradation rate of the seals and therefore the release profiles. Degradation of the films followed the PLGA composition order of 50:50 PLGA>75:25 PLGA>85:15 PLGA at all time-points beyond week 1. Scanning electron microscopy images showed that films were initially smooth, became porous and ruptured as the osmotic pressure pushed the degrading PLGA film outwards. Pulsatile release of DNA was controlled by the composition and thickness of the PLGA used to seal the well. Transfection experiments in a model Human Embryonic Kidney 293 (HEK293) cell line showed that plasmid DNA loaded in the wells was functional after pulsatile release in comparison to control plasmid DNA at all time-points. Thicker films degraded faster than thinner films and could be used to fine-tune the release of DNA over day length periods. Finally the PDMS chip was shown to provide repeated sequential release of CpG oligonucleotides and a model antigen, Ovalbumin (OVA), indicating significant potential for this device for vaccinations or applications that require defined complex release patterns of a variety of chemicals, drugs and biomolecules.

  20. Scalable Low-Cost Fabrication of Disposable Paper Sensors for DNA Detection

    PubMed Central

    2015-01-01

    Controlled integration of features that enhance the analytical performance of a sensor chip is a challenging task in the development of paper sensors. A critical issue in the fabrication of low-cost biosensor chips is the activation of the device surface in a reliable and controllable manner compatible with large-scale production. Here, we report stable, well-adherent, and repeatable site-selective deposition of bioreactive amine functionalities and biorepellant polyethylene glycol-like (PEG) functionalities on paper sensors by aerosol-assisted, atmospheric-pressure, plasma-enhanced chemical vapor deposition. This approach requires only 20 s of deposition time, compared to previous reports on cellulose functionalization, which takes hours. A detailed analysis of the near-edge X-ray absorption fine structure (NEXAFS) and its sensitivity to the local electronic structure of the carbon and nitrogen functionalities. σ*, π*, and Rydberg transitions in C and N K-edges are presented. Application of the plasma-processed paper sensors in DNA detection is also demonstrated. PMID:25423585

  1. Course 8: Biological Physics in Silico

    NASA Astrophysics Data System (ADS)

    Austin, R. H.

    1 Why micro/nanofabrication? Lecture 1a: Hydrodynamic Transport 1 Introduction: The need to control flows in 2 1/2 D 2 Somewhat simple hydrodynamics in 2 1/2 D 3 The N-port injector idea 4 Conclusion Lecture 1b: Dielectrophoresis and Microfabrication 1 Introduction 2 Methods 3 Results 4 Data and analysis 5 Origin of the low frequency dielectrophoretic force in DNA 6 Conclusion Lecture 2a: Hex Arrays 1 Introduction 2 Experimental approach 3 Conclusions Lecture 2b: The DNA Prism 1 Introduction 2 Design 3 Results 4 Conclusions Lecture 2c: Bigger is Better in Rachets 1 The problems with insulators in rachets 2 An experimental test 3 Conclusions Lecture 3: Going After Epigenetics 1 Introduction 2 The nearfield scanner 3 The chip 4 Experiments with molecules 5 Conclusions Lecture 4: Fractionating Cells 1 Introduction 2 Blood specifics 3 Magnetic separation 4 Microfabrication 5 Magnetic field gradients 6 Device interface 7 A preliminary blood cell run 8 Conclusions Lecture 5: Protein Folding on a Chip 1 Introduction 2 Technology 3 Experiments 4 Conclusions

  2. Scalable Low-Cost Fabrication of Disposable Paper Sensors for DNA Detection

    DOE PAGES

    Gandhiraman, Ram P.; Nordlund, Dennis; Jayan, Vivek; ...

    2014-11-25

    Controlled integration of features that enhance the analytical performance of a sensor chip is a challenging task in the development of paper sensors. A critical issue in the fabrication of low-cost biosensor chips is the activation of the device surface in a reliable and controllable manner compatible with large-scale production. Here, we report stable, well-adherent, and repeatable site-selective deposition of bioreactive amine functionalities and biorepellant polyethylene glycol-like (PEG) functionalities on paper sensors by aerosol-assisted, atmospheric-pressure, plasma-enhanced chemical vapor deposition. This approach requires only 20 s of deposition time, compared to previous reports on cellulose functionalization, which takes hours. We presentmore » a detailed analysis of the near-edge X-ray absorption fine structure (NEXAFS) and its sensitivity to the local electronic structure of the carbon and nitrogen functionalities. σ*, π*, and Rydberg transitions in C and N K-edges. Lastly, application of the plasma-processed paper sensors in DNA detection is also demonstrated.« less

  3. PCR amplification and genetic analysis in a microwell cell culturing chip.

    PubMed

    Lindström, Sara; Hammond, Maria; Brismar, Hjalmar; Andersson-Svahn, Helene; Ahmadian, Afshin

    2009-12-21

    We have previously described a microwell chip designed for high throughput, long-term single-cell culturing and clonal analysis in individual wells providing a controlled way of studying high numbers of individual adherent or non-adherent cells. Here we present a method for the genetic analysis of cells cultured on-chip by PCR and minisequencing, demonstrated using two human adherent cell lines: one wild type and one with a single-base mutation in the p53 gene. Five wild type or mutated cells were seeded per well (in a defined set of wells, each holding 500 nL of culture medium) in a 672-microwell chip. The cell chip was incubated overnight, or cultured for up to five days, depending on the desired colony size, after which the cells were lysed and subjected to PCR directly in the wells. PCR products were detected, in the wells, using a biotinylated primer and a fluorescently labelled primer, allowing the products to be captured on streptavidin-coated magnetic beads and detected by a fluorescence microscope. In addition, to enable genetic analysis by minisequencing, the double-stranded PCR products were denatured and the immobilized strands were kept in the wells by applying a magnetic field from the bottom of the wells while the wells were washed, a minisequencing reaction mixture was added, and after incubation in appropriate conditions the expected genotypes were detected in the investigated microwells, simultaneously, by an array scanner. We anticipate that the technique could be used in mutation frequency screening, providing the ability to correlate cells' proliferative heterogeneity to their genetic heterogeneity, in hundreds of samples simultaneously. The presented method of single-cell culture and DNA amplification thus offers a potentially powerful alternative to single-cell PCR, with advantageous robustness and sensitivity.

  4. A simple method of fabricating mask-free microfluidic devices for biological analysis

    PubMed Central

    Yi, Xin; Kodzius, Rimantas; Gong, Xiuqing; Xiao, Kang; Wen, Weijia

    2010-01-01

    We report a simple, low-cost, rapid, and mask-free method to fabricate two-dimensional (2D) and three-dimensional (3D) microfluidic chip for biological analysis researches. In this fabrication process, a laser system is used to cut through paper to form intricate patterns and differently configured channels for specific purposes. Bonded with cyanoacrylate-based resin, the prepared paper sheet is sandwiched between glass slides (hydrophilic) or polymer-based plates (hydrophobic) to obtain a multilayer structure. In order to examine the chip’s biocompatibility and applicability, protein concentration was measured while DNA capillary electrophoresis was carried out, and both of them show positive results. With the utilization of direct laser cutting and one-step gas-sacrificing techniques, the whole fabrication processes for complicated 2D and 3D microfluidic devices are shorten into several minutes which make it a good alternative of poly(dimethylsiloxane) microfluidic chips used in biological analysis researches. PMID:20890452

  5. A Rapid Method for Optimizing Running Temperature of Electrophoresis through Repetitive On-Chip CE Operations

    PubMed Central

    Kaneda, Shohei; Ono, Koichi; Fukuba, Tatsuhiro; Nojima, Takahiko; Yamamoto, Takatoki; Fujii, Teruo

    2011-01-01

    In this paper, a rapid and simple method to determine the optimal temperature conditions for denaturant electrophoresis using a temperature-controlled on-chip capillary electrophoresis (CE) device is presented. Since on-chip CE operations including sample loading, injection and separation are carried out just by switching the electric field, we can repeat consecutive run-to-run CE operations on a single on-chip CE device by programming the voltage sequences. By utilizing the high-speed separation and the repeatability of the on-chip CE, a series of electrophoretic operations with different running temperatures can be implemented. Using separations of reaction products of single-stranded DNA (ssDNA) with a peptide nucleic acid (PNA) oligomer, the effectiveness of the presented method to determine the optimal temperature conditions required to discriminate a single-base substitution (SBS) between two different ssDNAs is demonstrated. It is shown that a single run for one temperature condition can be executed within 4 min, and the optimal temperature to discriminate the SBS could be successfully found using the present method. PMID:21845077

  6. DNA FROM ANCIENT STONE TOOLS AND BONES EXCAVATED AT BUGAS-HOLDING, WYOMING

    EPA Science Inventory

    Traces of DNA may preserve on ancient stone tools. We examined 24 chipped stone artifacts recovered from the Bugas-Holding site in northwestern Wyoming for the presence of DNA residues, and we compared DNA preservation in bones and stone tools from the same stratigraphic context...

  7. Avatar DNA Nanohybrid System in Chip-on-a-Phone

    NASA Astrophysics Data System (ADS)

    Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

    2014-05-01

    Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording.

  8. Avatar DNA Nanohybrid System in Chip-on-a-Phone

    PubMed Central

    Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

    2014-01-01

    Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording. PMID:24824876

  9. Natural diversity of potato (Solanum tuberosum) invertases

    PubMed Central

    2010-01-01

    Background Invertases are ubiquitous enzymes that irreversibly cleave sucrose into fructose and glucose. Plant invertases play important roles in carbohydrate metabolism, plant development, and biotic and abiotic stress responses. In potato (Solanum tuberosum), invertases are involved in 'cold-induced sweetening' of tubers, an adaptive response to cold stress, which negatively affects the quality of potato chips and French fries. Linkage and association studies have identified quantitative trait loci (QTL) for tuber sugar content and chip quality that colocalize with three independent potato invertase loci, which together encode five invertase genes. The role of natural allelic variation of these genes in controlling the variation of tuber sugar content in different genotypes is unknown. Results For functional studies on natural variants of five potato invertase genes we cloned and sequenced 193 full-length cDNAs from six heterozygous individuals (three tetraploid and three diploid). Eleven, thirteen, ten, twelve and nine different cDNA alleles were obtained for the genes Pain-1, InvGE, InvGF, InvCD141 and InvCD111, respectively. Allelic cDNA sequences differed from each other by 4 to 9%, and most were genotype specific. Additional variation was identified by single nucleotide polymorphism (SNP) analysis in an association-mapping population of 219 tetraploid individuals. Haplotype modeling revealed two to three major haplotypes besides a larger number of minor frequency haplotypes. cDNA alleles associated with chip quality, tuber starch content and starch yield were identified. Conclusions Very high natural allelic variation was uncovered in a set of five potato invertase genes. This variability is a consequence of the cultivated potato's reproductive biology. Some of the structural variation found might underlie functional variation that influences important agronomic traits such as tuber sugar content. The associations found between specific invertase alleles and chip quality, tuber starch content and starch yield will facilitate the selection of superior potato genotypes in breeding programs. PMID:21143910

  10. Kidney Transplant Rejection and Tissue Injury by Gene Profiling of Biopsies and Peripheral Blood Lymphocytes

    PubMed Central

    Flechner, Stuart M.; Kurian, Sunil M.; Head, Steven R.; Sharp, Starlette M.; Whisenant, Thomas C.; Zhang, Jie; Chismar, Jeffrey D.; Horvath, Steve; Mondala, Tony; Gilmartin, Timothy; Cook, Daniel J.; Kay, Steven A.; Walker, John R.; Salomon, Daniel R.

    2007-01-01

    A major challenge for kidney transplantation is balancing the need for immunosuppression to prevent rejection, while minimizing drug-induced toxicities. We used DNA microarrays (HG-U95Av2 GeneChips, Affymetrix) to determine gene expression profiles for kidney biopsies and peripheral blood lymphocytes (PBLs) in transplant patients including normal donor kidneys, well-functioning transplants without rejection, kidneys undergoing acute rejection, and transplants with renal dysfunction without rejection. We developed a data analysis schema based on expression signal determination, class comparison and prediction, hierarchical clustering, statistical power analysis and real-time quantitative PCR validation. We identified distinct gene expression signatures for both biopsies and PBLs that correlated significantly with each of the different classes of transplant patients. This is the most complete report to date using commercial arrays to identify unique expression signatures in transplant biopsies distinguishing acute rejection, acute dysfunction without rejection and well-functioning transplants with no rejection history. We demonstrate for the first time the successful application of high density DNA chip analysis of PBL as a diagnostic tool for transplantation. The significance of these results, if validated in a multicenter prospective trial, would be the establishment of a metric based on gene expression signatures for monitoring the immune status and immunosuppression of transplanted patients. PMID:15307835

  11. Genome-wide analysis of replication timing by next-generation sequencing with E/L Repli-seq.

    PubMed

    Marchal, Claire; Sasaki, Takayo; Vera, Daniel; Wilson, Korey; Sima, Jiao; Rivera-Mulia, Juan Carlos; Trevilla-García, Claudia; Nogues, Coralin; Nafie, Ebtesam; Gilbert, David M

    2018-05-01

    This protocol is an extension to: Nat. Protoc. 6, 870-895 (2014); doi:10.1038/nprot.2011.328; published online 02 June 2011Cycling cells duplicate their DNA content during S phase, following a defined program called replication timing (RT). Early- and late-replicating regions differ in terms of mutation rates, transcriptional activity, chromatin marks and subnuclear position. Moreover, RT is regulated during development and is altered in diseases. Here, we describe E/L Repli-seq, an extension of our Repli-chip protocol. E/L Repli-seq is a rapid, robust and relatively inexpensive protocol for analyzing RT by next-generation sequencing (NGS), allowing genome-wide assessment of how cellular processes are linked to RT. Briefly, cells are pulse-labeled with BrdU, and early and late S-phase fractions are sorted by flow cytometry. Labeled nascent DNA is immunoprecipitated from both fractions and sequenced. Data processing leads to a single bedGraph file containing the ratio of nascent DNA from early versus late S-phase fractions. The results are comparable to those of Repli-chip, with the additional benefits of genome-wide sequence information and an increased dynamic range. We also provide computational pipelines for downstream analyses, for parsing phased genomes using single-nucleotide polymorphisms (SNPs) to analyze RT allelic asynchrony, and for direct comparison to Repli-chip data. This protocol can be performed in up to 3 d before sequencing, and requires basic cellular and molecular biology skills, as well as a basic understanding of Unix and R.

  12. VLSI Microsystem for Rapid Bioinformatic Pattern Recognition

    NASA Technical Reports Server (NTRS)

    Fang, Wai-Chi; Lue, Jaw-Chyng

    2009-01-01

    A system comprising very-large-scale integrated (VLSI) circuits is being developed as a means of bioinformatics-oriented analysis and recognition of patterns of fluorescence generated in a microarray in an advanced, highly miniaturized, portable genetic-expression-assay instrument. Such an instrument implements an on-chip combination of polymerase chain reactions and electrochemical transduction for amplification and detection of deoxyribonucleic acid (DNA).

  13. A paralleled readout system for an electrical DNA-hybridization assay based on a microstructured electrode array

    NASA Astrophysics Data System (ADS)

    Urban, Matthias; Möller, Robert; Fritzsche, Wolfgang

    2003-02-01

    DNA analytics is a growing field based on the increasing knowledge about the genome with special implications for the understanding of molecular bases for diseases. Driven by the need for cost-effective and high-throughput methods for molecular detection, DNA chips are an interesting alternative to more traditional analytical methods in this field. The standard readout principle for DNA chips is fluorescence based. Fluorescence is highly sensitive and broadly established, but shows limitations regarding quantification (due to signal and/or dye instability) and the need for sophisticated (and therefore high-cost) equipment. This article introduces a readout system for an alternative detection scheme based on electrical detection of nanoparticle-labeled DNA. If labeled DNA is present in the analyte solution, it will bind on complementary capture DNA immobilized in a microelectrode gap. A subsequent metal enhancement step leads to a deposition of conductive material on the nanoparticles, and finally an electrical contact between the electrodes. This detection scheme offers the potential for a simple (low-cost as well as robust) and highly miniaturizable method, which could be well-suited for point-of-care applications in the context of lab-on-a-chip technologies. The demonstrated apparatus allows a parallel readout of an entire array of microstructured measurement sites. The readout is combined with data-processing by an embedded personal computer, resulting in an autonomous instrument that measures and presents the results. The design and realization of such a system is described, and first measurements are presented.

  14. Comparison of the Predictive Accuracy of DNA Array-Based Multigene Classifiers across cDNA Arrays and Affymetrix GeneChips

    PubMed Central

    Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos

    2005-01-01

    We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308

  15. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

    2006-06-16

    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

  16. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.

    PubMed

    Landt, Stephen G; Marinov, Georgi K; Kundaje, Anshul; Kheradpour, Pouya; Pauli, Florencia; Batzoglou, Serafim; Bernstein, Bradley E; Bickel, Peter; Brown, James B; Cayting, Philip; Chen, Yiwen; DeSalvo, Gilberto; Epstein, Charles; Fisher-Aylor, Katherine I; Euskirchen, Ghia; Gerstein, Mark; Gertz, Jason; Hartemink, Alexander J; Hoffman, Michael M; Iyer, Vishwanath R; Jung, Youngsook L; Karmakar, Subhradip; Kellis, Manolis; Kharchenko, Peter V; Li, Qunhua; Liu, Tao; Liu, X Shirley; Ma, Lijia; Milosavljevic, Aleksandar; Myers, Richard M; Park, Peter J; Pazin, Michael J; Perry, Marc D; Raha, Debasish; Reddy, Timothy E; Rozowsky, Joel; Shoresh, Noam; Sidow, Arend; Slattery, Matthew; Stamatoyannopoulos, John A; Tolstorukov, Michael Y; White, Kevin P; Xi, Simon; Farnham, Peggy J; Lieb, Jason D; Wold, Barbara J; Snyder, Michael

    2012-09-01

    Chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) has become a valuable and widely used approach for mapping the genomic location of transcription-factor binding and histone modifications in living cells. Despite its widespread use, there are considerable differences in how these experiments are conducted, how the results are scored and evaluated for quality, and how the data and metadata are archived for public use. These practices affect the quality and utility of any global ChIP experiment. Through our experience in performing ChIP-seq experiments, the ENCODE and modENCODE consortia have developed a set of working standards and guidelines for ChIP experiments that are updated routinely. The current guidelines address antibody validation, experimental replication, sequencing depth, data and metadata reporting, and data quality assessment. We discuss how ChIP quality, assessed in these ways, affects different uses of ChIP-seq data. All data sets used in the analysis have been deposited for public viewing and downloading at the ENCODE (http://encodeproject.org/ENCODE/) and modENCODE (http://www.modencode.org/) portals.

  17. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia

    PubMed Central

    Landt, Stephen G.; Marinov, Georgi K.; Kundaje, Anshul; Kheradpour, Pouya; Pauli, Florencia; Batzoglou, Serafim; Bernstein, Bradley E.; Bickel, Peter; Brown, James B.; Cayting, Philip; Chen, Yiwen; DeSalvo, Gilberto; Epstein, Charles; Fisher-Aylor, Katherine I.; Euskirchen, Ghia; Gerstein, Mark; Gertz, Jason; Hartemink, Alexander J.; Hoffman, Michael M.; Iyer, Vishwanath R.; Jung, Youngsook L.; Karmakar, Subhradip; Kellis, Manolis; Kharchenko, Peter V.; Li, Qunhua; Liu, Tao; Liu, X. Shirley; Ma, Lijia; Milosavljevic, Aleksandar; Myers, Richard M.; Park, Peter J.; Pazin, Michael J.; Perry, Marc D.; Raha, Debasish; Reddy, Timothy E.; Rozowsky, Joel; Shoresh, Noam; Sidow, Arend; Slattery, Matthew; Stamatoyannopoulos, John A.; Tolstorukov, Michael Y.; White, Kevin P.; Xi, Simon; Farnham, Peggy J.; Lieb, Jason D.; Wold, Barbara J.; Snyder, Michael

    2012-01-01

    Chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) has become a valuable and widely used approach for mapping the genomic location of transcription-factor binding and histone modifications in living cells. Despite its widespread use, there are considerable differences in how these experiments are conducted, how the results are scored and evaluated for quality, and how the data and metadata are archived for public use. These practices affect the quality and utility of any global ChIP experiment. Through our experience in performing ChIP-seq experiments, the ENCODE and modENCODE consortia have developed a set of working standards and guidelines for ChIP experiments that are updated routinely. The current guidelines address antibody validation, experimental replication, sequencing depth, data and metadata reporting, and data quality assessment. We discuss how ChIP quality, assessed in these ways, affects different uses of ChIP-seq data. All data sets used in the analysis have been deposited for public viewing and downloading at the ENCODE (http://encodeproject.org/ENCODE/) and modENCODE (http://www.modencode.org/) portals. PMID:22955991

  18. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stephenson, S J

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less

  19. Chromatin immunoprecipitation in microfluidic droplets: towards fast and cheap analyses.

    PubMed

    Teste, Bruno; Champ, Jerome; Londono-Vallejo, Arturo; Descroix, Stéphanie; Malaquin, Laurent; Viovy, Jean-Louis; Draskovic, Irena; Mottet, Guillaume

    2017-01-31

    Genetic organization is governed by the interaction of DNA with histone proteins, and differential modifications of these proteins is a fundamental mechanism of gene regulation. Histone modifications are primarily studied through chromatin immunoprecipitation (ChIP) assays, however conventional ChIP procedures are time consuming, laborious and require a large number of cells. Here we report for the first time the development of ChIP in droplets based on a microfluidic platform combining nanoliter droplets, magnetic beads (MB) and magnetic tweezers (MT). The droplet approach enabled compartmentalization and improved mixing, while reducing the consumption of samples and reagents in an integrated workflow. Anti-histone antibodies grafted to MB were used as a solid support to capture and transfer the target chromatin from droplets to droplets in order to perform chromatin immunoprecipitation, washing, elution and purification of DNA. We designed a new ChIP protocol to investigate four different types of modified histones with known roles in gene activation or repression. We evaluated the performances of this new ChIP in droplet assay in comparison with conventional methods. The proposed technology dramatically reduces analytical time from a few days to 7 hours, simplifies the ChIP protocol and decreases the number of cells required by 100 fold while maintaining a high degree of sensitivity and specificity. Therefore this droplet-based ChIP assay represents a new, highly advantageous and convenient approach to epigenetic analyses.

  20. Knowledge-based image processing for on-off type DNA microarray

    NASA Astrophysics Data System (ADS)

    Kim, Jong D.; Kim, Seo K.; Cho, Jeong S.; Kim, Jongwon

    2002-06-01

    This paper addresses the image processing technique for discriminating whether the probes are hybrized with target DNA in the Human Papilloma Virus (HPV) DNA Chip designed for genotyping HPV. In addition to the probes, the HPV DNA chip has markers that always react with the sample DNA. The positions of probe-dots in the final scanned image are fixed relative to the marker-dot locations with a small variation according to the accuracy of the dotter and the scanner. The probes are duplicated 4 times for the diagnostic stability. The prior knowledges such as the maker relative distance and the duplication information of probes is integrated into the template matching technique with the normalized correlation measure. Results show that the employment of both of the prior knowledges is to simply average the template matching measures over the positions of the markers and probes. The eventual proposed scheme yields stable marker locating and probe classification.

  1. Microplate-based platform for combined chromatin and DNA methylation immunoprecipitation assays

    PubMed Central

    2011-01-01

    Background The processes that compose expression of a given gene are far more complex than previously thought presenting unprecedented conceptual and mechanistic challenges that require development of new tools. Chromatin structure, which is regulated by DNA methylation and histone modification, is at the center of gene regulation. Immunoprecipitations of chromatin (ChIP) and methylated DNA (MeDIP) represent a major achievement in this area that allow researchers to probe chromatin modifications as well as specific protein-DNA interactions in vivo and to estimate the density of proteins at specific sites genome-wide. Although a critical component of chromatin structure, DNA methylation has often been studied independently of other chromatin events and transcription. Results To allow simultaneous measurements of DNA methylation with other genomic processes, we developed and validated a simple and easy-to-use high throughput microplate-based platform for analysis of DNA methylation. Compared to the traditional beads-based MeDIP the microplate MeDIP was more sensitive and had lower non-specific binding. We integrated the MeDIP method with a microplate ChIP assay which allows measurements of both DNA methylation and histone marks at the same time, Matrix ChIP-MeDIP platform. We illustrated several applications of this platform to relate DNA methylation, with chromatin and transcription events at selected genes in cultured cells, human cancer and in a model of diabetic kidney disease. Conclusion The high throughput capacity of Matrix ChIP-MeDIP to profile tens and potentially hundreds of different genomic events at the same time as DNA methylation represents a powerful platform to explore complex genomic mechanism at selected genes in cultured cells and in whole tissues. In this regard, Matrix ChIP-MeDIP should be useful to complement genome-wide studies where the rich chromatin and transcription database resources provide fruitful foundation to pursue mechanistic, functional and diagnostic information at genes of interest in health and disease. PMID:22098709

  2. Mitochondrial DNA copy number is regulated in a tissue specific manner by DNA methylation of the nuclear-encoded DNA polymerase gamma A

    PubMed Central

    Kelly, Richard D. W.; Mahmud, Arsalan; McKenzie, Matthew; Trounce, Ian A.; St John, Justin C.

    2012-01-01

    DNA methylation is an essential mechanism controlling gene expression during differentiation and development. We investigated the epigenetic regulation of the nuclear-encoded, mitochondrial DNA (mtDNA) polymerase γ catalytic subunit (PolgA) by examining the methylation status of a CpG island within exon 2 of PolgA. Bisulphite sequencing identified low methylation levels (<10%) within exon 2 of mouse oocytes, blastocysts and embryonic stem cells (ESCs), while somatic tissues contained significantly higher levels (>40%). In contrast, induced pluripotent stem (iPS) cells and somatic nuclear transfer ESCs were hypermethylated (>20%), indicating abnormal epigenetic reprogramming. Real time PCR analysis of 5-methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) immunoprecipitated DNA suggests active DNA methylation and demethylation within exon 2 of PolgA. Moreover, neural differentiation of ESCs promoted de novo methylation and demethylation at the exon 2 locus. Regression analysis demonstrates that cell-specific PolgA expression levels were negatively correlated with DNA methylation within exon 2 and mtDNA copy number. Finally, using chromatin immunoprecipitation (ChIP) against RNA polymerase II (RNApII) phosphorylated on serine 2, we show increased DNA methylation levels are associated with reduced RNApII transcriptional elongation. This is the first study linking nuclear DNA epigenetic regulation with mtDNA regulation during differentiation and cell specialization. PMID:22941637

  3. Gene profile in the spleen under massive partial hepatectomy using complementary DNA microarray and pathway analysis.

    PubMed

    Arakawa, Yusuke; Shimada, Mitsuo; Utsunomiya, Tohru; Imura, Satoru; Morine, Yuji; Ikemoto, Tetsuya; Mori, Hiroki; Kanamoto, Mami; Iwahashi, Shuichi; Saito, Yu; Takasu, Chie

    2014-08-01

    In general, the spleen is one of the abdominal organs connected by the portal system, and a splenectomy improves hepatic functions in the settings of partial hepatectomy (Hx) for portal hypertensive cases or living donor liver transplantation with excessive portal vein flow. Those precise mechanisms remain still unclear; therefore, we investigated the DNA expression profile in the spleen after 90% Hx in rats using complementary DNA microarray and pathway analysis. Messenger RNAs (mRNAs) were prepared from three rat spleens at each time point (0, 3, and 6 h after 90% Hx). Using the gene chip, mRNA was hybridized to Affymetrix GeneChip Rat Genome 230 2.0 Array (Affymetrix®) and pathway analysis was done with Ingenuity Pathway Analysis (IPA®). We determined the 3-h or 6-h/0-h ratio to assess the influence of Hx, and cut-off values were set at more than 2.0-fold or less than 1/2 (0.5)-fold. Chemokine activity-related genes including Cxcl1 (GRO1) and Cxcl2 (MIP-2) related pathway were upregulated in the spleen. Also, immediate early response genes including early growth response-1 (EGR1), FBJ murine osteosarcoma (FOS) and activating transcription factor 3 (ATF3) related pathway were upregulated in the spleen. We concluded that in the spleen the expression of numerous inflammatory-related genes would occur after 90% Hx. The spleen could take a harmful role and provide a negative impact during post Hx phase due to the induction of chemokine and transcription factors including GRO1 and EGR1. © 2014 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.

  4. Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

    PubMed Central

    Kruhøffer, Mogens; Dyrskjøt, Lars; Voss, Thorsten; Lindberg, Raija L.P.; Wyrich, Ralf; Thykjaer, Thomas; Orntoft, Torben F.

    2007-01-01

    We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated microRNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis. PMID:17690207

  5. Quantum dot-based microfluidic biosensor for cancer detection

    NASA Astrophysics Data System (ADS)

    Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

    2015-05-01

    We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

  6. DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

    PubMed

    Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

    2018-04-01

    Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

  7. Another expert system rule inference based on DNA molecule logic gates

    NASA Astrophysics Data System (ADS)

    WÄ siewicz, Piotr

    2013-10-01

    With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

  8. Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

    NASA Astrophysics Data System (ADS)

    Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

    2007-02-01

    We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

  9. Trapping and Collection of Lymphocytes Using Microspot Array Chip and Magnetic Beads

    NASA Astrophysics Data System (ADS)

    Hashioka, Shingi; Obata, Tsutomu; Tokimitsu, Yoshiharu; Fujiki, Satoshi; Nakazato, Hiroyoshi; Muraguchi, Atsushi; Kishi, Hiroyuki; Tanino, Katsumi

    2006-04-01

    A microspot array chip, which has microspots of a magnetic thin film patterned on a glass substrate, was fabricated for trapping individual cells and for measuring their cellular response. The chip was easily fabricated by conventional semiconductor fabrication techniques on a mass production level as a disposable medical device. When a solution of lymphocyte-bound-magnetic beads was poured into the magnetized chip, each lymphocyte was trapped on each microspot of the magnetic thin film. The trapped cells were easily recovered from the chip using a micromanipulator. The micro-spot array chip can be utilized for arraying live cells and for measuring the response of each cell. The chip will be useful for preparing on array of different kinds of cells and for analyzing cellular response at the single cell level. The chip will be particularly useful for detecting antigen-specific B-lymphocytes and antigen-specific antibody complementary deoxyribonucleic acid (cDNA).

  10. Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarrays. 22-24 January 2001, Zurich, Switzerland.

    PubMed

    Jain, K K

    2001-02-01

    Cambridge Healthtech Institute's Third Annual Conference on Lab-on-a-Chip and Microarray technology covered the latest advances in this technology and applications in life sciences. Highlights of the meetings are reported briefly with emphasis on applications in genomics, drug discovery and molecular diagnostics. There was an emphasis on microfluidics because of the wide applications in laboratory and drug discovery. The lab-on-a-chip provides the facilities of a complete laboratory in a hand-held miniature device. Several microarray systems have been used for hybridisation and detection techniques. Oligonucleotide scanning arrays provide a versatile tool for the analysis of nucleic acid interactions and provide a platform for improving the array-based methods for investigation of antisense therapeutics. A method for analysing combinatorial DNA arrays using oligonucleotide-modified gold nanoparticle probes and a conventional scanner has considerable potential in molecular diagnostics. Various applications of microarray technology for high-throughput screening in drug discovery and single nucleotide polymorphisms (SNP) analysis were discussed. Protein chips have important applications in proteomics. With the considerable amount of data generated by the different technologies using microarrays, it is obvious that the reading of the information and its interpretation and management through the use of bioinformatics is essential. Various techniques for data analysis were presented. Biochip and microarray technology has an essential role to play in the evolving trends in healthcare, which integrate diagnosis with prevention/treatment and emphasise personalised medicines.

  11. 1-Million droplet array with wide-field fluorescence imaging for digital PCR.

    PubMed

    Hatch, Andrew C; Fisher, Jeffrey S; Tovar, Armando R; Hsieh, Albert T; Lin, Robert; Pentoney, Stephen L; Yang, David L; Lee, Abraham P

    2011-11-21

    Digital droplet reactors are useful as chemical and biological containers to discretize reagents into picolitre or nanolitre volumes for analysis of single cells, organisms, or molecules. However, most DNA based assays require processing of samples on the order of tens of microlitres and contain as few as one to as many as millions of fragments to be detected. Presented in this work is a droplet microfluidic platform and fluorescence imaging setup designed to better meet the needs of the high-throughput and high-dynamic-range by integrating multiple high-throughput droplet processing schemes on the chip. The design is capable of generating over 1-million, monodisperse, 50 picolitre droplets in 2-7 minutes that then self-assemble into high density 3-dimensional sphere packing configurations in a large viewing chamber for visualization and analysis. This device then undergoes on-chip polymerase chain reaction (PCR) amplification and fluorescence detection to digitally quantify the sample's nucleic acid contents. Wide-field fluorescence images are captured using a low cost 21-megapixel digital camera and macro-lens with an 8-12 cm(2) field-of-view at 1× to 0.85× magnification, respectively. We demonstrate both end-point and real-time imaging ability to perform on-chip quantitative digital PCR analysis of the entire droplet array. Compared to previous work, this highly integrated design yields a 100-fold increase in the number of on-chip digitized reactors with simultaneous fluorescence imaging for digital PCR based assays.

  12. Comparison of selected analytical techniques for protein sizing, quantitation and molecular weight determination.

    PubMed

    Goetz, H; Kuschel, M; Wulff, T; Sauber, C; Miller, C; Fisher, S; Woodward, C

    2004-09-30

    Protein analysis techniques are developing fast due to the growing number of proteins obtained by recombinant DNA techniques. In the present paper we compare selected techniques, which are used for protein sizing, quantitation and molecular weight determination: sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE), lab-on-a-chip or microfluidics technology (LoaC), size exclusion chromatography (SEC) and mass spectrometry (MS). We compare advantages and limitations of each technique in respect to different application areas, analysis time, protein sizing and quantitation performance.

  13. On-Chip Evaluation of DNA Methylation with Electrochemical Combined Bisulfite Restriction Analysis Utilizing a Carbon Film Containing a Nanocrystalline Structure.

    PubMed

    Kurita, Ryoji; Yanagisawa, Hiroyuki; Kamata, Tomoyuki; Kato, Dai; Niwa, Osamu

    2017-06-06

    This paper reports an on-chip electrochemical assessment of the DNA methylation status in genomic DNA on a conductive nanocarbon film electrode realized with combined bisulfite restriction analysis (COBRA). The film electrode consists of sp 2 and sp 3 hybrid bonds and is fabricated with an unbalanced magnetron (UBM) sputtering method. First, we studied the effect of the sp 2 /sp 3 ratio of the UBM nanocarbon film electrode with p-aminophenol, which is a major electro-active product of the labeling enzyme from p-aminophenol phosphate. The signal current for p-aminophenol increases as the sp 2 content in the UBM nanocarbon film electrode increases because of the π-π interaction between aromatic p-aminophenol and the graphene-like sp 2 structure. Furthermore, the capacitative current at the UBM nanocarbon film electrode was successfully reduced by about 1 order of magnitude thanks to the angstrom-level surface flatness. Therefore, a high signal-to-noise ratio was achieved compared with that of conventional electrodes. Then, after performing an ELISA-like hybridization assay with a restriction enzyme, we undertook an electrochemical evaluation of the cytosine methylation status in DNA by measuring the oxidation current derived from p-aminophenol. When the target cytosine in the analyte sequence is methylated (unmethylated), the restriction enzyme of HpyCH4IV is able (unable) to cleave the sequence, that is, the detection probe cannot (can) hybridize. We succeeded in estimating the methylation ratio at a site-specific CpG site from the peak current of a cyclic voltammogram obtained from a PCR product solution ranging from 0.01 to 1 nM.

  14. Association of mitofusin 2 methylation and essential hypertension: a case-control study in a Chinese population.

    PubMed

    Jin, Fei; Li, Xiao; Wang, Zuoguang; Liu, Ya; Liu, Jielin; Sun, Dongdong; Jin, Yongxin; Wang, Shiqi; Wen, Shaojun; Wei, Yongxiang

    2018-06-07

    Mitofusin 2 (Mfn2), a gene that negatively regulates the proliferation of vascular smooth muscle cells (VSMCs), is expressed at low levels in the VSMCs of hypertensive patients. DNA methylation can inhibit gene expression. The purpose of this study was to investigate the relationship between Mfn2 methylation and essential hypertension (EH). After bioinformatics analysis, five EH patients and five normal control (NC) subjects were selected for methylation chip screening. Then, bisulfite DNA sequencing was used to analyze the methylation status of differentially methylated fragments of Mfn2 in 40 EH patients and 36 NC subjects. Mfn2 mRNA expression in the blood was detected by RT-qPCR. There were three CpG islands in the full length Mfn2 DNA sequence and some transcription factor binding sites in these regions, including Sp1, Ap2, GATA box, NF-κB, etc. The chip screening showed that only the third CpG island had a significantly high degree of methylation. Subsequent verification experiments found that the EH group had a significantly lower C base rate of methylation than the NC group (2.5% vs. 44.44%, P < 0.0001), but a similar CpG methylation rate (P > 0.05). RT-qPCR detection showed that the level of Mfn2 mRNA expression was significantly lower in the EH group than in the NC group (P = 0.013). Further association analysis showed that the level of Mfn2 methylation was associated with systolic blood pressure and diastolic blood pressure (r = -0.902, r = -0.713, respectively) but not the other indexes. The DNA methylation level of Mfn2 was significantly lower in hypertensive patients than in control subjects, which may be an independent risk factor for EH.

  15. Description of the EuroTARGET cohort: A European collaborative project on TArgeted therapy in renal cell cancer-GEnetic- and tumor-related biomarkers for response and toxicity.

    PubMed

    van der Zanden, Loes F M; Vermeulen, Sita H; Oskarsdottir, Arna; Maurits, Jake S F; Diekstra, Meta H M; Ambert, Valentin; Cambon-Thomsen, Anne; Castellano, Daniel; Fritsch, Achim; Garcia Donas, Jesus; Guarch Troyas, Rosa; Guchelaar, Henk-Jan; Hartmann, Arndt; Hulsbergen-van de Kaa, Christina; Jaehde, Ulrich; Junker, Kerstin; Martinez-Cardus, Anna; Masson, Gisli; Oosterwijk-Wakka, Jeannette; Radu, Marius T; Rafnar, Thorunn; Rodriguez-Antona, Cristina; Roessler, Max; Ruijtenbeek, Rob; Stefansson, Kari; Warren, Anne; Wessels, Lodewyk; Eisen, Tim; Kiemeney, Lambertus A L M; Oosterwijk, Egbert

    2017-08-01

    For patients with metastatic renal cell cancer (mRCC), treatment choice is mainly based on clinical parameters. With many treatments available and the limited response to treatment and associated toxicities, there is much interest in identifying better biomarkers for personalized treatment. EuroTARGET aims to identify and characterize host- and tumor-related biomarkers for prediction of response to tyrosine kinase inhibitor therapy in mRCC. Here, we describe the EuroTARGET mRCC patient cohort. EuroTARGET is a European collaborative project designed as an observational study for which patients with mRCC were recruited prospectively in 62 centers. In addition, 462 patients with mRCC from previous studies were included. Detailed clinical information (baseline and follow-up) from all patients was entered in web-based case record forms. Blood was collected for germline DNA and pharmacokinetic/pharmacodynamic analyses and, where available, fresh-frozen tumor material was collected to perform tumor DNA, RNA, kinome, and methylome analyses. In total, 1,210 patients with mRCC were included. Of these, 920 received a tyrosine kinase inhibitor as first-line targeted treatment (sunitinib [N = 713, 78%], sorafenib [N = 41, 4%], or pazopanib [N = 166, 18%]) and had at least 6 months of outcome assessment (median follow-up 15.3 months [interquartile range: 8.5-30.2 months]). Germline DNA samples were available from 824 of these patients, fresh-frozen tumor material from 142 patients, fresh-frozen normal kidney tissue from 95 patients, and tissue microarrays created from formalin-fixed paraffin-embedded tumor material from 247 patients. Of the 920 patients, germline DNA variant chip data were successfully generated for 811 patients (Illumina HumanOmniExpress BeadChip). For 80 patients, next-generation exome sequencing of germline and tumor DNA was performed, tumor RNA sequencing was performed for 124 patients, kinome activity measured and processed for 121 patients (PamChip), and methylome data (Illumina Infinium HumanMethylation450 BeadChip) were created for 116 RCC tissues (and 23 normal kidney tissues). For 73 out of the 920 patients, all platform data types were generated. In addition, 40 patients were included in a pharmacokinetic/pharmacodynamic phase IV substudy. Analysis of EuroTARGET cohort data will contribute to personalization of therapy for patients with mRCC. The extensive clinical data and multiplatform EuroTARGET data will be freely available. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

    PubMed

    Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

    2016-04-15

    A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Modelling and simulation of passive Lab-on-a-Chip (LoC) based micromixer for clinical application

    NASA Astrophysics Data System (ADS)

    Saikat, Chakraborty; Sharath, M.; Srujana, M.; Narayan, K.; Pattnaik, Prasant Kumar

    2016-03-01

    In biomedical application, micromixer is an important component because of many processes requires rapid and efficient mixing. At micro scale, the flow is Laminar due to small channel size which enables controlled rapid mixing. The reduction in analysis time along with high throughput can be achieved with the help of rapid mixing. In LoC application, micromixer is used for mixing of fluids especially for the devices which requires efficient mixing. Micromixer of this type of microfluidic devices with a rapid mixing is useful in application such as DNA/RNA synthesis, drug delivery system & biological agent detection. In this work, we design and simulate a microfluidic based passive rapid micromixer for lab-on-a-chip application.

  18. A comparative study of ChIP-seq sequencing library preparation methods.

    PubMed

    Sundaram, Arvind Y M; Hughes, Timothy; Biondi, Shea; Bolduc, Nathalie; Bowman, Sarah K; Camilli, Andrew; Chew, Yap C; Couture, Catherine; Farmer, Andrew; Jerome, John P; Lazinski, David W; McUsic, Andrew; Peng, Xu; Shazand, Kamran; Xu, Feng; Lyle, Robert; Gilfillan, Gregor D

    2016-10-21

    ChIP-seq is the primary technique used to investigate genome-wide protein-DNA interactions. As part of this procedure, immunoprecipitated DNA must undergo "library preparation" to enable subsequent high-throughput sequencing. To facilitate the analysis of biopsy samples and rare cell populations, there has been a recent proliferation of methods allowing sequencing library preparation from low-input DNA amounts. However, little information exists on the relative merits, performance, comparability and biases inherent to these procedures. Notably, recently developed single-cell ChIP procedures employing microfluidics must also employ library preparation reagents to allow downstream sequencing. In this study, seven methods designed for low-input DNA/ChIP-seq sample preparation (Accel-NGS® 2S, Bowman-method, HTML-PCR, SeqPlex™, DNA SMART™, TELP and ThruPLEX®) were performed on five replicates of 1 ng and 0.1 ng input H3K4me3 ChIP material, and compared to a "gold standard" reference PCR-free dataset. The performance of each method was examined for the prevalence of unmappable reads, amplification-derived duplicate reads, reproducibility, and for the sensitivity and specificity of peak calling. We identified consistent high performance in a subset of the tested reagents, which should aid researchers in choosing the most appropriate reagents for their studies. Furthermore, we expect this work to drive future advances by identifying and encouraging use of the most promising methods and reagents. The results may also aid judgements on how comparable are existing datasets that have been prepared with different sample library preparation reagents.

