ChIP-seq.

PubMed

Kim, Tae Hoon; Dekker, Job

2018-05-01

Owing to its digital nature, ChIP-seq has become the standard method for genome-wide ChIP analysis. Using next-generation sequencing platforms (notably the Illumina Genome Analyzer), millions of short sequence reads can be obtained. The densities of recovered ChIP sequence reads along the genome are used to determine the binding sites of the protein. Although a relatively small amount of ChIP DNA is required for ChIP-seq, the current sequencing platforms still require amplification of the ChIP DNA by ligation-mediated PCR (LM-PCR). This protocol, which involves linker ligation followed by size selection, is the standard ChIP-seq protocol using an Illumina Genome Analyzer. The size-selected ChIP DNA is amplified by LM-PCR and size-selected for the second time. The purified ChIP DNA is then loaded into the Genome Analyzer. The ChIP DNA can also be processed in parallel for ChIP-chip results. © 2018 Cold Spring Harbor Laboratory Press.

Comparison of Four Human Papillomavirus Genotyping Methods: Next-generation Sequencing, INNO-LiPA, Electrochemical DNA Chip, and Nested-PCR.

PubMed

Nilyanimit, Pornjarim; Chansaenroj, Jira; Poomipak, Witthaya; Praianantathavorn, Kesmanee; Payungporn, Sunchai; Poovorawan, Yong

2018-03-01

Human papillomavirus (HPV) infection causes cervical cancer, thus necessitating early detection by screening. Rapid and accurate HPV genotyping is crucial both for the assessment of patients with HPV infection and for surveillance studies. Fifty-eight cervicovaginal samples were tested for HPV genotypes using four methods in parallel: nested-PCR followed by conventional sequencing, INNO-LiPA, electrochemical DNA chip, and next-generation sequencing (NGS). Seven HPV genotypes (16, 18, 31, 33, 45, 56, and 58) were identified by all four methods. Nineteen HPV genotypes were detected by NGS, but not by nested-PCR, INNO-LiPA, or electrochemical DNA chip. Although NGS is relatively expensive and complex, it may serve as a sensitive HPV genotyping method. Because of its highly sensitive detection of multiple HPV genotypes, NGS may serve as an alternative for diagnostic HPV genotyping in certain situations. © The Korean Society for Laboratory Medicine

Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale.

PubMed

Buhule, Olive D; Minster, Ryan L; Hawley, Nicola L; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T; Weeks, Daniel E

2014-01-01

Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After "removing" batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects.

Stratified randomization controls better for batch effects in 450K methylation analysis: a cautionary tale

PubMed Central

Buhule, Olive D.; Minster, Ryan L.; Hawley, Nicola L.; Medvedovic, Mario; Sun, Guangyun; Viali, Satupaitea; Deka, Ranjan; McGarvey, Stephen T.; Weeks, Daniel E.

2014-01-01

Background: Batch effects in DNA methylation microarray experiments can lead to spurious results if not properly handled during the plating of samples. Methods: Two pilot studies examining the association of DNA methylation patterns across the genome with obesity in Samoan men were investigated for chip- and row-specific batch effects. For each study, the DNA of 46 obese men and 46 lean men were assayed using Illumina's Infinium HumanMethylation450 BeadChip. In the first study (Sample One), samples from obese and lean subjects were examined on separate chips. In the second study (Sample Two), the samples were balanced on the chips by lean/obese status, age group, and census region. We used methylumi, watermelon, and limma R packages, as well as ComBat, to analyze the data. Principal component analysis and linear regression were, respectively, employed to identify the top principal components and to test for their association with the batches and lean/obese status. To identify differentially methylated positions (DMPs) between obese and lean males at each locus, we used a moderated t-test. Results: Chip effects were effectively removed from Sample Two but not Sample One. In addition, dramatic differences were observed between the two sets of DMP results. After “removing” batch effects with ComBat, Sample One had 94,191 probes differentially methylated at a q-value threshold of 0.05 while Sample Two had zero differentially methylated probes. The disparate results from Sample One and Sample Two likely arise due to the confounding of lean/obese status with chip and row batch effects. Conclusion: Even the best possible statistical adjustments for batch effects may not completely remove them. Proper study design is vital for guarding against spurious findings due to such effects. PMID:25352862

Plasmonic SERS nanochips and nanoprobes for medical diagnostics and bio-energy applications

NASA Astrophysics Data System (ADS)

Ngo, Hoan T.; Wang, Hsin-Neng; Crawford, Bridget M.; Fales, Andrew M.; Vo-Dinh, Tuan

2017-02-01

The development of rapid, easy-to-use, cost-effective, high accuracy, and high sensitive DNA detection methods for molecular diagnostics has been receiving increasing interest. Over the last five years, our laboratory has developed several chip-based DNA detection techniques including the molecular sentinel-on-chip (MSC), the multiplex MSC, and the inverse molecular sentinel-on-chip (iMS-on-Chip). In these techniques, plasmonic surface-enhanced Raman scattering (SERS) Nanowave chips were functionalized with DNA probes for single-step DNA detection. Sensing mechanisms were based on hybridization of target sequences and DNA probes, resulting in a distance change between SERS reporters and the Nanowave chip's gold surface. This distance change resulted in change in SERS intensity, thus indicating the presence and capture of the target sequences. Our techniques were single-step DNA detection techniques. Target sequences were detected by simple delivery of sample solutions onto DNA probe-functionalized Nanowave chips and SERS signals were measured after 1h - 2h incubation. Target sequence labeling or washing to remove unreacted components was not required, making the techniques simple, easy-to-use, and cost effective. The usefulness of the techniques for medical diagnostics was illustrated by the detection of genetic biomarkers for respiratory viral infection and of dengue virus 4 DNA.

A microfluidic chip containing a molecularly imprinted polymer and a DNA aptamer for voltammetric determination of carbofuran.

PubMed

Li, Shuhuai; Li, Jianping; Luo, Jinhui; Xu, Zhi; Ma, Xionghui

2018-05-11

An electrochemical microfluidic chip is described for the determination of the insecticide carbofuran. It is making use of a molecularly imprinted film (MIP) and a DNA aptamer as dual recognition units. The analyte (carbofuran) is transported to the MIP and captured at the identification site in the channel. Then, carbofuran is eluted with carbinol-acetic acid and transported to the DNA aptamer on the testing position of the chip. It is captured again, this time by the aptamer, and detected by differential pulse voltammetry (DPV). The dual recognition (by aptamer and MIP) results in outstanding selectivity. Additionally, graphene oxide-supported gold nanoparticles (GO-AuNPs) were used to improve the sensitivity of electrochemical detector. DPV response is linear in the 0.2 to 50 nM carbofuran concentration range at a potential of -1.2 V, with a 67 pM detection limit. The method has attractive features such as its potential for high throughput, high degree of automation, and high integration. Conceivably, the method may be extended to other analytes for which appropriate MIPs and aptamers are available. Graphical abstract Schematic of an electrochemical microfluidic chip for carbofuran detection based on a molecularly imprinted film (MIP) and a DNA aptamer as dual recognition units. In the chip, targets were recognized by MIP and aptamer, respectively. It shows promising potential for the design of electrochemical devices with high throughput, high automation, and high integration.

A multilevel Lab on chip platform for DNA analysis.

PubMed

Marasso, Simone Luigi; Giuri, Eros; Canavese, Giancarlo; Castagna, Riccardo; Quaglio, Marzia; Ferrante, Ivan; Perrone, Denis; Cocuzza, Matteo

2011-02-01

Lab-on-chips (LOCs) are critical systems that have been introduced to speed up and reduce the cost of traditional, laborious and extensive analyses in biological and biomedical fields. These ambitious and challenging issues ask for multi-disciplinary competences that range from engineering to biology. Starting from the aim to integrate microarray technology and microfluidic devices, a complex multilevel analysis platform has been designed, fabricated and tested (All rights reserved-IT Patent number TO2009A000915). This LOC successfully manages to interface microfluidic channels with standard DNA microarray glass slides, in order to implement a complete biological protocol. Typical Micro Electro Mechanical Systems (MEMS) materials and process technologies were employed. A silicon/glass microfluidic chip and a Polydimethylsiloxane (PDMS) reaction chamber were fabricated and interfaced with a standard microarray glass slide. In order to have a high disposable system all micro-elements were passive and an external apparatus provided fluidic driving and thermal control. The major microfluidic and handling problems were investigated and innovative solutions were found. Finally, an entirely automated DNA hybridization protocol was successfully tested with a significant reduction in analysis time and reagent consumption with respect to a conventional protocol.

Microfluidic Devices for Forensic DNA Analysis: A Review.

PubMed

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-08-05

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10-20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook.

Enzymic colorimetry-based DNA chip: a rapid and accurate assay for detecting mutations for clarithromycin resistance in the 23S rRNA gene of Helicobacter pylori.