  19. Genome wide approaches to identify protein-DNA interactions.

    PubMed

    Ma, Tao; Ye, Zhenqing; Wang, Liguo

    2018-05-29

    Transcription factors are DNA-binding proteins that play key roles in many fundamental biological processes. Unraveling their interactions with DNA is essential to identify their target genes and understand the regulatory network. Genome-wide identification of their binding sites became feasible thanks to recent progress in experimental and computational approaches. ChIP-chip, ChIP-seq, and ChIP-exo are three widely used techniques to demarcate genome-wide transcription factor binding sites. This review aims to provide an overview of these three techniques including their experiment procedures, computational approaches, and popular analytic tools. ChIP-chip, ChIP-seq, and ChIP-exo have been the major techniques to study genome-wide in vivo protein-DNA interaction. Due to the rapid development of next-generation sequencing technology, array-based ChIP-chip is deprecated and ChIP-seq has become the most widely used technique to identify transcription factor binding sites in genome-wide. The newly developed ChIP-exo further improves the spatial resolution to single nucleotide. Numerous tools have been developed to analyze ChIP-chip, ChIP-seq and ChIP-exo data. However, different programs may employ different mechanisms or underlying algorithms thus each will inherently include its own set of statistical assumption and bias. So choosing the most appropriate analytic program for a given experiment needs careful considerations. Moreover, most programs only have command line interface so their installation and usage will require basic computation expertise in Unix/Linux. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  20. A multi-scale analysis of bull sperm methylome revealed both species peculiarities and conserved tissue-specific features.

    PubMed

    Perrier, Jean-Philippe; Sellem, Eli; Prézelin, Audrey; Gasselin, Maxime; Jouneau, Luc; Piumi, François; Al Adhami, Hala; Weber, Michaël; Fritz, Sébastien; Boichard, Didier; Le Danvic, Chrystelle; Schibler, Laurent; Jammes, Hélène; Kiefer, Hélène

    2018-05-29

    Spermatozoa have a remarkable epigenome in line with their degree of specialization, their unique nature and different requirements for successful fertilization. Accordingly, perturbations in the establishment of DNA methylation patterns during male germ cell differentiation have been associated with infertility in several species. While bull semen is widely used in artificial insemination, the literature describing DNA methylation in bull spermatozoa is still scarce. The purpose of this study was therefore to characterize the bull sperm methylome relative to both bovine somatic cells and the sperm of other mammals through a multiscale analysis. The quantification of DNA methylation at CCGG sites using luminometric methylation assay (LUMA) highlighted the undermethylation of bull sperm compared to the sperm of rams, stallions, mice, goats and men. Total blood cells displayed a similarly high level of methylation in bulls and rams, suggesting that undermethylation of the bovine genome was specific to sperm. Annotation of CCGG sites in different species revealed no striking bias in the distribution of genome features targeted by LUMA that could explain undermethylation of bull sperm. To map DNA methylation at a genome-wide scale, bull sperm was compared with bovine liver, fibroblasts and monocytes using reduced representation bisulfite sequencing (RRBS) and immunoprecipitation of methylated DNA followed by microarray hybridization (MeDIP-chip). These two methods exhibited differences in terms of genome coverage, and consistently, two independent sets of sequences differentially methylated in sperm and somatic cells were identified for RRBS and MeDIP-chip. Remarkably, in the two sets most of the differentially methylated sequences were hypomethylated in sperm. In agreement with previous studies in other species, the sequences that were specifically hypomethylated in bull sperm targeted processes relevant to the germline differentiation program (piRNA metabolism, meiosis, spermatogenesis) and sperm functions (cell adhesion, fertilization), as well as satellites and rDNA repeats. These results highlight the undermethylation of bull spermatozoa when compared with both bovine somatic cells and the sperm of other mammals, and raise questions regarding the dynamics of DNA methylation in bovine male germline. Whether sperm undermethylation has potential interactions with structural variation in the cattle genome may deserve further attention.

  1. Ease fabrication of PCR modular chip for portable DNA detection kit

    NASA Astrophysics Data System (ADS)

    Whulanza, Yudan; Aditya, Rifky; Arvialido, Reyhan; Utomo, Muhammad S.; Bachtiar, Boy M.

    2017-02-01

    Engineering a lab-on-a-chip (LoC) to perform the DNA polymerase chain reaction (PCR) for malaria detection is the ultimate goal of this study. This paper investigates the ability to fabricate an LoC kit using conventional method to achieve the lowest production cost by using existing fabrication process. It has been known that majority of LoC was made of polydimethylsiloxane (PDMS) which in this study was realized through a contact mold process. CNC milling process was utilized to create channel features in the range of 150-250 µm on the mold. Characterization on the milling process was done to understand the shrinkage/contraction between mold to product, roughness and also angle of contact of PDMS surface. Ultimately, this paper also includes analysis on flow measurement and heat distribution of an assembled LoC PCR kit. The results show that the achieved dimension of microchannel is 227 µm wide with a roughness of 0.01 µm. The flow measurement indicates a deviation with simulation in the range of 10%. A heat distribution through the kit is achieved following the three temperature zones as desired.

  2. Automated array-based genomic profiling in chronic lymphocytic leukemia: Development of a clinical tool and discovery of recurrent genomic alterations

    PubMed Central

    Schwaenen, Carsten; Nessling, Michelle; Wessendorf, Swen; Salvi, Tatjana; Wrobel, Gunnar; Radlwimmer, Bernhard; Kestler, Hans A.; Haslinger, Christian; Stilgenbauer, Stephan; Döhner, Hartmut; Bentz, Martin; Lichter, Peter

    2004-01-01

    B cell chronic lymphocytic leukemia (B-CLL) is characterized by a highly variable clinical course. Recurrent chromosomal imbalances provide significant prognostic markers. Risk-adapted therapy based on genomic alterations has become an option that is currently being tested in clinical trials. To supply a robust tool for such large scale studies, we developed a comprehensive DNA microarray dedicated to the automated analysis of recurrent genomic imbalances in B-CLL by array-based comparative genomic hybridization (matrix–CGH). Validation of this chip in a series of 106 B-CLL cases revealed a high specificity and sensitivity that fulfils the criteria for application in clinical oncology. This chip is immediately applicable within clinical B-CLL treatment trials that evaluate whether B-CLL cases with distinct chromosomal abnormalities should be treated with chemotherapy of different intensities and/or stem cell transplantation. Through the control set of DNA fragments equally distributed over the genome, recurrent genomic imbalances were discovered: trisomy of chromosome 19 and gain of the MYCN oncogene correlating with an elevation of MYCN mRNA expression. PMID:14730057

  3. Bio-Inspired Microsystem for Robust Genetic Assay Recognition

    PubMed Central

    Lue, Jaw-Chyng; Fang, Wai-Chi

    2008-01-01

    A compact integrated system-on-chip (SoC) architecture solution for robust, real-time, and on-site genetic analysis has been proposed. This microsystem solution is noise-tolerable and suitable for analyzing the weak fluorescence patterns from a PCR prepared dual-labeled DNA microchip assay. In the architecture, a preceding VLSI differential logarithm microchip is designed for effectively computing the logarithm of the normalized input fluorescence signals. A posterior VLSI artificial neural network (ANN) processor chip is used for analyzing the processed signals from the differential logarithm stage. A single-channel logarithmic circuit was fabricated and characterized. A prototype ANN chip with unsupervised winner-take-all (WTA) function was designed, fabricated, and tested. An ANN learning algorithm using a novel sigmoid-logarithmic transfer function based on the supervised backpropagation (BP) algorithm is proposed for robustly recognizing low-intensity patterns. Our results show that the trained new ANN can recognize low-fluorescence patterns better than an ANN using the conventional sigmoid function. PMID:18566679

  4. Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

    PubMed

    Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

    2015-08-01

    Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

  5. Femtomolar level detection of RASSF1A tumor suppressor gene methylation by electrochemical nano-genosensor based on Fe3O4/TMC/Au nanocomposite and PT-modified electrode.

    PubMed

    Daneshpour, Maryam; Moradi, Leila Syed; Izadi, Pantea; Omidfar, Kobra

    2016-03-15

    The alterations in DNA methylation pattern have been identified as one of the most frequent molecular phenomenon in human cancers. The RASSF1A tumor suppressor gene was shown to be often inactivated by hypermethylation of its promoter region. In the present study, a novel chip format sandwich electrochemical genosensor has been developed for the analysis of gene-specific methylation using Fe3O4/N-trimethyl chitosan/gold (Fe3O4/TMC/Au) nanocomposite as tracing tag to label DNA probe and polythiophene (PT) as immobilization platform of sensing element. However, no attempt has yet been made to conjugate DNA probe to Fe3O4/TMC/Au nanocomposite as electrochemical label for strip-based genosensing. Cyclic voltammetric (CV) analysis indicated that modification procedure was well performed. Differential pulse voltammetry (DPV) was employed for quantitative assessment of RASSF1A DNA promoter methylation. The electrochemical measurements accomplished using non-specific DNA fragments mixed with samples, revealed the high specificity and selectivity in methylation analysis by means of this DNA nanobiosensor. With the linear range of concentration from 1 × 10(-14)M to 5 × 10(-9)M and the detection limit of 2 × 10(-15)M, this new strategy has shown such a promising application to be used for universal analysis of any DNA sequence. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. An Improved Method for Measuring Chromatin-binding Dynamics Using Time-dependent Formaldehyde Crosslinking

    PubMed Central

    Hoffman, Elizabeth A.; Zaidi, Hussain; Shetty, Savera J.; Bekiranov, Stefan; Auble, David T.

    2018-01-01

    Formaldehyde crosslinking is widely used in combination with chromatin immunoprecipitation (ChIP) to measure the locations along DNA and relative levels of transcription factor (TF)-DNA interactions in vivo. However, the measurements that are typically made do not provide unambiguous information about the dynamic properties of these interactions. We have developed a method to estimate binding kinetic parameters from time-dependent formaldehyde crosslinking data, called crosslinking kinetics (CLK) analysis. Cultures of yeast cells are crosslinked with formaldehyde for various periods of time, yielding the relative ChIP signal at particular loci. We fit the data using the mass-action CLK model to extract kinetic parameters of the TF-chromatin interaction, including the on- and off-rates and crosslinking rate. From the on- and off-rate we obtain the occupancy and residence time. The following protocol is the second iteration of this method, CLKv2, updated with improved crosslinking and quenching conditions, more information about crosslinking rates, and systematic procedures for modeling the observed kinetic regimes. CLKv2 analysis has been applied to investigate the binding behavior of the TATA-binding protein (TBP), and a selected subset of other TFs. The protocol was developed using yeast cells, but may be applicable to cells from other organisms as well. PMID:29682595

  7. Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

    PubMed

    Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

    2007-06-01

    Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

  8. A simple and cost-effective molecular diagnostic system and DNA probes synthesized by light emitting diode photolithography

    NASA Astrophysics Data System (ADS)

    Oleksandrov, Sergiy; Kwon, Jung Ho; Lee, Ki-chang; Sujin-Ku; Paek, Mun Cheol

    2014-09-01

    This work introduces a novel chip to be used in the future as a simple and cost-effective method for creating DNA arrays using light emission diode (LED) photolithography. The DNA chip platform contains 24 independent reaction sites, which allows for the testing of a corresponding amount of patients' samples in hospital. An array of commercial UV LEDs and lens systems was combined with a microfluidic flow system to provide patterning of 24 individual reaction sites, each with 64 independent probes. Using the LED array instead of conventional laser exposure systems or micro-mirror systems significantly reduces the cost of equipment. The microfluidic system together with microfluidic flow cells drastically reduces the amount of used reagents, which is important due to the high cost of commercial reagents. The DNA synthesis efficiency was verified by fluorescence labeling and conventional hybridization.

  9. Ultrafast, efficient separations of large-sized dsDNA in a blended polymer matrix by microfluidic chip electrophoresis: A Design of Experiments approach

    PubMed Central

    Sun, Mingyun; Lin, Jennifer S.

    2012-01-01

    Double-stranded (ds) DNA fragments over a wide size range were successfully separated in blended polymer matrices by microfluidic chip electrophoresis. Novel blended polymer matrices composed of two types of polymers with three different molar masses were developed to provide improved separations of large dsDNA without negatively impacting the separation of small dsDNA. Hydroxyethyl celluloses (HECs) with average molar masses of ~27 kDa and ~1 MDa were blended with a second class of polymer, high-molar mass (~7 MDa) linear polyacrylamide (LPA). Fast and highly efficient separations of commercially available DNA ladders were achieved on a borosilicate glass microchip. A distinct separation of a 1 Kb DNA extension ladder (200 bp to 40,000 bp) was completed in 2 minutes. An orthogonal Design of Experiments (DOE) was used to optimize experimental parameters for DNA separations over a wide size range. We find that the two dominant factors are the applied electric field strength and the inclusion of a high concentration of low-molar mass polymer in the matrix solution. These two factors exerted different effects on the separations of small dsDNA fragments below 1 kbp, medium dsDNA fragments between 1 kbp and 10 kbp, and large dsDNA fragments above 10 kbp. PMID:22009451

  10. A model of binding on DNA microarrays: understanding the combined effect of probe synthesis failure, cross-hybridization, DNA fragmentation and other experimental details of affymetrix arrays

    PubMed Central

    2012-01-01

    Background DNA microarrays are used both for research and for diagnostics. In research, Affymetrix arrays are commonly used for genome wide association studies, resequencing, and for gene expression analysis. These arrays provide large amounts of data. This data is analyzed using statistical methods that quite often discard a large portion of the information. Most of the information that is lost comes from probes that systematically fail across chips and from batch effects. The aim of this study was to develop a comprehensive model for hybridization that predicts probe intensities for Affymetrix arrays and that could provide a basis for improved microarray analysis and probe development. The first part of the model calculates probe binding affinities to all the possible targets in the hybridization solution using the Langmuir isotherm. In the second part of the model we integrate details that are specific to each experiment and contribute to the differences between hybridization in solution and on the microarray. These details include fragmentation, wash stringency, temperature, salt concentration, and scanner settings. Furthermore, the model fits probe synthesis efficiency and target concentration parameters directly to the data. All the parameters used in the model have a well-established physical origin. Results For the 302 chips that were analyzed the mean correlation between expected and observed probe intensities was 0.701 with a range of 0.88 to 0.55. All available chips were included in the analysis regardless of the data quality. Our results show that batch effects arise from differences in probe synthesis, scanner settings, wash strength, and target fragmentation. We also show that probe synthesis efficiencies for different nucleotides are not uniform. Conclusions To date this is the most complete model for binding on microarrays. This is the first model that includes both probe synthesis efficiency and hybridization kinetics/cross-hybridization. These two factors are sequence dependent and have a large impact on probe intensity. The results presented here provide novel insight into the effect of probe synthesis errors on Affymetrix microarrays; furthermore, the algorithms developed in this work provide useful tools for the analysis of cross-hybridization, probe synthesis efficiency, fragmentation, wash stringency, temperature, and salt concentration on microarray intensities. PMID:23270536

  11. Rapid DNA analysis for automated processing and interpretation of low DNA content samples.

    PubMed

    Turingan, Rosemary S; Vasantgadkar, Sameer; Palombo, Luke; Hogan, Catherine; Jiang, Hua; Tan, Eugene; Selden, Richard F

    2016-01-01

    Short tandem repeat (STR) analysis of casework samples with low DNA content include those resulting from the transfer of epithelial cells from the skin to an object (e.g., cells on a water bottle, or brim of a cap), blood spatter stains, and small bone and tissue fragments. Low DNA content (LDC) samples are important in a wide range of settings, including disaster response teams to assist in victim identification and family reunification, military operations to identify friend or foe, criminal forensics to identify suspects and exonerate the innocent, and medical examiner and coroner offices to identify missing persons. Processing LDC samples requires experienced laboratory personnel, isolated workstations, and sophisticated equipment, requires transport time, and involves complex procedures. We present a rapid DNA analysis system designed specifically to generate STR profiles from LDC samples in field-forward settings by non-technical operators. By performing STR in the field, close to the site of collection, rapid DNA analysis has the potential to increase throughput and to provide actionable information in real time. A Low DNA Content BioChipSet (LDC BCS) was developed and manufactured by injection molding. It was designed to function in the fully integrated Accelerated Nuclear DNA Equipment (ANDE) instrument previously designed for analysis of buccal swab and other high DNA content samples (Investigative Genet. 4(1):1-15, 2013). The LDC BCS performs efficient DNA purification followed by microfluidic ultrafiltration of the purified DNA, maximizing the quantity of DNA available for subsequent amplification and electrophoretic separation and detection of amplified fragments. The system demonstrates accuracy, precision, resolution, signal strength, and peak height ratios appropriate for casework analysis. The LDC rapid DNA analysis system is effective for the generation of STR profiles from a wide range of sample types. The technology broadens the range of sample types that can be processed and minimizes the time between sample collection, sample processing and analysis, and generation of actionable intelligence. The fully integrated Expert System is capable of interpreting a wide range or sample types and input DNA quantities, allowing samples to be processed and interpreted without a technical operator.

  12. The PEPR GeneChip data warehouse, and implementation of a dynamic time series query tool (SGQT) with graphical interface.

    PubMed

    Chen, Josephine; Zhao, Po; Massaro, Donald; Clerch, Linda B; Almon, Richard R; DuBois, Debra C; Jusko, William J; Hoffman, Eric P

    2004-01-01

    Publicly accessible DNA databases (genome browsers) are rapidly accelerating post-genomic research (see http://www.genome.ucsc.edu/), with integrated genomic DNA, gene structure, EST/ splicing and cross-species ortholog data. DNA databases have relatively low dimensionality; the genome is a linear code that anchors all associated data. In contrast, RNA expression and protein databases need to be able to handle very high dimensional data, with time, tissue, cell type and genes, as interrelated variables. The high dimensionality of microarray expression profile data, and the lack of a standard experimental platform have complicated the development of web-accessible databases and analytical tools. We have designed and implemented a public resource of expression profile data containing 1024 human, mouse and rat Affymetrix GeneChip expression profiles, generated in the same laboratory, and subject to the same quality and procedural controls (Public Expression Profiling Resource; PEPR). Our Oracle-based PEPR data warehouse includes a novel time series query analysis tool (SGQT), enabling dynamic generation of graphs and spreadsheets showing the action of any transcript of interest over time. In this report, we demonstrate the utility of this tool using a 27 time point, in vivo muscle regeneration series. This data warehouse and associated analysis tools provides access to multidimensional microarray data through web-based interfaces, both for download of all types of raw data for independent analysis, and also for straightforward gene-based queries. Planned implementations of PEPR will include web-based remote entry of projects adhering to quality control and standard operating procedure (QC/SOP) criteria, and automated output of alternative probe set algorithms for each project (see http://microarray.cnmcresearch.org/pgadatatable.asp).

  13. The PEPR GeneChip data warehouse, and implementation of a dynamic time series query tool (SGQT) with graphical interface

    PubMed Central

    Chen, Josephine; Zhao, Po; Massaro, Donald; Clerch, Linda B.; Almon, Richard R.; DuBois, Debra C.; Jusko, William J.; Hoffman, Eric P.

    2004-01-01

    Publicly accessible DNA databases (genome browsers) are rapidly accelerating post-genomic research (see http://www.genome.ucsc.edu/), with integrated genomic DNA, gene structure, EST/ splicing and cross-species ortholog data. DNA databases have relatively low dimensionality; the genome is a linear code that anchors all associated data. In contrast, RNA expression and protein databases need to be able to handle very high dimensional data, with time, tissue, cell type and genes, as interrelated variables. The high dimensionality of microarray expression profile data, and the lack of a standard experimental platform have complicated the development of web-accessible databases and analytical tools. We have designed and implemented a public resource of expression profile data containing 1024 human, mouse and rat Affymetrix GeneChip expression profiles, generated in the same laboratory, and subject to the same quality and procedural controls (Public Expression Profiling Resource; PEPR). Our Oracle-based PEPR data warehouse includes a novel time series query analysis tool (SGQT), enabling dynamic generation of graphs and spreadsheets showing the action of any transcript of interest over time. In this report, we demonstrate the utility of this tool using a 27 time point, in vivo muscle regeneration series. This data warehouse and associated analysis tools provides access to multidimensional microarray data through web-based interfaces, both for download of all types of raw data for independent analysis, and also for straightforward gene-based queries. Planned implementations of PEPR will include web-based remote entry of projects adhering to quality control and standard operating procedure (QC/SOP) criteria, and automated output of alternative probe set algorithms for each project (see http://microarray.cnmcresearch.org/pgadatatable.asp). PMID:14681485

  14. Clinical validation of an ultra high-throughput spiral microfluidics for the detection and enrichment of viable circulating tumor cells.

    PubMed

    Khoo, Bee Luan; Warkiani, Majid Ebrahimi; Tan, Daniel Shao-Weng; Bhagat, Ali Asgar S; Irwin, Darryl; Lau, Dawn Pingxi; Lim, Alvin S T; Lim, Kiat Hon; Krisna, Sai Sakktee; Lim, Wan-Teck; Yap, Yoon Sim; Lee, Soo Chin; Soo, Ross A; Han, Jongyoon; Lim, Chwee Teck

    2014-01-01

    Circulating tumor cells (CTCs) are cancer cells that can be isolated via liquid biopsy from blood and can be phenotypically and genetically characterized to provide critical information for guiding cancer treatment. Current analysis of CTCs is hindered by the throughput, selectivity and specificity of devices or assays used in CTC detection and isolation. Here, we enriched and characterized putative CTCs from blood samples of patients with both advanced stage metastatic breast and lung cancers using a novel multiplexed spiral microfluidic chip. This system detected putative CTCs under high sensitivity (100%, n = 56) (Breast cancer samples: 12-1275 CTCs/ml; Lung cancer samples: 10-1535 CTCs/ml) rapidly from clinically relevant blood volumes (7.5 ml under 5 min). Blood samples were completely separated into plasma, CTCs and PBMCs components and each fraction were characterized with immunophenotyping (Pan-cytokeratin/CD45, CD44/CD24, EpCAM), fluorescence in-situ hybridization (FISH) (EML4-ALK) or targeted somatic mutation analysis. We used an ultra-sensitive mass spectrometry based system to highlight the presence of an EGFR-activating mutation in both isolated CTCs and plasma cell-free DNA (cf-DNA), and demonstrate concordance with the original tumor-biopsy samples. We have clinically validated our multiplexed microfluidic chip for the ultra high-throughput, low-cost and label-free enrichment of CTCs. Retrieved cells were unlabeled and viable, enabling potential propagation and real-time downstream analysis using next generation sequencing (NGS) or proteomic analysis.

  15. Solid-phase based on-chip DNA purification through a valve-free stepwise injection of multiple reagents employing centrifugal force combined with a hydrophobic capillary barrier pressure.

    PubMed

    Zhang, Hainan; Tran, Hong Hanh; Chung, Bong Hyun; Lee, Nae Yoon

    2013-03-21

    In this paper, we demonstrate a simple technique for sequentially introducing multiple sample liquids into microchannels driven by centrifugal force combined with a hydrophobic barrier pressure and apply the technique for performing solid-phase based on-chip DNA purification. Three microchannels with varying widths, all equipped with independent sample reservoirs at the inlets, were fabricated on a hydrophobic elastomer, poly(dimethylsiloxane) (PDMS). First, glass beads were packed inside the reaction chamber, and a whole cell containing the DNA extract was introduced into the widest channel by applying centrifugal force for physical adsorption of the DNA onto the glass beads. Next, washing and elution solutions were sequentially introduced into the intermediate and narrowest microchannels, respectively, by gradually increasing the amount of centrifugal force. Through a precise manipulation of the centrifugal force, the DNA adsorbed onto the glass beads was successfully washed and eluted in a continuous manner without the need to introduce each solution manually. A stepwise injection of liquids was successfully demonstrated using multiple ink solutions, the results of which corresponded well with the theoretical analyses. As a practical application, the D1S80 locus of human genomic DNA, which is widely used for forensic purposes, was successfully purified using the microdevice introduced in this study, as demonstrated through successful target amplification. This will pave the way for the construction of a control-free valve system for realizing on-chip DNA purification, which is one of the most labor-intensive and hard-to-miniaturize components, on a greatly simplified and miniaturized platform employing hydrophobic PDMS.

  16. Microfluidic-Based Enrichment and Retrieval of Circulating Tumor Cells for RT-PCR Analysis.

    PubMed

    Gogoi, Priya; Sepehri, Saedeh; Chow, Will; Handique, Kalyan; Wang, Yixin

    2017-01-01

    Molecular analysis of circulating tumor cells (CTCs) is hindered by low sensitivity and high level of background leukocytes of currently available CTC enrichment technologies. We have developed a novel device to enrich and retrieve CTCs from blood samples by using a microfluidic chip. The Celsee PREP100 device captures CTCs with high sensitivity and allows the captured CTCs to be retrieved for molecular analysis. It uses the microfluidic chip which has approximately 56,320 capture chambers. Based on differences in cell size and deformability, each chamber ensures that small blood escape while larger CTCs of varying sizes are trapped and isolated in the chambers. In this report, we used the Celsee PREP100 to capture cancer cells spiked into normal donor blood samples. We were able to show that the device can capture as low as 10 cells with high reproducibility. The captured CTCs were retrieved from the microfluidic chip. The cell recovery rate of this back-flow procedure is 100% and the level of remaining background leukocytes is very low (about 300-400 cells). RNA from the retrieved cells are extracted and converted to cDNA, and gene expression analysis of selected cancer markers can be carried out by using RT-PCR assays. The sensitive and easy-to-use Celsee PREP100 system represents a promising technology for capturing and molecular characterization of CTCs.

  17. Quantum dot-based microfluidic biosensor for cancer detection

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

    2015-05-11

    We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

  18. Development of a High-Throughput Resequencing Array for the Detection of Pathogenic Mutations in Osteogenesis Imperfecta

    PubMed Central

    Wang, Yao; Cui, Yazhou; Zhou, Xiaoyan; Han, Jinxiang

    2015-01-01

    Objective Osteogenesis imperfecta (OI) is a rare inherited skeletal disease, characterized by bone fragility and low bone density. The mutations in this disorder have been widely reported to be on various exonal hotspots of the candidate genes, including COL1A1, COL1A2, CRTAP, LEPRE1, and FKBP10, thus creating a great demand for precise genetic tests. However, large genome sizes make the process daunting and the analyses, inefficient and expensive. Therefore, we aimed at developing a fast, accurate, efficient, and cheaper sequencing platform for OI diagnosis; and to this end, use of an advanced array-based technique was proposed. Method A CustomSeq Affymetrix Resequencing Array was established for high-throughput sequencing of five genes simultaneously. Genomic DNA extraction from 13 OI patients and 85 normal controls and amplification using long-range PCR (LR-PCR) were followed by DNA fragmentation and chip hybridization, according to standard Affymetrix protocols. Hybridization signals were determined using GeneChip Sequence Analysis Software (GSEQ). To examine the feasibility, the outcome from new resequencing approach was validated by conventional capillary sequencing method. Result Overall call rates using resequencing array was 96–98% and the agreement between microarray and capillary sequencing was 99.99%. 11 out of 13 OI patients with pathogenic mutations were successfully detected by the chip analysis without adjustment, and one mutation could also be identified using manual visual inspection. Conclusion A high-throughput resequencing array was developed that detects the disease-associated mutations in OI, providing a potential tool to facilitate large-scale genetic screening for OI patients. Through this method, a novel mutation was also found. PMID:25742658

  19. Defined-size DNA triple crossover construct for molecular electronics: modification, positioning and conductance properties.

    PubMed

    Linko, Veikko; Leppiniemi, Jenni; Paasonen, Seppo-Tapio; Hytönen, Vesa P; Toppari, J Jussi

    2011-07-08

    We present a novel, defined-size, small and rigid DNA template, a so-called B-A-B complex, based on DNA triple crossover motifs (TX tiles), which can be utilized in molecular scale patterning for nanoelectronics, plasmonics and sensing applications. The feasibility of the designed construct is demonstrated by functionalizing the TX tiles with one biotin-triethylene glycol (TEG) and efficiently decorating them with streptavidin, and furthermore by positioning and anchoring single thiol-modified B-A-B complexes to certain locations on a chip via dielectrophoretic trapping. Finally, we characterize the conductance properties of the non-functionalized construct, first by measuring DC conductivity and second by utilizing AC impedance spectroscopy in order to describe the conductivity mechanism of a single B-A-B complex using a detailed equivalent circuit model. This analysis also reveals further information about the conductivity of DNA structures in general.

  20. Systolic array IC for genetic computation

    NASA Technical Reports Server (NTRS)

    Anderson, D.

    1991-01-01

    Measuring similarities between large sequences of genetic information is a formidable task requiring enormous amounts of computer time. Geneticists claim that nearly two months of CRAY-2 time are required to run a single comparison of the known database against the new bases that will be found this year, and more than a CRAY-2 year for next year's genetic discoveries, and so on. The DNA IC, designed at HP-ICBD in cooperation with the California Institute of Technology and the Jet Propulsion Laboratory, is being implemented in order to move the task of genetic comparison onto workstations and personal computers, while vastly improving performance. The chip is a systolic (pumped) array comprised of 16 processors, control logic, and global RAM, totaling 400,000 FETS. At 12 MHz, each chip performs 2.7 billion 16 bit operations per second. Using 35 of these chips in series on one PC board (performing nearly 100 billion operations per second), a sequence of 560 bases can be compared against the eventual total genome of 3 billion bases, in minutes--on a personal computer. While the designed purpose of the DNA chip is for genetic research, other disciplines requiring similarity measurements between strings of 7 bit encoded data could make use of this chip as well. Cryptography and speech recognition are two examples. A mix of full custom design and standard cells, in CMOS34, were used to achieve these goals. Innovative test methods were developed to enhance controllability and observability in the array. This paper describes these techniques as well as the chip's functionality. This chip was designed in the 1989-90 timeframe.

  1. ChIPpeakAnno: a Bioconductor package to annotate ChIP-seq and ChIP-chip data

    PubMed Central

    2010-01-01

    Background Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) or ChIP followed by genome tiling array analysis (ChIP-chip) have become standard technologies for genome-wide identification of DNA-binding protein target sites. A number of algorithms have been developed in parallel that allow identification of binding sites from ChIP-seq or ChIP-chip datasets and subsequent visualization in the University of California Santa Cruz (UCSC) Genome Browser as custom annotation tracks. However, summarizing these tracks can be a daunting task, particularly if there are a large number of binding sites or the binding sites are distributed widely across the genome. Results We have developed ChIPpeakAnno as a Bioconductor package within the statistical programming environment R to facilitate batch annotation of enriched peaks identified from ChIP-seq, ChIP-chip, cap analysis of gene expression (CAGE) or any experiments resulting in a large number of enriched genomic regions. The binding sites annotated with ChIPpeakAnno can be viewed easily as a table, a pie chart or plotted in histogram form, i.e., the distribution of distances to the nearest genes for each set of peaks. In addition, we have implemented functionalities for determining the significance of overlap between replicates or binding sites among transcription factors within a complex, and for drawing Venn diagrams to visualize the extent of the overlap between replicates. Furthermore, the package includes functionalities to retrieve sequences flanking putative binding sites for PCR amplification, cloning, or motif discovery, and to identify Gene Ontology (GO) terms associated with adjacent genes. Conclusions ChIPpeakAnno enables batch annotation of the binding sites identified from ChIP-seq, ChIP-chip, CAGE or any technology that results in a large number of enriched genomic regions within the statistical programming environment R. Allowing users to pass their own annotation data such as a different Chromatin immunoprecipitation (ChIP) preparation and a dataset from literature, or existing annotation packages, such as GenomicFeatures and BSgenome, provides flexibility. Tight integration to the biomaRt package enables up-to-date annotation retrieval from the BioMart database. PMID:20459804

  2. An integratable microfluidic cartridge for forensic swab samples lysis.

    PubMed

    Yang, Jianing; Brooks, Carla; Estes, Matthew D; Hurth, Cedric M; Zenhausern, Frederic

    2014-01-01

    Fully automated rapid forensic DNA analysis requires integrating several multistep processes onto a single microfluidic platform, including substrate lysis, extraction of DNA from the released lysate solution, multiplexed PCR amplification of STR loci, separation of PCR products by capillary electrophoresis, and analysis for allelic peak calling. Over the past several years, most of the rapid DNA analysis systems developed started with the reference swab sample lysate and involved an off-chip lysis of collected substrates. As a result of advancement in technology and chemistry, addition of a microfluidic module for swab sample lysis has been achieved in a few of the rapid DNA analysis systems. However, recent reports on integrated rapid DNA analysis systems with swab-in and answer-out capability lack any quantitative and qualitative characterization of the swab-in sample lysis module, which is important for downstream forensic sample processing. Maximal collection and subsequent recovery of the biological material from the crime scene is one of the first and critical steps in forensic DNA technology. Herein we present the design, fabrication and characterization of an integratable swab lysis cartridge module and the test results obtained from different types of commonly used forensic swab samples, including buccal, saliva, and blood swab samples, demonstrating the compatibility with different downstream DNA extraction chemistries. This swab lysis cartridge module is easy to operate, compatible with both forensic and microfluidic requirements, and ready to be integrated with our existing automated rapid forensic DNA analysis system. Following the characterization of the swab lysis module, an integrated run from buccal swab sample-in to the microchip CE electropherogram-out was demonstrated on the integrated prototype instrument. Therefore, in this study, we demonstrate that this swab lysis cartridge module is: (1) functionally, comparable with routine benchtop lysis, (2) compatible with various types of swab samples and chemistries, and (3) integratable to achieve a micro total analysis system (μTAS) for rapid DNA analysis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. Microfluidics for rapid detection of isocitrate dehydrogenase 1 mutation for intraoperative application.

    PubMed

    Aibaidula, Abudumijiti; Zhao, Wang; Wu, Jin-Song; Chen, Hong; Shi, Zhi-Feng; Zheng, Lu-Lu; Mao, Ying; Zhou, Liang-Fu; Sui, Guo-Dong

    2016-06-01

    OBJECT Conventional methods for isocitrate dehydrogenase 1 (IDH1) detection, such as DNA sequencing and immunohistochemistry, are time- and labor-consuming and cannot be applied for intraoperative analysis. To develop a new approach for rapid analysis of IDH1 mutation from tiny tumor samples, this study used microfluidics as a method for IDH1 mutation detection. METHODS Forty-seven glioma tumor samples were used; IDH1 mutation status was investigated by immunohistochemistry and DNA sequencing. The microfluidic device was fabricated from polydimethylsiloxane following standard soft lithography. The immunoanalysis was conducted in the microfluidic chip. Fluorescence images of the on-chip microcolumn taken by the charge-coupled device camera were collected as the analytical results readout. Fluorescence signals were analyzed by NIS-Elements software to gather detailed information about the IDH1 concentration in the tissue samples. RESULTS DNA sequencing identified IDH1 R132H mutation in 33 of 47 tumor samples. The fluorescence signal for IDH1-mutant samples was 5.49 ± 1.87 compared with 3.90 ± 1.33 for wild type (p = 0.005). Thus, microfluidics was capable of distinguishing IDH1-mutant tumor samples from wild-type samples. When the cutoff value was 4.11, the sensitivity of microfluidics was 87.9% and the specificity was 64.3%. CONCLUSIONS This new approach was capable of analyzing IDH1 mutation status of tiny tissue samples within 30 minutes using intraoperative microsampling. This approach might also be applied for rapid pathological diagnosis of diffuse gliomas, thus guiding personalized resection.

  4. Microfluidic Chip-Based Detection and Intraspecies Strain Discrimination of Salmonella Serovars Derived from Whole Blood of Septic Mice

    PubMed Central

    Patterson, Adriana S.; Heithoff, Douglas M.; Ferguson, Brian S.; Soh, H. Tom; Mahan, Michael J.

    2013-01-01

    Salmonella is a zoonotic pathogen that poses a considerable public health and economic burden in the United States and worldwide. Resultant human diseases range from enterocolitis to bacteremia to sepsis and are acutely dependent on the particular serovar of Salmonella enterica subsp. enterica, which comprises over 99% of human-pathogenic S. enterica isolates. Point-of-care methods for detection and strain discrimination of Salmonella serovars would thus have considerable benefit to medical, veterinary, and field applications that safeguard public health and reduce industry-associated losses. Here we describe a single, disposable microfluidic chip that supports isothermal amplification and sequence-specific detection and discrimination of Salmonella serovars derived from whole blood of septic mice. The integrated microfluidic electrochemical DNA (IMED) chip consists of an amplification chamber that supports loop-mediated isothermal amplification (LAMP), a rapid, single-temperature amplification method as an alternative to PCR that offers advantages in terms of sensitivity, reaction speed, and amplicon yield. The amplification chamber is connected via a microchannel to a detection chamber containing a reagentless, multiplexed (here biplex) sensing array for sequence-specific electrochemical DNA (E-DNA) detection of the LAMP products. Validation of the IMED device was assessed by the detection and discrimination of S. enterica subsp. enterica serovars Typhimurium and Choleraesuis, the causative agents of enterocolitis and sepsis in humans, respectively. IMED chips conferred rapid (under 2 h) detection and discrimination of these strains at clinically relevant levels (<1,000 CFU/ml) from whole, unprocessed blood collected from septic animals. The IMED-based chip assay shows considerable promise as a rapid, inexpensive, and portable point-of-care diagnostic platform for the detection and strain-specific discrimination of microbial pathogens. PMID:23354710

  5. Chromatin immunoprecipitation (ChIP) method for non-model fruit flies (Diptera: Tephritidae) and evidence of histone modifications.

    PubMed

    Nagalingam, Kumaran; Lorenc, Michał T; Manoli, Sahana; Cameron, Stephen L; Clarke, Anthony R; Dudley, Kevin J

    2018-01-01

    Interactions between DNA and proteins located in the cell nucleus play an important role in controlling physiological processes by specifying, augmenting and regulating context-specific transcription events. Chromatin immunoprecipitation (ChIP) is a widely used methodology to study DNA-protein interactions and has been successfully used in various cell types for over three decades. More recently, by combining ChIP with genomic screening technologies and Next Generation Sequencing (e.g. ChIP-seq), it has become possible to profile DNA-protein interactions (including covalent histone modifications) across entire genomes. However, the applicability of ChIP-chip and ChIP-seq has rarely been extended to non-model species because of a number of technical challenges. Here we report a method that can be used to identify genome wide covalent histone modifications in a group of non-model fruit fly species (Diptera: Tephritidae). The method was developed by testing and refining protocols that have been used in model organisms, including Drosophila melanogaster. We demonstrate that this method is suitable for a group of economically important pest fruit fly species, viz., Bactrocera dorsalis, Ceratitis capitata, Zeugodacus cucurbitae and Bactrocera tryoni. We also report an example ChIP-seq dataset for B. tryoni, providing evidence for histone modifications in the genome of a tephritid fruit fly for the first time. Since tephritids are major agricultural pests globally, this methodology will be a valuable resource to study taxa-specific evolutionary questions and to assist with pest management. It also provides a basis for researchers working with other non-model species to undertake genome wide DNA-protein interaction studies.

  6. Micro-chromatin Immunoprecipation (μChIP) Protocol for Real-time PCR Analysis of a Limited Amount of Cells.

    PubMed

    Gillotin, Sébastien; Guillemot, François

    2016-06-20

    Chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) is an important strategy to study gene regulation. When availability of cells is limited, however, it can be useful to focus on specific genes to investigate in depth the role of transcription factors or histone marks. Unfortunately, performing ChIP experiments to study transcription factors' binding to DNA can be difficult when biological material is restricted. This protocol describes a robust method to perform μChIP for over-expressed or endogenous transcription factors using ~100,000 cells per ChIP experiment (Masserdotti et al ., 2015). We also describe optimization steps, which we think are critical for this protocol to work and which can be used to further reduce the number of cells.

  7. Fluorescent Quantification of DNA Based on Core-Shell Fe3O4@SiO2@Au Nanocomposites and Multiplex Ligation-Dependent Probe Amplification.

    PubMed

    Fan, Jing; Yang, Haowen; Liu, Ming; Wu, Dan; Jiang, Hongrong; Zeng, Xin; Elingarami, Sauli; Ll, Zhiyang; Li, Song; Liu, Hongna; He, Nongyue

    2015-02-01

    In this research, a novel method for relative fluorescent quantification of DNA based on Fe3O4@SiO2@Au gold-coated magnetic nanocomposites (GMNPs) and multiplex ligation- dependent probe amplification (MLPA) has been developed. With the help of self-assembly, seed-mediated growth and chemical reduction method, core-shell Fe3O4@SiO2@Au GMNPs were synthesized. Through modified streptavidin on the GMNPs surface, we obtained a bead chip which can capture the biotinylated probes. Then we designed MLPA probes which were tagged with biotin or Cy3 and target DNA on the basis of human APP gene sequence. The products from the thermostable DNA ligase induced ligation reactions and PCR amplifications were incubated with SA-GMNPs. After washing, magnetic separation, spotting, the fluorescent scanning results showed our method can be used for the relative quantitative analysis of the target DNA in the concentration range of 03004~0.5 µM.

  8. Suppression of the DHX9 Helicase Induces Premature Senescence in Human Diploid Fibroblasts in a p53-dependent Manner*

    PubMed Central

    Lee, Teresa; Di Paola, Domenic; Malina, Abba; Mills, John R.; Kreps, Amina; Grosse, Frank; Tang, Hengli; Zannis-Hadjopoulos, Maria; Larsson, Ola; Pelletier, Jerry

    2014-01-01

    DHX9 is an ATP-dependent DEXH box helicase with a multitude of cellular functions. Its ability to unwind both DNA and RNA, as well as aberrant, noncanonical polynucleotide structures, has implicated it in transcriptional and translational regulation, DNA replication and repair, and maintenance of genome stability. We report that loss of DHX9 in primary human fibroblasts results in premature senescence, a state of irreversible growth arrest. This is accompanied by morphological defects, elevation of senescence-associated β-galactosidase levels, and changes in gene expression closely resembling those encountered during replicative (telomere-dependent) senescence. Activation of the p53 signaling pathway was found to be essential to this process. ChIP analysis and investigation of nascent DNA levels revealed that DHX9 is associated with origins of replication and that its suppression leads to a reduction of DNA replication. Our results demonstrate an essential role of DHX9 in DNA replication and normal cell cycle progression. PMID:24990949

  9. Towards a DNA Nanoprocessor: Reusable Tile-Integrated DNA Circuits.

    PubMed

    Gerasimova, Yulia V; Kolpashchikov, Dmitry M

    2016-08-22

    Modern electronic microprocessors use semiconductor logic gates organized on a silicon chip to enable efficient inter-gate communication. Here, arrays of communicating DNA logic gates integrated on a single DNA tile were designed and used to process nucleic acid inputs in a reusable format. Our results lay the foundation for the development of a DNA nanoprocessor, a small and biocompatible device capable of performing complex analyses of DNA and RNA inputs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. Illuminating Cell Biology

    NASA Technical Reports Server (NTRS)

    2002-01-01

    NASA's Ames Research Center awarded Ciencia, Inc., a Small Business Innovation Research contract to develop the Cell Fluorescence Analysis System (CFAS) to address the size, mass, and power constraints of using fluorescence spectroscopy in the International Space Station's Life Science Research Facility. The system will play an important role in studying biological specimen's long-term adaptation to microgravity. Commercial applications for the technology include diverse markets such as food safety, in situ environmental monitoring, online process analysis, genomics and DNA chips, and non-invasive diagnostics. Ciencia has already sold the system to the private sector for biosensor applications.

  11. Arrays of nucleic acid probes on biological chips

    DOEpatents

    Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

    1998-11-17

    DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

  12. C/EBPα Expression is Partially Regulated by C/EBPβ in Response to DNA Damage and C/EBPα Deficient Fibroblasts Display an Impaired G1 Checkpoint

    PubMed Central

    Ranjan, Rakesh; Thompson, Elizabeth A.; Yoon, Kyungsil; Smart, Robert C.

    2009-01-01

    We observed that C/EBPα is highly inducible in primary fibroblasts by DNA damaging agents that induce strand breaks, alkylate and crosslink DNA as well as those that produce bulky DNA lesions. Fibroblasts deficient in C/EBPα (C/EBPα-/-) display an impaired G1 checkpoint as evidenced by inappropriate entry into S-phase in response to DNA damage and these cells also display an enhanced G1 to S transition in response to mitogens. The induction of C/EBPα by DNA damage in fibroblasts does not require p53. EMSA analysis of nuclear extracts prepared from UVB- and MNNG-treated fibroblasts revealed increased binding of C/EBPβ to a C/EBP consensus sequence and ChIP analysis revealed increased C/EBPβ binding to the C/EBPα promoter. To determine whether C/EBPβ has a role in the regulation of C/EBPα we treated C/EBPβ-/- fibroblasts with UVB or MNNG. We observed C/EBPα induction was impaired in both UVB- and MNNG- treated C/EBPβ-/- fibroblasts. Our study reveals a novel role for C/EBPβ in the regulation of C/EBPα in response to DNA damage and provides definitive genetic evidence that C/EBPα has a critical role in the DNA damage G1 checkpoint. PMID:19581927

  13. Quantitation of DNA adducts by stable isotope dilution mass spectrometry

    PubMed Central

    Tretyakova, Natalia; Goggin, Melissa; Janis, Gregory

    2012-01-01

    Exposure to endogenous and exogenous chemicals can lead to the formation of structurally modified DNA bases (DNA adducts). If not repaired, these nucleobase lesions can cause polymerase errors during DNA replication, leading to heritable mutations potentially contributing to the development of cancer. Due to their critical role in cancer initiation, DNA adducts represent mechanism-based biomarkers of carcinogen exposure, and their quantitation is particularly useful for cancer risk assessment. DNA adducts are also valuable in mechanistic studies linking tumorigenic effects of environmental and industrial carcinogens to specific electrophilic species generated from their metabolism. While multiple experimental methodologies have been developed for DNA adduct analysis in biological samples – including immunoassay, HPLC, and 32P-postlabeling – isotope dilution high performance liquid chromatography-electrospray ionization-tandem mass spectrometry (HPLC-ESI-MS/MS) generally has superior selectivity, sensitivity, accuracy, and reproducibility. As typical DNA adducts concentrations in biological samples are between 0.01 – 10 adducts per 108 normal nucleotides, ultrasensitive HPLC-ESI-MS/MS methodologies are required for their analysis. Recent developments in analytical separations and biological mass spectrometry – especially nanoflow HPLC, nanospray ionization MS, chip-MS, and high resolution MS – have pushed the limits of analytical HPLC-ESI-MS/MS methodologies for DNA adducts, allowing researchers to accurately measure their concentrations in biological samples from patients treated with DNA alkylating drugs and in populations exposed to carcinogens from urban air, drinking water, cooked food, alcohol, and cigarette smoke. PMID:22827593

  14. eSensor: an electrochemical detection-based DNA microarray technology enabling sample-to-answer molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Liu, Robin H.; Longiaru, Mathew

    2009-05-01

    DNA microarrays are becoming a widespread tool used in life science and drug screening due to its many benefits of miniaturization and integration. Microarrays permit a highly multiplexed DNA analysis. Recently, the development of new detection methods and simplified methodologies has rapidly expanded the use of microarray technologies from predominantly gene expression analysis into the arena of diagnostics. Osmetech's eSensor® is an electrochemical detection platform based on a low-to- medium density DNA hybridization array on a cost-effective printed circuit board substrate. eSensor® has been cleared by FDA for Warfarin sensitivity test and Cystic Fibrosis Carrier Detection. Other genetic-based diagnostic and infectious disease detection tests are under development. The eSensor® platform eliminates the need for an expensive laser-based optical system and fluorescent reagents. It allows one to perform hybridization and detection in a single and small instrument without any fluidic processing and handling. Furthermore, the eSensor® platform is readily adaptable to on-chip sample-to-answer genetic analyses using microfluidics technology. The eSensor® platform provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus have a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

  15. Using DNA chips for identification of tephritid pest species.

    PubMed

    Chen, Yen-Hou; Liu, Lu-Yan; Tsai, Wei-Huang; Haymer, David S; Lu, Kuang-Hui

    2014-08-01

    The ability correctly to identify species in a rapid and reliable manner is critical in many situations. For insects in particular, the primary tools for such identification rely on adult-stage morphological characters. For a number of reasons, however, there is a clear need for alternatives. This paper reports on the development of a new method employing DNA biochip technology for the identification of pest species within the family Tephritidae. The DNA biochip developed and tested here quickly and efficiently identifies and discriminates between several tephritid species, except for some that are members of a complex of closely related taxa and that may in fact not represent distinct biological species. The use of these chips offers a number of potential advantages over current methods. Results can be obtained in less than 5 h using material from any stage of the life cycle and with greater sensitivity than other methods currently available. This technology provides a novel tool for the rapid and reliable identification of several major pest species that may be intercepted in imported fruits or other commodities. The existing chips can also easily be expanded to incorporate additional markers and species as needed. © 2013 Society of Chemical Industry.

  16. Rapid detection of aflatoxigenic Aspergillus sp. in herbal specimens by a simple, bendable, paper-based lab-on-a-chip.

    PubMed

    Chaumpluk, Piyasak; Plubcharoensook, Pattra; Prasongsuk, Sehanat

    2016-06-01

    Postharvest herbal product contamination with mycotoxins and mycotoxin-producing fungi represents a potentially carcinogenic hazard. Aspergillus flavus is a major cause of this issue. Available mold detection methods are PCR-based and rely heavily on laboratories; thus, they are unsuitable for on-site monitoring. In this study, a bendable, paper-based lab-on-a-chip platform was developed to rapidly detect toxigenic Aspergillus spp. DNA. The 3.0-4.0 cm(2) chip is fabricated using Whatman™ filter paper, fishing line and a simple plastic lamination process and has nucleic acid amplification and signal detection components. The Aspergillus assay specifically amplifies the aflatoxin biosynthesis gene, aflR, using loop-mediated isothermal amplification (LAMP); hybridization between target DNA and probes on blue silvernanoplates (AgNPls) yields colorimetric results. Positive results are indicated by the detection pad appearing blue due to dispersed blue AgNPls; negative results are indicated by the detection pad appearing colorless or pale yellow due to probe/target DNA hybridization and AgNPls aggregation. Assay completion requires less than 40 min, has a limit of detection (LOD) of 100 aflR copies, and has high specificity (94.47%)and sensitivity (100%). Contamination was identified in 14 of 32 herbal samples tested (43.75%). This work demonstrates the fabrication of a simple, low-cost, paper-based lab-on-a-chip platform suitable for rapid-detection applications. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A detailed protocol for chromatin immunoprecipitation in the yeast Saccharomyces cerevisiae.

    PubMed

    Grably, Melanie; Engelberg, David

    2010-01-01

    Critical cellular processes such as DNA replication, DNA damage repair, and transcription are mediated and regulated by DNA-binding proteins. Many efforts have been invested therefore in developing methods that monitor the dynamics of protein-DNA association. As older techniques such as DNA footprinting, and electrophoretic mobility shift assays (EMSA) could be applied mostly in vitro, the development of the chromatin immunoprecipitation (ChIP) method, which allows quantitative measurement of protein-bound DNA most accurately in vivo, revolutionized our capabilities of understanding the mechanisms underlying the aforementioned processes. Furthermore, this powerful tool could be applied at the genomic-scale providing a global picture of the protein-DNA complexes at the entire genome.The procedure is conceptually simple; involves rapid crosslinking of proteins to DNA by the addition of formaldehyde to the culture, shearing the DNA and immunoprecipitating the protein of interest while covalently bound to its DNA targets. Following decrosslinking, DNA that was coimmunoprecipitated could be amplified by PCR or could serve as a probe of a genomic microarray to identify all DNA fragments that were bound to the protein.Although simple in principle, the method is not trivial to implement and the results might be misleading if proper controls are not included in the experiment. In this chapter, we provide therefore a highly detailed protocol of ChIP assay as is applied successfully in our laboratory. We pay special attention to describe every small detail, in order that any investigator could readily and successfully apply this important and powerful technology.

  18. Quantitative analysis of small molecule-nucleic acid interactions with a biosensor surface and surface plasmon resonance detection.

    PubMed

    Liu, Yang; Wilson, W David

    2010-01-01

    Surface plasmon resonance (SPR) technology with biosensor surfaces has become a widely-used tool for the study of nucleic acid interactions without any labeling requirements. The method provides simultaneous kinetic and equilibrium characterization of the interactions of biomolecules as well as small molecule-biopolymer binding. SPR monitors molecular interactions in real time and provides significant advantages over optical or calorimetic methods for systems with strong binding coupled to small spectroscopic signals and/or reaction heats. A detailed and practical guide for nucleic acid interaction analysis using SPR-biosensor methods is presented. Details of the SPR technology and basic fundamentals are described with recommendations on the preparation of the SPR instrument, sensor chips, and samples, as well as extensive information on experimental design, quantitative and qualitative data analysis and presentation. A specific example of the interaction of a minor-groove-binding agent with DNA is evaluated by both kinetic and steady-state SPR methods to illustrate the technique. Since the molecules that bind cooperatively to specific DNA sequences are attractive for many applications, a cooperative small molecule-DNA interaction is also presented.

  19. Is this the right normalization? A diagnostic tool for ChIP-seq normalization.

    PubMed

    Angelini, Claudia; Heller, Ruth; Volkinshtein, Rita; Yekutieli, Daniel

    2015-05-09

    Chip-seq experiments are becoming a standard approach for genome-wide profiling protein-DNA interactions, such as detecting transcription factor binding sites, histone modification marks and RNA Polymerase II occupancy. However, when comparing a ChIP sample versus a control sample, such as Input DNA, normalization procedures have to be applied in order to remove experimental source of biases. Despite the substantial impact that the choice of the normalization method can have on the results of a ChIP-seq data analysis, their assessment is not fully explored in the literature. In particular, there are no diagnostic tools that show whether the applied normalization is indeed appropriate for the data being analyzed. In this work we propose a novel diagnostic tool to examine the appropriateness of the estimated normalization procedure. By plotting the empirical densities of log relative risks in bins of equal read count, along with the estimated normalization constant, after logarithmic transformation, the researcher is able to assess the appropriateness of the estimated normalization constant. We use the diagnostic plot to evaluate the appropriateness of the estimates obtained by CisGenome, NCIS and CCAT on several real data examples. Moreover, we show the impact that the choice of the normalization constant can have on standard tools for peak calling such as MACS or SICER. Finally, we propose a novel procedure for controlling the FDR using sample swapping. This procedure makes use of the estimated normalization constant in order to gain power over the naive choice of constant (used in MACS and SICER), which is the ratio of the total number of reads in the ChIP and Input samples. Linear normalization approaches aim to estimate a scale factor, r, to adjust for different sequencing depths when comparing ChIP versus Input samples. The estimated scaling factor can easily be incorporated in many peak caller algorithms to improve the accuracy of the peak identification. The diagnostic plot proposed in this paper can be used to assess how adequate ChIP/Input normalization constants are, and thus it allows the user to choose the most adequate estimate for the analysis.

  20. Parallel confocal detection of single biomolecules using diffractive optics and integrated detector units.

    PubMed

    Blom, H; Gösch, M

    2004-04-01

    The past few years we have witnessed a tremendous surge of interest in so-called array-based miniaturised analytical systems due to their value as extremely powerful tools for high-throughput sequence analysis, drug discovery and development, and diagnostic tests in medicine (see articles in Issue 1). Terminologies that have been used to describe these array-based bioscience systems include (but are not limited to): DNA-chip, microarrays, microchip, biochip, DNA-microarrays and genome chip. Potential technological benefits of introducing these miniaturised analytical systems include improved accuracy, multiplexing, lower sample and reagent consumption, disposability, and decreased analysis times, just to mention a few examples. Among the many alternative principles of detection-analysis (e.g.chemiluminescence, electroluminescence and conductivity), fluorescence-based techniques are widely used, examples being fluorescence resonance energy transfer, fluorescence quenching, fluorescence polarisation, time-resolved fluorescence, and fluorescence fluctuation spectroscopy (see articles in Issue 11). Time-dependent fluctuations of fluorescent biomolecules with different molecular properties, like molecular weight, translational and rotational diffusion time, colour and lifetime, potentially provide all the kinetic and thermodynamic information required in analysing complex interactions. In this mini-review article, we present recent extensions aimed to implement parallel laser excitation and parallel fluorescence detection that can lead to even further increase in throughput in miniaturised array-based analytical systems. We also report on developments and characterisations of multiplexing extension that allow multifocal laser excitation together with matched parallel fluorescence detection for parallel confocal dynamical fluorescence fluctuation studies at the single biomolecule level.

  1. DNA Everywhere. A Guide for Simplified Environmental Genomic DNA Extraction Suitable for Use in Remote Areas

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gabrielle N. Pecora; Francine C. Reid; Lauren M. Tom

    2016-05-01

    Collecting field samples from remote or geographically distant areas can be a financially and logistically challenging. With participation of a local organization where the samples are originated from, gDNA samples can be extracted from the field and shipped to a research institution for further processing and analysis. The ability to set up gDNA extraction capabilities in the field can drastically reduce cost and time when running long-term microbial studies with a large sample set. The method outlined here has developed a compact and affordable method for setting up a “laboratory” and extracting and shipping gDNA samples from anywhere in themore » world. This white paper explains the process of setting up the “laboratory”, choosing and training individuals with no prior scientific experience how to perform gDNA extractions and safe methods for shipping extracts to any research institution. All methods have been validated by the Andersen group at Lawrence Berkeley National Laboratory using the Berkeley Lab PhyloChip.« less

  2. Microbial community analysis of an Alabama coastal salt marsh impacted by the Deepwater Horizon Oil Spill

    NASA Astrophysics Data System (ADS)

    Beazley, M. J.; Martinez, R.; Rajan, S.; Powell, J.; Piceno, Y.; Tom, L.; Andersen, G. L.; Hazen, T. C.; Van Nostrand, J. D.; Zhou, J.; Mortazavi, B.; Sobecky, P. A.

    2011-12-01

    Microbial community responses of an Alabama coastal salt marsh environment to the Deepwater Horizon oil spill were studied by 16S rRNA (PhyloChip) and functional gene (GeoChip) microarray-based analysis. Oil and tar balls associated with the oil spill arrived along the Alabama coast in June 2010. Marsh and inlet sediment samples collected in June, July, and September 2010 from a salt marsh ecosystem at Point Aux Pines Alabama were analyzed to determine if bacterial community structure changed as a result of oil perturbation. Sediment total petroleum hydrocarbon (TPH) concentrations ranged from below detection to 189 mg kg-1 and were randomly dispersed throughout the salt marsh sediments. Total DNA extracted from sediment and particulates were used for PhyloChip and GeoChip hybridization. A total of 4000 to 8000 operational taxonomic units (OTUs) were detected in marsh and inlet samples. Distinctive changes in the number of detectable OTUs were observed between June, July, and September 2010. Surficial inlet sediments demonstrated a significant increase in the total number of OTUs between June and September that correlated with TPH concentrations. The most significant increases in bacterial abundance were observed in the phyla Actinobacteria, Firmicutes, Gemmatimonadetes, Proteobacteria, and Verrucomicrobia. Bacterial richness in marsh sediments also correlated with TPH concentrations with significant changes primarily in Acidobacteria, Actinobacteria, Firmicutes, Fusobacteria, Nitrospirae, and Proteobacteria. GeoChip microarray analysis detected 5000 to 8300 functional genes in marsh and inlet samples. Surficial inlet sediments demonstrated distinctive increases in the number of detectable genes and gene signal intensities in July samples compared to June. Signal intensities increased (> 1.5-fold) in genes associated with petroleum degradation. Genes related to metal resistance, stress, and carbon cycling also demonstrated increases in oiled sediments. This study demonstrates the value of applying phylogenetic and functional gene microarray technology to characterize the extensive microbial diversity of marsh environments. Moreover, this technology provides significant insight into bacterial community responses to anthropogenic oil events.

  3. Development of DNA Pillar Chip Final Report CRADA No. TSB-2035-01

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ness, K. D.; Long, G. W.

    This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL) and Tetracore, to demonstrate a proof of principal device for the capture and controlled release of DNA moving within a flow stream.

  4. C. elegans-on-a-chip for in situ and in vivo Ag nanoparticles’ uptake and toxicity assay

    NASA Astrophysics Data System (ADS)

    Kim, Jin Ho; Lee, Seung Hwan; Cha, Yun Jeong; Hong, Sung Jin; Chung, Sang Kug; Park, Tai Hyun; Choi, Shin Sik

    2017-01-01

    Nanomaterials are extensively used in consumer products and medical applications, but little is known about their environmental and biological toxicities. Moreover, the toxicity analysis requires sophisticated instruments and labor-intensive experiments. Here we report a microfluidic chip incorporated with the nematode Caenorhabditis elegans that rapidly displays the changes in body growth and gene expression specifically responsive to the silver nanoparticles (AgNPs). C. elegans were cultured in microfluidic chambers in the presence or absence of AgNPs and were consequently transferred to wedge-shaped channels, which immobilized the animals, allowing the evaluation of parameters such as length, moving distance, and fluorescence from the reporter gene. The AgNPs reduced the length of C. elegans body, which was easily identified in the channel of chip. In addition, the decrease of body width enabled the worm to advance the longer distance compared to the animal without nanoparticles in a wedge-shaped channel. The transgenic marker DNA, mtl-2::gfp was highly expressed upon the uptake of AgNPs, resulting in green fluorescence emission. The comparative investigation using gold nanoparticles and heavy-metal ions indicated that these parameters are specific to AgNPs. These results demonstrate that C. elegans-on-a-chip has a great potential as a rapid and specific nanoparticle detection or nanotoxicity assessment system.

  5. Protein Chips for Detection of Salmonella spp. from Enrichment Culture

    PubMed Central

    Poltronieri, Palmiro; Cimaglia, Fabio; De Lorenzis, Enrico; Chiesa, Maurizio; Mezzolla, Valeria; Reca, Ida Barbara

    2016-01-01

    Food pathogens are the cause of foodborne epidemics, therefore there is a need to detect the pathogens in food productions rapidly. A pre-enrichment culture followed by selective agar plating are standard detection methods. Molecular methods such as qPCR have provided a first rapid protocol for detection of pathogens within 24 h of enrichment culture. Biosensors also may provide a rapid tool to individuate a source of Salmonella contamination at early times of pre-enrichment culture. Forty mL of Salmonella spp. enrichment culture were processed by immunoseparation using the Pathatrix, as in AFNOR validated qPCR protocols. The Salmonella biosensor combined with immunoseparation showed a limit of detection of 100 bacteria/40 mL, with a 400 fold increase to previous results. qPCR analysis requires processing of bead-bound bacteria with lysis buffer and DNA clean up, with a limit of detection of 2 cfu/50 μL. Finally, a protein chip was developed and tested in screening and identification of 5 common pathogen species, Salmonella spp., E. coli, S. aureus, Campylobacter spp. and Listeria spp. The protein chip, with high specificity in species identification, is proposed to be integrated into a Lab-on-Chip system, for rapid and reproducible screening of Salmonella spp. and other pathogen species contaminating food productions. PMID:27110786

  6. Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis

    PubMed Central

    Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

    2017-01-01

    Abstract China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production. PMID:28981563

  7. Optimized acoustic biochip integrated with microfluidics for biomarkers detection in molecular diagnostics.

    PubMed

    Papadakis, G; Friedt, J M; Eck, M; Rabus, D; Jobst, G; Gizeli, E

    2017-09-01

    The development of integrated platforms incorporating an acoustic device as the detection element requires addressing simultaneously several challenges of technological and scientific nature. The present work was focused on the design of a microfluidic module, which, combined with a dual or array type Love wave acoustic chip could be applied to biomedical applications and molecular diagnostics. Based on a systematic study we optimized the mechanics of the flow cell attachment and the sealing material so that fluidic interfacing/encapsulation would impose minimal losses to the acoustic wave. We have also investigated combinations of operating frequencies with waveguide materials and thicknesses for maximum sensitivity during the detection of protein and DNA biomarkers. Within our investigations neutravidin was used as a model protein biomarker and unpurified PCR amplified Salmonella DNA as the model genetic target. Our results clearly indicate the need for experimental verification of the optimum engineering and analytical parameters, in order to develop commercially viable systems for integrated analysis. The good reproducibility of the signal together with the ability of the array biochip to detect multiple samples hold promise for the future use of the integrated system in a Lab-on-a-Chip platform for application to molecular diagnostics.

  8. Genetic Inventory Task Final Report. Volume 2

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri; LaDuc, Myron T.; Vaishampayan, Parag

    2012-01-01

    Contaminant terrestrial microbiota could profoundly impact the scientific integrity of extraterrestrial life-detection experiments. It is therefore important to know what organisms persist on spacecraft surfaces so that their presence can be eliminated or discriminated from authentic extraterrestrial biosignatures. Although there is a growing understanding of the biodiversity associated with spacecraft and cleanroom surfaces, it remains challenging to assess the risk of these microbes confounding life-detection or sample-return experiments. A key challenge is to provide a comprehensive inventory of microbes present on spacecraft surfaces. To assess the phylogenetic breadth of microorganisms on spacecraft and associated surfaces, the Genetic Inventory team used three technologies: conventional cloning techniques, PhyloChip DNA microarrays, and 454 tag-encoded pyrosequencing, together with a methodology to systematically collect, process, and archive nucleic acids. These three analysis methods yielded considerably different results: Traditional approaches provided the least comprehensive assessment of microbial diversity, while PhyloChip and pyrosequencing illuminated more diverse microbial populations. The overall results stress the importance of selecting sample collection and processing approaches based on the desired target and required level of detection. The DNA archive generated in this study can be made available to future researchers as genetic-inventory-oriented technologies further mature.

  9. Identification of genes related to high royal jelly production in the honey bee (Apis mellifera) using microarray analysis.

    PubMed

    Nie, Hongyi; Liu, Xiaoyan; Pan, Jiao; Li, Wenfeng; Li, Zhiguo; Zhang, Shaowu; Chen, Shenglu; Miao, Xiaoqing; Zheng, Nenggan; Su, Songkun

    2017-01-01

    China is the largest royal jelly producer and exporter in the world, and high royal jelly-yielding strains have been bred in the country for approximately three decades. However, information on the molecular mechanism underlying high royal jelly production is scarce. Here, a cDNA microarray was used to screen and identify differentially expressed genes (DEGs) to obtain an overview on the changes in gene expression levels between high and low royal jelly producing bees. We developed a honey bee gene chip that covered 11,689 genes, and this chip was hybridised with cDNA generated from RNA isolated from heads of nursing bees. A total of 369 DEGs were identified between high and low royal jelly producing bees. Amongst these DEGs, 201 (54.47%) genes were up-regulated, whereas 168 (45.53%) were down-regulated in high royal jelly-yielding bees. Gene ontology (GO) analyses showed that they are mainly involved in four key biological processes, and pathway analyses revealed that they belong to a total of 46 biological pathways. These results provide a genetic basis for further studies on the molecular mechanisms involved in high royal jelly production.

  10. missMethyl: an R package for analyzing data from Illumina's HumanMethylation450 platform.

    PubMed

    Phipson, Belinda; Maksimovic, Jovana; Oshlack, Alicia

    2016-01-15

    DNA methylation is one of the most commonly studied epigenetic modifications due to its role in both disease and development. The Illumina HumanMethylation450 BeadChip is a cost-effective way to profile >450 000 CpGs across the human genome, making it a popular platform for profiling DNA methylation. Here we introduce missMethyl, an R package with a suite of tools for performing normalization, removal of unwanted variation in differential methylation analysis, differential variability testing and gene set analysis for the 450K array. missMethyl is an R package available from the Bioconductor project at www.bioconductor.org. alicia.oshlack@mcri.edu.au Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  11. PhyloChip microarray analysis reveals altered gastrointestinal microbial communities in a rat model of colonic hypersensitivity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nelson, T.A.; Holmes, S.; Alekseyenko, A.V.

    Irritable bowel syndrome (IBS) is a chronic, episodic gastrointestinal disorder that is prevalent in a significant fraction of western human populations; and changes in the microbiota of the large bowel have been implicated in the pathology of the disease. Using a novel comprehensive, high-density DNA microarray (PhyloChip) we performed a phylogenetic analysis of the microbial community of the large bowel in a rat model in which intracolonic acetic acid in neonates was used to induce long lasting colonic hypersensitivity and decreased stool water content and frequency, representing the equivalent of human constipation-predominant IBS. Our results revealed a significantly increased compositionalmore » difference in the microbial communities in rats with neonatal irritation as compared with controls. Even more striking was the dramatic change in the ratio of Firmicutes relative to Bacteroidetes, where neonatally irritated rats were enriched more with Bacteroidetes and also contained a different composition of species within this phylum. Our study also revealed differences at the level of bacterial families and species. The PhyloChip is a useful and convenient method to study enteric microflora. Further, this rat model system may be a useful experimental platform to study the causes and consequences of changes in microbial community composition associated with IBS.« less

  12. Fish species identification using PCR-RFLP analysis and lab-on-a-chip capillary electrophoresis: application to detect white fish species in food products and an interlaboratory study.

    PubMed

    Dooley, John J; Sage, Helen D; Clarke, Marie-Anne L; Brown, Helen M; Garrett, Stephen D

    2005-05-04

    Identification of 10 white fish species associated with U.K. food products was achieved using PCR-RFLP of the mitochondrial cytochrome b gene. Use of lab-on-a-chip capillary electrophoresis for end-point analysis enabled accurate sizing of DNA fragments and identification of fish species at a level of 5% (w/w) in a fish admixture. One restriction enzyme, DdeI, allowed discrimination of eight species. When combined with NlaIII and HaeIII, specific profiles for all 10 species were generated. The method was applied to a range of products and subjected to an interlaboratory study carried out by five U.K. food control laboratories. One hundred percent correct identification of single species samples and six of nine admixture samples was achieved by all laboratories. The results indicated that fish species identification could be carried out using a database of PCR-RFLP profiles without the need for reference materials.

  13. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.

    The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method.more » PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in host plants (5,27,40). Tatineni and colleagues discovered that the HLB bacteria were unevenly distributed in phloem of bark tissue, vascular tissue of the leaf midrib, roots, and different floral and fruit parts (43). Unsuccessful attempts in culturing the pathogen are notably hampering efforts to understand its biology and pathogenesis mechanism. Using a modified Koch's Postulates approach, Jagoueix and colleagues were able to re-infect periwinkle plants from a mixed microbial community harvested from HLB diseased plants (25). Emergence of the disease in otherwise healthy plants led to the conclusion that HLB was associated with Candidatus Liberibacter sp. based on its 16S rDNA sequence (18,25). Currently, three species of the pathogen are recognized from trees with HLB disease based on 16S rDNA sequence: Ca. Liberibacter asiaticus (Las), Ca. Liberibacter africanus (Laf), and Ca. Liberibacter americanus (Lam); Las is the most prevalent species among HLB diseased trees (5,12,18,25,44). Las is naturally transmitted to citrus by the psyllid, Diaphorina citri Kuwayama, and can be artificially transmitted by grafting from citrus to citrus and dodder (Cuscuta campestris) to periwinkle (Catharanthus roseus) or tobacco (Nicotiana tabacum Xanthi) (5). Based on current research regarding the associations of Liberibacter in planta there is not enough evidence to implicate Liberibacter as the definitive causal agent of HLB disease due to its resistance to cultivation in vitro. It is possible that HLB disease may be the result of complex etiology where Liberibacter interacts with other endophytic bacteria. However, there is not enough evidence regarding its association(s) in planta to make this conclusion, nor is it known whether associated microbial communities play a role in expression of pathogenic traits. The main objective of the study was to test the hypothesis that other bacteria besides Ca. Liberibacter spp. are associated with citrus greening disease. The differences between the relative abundance, species richness and phylogenetic diversity of the microbial communities associated with the leaf midribs of HLB symptomatic and asymptomatic citrus trees were investigated using high-density 16S rDNA microarray PhyloChip and 16S rRNA gene clone library methods.« less

  14. The easy road to genome-wide medium density SNP screening in a non-model species: development and application of a 10 K SNP-chip for the house sparrow (Passer domesticus).

    PubMed

    Hagen, Ingerid J; Billing, Anna M; Rønning, Bernt; Pedersen, Sindre A; Pärn, Henrik; Slate, Jon; Jensen, Henrik

    2013-05-01

    With the advent of next generation sequencing, new avenues have opened to study genomics in wild populations of non-model species. Here, we describe a successful approach to a genome-wide medium density Single Nucleotide Polymorphism (SNP) panel in a non-model species, the house sparrow (Passer domesticus), through the development of a 10 K Illumina iSelect HD BeadChip. Genomic DNA and cDNA derived from six individuals were sequenced on a 454 GS FLX system and generated a total of 1.2 million sequences, in which SNPs were detected. As no reference genome exists for the house sparrow, we used the zebra finch (Taeniopygia guttata) reference genome to determine the most likely position of each SNP. The 10 000 SNPs on the SNP-chip were selected to be distributed evenly across 31 chromosomes, giving on average one SNP per 100 000 bp. The SNP-chip was screened across 1968 individual house sparrows from four island populations. Of the original 10 000 SNPs, 7413 were found to be variable, and 99% of these SNPs were successfully called in at least 93% of all individuals. We used the SNP-chip to demonstrate the ability of such genome-wide marker data to detect population sub-division, and compared these results to similar analyses using microsatellites. The SNP-chip will be used to map Quantitative Trait Loci (QTL) for fitness-related phenotypic traits in natural populations. © 2013 Blackwell Publishing Ltd.

  15. The correlation of methylation levels measured using Illumina 450K and EPIC BeadChips in blood samples

    PubMed Central

    Logue, Mark W; Smith, Alicia K; Wolf, Erika J; Maniates, Hannah; Stone, Annjanette; Schichman, Steven A; McGlinchey, Regina E; Milberg, William; Miller, Mark W

    2017-01-01

    Aim: We examined concordance of methylation levels across the Illumina Infinium HumanMethylation450 BeadChip and the Infinium MethylationEPIC BeadChip. Methods: We computed the correlation for 145 whole blood DNA samples at each of the 422,524 CpG sites measured by both chips. Results: The correlation at some sites was high (up to r = 0.95), but many sites had low correlation (55% had r < 0.20). The low correspondence between 450K and EPIC measured methylation values at many loci was largely due to the low variability in methylation values for the majority of the CpG sites in blood. Conclusion: Filtering out probes based on the observed correlation or low variability may increase reproducibility of BeadChip-based epidemiological studies. PMID:28809127

  16. Self-priming compartmentalization digital LAMP for point-of-care.

    PubMed

    Zhu, Qiangyuan; Gao, Yibo; Yu, Bingwen; Ren, Hao; Qiu, Lin; Han, Sihai; Jin, Wei; Jin, Qinhan; Mu, Ying

    2012-11-21

    Digital nucleic acid amplification provides unprecedented opportunities for absolute nucleic acid quantification by counting of single molecules. This technique is useful for molecular genetic analysis in cancer, stem cell, bacterial, non-invasive prenatal diagnosis in which many biologists are interested. This paper describes a self-priming compartmentalization (SPC) microfluidic chip platform for performing digital loop-mediated amplification (LAMP). The energy for the pumping is pre-stored in the degassed bulk PDMS by exploiting the high gas solubility of PDMS; therefore, no additional structures other than channels and reservoirs are required. The sample and oil are sequentially sucked into the channels, and the pressure difference of gas dissolved in PDMS allows sample self-compartmentalization without the need for further chip manipulation such as with pneumatic microvalves and control systems, and so on. The SPC digital LAMP chip can be used like a 384-well plate, so, the world-to-chip fluidic interconnections are avoided. The microfluidic chip contains 4 separate panels, each panel contains 1200 independent 6 nL chambers and can be used to detect 4 samples simultaneously. Digital LAMP on the microfluidic chip was tested quantitatively by using β-actin DNA from humans. The self-priming compartmentalization behavior is roughly predictable using a two-dimensional model. The uniformity of compartmentalization was analyzed by fluorescent intensity and fraction of volume. The results showed that the feasibility and flexibility of the microfluidic chip platform for amplifying single nucleic acid molecules in different chambers made by diluting and distributing sample solutions. The SPC chip has the potential to meet the requirements of a general laboratory: power-free, valve-free, operating at isothermal temperature, inexpensive, sensitive, economizing labour time and reagents. The disposable analytical devices with appropriate air-tight packaging should be useful for point-of-care, and enabling it to become one of the common tools for biology research, especially, in point-of-care testing.

  17. Simplified transient isotachophoresis/capillary gel electrophoresis method for highly sensitive analysis of polymerase chain reaction samples on a microchip with laser-induced fluorescence detection.

    PubMed

    Liu, Dayu; Ou, Ziyou; Xu, Mingfei; Wang, Lihui

    2008-12-19

    We present a sensitive, simple and robust on-chip transient isotachophoresis/capillary gel electrophoresis (tITP/CGE) method for the analysis of polymerase chain reaction (PCR) samples. Using chloride ions in the PCR buffer and N-2-hydroxyethylpiperazine-N'-2-ethanesulfonic acid (HEPES) in the background electrolyte, respectively, as the leading and terminating electrolytes, the tITP preconcentration was coupled with CGE separation with double-T shaped channel network. The tITP/CGE separation was carried out with a single running buffer. The separation process involved only two steps that were performed continuously with the sequential switching of four voltage outputs. The tITP/CGE method showed an analysis time and a separation efficiency comparable to those of standard CGE, while the signal intensity was enhanced by factors of over 20. The limit of detection of the chip-based tITP/CGE method was estimated to be 1.1 ng/mL of DNA in 1x PCR buffer using confocal fluorescence detection following 473 nm laser excitation.

  18. Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

    PubMed

    Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

    2003-09-30

    Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

  19. An evaluation of two-channel ChIP-on-chip and DNA methylation microarray normalization strategies

    PubMed Central

    2012-01-01

    Background The combination of chromatin immunoprecipitation with two-channel microarray technology enables genome-wide mapping of binding sites of DNA-interacting proteins (ChIP-on-chip) or sites with methylated CpG di-nucleotides (DNA methylation microarray). These powerful tools are the gateway to understanding gene transcription regulation. Since the goals of such studies, the sample preparation procedures, the microarray content and study design are all different from transcriptomics microarrays, the data pre-processing strategies traditionally applied to transcriptomics microarrays may not be appropriate. Particularly, the main challenge of the normalization of "regulation microarrays" is (i) to make the data of individual microarrays quantitatively comparable and (ii) to keep the signals of the enriched probes, representing DNA sequences from the precipitate, as distinguishable as possible from the signals of the un-enriched probes, representing DNA sequences largely absent from the precipitate. Results We compare several widely used normalization approaches (VSN, LOWESS, quantile, T-quantile, Tukey's biweight scaling, Peng's method) applied to a selection of regulation microarray datasets, ranging from DNA methylation to transcription factor binding and histone modification studies. Through comparison of the data distributions of control probes and gene promoter probes before and after normalization, and assessment of the power to identify known enriched genomic regions after normalization, we demonstrate that there are clear differences in performance between normalization procedures. Conclusion T-quantile normalization applied separately on the channels and Tukey's biweight scaling outperform other methods in terms of the conservation of enriched and un-enriched signal separation, as well as in identification of genomic regions known to be enriched. T-quantile normalization is preferable as it additionally improves comparability between microarrays. In contrast, popular normalization approaches like quantile, LOWESS, Peng's method and VSN normalization alter the data distributions of regulation microarrays to such an extent that using these approaches will impact the reliability of the downstream analysis substantially. PMID:22276688

  20. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines

    PubMed Central

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours’ biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription–quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes. PMID:29263807

  1. Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

    PubMed

    Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

    2016-01-01

    Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

  2. Microfluidic integration of parallel solid-phase liquid chromatography.

    PubMed

    Huft, Jens; Haynes, Charles A; Hansen, Carl L

    2013-03-05

    We report the development of a fully integrated microfluidic chromatography system based on a recently developed column geometry that allows for robust packing of high-performance separation columns in poly(dimethylsiloxane) microfluidic devices having integrated valves made by multilayer soft lithography (MSL). The combination of parallel high-performance separation columns and on-chip plumbing was used to achieve a fully integrated system for on-chip chromatography, including all steps of automated sample loading, programmable gradient generation, separation, fluorescent detection, and sample recovery. We demonstrate this system in the separation of fluorescently labeled DNA and parallel purification of reverse transcription polymerase chain reaction (RT-PCR) amplified variable regions of mouse immunoglobulin genes using a strong anion exchange (AEX) resin. Parallel sample recovery in an immiscible oil stream offers the advantage of low sample dilution and high recovery rates. The ability to perform nucleic acid size selection and recovery on subnanogram samples of DNA holds promise for on-chip genomics applications including sequencing library preparation, cloning, and sample fractionation for diagnostics.

  3. A disposable, self-contained PCR chip.

    PubMed

    Kim, Jitae; Byun, Doyoung; Mauk, Michael G; Bau, Haim H

    2009-02-21

    A disposable, self-contained polymerase chain reaction (PCR) chip with on-board stored, just-on-time releasable, paraffin-passivated, dry reagents is described. During both storage and sample preparation, the paraffin immobilizes and protects the stored reagents. Fluid flow through the reactor leaves the reagents undisturbed. Prior to the amplification step, the chamber is filled with target analyte suspended in water. Upon heating the PCR chamber to the DNA's denaturation temperature, the paraffin melts and moves out of the way, and the reagents are released and hydrated. To better understand the reagent release process, a scaled up model of the reactor was constructed and the paraffin migration was visualized. Experiments were carried out with a 30 microl reactor demonstrating detectable amplification (with agarose gel electrophoresis) of 10 fg ( approximately 200 copies) of lambda DNA template. The in-reactor storage and on-time release of the PCR reagents reduce the number of needed operations and significantly simplifies the flow control that would, otherwise, be needed in lab-on-chip devices.

  4. On-chip PMA labeling of foodborne pathogenic bacteria for viable qPCR and qLAMP detection

    USDA-ARS?s Scientific Manuscript database

    Propidium monoazide (PMA) is a membrane impermeable molecule that covalently bonds to double stranded DNA when exposed to light and inhibits the polymerase activity, thus enabling DNA amplification detection protocols that discriminate between viable and non-viable entities. Here, we present a micro...

  5. Novel epigenetic changes unveiled by monozygotic twins discordant for smoking habits.

    PubMed

    Allione, Alessandra; Marcon, Francesca; Fiorito, Giovanni; Guarrera, Simonetta; Siniscalchi, Ester; Zijno, Andrea; Crebelli, Riccardo; Matullo, Giuseppe

    2015-01-01

    Exposure to cigarette smoking affects the epigenome and could increase the risk of developing diseases such as cancer and cardiovascular disorders. Changes in DNA methylation associated with smoking may help to identify molecular pathways that contribute to disease etiology. Previous studies are not completely concordant in the identification of differentially methylated regions in the DNA of smokers. We performed an epigenome-wide DNA methylation study in a group of monozygotic (MZ) twins discordant for smoking habits to determine the effect of smoking on DNA methylation. As MZ twins are considered genetically identical, this model allowed us to identify smoking-related DNA methylation changes independent from genetic components. We investigated the whole blood genome-wide DNA methylation profiles in 20 MZ twin pairs discordant for smoking habits by using the Illumina HumanMethylation450 BeadChip. We identified 22 CpG sites that were differentially methylated between smoker and non-smoker MZ twins by intra-pair analysis. We confirmed eight loci already described by other groups, located in AHRR, F2RL3, MYOG1 genes, at 2q37.1 and 6p21.33 regions, and also identified several new loci. Moreover, pathway analysis showed an enrichment of genes involved in GTPase regulatory activity. Our study confirmed the evidence of smoking-related DNA methylation changes, emphasizing that well-designed MZ twin models can aid the discovery of novel DNA methylation signals, even in a limited sample population.

  6. Detecting a single molecule using a micropore-nanopore hybrid chip

    PubMed Central

    2013-01-01

    Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing. PMID:24261484

  7. Detecting a single molecule using a micropore-nanopore hybrid chip.

    PubMed

    Liu, Lei; Zhu, Lizhong; Ni, Zhonghua; Chen, Yunfei

    2013-11-21

    Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing.

  8. Effects of soluble and particulate Cr(VI) on genome-wide DNA methylation in human B lymphoblastoid cells.

    PubMed

    Lou, Jianlin; Wang, Yu; Chen, Junqiang; Ju, Li; Yu, Min; Jiang, Zhaoqiang; Feng, Lingfang; Jin, Lingzhi; Zhang, Xing

    2015-10-01

    Several previous studies highlighted the potential epigenetic effects of Cr(VI), especially DNA methylation. However, few studies have compared the effects of Cr(VI) on DNA methylation profiles between soluble and particulate chromate in vitro. Accordingly, Illumina Infinium Human Methylation 450K BeadChip array was used to analyze DNA methylation profiles of human B lymphoblastoid cells exposed to potassium dichromate or lead chromate, and the cell viability was also studied. Array based DNA methylation analysis showed that the impacts of Cr(VI) on DNA methylation were limited, only about 40 differentially methylated CpG sites, with an overlap of 15CpG sites, were induced by both potassium dichromate and lead chromate. The results of mRNA expression showed that after Cr(VI) treatment, mRNA expression changes of four genes (TBL1Y, FZD5, IKZF2, and KIAA1949) were consistent with their DNA methylation alteration, but DNA methylation changes of other six genes did not correlate with mRNA expression. In conclusion, both of soluble and particulate Cr(VI) could induce a small amount of differentially methylated sites in human B lymphoblastoid cells, and the correlations between DNA methylation changes and mRNA expression varied between different genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. An epigenome-wide study of body mass index and DNA methylation in blood using participants from the Sister Study cohort.

    PubMed

    Wilson, L E; Harlid, S; Xu, Z; Sandler, D P; Taylor, J A

    2017-01-01

    The relationship between obesity and chronic disease risk is well-established; the underlying biological mechanisms driving this risk increase may include obesity-related epigenetic modifications. To explore this hypothesis, we conducted a genome-wide analysis of DNA methylation and body mass index (BMI) using data from a subset of women in the Sister Study. The Sister Study is a cohort of 50 884 US women who had a sister with breast cancer but were free of breast cancer themselves at enrollment. Study participants completed examinations which included measurements of height and weight, and provided blood samples. Blood DNA methylation data generated with the Illumina Infinium HumanMethylation27 BeadChip array covering 27,589 CpG sites was available for 871 women from a prior study of breast cancer and DNA methylation. To identify differentially methylated CpG sites associated with BMI, we analyzed this methylation data using robust linear regression with adjustment for age and case status. For those CpGs passing the false discovery rate significance level, we examined the association in a replication set comprised of a non-overlapping group of 187 women from the Sister Study who had DNA methylation data generated using the Infinium HumanMethylation450 BeadChip array. Analysis of this expanded 450 K array identified additional BMI-associated sites which were investigated with targeted pyrosequencing. Four CpG sites reached genome-wide significance (false discovery rate (FDR) q<0.05) in the discovery set and associations for all four were significant at strict Bonferroni correction in the replication set. An additional 23 sites passed FDR in the replication set and five were replicated by pyrosequencing in the discovery set. Several of the genes identified including ANGPT4, RORC, SOCS3, FSD2, XYLT1, ABCG1, STK39, ASB2 and CRHR2 have been linked to obesity and obesity-related chronic diseases. Our findings support the hypothesis that obesity-related epigenetic differences are detectable in blood and may be related to risk of chronic disease.

  10. The Influence of Metabolic Syndrome and Sex on the DNA Methylome in Schizophrenia

    PubMed Central

    Lines, Brittany N.