PubMed

Xuan, Shi-Hai; Zhou, Yu-Gui; Shao, Bo; Cui, Ya-Lin; Li, Jian; Yin, Hong-Bo; Song, Xiao-Ping; Cong, Hui; Jing, Feng-Xiang; Jin, Qing-Hui; Wang, Hui-Min; Zhou, Jie

2009-11-01

Macrolide drugs, such as clarithromycin (CAM), are a key component of many combination therapies used to eradicate Helicobacter pylori. However, resistance to CAM is increasing in H. pylori and is becoming a serious problem in H. pylori eradication therapy. CAM resistance in H. pylori is mostly due to point mutations (A2142G/C, A2143G) in the peptidyltransferase-encoding region of the 23S rRNA gene. In this study an enzymic colorimetry-based DNA chip was developed to analyse single-nucleotide polymorphisms of the 23S rRNA gene to determine the prevalence of mutations in CAM-related resistance in H. pylori-positive patients. The results of the colorimetric DNA chip were confirmed by direct DNA sequencing. In 63 samples, the incidence of the A2143G mutation was 17.46 % (11/63). The results of the colorimetric DNA chip were concordant with DNA sequencing in 96.83 % of results (61/63). The colorimetric DNA chip could detect wild-type and mutant signals at every site, even at a DNA concentration of 1.53 x 10(2) copies microl(-1). Thus, the colorimetric DNA chip is a reliable assay for rapid and accurate detection of mutations in the 23S rRNA gene of H. pylori that lead to CAM-related resistance, directly from gastric tissues.

Multienzyme-nanoparticles amplification for sensitive virus genotyping in microfluidic microbeads array using Au nanoparticle probes and quantum dots as labels.

PubMed

Zhang, He; Liu, Lian; Li, Cheuk-Wing; Fu, Huayang; Chen, Yao; Yang, Mengsu

2011-11-15

A novel microfluidic device with microbeads array was developed and sensitive genotyping of human papillomavirus was demonstrated using a multiple-enzyme labeled oligonucleotide-Au nanoparticle bioconjugate as the detection tool. This method utilizes microbeads as sensing platform that was functionalized with the capture probes and modified electron rich proteins, and uses the horseradish peroxidase (HRP)-functionalized gold nanoparticles as label with a secondary DNA probe. The functionalized microbeads were independently introduced into the arrayed chambers using the loading chip slab. A single channel was used to generate weir structures to confine the microbeads and make the beads array accessible by microfluidics. Through "sandwich" hybridization, the enzyme-functionalized Au nanoparticles labels were brought close to the surface of microbeads. The oxidation of biotin-tyramine by hydrogen peroxide resulted in the deposition of multiple biotin moieties onto the surface of beads. This deposition is markedly increased in the presence of immobilized electron rich proteins. Streptavidin-labeled quantum dots were then allowed to bind to the deposited biotin moieties and displayed the signal. Enhanced detection sensitivity was achieved where the large surface area of Au nanoparticle carriers increased the amount HRP bound per sandwiched hybridization. The on-chip genotyping method could discriminate as low as 1fmol/L (10zmol/chip, SNR>3) synthesized HPV oligonucleotides DNA. The chip-based signal enhancement of the amplified assay resulted in 1000 times higher sensitivity than that of off-chip test. In addition, this on-chip format could discriminate and genotype 10copies/μL HPV genomic DNA using the PCR products. These results demonstrated that this on-chip approach can achieve highly sensitive detection and genotyping of target DNA and can be further developed for detection of disease-related biomolecules at the lowest level at their earliest incidence. Copyright © 2011 Elsevier B.V. All rights reserved.

Global Analysis of Transcription Factor-Binding Sites in Yeast Using ChIP-Seq

PubMed Central

Lefrançois, Philippe; Gallagher, Jennifer E. G.; Snyder, Michael

2016-01-01

Transcription factors influence gene expression through their ability to bind DNA at specific regulatory elements. Specific DNA-protein interactions can be isolated through the chromatin immunoprecipitation (ChIP) procedure, in which DNA fragments bound by the protein of interest are recovered. ChIP is followed by high-throughput DNA sequencing (Seq) to determine the genomic provenance of ChIP DNA fragments and their relative abundance in the sample. This chapter describes a ChIP-Seq strategy adapted for budding yeast to enable the genome-wide characterization of binding sites of transcription factors (TFs) and other DNA-binding proteins in an efficient and cost-effective way. Yeast strains with epitope-tagged TFs are most commonly used for ChIP-Seq, along with their matching untagged control strains. The initial step of ChIP involves the cross-linking of DNA and proteins. Next, yeast cells are lysed and sonicated to shear chromatin into smaller fragments. An antibody against an epitope-tagged TF is used to pull down chromatin complexes containing DNA and the TF of interest. DNA is then purified and proteins degraded. Specific barcoded adapters for multiplex DNA sequencing are ligated to ChIP DNA. Short DNA sequence reads (28–36 base pairs) are parsed according to the barcode and aligned against the yeast reference genome, thus generating a nucleotide-resolution map of transcription factor-binding sites and their occupancy. PMID:25213249

[Fabrications of a poly (methyl methacrylate) (PMMA) microfluidic chip-based DNA analysis device].

PubMed

Du, Xiao-Guang

2009-12-01

A DNA analysis device based on poly(methyl methacrylate) (PMMA) microfluidic chips was developed. A PMMA chip with cross microchannels was fabricated by a simple hot embossing. Microchannels were modified with a static adsorptive coating method using 2% hydroxyethyl cellulose. A high-voltage power unit, variable in the range 0-1 800 V, was used for on-chip DNA sample injection and gel electrophoretic separation. High speed, high resolution DNA analysis was obtained with the home-built PMMA chip in a sieving matrix containing 2% hydroxyethyl cellulose with a blue intercalating dye, TO-PRO-3 (TP3), by using diode laser induced fluorescence detection based on optical fibers with a 670 nm long-pass filter. The DNA analysis device was applied for the separation of phiX-174/HaeIII DNA digest sample with 11 fragments ranging from 72 to 1 353 bp. A separation efficiency of 1.14 x 10(6) plates/m was obtained for the 603 bp fragments, while the R of 271/281 bp fragments was 1.2. The device was characterized by simple design, low cost for fabrication and operation, reusable PMMA chips, and good reproducibility. A portable microfluidic device for DNA analysis can be developed for clinical diagnosis and disease screening.

How single nucleotide polymorphism chips will advance our knowledge of factors controlling puberty and aid in selecting replacement beef females

USDA-ARS?s Scientific Manuscript database

The promise of genomic selection is accurate prediction of animals' genetic potential from their genotypes. Simple DNA tests might replace low accuracy predictions for expensive or lowly heritable measures of puberty and fertility based on performance and pedigree. Knowing which DNA variants affec...

Microfluidic Devices for Forensic DNA Analysis: A Review

PubMed Central

Bruijns, Brigitte; van Asten, Arian; Tiggelaar, Roald; Gardeniers, Han

2016-01-01

Microfluidic devices may offer various advantages for forensic DNA analysis, such as reduced risk of contamination, shorter analysis time and direct application at the crime scene. Microfluidic chip technology has already proven to be functional and effective within medical applications, such as for point-of-care use. In the forensic field, one may expect microfluidic technology to become particularly relevant for the analysis of biological traces containing human DNA. This would require a number of consecutive steps, including sample work up, DNA amplification and detection, as well as secure storage of the sample. This article provides an extensive overview of microfluidic devices for cell lysis, DNA extraction and purification, DNA amplification and detection and analysis techniques for DNA. Topics to be discussed are polymerase chain reaction (PCR) on-chip, digital PCR (dPCR), isothermal amplification on-chip, chip materials, integrated devices and commercially available techniques. A critical overview of the opportunities and challenges of the use of chips is discussed, and developments made in forensic DNA analysis over the past 10–20 years with microfluidic systems are described. Areas in which further research is needed are indicated in a future outlook. PMID:27527231

DNA Extraction by Isotachophoresis in a Microfluidic Channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stephenson, S J

Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in anmore » inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing electrolyte ions. Conversely, the trailing electrolyte ions have a slow electrophoretic mobility, so they lag behind the sample, thus trapping the species of interest between the LE and TE streams. In a typical isotachophoresis configuration, the electric field is applied in a direction parallel to the direction of flow. The species then form bands that stretch across the width of the channel. A major limitation of that approach is that only a finite amount of sample can be processed at once, and the sample must be processed in batches. For our purposes, a form of free-flow isotachophoresis is more convenient, where the DNA forms a band parallel to the edges of the channel. To achieve this, in our chip, the electric field is applied transversely. This creates a force perpendicular to the direction of flow, which causes the different ions to migrate across the flow direction. Because the mobility of the DNA is between the mobility of the leading and the trailing electrolyte, the DNA is focused in a tight band near the center of the channel. The stream of DNA can then be directed to a different output to produce a highly concentrated outlet stream without batch processing. One hurdle that must be overcome for successful ITP is isolating the electrochemical reactions that result from the application of high voltage for the actual process of isotachophoresis. The electrochemical reactions that occur around metal electrodes produce bubbles and pH changes that are detrimental to successful ITP. The design of the chips we use incorporates polyacrylamide gels to serve as electrodes along the central channel. For our design, the metal electrodes are located away from the chip, and high conductivity buffer streams carry the potential to the chip, functioning as a 'liquid electrode.' The stream then runs alongside a gel barrier. The gel electrode permits ion transfer while simultaneously isolating the separation chamber from any contaminants in the outer, 'liquid electrode' streams. The difference in potential from one side of the chip to the other creates an electric field. This field traverses the inner, separation channel, containing the leading electrolyte, the trailing electrolyte, and the sample of interest (DNA). To increase the ease of use of the chips, a newer chip design has been fabricated. This design has wire electrodes integrated on the chip, rather than elsewhere. To keep the pH changes and bubbling isolated from the separation channel, the chip contains deeper wells near the electrodes so that the flowing buffer can wash away any gases that form around the electrode. This design is significantly more compact because it eliminates the cumbersome electrode boxes. Eliminating the electrode boxes also decreases the required voltage, making the experiments safer. This happens because when the 'liquid electrode' streams travel through small diameter tubing, they lose much of their voltage due to the electrical resistance of the fluid in the tubing.« less