    2018-01-01

    Introduction The mechanism by which metabolic syndrome occurs in schizophrenia is not completely known; however, previous work suggests that changes in DNA methylation may be involved which is further influenced by sex. Within this study, the DNA methylome was profiled to identify altered methylation associated with metabolic syndrome in a schizophrenia population on atypical antipsychotics. Methods Peripheral blood from schizophrenia subjects was utilized for DNA methylation analyses. Discovery analyses (n = 96) were performed using an epigenome-wide analysis on the Illumina HumanMethylation450K BeadChip based on metabolic syndrome diagnosis. A secondary discovery analysis was conducted based on sex. The top hits from the discovery analyses were assessed in an additional validation set (n = 166) using site-specific methylation pyrosequencing. Results A significant increase in CDH22 gene methylation in subjects with metabolic syndrome was identified in the overall sample. Additionally, differential methylation was found within the MAP3K13 gene in females and the CCDC8 gene within males. Significant differences in methylation were again observed for the CDH22 and MAP3K13 genes, but not CCDC8, in the validation sample set. Conclusions This study provides preliminary evidence that DNA methylation may be associated with metabolic syndrome and sex in schizophrenia. PMID:29850476

  11. Analysis of DNA methylation and gene expression in radiation-resistant head and neck tumors.

    PubMed

    Chen, Xiaofei; Liu, Liang; Mims, Jade; Punska, Elizabeth C; Williams, Kristin E; Zhao, Weiling; Arcaro, Kathleen F; Tsang, Allen W; Zhou, Xiaobo; Furdui, Cristina M

    2015-01-01

    Resistance to radiation therapy constitutes a significant challenge in the treatment of head and neck squamous cell cancer (HNSCC). Alteration in DNA methylation is thought to play a role in this resistance. Here, we analyzed DNA methylation changes in a matched model of radiation resistance for HNSCC using the Illumina HumanMethylation450 BeadChip. Our results show that compared to radiation-sensitive cells (SCC-61), radiation-resistant cells (rSCC-61) had a significant increase in DNA methylation. After combining these results with microarray gene expression data, we identified 84 differentially methylated and expressed genes between these 2 cell lines. Ingenuity Pathway Analysis revealed ILK signaling, glucocorticoid receptor signaling, fatty acid α-oxidation, and cell cycle regulation as top canonical pathways associated with radiation resistance. Validation studies focused on CCND2, a protein involved in cell cycle regulation, which was identified as hypermethylated in the promoter region and downregulated in rSCC-61 relative to SCC-61 cells. Treatment of rSCC-61 and SCC-61 with the DNA hypomethylating agent 5-aza-2'deoxycitidine increased CCND2 levels only in rSCC-61 cells, while treatment with the control reagent cytosine arabinoside did not influence the expression of this gene. Further analysis of HNSCC data from The Cancer Genome Atlas found increased methylation in radiation-resistant tumors, consistent with the cell culture data. Our findings point to global DNA methylation status as a biomarker of radiation resistance in HNSCC, and suggest a need for targeted manipulation of DNA methylation to increase radiation response in HNSCC.

  12. Epigenetic Guardian: A Review of the DNA Methyltransferase DNMT3A in Acute Myeloid Leukaemia and Clonal Haematopoiesis.

    PubMed

    Chaudry, Sabah F; Chevassut, Timothy J T

    2017-01-01

    Acute myeloid leukaemia (AML) is a haematological malignancy characterized by clonal stem cell proliferation and aberrant block in differentiation. Dysfunction of epigenetic modifiers contributes significantly to the pathogenesis of AML. One frequently mutated gene involved in epigenetic modification is DNMT3A (DNA methyltransferase-3-alpha), a DNA methyltransferase that alters gene expression by de novo methylation of cytosine bases at CpG dinucleotides. Approximately 22% of AML and 36% of cytogenetically normal AML cases carry DNMT3A mutations and around 60% of these mutations affect the R882 codon. These mutations have been associated with poor prognosis and adverse survival outcomes for AML patients. Advances in whole-exome sequencing techniques have recently identified a large number of DNMT3A mutations present in clonal cells in normal elderly individuals with no features of haematological malignancy. Categorically distinct from other preleukaemic conditions, this disorder has been termed clonal haematopoiesis of indeterminate potential (CHIP). Further insight into the mutational landscape of CHIP may illustrate the consequence of particular mutations found in DNMT3A and identify specific "founder" mutations responsible for clonal expansion that may contribute to leukaemogenesis. This review will focus on current research and understanding of DNMT3A mutations in both AML and CHIP.

  13. Detection and size analysis of proteins with switchable DNA layers.

    PubMed

    Rant, Ulrich; Pringsheim, Erika; Kaiser, Wolfgang; Arinaga, Kenji; Knezevic, Jelena; Tornow, Marc; Fujita, Shozo; Yokoyama, Naoki; Abstreiter, Gerhard

    2009-04-01

    We introduce a chip-compatible scheme for the label-free detection of proteins in real-time that is based on the electrically driven conformation switching of DNA oligonucleotides on metal surfaces. The switching behavior is a sensitive indicator for the specific recognition of IgG antibodies and antibody fragments, which can be detected in quantities of less than 10(-18) mol on the sensor surface. Moreover, we show how the dynamics of the induced molecular motion can be monitored by measuring the high-frequency switching response. When proteins bind to the layer, the increase in hydrodynamic drag slows the switching dynamics, which allows us to determine the size of the captured proteins. We demonstrate the identification of different antibody fragments by means of their kinetic fingerprint. The switchDNA method represents a generic approach to simultaneously detect and size target molecules using a single analytical platform.

  14. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  15. Comparison of innovative molecular approaches and standard spore assays for assessment of surface cleanliness.

    PubMed

    Cooper, Moogega; La Duc, Myron T; Probst, Alexander; Vaishampayan, Parag; Stam, Christina; Benardini, James N; Piceno, Yvette M; Andersen, Gary L; Venkateswaran, Kasthuri

    2011-08-01

    A bacterial spore assay and a molecular DNA microarray method were compared for their ability to assess relative cleanliness in the context of bacterial abundance and diversity on spacecraft surfaces. Colony counts derived from the NASA standard spore assay were extremely low for spacecraft surfaces. However, the PhyloChip generation 3 (G3) DNA microarray resolved the genetic signatures of a highly diverse suite of microorganisms in the very same sample set. Samples completely devoid of cultivable spores were shown to harbor the DNA of more than 100 distinct microbial phylotypes. Furthermore, samples with higher numbers of cultivable spores did not necessarily give rise to a greater microbial diversity upon analysis with the DNA microarray. The findings of this study clearly demonstrated that there is not a statistically significant correlation between the cultivable spore counts obtained from a sample and the degree of bacterial diversity present. Based on these results, it can be stated that validated state-of-the-art molecular techniques, such as DNA microarrays, can be utilized in parallel with classical culture-based methods to further describe the cleanliness of spacecraft surfaces.

  16. Spatial and temporal plasticity of chromatin during programmed DNA-reorganization in Stylonychia macronuclear development

    PubMed Central

    Postberg, Jan; Heyse, Katharina; Cremer, Marion; Cremer, Thomas; Lipps, Hans J

    2008-01-01

    Background: In this study we exploit the unique genome organization of ciliates to characterize the biological function of histone modification patterns and chromatin plasticity for the processing of specific DNA sequences during a nuclear differentiation process. Ciliates are single-cell eukaryotes containing two morphologically and functionally specialized types of nuclei, the somatic macronucleus and the germline micronucleus. In the course of sexual reproduction a new macronucleus develops from a micronuclear derivative. During this process specific DNA sequences are eliminated from the genome, while sequences that will be transcribed in the mature macronucleus are retained. Results: We show by immunofluorescence microscopy, Western analyses and chromatin immunoprecipitation (ChIP) experiments that each nuclear type establishes its specific histone modification signature. Our analyses reveal that the early macronuclear anlage adopts a permissive chromatin state immediately after the fusion of two heterochromatic germline micronuclei. As macronuclear development progresses, repressive histone modifications that specify sequences to be eliminated are introduced de novo. ChIP analyses demonstrate that permissive histone modifications are associated with sequences that will be retained in the new macronucleus. Furthermore, our data support the hypothesis that a PIWI-family protein is involved in a transnuclear cross-talk and in the RNAi-dependent control of developmental chromatin reorganization. Conclusion: Based on these data we present a comprehensive analysis of the spatial and temporal pattern of histone modifications during this nuclear differentiation process. Results obtained in this study may also be relevant for our understanding of chromatin plasticity during metazoan embryogenesis. PMID:19014664

  17. Genome-scale case-control analysis of CD4+ T-cell DNA methylation in juvenile idiopathic arthritis reveals potential targets involved in disease.

    PubMed

    Ellis, Justine A; Munro, Jane E; Chavez, Raul A; Gordon, Lavinia; Joo, Jihoon E; Akikusa, Jonathan D; Allen, Roger C; Ponsonby, Anne-Louise; Craig, Jeffrey M; Saffery, Richard

    2012-11-13

    Juvenile Idiopathic Arthritis (JIA) is a complex autoimmune rheumatic disease of largely unknown cause. Evidence is growing that epigenetic variation, particularly DNA methylation, is associated with autoimmune disease. However, nothing is currently known about the potential role of aberrant DNA methylation in JIA. As a first step to addressing this knowledge gap, we have profiled DNA methylation in purified CD4+ T cells from JIA subjects and controls. Genomic DNA was isolated from peripheral blood CD4+ T cells from 14 oligoarticular and polyarticular JIA cases with active disease, and healthy age- and sex-matched controls. Genome-scale methylation analysis was carried out using the Illumina Infinium HumanMethylation27 BeadChip. Methylation data at >25,000 CpGs was compared in a case-control study design. Methylation levels were significantly different (FDR adjusted p<0.1) at 145 loci. Removal of four samples exposed to methotrexate had a striking impact on the outcome of the analysis, reducing the number of differentially methylated loci to 11. The methotrexate-naive analysis identified reduced methylation at the gene encoding the pro-inflammatory cytokine IL32, which was subsequently replicated using a second analysis platform and a second set of case-control pairs. Our data suggests that differential T cell DNA methylation may be a feature of JIA, and that reduced methylation at IL32 is associated with this disease. Further work in larger prospective and longitudinal sample collections is required to confirm these findings, assess whether the identified differences are causal or consequential of disease, and further investigate the epigenetic modifying properties of therapeutic regimens.

  18. Detection of influenza A virus subtypes using a solid-phase PCR microplate chip assay.

    PubMed

    Sun, Xin-Cheng; Wang, YunLong; Yang, Liping; Zhang, HuiRu

    2015-01-01

    A rapid and sensitive microplate chip based on solid PCR was developed to identify influenza A subtypes. A simple ultraviolet cross-linking method was used to immobilize DNA probes on pretreated microplates. Solid-phase PCR was proven to be a convenient method for influenza A screening. The sensitivity of the microplate chip was 10(-3) μg/mL for the enzymatic colorimetric method and 10(-4) μg/mL for the fluorescence method. The 10 sets of primers and probes for the microplate chip were highly specific and did not interfere with each other. These results suggest that the microplate chip based on solid PCR can be used to rapidly detect universal influenza A and its subtypes. This platform can also be used to detect other pathogenic microorganisms. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Progress in ion torrent semiconductor chip based sequencing.

    PubMed

    Merriman, Barry; Rothberg, Jonathan M

    2012-12-01

    In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Development of a facile droplet-based single-cell isolation platform for cultivation and genomic analysis in microorganisms.

    PubMed

    Zhang, Qiang; Wang, Tingting; Zhou, Qian; Zhang, Peng; Gong, Yanhai; Gou, Honglei; Xu, Jian; Ma, Bo

    2017-01-23

    Wider application of single-cell analysis has been limited by the lack of an easy-to-use and low-cost strategy for single-cell isolation that can be directly coupled to single-cell sequencing and single-cell cultivation, especially for small-size microbes. Herein, a facile droplet microfluidic platform was developed to dispense individual microbial cells into conventional standard containers for downstream analysis. Functional parts for cell encapsulation, droplet inspection and sorting, as well as a chip-to-tube capillary interface were integrated on one single chip with simple architecture, and control of the droplet sorting was achieved by a low-cost solenoid microvalve. Using microalgal and yeast cells as models, single-cell isolation success rate of over 90% and single-cell cultivation success rate of 80% were demonstrated. We further showed that the individual cells isolated can be used in high-quality DNA and RNA analyses at both gene-specific and whole-genome levels (i.e. real-time quantitative PCR and genome sequencing). The simplicity and reliability of the method should improve accessibility of single-cell analysis and facilitate its wider application in microbiology researches.

  1. Development of a facile droplet-based single-cell isolation platform for cultivation and genomic analysis in microorganisms

    PubMed Central

    Zhang, Qiang; Wang, Tingting; Zhou, Qian; Zhang, Peng; Gong, Yanhai; Gou, Honglei; Xu, Jian; Ma, Bo

    2017-01-01

    Wider application of single-cell analysis has been limited by the lack of an easy-to-use and low-cost strategy for single-cell isolation that can be directly coupled to single-cell sequencing and single-cell cultivation, especially for small-size microbes. Herein, a facile droplet microfluidic platform was developed to dispense individual microbial cells into conventional standard containers for downstream analysis. Functional parts for cell encapsulation, droplet inspection and sorting, as well as a chip-to-tube capillary interface were integrated on one single chip with simple architecture, and control of the droplet sorting was achieved by a low-cost solenoid microvalve. Using microalgal and yeast cells as models, single-cell isolation success rate of over 90% and single-cell cultivation success rate of 80% were demonstrated. We further showed that the individual cells isolated can be used in high-quality DNA and RNA analyses at both gene-specific and whole-genome levels (i.e. real-time quantitative PCR and genome sequencing). The simplicity and reliability of the method should improve accessibility of single-cell analysis and facilitate its wider application in microbiology researches. PMID:28112223

  2. Using dual-polarization interferometry to study surface-initiated DNA hybridization chain reactions in real time.

    PubMed

    Huang, Fujian; Xu, Pingping; Liang, Haojun

    2014-01-15

    In this study we used dual-polarization interferometry to investigate DNA hybridization chain reactions (HCRs) at solid-liquid interfaces. We monitored the effects of variations in mass, thickness, and density of the immobilized initiator on the subsequent HCRs at various salt concentrations. At low salt concentrations, the single-stranded DNA (ssDNA) initiator was attached uniformly to the chip surface. At high salt concentrations, it lay on the surface at the onset of the immobilization process, but the approaching ssDNA forced the pre-immobilized ssDNA strands to extend into solution as a result of increased electrostatic repulsion between the pre-adsorbed and approaching ssDNA chains. Injection of a mixture of H1 and H2 increased the mass and thickness of the films initially, but thereafter the thickness decreased. These changes indicate that the long double-stranded DNA that formed lay on the surface, rather than extended into the solution, thereby suppressing the subsequent initiation activity of the released single-strand parts of H1 and H2. Increasing the salt concentration increased the HCR efficiency and reaction rate. The HCR efficiency of the initiator ssDNA immobilized on its 5' end was higher than that immobilized on its 3' end, suggesting that the released single-strand parts of H1 and H2 close to the chip surface decreased the initiation activity relative to those of the ones extending into solution. © 2013 Elsevier B.V. All rights reserved.

  3. Molecular Sticker Model Stimulation on Silicon for a Maximum Clique Problem

    PubMed Central

    Ning, Jianguo; Li, Yanmei; Yu, Wen

    2015-01-01

    Molecular computers (also called DNA computers), as an alternative to traditional electronic computers, are smaller in size but more energy efficient, and have massive parallel processing capacity. However, DNA computers may not outperform electronic computers owing to their higher error rates and some limitations of the biological laboratory. The stickers model, as a typical DNA-based computer, is computationally complete and universal, and can be viewed as a bit-vertically operating machine. This makes it attractive for silicon implementation. Inspired by the information processing method on the stickers computer, we propose a novel parallel computing model called DEM (DNA Electronic Computing Model) on System-on-a-Programmable-Chip (SOPC) architecture. Except for the significant difference in the computing medium—transistor chips rather than bio-molecules—the DEM works similarly to DNA computers in immense parallel information processing. Additionally, a plasma display panel (PDP) is used to show the change of solutions, and helps us directly see the distribution of assignments. The feasibility of the DEM is tested by applying it to compute a maximum clique problem (MCP) with eight vertices. Owing to the limited computing sources on SOPC architecture, the DEM could solve moderate-size problems in polynomial time. PMID:26075867

  4. An Integrated Lab-on-Chip for Rapid Identification and Simultaneous Differentiation of Tropical Pathogens

    PubMed Central

    Sato, Mitsuharu; Watthanaworawit, Wanitda; Ling, Clare L.; Mauduit, Marjorie; Malleret, Benoît; Grüner, Anne-Charlotte; Tan, Rosemary; Nosten, François H.; Snounou, Georges; Rénia, Laurent; Ng, Lisa F. P.

    2014-01-01

    Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens. PMID:25078474

  5. DNA Copy Number Signature to Predict Recurrence in Early Stage Ovarian Cancer

    DTIC Science & Technology

    2016-08-01

    AWARD NUMBER: W81XWH-14-1-0194 TITLE: DNA Copy Number Signature to Predict Recurrence in Early-Stage Ovarian Cancer PRINCIPAL INVESTIGATOR...SUBTITLE 5a. CONTRACT NUMBER DNA Copy Number Signature to Predict Recurrence in Early-Stage Ovarian Cancer 5b. GRANT NUMBER W81XWH-14-1-0194 5c. PROGRAM...determine the copy number gain and loss for early stage high grade ovarian cancers through IlluminaHumanOmniExpress-FFPE BeadChip system • Subtask 1 DNA

  6. Identification of genes modulated in rheumatoid arthritis using complementary DNA microarray analysis of lymphoblastoid B cell lines from disease-discordant monozygotic twins.

    PubMed

    Haas, Christian S; Creighton, Chad J; Pi, Xiujun; Maine, Ira; Koch, Alisa E; Haines, G Kenneth; Ling, Song; Chinnaiyan, Arul M; Holoshitz, Joseph

    2006-07-01

    To identify disease-specific gene expression profiles in patients with rheumatoid arthritis (RA), using complementary DNA (cDNA) microarray analyses on lymphoblastoid B cell lines (LCLs) derived from RA-discordant monozygotic (MZ) twins. The cDNA was prepared from LCLs derived from the peripheral blood of 11 pairs of RA-discordant MZ twins. The RA twin cDNA was labeled with cy5 fluorescent dye, and the cDNA of the healthy co-twin was labeled with cy3. To determine relative expression profiles, cDNA from each twin pair was combined and hybridized on 20,000-element microarray chips. Immunohistochemistry and real-time polymerase chain reaction were used to detect the expression of selected gene products in synovial tissue from patients with RA compared with patients with osteoarthritis and normal healthy controls. In RA twin LCLs compared with healthy co-twin LCLs, 1,163 transcripts were significantly differentially expressed. Of these, 747 were overexpressed and 416 were underexpressed. Gene ontology analysis revealed many genes known to play a role in apoptosis, angiogenesis, proteolysis, and signaling. The 3 most significantly overexpressed genes were laeverin (a novel enzyme with sequence homology to CD13), 11beta-hydroxysteroid dehydrogenase type 2 (a steroid pathway enzyme), and cysteine-rich, angiogenic inducer 61 (a known angiogenic factor). The products of these genes, heretofore uncharacterized in RA, were all abundantly expressed in RA synovial tissues. Microarray cDNA analysis of peripheral blood-derived LCLs from well-controlled patient populations is a useful tool to detect RA-relevant genes and could help in identifying novel therapeutic targets.

  7. How single nucleotide polymorphism chips will advance our knowledge of factors controlling puberty and aid in selecting replacement beef females

    USDA-ARS?s Scientific Manuscript database

    The promise of genomic selection is accurate prediction of animals' genetic potential from their genotypes. Simple DNA tests might replace low accuracy predictions for expensive or lowly heritable measures of puberty and fertility based on performance and pedigree. Knowing which DNA variants affec...

  8. Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

    PubMed

    Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

    2009-01-01

    DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

  9. Adaptable gene-specific dye bias correction for two-channel DNA microarrays

    PubMed Central

    Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

    2009-01-01

    DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

  10. The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

    PubMed

    Perreault, Andrea A; Venters, Bryan J

    2016-12-23

    Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

  11. C 3-symmetric opioid scaffolds are pH-responsive DNA condensation agents

    PubMed Central

    McStay, Natasha; Molphy, Zara; Coughlan, Alan; Cafolla, Attilio; McKee, Vickie; Gathergood, Nicholas; Kellett, Andrew

    2017-01-01

    Herein we report the synthesis of tripodal C3-symmetric opioid scaffolds as high-affinity condensation agents of duplex DNA. Condensation was achieved on both supercoiled and canonical B-DNA structures and identified by agarose electrophoresis, viscosity, turbidity and atomic force microscopy (AFM) measurements. Structurally, the requirement of a tris-opioid scaffold for condensation is demonstrated as both di- (C2-symmetric) and mono-substituted (C1-symmetric) mesitylene-linked opioid derivatives poorly coordinate dsDNA. Condensation, observed by toroidal and globule AFM aggregation, arises from surface-binding ionic interactions between protonated, cationic, tertiary amine groups on the opioid skeleton and the phosphate nucleic acid backbone. Indeed, by converting the 6-hydroxyl group of C3-morphine (MC3) to methoxy substituents in C3-heterocodeine (HC3) and C3-oripavine (OC3) molecules, dsDNA compaction is retained thus negating the possibility of phosphate—hydroxyl surface-binding. Tripodal opioid condensation was identified as pH dependent and strongly influenced by ionic strength with further evidence of cationic amine-phosphate backbone coordination arising from thermal melting analysis and circular dichroism spectroscopy, with compaction also witnessed on synthetic dsDNA co-polymers poly[d(A-T)2] and poly[d(G-C)2]. On-chip microfluidic analysis of DNA condensed by C3-agents provided concentration-dependent protection (inhibition) to site-selective excision by type II restriction enzymes: BamHI, HindIII, SalI and EcoRI, but not to the endonuclease DNase I. PMID:27899572

  12. Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

    PubMed

    Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

    2018-02-01

    This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Light emitting diode, photodiode-based fluorescence detection system for DNA analysis with microchip electrophoresis.

    PubMed

    Hall, Gordon H; Glerum, D Moira; Backhouse, Christopher J

    2016-02-01

    Electrophoretic separation of fluorescently end-labeled DNA after a PCR serves as a gold standard in genetic diagnostics. Because of their size and cost, instruments for this type of analysis have had limited market uptake, particularly for point-of-care applications. This might be changed through a higher level of system integration and lower instrument costs that can be realized through the use of LEDs for excitation and photodiodes for detection--if they provide sufficient sensitivity. Here, we demonstrate an optimized microchip electrophoresis instrument using polymeric fluidic chips with fluorescence detection of end-labeled DNA with a LOD of 0.15 nM of Alexa Fluor 532. This represents orders of magnitude improvement over previously reported instruments of this type. We demonstrate the system with an electrophoretic separation of two PCR products and their respective primers. We believe that this is the first LED-induced fluorescence microchip electrophoresis system with photodiode-based detection that could be used for standard applications of PCR and electrophoresis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  14. Alcohol exposure alters DNA methylation profiles in mouse embryos at early neurulation

    PubMed Central

    Liu, Yunlong; Balaraman, Yokesh; Wang, Guohua; Nephew, Kenneth P.; Zhou, Feng C.

    2009-01-01

    Alcohol exposure during development can cause variable neurofacial deficit and growth retardation known as fetal alcohol spectrum disorders (FASD). The mechanism underlying FASD is not fully understood. However, alcohol, which is known to affect methyl donor metabolism, may induce aberrant epigenetic changes contributing to FASD. Using a tightly controlled whole-embryo culture, we investigated the effect of alcohol exposure (88 mM) at early embryonic neurulation on genome-wide DNA methylation and gene expression in the C57BL/6 mouse. The DNA methylation landscape around promoter CpG islands at early mouse development was analyzed using MeDIP (methylated DNA immunoprecipitation) coupled with microarray (MeDIP-chip). At early neurulation, genes associated with high CpG promoters (HCP) had a lower ratio of methylation but a greater ratio of expression. Alcohol-induced alterations in DNA methylation were observed, particularly in genes on chromosomes 7, 10 and X; remarkably, a >10 fold increase in the number of genes with increased methylation on chromosomes 10 and X was observed in alcohol-exposed embryos with a neural tube defect phenotype compared to embryos without a neural tube defect. Significant changes in methylation were seen in imprinted genes, genes known to play roles in cell cycle, growth, apoptosis, cancer, and in a large number of genes associated with olfaction. Altered methylation was associated with significant (p < 0.01) changes in expression for 84 genes. Sequenom EpiTYPER DNA methylation analysis was used for validation of the MeDIP-chip data. Increased methylation of genes known to play a role in metabolism (Cyp4f13) and decreased methylation of genes associated with development (Nlgn3, Elavl2, Sox21 and Sim1), imprinting (Igf2r) and chromatin (Hist1h3d) was confirmed. In a mouse model for FASD, we show for the first time that alcohol exposure during early neurulation can induce aberrant changes in DNA methylation patterns with associated changes in gene expression, which together may contribute to the observed abnormal fetal development. PMID:20009564

  15. Alcohol exposure alters DNA methylation profiles in mouse embryos at early neurulation.

    PubMed

    Liu, Yunlong; Balaraman, Yokesh; Wang, Guohua; Nephew, Kenneth P; Zhou, Feng C

    2009-10-01

    Alcohol exposure during development can cause variable neurofacial deficit and growth retardation known as fetal alcohol spectrum disorders (FASD). The mechanism underlying FASD is not fully understood. However, alcohol, which is known to affect methyl donor metabolism, may induce aberrant epigenetic changes contributing to FASD. Using a tightly controlled whole-embryo culture, we investigated the effect of alcohol exposure (88mM) at early embryonic neurulation on genome-wide DNA methylation and gene expression in the C57BL/6 mouse. The DNA methylation landscape around promoter CpG islands at early mouse development was analyzed using MeDIP (methylated DNA immunoprecipitation) coupled with microarray (MeDIP-chip). At early neurulation, genes associated with high CpG promoters (HCP) had a lower ratio of methylation but a greater ratio of expression. Alcohol-induced alterations in DNA methylation were observed, particularly in genes on chromosomes 7, 10, and X; remarkably, a >10 fold increase in the number of genes with increased methylation on chromosomes 10 and X was observed in alcohol-exposed embryos with a neural tube defect phenotype compared to embryos without a neural tube defect. Significant changes in methylation were seen in imprinted genes, genes known to play roles in cell cycle, growth, apoptosis, cancer, and in a large number of genes associated with olfaction. Altered methylation was associated with significant (p<0.01) changes in expression for 84 genes. Sequenom EpiTYPER DNA methylation analysis was used for validation of the MeDIP-chip data. Increased methylation of genes known to play a role in metabolism (Cyp4f13) and decreased methylation of genes associated with development (Nlgn3, Elavl2, Sox21 and Sim1), imprinting (Igf2r) and chromatin (Hist1h3d) was confirmed. In a mouse model for FASD, we show for the first time that alcohol exposure during early neurulation can induce aberrant changes in DNA methylation patterns with associated changes in gene expression, which together may contribute to the observed abnormal fetal development.

  16. Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip.

    PubMed

    Ankireddy, Seshadri Reddy; Kim, Jongsung

    2015-01-01

    Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn(2+) because of the strong coordination interactions. In the presence of adenosine, Zn(2+) cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes.

  17. Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip

    PubMed Central

    Ankireddy, Seshadri Reddy; Kim, Jongsung

    2015-01-01

    Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn2+ because of the strong coordination interactions. In the presence of adenosine, Zn2+ cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes. PMID:26347351

  18. Protein analysis by time-resolved measurements with an electro-switchable DNA chip

    PubMed Central

    Langer, Andreas; Hampel, Paul A.; Kaiser, Wolfgang; Knezevic, Jelena; Welte, Thomas; Villa, Valentina; Maruyama, Makiko; Svejda, Matej; Jähner, Simone; Fischer, Frank; Strasser, Ralf; Rant, Ulrich

    2013-01-01

    Measurements in stationary or mobile phases are fundamental principles in protein analysis. Although the immobilization of molecules on solid supports allows for the parallel analysis of interactions, properties like size or shape are usually inferred from the molecular mobility under the influence of external forces. However, as these principles are mutually exclusive, a comprehensive characterization of proteins usually involves a multi-step workflow. Here we show how these measurement modalities can be reconciled by tethering proteins to a surface via dynamically actuated nanolevers. Short DNA strands, which are switched by alternating electric fields, are employed as capture probes to bind target proteins. By swaying the proteins over nanometre amplitudes and comparing their motional dynamics to a theoretical model, the protein diameter can be quantified with Angström accuracy. Alterations in the tertiary protein structure (folding) and conformational changes are readily detected, and even post-translational modifications are revealed by time-resolved molecular dynamics measurements. PMID:23839273

  19. An Alternative Approach to ChIP-Seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition

    PubMed Central

    Yuan, Chih-Chi; Craske, Madeleine Lisa; Labhart, Paul; Guler, Gulfem D.; Arnott, David; Maile, Tobias M.; Busby, Jennifer; Henry, Chisato; Kelly, Theresa K.; Tindell, Charles A.; Jhunjhunwala, Suchit; Zhao, Feng; Hatton, Charlie; Bryant, Barbara M.

    2016-01-01

    Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) has been instrumental in inferring the roles of histone post-translational modifications in the regulation of transcription, chromatin compaction and other cellular processes that require modulation of chromatin structure. However, analysis of ChIP-seq data is challenging when the manipulation of a chromatin-modifying enzyme significantly affects global levels of histone post-translational modifications. For example, small molecule inhibition of the methyltransferase EZH2 reduces global levels of histone H3 lysine 27 trimethylation (H3K27me3). However, standard ChIP-seq normalization and analysis methods fail to detect a decrease upon EZH2 inhibitor treatment. We overcome this challenge by employing an alternative normalization approach that is based on the addition of Drosophila melanogaster chromatin and a D. melanogaster-specific antibody into standard ChIP reactions. Specifically, the use of an antibody that exclusively recognizes the D. melanogaster histone variant H2Av enables precipitation of D. melanogaster chromatin as a minor fraction of the total ChIP DNA. The D. melanogaster ChIP-seq tags are used to normalize the human ChIP-seq data from DMSO and EZH2 inhibitor-treated samples. Employing this strategy, a substantial reduction in H3K27me3 signal is now observed in ChIP-seq data from EZH2 inhibitor treated samples. PMID:27875550

  20. An Alternative Approach to ChIP-Seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition.

    PubMed

    Egan, Brian; Yuan, Chih-Chi; Craske, Madeleine Lisa; Labhart, Paul; Guler, Gulfem D; Arnott, David; Maile, Tobias M; Busby, Jennifer; Henry, Chisato; Kelly, Theresa K; Tindell, Charles A; Jhunjhunwala, Suchit; Zhao, Feng; Hatton, Charlie; Bryant, Barbara M; Classon, Marie; Trojer, Patrick

    2016-01-01

    Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) has been instrumental in inferring the roles of histone post-translational modifications in the regulation of transcription, chromatin compaction and other cellular processes that require modulation of chromatin structure. However, analysis of ChIP-seq data is challenging when the manipulation of a chromatin-modifying enzyme significantly affects global levels of histone post-translational modifications. For example, small molecule inhibition of the methyltransferase EZH2 reduces global levels of histone H3 lysine 27 trimethylation (H3K27me3). However, standard ChIP-seq normalization and analysis methods fail to detect a decrease upon EZH2 inhibitor treatment. We overcome this challenge by employing an alternative normalization approach that is based on the addition of Drosophila melanogaster chromatin and a D. melanogaster-specific antibody into standard ChIP reactions. Specifically, the use of an antibody that exclusively recognizes the D. melanogaster histone variant H2Av enables precipitation of D. melanogaster chromatin as a minor fraction of the total ChIP DNA. The D. melanogaster ChIP-seq tags are used to normalize the human ChIP-seq data from DMSO and EZH2 inhibitor-treated samples. Employing this strategy, a substantial reduction in H3K27me3 signal is now observed in ChIP-seq data from EZH2 inhibitor treated samples.

  1. DNA analysis using an integrated microchip for multiplex PCR amplification and electrophoresis for reference samples.

    PubMed

    Le Roux, Delphine; Root, Brian E; Reedy, Carmen R; Hickey, Jeffrey A; Scott, Orion N; Bienvenue, Joan M; Landers, James P; Chassagne, Luc; de Mazancourt, Philippe

    2014-08-19

    A system that automatically performs the PCR amplification and microchip electrophoretic (ME) separation for rapid forensic short tandem repeat (STR) forensic profiling in a single disposable plastic chip is demonstrated. The microchip subassays were optimized to deliver results comparable to conventional benchtop methods. The microchip process was accomplished in sub-90 min compared with >2.5 h for the conventional approach. An infrared laser with a noncontact temperature sensing system was optimized for a 45 min PCR compared with the conventional 90 min amplification time. The separation conditions were optimized using LPA-co-dihexylacrylamide block copolymers specifically designed for microchip separations to achieve accurate DNA size calling in an effective length of 7 cm in a plastic microchip. This effective separation length is less than half of other reports for integrated STR analysis and allows a compact, inexpensive microchip design. This separation quality was maintained when integrated with microchip PCR. Thirty samples were analyzed conventionally and then compared with data generated by the microfluidic chip system. The microfluidic system allele calling was 100% concordant with the conventional process. This study also investigated allelic ladder consistency over time. The PCR-ME genetic profiles were analyzed using binning palettes generated from two sets of allelic ladders run three and six months apart. Using these binning palettes, no allele calling errors were detected in the 30 samples demonstrating that a microfluidic platform can be highly consistent over long periods of time.

  2. Molecular strain typing of Brucella abortus isolates from Italy by two VNTR allele sizing technologies.

    PubMed

    De Santis, Riccardo; Ancora, Massimo; De Massis, Fabrizio; Ciammaruconi, Andrea; Zilli, Katiuscia; Di Giannatale, Elisabetta; Pittiglio, Valentina; Fillo, Silvia; Lista, Florigio

    2013-10-01

    Brucellosis, one of the most important re-emerging zoonoses in many countries, is caused by bacteria belonging to the genus Brucella. Furthermore these bacteria represent potential biological warfare agents and the identification of species and biovars of field strains may be crucial for tracing back source of infection, allowing to discriminate naturally occurring outbreaks instead of bioterrorist events. In the last years, multiple-locus variable-number tandem repeat analysis (MLVA) has been proposed as complement of the classical biotyping methods and it has been applied for genotyping large collections of Brucella spp. At present, the MLVA band profiles may be resolved by automated or manual procedures. The Lab on a chip technology represents a valid alternative to standard genotyping techniques (as agarose gel electrophoresis) and it has been previously used for Brucella genotyping. Recently, a new high-throughput genotyping analysis system based on capillary gel electrophoresis, the QIAxcel, has been described. The aim of the study was to evaluate the ability of two DNA sizing equipments, the QIAxcel System and the Lab chip GX, to correctly call alleles at the sixteen loci including one frequently used MLVA assay for Brucella genotyping. The results confirmed that these technologies represent a meaningful advancement in high-throughput Brucella genotyping. Considering the accuracy required to confidently resolve loci discrimination, QIAxcel shows a better ability to measure VNTR allele sizes compared to LabChip GX.

  3. Divergent dispersion behavior of ssDNA fragments during microchip electrophoresis in pDMA and LPA entangled polymer networks

    PubMed Central

    Fredlake, Christopher P.; Hert, Daniel G.; Niedringhaus, Thomas P.; Lin, Jennifer S.; Barron, Annelise E.

    2015-01-01

    Resolution of DNA fragments separated by electrophoresis in polymer solutions (“matrices”) is determined by both the spacing between peaks and the width of the peaks. Prior research on the development of high-performance separation matrices has been focused primarily on optimizing DNA mobility and matrix selectivity, and gave less attention to peak broadening. Quantitative data are rare for peak broadening in systems in which high electric field strengths are used (> 150 V/cm), which is surprising since capillary and microchip-based systems commonly run at these field strengths. Here, we report results for a study of band broadening behavior for ssDNA fragments on a glass microfluidic chip, for electric field strengths up to 320 V/cm. We compare dispersion coefficients obtained in a poly(N,N-dimethylacrylamide) (pDMA) separation matrix that was developed for chip-based DNA sequencing with a commercially available linear polyacrylamide (LPA) matrix commonly used in capillaries. Much larger DNA dispersion coefficients were measured in the LPA matrix as compared to the pDMA matrix, and the dependences of dispersion coefficient on DNA size and electric field strength were found to differ quite starkly in the two matrices. These observations lead us to propose that DNA migration mechanisms differ substantially in our custom pDMA matrix compared to the commercially available LPA matrix. We discuss the implications of these results in terms of developing optimal matrices for specific separation (microchip or capillary) platforms. PMID:22648809

  4. DNA methylome signature in rheumatoid arthritis.

    PubMed

    Nakano, Kazuhisa; Whitaker, John W; Boyle, David L; Wang, Wei; Firestein, Gary S

    2013-01-01

    Epigenetics can influence disease susceptibility and severity. While DNA methylation of individual genes has been explored in autoimmunity, no unbiased systematic analyses have been reported. Therefore, a genome-wide evaluation of DNA methylation loci in fibroblast-like synoviocytes (FLS) isolated from the site of disease in rheumatoid arthritis (RA) was performed. Genomic DNA was isolated from six RA and five osteoarthritis (OA) FLS lines and evaluated using the Illumina HumanMethylation450 chip. Cluster analysis of data was performed and corrected using Benjamini-Hochberg adjustment for multiple comparisons. Methylation was confirmed by pyrosequencing and gene expression was determined by qPCR. Pathway analysis was performed using the Kyoto Encyclopedia of Genes and Genomes. RA and control FLS segregated based on DNA methylation, with 1859 differentially methylated loci. Hypomethylated loci were identified in key genes relevant to RA, such as CHI3L1, CASP1, STAT3, MAP3K5, MEFV and WISP3. Hypermethylation was also observed, including TGFBR2 and FOXO1. Hypomethylation of individual genes was associated with increased gene expression. Grouped analysis identified 207 hypermethylated or hypomethylated genes with multiple differentially methylated loci, including COL1A1, MEFV and TNF. Hypomethylation was increased in multiple pathways related to cell migration, including focal adhesion, cell adhesion, transendothelial migration and extracellular matrix interactions. Confirmatory studies with OA and normal FLS also demonstrated segregation of RA from control FLS based on methylation pattern. Differentially methylated genes could alter FLS gene expression and contribute to the pathogenesis of RA. DNA methylation of critical genes suggests that RA FLS are imprinted and implicate epigenetic contributions to inflammatory arthritis.

  5. Design and development of a microfluidic platform for use with colorimetric gold nanoprobe assays

    NASA Astrophysics Data System (ADS)

    Bernacka-Wojcik, Iwona

    Due to the importance and wide applications of the DNA analysis, there is a need to make genetic analysis more available and more affordable. As such, the aim of this PhD thesis is to optimize a colorimetric DNA biosensor based on gold nanoprobes developed in CEMOP by reducing its price and the needed volume of solution without compromising the device sensitivity and reliability, towards the point of care use. Firstly, the price of the biosensor was decreased by replacing the silicon photodetector by a low cost, solution processed TiO2 photodetector. To further reduce the photodetector price, a novel fabrication method was developed: a cost-effective inkjet printing technology that enabled to increase TiO2 surface area. Secondly, the DNA biosensor was optimized by means of microfluidics that offer advantages of miniaturization, much lower sample/reagents consumption, enhanced system performance and functionality by integrating different components. In the developed microfluidic platform, the optical path length was extended by detecting along the channel and the light was transmitted by optical fibres enabling to guide the light very close to the analysed solution. Microfluidic chip of high aspect ratio ( 13), smooth and nearly vertical sidewalls was fabricated in PDMS using a SU-8 mould for patterning. The platform coupled to the gold nanoprobe assay enabled detection of Mycobacterium tuberculosis using 3 mul on DNA solution, i.e. 20 times less than in the previous state-of-the-art. Subsequently, the bio-microfluidic platform was optimized in terms of cost, electrical signal processing and sensitivity to colour variation, yielding 160% improvement of colorimetric AuNPs analysis. Planar microlenses were incorporated to converge light into the sample and then to the output fibre core increasing 6 times the signal-to-losses ratio. The optimized platform enabled detection of single nucleotide polymorphism related with obesity risk (FTO) using target DNA concentration below the limit of detection of the conventionally used microplate reader (i.e. 15 ng/mul) with 10 times lower solution volume (3 mul). The combination of the unique optical properties of gold nanoprobes with microfluidic platform resulted in sensitive and accurate sensor for single nucleotide polymorphism detection operating using small volumes of solutions and without the need for substrate functionalization or sophisticated instrumentation. Simultaneously, to enable on chip reagents mixing, a PDMS micromixer was developed and optimized for the highest efficiency, low pressure drop and short mixing length. The optimized device shows 80% of mixing efficiency at Re = 0.1 in 2.5 mm long mixer with the pressure drop of 6 Pa, satisfying requirements for the application in the microfluidic platform for DNA analysis.

  6. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  7. Spatiotemporal recruitment of human DNA polymerase delta to sites of UV damage

    PubMed Central

    Chea, Jennifer; Zhang, Sufang; Zhao, Hong; Zhang, Zhongtao; Lee, Ernest Y.C.; Darzynkiewicz, Zbigniew; Lee, Marietta Y.W.T.

    2012-01-01

    Human DNA polymerase δ (Pol δ) is involved in various DNA damage responses in addition to its central role in DNA replication. The Pol δ4 holoenzyme consists of four subunits, p125, p50, p68 and p12. It has been established that the p12 subunit is rapidly degraded in response to DNA damage by UV leading to the in vivo conversion of Pol δ4 to Pol δ3, a trimeric form lacking the p12 subunit. We provide the first analysis of the time-dependent recruitment of the individual Pol δ subunits to sites of DNA damage produced by UV irradiation through 5 μm polycarbonate filters by immunofluorescence microscopy and laser scanning cytometry (LSC). Quantitative analysis demonstrates that the recruitments of the three large subunits was near complete by 2 h and did not change significantly up to 4 h after UV exposure. However, the recruitment of p12 was incomplete even at 4 h, with about 70% of the Pol δ lacking the p12 subunit. ChIP analysis of Pol δ after global UV irradiation further demonstrates that only p125, p50 and p68 were present. Thus, Pol δ3 is the predominant form of Pol δ at sites of UV damage as a result of p12 degradation. Using LSC, we have further confirmed that Pol δ was recruited to CPD damage sites in all phases of the cell cycle. Collectively, our results show that Pol δ at the DNA damage site is the Pol δ trimer lacking p12 regardless of the cell cycle phase. PMID:22801543

  8. Array-based DNA methylation analysis in individuals with developmental delay/intellectual disability and normal molecular karyotype.

    PubMed

    Kolarova, Julia; Tangen, Imke; Bens, Susanne; Gillessen-Kaesbach, Gabriele; Gutwein, Jana; Kautza, Monika; Rydzanicz, Malgorzata; Stephani, Ulrich; Siebert, Reiner; Ammerpohl, Ole; Caliebe, Almuth

    2015-08-01

    Despite recent progress in molecular karyotyping and clinical sequencing the cause of intellectual disability in a considerable subset of individuals affected by this phenotype remains elusive. As intellectual disability is also a feature of various imprinting disorders and some monogenic forms of intellectual disability are caused by epigenetic modifiers we hypothesized that changes in DNA methylation might be associated with or even causative in some cases of intellectual disability. Therefore, we performed a DNA methylation analysis of peripheral blood samples from 82 patients with intellectual disability and additional features using the HumanMethylation450 BeadChip. The findings were compared to that of 19 normal controls. Differentially methylated loci were validated by bisulfite pyrosequencing. On a global level, we failed to detect a robust DNA methylation signature segregating individuals with intellectual disability from controls. Using an individual approach, we identified 157 regions showing individual DNA methylation changes in at least one patient. These correlated to 107 genes including genes linked to conditions associated with intellectual disability, namely COLEC11, SHANK2, GLI2 and KCNQ2, as well as imprinted genes like FAM50B and MEG3. The latter was suggestive of an undiagnosed Temple syndrome which could be confirmed by diagnostic tests. Subsequent in-depth analysis of imprinted loci revealed DNA methylation changes at additional imprinted loci, i.e. PPIEL, IGF2R, MEG8 and MCTS2/HM13, in up to five patients. Our findings indicate that imprinting disorders are rare but probably under-diagnosed in patients with intellectual disability and moreover point to DNA methylation changes as potential alternative means to identify deregulated genes involved in the pathogenesis of intellectual disability. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  9. Chip morphology as a performance predictor during high speed end milling of soda lime glass

    NASA Astrophysics Data System (ADS)

    Bagum, M. N.; Konneh, M.; Abdullah, K. A.; Ali, M. Y.

    2018-01-01

    Soda lime glass has application in DNA arrays and lab on chip manufacturing. Although investigation revealed that machining of such brittle material is possible using ductile mode under controlled cutting parameters and tool geometry, it remains a challenging task. Furthermore, ability of ductile machining is usually assed through machined surface texture examination. Soda lime glass is a strain rate and temperature sensitive material. Hence, influence on attainment of ductile surface due to adiabatic heat generated during high speed end milling using uncoated tungsten carbide tool is investigated in this research. Experimental runs were designed using central composite design (CCD), taking spindle speed, feed rate and depth of cut as input variable and tool-chip contact point temperature (Ttc) and the surface roughness (Rt) as responses. Along with machined surface texture, Rt and chip morphology was examined to assess machinability of soda lime glass. The relation between Ttc and chip morphology was examined. Investigation showed that around glass transition temperature (Tg) ductile chip produced and subsequently clean and ductile final machined surface produced.

  10. Parallel human genome analysis: microarray-based expression monitoring of 1000 genes.

    PubMed Central

    Schena, M; Shalon, D; Heller, R; Chai, A; Brown, P O; Davis, R W

    1996-01-01

    Microarrays containing 1046 human cDNAs of unknown sequence were printed on glass with high-speed robotics. These 1.0-cm2 DNA "chips" were used to quantitatively monitor differential expression of the cognate human genes using a highly sensitive two-color hybridization assay. Array elements that displayed differential expression patterns under given experimental conditions were characterized by sequencing. The identification of known and novel heat shock and phorbol ester-regulated genes in human T cells demonstrates the sensitivity of the assay. Parallel gene analysis with microarrays provides a rapid and efficient method for large-scale human gene discovery. Images Fig. 1 Fig. 2 Fig. 3 PMID:8855227

  11. From sample-to-answer: integrated genotyping and immunological analysis microfluidic platforms for the diagnostic and treatment of coeliac disease

    NASA Astrophysics Data System (ADS)

    Jung, M.; Höth, J.; Erwes, J.; Latta, D.; Strobach, X.; Hansen-Hagge, T.; Klemm, R.; Gärtner, C.; Demiris, T. M.; O'Sullivan, C.; Ritzi-Lehnert, M.; Drese, K. S.

    2011-02-01

    Taking advantage of microfluidics technology, a Lab-on-Chip system was developed offering the possibility of performing HLA (Human Leukocyte Antigen) typing to test genetic predisposition to coeliac disease and measure the level of immunodeficiency at the point-of-care. These analysis procedures are implemented on two different microfluidic cartridges, both having identical interfacial connections to the identical automated instrument. In order to assess the concentration of the targeted analytes in human blood, finger prick samples are processed to either extract genomic DNA carrying the coeliac disease gene or blood plasma containing the disease specific antibodies. We present here the different microfluidic modules integrated in a common platform, capable of automated sample preparation and analyte detection. In summary, this new microfluidic approach will dramatically reduce the costs of materials (polymer for the disposable chips and minute amount of bio-reagents) and minimize the time for analysis down to less than 20 minutes. In comparison to the state of the art detection of coeliac disease this work represents a tremendous improvement for the patient's quality of live and will significantly reduce the cost burden on the health care system.

  12. Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

    PubMed Central

    Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

    2014-01-01

    A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

  13. A Pre-mRNA-Splicing Factor Is Required for RNA-Directed DNA Methylation in Arabidopsis

    PubMed Central

    Huang, Chao-Feng; Miki, Daisuke; Tang, Kai; Zhou, Hao-Ran; Zheng, Zhimin; Chen, Wei; Ma, Ze-Yang; Yang, Lan; Zhang, Heng; Liu, Renyi; He, Xin-Jian; Zhu, Jian-Kang

    2013-01-01

    Cytosine DNA methylation is a stable epigenetic mark that is frequently associated with the silencing of genes and transposable elements (TEs). In Arabidopsis, the establishment of DNA methylation is through the RNA-directed DNA methylation (RdDM) pathway. Here, we report the identification and characterization of RDM16, a new factor in the RdDM pathway. Mutation of RDM16 reduced the DNA methylation levels and partially released the silencing of a reporter gene as well as some endogenous genomic loci in the DNA demethylase ros1-1 mutant background. The rdm16 mutant had morphological defects and was hypersensitive to salt stress and abscisic acid (ABA). Map-based cloning and complementation test led to the identification of RDM16, which encodes a pre-mRNA-splicing factor 3, a component of the U4/U6 snRNP. RNA-seq analysis showed that 308 intron retention events occurred in rdm16, confirming that RDM16 is involved in pre-mRNA splicing in planta. RNA-seq and mRNA expression analysis also revealed that the RDM16 mutation did not affect the pre-mRNA splicing of known RdDM genes, suggesting that RDM16 might be directly involved in RdDM. Small RNA expression analysis on loci showing RDM16-dependent DNA methylation suggested that unlike the previously reported putative splicing factor mutants, rdm16 did not affect small RNA levels; instead, the rdm16 mutation caused a decrease in the levels of Pol V transcripts. ChIP assays revealed that RDM16 was enriched at some Pol V target loci. Our results suggest that RDM16 regulates DNA methylation through influencing Pol V transcript levels. Finally, our genome-wide DNA methylation analysis indicated that RDM16 regulates the overall methylation of TEs and gene-surrounding regions, and preferentially targets Pol IV-dependent DNA methylation loci and the ROS1 target loci. Our work thus contributes to the understanding of RdDM and its interactions with active DNA demethylation. PMID:24068953

  14. Ultralow power trapping and fluorescence detection of single particles on an optofluidic chip.

    PubMed

    Kühn, S; Phillips, B S; Lunt, E J; Hawkins, A R; Schmidt, H

    2010-01-21

    The development of on-chip methods to manipulate particles is receiving rapidly increasing attention. All-optical traps offer numerous advantages, but are plagued by large required power levels on the order of hundreds of milliwatts and the inability to act exclusively on individual particles. Here, we demonstrate a fully integrated electro-optical trap for single particles with optical excitation power levels that are five orders of magnitude lower than in conventional optical force traps. The trap is based on spatio-temporal light modulation that is implemented using networks of antiresonant reflecting optical waveguides. We demonstrate the combination of on-chip trapping and fluorescence detection of single microorganisms by studying the photobleaching dynamics of stained DNA in E. coli bacteria. The favorable size scaling facilitates the trapping of single nanoparticles on integrated optofluidic chips.

  15. A Versatile Microfluidic Device for Automating Synthetic Biology.

    PubMed

    Shih, Steve C C; Goyal, Garima; Kim, Peter W; Koutsoubelis, Nicolas; Keasling, Jay D; Adams, Paul D; Hillson, Nathan J; Singh, Anup K

    2015-10-16

    New microbes are being engineered that contain the genetic circuitry, metabolic pathways, and other cellular functions required for a wide range of applications such as producing biofuels, biobased chemicals, and pharmaceuticals. Although currently available tools are useful in improving the synthetic biology process, further improvements in physical automation would help to lower the barrier of entry into this field. We present an innovative microfluidic platform for assembling DNA fragments with 10× lower volumes (compared to that of current microfluidic platforms) and with integrated region-specific temperature control and on-chip transformation. Integration of these steps minimizes the loss of reagents and products compared to that with conventional methods, which require multiple pipetting steps. For assembling DNA fragments, we implemented three commonly used DNA assembly protocols on our microfluidic device: Golden Gate assembly, Gibson assembly, and yeast assembly (i.e., TAR cloning, DNA Assembler). We demonstrate the utility of these methods by assembling two combinatorial libraries of 16 plasmids each. Each DNA plasmid is transformed into Escherichia coli or Saccharomyces cerevisiae using on-chip electroporation and further sequenced to verify the assembly. We anticipate that this platform will enable new research that can integrate this automated microfluidic platform to generate large combinatorial libraries of plasmids and will help to expedite the overall synthetic biology process.

  16. Combining genomic and proteomic approaches for epigenetics research

    PubMed Central

    Han, Yumiao; Garcia, Benjamin A

    2014-01-01

    Epigenetics is the study of changes in gene expression or cellular phenotype that do not change the DNA sequence. In this review, current methods, both genomic and proteomic, associated with epigenetics research are discussed. Among them, chromatin immunoprecipitation (ChIP) followed by sequencing and other ChIP-based techniques are powerful techniques for genome-wide profiling of DNA-binding proteins, histone post-translational modifications or nucleosome positions. However, mass spectrometry-based proteomics is increasingly being used in functional biological studies and has proved to be an indispensable tool to characterize histone modifications, as well as DNA–protein and protein–protein interactions. With the development of genomic and proteomic approaches, combination of ChIP and mass spectrometry has the potential to expand our knowledge of epigenetics research to a higher level. PMID:23895656

  17. Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA.

    PubMed

    Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J

    2013-12-07

    LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

  18. ChIP-Seq Analysis for Identifying Genome-Wide Histone Modifications Associated with Stress-Responsive Genes in Plants.

    PubMed

    Li, Guosheng; Jagadeeswaran, Guru; Mort, Andrew; Sunkar, Ramanjulu

    2017-01-01

    Histone modifications represent the crux of epigenetic gene regulation essential for most biological processes including abiotic stress responses in plants. Thus, identification of histone modifications at the genome-scale can provide clues for how some genes are 'turned-on' while some others are "turned-off" in response to stress. This chapter details a step-by-step protocol for identifying genome-wide histone modifications associated with stress-responsive gene regulation using chromatin immunoprecipitation (ChIP) followed by sequencing of the DNA (ChIP-seq).

  19. A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.

    PubMed

    Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

    2009-03-01

    IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.

  20. A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response

    PubMed Central

    Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

    2009-01-01

    IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219

  1. Integrated circuit-based instrumentation for microchip capillary electrophoresis.

    PubMed

    Behnam, M; Kaigala, G V; Khorasani, M; Martel, S; Elliott, D G; Backhouse, C J

    2010-09-01

    Although electrophoresis with laser-induced fluorescence (LIF) detection has tremendous potential in lab on chip-based point-of-care disease diagnostics, the wider use of microchip electrophoresis has been limited by the size and cost of the instrumentation. To address this challenge, the authors designed an integrated circuit (IC, i.e. a microelectronic chip, with total silicon area of <0.25 cm2, less than 5 mmx5 mm, and power consumption of 28 mW), which, with a minimal additional infrastructure, can perform microchip electrophoresis with LIF detection. The present work enables extremely compact and inexpensive portable systems consisting of one or more complementary metal-oxide-semiconductor (CMOS) chips and several other low-cost components. There are, to the authors' knowledge, no other reports of a CMOS-based LIF capillary electrophoresis instrument (i.e. high voltage generation, switching, control and interface circuit combined with LIF detection). This instrument is powered and controlled using a universal serial bus (USB) interface to a laptop computer. The authors demonstrate this IC in various configurations and can readily analyse the DNA produced by a standard medical diagnostic protocol (end-labelled polymerase chain reaction (PCR) product) with a limit of detection of approximately 1 ng/microl (approximately 1 ng of total DNA). The authors believe that this approach may ultimately enable lab-on-a-chip-based electrophoretic instruments that cost on the order of several dollars.

  2. Using Chromatin Immunoprecipitation in Toxicology: A Step-by-Step Guide to Increasing Efficiency, Reducing Variability, and Expanding Applications.

    PubMed

    McCullough, Shaun D; On, Doan M; Bowers, Emma C

    2017-05-02

    Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

  3. Assessing the cleanliness of surfaces: Innovative molecular approaches vs. standard spore assays

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cooper, M.; Duc, M.T. La; Probst, A.

    2011-04-01

    A bacterial spore assay and a molecular DNA microarray method were compared for their ability to assess relative cleanliness in the context of bacterial abundance and diversity on spacecraft surfaces. Colony counts derived from the NASA standard spore assay were extremely low for spacecraft surfaces. However, the PhyloChip generation 3 (G3) DNA microarray resolved the genetic signatures of a highly diverse suite of microorganisms in the very same sample set. Samples completely devoid of cultivable spores were shown to harbor the DNA of more than 100 distinct microbial phylotypes. Furthermore, samples with higher numbers of cultivable spores did not necessarilymore » give rise to a greater microbial diversity upon analysis with the DNA microarray. The findings of this study clearly demonstrated that there is not a statistically significant correlation between the cultivable spore counts obtained from a sample and the degree of bacterial diversity present. Based on these results, it can be stated that validated state-of-the-art molecular techniques, such as DNA microarrays, can be utilized in parallel with classical culture-based methods to further describe the cleanliness of spacecraft surfaces.« less

  4. Vitamin K2 downregulates the expression of fibroblast growth factor receptor 3 in human hepatocellular carcinoma cells.

    PubMed

    Cao, Ke; Liu, Weidong; Nakamura, Hideji; Enomoto, Hirayuki; Yamamoto, Teruhisa; Saito, Masaki; Imanishi, Hiroyasu; Shimomura, Soji; Cao, Peiguo; Nishiguchi, Shuhei

    2009-11-01

    Vitamin K2 exerts an antitumor activity on human hepatocellular carcinoma (HCC), however, its inhibitory mechanism has not yet been clarified. This study was designed to identify the attractive target molecule of vitamin K2 and shed some light on its effects on fibroblast growth factor receptor (FGFR)3 in HCC cells. The changes in the gene expression of HuH-7 after vitamin K2 treatment were evaluated by a DNA chip analysis. The mRNA and protein levels of FGFR were evaluated by semiquantitative reverse transcription polymerase chain reaction (RT-PCR), real-time PCR and western blot analysis. The promoter activity of the FGFR3 gene was measured by a dual-luciferase assay. The DNA chip analysis revealed different inhibitory rates of gene expression of FGFR3 (60.6%) and FGFR1 (19.4%) after vitamin K2 treatment. Vitamin K2 suppresses the proliferation of HuH-7 in a dose-dependent manner and its inhibitory rate reached approximately 61.8% at the dose of 30 microM. FGFR3 mRNA was significantly reduced based on semiquantitative RT-PCR and decreased 61.5% by a real-time PCR method after vitamin K2 treatment, but FGFR1 mRNA was not. The level of FGFR3 protein was also reduced by vitamin K2 treatment. The luciferase assay demonstrated that vitamin K2 significantly suppressed the promoter activity of FGFR3. Furthermore, the FGFR3-ERK1/2 signaling pathway was suppressed by vitamin K2 treatment. These findings suggest that vitamin K2 may suppress the proliferation of HCC cells through the downregulation of the FGFR3 expression. The transcriptional suppression of FGFR3 may be a novel mechanism of the vitamin K2 action for HCC cells.

  5. Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

    PubMed Central

    Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

    2013-01-01

    Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

  6. The effects of plant extracts on microbial community structure in a rumen-simulating continuous-culture system as revealed by molecular profiling.

    PubMed

    Ferme, D; Banjac, M; Calsamiglia, S; Busquet, M; Kamel, C; Avgustin, G

    2004-01-01

    An in vitro study in dual-flow continuous-culture fermentors was conducted with two different concentrations of monensin, cinnamaldehyde or garlic extract added to 1:1 forage-to-concentrate diet in order to determine their effects on selected rumen bacterial populations. Samples were subjected to total DNA extraction, restriction analysis of PCR amplified parts of 16S rRNA genes (ARDRA) and subsequent analysis of the restriction profiles by lab-on-chip technology with the Agilent's Bioanalyser 2100. Eub338-BacPre primer pair was used to select for the bacteria from the genera Bacteroides, Porphyromonas and Prevotella, especially the latter representing the dominant Gram-negative bacterial population in the rumen. Preliminary results of HaeIII restriction analysis show that the effects of monensin, cinnamaldehyde and garlic extract on the BacPre targeted ruminal bacteria are somewhat different in regard to targeted populations and to the nature of the effect. Garlic extract was found to trigger the most intensive changes in the structure of the BacPre targeted population. Comparison of the in silico restriction analysis of BacPre sequences deposited in different DNA databanks and of the results of performed amplified ribosomal DNA restriction analysis showed differences between the predicted and obtained HaeIII restriction profiles, and suggested the presence of novel, still unknown Prevotella populations in studied samples.

  7. Thermal Analysis of a Disposable, Instrument-Free DNA Amplification Lab-on-a-Chip Platform.

    PubMed

    Pardy, Tamás; Rang, Toomas; Tulp, Indrek

    2018-06-04

    Novel second-generation rapid diagnostics based on nucleic acid amplification tests (NAAT) offer performance metrics on par with clinical laboratories in detecting infectious diseases at the point of care. The diagnostic assay is typically performed within a Lab-on-a-Chip (LoC) component with integrated temperature regulation. However, constraints on device dimensions, cost and power supply inherent with the device format apply to temperature regulation as well. Thermal analysis on simplified thermal models for the device can help overcome these barriers by speeding up thermal optimization. In this work, we perform experimental thermal analysis on the simplified thermal model for our instrument-free, single-use LoC NAAT platform. The system is evaluated further by finite element modelling. Steady-state as well as transient thermal analysis are performed to evaluate the performance of a self-regulating polymer resin heating element in the proposed device geometry. Reaction volumes in the target temperature range of the amplification reaction are estimated in the simulated model to assess compliance with assay requirements. Using the proposed methodology, we demonstrated our NAAT device concept capable of performing loop-mediated isothermal amplification in the 20⁻25 °C ambient temperature range with 32 min total assay time.

  8. C 3-symmetric opioid scaffolds are pH-responsive DNA condensation agents.

    PubMed

    McStay, Natasha; Molphy, Zara; Coughlan, Alan; Cafolla, Attilio; McKee, Vickie; Gathergood, Nicholas; Kellett, Andrew

    2017-01-25

    Herein we report the synthesis of tripodal C 3 -symmetric opioid scaffolds as high-affinity condensation agents of duplex DNA. Condensation was achieved on both supercoiled and canonical B-DNA structures and identified by agarose electrophoresis, viscosity, turbidity and atomic force microscopy (AFM) measurements. Structurally, the requirement of a tris-opioid scaffold for condensation is demonstrated as both di- (C 2 -symmetric) and mono-substituted (C 1 -symmetric) mesitylene-linked opioid derivatives poorly coordinate dsDNA. Condensation, observed by toroidal and globule AFM aggregation, arises from surface-binding ionic interactions between protonated, cationic, tertiary amine groups on the opioid skeleton and the phosphate nucleic acid backbone. Indeed, by converting the 6-hydroxyl group of C 3 -morphine ( MC3: ) to methoxy substituents in C 3 -heterocodeine ( HC3: ) and C 3 -oripavine ( OC3: ) molecules, dsDNA compaction is retained thus negating the possibility of phosphate-hydroxyl surface-binding. Tripodal opioid condensation was identified as pH dependent and strongly influenced by ionic strength with further evidence of cationic amine-phosphate backbone coordination arising from thermal melting analysis and circular dichroism spectroscopy, with compaction also witnessed on synthetic dsDNA co-polymers poly[d(A-T) 2 ] and poly[d(G-C) 2 ]. On-chip microfluidic analysis of DNA condensed by C 3 -agents provided concentration-dependent protection (inhibition) to site-selective excision by type II restriction enzymes: BamHI, HindIII, SalI and EcoRI, but not to the endonuclease DNase I. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Physics and Application of Nanofluidic Systems

    NASA Astrophysics Data System (ADS)

    Karpusenka, Alena V.

    We report results of the three main groups of experiments: DNA bending, fluctuations and single cell mapping. In our work on the estimation of the herniation onset, we have observed DNA molecules of various lengths confined to the different nanochannels. We have discovered a certain diviation from the commonly used theories and presented a newly qualitative theory based on the observed results. We have also performed numerical analysis of the energy profile at the junction of the nanochannels in a crisscross lattice. Results qualitatively agree with experimental observations. We also performed experimental observation and analysis of the magnitude of length and density fluctuations in DNA that has been stretched to a new equilibrium state in the nanofluidic channels. We found that experimental data agrees with the Rouse model and can be described using a one-dimensional overdamped oscillator chain with nonzero equilibrium spring length. A discussion of how the measurement process would influence the apparent measured dynamic properties was done. In the last section, we first report the profiling of the 5-methyl cytosine distribution within single genomic-sized barcode molecules. To achieve gene-relevant resolution, we linearized the molecule by stretching it in a nanochannel and detected the location of the methyl-CpG binding domain proteins (MBD) conjugated with methylated parts of the barcode. The same technique was used in the chromatin mapping experiments. We report our work on the detection of the trimethylated H3K4 and acetylated H3K9 histone markers on the three different reconstituted chromatin (calf thymus, HeLa, chicken erythrocyte). We demonstrated successful results in quantification of the relative histone modifications at a single molecule scale. Lastly, we report the results of development of the single cell fluidic system, which is able to operate with genetic material after cell lysis is performed on the chip. We also show that cleaning procedure and buffer exchange can be effectively performed on the same chip without extra manipulations to the DNA material, which could result in higher yield and precision of the experimental technique on a single cell level.

  10. Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays

    PubMed Central

    Binder, Hans; Fasold, Mario; Glomb, Torsten

    2009-01-01

    Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253

  11. [Differentially expressed genes of cell signal transduction associated with benzene poisoning by cDNA microarray].

    PubMed

    Wang, Hong; Bi, Yongyi; Tao, Ning; Wang, Chunhong

    2005-08-01

    To detect the differential expression of cell signal transduction genes associated with benzene poisoning, and to explore the pathogenic mechanisms of blood system damage induced by benzene. Peripheral white blood cell gene expression profile of 7 benzene poisoning patients, including one aplastic anemia, was determined by cDNA microarray. Seven chips from normal workers were served as controls. Cluster analysis of gene expression profile was performed. Among the 4265 target genes, 176 genes associated with cell signal transduction were differentially expressed. 35 up-regulated genes including PTPRC, STAT4, IFITM1 etc were found in at least 6 pieces of microarray; 45 down-regulated genes including ARHB, PPP3CB, CDC37 etc were found in at least 5 pieces of microarray. cDNA microarray technology is an effective technique for screening the differentially expressed genes of cell signal transduction. Disorder in cell signal transduction may play certain role in the pathogenic mechanism of benzene poisoning.

  12. An epigenome-wide association analysis of cardiac autonomic responses among a population of welders.

    PubMed

    Zhang, Jinming; Liu, Zhonghua; Umukoro, Peter E; Cavallari, Jennifer M; Fang, Shona C; Weisskopf, Marc G; Lin, Xihong; Mittleman, Murray A; Christiani, David C

    2017-02-01

    DNA methylation is one of the potential epigenetic mechanisms associated with various adverse cardiovascular effects; however, its association with cardiac autonomic dysfunction, in particular, is unknown. In the current study, we aimed to identify epigenetic variants associated with alterations in cardiac autonomic responses. Cardiac autonomic responses were measured with two novel markers: acceleration capacity (AC) and deceleration capacity (DC). We examined DNA methylation levels at more than 472,506 CpG probes through the Illumina Infinium HumanMethylation450 BeadChip assay. We conducted separate linear mixed models to examine associations of DNA methylation levels at each CpG with AC and DC. One CpG (cg26829071) located in the GPR133 gene was negatively associated with DC values after multiple testing corrections through false discovery rate. Our study suggests the potential functional importance of methylation in cardiac autonomic responses. Findings from the current study need to be replicated in future studies in a larger population.

  13. Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

    PubMed

    Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

    2015-08-10

    The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

  14. Measuring Sister Chromatid Cohesion Protein Genome Occupancy in Drosophila melanogaster by ChIP-seq.

    PubMed

    Dorsett, Dale; Misulovin, Ziva

    2017-01-01

    This chapter presents methods to conduct and analyze genome-wide chromatin immunoprecipitation of the cohesin complex and the Nipped-B cohesin loading factor in Drosophila cells using high-throughput DNA sequencing (ChIP-seq). Procedures for isolation of chromatin, immunoprecipitation, and construction of sequencing libraries for the Ion Torrent Proton high throughput sequencer are detailed, and computational methods to calculate occupancy as input-normalized fold-enrichment are described. The results obtained by ChIP-seq are compared to those obtained by ChIP-chip (genomic ChIP using tiling microarrays), and the effects of sequencing depth on the accuracy are analyzed. ChIP-seq provides similar sensitivity and reproducibility as ChIP-chip, and identifies the same broad regions of occupancy. The locations of enrichment peaks, however, can differ between ChIP-chip and ChIP-seq, and low sequencing depth can splinter broad regions of occupancy into distinct peaks.

  15. Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

    NASA Astrophysics Data System (ADS)

    Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

    2012-02-01

    Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

  16. An air-pressure-free elastomeric valve for integrated nucleic acid analysis by capillary electrophoresis

    NASA Astrophysics Data System (ADS)

    Jung, Wooseok; Barrett, Matthew; Brooks, Carla; Rivera, Andrew; Birdsell, Dawn N.; Wagner, David M.; Zenhausern, Frederic

    2015-12-01

    We present a new elastomeric valve for integrated nucleic acid analysis by capillary electrophoresis. The valve functions include metering to capture a designated volume of biological sample into a polymerase chain reaction (PCR) chamber, sealing to preserve the sample during PCR cycling, and transfer of the PCR-products and on-chip formamide post-processing for the analysis of DNA fragments by capillary gel electrophoresis. This new valve differs from prior art polydimethylsiloxane (PDMS) valves in that the valve is not actuated externally by air-pressure or vacuum so that it simplifies a DNA analysis system by eliminating the need for an air-pressure or vacuum source, and off-cartridge solenoid valves, control circuit boards and software. Instead, the new valve is actuated by a thermal cycling peltier assembly integrated within the hardware instrument that tightly comes in contact with a microfluidic cartridge for thermal activation during PCR, so that it spontaneously closes the valve without an additional actuator system. The valve has bumps in the designated locations so that it has a self-alignment that does not require precise alignment of a valve actuator. Moreover, the thickness of the new valve is around 600 μm with an additional bump height of 400 μm so that it is easy to handle and very feasible to fabricate by injection molding compared to other PDMS valves whose thicknesses are around 30-100 μm. The new valve provided over 95% of metering performance in filling the fixed volume of the PCR chamber, preserved over 97% of the sample volume during PCR, and showed very comparable capillary electrophoresis peak heights to the benchtop assay tube controls with very consistent transfer volume of the PCR-product and on-chip formamide. The new valve can perform a core function for integrated nucleic acid analysis by capillary electrophoresis.

  17. Portable low-power thermal cycler with dual thin-film Pt heaters for a polymeric PCR chip.

    PubMed

    Jeong, Sangdo; Lim, Juhun; Kim, Mi-Young; Yeom, JiHye; Cho, Hyunmin; Lee, Hyunjung; Shin, Yong-Beom; Lee, Jong-Hyun

    2018-01-29

    Polymerase chain reaction (PCR) has been widely used for major definite diagnostic tool, but very limited its place used only indoor such as hospital or diagnosis lab. For the rapid on-site detection of pathogen in an outdoor environment, a low-power cordless polymerase chain reaction (PCR) thermal cycler is crucial module. At this point of view, we proposed a low-power PCR thermal cycler that could be operated in an outdoor anywhere. The disposable PCR chip was made of a polymeric (PI/PET) film to reduce the thermal mass. A dual arrangement of the Pt heaters, which were positioned on the top and bottom of the PCR chip, improved the temperature uniformity. The temperature sensor, which was made of the same material as the heater, utilized the temperature dependence of the Pt resistor to ensure simple fabrication of the temperature sensor. Cooling the PCR chip using dual blower fans enabled thermal cycling to operate with a lower power than that of a Peltier element with a high power consumption. The PCR components were electrically connected to a control module that could be operated with a Li-ion battery (12 V), and the PCR conditions (temperature, time, cycle, etc.) were inputted on a touch screen. For 30 PCR cycles, the accumulated power consumption of heating and cooling was 7.3 Wh, which is easily available from a compact battery. Escherichia coli genomic DNA (510 bp) was amplified using the proposed PCR thermal cycler and the disposable PCR chip. A similar DNA amplification capability was confirmed using the proposed portable and low-power thermal cycler compared with a conventional thermal cycler.

  18. Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

    PubMed

    Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

    2016-06-01

    We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

  19. DNA methylation data analysis and its application to cancer research

    PubMed Central

    Ma, Xiaotu; Wang, Yi-Wei; Zhang, Michael Q; Gazdar, Adi F

    2013-01-01

    With the rapid development of genome-wide high-throughput technologies, including expression arrays, SNP arrays and next-generation sequencing platforms, enormous amounts of molecular data have been generated and deposited in the public domain. The application of computational approaches is required to yield biological insights from this enormous, ever-growing resource. A particularly interesting subset of these resources is related to epigenetic regulation, with DNA methylation being the most abundant data type. In this paper, we will focus on the analysis of DNA methylation data and its application to cancer studies. We first briefly review the molecular techniques that generate such data, much of which has been obtained with the use of the most recent version of Infinium HumanMethylation450 BeadChip® technology (Illumina, CA, USA). We describe the coverage of the methylome by this technique. Several examples of data mining are provided. However, it should be understood that reliance on a single aspect of epigenetics has its limitations. In the not too distant future, these defects may be rectified, providing scientists with previously unavailable opportunities to explore in detail the role of epigenetics in cancer and other disease states. PMID:23750645

  20. Methylsorb: a simple method for quantifying DNA methylation using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Carrascosa, Laura G; Palanisamy, Ramkumar; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-10-21

    The analysis of DNA methylation is becoming increasingly important both in the clinic and also as a research tool to unravel key epigenetic molecular mechanisms in biology. Current methodologies for the quantification of regional DNA methylation (i.e., the average methylation over a region of DNA in the genome) are largely affected by comprehensive DNA sequencing methodologies which tend to be expensive, tedious, and time-consuming for many applications. Herein, we report an alternative DNA methylation detection method referred to as "Methylsorb", which is based on the inherent affinity of DNA bases to the gold surface (i.e., the trend of the affinity interactions is adenine > cytosine ≥ guanine > thymine).1 Since the degree of gold-DNA affinity interaction is highly sequence dependent, it provides a new capability to detect DNA methylation by simply monitoring the relative adsorption of bisulfite treated DNA sequences onto a gold chip. Because the selective physical adsorption of DNA fragments to gold enable a direct read-out of regional DNA methylation, the current requirement for DNA sequencing is obviated. To demonstrate the utility of this method, we present data on the regional methylation status of two CpG clusters located in the EN1 and MIR200B genes in MCF7 and MDA-MB-231 cells. The methylation status of these regions was obtained from the change in relative mass on gold surface with respect to relative adsorption of an unmethylated DNA source and this was detected using surface plasmon resonance (SPR) in a label-free and real-time manner. We anticipate that the simplicity of this method, combined with the high level of accuracy for identifying the methylation status of cytosines in DNA, could find broad application in biology and diagnostics.

  1. Rapid detection of a cocaine-binding aptamer using biological nanopores on a chip.

    PubMed

    Kawano, Ryuji; Osaki, Toshihisa; Sasaki, Hirotaka; Takinoue, Masahiro; Yoshizawa, Satoko; Takeuchi, Shoji

    2011-06-08

    This paper describes a methodology for the rapid and highly selective detection of cocaine using a membrane protein channel combined with a DNA aptamer. The DNA aptamer recognizes the cocaine molecule with high selectivity. We successfully detected a low concentration of cocaine (300 ng/mL, the drug test cutoff limit) within 60 s using a biological nanopore embedded in a microchip.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Farahani, Poupak; Chiu, Sally; Bowlus, Christopher L.

    Obesity is a complex disease. To date, over 100 chromosomal loci for body weight, body fat, regional white adipose tissue weight, and other obesity-related traits have been identified in humans and in animal models. For most loci, the underlying genes are not yet identified; some of these chromosomal loci will be alleles of known obesity genes, whereas many will represent alleles of unknown genes. Microarray analysis allows simultaneous multiple gene and pathway discovery. cDNA and oligonucleotide arrays are commonly used to identify differentially expressed genes by surveys of large numbers of known and unnamed genes. Two papers previously identified genesmore » differentially expressed in adipose tissue of mouse models of obesity and diabetes by analysis of hybridization to Affymetrix oligonucleotide chips.« less

  3. Free-solution electrophoretic separations of DNA–drag-tag conjugates on glass microchips with no polymer network and no loss of resolution at increased electric field strength

    PubMed Central

    Albrecht, Jennifer Coyne; Kerby, Matthew B.; Niedringhaus, Thomas P.; Lin, Jennifer S.; Wang, Xiaoxiao; Barron, Annelise E.

    2012-01-01

    Here, we demonstrate the potential for high-resolution electrophoretic separations of ssDNA-protein conjugates in borosilicate glass microfluidic chips, with no sieving media and excellent repeatability. Using polynucleotides of two different lengths conjugated to moderately cationic protein polymer drag-tags, we measured separation efficiency as a function of applied electric field. In excellent agreement with prior theoretical predictions of Slater et al., resolution is found to remain constant as applied field is increased up to 700 V/cm, the highest field we were able to apply. This remarkable result illustrates the fundamentally different physical limitations of Free-Solution Conjugate Electrophoresis (FSCE)-based DNA separations relative to matrix-based DNA electrophoresis. Single-stranded DNA separations in “gels” have always shown rapidly declining resolution as the field strength is increased; this is especially true for ssDNA > 400 bases in length. FSCE’s ability to decouple DNA peak resolution from applied electric field suggests the future possibility of ultra-rapid FSCE sequencing on chips. We investigated sources of peak broadening for FSCE separations on borosilicate glass microchips, using six different protein polymer drag-tags. For drag-tags with four or more positive charges, electrostatic and adsorptive interactions with pHEA-coated microchannel walls led to appreciable band-broadening, while much sharper peaks were seen for bioconjugates with nearly charge-neutral protein drag-tags. PMID:21500207

  4. Design and operation of a portable scanner for high performance microchip capillary array electrophoresis.

    PubMed

    Scherer, James R; Liu, Peng; Mathies, Richard A

    2010-11-01

    We have developed a compact, laser-induced fluorescence detection scanner, the multichannel capillary array electrophoresis portable scanner (McCAEPs) as a platform for electrophoretic detection and control of high-throughput, integrated microfluidic devices for genetic and other analyses. The instrument contains a confocal optical system with a rotary objective for detecting four different fluorescence signals, a pneumatic system consisting of two pressure/vacuum pumps and 28 individual addressable solenoid valves for control of on-chip microvalves and micropumps, four Polymerase Chain Reaction (PCR) temperature control systems, and four high voltage power supplies for electrophoresis. The detection limit of the instrument is ~20 pM for on-chip capillary electrophoresis of fluorescein dyes. To demonstrate the system performance for forensic short tandem repeat (STR) analysis, two experiments were conducted: (i) electrophoretic separation and detection of STR samples on a 96-lane microfabricated capillary array electrophoresis microchip. Fully resolved PowerPlex(®) 16 STR profiles amplified from 1 ng of 9947A female standard DNA were successfully obtained; (ii) nine-plex STR amplification, sample injection, separation, and fluorescence detection of 100-copy 9948 male standard DNA in a single integrated PCR- capillary electrophoresis microchip. These results demonstrate that the McCAEPs can be used as a versatile control and detection instrument that operates integrated microfluidic devices for high-performance forensic human identification.

  5. Design and operation of a portable scanner for high performance microchip capillary array electrophoresis

    NASA Astrophysics Data System (ADS)

    Scherer, James R.; Liu, Peng; Mathies, Richard A.

    2010-11-01

    We have developed a compact, laser-induced fluorescence detection scanner, the multichannel capillary array electrophoresis portable scanner (McCAEPs) as a platform for electrophoretic detection and control of high-throughput, integrated microfluidic devices for genetic and other analyses. The instrument contains a confocal optical system with a rotary objective for detecting four different fluorescence signals, a pneumatic system consisting of two pressure/vacuum pumps and 28 individual addressable solenoid valves for control of on-chip microvalves and micropumps, four Polymerase Chain Reaction (PCR) temperature control systems, and four high voltage power supplies for electrophoresis. The detection limit of the instrument is ˜20 pM for on-chip capillary electrophoresis of fluorescein dyes. To demonstrate the system performance for forensic short tandem repeat (STR) analysis, two experiments were conducted: (i) electrophoretic separation and detection of STR samples on a 96-lane microfabricated capillary array electrophoresis microchip. Fully resolved PowerPlex® 16 STR profiles amplified from 1 ng of 9947A female standard DNA were successfully obtained; (ii) nine-plex STR amplification, sample injection, separation, and fluorescence detection of 100-copy 9948 male standard DNA in a single integrated PCR- capillary electrophoresis microchip. These results demonstrate that the McCAEPs can be used as a versatile control and detection instrument that operates integrated microfluidic devices for high-performance forensic human identification.

  6. Integrated Microfluidic Devices for Automated Microarray-Based Gene Expression and Genotyping Analysis

    NASA Astrophysics Data System (ADS)

    Liu, Robin H.; Lodes, Mike; Fuji, H. Sho; Danley, David; McShea, Andrew

    Microarray assays typically involve multistage sample processing and fluidic handling, which are generally labor-intensive and time-consuming. Automation of these processes would improve robustness, reduce run-to-run and operator-to-operator variation, and reduce costs. In this chapter, a fully integrated and self-contained microfluidic biochip device that has been developed to automate the fluidic handling steps for microarray-based gene expression or genotyping analysis is presented. The device consists of a semiconductor-based CustomArray® chip with 12,000 features and a microfluidic cartridge. The CustomArray was manufactured using a semiconductor-based in situ synthesis technology. The micro-fluidic cartridge consists of microfluidic pumps, mixers, valves, fluid channels, and reagent storage chambers. Microarray hybridization and subsequent fluidic handling and reactions (including a number of washing and labeling steps) were performed in this fully automated and miniature device before fluorescent image scanning of the microarray chip. Electrochemical micropumps were integrated in the cartridge to provide pumping of liquid solutions. A micromixing technique based on gas bubbling generated by electrochemical micropumps was developed. Low-cost check valves were implemented in the cartridge to prevent cross-talk of the stored reagents. Gene expression study of the human leukemia cell line (K562) and genotyping detection and sequencing of influenza A subtypes have been demonstrated using this integrated biochip platform. For gene expression assays, the microfluidic CustomArray device detected sample RNAs with a concentration as low as 0.375 pM. Detection was quantitative over more than three orders of magnitude. Experiment also showed that chip-to-chip variability was low indicating that the integrated microfluidic devices eliminate manual fluidic handling steps that can be a significant source of variability in genomic analysis. The genotyping results showed that the device identified influenza A hemagglutinin and neuraminidase subtypes and sequenced portions of both genes, demonstrating the potential of integrated microfluidic and microarray technology for multiple virus detection. The device provides a cost-effective solution to eliminate labor-intensive and time-consuming fluidic handling steps and allows microarray-based DNA analysis in a rapid and automated fashion.

  7. DNA methylation map in circulating leukocytes mirrors subcutaneous adipose tissue methylation pattern: a genome-wide analysis from non-obese and obese patients

    PubMed Central

    Crujeiras, A. B.; Diaz-Lagares, A.; Sandoval, J.; Milagro, F. I.; Navas-Carretero, S.; Carreira, M. C.; Gomez, A.; Hervas, D.; Monteiro, M. P.; Casanueva, F. F.; Esteller, M.; Martinez, J. A.

    2017-01-01

    The characterization of the epigenetic changes within the obesity-related adipose tissue will provide new insights to understand this metabolic disorder, but adipose tissue is not easy to sample in population-based studies. We aimed to evaluate the capacity of circulating leukocytes to reflect the adipose tissue-specific DNA methylation status of obesity susceptibility. DNA samples isolated from subcutaneous adipose tissue and circulating leukocytes were hybridized in the Infinium HumanMethylation 450 BeadChip. Data were compared between samples from obese (n = 45) and non-obese (n = 8–10) patients by Wilcoxon-rank test, unadjusted for cell type distributions. A global hypomethylation of the differentially methylated CpG sites (DMCpGs) was observed in the obese subcutaneous adipose tissue and leukocytes. The overlap analysis yielded a number of genes mapped by the common DMCpGs that were identified to reflect the obesity state in the leukocytes. Specifically, the methylation levels of FGFRL1, NCAPH2, PNKD and SMAD3 exhibited excellent and statistically significant efficiencies in the discrimination of obesity from non-obesity status (AUC > 0.80; p < 0.05) and a great correlation between both tissues. Therefore, the current study provided new and valuable DNA methylation biomarkers of obesity-related adipose tissue pathogenesis through peripheral blood analysis, an easily accessible and minimally invasive biological material instead of adipose tissue. PMID:28211912

  8. Multi-platform metabolomics and a genetic approach support the authentication of agarwood produced by Aquilaria crassna and Aquilaria malaccensis.

    PubMed

    Nguyen, Huy Truong; Min, Jung-Eun; Long, Nguyen Phuoc; Thanh, Ma Chi; Le, Thi Hong Van; Lee, Jeongmi; Park, Jeong Hill; Kwon, Sung Won

    2017-08-05

    Agarwood, the resinous heartwood produced by some Aquilaria species such as Aquilaria crassna, Aquilaria malaccensis and Aquilaria sinensis, has been traditionally and widely used in medicine, incenses and especially perfumes. However, up to now, the authentication of agarwood has been largely based on morphological characteristics, a method which is prone to errors and lacks reproducibility. Hence, in this study, we applied metabolomics and a genetic approach to the authentication of two common agarwood chips, those produced by Aquilaria crassna and Aquilaria malaccensis. Primary metabolites, secondary metabolites and DNA markers of agarwood were authenticated by 1 H NMR metabolomics, GC-MS metabolomics and DNA-based techniques, respectively. The results indicated that agarwood chips could be classified accurately by all the methods illustrated in this study. Additionally, the pros and cons of each method are also discussed. To the best of our knowledge, our research is the first study detailing all the differences in the primary and secondary metabolites, as well as the DNA markers between the agarwood produced by these two species. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. A Predictive Approach to Network Reverse-Engineering

    NASA Astrophysics Data System (ADS)

    Wiggins, Chris

    2005-03-01

    A central challenge of systems biology is the ``reverse engineering" of transcriptional networks: inferring which genes exert regulatory control over which other genes. Attempting such inference at the genomic scale has only recently become feasible, via data-intensive biological innovations such as DNA microrrays (``DNA chips") and the sequencing of whole genomes. In this talk we present a predictive approach to network reverse-engineering, in which we integrate DNA chip data and sequence data to build a model of the transcriptional network of the yeast S. cerevisiae capable of predicting the response of genes in unseen experiments. The technique can also be used to extract ``motifs,'' sequence elements which act as binding sites for regulatory proteins. We validate by a number of approaches and present comparison of theoretical prediction vs. experimental data, along with biological interpretations of the resulting model. En route, we will illustrate some basic notions in statistical learning theory (fitting vs. over-fitting; cross- validation; assessing statistical significance), highlighting ways in which physicists can make a unique contribution in data- driven approaches to reverse engineering.

  10. PhyloChip Tackles Coral Disease

    ScienceCinema

    Todd DeSantis

    2017-12-09

    Scientists at Berkeley Lab and the University of California, Merced are using an innovative DNA array developed at Berkeley Lab to catalog the microbes that live among coral in the tropical waters off the coast of Puerto Rico.