A simple and cost-effective molecular diagnostic system and DNA probes synthesized by light emitting diode photolithography

NASA Astrophysics Data System (ADS)

Oleksandrov, Sergiy; Kwon, Jung Ho; Lee, Ki-chang; Sujin-Ku; Paek, Mun Cheol

2014-09-01

This work introduces a novel chip to be used in the future as a simple and cost-effective method for creating DNA arrays using light emission diode (LED) photolithography. The DNA chip platform contains 24 independent reaction sites, which allows for the testing of a corresponding amount of patients' samples in hospital. An array of commercial UV LEDs and lens systems was combined with a microfluidic flow system to provide patterning of 24 individual reaction sites, each with 64 independent probes. Using the LED array instead of conventional laser exposure systems or micro-mirror systems significantly reduces the cost of equipment. The microfluidic system together with microfluidic flow cells drastically reduces the amount of used reagents, which is important due to the high cost of commercial reagents. The DNA synthesis efficiency was verified by fluorescence labeling and conventional hybridization.

Justification of rapid prototyping in the development cycle of thermoplastic-based lab-on-a-chip.

PubMed

Preywisch, Regina; Ritzi-Lehnert, Marion; Drese, Klaus S; Röser, Tina

2011-11-01

During the developmental cycle of lab-on-a-chip devices, various microstructuring techniques are required. While in the designing and assay implementation phase direct structuring or so-called rapid-prototyping methods such as milling or laser ablation are applied, replication methods like hot embossing or injection moulding are favourable for large quantity manufacturing. This work investigated the applicability of rapid-prototyping techniques for thermoplastic chip development in general, and the reproducibility of performances in dependency of the structuring technique. A previously published chip for prenatal diagnosis that preconcentrates DNA via electrokinetic trapping and field-amplified-sample-stacking and afterwards separates it in CGE was chosen as a model. The impact of structuring, sealing, and the integration of membranes on the mobility of the EOF, DNA preconcentration, and DNA separation was studied. Structuring methods were found to significantly change the location where preconcentration of DNA occurs. However, effects on the mobility of the EOF and the separation quality of DNA were not observed. Exchange of the membrane has no effect on the chip performance, whereas the sealing method impairs the separation of DNA within the chip. The overall assay performance is not significantly influenced by different structuring methods; thus, the application of rapid-prototyping methods during a chip development cycle is well justified. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mapping of transcription factor binding regions in mammalian cells by ChIP: Comparison of array- and sequencing-based technologies

PubMed Central

Euskirchen, Ghia M.; Rozowsky, Joel S.; Wei, Chia-Lin; Lee, Wah Heng; Zhang, Zhengdong D.; Hartman, Stephen; Emanuelsson, Olof; Stolc, Viktor; Weissman, Sherman; Gerstein, Mark B.; Ruan, Yijun; Snyder, Michael

2007-01-01

Recent progress in mapping transcription factor (TF) binding regions can largely be credited to chromatin immunoprecipitation (ChIP) technologies. We compared strategies for mapping TF binding regions in mammalian cells using two different ChIP schemes: ChIP with DNA microarray analysis (ChIP-chip) and ChIP with DNA sequencing (ChIP-PET). We first investigated parameters central to obtaining robust ChIP-chip data sets by analyzing STAT1 targets in the ENCODE regions of the human genome, and then compared ChIP-chip to ChIP-PET. We devised methods for scoring and comparing results among various tiling arrays and examined parameters such as DNA microarray format, oligonucleotide length, hybridization conditions, and the use of competitor Cot-1 DNA. The best performance was achieved with high-density oligonucleotide arrays, oligonucleotides ≥50 bases (b), the presence of competitor Cot-1 DNA and hybridizations conducted in microfluidics stations. When target identification was evaluated as a function of array number, 80%–86% of targets were identified with three or more arrays. Comparison of ChIP-chip with ChIP-PET revealed strong agreement for the highest ranked targets with less overlap for the low ranked targets. With advantages and disadvantages unique to each approach, we found that ChIP-chip and ChIP-PET are frequently complementary in their relative abilities to detect STAT1 targets for the lower ranked targets; each method detected validated targets that were missed by the other method. The most comprehensive list of STAT1 binding regions is obtained by merging results from ChIP-chip and ChIP-sequencing. Overall, this study provides information for robust identification, scoring, and validation of TF targets using ChIP-based technologies. PMID:17568005

Plasma micro-nanotextured polymeric micromixer for DNA purification with high efficiency and dynamic range.

PubMed

Kastania, Athina S; Tsougeni, Katerina; Papadakis, George; Gizeli, Electra; Kokkoris, George; Tserepi, Angeliki; Gogolides, Evangelos

2016-10-26

We present a polymeric microfluidic chip capable of purifying DNA through solid phase extraction. It is designed to be used as a module of an integrated Lab-on-chip platform for pathogen detection, but it can also be used as a stand-alone device. The microfluidic channels are oxygen plasma micro-nanotextured, i.e. randomly roughened in the micro-nano scale, a process creating high surface area as well as high density of carboxyl groups (COOH). The COOH groups together with a buffer that contains polyethylene glycol (PEG), NaCl and ethanol are able to bind DNA on the microchannel surface. The chip design incorporates a mixer so that sample and buffer can be efficiently mixed on chip under continuous flow. DNA is subsequently eluted in water. The chip is able to isolate DNA with high recovery efficiency (96± 11%) in an extremely large dynamic range of prepurified Salmonella DNA as well as from Salmonella cell lysates that correspond to a range of 5 to 1.9 × 10 8  cells (0.263 fg to 2 × 500 ng). The chip was evaluated via absorbance measurements, polymerase chain reaction (PCR), and gel electrophoresis. Copyright © 2016 Elsevier B.V. All rights reserved.

A fully sealed plastic chip for multiplex PCR and its application in bacteria identification.

PubMed

Xu, Youchun; Yan, He; Zhang, Yan; Jiang, Kewei; Lu, Ying; Ren, Yonghong; Wang, Hui; Wang, Shan; Xing, Wanli

2015-07-07

Multiplex PCR is an effective tool for simultaneous multiple target detection but is limited by the intrinsic interference and competition among primer pairs when it is performed in one reaction tube. Dividing a multiplex PCR into many single PCRs is a simple strategy to overcome this issue. Here, we constructed a plastic, easy-to-use, fully sealed multiplex PCR chip based on reversible centrifugation for the simultaneous detection of 63 target DNA sequences. The structure of the chip is quite simple, which contains sine-shaped infusing channels and a number of reaction chambers connecting to one side of these channels. Primer pairs for multiplex PCR were sequentially preloaded in the different reaction chambers, and the chip was enclosed with PCR-compatible adhesive tape. For usage, the PCR master mix containing a DNA template is pipetted into the infusing channels and centrifuged into the reaction chambers, leaving the infusing channels filled with air to avoid cross-contamination of the different chambers. Then, the chip is sealed and placed on a flat thermal cycler for PCR. Finally, amplification products can be detected in situ using a fluorescence scanner or recovered by reverse centrifugation for further analyses. Therefore, our chip possesses two functions: 1) it can be used for multi-target detection based on end-point in situ fluorescence detection; and 2) it can work as a sample preparation unit for analyses that need multiplex PCR such as hybridization and target sequencing. The performance of this chip was carefully examined and further illustrated in the identification of 8 pathogenic bacterial genomic DNA samples and 13 drug-resistance genes. Due to simplicity of its structure and operation, accuracy and generality, high-throughput capacity, and versatile functions (i.e., for in situ detection and sample preparation), our multiplex PCR chip has great potential in clinical diagnostics and nucleic acid-based point-of-care testing.

Microarrays Made Simple: "DNA Chips" Paper Activity

ERIC Educational Resources Information Center

Barnard, Betsy

2006-01-01

DNA microarray technology is revolutionizing biological science. DNA microarrays (also called DNA chips) allow simultaneous screening of many genes for changes in expression between different cells. Now researchers can obtain information about genes in days or weeks that used to take months or years. The paper activity described in this article…

Highly specific detection of genetic modification events using an enzyme-linked probe hybridization chip.