  11. Thermoresponsive N-alkoxyalkylacrylamide polymers as a sieving matrix for high-resolution DNA separations on a microfluidic chip

    PubMed Central

    Root, Brian E.; Hammock, Mallory L.; Barron, Annelise E.

    2012-01-01

    In recent years, there has been an increasing demand for a wide range of DNA separations that require the development of materials to meet the needs of high resolution and high throughput. Here, we demonstrate the use of thermoresponsive N-alkoxyalkylacrylamide polymers as a sieving matrix for DNA separations on a microfluidic chip. The viscosities of the N-alkoxyalkylacrylamide polymers are more than an order of magnitude lower than that of a linear polyacrylamide of corresponding molecular weight, allowing rapid loading of the microchip. At 25 °C, N-alkoxyalkylacrylamide polymers can provide improved DNA separations compared to LPA in terms of reduced separation time and increased separation efficiency, particularly for the larger DNA fragments. The improved separation efficiency in N-alkoxyalkylacrylamide polymers is attributed to the peak widths increasing only slightly with DNA fragment size, while the peak widths increase appreciably above 150 bp using an LPA matrix. Upon elevating the temperature to 50 °C, the increase in viscosity of the N-alkoxyalkylacrylamide solutions is dependent upon their overall degree of hydrophobicity. The most hydrophobic polymers exhibit an LCST below 50 °C, undergoing a coil-to-globule transition followed by chain aggregation. DNA separation efficiency at 50 °C therefore decreases significantly with increasing hydrophobic character of the polymers, and no separations were possible with solutions with an LCST below 50 °C. The work reported here demonstrates the potential for this class of polymer to be used for applications such as PCR product and RFLP sizing, and provides insight into the effect of polymer hydrophobicity on DNA separations. PMID:19053065

  12. Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

    NASA Astrophysics Data System (ADS)

    Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

    2016-07-01

    The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

  13. Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip

    PubMed Central

    Yeh, Erh-Chia; Fu, Chi-Cheng; Hu, Lucy; Thakur, Rohan; Feng, Jeffrey; Lee, Luke P.

    2017-01-01

    Portable, low-cost, and quantitative nucleic acid detection is desirable for point-of-care diagnostics; however, current polymerase chain reaction testing often requires time-consuming multiple steps and costly equipment. We report an integrated microfluidic diagnostic device capable of on-site quantitative nucleic acid detection directly from the blood without separate sample preparation steps. First, we prepatterned the amplification initiator [magnesium acetate (MgOAc)] on the chip to enable digital nucleic acid amplification. Second, a simplified sample preparation step is demonstrated, where the plasma is separated autonomously into 224 microwells (100 nl per well) without any hemolysis. Furthermore, self-powered microfluidic pumping without any external pumps, controllers, or power sources is accomplished by an integrated vacuum battery on the chip. This simple chip allows rapid quantitative digital nucleic acid detection directly from human blood samples (10 to 105 copies of methicillin-resistant Staphylococcus aureus DNA per microliter, ~30 min, via isothermal recombinase polymerase amplification). These autonomous, portable, lab-on-chip technologies provide promising foundations for future low-cost molecular diagnostic assays. PMID:28345028

  14. Agreement in DNA methylation levels from the Illumina 450K array across batches, tissues, and time

    PubMed Central

    Forest, Marie; O'Donnell, Kieran J.; Voisin, Greg; Gaudreau, Helene; MacIsaac, Julia L.; McEwen, Lisa M.; Silveira, Patricia P.; Steiner, Meir; Kobor, Michael S.; Meaney, Michael J.; Greenwood, Celia M.T.

    2018-01-01

    ABSTRACT Epigenome-wide association studies (EWAS) have focused primarily on DNA methylation as a chemically stable and functional epigenetic modification. However, the stability and accuracy of the measurement of methylation in different tissues and extraction types is still being actively studied, and the longitudinal stability of DNA methylation in commonly studied peripheral tissues is of great interest. Here, we used data from two studies, three tissue types, and multiple time points to assess the stability of DNA methylation measured with the Illumina Infinium HumanMethylation450 BeadChip array. Redundancy analysis enabled visual assessment of agreement of replicate samples overall and showed good agreement after removing effects of tissue type, age, and sex. At the probe level, analysis of variance contrasts separating technical and biological replicates clearly showed better agreement between technical replicates versus longitudinal samples, and suggested increased stability for buccal cells versus blood or blood spots. Intraclass correlations (ICCs) demonstrated that inter-individual variability is of similar magnitude to within-sample variability at many probes; however, as inter-individual variability increased, so did ICC. Furthermore, we were able to demonstrate decreasing agreement in methylation levels with time, despite a maximal sampling interval of only 576 days. Finally, at 6 popular candidate genes, there was a large range of stability across probes. Our findings highlight important sources of technical and biological variation in DNA methylation across different tissues over time. These data will help to inform longitudinal sampling strategies of future EWAS. PMID:29381404

  15. Loss of the Nuclear Pool of Ubiquitin Ligase CHIP/STUB1 in Breast Cancer Unleashes the MZF1-Cathepsin Pro-oncogenic Program.

    PubMed

    Luan, Haitao; Mohapatra, Bhopal; Bielecki, Timothy A; Mushtaq, Insha; Mirza, Sameer; Jennings, Tameka A; Clubb, Robert J; An, Wei; Ahmed, Dena; El-Ansari, Rokaya; Storck, Matthew D; Mishra, Nitish K; Guda, Chittibabu; Sheinin, Yuri M; Meza, Jane L; Raja, Srikumar; Rakha, Emad A; Band, Vimla; Band, Hamid

    2018-05-15

    CHIP/STUB1 ubiquitin ligase is a negative co-chaperone for HSP90/HSC70, and its expression is reduced or lost in several cancers, including breast cancer. Using an extensive and well-annotated breast cancer tissue collection, we identified the loss of nuclear but not cytoplasmic CHIP to predict more aggressive tumorigenesis and shorter patient survival, with loss of CHIP in two thirds of ErbB2 + and triple-negative breast cancers (TNBC) and in one third of ER + breast cancers. Reduced CHIP expression was seen in breast cancer patient-derived xenograft tumors and in ErbB2 + and TNBC cell lines. Ectopic CHIP expression in ErbB2 + lines suppressed in vitro oncogenic traits and in vivo xenograft tumor growth. An unbiased screen for CHIP-regulated nuclear transcription factors identified many candidates whose DNA-binding activity was up- or downregulated by CHIP. We characterized myeloid zinc finger 1 (MZF1) as a CHIP target, given its recently identified role as a positive regulator of cathepsin B/L (CTSB/L)-mediated tumor cell invasion downstream of ErbB2. We show that CHIP negatively regulates CTSB/L expression in ErbB2 + and other breast cancer cell lines. CTSB inhibition abrogates invasion and matrix degradation in vitro and halts ErbB2 + breast cancer cell line xenograft growth. We conclude that loss of CHIP remodels the cellular transcriptome to unleash critical pro-oncogenic pathways, such as the matrix-degrading enzymes of the cathepsin family, whose components can provide new therapeutic opportunities in breast and other cancers with loss of CHIP expression. Significance: These findings reveal a novel targetable pathway of breast oncogenesis unleashed by the loss of tumor suppressor ubiquitin ligase CHIP/STUB1. Cancer Res; 78(10); 2524-35. ©2018 AACR . ©2018 American Association for Cancer Research.

  16. Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection

    PubMed Central

    Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

    2017-01-01

    Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were “DNA methylation-sensitive” genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A. The other half were “DNA methylation-resistant” genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site. PMID:28903418

  17. Histone modification alteration coordinated with acquisition of promoter DNA methylation during Epstein-Barr virus infection.

    PubMed

    Funata, Sayaka; Matsusaka, Keisuke; Yamanaka, Ryota; Yamamoto, Shogo; Okabe, Atsushi; Fukuyo, Masaki; Aburatani, Hiroyuki; Fukayama, Masashi; Kaneda, Atsushi

    2017-08-15

    Aberrant DNA hypermethylation is a major epigenetic mechanism to inactivate tumor suppressor genes in cancer. Epstein-Barr virus positive gastric cancer is the most frequently hypermethylated tumor among human malignancies. Herein, we performed comprehensive analysis of epigenomic alteration during EBV infection, by Infinium HumanMethylation 450K BeadChip for DNA methylation and ChIP-sequencing for histone modification alteration during EBV infection into gastric cancer cell line MKN7. Among 7,775 genes with increased DNA methylation in promoter regions, roughly half were "DNA methylation-sensitive" genes, which acquired DNA methylation in the whole promoter regions and thus were repressed. These included anti-oncogenic genes, e.g. CDKN2A . The other half were "DNA methylation-resistant" genes, where DNA methylation is acquired in the surrounding of promoter regions, but unmethylated status is protected in the vicinity of transcription start site. These genes thereby retained gene expression, and included DNA repair genes. Histone modification was altered dynamically and coordinately with DNA methylation alteration. DNA methylation-sensitive genes significantly correlated with loss of H3K27me3 pre-marks or decrease of active histone marks, H3K4me3 and H3K27ac. Apoptosis-related genes were significantly enriched in these epigenetically repressed genes. Gain of active histone marks significantly correlated with DNA methylation-resistant genes. Genes related to mitotic cell cycle and DNA repair were significantly enriched in these epigenetically activated genes. Our data show that orchestrated epigenetic alterations are important in gene regulation during EBV infection, and histone modification status in promoter regions significantly associated with acquisition of de novo DNA methylation or protection of unmethylated status at transcription start site.

  18. Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.

    PubMed

    Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L

    2005-04-01

    The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.

  19. Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

    PubMed Central

    2016-01-01

    Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709

  20. On-chip purification and detection of hepatitis C virus RNA from human plasma.

    PubMed

    Vaghi, V; Potrich, C; Pasquardini, L; Lunelli, L; Vanzetti, L; Ebranati, E; Lai, A; Zehender, G; Mombello, D; Cocuzza, M; Pirri, C F; Pederzolli, C

    2016-01-01

    Hepatitis C virus (HCV) is one of the main causes of chronic liver disease worldwide. The diagnosis and monitoring of HCV infection is a crucial need in the clinical management. The conventional diagnostic technologies are challenged when trying to address molecular diagnostics, especially because they require a complex and time-consuming sample preparation phase. Here, a new concept based on surface functionalization was applied to viral RNA purification: first of all polydimethylsiloxane (PDMS) flat surfaces were modified to hold RNA adsorption. After a careful chemical and morphological analysis of the modified surfaces, the functionalization protocols giving the best RNA adsorbing surfaces were applied to PDMS microdevices. The functionalized microdevices were then used for RNA purification from HCV infected human plasma samples. RNA purification and RT were successfully performed in the same microdevice chamber, saving time of analysis, reagents, and labor. The PCR protocol for HCV cDNA amplification was also implemented in the microdevice, demonstrating that the entire process of HCV analysis, from plasma to molecular readout, could be performed on-chip. Not only HCV but also other microdevice-based viral RNA detection could therefore result in a successful Point-of-Care (POC) diagnostics for resource-limited settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Transcriptional Regulation of Fruit Ripening by Tomato FRUITFULL Homologs and Associated MADS Box Proteins[W

    PubMed Central

    Fujisawa, Masaki; Shima, Yoko; Nakagawa, Hiroyuki; Kitagawa, Mamiko; Kimbara, Junji; Nakano, Toshitsugu; Kasumi, Takafumi; Ito, Yasuhiro

    2014-01-01

    The tomato (Solanum lycopersicum) MADS box FRUITFULL homologs FUL1 and FUL2 act as key ripening regulators and interact with the master regulator MADS box protein RIPENING INHIBITOR (RIN). Here, we report the large-scale identification of direct targets of FUL1 and FUL2 by transcriptome analysis of FUL1/FUL2 suppressed fruits and chromatin immunoprecipitation coupled with microarray analysis (ChIP-chip) targeting tomato gene promoters. The ChIP-chip and transcriptome analysis identified FUL1/FUL2 target genes that contain at least one genomic region bound by FUL1 or FUL2 (regions that occur mainly in their promoters) and exhibit FUL1/FUL2-dependent expression during ripening. These analyses identified 860 direct FUL1 targets and 878 direct FUL2 targets; this set of genes includes both direct targets of RIN and nontargets of RIN. Functional classification of the FUL1/FUL2 targets revealed that these FUL homologs function in many biological processes via the regulation of ripening-related gene expression, both in cooperation with and independent of RIN. Our in vitro assay showed that the FUL homologs, RIN, and tomato AGAMOUS-LIKE1 form DNA binding complexes, suggesting that tetramer complexes of these MADS box proteins are mainly responsible for the regulation of ripening. PMID:24415769

  2. DNA methylation array analysis identifies breast cancer associated RPTOR, MGRN1 and RAPSN hypomethylation in peripheral blood DNA.

    PubMed

    Tang, Qiuqiong; Holland-Letz, Tim; Slynko, Alla; Cuk, Katarina; Marme, Frederik; Schott, Sarah; Heil, Jörg; Qu, Bin; Golatta, Michael; Bewerunge-Hudler, Melanie; Sutter, Christian; Surowy, Harald; Wappenschmidt, Barbara; Schmutzler, Rita; Hoth, Markus; Bugert, Peter; Bartram, Claus R; Sohn, Christof; Schneeweiss, Andreas; Yang, Rongxi; Burwinkel, Barbara

    2016-09-27

    DNA methylation changes in peripheral blood DNA have been shown to be associated with solid tumors. We sought to identify methylation alterations in whole blood DNA that are associated with breast cancer (BC). Epigenome-wide DNA methylation profiling on blood DNA from BC cases and healthy controls was performed by applying Infinium HumanMethylation450K BeadChips. Promising CpG sites were selected and validated in three independent larger sample cohorts via MassARRAY EpiTyper assays. CpG sites located in three genes (cg06418238 in RPTOR, cg00736299 in MGRN1 and cg27466532 in RAPSN), which showed significant hypomethylation in BC patients compared to healthy controls in the discovery cohort (p < 1.00 x 10-6) were selected and successfully validated in three independent cohorts (validation I, n =211; validation II, n=378; validation III, n=520). The observed methylation differences are likely not cell-type specific, as the differences were only seen in whole blood, but not in specific sub cell-types of leucocytes. Moreover, we observed in quartile analysis that women in the lower methylation quartiles of these three loci had higher ORs than women in the higher quartiles. The combined AUC of three loci was 0.79 (95%CI 0.73-0.85) in validation cohort I, and was 0.60 (95%CI 0.54-0.66) and 0.62 (95%CI 0.57-0.67) in validation cohort II and III, respectively. Our study suggests that hypomethylation of CpG sites in RPTOR, MGRN1 and RAPSN in blood is associated with BC and might serve as blood-based marker supplements for BC if these could be verified in prospective studies.

  3. Lithographic chip identification: meeting the failure analysis challenge

    NASA Astrophysics Data System (ADS)

    Perkins, Lynn; Riddell, Kevin G.; Flack, Warren W.

    1992-06-01

    This paper describes a novel method using stepper photolithography to uniquely identify individual chips for permanent traceability. A commercially available 1X stepper is used to mark chips with an identifier or `serial number' which can be encoded with relevant information for the integrated circuit manufacturer. The permanent identification of individual chips can improve current methods of quality control, failure analysis, and inventory control. The need for this technology is escalating as manufacturers seek to provide six sigma quality control for their products and trace fabrication problems to their source. This need is especially acute for parts that fail after packaging and are returned to the manufacturer for analysis. Using this novel approach, failure analysis data can be tied back to a particular batch, wafer, or even a position within a wafer. Process control can be enhanced by identifying the root cause of chip failures. Chip identification also addresses manufacturers concerns with increasing incidences of chip theft. Since chips currently carry no identification other than the manufacturer's name and part number, recovery efforts are hampered by the inability to determine the sales history of a specific packaged chip. A definitive identifier or serial number for each chip would address this concern. The results of chip identification (patent pending) are easily viewed through a low power microscope. Batch number, wafer number, exposure step, and chip location within the exposure step can be recorded, as can dates and other items of interest. An explanation of the chip identification procedure and processing requirements are described. Experimental testing and results are presented, and potential applications are discussed.

  4. Drosophila CHIP protects against mitochondrial dysfunction by acting downstream of Pink1 in parallel with Parkin.

    PubMed

    Chen, Jia; Xue, Jin; Ruan, Jingsong; Zhao, Juan; Tang, Beisha; Duan, Ranhui

    2017-12-01

    Mitochondrial kinase PTEN-induced putative kinase 1 (PINK1) and E3 ubiquitin ligase Parkin function in a common pathway to regulate mitochondrial homeostasis contributing to the pathogenesis of Parkinson disease. The carboxyl terminus of Hsc70-interacting protein (CHIP) acts as a heat shock protein 70/heat shock protein 90 cochaperone to mediate protein folding or as an E3 ubiquitin ligase to target proteins for degradation. In this study, overexpression of Drosophila CHIP suppressed a range of Pink1 mutant phenotypes in flies, including abnormal wing posture, thoracic indentation, locomotion defects, muscle degeneration, and loss of dopaminergic neurons. Mitochondrial defects of Pink1 mutant, such as excessive fusion, reduced ATP content, and crista disorganization, were rescued by CHIP but not its ligase-dead mutants. Similar phenotypes and mitochondrial impairment were ameliorated in Parkin mutant flies by wild-type CHIP. Inactivation of CHIP with null fly mutants resulted in mitochondrial defects, such as reduced thoracic ATP content at 3 d old, decreased thoracic mitochondrial DNA content, and defective mitochondrial morphology at 60 d old. CHIP mutants did not exacerbate the phenotypes of Pink1 mutant flies but markedly shortened the life span of Parkin mutant flies. These results indicate that CHIP is involved in mitochondrial integrity and may act downstream of Pink1 in parallel with Parkin.-Chen, J., Xue, J., Ruan, J., Zhao, J., Tang, B., Duan, R. Drosophila CHIP protects against mitochondrial dysfunction by acting downstream of Pink1 in parallel with Parkin. © FASEB.

  5. GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle.

    PubMed

    Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

    2010-01-01

    GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3'-UTR GeneChips), genome-wide protein-DNA binding assays and protein-protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/

  6. GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle

    PubMed Central

    Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

    2010-01-01

    GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3′-UTR GeneChips), genome-wide protein–DNA binding assays and protein–protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/ PMID:21149299

  7. Assay for Listeria monocytogenes cells in whole blood using isotachophoresis and recombinase polymerase amplification.

    PubMed

    Eid, Charbel; Santiago, Juan G

    2016-12-19

    We present a new approach which enables lysis, extraction, and detection of inactivated Listeria monocytogenes cells from blood using isotachophoresis (ITP) and recombinase polymerase amplification (RPA). We use an ITP-compatible alkaline and proteinase K approach for rapid and effective lysis. We then perform ITP purification to separate bacterial DNA from whole blood contaminants using a microfluidic device that processes 25 μL sample volume. Lysis, mixing, dispensing, and on-chip ITP purification are completed in a total of less than 50 min. We transfer extracted DNA directly into RPA master mix for isothermal incubation and detection, an additional 25 min. We first validate our assay in the detection of purified genomic DNA spiked into whole blood, and demonstrate a limit of detection of 16.7 fg μL -1 genomic DNA, the equivalent of 5 × 10 3 cells per mL. We then show detection of chemically-inactivated L. monocytogenes cells spiked into whole blood, and demonstrate a limit of detection of 2 × 10 4 cells per mL. Lastly, we show preliminary experimental data demonstrating the feasibility of the integration of ITP purification with RPA detection on a microfluidic chip. Our results suggest that ITP purification is compatible with RPA detection, and has potential to extend the applicability of RPA to whole blood.

  8. DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

    PubMed

    Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

    2014-09-01

    Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  9. Lab-on-chip components for molecular detection

    NASA Astrophysics Data System (ADS)

    Adam, Tijjani; Dhahi, Th S.; Mohammed, Mohammed; Hashim, U.; Noriman, N. Z.; Dahham, Omar S.

    2017-09-01

    We successfully fabricated Lab on chip components and integrated for possible use in biomedical application. The sensor was fabricated by using conventional photolithography method integrated with PDMS micro channels for smooth delivery of sample to the sensing domain. The sensor was silanized and aminated with 3-Aminopropyl triethoxysilane (APTES) to functionalize the surface with biomolecules and create molecular binding chemistry. The resulting Si-O-Si- components were functionalized with oligonucleotides probe of HPV, which interacted with the single stranded HPV DNA target to create a field across on the device. The fabrication, immobilization and hybridization processes were characterized with current voltage (I-V) characterization (KEITHLEY, 6487). The sensor show selectivity for the HPV DNA target in a linear range from concentration 0.1 nM to 1 µM. This strategy presented a simple, rapid and sensitive platform for HPV detection and would become a powerful tool for pathogenic microorganisms screening in clinical diagnosis.

  10. Baseball Bats and Chocolate Chip Cookies: The Judicial Treatment of DNA in the Myriad Genetics Litigation

    PubMed Central

    Binnie, Ian; Park-Thompson, Vanessa

    2015-01-01

    In June 2013, the U.S. Supreme Court rendered a controversial ruling that naturally occurring DNA segments are “products of nature” and therefore not patentable subject matter. At this intersection between science and law, in litigation of crucial importance to patients, science, and multibillion-dollar biotech enterprises, the appellate judges sidestepped genetics and engaged in a war of metaphors from diamonds to chocolate chip cookies. This case is not an outlier. Apprehensive judges and juries in both Canada and the United States find many convenient excuses to avoid coming to grips with the underlying science in patent cases. But this is simply not acceptable. Legal rulings must be, and must seem to be, well grounded, as a matter of both law and science. The legitimacy of court decisions in the eyes of the stakeholders and the broader public depends on it. PMID:25524722

  11. Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

    PubMed Central

    Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

    2015-01-01

    Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

  12. Design of a DNA chip for detection of unknown genetically modified organisms (GMOs).

    PubMed

    Nesvold, Håvard; Kristoffersen, Anja Bråthen; Holst-Jensen, Arne; Berdal, Knut G

    2005-05-01

    Unknown genetically modified organisms (GMOs) have not undergone a risk evaluation, and hence might pose a danger to health and environment. There are, today, no methods for detecting unknown GMOs. In this paper we propose a novel method intended as a first step in an approach for detecting unknown genetically modified (GM) material in a single plant. A model is designed where biological and combinatorial reduction rules are applied to a set of DNA chip probes containing all possible sequences of uniform length n, creating probes capable of detecting unknown GMOs. The model is theoretically tested for Arabidopsis thaliana Columbia, and the probabilities for detecting inserts and receiving false positives are assessed for various parameters for this organism. From a theoretical standpoint, the model looks very promising but should be tested further in the laboratory. The model and algorithms will be available upon request to the corresponding author.

  13. Comparison of semi-automated commercial rep-PCR fingerprinting, spoligotyping, 12-locus MIRU-VNTR typing and single nucleotide polymorphism analysis of the embB gene as molecular typing tools for Mycobacterium bovis.

    PubMed

    Armas, Federica; Camperio, Cristina; Coltella, Luana; Selvaggini, Serena; Boniotti, Maria Beatrice; Pacciarini, Maria Lodovica; Di Marco Lo Presti, Vincenzo; Marianelli, Cinzia

    2017-08-04

    Highly discriminatory genotyping strategies are essential in molecular epidemiological studies of tuberculosis. In this study we evaluated, for the first time, the efficacy of the repetitive sequence-based PCR (rep-PCR) DiversiLab Mycobacterium typing kit over spoligotyping, 12-locus mycobacterial interspersed repetitive unit-variable number tandem repeat (MIRU-VNTR) typing and embB single nucleotide polymorphism (SNP) analysis for Mycobacterium bovis typing. A total of 49 M. bovis animal isolates were used. DNA was extracted and genomic DNA was amplified using the DiversiLab Mycobacterium typing kit. The amplified fragments were separated and detected using a microfluidics chip with Agilent 2100. The resulting rep-PCR-based DNA fingerprints were uploaded to and analysed using web-based DiversiLab software through Pearson's correlation coefficient. Rep-PCR DiversiLab grouped M. bovis isolates into ten different clusters. Most isolates sharing identical spoligotype, MIRU-VNTR profile or embB gene polymorphism were grouped into different rep-PCR clusters. Rep-PCR DiversiLab displayed greater discriminatory power than spoligotyping and embB SNP analysis but a lower resolution power than the 12-locus MIRU-VNTR analysis. MIRU-VNTR confirmed that it is superior to the other PCR-based methods tested here. In combination with spoligotyping and 12-locus MIRU-VNTR analysis, rep-PCR improved the discriminatory power for M. bovis typing.

  14. Epigenetic regulation of neuronal immediate early genes is associated with decline in their expression and memory consolidation in scopolamine-induced amnesic mice.

    PubMed

    Srivas, Sweta; Thakur, Mahendra K

    2017-09-01

    Recently, we reported a correlation of scopolamine mediated decline in memory consolidation with increase in the expression of DNA methyltransferase 1 (DNMT1) and histone deacetylase 2 (HDAC2) in the mouse hippocampus. Memory consolidation is a protein synthesis-dependent process which involves the expression of synaptic plasticity genes, particularly neuronal immediate early genes (IEGs). However, the mechanism of regulation of these genes during decline in memory is poorly understood. Therefore, we have studied the epigenetic regulation of expression of neuronal IEGs in scopolamine-induced amnesic mice. Scopolamine significantly impaired memory consolidation as tested by radial arm maze, and the expression of neuronal IEGs was downregulated in the hippocampus as revealed by qRT-PCR and Western blotting. Further, methylated DNA immunoprecipitation (MeDIP) analysis showed increase in DNA methylation, while chromatin immunoprecipitation (ChIP) revealed decrease in H3K9/14 acetylation at the promoter of neuronal IEGs. Taken together, the present study shows that increased DNA methylation and decreased histone acetylation at the promoter of neuronal IEGs are associated with decline in their expression and memory consolidation during scopolamine-induced amnesia. These findings suggest that the epigenetic regulation through altered DNA methylation and histone acetylation might be explored further to develop potential therapeutic interventions for amnesia.

  15. Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

    PubMed Central

    Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

    2008-01-01

    We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

  16. Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

    NASA Astrophysics Data System (ADS)

    Takenaka, Shigeori

    2017-07-01

    It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

  17. Phospholipid Polymer Biointerfaces for Lab-on-a-Chip Devices.

    PubMed

    Xu, Yan; Takai, Madoka; Ishihara, Kazuhiko

    2010-06-01

    This review summarizes recent achievements and progress in the development of various functional 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer biointerfaces for lab-on-a-chip devices and applications. As phospholipid polymers, MPC polymers can form cell-membrane-like surfaces by surface chemistry and physics and thereby provide biointerfaces capable of suppressing protein adsorption and many subsequent biological responses. In order to enable application to microfluidic devices, a number of MPC polymers with diverse functions have been specially designed and synthesized by incorporating functional units such as charge and active ester for generating the microfluidic flow and conjugating biomolecules, respectively. Furthermore, these polymers were incorporated with silane or hydrophobic moiety to construct stable interfaces on various substrate materials such as glass, quartz, poly(methyl methacrylate), and poly(dimethylsiloxane), via a silane-coupling reaction or hydrophobic interactions. The basic interfacial properties of these interfaces have been characterized from multiple aspects of chemistry, physics, and biology, and the suppression of nonspecific bioadsorption and control of microfluidic flow have been successfully achieved using these biointerfaces on a chip. Further, many chip-based biomedical applications such as immunoassays and DNA separation have been accomplished by integrating these biointerfaces on a chip. Therefore, functional phospholipid polymer interfaces are promising and useful for application to lab-on-a-chip devices in biomedicine.

  18. Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

    NASA Astrophysics Data System (ADS)

    Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

    2012-04-01

    A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

  19. Analytical applications of aptamers

    NASA Astrophysics Data System (ADS)

    Tombelli, S.; Minunni, M.; Mascini, M.

    2007-05-01

    Aptamers are single stranded DNA or RNA ligands which can be selected for different targets starting from a library of molecules containing randomly created sequences. Aptamers have been selected to bind very different targets, from proteins to small organic dyes. Aptamers are proposed as alternatives to antibodies as biorecognition elements in analytical devices with ever increasing frequency. This in order to satisfy the demand for quick, cheap, simple and highly reproducible analytical devices, especially for protein detection in the medical field or for the detection of smaller molecules in environmental and food analysis. In our recent experience, DNA and RNA aptamers, specific for three different proteins (Tat, IgE and thrombin), have been exploited as bio-recognition elements to develop specific biosensors (aptasensors). These recognition elements have been coupled to piezoelectric quartz crystals and surface plasmon resonance (SPR) devices as transducers where the aptamers have been immobilized on the gold surface of the crystals electrodes or on SPR chips, respectively.

  20. Epigenetic changes in leukocytes after 8 weeks of resistance exercise training.

    PubMed

    Denham, Joshua; Marques, Francine Z; Bruns, Emma L; O'Brien, Brendan J; Charchar, Fadi J

    2016-06-01

    Regular engagement in resistance exercise training elicits many health benefits including improvement to muscular strength, hypertrophy and insulin sensitivity, though the underpinning molecular mechanisms are poorly understood. The purpose of this study was to determine the influence 8 weeks of resistance exercise training has on leukocyte genome-wide DNA methylation and gene expression in healthy young men. Eight young (21.1 ± 2.2 years) men completed one repetition maximum (1RM) testing before completing 8 weeks of supervised, thrice-weekly resistance exercise training comprising three sets of 8-12 repetitions with a load equivalent to 80 % of 1RM. Blood samples were collected at rest before and after the 8-week training intervention. Genome-wide DNA methylation and gene expression were assessed on isolated leukocyte DNA and RNA using the 450K BeadChip and HumanHT-12 v4 Expression BeadChip (Illumina), respectively. Resistance exercise training significantly improved upper and lower body strength concurrently with diverse genome-wide DNA methylation and gene expression changes (p ≤ 0. 01). DNA methylation changes occurred at multiple regions throughout the genome in context with genes and CpG islands, and in genes relating to axon guidance, diabetes and immune pathways. There were multiple genes with increased expression that were enriched for RNA processing and developmental proteins. Growth factor genes-GHRH and FGF1-showed differential methylation and mRNA expression changes after resistance training. Our findings indicate that resistance exercise training improves muscular strength and is associated with reprogramming of the leukocyte DNA methylome and transcriptome.

  1. Plasmonic nanoparticles-decorated diatomite biosilica: extending the horizon of on-chip chromatography and label-free biosensing.

    PubMed

    Kong, Xianming; Li, Erwen; Squire, Kenny; Liu, Ye; Wu, Bo; Cheng, Li-Jing; Wang, Alan X

    2017-11-01

    Diatomite consists of fossilized remains of ancient diatoms and is a type of naturally abundant photonic crystal biosilica with multiple unique physical and chemical functionalities. In this paper, we explored the fluidic properties of diatomite as the matrix for on-chip chromatography and, simultaneously, the photonic crystal effects to enhance the plasmonic resonances of metallic nanoparticles for surface-enhanced Raman scattering (SERS) biosensing. The plasmonic nanoparticle-decorated diatomite biosilica provides a lab-on-a-chip capability to separate and detect small molecules from mixture samples with ultra-high detection sensitivity down to 1 ppm. We demonstrate the significant potential for biomedical applications by screening toxins in real biofluid, achieving simultaneous label-free biosensing of phenethylamine and miR21cDNA in human plasma with unprecedented sensitivity and specificity. To the best of our knowledge, this is the first time demonstration to detect target molecules from real biofluids by on-chip chromatography-SERS techniques. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Nanophotonic Trapping for Precise Manipulation of Biomolecular Arrays

    PubMed Central

    Soltani, Mohammad; Lin, Jun; Forties, Robert A.; Inman, James T.; Saraf, Summer N.; Fulbright, Robert M.; Lipson, Michal; Wang, Michelle D.

    2014-01-01

    Optical trapping is a powerful manipulation and measurement technique widely employed in the biological and materials sciences1–8. Miniaturizing optical trap instruments onto optofluidic platforms holds promise for high throughput lab-on-chip applications9–16. However, a persistent challenge with existing optofluidic devices has been controlled and precise manipulation of trapped particles. Here we report a new class of on-chip optical trapping devices. Using photonic interference functionalities, an array of stable, three-dimensional on-chip optical traps is formed at the antinodes of a standing-wave evanescent field on a nanophotonic waveguide. By employing the thermo-optic effect via integrated electric microheaters, the traps can be repositioned at high speed (~ 30 kHz) with nanometer precision. We demonstrate sorting and manipulation of individual DNA molecules. In conjunction with laminar flows and fluorescence, we also show precise control of the chemical environment of a sample with simultaneous monitoring. Such a controllable trapping device has the potential for high-throughput precision measurements on chip. PMID:24776649

  3. Nanophotonic trapping for precise manipulation of biomolecular arrays.

    PubMed

    Soltani, Mohammad; Lin, Jun; Forties, Robert A; Inman, James T; Saraf, Summer N; Fulbright, Robert M; Lipson, Michal; Wang, Michelle D

    2014-06-01

    Optical trapping is a powerful manipulation and measurement technique widely used in the biological and materials sciences. Miniaturizing optical trap instruments onto optofluidic platforms holds promise for high-throughput lab-on-a-chip applications. However, a persistent challenge with existing optofluidic devices has been achieving controlled and precise manipulation of trapped particles. Here, we report a new class of on-chip optical trapping devices. Using photonic interference functionalities, an array of stable, three-dimensional on-chip optical traps is formed at the antinodes of a standing-wave evanescent field on a nanophotonic waveguide. By employing the thermo-optic effect via integrated electric microheaters, the traps can be repositioned at high speed (∼30 kHz) with nanometre precision. We demonstrate sorting and manipulation of individual DNA molecules. In conjunction with laminar flows and fluorescence, we also show precise control of the chemical environment of a sample with simultaneous monitoring. Such a controllable trapping device has the potential to achieve high-throughput precision measurements on chip.

  4. Pro-oncogene Pokemon promotes breast cancer progression by upregulating survivin expression.

    PubMed

    Zu, Xuyu; Ma, Jun; Liu, Hongxia; Liu, Feng; Tan, Chunyan; Yu, Lingling; Wang, Jue; Xie, Zhenhua; Cao, Deliang; Jiang, Yuyang

    2011-03-10

    Pokemon is an oncogenic transcription factor involved in cell growth, differentiation and oncogenesis, but little is known about its role in human breast cancer. In this study, we aimed to reveal the role of Pokemon in breast cancer progression and patient survival and to understand its underlying mechanisms. Tissue microarray analysis of breast cancer tissues from patients with complete clinicopathological data and more than 20 years of follow-up were used to evaluate Pokemon expression and its correlation with the progression and prognosis of the disease. DNA microarray analysis of MCF-7 cells that overexpress Pokemon was used to identify Pokemon target genes. Chromatin immunoprecipitation (ChIP) and site-directed mutagenesis were utilized to determine how Pokemon regulates survivin expression, a target gene. Pokemon was found to be overexpressed in 158 (86.8%) of 182 breast cancer tissues, and its expression was correlated with tumor size (P = 0.0148) and lymph node metastasis (P = 0.0014). Pokemon expression led to worse overall (n = 175, P = 0.01) and disease-related (n = 79, P = 0.0134) patient survival. DNA microarray analyses revealed that in MCF-7 breast cancer cells, Pokemon regulates the expression of at least 121 genes involved in several signaling and metabolic pathways, including anti-apoptotic survivin. In clinical specimens, Pokemon and survivin expression were highly correlated (n = 49, r = 0.6799, P < 0.0001). ChIP and site-directed mutagenesis indicated that Pokemon induces survivin expression by binding to the GT boxes in its promoter. Pokemon promotes breast cancer progression by upregulating survivin expression and thus may be a potential target for the treatment of this malignancy.

  5. Pro-oncogene Pokemon promotes breast cancer progression by upregulating survivin expression

    PubMed Central

    2011-01-01

    Introduction Pokemon is an oncogenic transcription factor involved in cell growth, differentiation and oncogenesis, but little is known about its role in human breast cancer. In this study, we aimed to reveal the role of Pokemon in breast cancer progression and patient survival and to understand its underlying mechanisms. Methods Tissue microarray analysis of breast cancer tissues from patients with complete clinicopathological data and more than 20 years of follow-up were used to evaluate Pokemon expression and its correlation with the progression and prognosis of the disease. DNA microarray analysis of MCF-7 cells that overexpress Pokemon was used to identify Pokemon target genes. Chromatin immunoprecipitation (ChIP) and site-directed mutagenesis were utilized to determine how Pokemon regulates survivin expression, a target gene. Results Pokemon was found to be overexpressed in 158 (86.8%) of 182 breast cancer tissues, and its expression was correlated with tumor size (P = 0.0148) and lymph node metastasis (P = 0.0014). Pokemon expression led to worse overall (n = 175, P = 0.01) and disease-related (n = 79, P = 0.0134) patient survival. DNA microarray analyses revealed that in MCF-7 breast cancer cells, Pokemon regulates the expression of at least 121 genes involved in several signaling and metabolic pathways, including anti-apoptotic survivin. In clinical specimens, Pokemon and survivin expression were highly correlated (n = 49, r = 0.6799, P < 0.0001). ChIP and site-directed mutagenesis indicated that Pokemon induces survivin expression by binding to the GT boxes in its promoter. Conclusions Pokemon promotes breast cancer progression by upregulating survivin expression and thus may be a potential target for the treatment of this malignancy. PMID:21392388

  6. Genome-wide Mapping Reveals Conservation of Promoter DNA Methylation Following Chicken Domestication

    PubMed Central

    Li, Qinghe; Wang, Yuanyuan; Hu, Xiaoxiang; Zhao, Yaofeng; Li, Ning

    2015-01-01

    It is well-known that environment influences DNA methylation, however, the extent of heritable DNA methylation variation following animal domestication remains largely unknown. Using meDIP-chip we mapped the promoter methylomes for 23,316 genes in muscle tissues of ancestral and domestic chickens. We systematically examined the variation of promoter DNA methylation in terms of different breeds, differentially expressed genes, SNPs and genes undergo genetic selection sweeps. While considerable changes in DNA sequence and gene expression programs were prevalent, we found that the inter-strain DNA methylation patterns were highly conserved in promoter region between the wild and domestic chicken breeds. Our data suggests a global preservation of DNA methylation between the wild and domestic chicken breeds in either a genome-wide or locus-specific scale in chick muscle tissues. PMID:25735894

  7. Design and synthesis of target-responsive hydrogel for portable visual quantitative detection of uranium with a microfluidic distance-based readout device.

    PubMed

    Huang, Yishun; Fang, Luting; Zhu, Zhi; Ma, Yanli; Zhou, Leiji; Chen, Xi; Xu, Dunming; Yang, Chaoyong

    2016-11-15

    Due to uranium's increasing exploitation in nuclear energy and its toxicity to human health, it is of great significance to detect uranium contamination. In particular, development of a rapid, sensitive and portable method is important for personal health care for those who frequently come into contact with uranium ore mining or who investigate leaks at nuclear power plants. The most stable form of uranium in water is uranyl ion (UO2(2+)). In this work, a UO2(2+) responsive smart hydrogel was designed and synthesized for rapid, portable, sensitive detection of UO2(2+). A UO2(2+) dependent DNAzyme complex composed of substrate strand and enzyme strand was utilized to crosslink DNA-grafted polyacrylamide chains to form a DNA hydrogel. Colorimetric analysis was achieved by encapsulating gold nanoparticles (AuNPs) in the DNAzyme-crosslinked hydrogel to indicate the concentration of UO2(2+). Without UO2(2+), the enzyme strand is not active. The presence of UO2(2+) in the sample activates the enzyme strand and triggers the cleavage of the substrate strand from the enzyme strand, thereby decreasing the density of crosslinkers and destabilizing the hydrogel, which then releases the encapsulated AuNPs. As low as 100nM UO2(2+) was visually detected by the naked eye. The target-responsive hydrogel was also demonstrated to be applicable in natural water spiked with UO2(2+). Furthermore, to avoid the visual errors caused by naked eye observation, a previously developed volumetric bar-chart chip (V-Chip) was used to quantitatively detect UO2(2+) concentrations in water by encapsulating Au-Pt nanoparticles in the hydrogel. The UO2(2+) concentrations were visually quantified from the travelling distance of ink-bar on the V-Chip. The method can be used for portable and quantitative detection of uranium in field applications without skilled operators and sophisticated instruments. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. A fractal analysis of protein to DNA binding kinetics using biosensors.

    PubMed

    Sadana, Ajit

    2003-08-01

    A fractal analysis of a confirmative nature only is presented for the binding of estrogen receptor (ER) in solution to its corresponding DNA (estrogen response element, ERE) immobilized on a sensor chip surface [J. Biol. Chem. 272 (1997) 11384], and for the cooperative binding of human 1,25-dihydroxyvitamin D(3) receptor (VDR) to DNA with the 9-cis-retinoic acid receptor (RXR) [Biochemistry 35 (1996) 3309]. Ligands were also used to modulate the first reaction. Data taken from the literature may be modeled by using a single- or a dual-fractal analysis. Relationships are presented for the binding rate coefficient as a function of either the analyte concentration in solution or the fractal dimension that exists on the biosensor surface. The binding rate expressions developed exhibit a wide range of dependence on the degree of heterogeneity that exists on the surface, ranging from sensitive (order of dependence equal to 1.202) to very sensitive (order of dependence equal to 12.239). In general, the binding rate coefficient increases as the degree of heterogeneity or the fractal dimension of the surface increases. The predictive relationships presented provide further physical insights into the reactions occurring on the biosensor surface. Even though these reactions are occurring on the biosensor surface, the relationships presented should assist in understanding and in possibly manipulating the reactions occurring on cellular surfaces.

  9. Sunflower centromeres consist of a centromere-specific LINE and a chromosome-specific tandem repeat.

    PubMed

    Nagaki, Kiyotaka; Tanaka, Keisuke; Yamaji, Naoki; Kobayashi, Hisato; Murata, Minoru

    2015-01-01

    The kinetochore is a protein complex including kinetochore-specific proteins that plays a role in chromatid segregation during mitosis and meiosis. The complex associates with centromeric DNA sequences that are usually species-specific. In plant species, tandem repeats including satellite DNA sequences and retrotransposons have been reported as centromeric DNA sequences. In this study on sunflowers, a cDNA-encoding centromere-specific histone H3 (CENH3) was isolated from a cDNA pool from a seedling, and an antibody was raised against a peptide synthesized from the deduced cDNA. The antibody specifically recognized the sunflower CENH3 (HaCENH3) and showed centromeric signals by immunostaining and immunohistochemical staining analysis. The antibody was also applied in chromatin immunoprecipitation (ChIP)-Seq to isolate centromeric DNA sequences and two different types of repetitive DNA sequences were identified. One was a long interspersed nuclear element (LINE)-like sequence, which showed centromere-specific signals on almost all chromosomes in sunflowers. This is the first report of a centromeric LINE sequence, suggesting possible centromere targeting ability. Another type of identified repetitive DNA was a tandem repeat sequence with a 187-bp unit that was found only on a pair of chromosomes. The HaCENH3 content of the tandem repeats was estimated to be much higher than that of the LINE, which implies centromere evolution from LINE-based centromeres to more stable tandem-repeat-based centromeres. In addition, the epigenetic status of the sunflower centromeres was investigated by immunohistochemical staining and ChIP, and it was found that centromeres were heterochromatic.

  10. Concordance of DNA methylation profiles between breast core biopsy and surgical excision specimens containing ductal carcinoma in situ (DCIS).