PubMed

Zhang, M Z; Zhang, X F; Chen, X M; Chen, X; Wu, S; Xu, L L

2015-08-10

The enzyme-linked probe hybridization chip utilizes a method based on ligase-hybridizing probe chip technology, with the principle of using thio-primers for protection against enzyme digestion, and using lambda DNA exonuclease to cut multiple PCR products obtained from the sample being tested into single-strand chains for hybridization. The 5'-end amino-labeled probe was fixed onto the aldehyde chip, and hybridized with the single-stranded PCR product, followed by addition of a fluorescent-modified probe that was then enzymatically linked with the adjacent, substrate-bound probe in order to achieve highly specific, parallel, and high-throughput detection. Specificity and sensitivity testing demonstrated that enzyme-linked probe hybridization technology could be applied to the specific detection of eight genetic modification events at the same time, with a sensitivity reaching 0.1% and the achievement of accurate, efficient, and stable results.

DNA extraction on bio-chip: history and preeminence over conventional and solid-phase extraction methods.

PubMed

Ayoib, Adilah; Hashim, Uda; Gopinath, Subash C B; Md Arshad, M K

2017-11-01

This review covers a developmental progression on early to modern taxonomy at cellular level following the advent of electron microscopy and the advancement in deoxyribonucleic acid (DNA) extraction for expatiation of biological classification at DNA level. Here, we discuss the fundamental values of conventional chemical methods of DNA extraction using liquid/liquid extraction (LLE) followed by development of solid-phase extraction (SPE) methods, as well as recent advances in microfluidics device-based system for DNA extraction on-chip. We also discuss the importance of DNA extraction as well as the advantages over conventional chemical methods, and how Lab-on-a-Chip (LOC) system plays a crucial role for the future achievements.

Stability of the cancer target DDIAS is regulated by the CHIP/HSP70 pathway in lung cancer cells

PubMed Central

Won, Kyoung-Jae; Im, Joo-Young; Kim, Bo-Kyung; Ban, Hyun Seung; Jung, Young-Jin; Jung, Kyeong Eun; Won, Misun

2017-01-01

DNA damage-induced apoptosis suppressor (DDIAS) rescues lung cancer cells from apoptosis in response to DNA damage. DDIAS is transcriptionally activated by NFATc1 and EGF-mediated ERK5/MEF2B, leading to cisplatin resistance and cell invasion. Therefore, DDIAS is suggested as a therapeutic target for lung cancer. Here, we report that DDIAS stability is regulated by E3 U-box ubiquitin ligase carboxyl terminus of HSP70-interacting protein (CHIP)-mediated proteasomal degradation. We first isolated CHIP as an interacting partner of DDIAS by yeast two-hybrid screening. CHIP physically associated with both the N- and C-terminal regions of DDIAS, targeting it for proteasomal degradation and reducing the DDIAS half-life. CHIP overexpression analyses indicated that the tetratrico peptide repeat (TPR) domain and the U-box are required for DDIAS ubiquitination. It is likely that HSP70-bound DDIAS is recruited to the CHIP E3 ligase via the TPR domain, suggesting DDIAS as a client protein of HSP70. In addition, CHIP overexpression in lung cancer cells expressing high DDIAS levels induced significant growth inhibition by enhancing DDIAS degradation. Furthermore, simultaneous CHIP overexpression and DNA damage agent treatment caused a substantial increase in the apoptosis of lung cancer cells. Taken together, these findings indicate that the stability of the DDIAS protein is regulated by CHIP/HSP70-mediated proteasomal degradation and that CHIP overexpression stimulates the apoptosis of lung cancer cells in response to DNA-damaging agents. PMID:28079882

Stability of the cancer target DDIAS is regulated by the CHIP/HSP70 pathway in lung cancer cells.

PubMed

Won, Kyoung-Jae; Im, Joo-Young; Kim, Bo-Kyung; Ban, Hyun Seung; Jung, Young-Jin; Jung, Kyeong Eun; Won, Misun

2017-01-12

DNA damage-induced apoptosis suppressor (DDIAS) rescues lung cancer cells from apoptosis in response to DNA damage. DDIAS is transcriptionally activated by NFATc1 and EGF-mediated ERK5/MEF2B, leading to cisplatin resistance and cell invasion. Therefore, DDIAS is suggested as a therapeutic target for lung cancer. Here, we report that DDIAS stability is regulated by E3 U-box ubiquitin ligase carboxyl terminus of HSP70-interacting protein (CHIP)-mediated proteasomal degradation. We first isolated CHIP as an interacting partner of DDIAS by yeast two-hybrid screening. CHIP physically associated with both the N- and C-terminal regions of DDIAS, targeting it for proteasomal degradation and reducing the DDIAS half-life. CHIP overexpression analyses indicated that the tetratrico peptide repeat (TPR) domain and the U-box are required for DDIAS ubiquitination. It is likely that HSP70-bound DDIAS is recruited to the CHIP E3 ligase via the TPR domain, suggesting DDIAS as a client protein of HSP70. In addition, CHIP overexpression in lung cancer cells expressing high DDIAS levels induced significant growth inhibition by enhancing DDIAS degradation. Furthermore, simultaneous CHIP overexpression and DNA damage agent treatment caused a substantial increase in the apoptosis of lung cancer cells. Taken together, these findings indicate that the stability of the DDIAS protein is regulated by CHIP/HSP70-mediated proteasomal degradation and that CHIP overexpression stimulates the apoptosis of lung cancer cells in response to DNA-damaging agents.

Development of a photodiode array biochip using a bipolar semiconductor and its application to detection of human papilloma virus.

PubMed

Baek, Taek Jin; Park, Pan Yun; Han, Kwi Nam; Kwon, Ho Taik; Seong, Gi Hun

2008-03-01

We describe a DNA microarray system using a bipolar integrated circuit photodiode array (PDA) chip as a new platform for DNA analysis. The PDA chip comprises an 8 x 6 array of photodiodes each with a diameter of 600 microm. Each photodiode element acts both as a support for an immobilizing probe DNA and as a two-dimensional photodetector. The usefulness of the PDA microarray platform is demonstrated by the detection of high-risk subtypes of human papilloma virus (HPV). The polymerase chain reaction (PCR)-amplified biotinylated HPV target DNA was hybridized with the immobilized probe DNA on the photodiode surface, and the chip was incubated in an anti-biotin antibody-conjugated gold nanoparticle solution. The silver enhancement by the gold nanoparticles bound to the biotin of the HPV target DNA precipitates silver metal particles at the chip surfaces, which block light irradiated from above. The resulting drop in output voltage depends on the amount of target DNA present in the sample solution, which allows the specific detection and the quantitative analysis of the complementary target DNA. The PDA chip showed high relative signal ratios of HPV probe DNA hybridized with complementary target DNA, indicating an excellent capability in discriminating HPV subtypes. The detection limit for the HPV target DNA analysis improved from 1.2 nM to 30 pM by changing the silver development time from 5 to 10 min. Moreover, the enhanced silver development promoted by the gold nanoparticles could be applied to a broader range of target DNA concentration by controlling the silver development time.

Integrated microfluidic chip for rapid DNA digestion and time-resolved capillary electrophoresis analysis

PubMed Central

Lin, Che-Hsin; Wang, Yao-Nan; Fu, Lung-Ming

2012-01-01

An integrated microfluidic chip is proposed for rapid DNA digestion and time-resolved capillary electrophoresis (CE) analysis. The chip comprises two gel-filled chambers for DNA enrichment and purification, respectively, a T-form micromixer for DNA/restriction enzyme mixing, a serpentine channel for DNA digestion reaction, and a CE channel for on-line capillary electrophoresis analysis. The DNA and restriction enzyme are mixed electroomostically using a pinched-switching DC field. The experimental and numerical results show that a mixing performance of 97% is achieved within a distance of 1 mm from the T-junction when a driving voltage of 90 V/cm and a switching frequency of 4 Hz are applied. Successive mixing digestion and capillary electrophoresis operation clearly present the changes on digesting φx-174 DNA in different CE runs. The time-resolved electropherograms show that the proposed device enables a φx-174 DNA sample comprising 11 fragments to be concentrated and analyzed within 24 min. Overall, the results presented in this study show that the proposed microfluidic chip provides a rapid and effective tool for DNA digestion and CE analysis applications. PMID:22662085

Detection of Alicyclobacillus species in fruit juice using a random genomic DNA microarray chip.

PubMed

Jang, Jun Hyeong; Kim, Sun-Joong; Yoon, Bo Hyun; Ryu, Jee-Hoon; Gu, Man Bock; Chang, Hyo-Ihl

2011-06-01

This study describes a method using a DNA microarray chip to rapidly and simultaneously detect Alicyclobacillus species in orange juice based on the hybridization of genomic DNA with random probes. Three food spoilage bacteria were used in this study: Alicyclobacillus acidocaldarius, Alicyclobacillus acidoterrestris, and Alicyclobacillus cycloheptanicus. The three Alicyclobacillus species were adjusted to 2 × 10(3) CFU/ml and inoculated into pasteurized 100% pure orange juice. Cy5-dCTP labeling was used for reference signals, and Cy3-dCTP was labeled for target genomic DNA. The molar ratio of 1:1 of Cy3-dCTP and Cy5-dCTP was used. DNA microarray chips were fabricated using randomly fragmented DNA of Alicyclobacillus spp. and were hybridized with genomic DNA extracted from Bacillus spp. Genomic DNA extracted from Alicyclobacillus spp. showed a significantly higher hybridization rate compared with DNA of Bacillus spp., thereby distinguishing Alicyclobacillus spp. from Bacillus spp. The results showed that the microarray DNA chip containing randomly fragmented genomic DNA was specific and clearly identified specific food spoilage bacteria. This microarray system is a good tool for rapid and specific detection of thermophilic spoilage bacteria, mainly Alicyclobacillus spp., and is useful and applicable to the fruit juice industry.

Design of a DNA chip for detection of unknown genetically modified organisms (GMOs).

PubMed

Nesvold, Håvard; Kristoffersen, Anja Bråthen; Holst-Jensen, Arne; Berdal, Knut G

2005-05-01

Unknown genetically modified organisms (GMOs) have not undergone a risk evaluation, and hence might pose a danger to health and environment. There are, today, no methods for detecting unknown GMOs. In this paper we propose a novel method intended as a first step in an approach for detecting unknown genetically modified (GM) material in a single plant. A model is designed where biological and combinatorial reduction rules are applied to a set of DNA chip probes containing all possible sequences of uniform length n, creating probes capable of detecting unknown GMOs. The model is theoretically tested for Arabidopsis thaliana Columbia, and the probabilities for detecting inserts and receiving false positives are assessed for various parameters for this organism. From a theoretical standpoint, the model looks very promising but should be tested further in the laboratory. The model and algorithms will be available upon request to the corresponding author.

Application of the CometChip platform to assess DNA damage in field-collected blood samples from turtles.

PubMed

Sykora, Peter; Chiari, Ylenia; Heaton, Andrew; Moreno, Nickolas; Glaberman, Scott; Sobol, Robert W

2018-05-01

DNA damage has been linked to genomic instability and the progressive breakdown of cellular and organismal homeostasis, leading to the onset of disease and reduced longevity. Insults to DNA from endogenous sources include base deamination, base hydrolysis, base alkylation, and metabolism-induced oxidative damage that can lead to single-strand and double-strand DNA breaks. Alternatively, exposure to environmental pollutants, radiation or ultra-violet light, can also contribute to exogenously derived DNA damage. We previously validated a novel, high through-put approach to measure levels of DNA damage in cultured mammalian cells. This new CometChip Platform builds on the classical single cell gel electrophoresis or comet methodology used extensively in environmental toxicology and molecular biology. We asked whether the CometChip Platform could be used to measure DNA damage in samples derived from environmental field studies. To this end, we determined that nucleated erythrocytes from multiple species of turtle could be successfully evaluated in the CometChip Platform to quantify levels of DNA damage. In total, we compared levels of DNA damage in 40 animals from two species: the box turtle (Terrapene carolina) and the red-eared slider (Trachemys scripta elegans). Endogenous levels of DNA damage were identical between the two species, yet we did discover some sex-linked differences and changes in DNA damage accumulation. Based on these results, we confirm that the CometChip Platform allows for the measurement of DNA damage in a large number of samples quickly and accurately, and is particularly adaptable to environmental studies using field-collected samples. Environ. Mol. Mutagen. 59:322-333, 2018. © 2018 Wiley Periodicals, Inc. © 2018 Wiley Periodicals, Inc.

The Ubiquitin Ligase CHIP Prevents SirT6 Degradation through Noncanonical Ubiquitination

PubMed Central

Ronnebaum, Sarah M.; Wu, Yaxu; McDonough, Holly

2013-01-01

The ubiquitin ligase CHIP (carboxyl terminus of Hsp70-interacting protein) regulates protein quality control, and CHIP deletion accelerates aging and reduces the life span in mice. Here, we reveal a mechanism for CHIP's influence on longevity by demonstrating that CHIP stabilizes the sirtuin family member SirT6, a lysine deacetylase/ADP ribosylase involved in DNA repair, metabolism, and longevity. In CHIP-deficient cells, SirT6 protein half-life is substantially reduced due to increased proteasome-mediated degradation, but CHIP overexpression in these cells increases SirT6 protein expression without affecting SirT6 transcription. CHIP noncanonically ubiquitinates SirT6 at K170, which stabilizes SirT6 and prevents SirT6 canonical ubiquitination by other ubiquitin ligases. In CHIP-depleted cells, SirT6 K170 mutation increases SirT6 half-life and prevents proteasome-mediated degradation. The global decrease in SirT6 expression in the absence of CHIP is associated with decreased SirT6 promoter occupancy, which increases histone acetylation and promotes downstream gene transcription in CHIP-depleted cells. Cells lacking CHIP are hypersensitive to DNA-damaging agents, but DNA repair and cell viability are rescued by enforced expression of SirT6. The discovery of this CHIP-SirT6 interaction represents a novel protein-stabilizing mechanism and defines an intersection between protein quality control and epigenetic regulation to influence pathways that regulate the biology of aging. PMID:24043303

Plasma epidermal growth factor receptor mutation testing with a chip-based digital PCR system in patients with advanced non-small cell lung cancer.

PubMed

Kasahara, Norimitsu; Kenmotsu, Hirotsugu; Serizawa, Masakuni; Umehara, Rina; Ono, Akira; Hisamatsu, Yasushi; Wakuda, Kazushige; Omori, Shota; Nakashima, Kazuhisa; Taira, Tetsuhiko; Naito, Tateaki; Murakami, Haruyasu; Koh, Yasuhiro; Mori, Keita; Endo, Masahiro; Nakajima, Takashi; Yamada, Masanobu; Kusuhara, Masatoshi; Takahashi, Toshiaki

2017-04-01

Epidermal growth factor receptor (EGFR) mutation testing is a companion diagnostic to determine eligibility for treatment with EGFR tyrosine kinase inhibitors (EGFR-TKIs) in non-small cell lung cancer (NSCLC). Recently, plasma-based EGFR testing by digital polymerase chain reaction (dPCR), which enables accurate quantification of target DNA, has shown promise as a minimally invasive diagnostic. Here, we aimed to evaluate the accuracy of a plasma-based EGFR mutation test developed using chip-based dPCR-based detection of 3 EGFR mutations (exon 19 deletions, L858R in exon 21, and T790M in exon 20). Forty-nine patients with NSCLC harboring EGFR-activating mutations were enrolled, and circulating free DNAs (cfDNAs) were extracted from the plasma of 21 and 28 patients before treatment and after progression following EGFR-TKI treatment, respectively. Using reference genomic DNA containing each mutation, the detection limit of each assay was determined to be 0.1%. The sensitivity and specificity of detecting exon 19 deletions and L858R mutations, calculated by comparing the mutation status in the corresponding tumors, were 70.6% and 93.3%, and 66.7% and 100%, respectively, showing similar results compared with previous studies. T790M was detected in 43% of 28 cfDNAs after progression with EGFR-TKI treatment, but in no cfDNAs before the start of the treatment. This chip-based dPCR assay can facilitate detection of EGFR mutations in cfDNA as a minimally invasive method in clinical settings. Copyright © 2017 Elsevier B.V. All rights reserved.

Using DNA chips for identification of tephritid pest species.

PubMed

Chen, Yen-Hou; Liu, Lu-Yan; Tsai, Wei-Huang; Haymer, David S; Lu, Kuang-Hui

2014-08-01

The ability correctly to identify species in a rapid and reliable manner is critical in many situations. For insects in particular, the primary tools for such identification rely on adult-stage morphological characters. For a number of reasons, however, there is a clear need for alternatives. This paper reports on the development of a new method employing DNA biochip technology for the identification of pest species within the family Tephritidae. The DNA biochip developed and tested here quickly and efficiently identifies and discriminates between several tephritid species, except for some that are members of a complex of closely related taxa and that may in fact not represent distinct biological species. The use of these chips offers a number of potential advantages over current methods. Results can be obtained in less than 5 h using material from any stage of the life cycle and with greater sensitivity than other methods currently available. This technology provides a novel tool for the rapid and reliable identification of several major pest species that may be intercepted in imported fruits or other commodities. The existing chips can also easily be expanded to incorporate additional markers and species as needed. © 2013 Society of Chemical Industry.

Rapid detection of a cocaine-binding aptamer using biological nanopores on a chip.

PubMed

Kawano, Ryuji; Osaki, Toshihisa; Sasaki, Hirotaka; Takinoue, Masahiro; Yoshizawa, Satoko; Takeuchi, Shoji

2011-06-08

This paper describes a methodology for the rapid and highly selective detection of cocaine using a membrane protein channel combined with a DNA aptamer. The DNA aptamer recognizes the cocaine molecule with high selectivity. We successfully detected a low concentration of cocaine (300 ng/mL, the drug test cutoff limit) within 60 s using a biological nanopore embedded in a microchip.

[The development of reagents set in the format of DNA-chip for genetic typing of strains of Vibrio cholerae].

PubMed

Pudova, E A; Markelov, M L; Dedkov, V G; Tchekanova, T A; Sadjin, A I; Kirdiyashkina, N P; Bekova, M V; Deviyatkin, A A

2014-05-01

The necessity of development of methods of genic diagnostic of cholera is conditioned by continuation of the Seventh pandemic of cholera, taxonomic variability of strains of Vibrio cholerae involved into pandemic and also permanent danger of delivery of disease to the territory of the Russian Federation. The methods of genic diagnostic of cholera make it possible in a comparatively short time to maximally minutely characterize strains isolated from patients or their environment. The article presents information about working out reagents set for genetic typing of agents of cholera using DNA-chip. The makeup of DNA-chip included oligonucleotide probes making possible to differentiate strains of V. cholerae on serogroups and biovars and to determine their pathogenicity. The single DNA-chip makes it possible to genetically type up to 12 samples concurrently. At that, duration of analysis without accounting stage of DNA separation makes up to 5 hours. In the progress of work, 23 cholera and non-cholera strains were analyzed. The full compliance of DNA-chip typing results to previously known characteristics of strains. Hence, there is a reason to consider availability of further development of reagents set and possibility of its further application in laboratories of regional level and reference centers.