    PubMed

    Chen, Youdinghuan; Marotti, Jonathan D; Jenson, Erik G; Onega, Tracy L; Johnson, Kevin C; Christensen, Brock C

    2017-08-01

    The utility and reliability of assessing molecular biomarkers for translational applications on pre-operative core biopsy specimens assume consistency of molecular profiles with larger surgical specimens. Whether DNA methylation in ductal carcinoma in situ (DCIS), measured in core biopsy and surgical specimens are similar, remains unclear. Here, we compared genome-scale DNA methylation measured in matched core biopsy and surgical specimens from DCIS, including specific DNA methylation biomarkers of subsequent invasive cancer. DNA was extracted from guided 2mm cores of formalin fixed paraffin embedded (FFPE) specimens, bisulfite-modified, and measured on the Illumina HumanMethylation450 BeadChip. DNA methylation profiles of core biopsies exhibited high concordance with matched surgical specimens. Within-subject variability in DNA methylation was significantly lower than between-subject variability (all P<2.20E-16). In 641 CpGs whose methylation was related with increased hazard of invasive breast cancer, lower within-subject than between-subject variability was observed in 92.3% of the study participants (P<0.05). Between patient-matched core biopsy and surgical specimens, <0.6% of CpGs measured had changes in median DNA methylation >15%, and a pathway analysis of these CpGs indicated enrichment for genes related with wound healing. Our results indicate that DNA methylation measured in core biopsies are representative of the matched surgical specimens and suggest that DCIS biomarkers measured in core biopsies can inform clinical decision-making. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  11. An Analysis of the Effects of Chip-groove Geometry on Machining Performance Using Finite Element Methods

    NASA Astrophysics Data System (ADS)

    Ee, K. C.; Dillon, O. W.; Jawahir, I. S.

    2004-06-01

    This paper discusses the influence of major chip-groove parameters of a cutting tool on the chip formation process in orthogonal machining using finite element (FE) methods. In the FE formulation, a thermal elastic-viscoplastic material model is used together with a modified Johnson-Cook material law for the flow stress. The chip back-flow angle and the chip up-curl radius are calculated for a range of cutting conditions by varying the chip-groove parameters. The analysis provides greater understanding of the effectiveness of chip-groove configurations and points a way to correlate cutting conditions with tool-wear when machining with a grooved cutting tool.

  12. ChIP-seq: advantages and challenges of a maturing technology.

    PubMed

    Park, Peter J

    2009-10-01

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) is a technique for genome-wide profiling of DNA-binding proteins, histone modifications or nucleosomes. Owing to the tremendous progress in next-generation sequencing technology, ChIP-seq offers higher resolution, less noise and greater coverage than its array-based predecessor ChIP-chip. With the decreasing cost of sequencing, ChIP-seq has become an indispensable tool for studying gene regulation and epigenetic mechanisms. In this Review, I describe the benefits and challenges in harnessing this technique with an emphasis on issues related to experimental design and data analysis. ChIP-seq experiments generate large quantities of data, and effective computational analysis will be crucial for uncovering biological mechanisms.

  13. Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miyada, C.G.; Cronin, M.T.; Kim, S.M.

    1994-09-01

    We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

  14. A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation.

    PubMed

    Nohara, Kazunari; Chen, Zheng; Yoo, Seung-Hee

    2017-07-06

    Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.

  15. Design and synthesis of target-responsive aptamer-cross-linked hydrogel for visual quantitative detection of ochratoxin A.

    PubMed

    Liu, Rudi; Huang, Yishun; Ma, Yanli; Jia, Shasha; Gao, Mingxuan; Li, Jiuxing; Zhang, Huimin; Xu, Dunming; Wu, Min; Chen, Yan; Zhu, Zhi; Yang, Chaoyong

    2015-04-01

    A target-responsive aptamer-cross-linked hydrogel was designed and synthesized for portable and visual quantitative detection of the toxin Ochratoxin A (OTA), which occurs in food and beverages. The hydrogel network forms by hybridization between one designed DNA strand containing the OTA aptamer and two complementary DNA strands grafting on linear polyacrylamide chains. Upon the introduction of OTA, the aptamer binds with OTA, leading to the dissociation of the hydrogel, followed by release of the preloaded gold nanoparticles (AuNPs), which can be observed by the naked eye. To enable sensitive visual and quantitative detection, we encapsulated Au@Pt core-shell nanoparticles (Au@PtNPs) in the hydrogel to generate quantitative readout in a volumetric bar-chart chip (V-Chip). In the V-Chip, Au@PtNPs catalyzes the oxidation of H2O2 to generate O2, which induces movement of an ink bar to a concentration-dependent distance for visual quantitative readout. Furthermore, to improve the detection limit in complex real samples, we introduced an immunoaffinity column (IAC) of OTA to enrich OTA from beer. After the enrichment, as low as 1.27 nM (0.51 ppb) OTA can be detected by the V-Chip, which satisfies the test requirement (2.0 ppb) by the European Commission. The integration of a target-responsive hydrogel with portable enrichment by IAC, as well as signal amplification and quantitative readout by a simple microfluidic device, offers a new method for portable detection of food safety hazard toxin OTA.

  16. A poly(dimethylsiloxane) microfluidic sheet reversibly adhered on a glass plate for creation of emulsion droplets for droplet digital PCR.

    PubMed

    Nakashoji, Yuta; Tanaka, Hironari; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

    2017-01-01

    A PDMS microfluidic chip with T-junction channel geometry, two inlet reservoirs, and one outlet reservoir was reversibly adhered on a glass plate through the viscoelastic properties of PDMS. This formed a detachable microfluidic device for creation of water-in-oil emulsion droplets that were used as discrete reaction compartments for the droplet digital PCR. The PDMS/glass device could continuously produce monodisperse droplets without leakage of fluids using a vacuum-driven autonomous micropumping method. This droplet preparation technique only required evacuation of air dissolved in the PDMS before loading of oil and aqueous phases into separate inlet reservoirs. Degassing of the PDMS chip at approximately 300 Pa for 1.5 h in a vacuum desiccator gave 40 000 droplets in 80 min, which corresponded to a generation frequency of up to nine droplets per second. Over multiple runs the droplet creation was very reproducible, and the size reproducibility of generated droplets (polydispersity of up to 4.1%) was comparable to that acquired using other microfluidic droplet preparation techniques. Because the PDMS chip can be peeled off the glass plate, blocked channels can easily be fixed when they arise, and this extends the lifetime of the chip. Single DNA molecules partitioned into the droplets were successfully amplified by PCR. In addition, the droplet digital PCR platform allowed absolute quantification of low copy numbers of target DNA, and was robust against instrumental variance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Molecular Aging of Human Liver: An Epigenetic/Transcriptomic Signature.

    PubMed

    Bacalini, Maria Giulia; Franceschi, Claudio; Gentilini, Davide; Ravaioli, Francesco; Zhou, Xiaoyuan; Remondini, Daniel; Pirazzini, Chiara; Giuliani, Cristina; Marasco, Elena; Gensous, Noémie; Di Blasio, Anna Maria; Ellis, Ewa; Gramignoli, Roberto; Castellani, Gastone; Capri, Miriam; Strom, Stephen; Nardini, Christine; Cescon, Matteo; Grazi, Gian Luca; Garagnani, Paolo

    2018-03-15

    The feasibility of liver transplantation from old healthy donors suggests that this organ is able to preserve its functionality during aging. To explore the biological basis of this phenomenon, we characterized the epigenetic profile of liver biopsies collected from 45 healthy liver donors ranging from 13 to 90 years old using the Infinium HumanMethylation450 BeadChip. The analysis indicates that a large remodeling in DNA methylation patterns occurs, with 8823 age-associated differentially methylated CpG probes. Notably, these age-associated changes tended to level off after the age of 60, as confirmed by Horvath's clock. Using stringent selection criteria we further identified a DNA methylation signature of aging liver including 75 genomic regions. We demonstrated that this signature is specific for liver compared to other tissues and that it is able to detect biological age-acceleration effects associated with obesity. Finally we combined DNA methylation measurements with available expression data. Although the intersection between the two omic characterizations was low, both approaches suggested a previously unappreciated role of epithelial-mesenchymal transition and Wnt signaling pathways in the aging of human liver.

  18. Development of an electro-responsive platform for the controlled transfection of mammalian cells

    NASA Astrophysics Data System (ADS)

    Hook, Andrew L.; Thissen, Helmut W.; Hayes, Jason P.; Voelcker, Nicolas H.

    2005-02-01

    The recent development of living microarrays as novel tools for the analysis of gene expression in an in-situ environment promises to unravel gene function within living organisms. In order to significantly enhance microarray performance, we are working towards electro-responsive DNA transfection chips. This study focuses on the control of DNA adsorption and desorption by appropriate surface modification of highly doped p++ silicon. Silicon was modified by plasma polymerisation of allylamine (ALAPP), a non-toxic surface that sustains cell growth. Subsequent high surface density grafting of poly(ethylene oxide) formed a layer resistant to biomolecule adsorption and cell attachment. Spatially controlled excimer laser ablation of the surface produced micron resolution patterns of re-exposed plasma polymer whilst the rest of the surface remained non-fouling. We observed electro-stimulated preferential adsorption of DNA to the ALAPP surface and subsequent desorption by the application of a negative bias. Cell culture experiments with HEK 293 cells demonstrated efficient and controlled transfection of cells using the expression of green fluorescent protein as a reporter. Thus, these chemically patterned surfaces are promising platforms for use as living microarrays.

  19. Development of a bi-functional silica monolith for electro-osmotic pumping and DNA clean-up/extraction using gel-supported reagents in a microfluidic device.

    PubMed

    Oakley, Jennifer A; Shaw, Kirsty J; Docker, Peter T; Dyer, Charlotte E; Greenman, John; Greenway, Gillian M; Haswell, Stephen J

    2009-06-07

    A silica monolith used to support both electro-osmotic pumping (EOP) and the extraction/elution of DNA coupled with gel-supported reagents is described. The benefits of the combined EOP extraction/elution system were illustrated by combining DNA extraction and gene amplification using the polymerase chain reaction (PCR) process. All the reagents necessary for both processes were supported within pre-loaded gels that allow the reagents to be stored at 4 degrees C for up to four weeks in the microfluidic device. When carrying out an analysis the crude sample only needed to be hydrodynamically introduced into the device which was connected to an external computer controlled power supply via platinum wire electrodes. DNA was extracted with 65% efficiency after loading lysed cells onto a silica monolith. Ethanol contained within an agarose gel matrix was then used to wash unwanted debris away from the sample by EOP (100 V cm(-1) for 5 min). The retained DNA was subsequently eluted from the monolith by water contained in a second agarose gel, again by EOP using an electric field of 100 V cm(-1) for 5 min, and transferred into the PCR reagent containing gel. The eluted DNA in solution was successfully amplified by PCR, confirming that the concept of a complete self-contained microfluidic device could be realised for DNA sample clean up and amplification, using a simple pumping and on-chip reagent storage methodology.

  20. Cancer Biomarkers from Genome-Scale DNA Methylation: Comparison of Evolutionary and Semantic Analysis Methods

    PubMed Central

    Valavanis, Ioannis; Pilalis, Eleftherios; Georgiadis, Panagiotis; Kyrtopoulos, Soterios; Chatziioannou, Aristotelis

    2015-01-01

    DNA methylation profiling exploits microarray technologies, thus yielding a wealth of high-volume data. Here, an intelligent framework is applied, encompassing epidemiological genome-scale DNA methylation data produced from the Illumina’s Infinium Human Methylation 450K Bead Chip platform, in an effort to correlate interesting methylation patterns with cancer predisposition and, in particular, breast cancer and B-cell lymphoma. Feature selection and classification are employed in order to select, from an initial set of ~480,000 methylation measurements at CpG sites, predictive cancer epigenetic biomarkers and assess their classification power for discriminating healthy versus cancer related classes. Feature selection exploits evolutionary algorithms or a graph-theoretic methodology which makes use of the semantics information included in the Gene Ontology (GO) tree. The selected features, corresponding to methylation of CpG sites, attained moderate-to-high classification accuracies when imported to a series of classifiers evaluated by resampling or blindfold validation. The semantics-driven selection revealed sets of CpG sites performing similarly with evolutionary selection in the classification tasks. However, gene enrichment and pathway analysis showed that it additionally provides more descriptive sets of GO terms and KEGG pathways regarding the cancer phenotypes studied here. Results support the expediency of this methodology regarding its application in epidemiological studies. PMID:27600245

  1. Focusing analytes from 50 μL into 500 pL: On-chip focusing from large sample volumes using isotachophoresis.

    PubMed

    van Kooten, Xander F; Truman-Rosentsvit, Marianna; Kaigala, Govind V; Bercovici, Moran

    2017-09-05

    The use of on-chip isotachophoresis assays for diagnostic applications is often limited by the small volumes of standard microfluidic channels. Overcoming this limitation is particularly important for detection of 'discrete' biological targets (such as bacteria) at low concentrations, where the volume of processed liquid in a standard microchannel might not contain any targets. We present a novel microfluidic chip that enables ITP focusing of target analytes from initial sample volumes of 50 μL into a concentrated zone with a volume of 500 pL, corresponding to a 100,000-fold increase in mean concentration, and a 300,000-fold increase in peak concentration. We present design considerations for limiting sample dispersion in such large-volume focusing (LVF) chips and discuss the trade-off between assay time and Joule heating, which ultimately governs the scalability of LVF designs. Finally, we demonstrate a 100-fold improvement of ITP focusing performance in the LVF chip as compared to conventional microchannels, and apply this enhancement to achieve highly sensitive detection of both molecular targets (DNA, down to 10 fM) and whole bacteria (down to 100 cfu/mL).

  2. Silicon Integrated Cavity Optomechanical Transducer

    NASA Astrophysics Data System (ADS)

    Zou, Jie; Miao, Houxun; Michels, Thomas; Liu, Yuxiang; Srinivasan, Kartik; Aksyuk, Vladimir

    2013-03-01

    Cavity optomechanics enables measurements of mechanical motion at the fundamental limits of precision imposed by quantum mechanics. However, the need to align and couple devices to off-chip optical components hinders development, miniaturization and broader application of ultrahigh sensitivity chip-scale optomechanical transducers. Here we demonstrate a fully integrated and optical fiber pigtailed optomechanical transducer with a high Q silicon micro-disk cavity near-field coupled to a nanoscale cantilever. We detect the motion of the cantilever by measuring the resonant frequency shift of the whispering gallery mode of the micro-disk. The sensitivity near the standard quantum limit can be reached with sub-uW optical power. Our on-chip approach combines compactness and stability with great design flexibility: the geometry of the micro-disk and cantilever can be tailored to optimize the mechanical/optical Q factors and tune the mechanical frequency over two orders of magnitudes. Electrical transduction in addition to optical transduction was also demonstrated and both can be used to effectively cool the cantilever. Moreover, cantilevers with sharp tips overhanging the chip edge were fabricated to potentially allow the mechanical cantilever to be coupled to a wide range of off-chip systems, such as spins, DNA, nanostructures and atoms on clean surfaces.

  3. AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

    EPA Science Inventory

    The application of new molecular biological tools to environmental toxicology was discussed at an international workshop attended by
    approximately 60 government, academic, and industrial scientists. The sequencing of the human genome, development of microarrays and
    DNA chip...

  4. Epigenetic Transgenerational Actions of Vinclozolin on Promoter Regions of the Sperm Epigenome

    PubMed Central

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K.

    2010-01-01

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome. PMID:20927350

  5. Epigenetic transgenerational actions of vinclozolin on promoter regions of the sperm epigenome.

    PubMed

    Guerrero-Bosagna, Carlos; Settles, Matthew; Lucker, Ben; Skinner, Michael K

    2010-09-30

    Previous observations have demonstrated that embryonic exposure to the endocrine disruptor vinclozolin during gonadal sex determination promotes transgenerational adult onset disease such as male infertility, kidney disease, prostate disease, immune abnormalities and tumor development. The current study investigates genome-wide promoter DNA methylation alterations in the sperm of F3 generation rats whose F0 generation mother was exposed to vinclozolin. A methylated DNA immunoprecipitation with methyl-cytosine antibody followed by a promoter tilling microarray (MeDIP-Chip) procedure was used to identify 52 different regions with statistically significant altered methylation in the sperm promoter epigenome. Mass spectrometry bisulfite analysis was used to map the CpG DNA methylation and 16 differential DNA methylation regions were confirmed, while the remainder could not be analyzed due to bisulfite technical limitations. Analysis of these validated regions identified a consensus DNA sequence (motif) that associated with 75% of the promoters. Interestingly, only 16.8% of a random set of 125 promoters contained this motif. One candidate promoter (Fam111a) was found to be due to a copy number variation (CNV) and not a methylation change, suggesting initial alterations in the germline epigenome may promote genetic abnormalities such as induced CNV in later generations. This study identifies differential DNA methylation sites in promoter regions three generations after the initial exposure and identifies common genome features present in these regions. In addition to primary epimutations, a potential indirect genetic abnormality was identified, and both are postulated to be involved in the epigenetic transgenerational inheritance observed. This study confirms that an environmental agent has the ability to induce epigenetic transgenerational changes in the sperm epigenome.

  6. MethLAB: a graphical user interface package for the analysis of array-based DNA methylation data.

    PubMed

    Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K; Conneely, Karen N

    2012-03-01

    Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data.

  7. PMA-PhyloChip DNA Microarray to Elucidate Viable Microbial Community Structure

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri J.; Stam, Christina N.; Andersen, Gary L.; DeSantis, Todd

    2011-01-01

    Since the Viking missions in the mid-1970s, traditional culture-based methods have been used for microbial enumeration by various NASA programs. Viable microbes are of particular concern for spacecraft cleanliness, for forward contamination of extraterrestrial bodies (proliferation of microbes), and for crew health/safety (viable pathogenic microbes). However, a "true" estimation of viable microbial population and differentiation from their dead cells using the most sensitive molecular methods is a challenge, because of the stability of DNA from dead cells. The goal of this research is to evaluate a rapid and sensitive microbial detection concept that will selectively estimate viable microbes. Nucleic acid amplification approaches such as the polymerase chain reaction (PCR) have shown promise for reducing time to detection for a wide range of applications. The proposed method is based on the use of a fluorescent DNA intercalating agent, propidium monoazide (PMA), which can only penetrate the membrane of dead cells. The PMA-quenched reaction mixtures can be screened, where only the DNA from live cells will be available for subsequent PCR reaction and microarray detection, and be identified as part of the viable microbial community. An additional advantage of the proposed rapid method is that it will detect viable microbes and differentiate from dead cells in only a few hours, as opposed to less comprehensive culture-based assays, which take days to complete. This novel combination approach is called the PMA-Microarray method. DNA intercalating agents such as PMA have previously been used to selectively distinguish between viable and dead bacterial cells. Once in the cell, the dye intercalates with the DNA and, upon photolysis under visible light, produces stable DNA adducts. DNA cross-linked in this way is unavailable for PCR. Environmental samples suspected of containing a mixture of live and dead microbial cells/spores will be treated with PMA, and then incubated in the dark. Thereafter, the sample is exposed to visible light for five minutes, so that the DNA from dead cells will be cross-linked. Following this PMA treatment step, the sample is concentrated by centrifugation and washed (to remove excessive PMA) before DNA is extracted. The 16S rRNA gene fragments will be amplified by PCR to screen the total microbial community using PhyloChip DNA microarray analysis. This approach will detect only the viable microbial community since the PMA intercalated DNA from dead cells would be unavailable for PCR amplification. The total detection time including PCR reaction for low biomass samples will be a few hours. Numerous markets may use this technology. The food industry uses spore detection to validate new alternative food processing technologies, sterility, and quality. Pharmaceutical and medical equipment companies also detect spores as a marker for sterility. This system can be used for validating sterilization processes, water treatment systems, and in various public health and homeland security applications.

  8. Genomic response to Wnt signalling is highly context-dependent - Evidence from DNA microarray and chromatin immunoprecipitation screens of Wnt/TCF targets

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Railo, Antti; Pajunen, Antti; Itaeranta, Petri

    2009-10-01

    Wnt proteins are important regulators of embryonic development, and dysregulated Wnt signalling is involved in the oncogenesis of several human cancers. Our knowledge of the downstream target genes is limited, however. We used a chromatin immunoprecipitation-based assay to isolate and characterize the actual gene segments through which Wnt-activatable transcription factors, TCFs, regulate transcription and an Affymetrix microarray analysis to study the global transcriptional response to the Wnt3a ligand. The anti-{beta}-catenin immunoprecipitation of DNA-protein complexes from mouse NIH3T3 fibroblasts expressing a fusion protein of {beta}-catenin and TCF7 resulted in the identification of 92 genes as putative TCF targets. GeneChip assays ofmore » gene expression performed on NIH3T3 cells and the rat pheochromocytoma cell line PC12 revealed 355 genes in NIH3T3 and 129 genes in the PC12 cells with marked changes in expression after Wnt3a stimulus. Only 2 Wnt-regulated genes were shared by both cell lines. Surprisingly, Disabled-2 was the only gene identified by the chromatin immunoprecipitation approach that displayed a marked change in expression in the GeneChip assay. Taken together, our approaches give an insight into the complex context-dependent nature of Wnt pathway transcriptional responses and identify Disabled-2 as a potential new direct target for Wnt signalling.« less

  9. Identifying the impact of G-quadruplexes on Affymetrix 3' arrays using cloud computing.

    PubMed

    Memon, Farhat N; Owen, Anne M; Sanchez-Graillet, Olivia; Upton, Graham J G; Harrison, Andrew P

    2010-01-15

    A tetramer quadruplex structure is formed by four parallel strands of DNA/ RNA containing runs of guanine. These quadruplexes are able to form because guanine can Hoogsteen hydrogen bond to other guanines, and a tetrad of guanines can form a stable arrangement. Recently we have discovered that probes on Affymetrix GeneChips that contain runs of guanine do not measure gene expression reliably. We associate this finding with the likelihood that quadruplexes are forming on the surface of GeneChips. In order to cope with the rapidly expanding size of GeneChip array datasets in the public domain, we are exploring the use of cloud computing to replicate our experiments on 3' arrays to look at the effect of the location of G-spots (runs of guanines). Cloud computing is a recently introduced high-performance solution that takes advantage of the computational infrastructure of large organisations such as Amazon and Google. We expect that cloud computing will become widely adopted because it enables bioinformaticians to avoid capital expenditure on expensive computing resources and to only pay a cloud computing provider for what is used. Moreover, as well as financial efficiency, cloud computing is an ecologically-friendly technology, it enables efficient data-sharing and we expect it to be faster for development purposes. Here we propose the advantageous use of cloud computing to perform a large data-mining analysis of public domain 3' arrays.

  10. DNA methylation alterations in response to pesticide exposure in vitro

    PubMed Central

    Zhang, Xiao; Wallace, Andrew D.; Du, Pan; Kibbe, Warren A.; Jafari, Nadereh; Xie, Hehuang; Lin, Simon; Baccarelli, Andrea; Soares, Marcelo Bento; Hou, Lifang

    2013-01-01

    Although pesticides are subject to extensive carcinogenicity testing before regulatory approval, pesticide exposure has repeatedly been associated with various cancers. This suggests that pesticides may cause cancer via non-mutagenicity mechanisms. The present study provides evidence to support the hypothesis that pesticide-induced cancer may be mediated in part by epigenetic mechanisms. We examined whether exposure to 7 commonly used pesticides (i.e., fonofos, parathion, terbufos, chlorpyrifos, diazinon, malathion, and phorate) induces DNA methylation alterations in vitro. We conducted genome-wide DNA methylation analyses on DNA samples obtained from the human hematopoietic K562 cell line exposed to ethanol (control) and several OPs using the Illumina Infinium HumanMethylation27 BeadChip. Bayesian-adjusted t-tests were used to identify differentially methylated gene promoter CpG sites. In this report, we present our results on three pesticides (fonofos, parathion, and terbufos) that clustered together based on principle component analysis and hierarchical clustering. These three pesticides induced similar methylation changes in the promoter regions of 712 genes, while also exhibiting their own OP-specific methylation alterations. Functional analysis of methylation changes specific to each OP, or common to all three OPs, revealed that differential methylation was associated with numerous genes that are involved in carcinogenesis-related processes. Our results provide experimental evidence that pesticides may modify gene promoter DNA methylation levels, suggesting that epigenetic mechanisms may contribute to pesticide-induced carcinogenesis. Further studies in other cell types and human samples are required, as well as determining the impact of these methylation changes on gene expression. PMID:22847954

  11. iTAR: a web server for identifying target genes of transcription factors using ChIP-seq or ChIP-chip data.

    PubMed

    Yang, Chia-Chun; Andrews, Erik H; Chen, Min-Hsuan; Wang, Wan-Yu; Chen, Jeremy J W; Gerstein, Mark; Liu, Chun-Chi; Cheng, Chao

    2016-08-12

    Chromatin immunoprecipitation followed by massively parallel DNA sequencing (ChIP-seq) or microarray hybridization (ChIP-chip) has been widely used to determine the genomic occupation of transcription factors (TFs). We have previously developed a probabilistic method, called TIP (Target Identification from Profiles), to identify TF target genes using ChIP-seq/ChIP-chip data. To achieve high specificity, TIP applies a conservative method to estimate significance of target genes, with the trade-off being a relatively low sensitivity of target gene identification compared to other methods. Additionally, TIP's output does not render binding-peak locations or intensity, information highly useful for visualization and general experimental biological use, while the variability of ChIP-seq/ChIP-chip file formats has made input into TIP more difficult than desired. To improve upon these facets, here we present are fined TIP with key extensions. First, it implements a Gaussian mixture model for p-value estimation, increasing target gene identification sensitivity and more accurately capturing the shape of TF binding profile distributions. Second, it enables the incorporation of TF binding-peak data by identifying their locations in significant target gene promoter regions and quantifies their strengths. Finally, for full ease of implementation we have incorporated it into a web server ( http://syslab3.nchu.edu.tw/iTAR/ ) that enables flexibility of input file format, can be used across multiple species and genome assembly versions, and is freely available for public use. The web server additionally performs GO enrichment analysis for the identified target genes to reveal the potential function of the corresponding TF. The iTAR web server provides a user-friendly interface and supports target gene identification in seven species, ranging from yeast to human. To facilitate investigating the quality of ChIP-seq/ChIP-chip data, the web server generates the chart of the characteristic binding profiles and the density plot of normalized regulatory scores. The iTAR web server is a useful tool in identifying TF target genes from ChIP-seq/ChIP-chip data and discovering biological insights.

  12. DNA MemoChip: Long-Term and High Capacity Information Storage and Select Retrieval.

    PubMed

    Stefano, George B; Wang, Fuzhou; Kream, Richard M

    2018-02-26

    Over the course of history, human beings have never stopped seeking effective methods for information storage. From rocks to paper, and through the past several decades of using computer disks, USB sticks, and on to the thin silicon "chips" and "cloud" storage of today, it would seem that we have reached an era of efficiency for managing innumerable and ever-expanding data. Astonishingly, when tracing this technological path, one realizes that our ancient methods of informational storage far outlast paper (10,000 vs. 1,000 years, respectively), let alone the computer-based memory devices that only last, on average, 5 to 25 years. During this time of fast-paced information generation, it becomes increasingly difficult for current storage methods to retain such massive amounts of data, and to maintain appropriate speeds with which to retrieve it, especially when in demand by a large number of users. Others have proposed that DNA-based information storage provides a way forward for information retention as a result of its temporal stability. It is now evident that DNA represents a potentially economical and sustainable mechanism for storing information, as demonstrated by its decoding from a 700,000 year-old horse genome. The fact that the human genome is present in a cell, containing also the varied mitochondrial genome, indicates DNA's great potential for large data storage in a 'smaller' space.

  13. Multiplexed ChIP-Seq Using Direct Nucleosome Barcoding: A Tool for High-Throughput Chromatin Analysis.

    PubMed

    Chabbert, Christophe D; Adjalley, Sophie H; Steinmetz, Lars M; Pelechano, Vicent

    2018-01-01

    Chromatin immunoprecipitation followed by sequencing (ChIP-Seq) or microarray hybridization (ChIP-on-chip) are standard methods for the study of transcription factor binding sites and histone chemical modifications. However, these approaches only allow profiling of a single factor or protein modification at a time.In this chapter, we present Bar-ChIP, a higher throughput version of ChIP-Seq that relies on the direct ligation of molecular barcodes to chromatin fragments. Bar-ChIP enables the concurrent profiling of multiple DNA-protein interactions and is therefore amenable to experimental scale-up, without the need for any robotic instrumentation.

  14. Enhancing Results of Microarray Hybridizations Through Microagitation

    PubMed Central

    Toegl, Andreas; Kirchner, Roland; Gauer, Christoph; Wixforth, Achim

    2003-01-01

    Protein and DNA microarrays have become a standard tool in proteomics/genomics research. In order to guarantee fast and reproducible hybridization results, the diffusion limit must be overcome. Surface acoustic wave (SAW) micro-agitation chips efficiently agitate the smallest sample volumes (down to 10 μL and below) without introducing any dead volume. The advantages are reduced reaction time, increased signal-to-noise ratio, improved homogeneity across the microarray, and better slide-to-slide reproducibility. The SAW micromixer chips are the heart of the Advalytix ArrayBooster, which is compatible with all microarrays based on the microscope slide format. PMID:13678150

  15. Precision-cut tissue chips as an in vitro toxicology system

    PubMed Central

    Catania, J. M.; Pershing, A. M.; Gandolfi, A. J.

    2007-01-01

    Precision-cut tissue slices mimic specific organ toxicity because normal cellular heterogeneity and organ architecture are retained. To optimize the use of the smaller tissues of the mouse and to establish easy assays for tissue viability, a tissue chip based system was used to generate large numbers of samples from a single organ. Iodoacetamide (IAM), was used as a model toxicant, and assays for intracellular potassium (normalized to DNA content) were used to establish viability and toxicant susceptibility. Thereafter, assays that were more rapid and specific were pursued. Lysates from tissues incubated in 6-carboxyfluorescein fluoresced proportionately to concentrations of IAM, indicating disruption of cellular membranes. Similarly, FURA-2, a probe applied to lysates to measure calcium levels, fluoresced proportionately to IAM dosage. Monobromobimane, a fluorescent sulfhydryl probe, displayed a decrease in fluorescent intensity at higher IAM challenge; a finding confirmed with an absorbance assay with Ellman’s reagent. Importantly, the number of samples per organ/mouse was increased at least 3-fold and a significant time reduction per analysis was realized. PMID:17376647

  16. Advances in Testing Techniques for Digital Microfluidic Biochips

    PubMed Central

    Shukla, Vineeta; Hussin, Fawnizu Azmadi; Hamid, Nor Hisham; Zain Ali, Noohul Basheer

    2017-01-01

    With the advancement of digital microfluidics technology, applications such as on-chip DNA analysis, point of care diagnosis and automated drug discovery are common nowadays. The use of Digital Microfluidics Biochips (DMFBs) in disease assessment and recognition of target molecules had become popular during the past few years. The reliability of these DMFBs is crucial when they are used in various medical applications. Errors found in these biochips are mainly due to the defects developed during droplet manipulation, chip degradation and inaccuracies in the bio-assay experiments. The recently proposed Micro-electrode-dot Array (MEDA)-based DMFBs involve both fluidic and electronic domains in the micro-electrode cell. Thus, the testing techniques for these biochips should be revised in order to ensure proper functionality. This paper describes recent advances in the testing technologies for digital microfluidics biochips, which would serve as a useful platform for developing revised/new testing techniques for MEDA-based biochips. Therefore, the relevancy of these techniques with respect to testing of MEDA-based biochips is analyzed in order to exploit the full potential of these biochips. PMID:28749411

  17. ChIP-Chip Identifies SEC23A, CFDP1, and NSD1 as TFII-I Target Genes in Human Neural Crest Progenitor Cells.

    PubMed

    Makeyev, Aleksandr V; Bayarsaihan, Dashzeveg

    2013-05-01

    Objectives :  GTF2I and GTF2IRD1 genes located in Williams-Beuren syndrome (WBS) critical region encode TFII-I family transcription factors. The aim of this study was to map genomic sites bound by these proteins across promoter regions of developmental regulators associated with craniofacial development. Design :  Chromatin was isolated from human neural crest progenitor cells and the DNA-binding profile was generated using the human RefSeq tiling promoter ChIP-chip arrays. Results :  TFII-I transcription factors are recruited to the promoters of SEC23A, CFDP1, and NSD1 previously defined as TFII-I target genes. Moreover, our analysis revealed additional binding elements that contain E-boxes and initiator-like motifs. Conclusions :  Genome-wide promoter binding studies revealed SEC23A, CFDP1, and NSD1 linked to craniofacial or dental development as direct TFII-I targets. Developmental regulation of these genes by TFII-I factors could contribute to the WBS-specific facial dysmorphism.

  18. Advances in Testing Techniques for Digital Microfluidic Biochips.

    PubMed

    Shukla, Vineeta; Hussin, Fawnizu Azmadi; Hamid, Nor Hisham; Zain Ali, Noohul Basheer

    2017-07-27

    With the advancement of digital microfluidics technology, applications such as on-chip DNA analysis, point of care diagnosis and automated drug discovery are common nowadays. The use of Digital Microfluidics Biochips (DMFBs) in disease assessment and recognition of target molecules had become popular during the past few years. The reliability of these DMFBs is crucial when they are used in various medical applications. Errors found in these biochips are mainly due to the defects developed during droplet manipulation, chip degradation and inaccuracies in the bio-assay experiments. The recently proposed Micro-electrode-dot Array (MEDA)-based DMFBs involve both fluidic and electronic domains in the micro-electrode cell. Thus, the testing techniques for these biochips should be revised in order to ensure proper functionality. This paper describes recent advances in the testing technologies for digital microfluidics biochips, which would serve as a useful platform for developing revised/new testing techniques for MEDA-based biochips. Therefore, the relevancy of these techniques with respect to testing of MEDA-based biochips is analyzed in order to exploit the full potential of these biochips.

  19. Microarray-Based Analysis of Methylation of 1st Trimester Trisomic Placentas from Down Syndrome, Edwards Syndrome and Patau Syndrome.

    PubMed

    Hatt, Lotte; Aagaard, Mads M; Bach, Cathrine; Graakjaer, Jesper; Sommer, Steffen; Agerholm, Inge E; Kølvraa, Steen; Bojesen, Anders

    2016-01-01

    Methylation-based non-invasive prenatal testing of fetal aneuploidies is an alternative method that could possibly improve fetal aneuploidy diagnosis, especially for trisomy 13(T13) and trisomy 18(T18). Our aim was to study the methylation landscape in placenta DNA from trisomy 13, 18 and 21 pregnancies in an attempt to find trisomy-specific methylation differences better suited for non-invasive prenatal diagnosis. We have conducted high-resolution methylation specific bead chip microarray analyses assessing more than 450,000 CpGs analyzing placentas from 12 T21 pregnancies, 12 T18 pregnancies and 6 T13 pregnancies. We have compared the methylation landscape of the trisomic placentas to the methylation landscape from normal placental DNA and to maternal blood cell DNA. Comparing trisomic placentas to normal placentas we identified 217 and 219 differentially methylated CpGs for CVS T18 and CVS T13, respectively (delta β>0.2, FDR<0.05), but only three differentially methylated CpGs for T21. However, the methylation differences was only modest (delta β<0.4), making them less suitable as diagnostic markers. Gene ontology enrichment analysis revealed that the gene set connected to theT18 differentially methylated CpGs was highly enriched for GO terms related to"DNA binding" and "transcription factor binding" coupled to the RNA polymerase II transcription. In the gene set connected to the T13 differentially methylated CpGs we found no significant enrichments.

  20. Microarray-Based Analysis of Methylation of 1st Trimester Trisomic Placentas from Down Syndrome, Edwards Syndrome and Patau Syndrome

    PubMed Central

    Hatt, Lotte; Aagaard, Mads M.; Bach, Cathrine; Graakjaer, Jesper; Sommer, Steffen; Agerholm, Inge E.; Bojesen, Anders

    2016-01-01

    Methylation-based non-invasive prenatal testing of fetal aneuploidies is an alternative method that could possibly improve fetal aneuploidy diagnosis, especially for trisomy 13(T13) and trisomy 18(T18). Our aim was to study the methylation landscape in placenta DNA from trisomy 13, 18 and 21 pregnancies in an attempt to find trisomy–specific methylation differences better suited for non-invasive prenatal diagnosis. We have conducted high-resolution methylation specific bead chip microarray analyses assessing more than 450,000 CpGs analyzing placentas from 12 T21 pregnancies, 12 T18 pregnancies and 6 T13 pregnancies. We have compared the methylation landscape of the trisomic placentas to the methylation landscape from normal placental DNA and to maternal blood cell DNA. Comparing trisomic placentas to normal placentas we identified 217 and 219 differentially methylated CpGs for CVS T18 and CVS T13, respectively (delta β>0.2, FDR<0.05), but only three differentially methylated CpGs for T21. However, the methylation differences was only modest (delta β<0.4), making them less suitable as diagnostic markers. Gene ontology enrichment analysis revealed that the gene set connected to theT18 differentially methylated CpGs was highly enriched for GO terms related to”DNA binding” and “transcription factor binding” coupled to the RNA polymerase II transcription. In the gene set connected to the T13 differentially methylated CpGs we found no significant enrichments. PMID:27490343

  1. Sequence information signal processor for local and global string comparisons

    DOEpatents

    Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

    1997-01-01

    A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

  2. High-throughput screening platform for engineered nanoparticle-mediated genotoxicity using CometChip technology.

    PubMed

    Watson, Christa; Ge, Jing; Cohen, Joel; Pyrgiotakis, Georgios; Engelward, Bevin P; Demokritou, Philip

    2014-03-25

    The likelihood of intentional and unintentional engineered nanoparticle (ENP) exposure has dramatically increased due to the use of nanoenabled products. Indeed, ENPs have been incorporated in many useful products and have enhanced our way of life. However, there are many unanswered questions about the consequences of nanoparticle exposures, in particular, with regard to their potential to damage the genome and thus potentially promote cancer. In this study, we present a high-throughput screening assay based upon the recently developed CometChip technology, which enables evaluation of single-stranded DNA breaks, abasic sites, and alkali-sensitive sites in cells exposed to ENPs. The strategic microfabricated, 96-well design and automated processing improves efficiency, reduces processing time, and suppresses user bias in comparison to the standard comet assay. We evaluated the versatility of this assay by screening five industrially relevant ENP exposures (SiO2, ZnO, Fe2O3, Ag, and CeO2) on both suspension human lymphoblastoid (TK6) and adherent Chinese hamster ovary (H9T3) cell lines. MTT and CyQuant NF assays were employed to assess cellular viability and proliferation after ENP exposure. Exposure to ENPs at a dose range of 5, 10, and 20 μg/mL induced dose-dependent increases in DNA damage and cytotoxicity. Genotoxicity profiles of ZnO>Ag>Fe2O3>CeO2>SiO2 in TK6 cells at 4 h and Ag>Fe2O3>ZnO>CeO2>SiO2 in H9T3 cells at 24 h were observed. The presented CometChip platform enabled efficient and reliable measurement of ENP-mediated DNA damage, therefore demonstrating the efficacy of this powerful tool in nanogenotoxicity studies.

  3. Plasma epidermal growth factor receptor mutation testing with a chip-based digital PCR system in patients with advanced non-small cell lung cancer.

    PubMed

    Kasahara, Norimitsu; Kenmotsu, Hirotsugu; Serizawa, Masakuni; Umehara, Rina; Ono, Akira; Hisamatsu, Yasushi; Wakuda, Kazushige; Omori, Shota; Nakashima, Kazuhisa; Taira, Tetsuhiko; Naito, Tateaki; Murakami, Haruyasu; Koh, Yasuhiro; Mori, Keita; Endo, Masahiro; Nakajima, Takashi; Yamada, Masanobu; Kusuhara, Masatoshi; Takahashi, Toshiaki

    2017-04-01

    Epidermal growth factor receptor (EGFR) mutation testing is a companion diagnostic to determine eligibility for treatment with EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small cell lung cancer (NSCLC). Recently, plasma-based EGFR testing by digital polymerase chain reaction (dPCR), which enables accurate quantification of target DNA, has shown promise as a minimally invasive diagnostic. Here, we aimed to evaluate the accuracy of a plasma-based EGFR mutation test developed using chip-based dPCR-based detection of 3 EGFR mutations (exon 19 deletions, L858R in exon 21, and T790M in exon 20). Forty-nine patients with NSCLC harboring EGFR-activating mutations were enrolled, and circulating free DNAs (cfDNAs) were extracted from the plasma of 21 and 28 patients before treatment and after progression following EGFR-TKI treatment, respectively. Using reference genomic DNA containing each mutation, the detection limit of each assay was determined to be 0.1%. The sensitivity and specificity of detecting exon 19 deletions and L858R mutations, calculated by comparing the mutation status in the corresponding tumors, were 70.6% and 93.3%, and 66.7% and 100%, respectively, showing similar results compared with previous studies. T790M was detected in 43% of 28 cfDNAs after progression with EGFR-TKI treatment, but in no cfDNAs before the start of the treatment. This chip-based dPCR assay can facilitate detection of EGFR mutations in cfDNA as a minimally invasive method in clinical settings. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. A Digitally Programmable Cytomorphic Chip for Simulation of Arbitrary Biochemical Reaction Networks.

    PubMed

    Woo, Sung Sik; Kim, Jaewook; Sarpeshkar, Rahul

    2018-04-01

    Prior work has shown that compact analog circuits can faithfully represent and model fundamental biomolecular circuits via efficient log-domain cytomorphic transistor equivalents. Such circuits have emphasized basis functions that are dominant in genetic transcription and translation networks and deoxyribonucleic acid (DNA)-protein binding. Here, we report a system featuring digitally programmable 0.35 μm BiCMOS analog cytomorphic chips that enable arbitrary biochemical reaction networks to be exactly represented thus enabling compact and easy composition of protein networks as well. Since all biomolecular networks can be represented as chemical reaction networks, our protein networks also include the former genetic network circuits as a special case. The cytomorphic analog protein circuits use one fundamental association-dissociation-degradation building-block circuit that can be configured digitally to exactly represent any zeroth-, first-, and second-order reaction including loading, dynamics, nonlinearity, and interactions with other building-block circuits. To address a divergence issue caused by random variations in chip fabrication processes, we propose a unique way of performing computation based on total variables and conservation laws, which we instantiate at both the circuit and network levels. Thus, scalable systems that operate with finite error over infinite time can be built. We show how the building-block circuits can be composed to form various network topologies, such as cascade, fan-out, fan-in, loop, dimerization, or arbitrary networks using total variables. We demonstrate results from a system that combines interacting cytomorphic chips to simulate a cancer pathway and a glycolysis pathway. Both simulations are consistent with conventional software simulations. Our highly parallel digitally programmable analog cytomorphic systems can lead to a useful design, analysis, and simulation tool for studying arbitrary large-scale biological networks in systems and synthetic biology.

  5. Fully solution-processed organic light-emitting electrochemical cells (OLEC) with inkjet-printed micro-lenses for disposable lab-on-chip applications at ambient conditions

    NASA Astrophysics Data System (ADS)

    Shu, Zhe; Pabst, Oliver; Beckert, Erik; Eberhardt, Ramona; Tünnermann, Andreas

    2016-02-01

    Microfluidic lab-on-chip devices can be used for chemical and biological analyses such as DNA tests or environmental monitoring. Such devices integrate most of the basic functionalities needed for scientific analysis on a microfluidic chip. When using such devices, cost and space-intensive lab equipment is no longer necessary. However, in order to make a monolithic and cost-efficient/disposable microfluidic sensing device, direct integration of the excitation light source for fluorescent sensing is often required. To achieve this, we introduce a fully solution processable deviation of OLEDs, organic light-emitting electrochemical cells (OLECs), as a low-cost excitation light source for a disposable microfluidic sensing platform. By mixing metal ions and a solid electrolyte with light-emitting polymers as active materials, an in-situ doping and in-situ PN-junction can be generated within a three layer sandwich device. Thanks to this doping effect, work function adaptation is not necessary and air-stable electrode can be used. An ambient manufacturing process for fully solution-processed OLECs is presented, which consist of a spin-coated blue light-emitting polymer plus dopants on an ITO cathode and an inkjet-printed PEDOT:PSS transparent top anode. A fully transparent blue OLEC is able to obtain light intensity > 2500 cd/m2 under pulsed driving mode and maintain stable after 1000 cycles, which fulfils requirements for simple fluorescent on-chip sensing applications. However, because of the large refractive index difference between substrates and air, about 80% of emitted light is trapped inside the device. Therefore, inkjet printed micro-lenses on the rear side are introduced here to further increase light-emitting brightness.