Comparison of the Predictive Accuracy of DNA Array-Based Multigene Classifiers across cDNA Arrays and Affymetrix GeneChips

PubMed Central

Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos

2005-01-01

We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308

Single cell digital polymerase chain reaction on self-priming compartmentalization chip

PubMed Central

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%–4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease. PMID:28191267

Single cell digital polymerase chain reaction on self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Xu, Yanan; Li, Guang; Mu, Ying

2017-01-01

Single cell analysis provides a new framework for understanding biology and disease, however, an absolute quantification of single cell gene expression still faces many challenges. Microfluidic digital polymerase chain reaction (PCR) provides a unique method to absolutely quantify the single cell gene expression, but only limited devices are developed to analyze a single cell with detection variation. This paper describes a self-priming compartmentalization (SPC) microfluidic digital polymerase chain reaction chip being capable of performing single molecule amplification from single cell. The chip can be used to detect four single cells simultaneously with 85% of sample digitization. With the optimized protocol for the SPC chip, we first tested the ability, precision, and sensitivity of our SPC digital PCR chip by assessing β-actin DNA gene expression in 1, 10, 100, and 1000 cells. And the reproducibility of the SPC chip is evaluated by testing 18S rRNA of single cells with 1.6%-4.6% of coefficient of variation. At last, by detecting the lung cancer related genes, PLAU gene expression of A549 cells at the single cell level, the single cell heterogeneity was demonstrated. So, with the power-free, valve-free SPC chip, the gene copy number of single cells can be quantified absolutely with higher sensitivity, reduced labor time, and reagent. We expect that this chip will enable new studies for biology and disease.

Research and development of biochip technologies in Taiwan

NASA Astrophysics Data System (ADS)

Ting, Solomon J.; Chiou, Arthur E. T.

2000-07-01

Recent advancements in several genome-sequencing projects have stimulated an enormous interest in microarray DNA chip technology, especially in the biomedical sciences and pharmaceutical industries. The DNA chips facilitated the miniaturization of conventional nucleic acid hybridizations, by either robotically spotting thousands of library cDNAs or in situ synthesis of high-density oligonucleotides onto solid supports. These innovations have found a wide range of applications in molecular biology, especially in studying gene expression and discovering new genes from the global view of genomic analysis. The research and development of this powerful tool has also received great attentions in Taiwan. In this paper, we report the current progresses of our DNA chip project, along with the current status of other biochip projects in Taiwan, such as protein chip, PCR chip, electrophoresis chip, olfactory chip, etc. The new development of biochip technologies integrates the biotechnology with the semiconductor processing, the micro- electro-mechanical, optoelectronic, and digital signal processing technologies. Most of these biochip technologies utilitze optical detection methods for data acquisition and analysis. The strengths and advantages of different approaches are compared and discussed in this report.

Systolic array IC for genetic computation

NASA Technical Reports Server (NTRS)

Anderson, D.

1991-01-01

Measuring similarities between large sequences of genetic information is a formidable task requiring enormous amounts of computer time. Geneticists claim that nearly two months of CRAY-2 time are required to run a single comparison of the known database against the new bases that will be found this year, and more than a CRAY-2 year for next year's genetic discoveries, and so on. The DNA IC, designed at HP-ICBD in cooperation with the California Institute of Technology and the Jet Propulsion Laboratory, is being implemented in order to move the task of genetic comparison onto workstations and personal computers, while vastly improving performance. The chip is a systolic (pumped) array comprised of 16 processors, control logic, and global RAM, totaling 400,000 FETS. At 12 MHz, each chip performs 2.7 billion 16 bit operations per second. Using 35 of these chips in series on one PC board (performing nearly 100 billion operations per second), a sequence of 560 bases can be compared against the eventual total genome of 3 billion bases, in minutes--on a personal computer. While the designed purpose of the DNA chip is for genetic research, other disciplines requiring similarity measurements between strings of 7 bit encoded data could make use of this chip as well. Cryptography and speech recognition are two examples. A mix of full custom design and standard cells, in CMOS34, were used to achieve these goals. Innovative test methods were developed to enhance controllability and observability in the array. This paper describes these techniques as well as the chip's functionality. This chip was designed in the 1989-90 timeframe.

Microarrays (DNA Chips) for the Classroom Laboratory

ERIC Educational Resources Information Center

Barnard, Betsy; Sussman, Michael; BonDurant, Sandra Splinter; Nienhuis, James; Krysan, Patrick

2006-01-01

We have developed and optimized the necessary laboratory materials to make DNA microarray technology accessible to all high school students at a fraction of both cost and data size. The primary component is a DNA chip/array that students "print" by hand and then analyze using research tools that have been adapted for classroom use. The…

Preparation of Low-Input and Ligation-Free ChIP-seq Libraries Using Template-Switching Technology.

PubMed

Bolduc, Nathalie; Lehman, Alisa P; Farmer, Andrew

2016-10-10

Chromatin immunoprecipitation (ChIP) followed by high-throughput sequencing (ChIP-seq) has become the gold standard for mapping of transcription factors and histone modifications throughout the genome. However, for ChIP experiments involving few cells or targeting low-abundance transcription factors, the small amount of DNA recovered makes ligation of adapters very challenging. In this unit, we describe a ChIP-seq workflow that can be applied to small cell numbers, including a robust single-tube and ligation-free method for preparation of sequencing libraries from sub-nanogram amounts of ChIP DNA. An example ChIP protocol is first presented, resulting in selective enrichment of DNA-binding proteins and cross-linked DNA fragments immobilized on beads via an antibody bridge. This is followed by a protocol for fast and easy cross-linking reversal and DNA recovery. Finally, we describe a fast, ligation-free library preparation protocol, featuring DNA SMART technology, resulting in samples ready for Illumina sequencing. © 2016 by John Wiley & Sons, Inc. Copyright © 2016 John Wiley & Sons, Inc.

Spike-In Normalization of ChIP Data Using DNA-DIG-Antibody Complex.

PubMed

Eberle, Andrea B

2018-01-01

Chromatin immunoprecipitation (ChIP) is a widely used method to determine the occupancy of specific proteins within the genome, helping to unravel the function and activity of specific genomic regions. In ChIP experiments, normalization of the obtained data by a suitable internal reference is crucial. However, particularly when comparing differently treated samples, such a reference is difficult to identify. Here, a simple method to improve the accuracy and reliability of ChIP experiments by the help of an external reference is described. An artificial molecule, composed of a well-defined digoxigenin (DIG) labeled DNA fragment in complex with an anti-DIG antibody, is synthesized and added to each chromatin sample before immunoprecipitation. During the ChIP procedure, the DNA-DIG-antibody complex undergoes the same treatments as the chromatin and is therefore purified and quantified together with the chromatin of interest. This external reference compensates for variability during the ChIP routine and improves the similarity between replicates, thereby emphasizing the biological differences between samples.

CE chips fabricated by injection molding and polyethylene/thermoplastic elastomer film packaging methods.

PubMed

Huang, Fu-Chun; Chen, Yih-Far; Lee, Gwo-Bin

2007-04-01

This study presents a new packaging method using a polyethylene/thermoplastic elastomer (PE/TPE) film to seal an injection-molded CE chip made of either poly(methyl methacrylate) (PMMA) or polycarbonate (PC) materials. The packaging is performed at atmospheric pressure and at room temperature, which is a fast, easy, and reliable bonding method to form a sealed CE chip for chemical analysis and biomedical applications. The fabrication of PMMA and PC microfluidic channels is accomplished by using an injection-molding process, which could be mass-produced for commercial applications. In addition to microfluidic CE channels, 3-D reservoirs for storing biosamples, and CE buffers are also formed during this injection-molding process. With this approach, a commercial CE chip can be of low cost and disposable. Finally, the functionality of the mass-produced CE chip is demonstrated through its successful separation of phiX174 DNA/HaeIII markers. Experimental data show that the S/N for the CE chips using the PE/TPE film has a value of 5.34, when utilizing DNA markers with a concentration of 2 ng/microL and a CE buffer of 2% hydroxypropyl-methylcellulose (HPMC) in Tris-borate-EDTA (TBE) with 1% YO-PRO-1 fluorescent dye. Thus, the detection limit of the developed chips is improved. Lastly, the developed CE chips are used for the separation and detection of PCR products. A mixture of an amplified antibiotic gene for Streptococcus pneumoniae and phiX174 DNA/HaeIII markers was successfully separated and detected by using the proposed CE chips. Experimental data show that these DNA samples were separated within 2 min. The study proposed a promising method for the development of mass-produced CE chips.

Digital PCR on a SlipChip.

PubMed

Shen, Feng; Du, Wenbin; Kreutz, Jason E; Fok, Alice; Ismagilov, Rustem F

2010-10-21

This paper describes a SlipChip to perform digital PCR in a very simple and inexpensive format. The fluidic path for introducing the sample combined with the PCR mixture was formed using elongated wells in the two plates of the SlipChip designed to overlap during sample loading. This fluidic path was broken up by simple slipping of the two plates that removed the overlap among wells and brought each well in contact with a reservoir preloaded with oil to generate 1280 reaction compartments (2.6 nL each) simultaneously. After thermal cycling, end-point fluorescence intensity was used to detect the presence of nucleic acid. Digital PCR on the SlipChip was tested quantitatively by using Staphylococcus aureus genomic DNA. As the concentration of the template DNA in the reaction mixture was diluted, the fraction of positive wells decreased as expected from the statistical analysis. No cross-contamination was observed during the experiments. At the extremes of the dynamic range of digital PCR the standard confidence interval determined using a normal approximation of the binomial distribution is not satisfactory. Therefore, statistical analysis based on the score method was used to establish these confidence intervals. The SlipChip provides a simple strategy to count nucleic acids by using PCR. It may find applications in research applications such as single cell analysis, prenatal diagnostics, and point-of-care diagnostics. SlipChip would become valuable for diagnostics, including applications in resource-limited areas after integration with isothermal nucleic acid amplification technologies and visual readout.

Easy detection of multiple Alexandrium species using DNA chromatography chip.

PubMed

Nagai, Satoshi; Miyamoto, Shigehiko; Ino, Keita; Tajimi, Seisuke; Nishi, Hiromi; Tomono, Jun

2016-01-01

In this study, the Kaneka DNA chromatography chip (KDCC) for the Alexandrium species was successfully developed for simultaneous detection of five Alexandrium species. This method utilizes a DNA-DNA hybridization technology. In the PCR process, specifically designed tagged-primers are used, i.e. a forward primer consisting of a tag domain, which can conjugate with gold nanocolloids on the chip, and a primer domain, which can anneal/amplify the target sequence. However, the reverse primer consists of a tag domain, which can hybridize to the solid-phased capture probe on the chip, and a primer domain, which can anneal/amplify the target sequence. As a result, a red line that originates from gold nanocolloids appears as a positive signal on the chip, and the amplicon is detected visually by the naked eye. This technique is simple, because it is possible to visually detect the target species soon after (<5min) the application of 2μL of PCR amplicon and 65μL of development buffer to the sample pad of the chip. Further, this technique is relatively inexpensive and does not require expensive laboratory equipment, such as real-time Q-PCR machines or DNA microarray detectors, but a thermal cycler. Regarding the detection limit of KDCC for the five Alexandrium species, it varied among species and it was <0.1-10pg and equivalent to 5-500 copies of rRNA genes, indicating that the technique is sensitive enough for practical use to detect several cells of the target species from 1L of seawater. The detection sensitivity of KDCC was also evaluated with two different techniques, i.e. a multiplex-PCR and a digital DNA hybridization by digital DNA chip analyzer (DDCA), using natural plankton assemblages. There was no significant difference in the detection sensitivity among the three techniques, suggesting KDCC can be readily used to monitor the HAB species. Copyright © 2015 Elsevier B.V. All rights reserved.

Digital LAMP in a sample self-digitization (SD) chip

PubMed Central

Herrick, Alison M.; Dimov, Ivan K.; Lee, Luke P.; Chiu, Daniel T.

2012-01-01

This paper describes the realization of digital loop-mediated DNA amplification (dLAMP) in a sample self-digitization (SD) chip. Digital DNA amplification has become an attractive technique to quantify absolute concentrations of DNA in a sample. While digital polymerase chain reaction is still the most widespread implementation, its use in resource—limited settings is impeded by the need for thermal cycling and robust temperature control. In such situations, isothermal protocols that can amplify DNA or RNA without thermal cycling are of great interest. Here, we showed the successful amplification of single DNA molecules in a stationary droplet array using isothermal digital loop-mediated DNA amplification. Unlike most (if not all) existing methods for sample discretization, our design allows for automated, loss-less digitization of sample volumes on-chip. We demonstrated accurate quantification of relative and absolute DNA concentrations with sample volumes of less than 2 μl. We assessed the homogeneity of droplet size during sample self-digitization in our device, and verified that the size variation was small enough such that straightforward counting of LAMP-active droplets sufficed for data analysis. We anticipate that the simplicity and robustness of our SD chip make it attractive as an inexpensive and easy-to-operate device for DNA amplification, for example in point-of-care settings. PMID:22399016

Chromatin immunoprecipitation (ChIP) method for non-model fruit flies (Diptera: Tephritidae) and evidence of histone modifications.

PubMed

Nagalingam, Kumaran; Lorenc, Michał T; Manoli, Sahana; Cameron, Stephen L; Clarke, Anthony R; Dudley, Kevin J

2018-01-01

Interactions between DNA and proteins located in the cell nucleus play an important role in controlling physiological processes by specifying, augmenting and regulating context-specific transcription events. Chromatin immunoprecipitation (ChIP) is a widely used methodology to study DNA-protein interactions and has been successfully used in various cell types for over three decades. More recently, by combining ChIP with genomic screening technologies and Next Generation Sequencing (e.g. ChIP-seq), it has become possible to profile DNA-protein interactions (including covalent histone modifications) across entire genomes. However, the applicability of ChIP-chip and ChIP-seq has rarely been extended to non-model species because of a number of technical challenges. Here we report a method that can be used to identify genome wide covalent histone modifications in a group of non-model fruit fly species (Diptera: Tephritidae). The method was developed by testing and refining protocols that have been used in model organisms, including Drosophila melanogaster. We demonstrate that this method is suitable for a group of economically important pest fruit fly species, viz., Bactrocera dorsalis, Ceratitis capitata, Zeugodacus cucurbitae and Bactrocera tryoni. We also report an example ChIP-seq dataset for B. tryoni, providing evidence for histone modifications in the genome of a tephritid fruit fly for the first time. Since tephritids are major agricultural pests globally, this methodology will be a valuable resource to study taxa-specific evolutionary questions and to assist with pest management. It also provides a basis for researchers working with other non-model species to undertake genome wide DNA-protein interaction studies.

Rapid detection of aflatoxigenic Aspergillus sp. in herbal specimens by a simple, bendable, paper-based lab-on-a-chip.

PubMed

Chaumpluk, Piyasak; Plubcharoensook, Pattra; Prasongsuk, Sehanat

2016-06-01

Postharvest herbal product contamination with mycotoxins and mycotoxin-producing fungi represents a potentially carcinogenic hazard. Aspergillus flavus is a major cause of this issue. Available mold detection methods are PCR-based and rely heavily on laboratories; thus, they are unsuitable for on-site monitoring. In this study, a bendable, paper-based lab-on-a-chip platform was developed to rapidly detect toxigenic Aspergillus spp. DNA. The 3.0-4.0 cm(2) chip is fabricated using Whatman™ filter paper, fishing line and a simple plastic lamination process and has nucleic acid amplification and signal detection components. The Aspergillus assay specifically amplifies the aflatoxin biosynthesis gene, aflR, using loop-mediated isothermal amplification (LAMP); hybridization between target DNA and probes on blue silvernanoplates (AgNPls) yields colorimetric results. Positive results are indicated by the detection pad appearing blue due to dispersed blue AgNPls; negative results are indicated by the detection pad appearing colorless or pale yellow due to probe/target DNA hybridization and AgNPls aggregation. Assay completion requires less than 40 min, has a limit of detection (LOD) of 100 aflR copies, and has high specificity (94.47%)and sensitivity (100%). Contamination was identified in 14 of 32 herbal samples tested (43.75%). This work demonstrates the fabrication of a simple, low-cost, paper-based lab-on-a-chip platform suitable for rapid-detection applications. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

PubMed

Kumar Khanna, Vinod

2007-01-01

The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

Static adsorptive coating of poly(methyl methacrylate) microfluidic chips for extended usage in DNA separations.

PubMed

Du, Xiao-Guang; Fang, Zhao-Lun

2005-12-01

A simple and robust static adsorptive (dynamic) coating process using 2% hydroxyethylcellulose was developed for surface modification of poly(methyl methacrylate) (PMMA) microfluidic chips for DNA separations, suitable for usage over extended periods, involving hundreds of runs. The coating medium was also used as a sieving matrix for the DNA separations following the coating process. Four consecutive static treatments, by simply filling the PMMA chip channels with sieving matrix once every day, were required for obtaining a stable coating and optimum performance. The performance of the coated chips at different phases of the coating process was studied by consecutive gel electrophoretic separations with LIF detection using a PhiX-174/HaeIII DNA digest sample. The coated chip, with daily renewal of the sieving matrix, showed high stability in performance during a 25-day period of systematic study, involving more than 100 individual runs. The performance of the coated chip also remained almost the same after 3 months of continuous usage, during which over 200 separations were performed. The average precision of migration time for the 603-bp fragment was 1.31% RSD (n = 6) during the 25-day study, with a separation efficiency of 6.5 x 10(4) plates (effective separation length 5.4 cm).