  6. Examining rare and low-frequency genetic variants previously associated with lone or familial forms of atrial fibrillation in an electronic medical record system: a cautionary note.

    PubMed

    Weeke, Peter; Denny, Joshua C; Basterache, Lisa; Shaffer, Christian; Bowton, Erica; Ingram, Christie; Darbar, Dawood; Roden, Dan M

    2015-02-01

    Studies in individuals or small kindreds have implicated rare variants in 25 different genes in lone and familial atrial fibrillation (AF) using linkage and segregation analysis, functional characterization, and rarity in public databases. Here, we used a cohort of 20 204 patients of European or African ancestry with electronic medical records and exome chip data to compare the frequency of AF among carriers and noncarriers of these rare variants. The exome chip included 19 of 115 rare variants, in 9 genes, previously associated with lone or familial AF. Using validated algorithms querying a combination of clinical notes, structured billing codes, ECG reports, and procedure codes, we identified 1056 AF cases (>18 years) and 19 148 non-AF controls (>50 years) with available genotype data on the Illumina HumanExome BeadChip v.1.0 in the Vanderbilt electronic medical record-linked DNA repository, BioVU. Known correlations between AF and common variants at 4q25 were replicated. None of the 19 variants previously associated with AF were over-represented among AF cases (P>0.1 for all), and the frequency of variant carriers among non-AF controls was >0.1% for 14 of 19. Repeat analyses using non-AF controls aged >60 (n=14 904), >70 (n=9670), and >80 (n=4729) years did not influence these findings. Rare variants previously implicated in lone or familial forms of AF present on the exome chip are detected at low frequencies in a general population but are not associated with AF. These findings emphasize the need for caution when ascribing variants as pathogenic or causative. © 2014 American Heart Association, Inc.

  7. Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.)

    PubMed Central

    2012-01-01

    Background High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). Results We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. Conclusion By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously. PMID:22583801

  8. Development and application of a 6.5 million feature Affymetrix Genechip® for massively parallel discovery of single position polymorphisms in lettuce (Lactuca spp.).

    PubMed

    Stoffel, Kevin; van Leeuwen, Hans; Kozik, Alexander; Caldwell, David; Ashrafi, Hamid; Cui, Xinping; Tan, Xiaoping; Hill, Theresa; Reyes-Chin-Wo, Sebastian; Truco, Maria-Jose; Michelmore, Richard W; Van Deynze, Allen

    2012-05-14

    High-resolution genetic maps are needed in many crops to help characterize the genetic diversity that determines agriculturally important traits. Hybridization to microarrays to detect single feature polymorphisms is a powerful technique for marker discovery and genotyping because of its highly parallel nature. However, microarrays designed for gene expression analysis rarely provide sufficient gene coverage for optimal detection of nucleotide polymorphisms, which limits utility in species with low rates of polymorphism such as lettuce (Lactuca sativa). We developed a 6.5 million feature Affymetrix GeneChip® for efficient polymorphism discovery and genotyping, as well as for analysis of gene expression in lettuce. Probes on the microarray were designed from 26,809 unigenes from cultivated lettuce and an additional 8,819 unigenes from four related species (L. serriola, L. saligna, L. virosa and L. perennis). Where possible, probes were tiled with a 2 bp stagger, alternating on each DNA strand; providing an average of 187 probes covering approximately 600 bp for each of over 35,000 unigenes; resulting in up to 13 fold redundancy in coverage per nucleotide. We developed protocols for hybridization of genomic DNA to the GeneChip® and refined custom algorithms that utilized coverage from multiple, high quality probes to detect single position polymorphisms in 2 bp sliding windows across each unigene. This allowed us to detect greater than 18,000 polymorphisms between the parental lines of our core mapping population, as well as numerous polymorphisms between cultivated lettuce and wild species in the lettuce genepool. Using marker data from our diversity panel comprised of 52 accessions from the five species listed above, we were able to separate accessions by species using both phylogenetic and principal component analyses. Additionally, we estimated the diversity between different types of cultivated lettuce and distinguished morphological types. By hybridizing genomic DNA to a custom oligonucleotide array designed for maximum gene coverage, we were able to identify polymorphisms using two approaches for pair-wise comparisons, as well as a highly parallel method that compared all 52 genotypes simultaneously.

  9. Microfluidic Exosome Analysis toward Liquid Biopsy for Cancer.

    PubMed

    He, Mei; Zeng, Yong

    2016-08-01

    Assessment of a tumor's molecular makeup using biofluid samples, known as liquid biopsy, is a prominent research topic in precision medicine for cancer, due to its noninvasive property allowing repeat sampling for monitoring molecular changes of tumors over time. Circulating exosomes recently have been recognized as promising tumor surrogates because they deliver enriched biomarkers, such as proteins, RNAs, and DNA. However, purification and characterization of these exosomes are technically challenging. Microfluidic lab-on-a-chip technology effectively addresses these challenges owing to its inherent advantages in integration and automation of multiple functional modules, enhancing sensing performance, and expediting analysis processes. In this article, we review the state-of-the-art development of microfluidic technologies for exosome isolation and molecular characterization with emphasis on their applications toward liquid biopsy-based analysis of cancer. Finally, we share our perspectives on current challenges and future directions of microfluidic exosome analysis. © 2016 Society for Laboratory Automation and Screening.

  10. Fabrication and characterization of SPR chips with the modified bovine serum albumin

    NASA Astrophysics Data System (ADS)

    Chen, Xing; Zhang, Lu-lu; Cui, Da-fu

    2016-03-01

    A facile surface plasmon resonance (SPR) chip is developed for small molecule determination and analysis. The SPR chip was prepared based on a self assembling principle, in which the modified bovine serum albumin (BSA) was directly self-assembled onto the bare gold surface. The surface morphology of the chip with the modified BSA was investigated by atomic force microscopy (AFM) and its optical properties were characterized. The surface binding capacity of the bare facile SPR chip with a uniform morphology is 8 times of that of the bare control SPR chip. Based on the experiments of immune reaction between cortisol antibody and cortisol derivative, the sensitivity of the facile SPR chip with the modified BSA is much higher than that of the control SPR chip with the un-modified BSA. The facile SPR chip has been successfully used to detect small molecules. The lowest detection limit is 5 ng/mL with a linear range of 5—100 ng/mL for cortisol analysis. The novel facile SPR chip can also be applied to detect other small molecules.

  11. Electrophoretic and field-effect graphene for all-electrical DNA array technology.

    PubMed

    Xu, Guangyu; Abbott, Jeffrey; Qin, Ling; Yeung, Kitty Y M; Song, Yi; Yoon, Hosang; Kong, Jing; Ham, Donhee

    2014-09-05

    Field-effect transistor biomolecular sensors based on low-dimensional nanomaterials boast sensitivity, label-free operation and chip-scale construction. Chemical vapour deposition graphene is especially well suited for multiplexed electronic DNA array applications, since its large two-dimensional morphology readily lends itself to top-down fabrication of transistor arrays. Nonetheless, graphene field-effect transistor DNA sensors have been studied mainly at single-device level. Here we create, from chemical vapour deposition graphene, field-effect transistor arrays with two features representing steps towards multiplexed DNA arrays. First, a robust array yield--seven out of eight transistors--is achieved with a 100-fM sensitivity, on par with optical DNA microarrays and at least 10 times higher than prior chemical vapour deposition graphene transistor DNA sensors. Second, each graphene acts as an electrophoretic electrode for site-specific probe DNA immobilization, and performs subsequent site-specific detection of target DNA as a field-effect transistor. The use of graphene as both electrode and transistor suggests a path towards all-electrical multiplexed graphene DNA arrays.

  12. AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

    EPA Science Inventory

    A workshop attended by approximately 60 scientists from around the world met to discuss the application of new molecular biology tools to issues in environmental toxicology and chemistry. With the sequencing of the human genome, development of microarrays and DNA chips, and devel...

  13. A Decade of Boon or Burden: What Has the CHIP Ever Done for Cellular Protein Quality Control Mechanism Implicated in Neurodegeneration and Aging?

    PubMed Central

    Joshi, Vibhuti; Amanullah, Ayeman; Upadhyay, Arun; Mishra, Ribhav; Kumar, Amit; Mishra, Amit

    2016-01-01

    Cells regularly synthesize new proteins to replace old and abnormal proteins for normal cellular functions. Two significant protein quality control pathways inside the cellular milieu are ubiquitin proteasome system (UPS) and autophagy. Autophagy is known for bulk clearance of cytoplasmic aggregated proteins, whereas the specificity of protein degradation by UPS comes from E3 ubiquitin ligases. Few E3 ubiquitin ligases, like C-terminus of Hsc70-interacting protein (CHIP) not only take part in protein quality control pathways, but also plays a key regulatory role in other cellular processes like signaling, development, DNA damage repair, immunity and aging. CHIP targets misfolded proteins for their degradation through proteasome, as well as autophagy; simultaneously, with the help of chaperones, it also regulates folding attempts for misfolded proteins. The broad range of CHIP substrates and their associations with multiple pathologies make it a key molecule to work upon and focus for future therapeutic interventions. E3 ubiquitin ligase CHIP interacts and degrades many protein inclusions formed in neurodegenerative diseases. The presence of CHIP at various nodes of cellular protein-protein interaction network presents this molecule as a potential candidate for further research. In this review, we have explored a wide range of functionality of CHIP inside cells by a detailed presentation of its co-chaperone, E3 and E4 enzyme like functions, with central focus on its protein quality control roles in neurodegenerative diseases. We have also raised many unexplored but expected fundamental questions regarding CHIP functions, which generate hopes for its future applications in research, as well as drug discovery. PMID:27757073

  14. Cloning and characterization of carboxyl terminus of heat shock cognate 70-interacting protein gene from the silkworm, Bombyx mori.

    PubMed

    Ohsawa, Takeshi; Fujimoto, Shota; Tsunakawa, Akane; Shibano, Yuka; Kawasaki, Hideki; Iwanaga, Masashi

    2016-11-01

    Carboxyl terminus of heat shock cognate 70-interacting protein (CHIP) is an evolutionarily conserved E3 ubiquitin ligase across different eukaryotic species and is known to play a key role in protein quality control. CHIP has two distinct functional domains, an N-terminal tetratricopeptide repeat (TPR) and a C-terminal U-box domain, which are required for the ubiquitination of numerous labile client proteins that are chaperoned by heat shock proteins (HSPs) and heat shock cognate proteins (HSCs). During our screen for CHIP-like proteins in the Bombyx mori databases, we found a novel silkworm gene, Bombyx mori CHIP. Phylogenetic analysis showed that BmCHIP belongs to Lepidopteran lineages. Quantitative reverse transcription-PCR analysis indicated that BmCHIP was relatively highly expressed in the gonad and fat body. A pull-down experiment and auto-ubiquitination assay showed that BmCHIP interacted with BmHSC70 and had E3 ligase activity. Additionally, immunohistochemical analysis revealed that BmCHIP was partially co-localized with ubiquitin in BmN4 cells. These data support that BmCHIP plays an important role in the ubiquitin proteasome system as an E3 ubiquitin ligase in B. mori. Copyright © 2016 Elsevier Inc. All rights reserved.

  15. The Pluripotent Stem-Cell Marker Alkaline Phosphatase is Highly Expressed in Refractory Glioblastoma with DNA Hypomethylation.

    PubMed

    Iwadate, Yasuo; Suganami, Akiko; Tamura, Yutaka; Matsutani, Tomoo; Hirono, Seiichiro; Shinozaki, Natsuki; Hiwasa, Takaki; Takiguchi, Masaki; Saeki, Naokatsu

    2017-02-01

    Hypomethylation of genomic DNA induces stem-cell properties in cancer cells and contributes to the treatment resistance of various malignancies. To examine the correlation between the methylation status of stem-cell-related genes and the treatment outcomes in patients with glioblastoma (GBM). The genome-wide DNA methylation status was determined using HumanMethylation450 BeadChips, and the methylation status was compared between a group of patients with good prognosis (survival > 4 yr) and a group with poor prognosis (survival < 1 yr). Immunohistochemistry for proteins translated from hypomethylated genes, including alkaline phosphatase (ALPL), CD133, and CD44, was performed in 70 GBMs and 60 oligodendroglial tumors. The genomic DNA in refractory GBM was more hypomethylated than in GBM from patients with relatively long survival (P = .0111). Stem-cell-related genes including ALPL, CD133, and CD44 were also significantly hypomethylated. A validation study using immunohistochemistry showed that DNA hypomethylation was strongly correlated with high protein expression of ALPL, CD133, and CD44. GBM patients with short survival showed high expression of these stem-cell markers. Multivariate analysis confirmed that co-expression of ALPL + CD133 or ALPL + CD44 was a strong predictor of short survival. Anaplastic oligodendroglial tumors without isocitrate dehydrogenase 1 mutation were significantly correlated with high ALPL expression and poor survival. Accumulation of stem-cell properties due to aberrant DNA hypomethylation is associated with the refractory nature of GBM. Copyright © 2017 by the Congress of Neurological Surgeons

  16. Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes.

    PubMed

    Fredlake, Christopher P; Hert, Daniel G; Kan, Cheuk-Wai; Chiesl, Thomas N; Root, Brian E; Forster, Ryan E; Barron, Annelise E

    2008-01-15

    To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require approximately 70 min to deliver approximately 650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered "hybrid" mechanism of DNA electromigration, in which DNA molecules alternate rapidly between repeating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs.

  17. Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes

    PubMed Central

    Fredlake, Christopher P.; Hert, Daniel G.; Kan, Cheuk-Wai; Chiesl, Thomas N.; Root, Brian E.; Forster, Ryan E.; Barron, Annelise E.

    2008-01-01

    To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require ≈70 min to deliver ≈650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered “hybrid” mechanism of DNA electromigration, in which DNA molecules alternate rapidly between reptating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs. PMID:18184818

  18. Proteomics to study DNA-bound and chromatin-associated gene regulatory complexes

    PubMed Central

    Wierer, Michael; Mann, Matthias

    2016-01-01

    High-resolution mass spectrometry (MS)-based proteomics is a powerful method for the identification of soluble protein complexes and large-scale affinity purification screens can decode entire protein interaction networks. In contrast, protein complexes residing on chromatin have been much more challenging, because they are difficult to purify and often of very low abundance. However, this is changing due to recent methodological and technological advances in proteomics. Proteins interacting with chromatin marks can directly be identified by pulldowns with synthesized histone tails containing posttranslational modifications (PTMs). Similarly, pulldowns with DNA baits harbouring single nucleotide polymorphisms or DNA modifications reveal the impact of those DNA alterations on the recruitment of transcription factors. Accurate quantitation – either isotope-based or label free – unambiguously pinpoints proteins that are significantly enriched over control pulldowns. In addition, protocols that combine classical chromatin immunoprecipitation (ChIP) methods with mass spectrometry (ChIP-MS) target gene regulatory complexes in their in-vivo context. Similar to classical ChIP, cells are crosslinked with formaldehyde and chromatin sheared by sonication or nuclease digested. ChIP-MS baits can be proteins in tagged or endogenous form, histone PTMs, or lncRNAs. Locus-specific ChIP-MS methods would allow direct purification of a single genomic locus and the proteins associated with it. There, loci can be targeted either by artificial DNA-binding sites and corresponding binding proteins or via proteins with sequence specificity such as TAL or nuclease deficient Cas9 in combination with a specific guide RNA. We predict that advances in MS technology will soon make such approaches generally applicable tools in epigenetics. PMID:27402878

  19. A Microwell-Printing Fabrication Strategy for the On-Chip Templated Biosynthesis of Protein Microarrays for Surface Plasmon Resonance Imaging

    PubMed Central

    Manuel, Gerald; Lupták, Andrej; Corn, Robert M.

    2017-01-01

    A two-step templated, ribosomal biosynthesis/printing method for the fabrication of protein microarrays for surface plasmon resonance imaging (SPRI) measurements is demonstrated. In the first step, a sixteen component microarray of proteins is created in microwells by cell free on chip protein synthesis; each microwell contains both an in vitro transcription and translation (IVTT) solution and 350 femtomoles of a specific DNA template sequence that together are used to create approximately 40 picomoles of a specific hexahistidine-tagged protein. In the second step, the protein microwell array is used to contact print one or more protein microarrays onto nitrilotriacetic acid (NTA)-functionalized gold thin film SPRI chips for real-time SPRI surface bioaffinity adsorption measurements. Even though each microwell array element only contains approximately 40 picomoles of protein, the concentration is sufficiently high for the efficient bioaffinity adsorption and capture of the approximately 100 femtomoles of hexahistidine-tagged protein required to create each SPRI microarray element. As a first example, the protein biosynthesis process is verified with fluorescence imaging measurements of a microwell array containing His-tagged green fluorescent protein (GFP), yellow fluorescent protein (YFP) and mCherry (RFP), and then the fidelity of SPRI chips printed from this protein microwell array is ascertained by measuring the real-time adsorption of various antibodies specific to these three structurally related proteins. This greatly simplified two-step synthesis/printing fabrication methodology eliminates most of the handling, purification and processing steps normally required in the synthesis of multiple protein probes, and enables the rapid fabrication of SPRI protein microarrays from DNA templates for the study of protein-protein bioaffinity interactions. PMID:28706572

  20. Genetic identification of missing persons: DNA analysis of human remains and compromised samples.

    PubMed

    Alvarez-Cubero, M J; Saiz, M; Martinez-Gonzalez, L J; Alvarez, J C; Eisenberg, A J; Budowle, B; Lorente, J A

    2012-01-01

    Human identification has made great strides over the past 2 decades due to the advent of DNA typing. Forensic DNA typing provides genetic data from a variety of materials and individuals, and is applied to many important issues that confront society. Part of the success of DNA typing is the generation of DNA databases to help identify missing persons and to develop investigative leads to assist law enforcement. DNA databases house DNA profiles from convicted felons (and in some jurisdictions arrestees), forensic evidence, human remains, and direct and family reference samples of missing persons. These databases are essential tools, which are becoming quite large (for example the US Database contains 10 million profiles). The scientific, governmental and private communities continue to work together to standardize genetic markers for more effective worldwide data sharing, to develop and validate robust DNA typing kits that contain the reagents necessary to type core identity genetic markers, to develop technologies that facilitate a number of analytical processes and to develop policies to make human identity testing more effective. Indeed, DNA typing is integral to resolving a number of serious criminal and civil concerns, such as solving missing person cases and identifying victims of mass disasters and children who may have been victims of human trafficking, and provides information for historical studies. As more refined capabilities are still required, novel approaches are being sought, such as genetic testing by next-generation sequencing, mass spectrometry, chip arrays and pyrosequencing. Single nucleotide polymorphisms offer the potential to analyze severely compromised biological samples, to determine the facial phenotype of decomposed human remains and to predict the bioancestry of individuals, a new focus in analyzing this type of markers. Copyright © 2012 S. Karger AG, Basel.

  1. Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

    PubMed Central

    Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

    2002-01-01

    For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

  2. Lab-on-a-chip enabled HLA diagnostic: combined sample preparation and real time PCR for HLA-B57 diagnosis

    NASA Astrophysics Data System (ADS)

    Gärtner, Claudia; Becker, Holger; Hlawatsch, Nadine; Klemm, Richard; Moche, Christian; Schattschneider, Sebastian; Frank, Rainer; Willems, Andreas

    2015-05-01

    The diverse human HLA (human leukocyte antigen) system is responsible for antigen presentation and recognition. It is essential for the immune system to maintain a stable defense line, but also is also involved in autoimmunity as well as metabolic disease. HLA-haplotype (HLA-B27), for instance, is associated with inflammatory diseases such as Bechterew's disease. The administration of the HIV drug Abacavir in combination with another HLA-haplotype (HLAB57) is associated with severe hypersensitivity reactions. Accordingly, the HLA status has to be monitored for diagnosis or prior to start of therapy. Along this line, a miniaturized microfluidic platform has been developed allowing performing the complete analytical process from "sample-in" to "answer-out" in a point-of-care environment. The main steps of the analytical cascade inside the integrated system are blood cell lysis and DNA isolation, DNA purification, real-time PCR and quantitative monitoring of the rise of a fluorescent signal appearing during the PCR based sequence amplification. All bio-analytical steps were intended to be performed inside one chip and will be actuated, controlled and monitored by a matching device. This report will show that all required processes are established and tested and all device components work well and interact with the functional modules on the chips in a harmonized fashion.

  3. MOBE-ChIP: Probing Cell Type-Specific Binding Through Large-Scale Chromatin Immunoprecipitation.

    PubMed

    Wang, Shenqi; Lau, On Sun

    2018-01-01

    In multicellular organisms, the initiation and maintenance of specific cell types often require the activity of cell type-specific transcriptional regulators. Understanding their roles in gene regulation is crucial but probing their DNA targets in vivo, especially in a genome-wide manner, remains a technical challenge with their limited expression. To improve the sensitivity of chromatin immunoprecipitation (ChIP) for detecting the cell type-specific signals, we have developed the Maximized Objects for Better Enrichment (MOBE)-ChIP, where ChIP is performed at a substantially larger experimental scale and under low background conditions. Here, we describe the procedure in the study of transcription factors in the model plant Arabidopsis. However, with some modifications, the technique should also be implemented in other systems. Besides cell type-specific studies, MOBE-ChIP can also be used as a general strategy to improve ChIP signals.

  4. Laboratory study of fungal bioreceptivity of different fractions of composite flooring tiles showing efflorescence.

    PubMed

    Masaphy, Segula; Lavi, Ido; Sultz, Stephan; Zabari, Limor

    2014-06-01

    Fungi can grow in extreme habitats, such as natural stone and mineral building materials, sometimes causing deterioration. Efflorescence-concentrated salt deposits-results from water movement through building material; it can damage masonry materials and other bricks. Fungal isolate KUR1, capable of growth on, and dissolution of stone chips composing terrazzo-type floor tiles, was isolated from such tiles showing fiber-like crystalline efflorescence. The isolate's ribosomal DNA sequences were 100 % identical to those of Nigrospora sphaerica. The ability of KUR1 to colonize and degrade the different stone chips composing the tiles was studied in axenic culture experiments. When exposed to each of the different mineral chip types composed of dolomite, calcite, or calcite-apatite mineral in low-nutrition medium, the fungus showed selective nutrient consumption, and different growth and stone mineral dissolution rates. Micromorphological examination of the fungus-colonized chips by electron microscopy showed the production of a fungal biofilm with thin films around the hyphae on the surface of the examined chips and disintegration of the calcite-apatite fraction. More than 70 % dissolution of the introduced powdered (<1 mm particle size) mineral was obtained within 10 days of incubation for the soft calcite-apatite fraction.

  5. Plug-and-play, infrared, laser-mediated PCR in a microfluidic chip.

    PubMed

    Pak, Nikita; Saunders, D Curtis; Phaneuf, Christopher R; Forest, Craig R

    2012-04-01

    Microfluidic polymerase chain reaction (PCR) systems have set milestones for small volume (100 nL-5 μL), amplification speed (100-400 s), and on-chip integration of upstream and downstream sample handling including purification and electrophoretic separation functionality. In practice, the microfluidic chips in these systems require either insertion of thermocouples or calibration prior to every amplification. These factors can offset the speed advantages of microfluidic PCR and have likely hindered commercialization. We present an infrared, laser-mediated, PCR system that features a single calibration, accurate and repeatable precision alignment, and systematic thermal modeling and management for reproducible, open-loop control of PCR in 1 μL chambers of a polymer microfluidic chip. Total cycle time is less than 12 min: 1 min to fill and seal, 10 min to amplify, and 1 min to recover the sample. We describe the design, basis for its operation, and the precision engineering in the system and microfluidic chip. From a single calibration, we demonstrate PCR amplification of a 500 bp amplicon from λ-phage DNA in multiple consecutive trials on the same instrument as well as multiple identical instruments. This simple, relatively low-cost plug-and-play design is thus accessible to persons who may not be skilled in assembly and engineering.

  6. DNA microarray unravels rapid changes in transcriptome of MK-801 treated rat brain

    PubMed Central

    Kobayashi, Yuka; Kulikova, Sofya P; Shibato, Junko; Rakwal, Randeep; Satoh, Hiroyuki; Pinault, Didier; Masuo, Yoshinori

    2015-01-01

    AIM: To investigate the impact of MK-801 on gene expression patterns genome wide in rat brain regions. METHODS: Rats were treated with an intraperitoneal injection of MK-801 [0.08 (low-dose) and 0.16 (high-dose) mg/kg] or NaCl (vehicle control). In a first series of experiment, the frontoparietal electrocorticogram was recorded 15 min before and 60 min after injection. In a second series of experiments, the whole brain of each animal was rapidly removed at 40 min post-injection, and different regions were separated: amygdala, cerebral cortex, hippocampus, hypothalamus, midbrain and ventral striatum on ice followed by DNA microarray (4 × 44 K whole rat genome chip) analysis. RESULTS: Spectral analysis revealed that a single systemic injection of MK-801 significantly and selectively augmented the power of baseline gamma frequency (30-80 Hz) oscillations in the frontoparietal electroencephalogram. DNA microarray analysis showed the largest number (up- and down- regulations) of gene expressions in the cerebral cortex (378), midbrain (376), hippocampus (375), ventral striatum (353), amygdala (301), and hypothalamus (201) under low-dose (0.08 mg/kg) of MK-801. Under high-dose (0.16 mg/kg), ventral striatum (811) showed the largest number of gene expression changes. Gene expression changes were functionally categorized to reveal expression of genes and function varies with each brain region. CONCLUSION: Acute MK-801 treatment increases synchrony of baseline gamma oscillations, and causes very early changes in gene expressions in six individual rat brain regions, a first report. PMID:26629322

  7. Direct electrical and mechanical characterization of in situ generated DNA between the tips of silicon nanotweezers (SNT).

    PubMed

    Karsten, Stanislav L; Kumemura, Momoko; Jalabert, Laurent; Lafitte, Nicolas; Kudo, Lili C; Collard, Dominique; Fujita, Hiroyuki

    2016-05-24

    Previously, we reported the application of micromachined silicon nanotweezers (SNT) integrated with a comb-drive actuator and capacitive sensors for capturing and mechanical characterization of DNA bundles. Here, we demonstrate direct DNA amplification on such a MEMS structure with subsequent electrical and mechanical characterization of a single stranded DNA (ssDNA) bundle generated between the tips of SNT via isothermal rolling circle amplification (RCA) and dielectrophoresis (DEP). An in situ generated ssDNA bundle was visualized and evaluated via electrical conductivity (I-V) and mechanical frequency response measurements. Colloidal gold nanoparticles significantly enhanced (P < 0.01) the electrical properties of thin ssDNA bundles. The proposed technology allows direct in situ synthesis of DNA with a predefined sequence on the tips of a MEMS sensor device, such as SNT, followed by direct DNA electrical and mechanical characterization. In addition, our data provides a "proof-of-principle" for the feasibility of the on-chip label free DNA detection device that can be used for a variety of biomedical applications focused on sequence specific DNA detection.

  8. Occupancy of RNA Polymerase II Phosphorylated on Serine 5 (RNAP S5P) and RNAP S2P on Varicella-Zoster Virus Genes 9, 51, and 66 Is Independent of Transcript Abundance and Polymerase Location within the Gene.

    PubMed

    Henderson, Heather H; Timberlake, Kensey B; Austin, Zoe A; Badani, Hussain; Sanford, Bridget; Tremblay, Keriann; Baird, Nicholas L; Jones, Kenneth; Rovnak, Joel; Frietze, Seth; Gilden, Don; Cohrs, Randall J

    2016-02-01

    Regulation of gene transcription in varicella-zoster virus (VZV), a ubiquitous human neurotropic alphaherpesvirus, requires coordinated binding of multiple host and virus proteins onto specific regions of the virus genome. Chromatin immunoprecipitation (ChIP) is widely used to determine the location of specific proteins along a genomic region. Since the size range of sheared virus DNA fragments governs the limit of accurate protein localization, particularly for compact herpesvirus genomes, we used a quantitative PCR (qPCR)-based assay to determine the efficiency of VZV DNA shearing before ChIP, after which the assay was used to determine the relationship between transcript abundance and the occupancy of phosphorylated RNA polymerase II (RNAP) on the gene promoter, body, and terminus of VZV genes 9, 51, and 66. The abundance of VZV gene 9, 51, and 66 transcripts in VZV-infected human fetal lung fibroblasts was determined by reverse transcription-linked quantitative PCR. Our results showed that the C-terminal domain of RNAP is hyperphosphorylated at serine 5 (S5(P)) on VZV genes 9, 51, and 66 independently of transcript abundance and the location within the virus gene at both 1 and 3 days postinfection (dpi). In contrast, phosphorylated serine 2 (S2(P))-modified RNAP was not detected at any virus gene location at 3 dpi and was detected at levels only slightly above background levels at 1 dpi. Regulation of herpesvirus gene transcription is an elaborate choreography between proteins and DNA that is revealed by chromatin immunoprecipitation (ChIP). We used a quantitative PCR-based assay to determine fragment size after DNA shearing, a critical parameter in ChIP assays, and exposed a basic difference in the mechanism of transcription between mammalian cells and VZV. We found that hyperphosphorylation at serine 5 of the C-terminal domain of RNAP along the lengths of VZV genes (the promoter, body, and transcription termination site) was independent of mRNA abundance. In contrast, little to no enrichment of serine 3 phosphorylation of RNAP was detected at these virus gene regions. This is distinct from the findings for RNAP at highly regulated host genes, where RNAP S5(P) occupancy decreased and S2(P) levels increased as the polymerase transited through the gene. Overall, these results suggest that RNAP associates with human and virus transcriptional units through different mechanisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  9. Stress analysis of ultra-thin silicon chip-on-foil electronic assembly under bending

    NASA Astrophysics Data System (ADS)

    Wacker, Nicoleta; Richter, Harald; Hoang, Tu; Gazdzicki, Pawel; Schulze, Mathias; Angelopoulos, Evangelos A.; Hassan, Mahadi-Ul; Burghartz, Joachim N.

    2014-09-01

    In this paper we investigate the bending-induced uniaxial stress at the top of ultra-thin (thickness \\leqslant 20 μm) single-crystal silicon (Si) chips adhesively attached with the aid of an epoxy glue to soft polymeric substrate through combined theoretical and experimental methods. Stress is first determined analytically and numerically using dedicated models. The theoretical results are validated experimentally through piezoresistive measurements performed on complementary metal-oxide-semiconductor (CMOS) transistors built on specially designed chips, and through micro-Raman spectroscopy investigation. Stress analysis of strained ultra-thin chips with CMOS circuitry is crucial, not only for the accurate evaluation of the piezoresistive behavior of the built-in devices and circuits, but also for reliability and deformability analysis. The results reveal an uneven bending-induced stress distribution at the top of the Si-chip that decreases from the central area towards the chip's edges along the bending direction, and increases towards the other edges. Near these edges, stress can reach very high values, facilitating the emergence of cracks causing ultimate chip failure.

  10. EG-13GENOME-WIDE METHYLATION ANALYSIS IDENTIFIES GENOMIC DNA DEMETHYLATION DURING MALIGNANT PROGRESSION OF GLIOMAS

    PubMed Central

    Saito, Kuniaki; Mukasa, Akitake; Nagae, Genta; Aihara, Koki; Otani, Ryohei; Takayanagi, Shunsaku; Omata, Mayu; Tanaka, Shota; Shibahara, Junji; Takahashi, Miwako; Momose, Toshimitsu; Shimamura, Teppei; Miyano, Satoru; Narita, Yoshitaka; Ueki, Keisuke; Nishikawa, Ryo; Nagane, Motoo; Aburatani, Hiroyuki; Saito, Nobuhito

    2014-01-01

    Low-grade gliomas often undergo malignant progression, and these transformations are a leading cause of death in patients with low-grade gliomas. However, the molecular mechanisms underlying malignant tumor progression are still not well understood. Recent evidence indicates that epigenetic deregulation is an important cause of gliomagenesis; therefore, we examined the impact of epigenetic changes during malignant progression of low-grade gliomas. Specifically, we used the Illumina Infinium Human Methylation 450K BeadChip to perform genome-wide DNA methylation analysis of 120 gliomas and four normal brains. This study sample included 25 matched-pairs of initial low-grade gliomas and recurrent tumors (temporal heterogeneity) and 20 of the 25 recurring tumors recurred as malignant progressions, and one matched-pair of newly emerging malignant lesions and pre-existing lesions (spatial heterogeneity). Analyses of methylation profiles demonstrated that most low-grade gliomas in our sample (43/51; 84%) had a CpG island methylator phenotype (G-CIMP). Remarkably, approximately 50% of secondary glioblastomas that had progressed from low-grade tumors with the G-CIMP status exhibited a characteristic partial demethylation of genomic DNA during malignant progression, but other recurrent gliomas showed no apparent change in DNA methylation pattern. Interestingly, we found that most loci that were demethylated during malignant progression were located outside of CpG islands. The information of histone modifications patterns in normal human astrocytes and embryonal stem cells also showed that the ratio of active marks at the site corresponding to DNA demethylated loci in G-CIMP-demethylated tumors was significantly lower; this finding indicated that most demethylated loci in G-CIMP-demethylated tumors were likely transcriptionally inactive. A small number of the genes that were upregulated and had demethylated CpG islands were associated with cell cycle-related pathway. In summary, we demonstrated that characteristic DNA demethylation occurred during malignant progression of a subset of low-grade gliomas. The mechanisms underlying and consequences of such DNA demethylation should be studied further.

  11. Portable SERS sensor for malachite green and other small dye molecules

    NASA Astrophysics Data System (ADS)

    Qiu, Suyan; Zhao, Fusheng; Li, Jingting; Shih, Wei-Chuan

    2017-02-01

    Sensitive detection of specific chemicals on site can be extremely powerful in many fields. Owing to its molecular fingerprinting capability, surface-enhanced Raman scattering has been one of the technological contenders. In this paper, we describe the novel use of DNA topological nanostructure on nanoporous gold nanoparticle (NPG-NP) array chip for chemical sensing. NPG-NP features large surface area and high-density plasmonic field enhancement known as "hotspots". Hence, NPG-NP array chip has found many applications in nanoplasmonic sensor development. This technique can provide novel label-free molecular sensing capability and enables high sensitivity and specificity detection using a portable Raman spectrometer.

  12. High-bandwidth detection of short DNA in nanopipettes.

    PubMed

    Fraccari, Raquel L; Carminati, Marco; Piantanida, Giacomo; Leontidou, Tina; Ferrari, Giorgio; Albrecht, Tim

    2016-12-12

    Glass or quartz nanopipettes have found increasing use as tools for studying the biophysical properties of DNA and proteins, and as sensor devices. The ease of fabrication, favourable wetting properties and low capacitance are some of the inherent advantages, for example compared to more conventional, silicon-based nanopore chips. Recently, we have demonstrated high-bandwidth detection of double-stranded (ds) DNA with microsecond time resolution in nanopipettes, using custom-designed electronics. The electronics design has now been refined to include more sophisticated control features, such as integrated bias reversal and other features. Here, we exploit these capabilities and probe the translocation of short dsDNA in the 100 bp range, in different electrolytes. Single-stranded (ss) DNA of similar length are in use as capture probes, so label-free detection of their ds counterparts could therefore be of relevance in disease diagnostics.

  13. Assessment of HPV-mRNA test to predict recurrent disease in patients previously treated for CIN 2/3.

    PubMed

    Frega, Antonio; Sesti, Francesco; Lombardi, Danila; Votano, Sergio; Sopracordevole, Francesco; Catalano, Angelica; Milazzo, Giusi Natalia; Lombardo, Riccardo; Assorgi, Chiara; Olivola, Sara; Chiusuri, Valentina; Ricciardi, Enzo; French, Deborah; Moscarini, Massimo

    2014-05-01

    The use of HPV-mRNA test in the follow-up after LEEP is still matter of debate, with regard to its capacity of prediction relapse. The aim of the present study is to evaluate the reliability of HPV-mRNA test to predict the residual and recurrent disease, and its accuracy in the follow-up of patients treated for CIN 2/3. Multicenter prospective cohort study. Patients who underwent LEEP after a biopsy diagnosing CIN 2/3 were followed at 3, 6, 12, 24 and 36 months. Each check up included cytology, colposcopy, HPV-DNA test (LiPA) and HPV-mRNA test (PreTect HPV Proofer Kit NorChip). Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), of HPV-DNA test and HPV-mRNA test to predict relapse, recurrent and residual disease. Using multiple logistic regression, the statistical significant variables as assessed in univariate analysis were entered and investigated as predictors of relapse disease. The mRNA-test in predicting a residual disease had a sensitivity of 52% and a NPV of 91%, whereas DNA-test had 100% and 100%, respectively. On the contrary in the prediction of recurrent disease mRNA-test had a sensitivity and a NPV of 73.5% and 97%, whereas DNA-test had 44% and 93%. On the multivariate analysis, age, cytology, HPV DNA and mRNA test achieved the role of independent predictors of relapse. HPV-mRNA test has a higher sensitivity and a higher NPV in predicting recurrent disease, for this reason it should be used in the follow-up of patients treated with LEEP for CIN 2/3 in order to individualize the timing of check up. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Band-broadening suppressed effect in long turned geometry channel and high-sensitive analysis of DNA sample by using floating electrokinetic supercharging on a microchip.

    PubMed

    Xu, Zhongqi; Murata, Kenji; Arai, Akihiro; Hirokawa, Takeshi

    2010-03-12

    A featured microchip owning three big reservoirs and long turned geometry channel was designed to improve the detection limit of DNA fragments by using floating electrokinetic supercharging (FEKS) method. The novel design matches the FEKS preconcentration needs of a large sample volume introduction with electrokinetic injection (EKI), as well as long duration of isotachophoresis (ITP) process to enrich low concentration sample. In the curved channel [ approximately 45.6 mm long between port 1 (P1) and the intersection point of two channels], EKI and ITP were performed while the side port 3 (P3) was electrically floated. The turn-induced band broadening with or without ITP process was investigated by a computer simulation (using CFD-ACE+ software) when the analytes traveling through the U-shaped geometry. It was found that the channel curvature determined the extent of band broadening, however, which could be effectively eliminated by the way of ITP. After the ITP-stacked zones passed the intersection point from P1, they were rapidly destacked for separation and detection from ITP to zone electrophoresis by using leading ions from P3. The FEKS carried on the novel chip successfully contributed to higher sensitivities of DNA fragments in comparison with our previous results realized on either a single channel or a cross microchip. The analysis of low concentration 50 bp DNA step ladders (0.23 mugml after 1500-fold diluted) was achieved with normal UV detection at 260 nm. The obtained limit of detections (LODs) were on average 100 times better than using conventional pinched injection, down to several ngml for individual DNA fragment.

  15. Rapid analysis of protein interactions: On-chip micropurification of recombinant protein expressed in Esherichia coli.

    PubMed

    Natsume, Tohru; Taoka, Masato; Manki, Hiroshi; Kume, Shouen; Isobe, Toshiaki; Mikoshiba, Katsuhiko

    2002-09-01

    We describe a rapid analysis of interactions between antibodies and a recombinant protein present in total cell lysates. Using a surface plasmon resonance biosensor, a low concentration of glutathione-S-transferase (GST) fused protein expressed in small scale Esherichia coli culture was purified on an anti-GST antibody immobilized sensor chip. The 'on-chip purification' was verified using matrix-assisted laser desorption/ionization-time of flight mass spectrometry by measuring the molecular masses of recombinant proteins purified on the sensor chip. The specific binding of monoclonal antibodies for the on-chip micropurified recombinant proteins can then be monitored, thus enabling kinetic analysis and epitope mapping of the bound antibodies. This approach reduced time, resources and sample consumption by avoiding conventional steps related to concentration and purification.

  16. A Feature-Based Approach to Modeling Protein–DNA Interactions

    PubMed Central

    Segal, Eran

    2008-01-01

    Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

  17. Finite element analysis of a micromechanical deformable mirror device

    NASA Technical Reports Server (NTRS)

    Sheerer, T. J.; Nelson, W. E.; Hornbeck, L. J.

    1989-01-01

    A monolithic spatial light modulator chip was developed consisting of a large number of micrometer-scale mirror cells which can be rotated through an angle by application of an electrostatic field. The field is generated by electronics integral to the chip. The chip has application in photoreceptor based non-impact printing technologies. Chips containing over 16000 cells were fabricated, and were tested to several billions of cycles. Finite Element Analysis (FEA) of the device was used to model both the electrical and mechanical characteristics.

  18. Versatile microfluidic total internal reflection (TIR)-based devices: application to microbeads velocity measurement and single molecule detection with upright and inverted microscope.

    PubMed

    Le, Nam Cao Hoai; Yokokawa, Ryuji; Dao, Dzung Viet; Nguyen, Thien Duy; Wells, John C; Sugiyama, Susumu

    2009-01-21

    A poly(dimethylsiloxane) (PDMS) chip for Total Internal Reflection (TIR)-based imaging and detection has been developed using Si bulk micromachining and PDMS casting. In this paper, we report the applications of the chip on both inverted and upright fluorescent microscopes and confirm that two types of sample delivery platforms, PDMS microchannel and glass microchannel, can be easily integrated depending on the magnification of an objective lens needed to visualize a sample. Although any device configuration can be achievable, here we performed two experiments to demonstrate the versatility of the microfluidic TIR-based devices. The first experiment was velocity measurement of Nile red microbeads with nominal diameter of 500 nm in a pressure-driven flow. The time-sequenced fluorescent images of microbeads, illuminated by an evanescent field, were cross-correlated by a Particle Image Velocimetry (PIV) program to obtain near-wall velocity field of the microbeads at various flow rates from 500 nl/min to 3000 nl/min. We then evaluated the capabilities of the device for Single Molecule Detection (SMD) of fluorescently labeled DNA molecules from 30 bp to 48.5 kbp and confirm that DNA molecules as short as 1105 bp were detectable. Our versatile, integrated device could provide low-cost and fast accessibility to Total Internal Reflection Fluorescent Microscopy (TIRFM) on both conventional upright and inverted microscopes. It could also be a useful component in a Micro-Total Analysis System (micro-TAS) to analyze nanoparticles or biomolecules near-wall transport or motion.

  19. Single-cell PCR of genomic DNA enabled by automated single-cell printing for cell isolation.

    PubMed

    Stumpf, F; Schoendube, J; Gross, A; Rath, C; Niekrawietz, S; Koltay, P; Roth, G

    2015-07-15

    Single-cell analysis has developed into a key topic in cell biology with future applications in personalized medicine, tumor identification as well as tumor discovery (Editorial, 2013). Here we employ inkjet-like printing to isolate individual living single human B cells (Raji cell line) and load them directly into standard PCR tubes. Single cells are optically detected in the nozzle of the microfluidic piezoelectric dispenser chip to ensure printing of droplets with single cells only. The printing process has been characterized by using microbeads (10µm diameter) resulting in a single bead delivery in 27 out of 28 cases and relative positional precision of ±350µm at a printing distance of 6mm between nozzle and tube lid. Process-integrated optical imaging enabled to identify the printing failure as void droplet and to exclude it from downstream processing. PCR of truly single-cell DNA was performed without pre-amplification directly from single Raji cells with 33% success rate (N=197) and Cq values of 36.3±2.5. Additionally single cell whole genome amplification (WGA) was employed to pre-amplify the single-cell DNA by a factor of >1000. This facilitated subsequent PCR for the same gene yielding a success rate of 64% (N=33) which will allow more sophisticated downstream analysis like sequencing, electrophoresis or multiplexing. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

Top