Integration of Biological Specificity with Solid-State Devices for Selective Chemical Sensing

DTIC Science & Technology

2016-01-29

materials onto a single sensor chip. We demonstrate a path to combine a large number of DNA aptamers with nanoscale device arrays to achieve integrated...solid-state, sensor chips with specificity. 15. SUBJECT TERMS DNA sensors aptamers chemiresistors nanosensors LSER specificity vapor 16. SECURITY...and engineering. In particular, DNA and RNA aptamers are a class of man- made receptors with a high degree of specificity that rivals proteins. DNA

Molecular Sticker Model Stimulation on Silicon for a Maximum Clique Problem

PubMed Central

Ning, Jianguo; Li, Yanmei; Yu, Wen

2015-01-01

Molecular computers (also called DNA computers), as an alternative to traditional electronic computers, are smaller in size but more energy efficient, and have massive parallel processing capacity. However, DNA computers may not outperform electronic computers owing to their higher error rates and some limitations of the biological laboratory. The stickers model, as a typical DNA-based computer, is computationally complete and universal, and can be viewed as a bit-vertically operating machine. This makes it attractive for silicon implementation. Inspired by the information processing method on the stickers computer, we propose a novel parallel computing model called DEM (DNA Electronic Computing Model) on System-on-a-Programmable-Chip (SOPC) architecture. Except for the significant difference in the computing medium—transistor chips rather than bio-molecules—the DEM works similarly to DNA computers in immense parallel information processing. Additionally, a plasma display panel (PDP) is used to show the change of solutions, and helps us directly see the distribution of assignments. The feasibility of the DEM is tested by applying it to compute a maximum clique problem (MCP) with eight vertices. Owing to the limited computing sources on SOPC architecture, the DEM could solve moderate-size problems in polynomial time. PMID:26075867

Single cell HaloChip assay on paper for point-of-care diagnosis.

PubMed

Ma, Liyuan; Qiao, Yong; Jones, Ross; Singh, Narendra; Su, Ming

2016-11-01

This article describes a paper-based low cost single cell HaloChip assay that can be used to assess drug- and radiation-induced DNA damage at point-of-care. Printing ink on paper effectively blocks fluorescence of paper materials, provides high affinity to charged polyelectrolytes, and prevents penetration of water in paper. After exposure to drug or ionizing radiation, cells are patterned on paper to create discrete and ordered single cell arrays, embedded inside an agarose gel, lysed with alkaline solution to allow damaged DNA fragments to diffuse out of nucleus cores, and form diffusing halos in the gel matrix. After staining DNA with a fluorescent dye, characteristic halos formed around cells, and the level of DNA damage can be quantified by determining sizes of halos and nucleus with an image processing program based on MATLAB. With its low fabrication cost and easy operation, this HaloChip on paper platform will be attractive to rapidly and accurately determine DNA damage for point-of-care evaluation of drug efficacy and radiation condition. Graphical Abstract Single cell HaloChip on paper.

On-Chip Fluorescence Switching System for Constructing a Rewritable Random Access Data Storage Device.

PubMed

Nguyen, Hoang Hiep; Park, Jeho; Hwang, Seungwoo; Kwon, Oh Seok; Lee, Chang-Soo; Shin, Yong-Beom; Ha, Tai Hwan; Kim, Moonil

2018-01-10

We report the development of on-chip fluorescence switching system based on DNA strand displacement and DNA hybridization for the construction of a rewritable and randomly accessible data storage device. In this study, the feasibility and potential effectiveness of our proposed system was evaluated with a series of wet experiments involving 40 bits (5 bytes) of data encoding a 5-charactered text (KRIBB). Also, a flexible data rewriting function was achieved by converting fluorescence signals between "ON" and "OFF" through DNA strand displacement and hybridization events. In addition, the proposed system was successfully validated on a microfluidic chip which could further facilitate the encoding and decoding process of data. To the best of our knowledge, this is the first report on the use of DNA hybridization and DNA strand displacement in the field of data storage devices. Taken together, our results demonstrated that DNA-based fluorescence switching could be applicable to construct a rewritable and randomly accessible data storage device through controllable DNA manipulations.

Isolation of centromeric-tandem repetitive DNA sequences by chromatin affinity purification using a HaloTag7-fused centromere-specific histone H3 in tobacco.

PubMed

Nagaki, Kiyotaka; Shibata, Fukashi; Kanatani, Asaka; Kashihara, Kazunari; Murata, Minoru

2012-04-01

The centromere is a multi-functional complex comprising centromeric DNA and a number of proteins. To isolate unidentified centromeric DNA sequences, centromere-specific histone H3 variants (CENH3) and chromatin immunoprecipitation (ChIP) have been utilized in some plant species. However, anti-CENH3 antibody for ChIP must be raised in each species because of its species specificity. Production of the antibodies is time-consuming and costly, and it is not easy to produce ChIP-grade antibodies. In this study, we applied a HaloTag7-based chromatin affinity purification system to isolate centromeric DNA sequences in tobacco. This system required no specific antibody, and made it possible to apply a highly stringent wash to remove contaminated DNA. As a result, we succeeded in isolating five tandem repetitive DNA sequences in addition to the centromeric retrotransposons that were previously identified by ChIP. Three of the tandem repeats were centromere-specific sequences located on different chromosomes. These results confirm the validity of the HaloTag7-based chromatin affinity purification system as an alternative method to ChIP for isolating unknown centromeric DNA sequences. The discovery of more than two chromosome-specific centromeric DNA sequences indicates the mosaic structure of tobacco centromeres. © Springer-Verlag 2011

Multifunctional System-on-Glass for Lab-on-Chip applications.

PubMed

Petrucci, G; Caputo, D; Lovecchio, N; Costantini, F; Legnini, I; Bozzoni, I; Nascetti, A; de Cesare, G

2017-07-15

Lab-on-Chip are miniaturized systems able to perform biomolecular analysis in shorter time and with lower reagent consumption than a standard laboratory. Their miniaturization interferes with the multiple functions that the biochemical procedures require. In order to address this issue, our paper presents, for the first time, the integration on a single glass substrate of different thin film technologies in order to develop a multifunctional platform suitable for on-chip thermal treatments and on-chip detection of biomolecules. The proposed System on-Glass hosts thin metal films acting as heating sources; hydrogenated amorphous silicon diodes acting both as temperature sensors to monitor the temperature distribution and photosensors for the on-chip detection and a ground plane ensuring that the heater operation does not affect the photodiode currents. The sequence of the technological steps, the deposition temperatures of the thin films and the parameters of the photolithographic processes have been optimized in order to overcome all the issues of the technological integration. The device has been designed, fabricated and tested for the implementation of DNA amplification through the Polymerase Chain Reaction (PCR) with thermal cycling among three different temperatures on a single site. The glass has been connected to an electronic system that drives the heaters and controls the temperature and light sensors. It has been optically and thermally coupled with another glass hosting a microfluidic network made in polydimethylsiloxane that includes thermally actuated microvalves and a PCR process chamber. The successful DNA amplification has been verified off-chip by using a standard fluorometer. Copyright © 2016 Elsevier B.V. All rights reserved.

Chromatin immunoprecipitation of mouse embryos.

PubMed

Voss, Anne K; Dixon, Mathew P; McLennan, Tamara; Kueh, Andrew J; Thomas, Tim

2012-01-01

During prenatal development, a large number of different cell types are formed, the vast majority of which contain identical genetic material. The basis of the great variety in cell phenotype and function is the differential expression of the approximately 25,000 genes in the mammalian genome. Transcriptional activity is regulated at many levels by proteins, including members of the basal transcriptional apparatus, DNA-binding transcription factors, and chromatin-binding proteins. Importantly, chromatin structure dictates the availability of a specific genomic locus for transcriptional activation as well as the efficiency, with which transcription can occur. Chromatin immunoprecipitation (ChIP) is a method to assess if chromatin modifications or proteins are present at a specific locus. ChIP involves the cross linking of DNA and associated proteins and immunoprecipitation using specific antibodies to DNA-associated proteins followed by examination of the co-precipitated DNA sequences or proteins. In the last few years, ChIP has become an essential technique for scientists studying transcriptional regulation and chromatin structure. Using ChIP on mouse embryos, we can document the presence or absence of specific proteins and chromatin modifications at genomic loci in vivo during mammalian development. Here, we describe a ChIP technique adapted for mouse embryos.

Functional integration of PCR amplification and capillary eletrophoresis in a microfabricated DNA analysis device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woolley, A.T.; deMello, A.J.; Mathies, R.A.

Microfabricated silicon PCR reactors and glass capillary electrophoresis (CE) chips have been successfully coupled to form an integrated DNA analysis system. This construct combines the rapid thermal cycling capabilities of microfabricated PCR devices (10{degree}C/s heating, 2.5{degree}C/s cooling) with the high-speed (<120 s) DNA separations provided by microfabricated CE chips. The PCR chamber and the CE chip were directly linked through a photolithographically fabricated channel filled with hydroxyethylcellulose sieving matrix. Electrophoretic injection directly from the PCR chamber through the cross injection channel was used as an `electrophoretic valve` to couple the PCR and CE devices on-chip. To demonstrate the functionality ofmore » this system, a 15 min PCR amplification of a {Beta}-globin target cloned in m13 was immediately followed by high-speed CE chip separation in under 120 s, providing a rapid PCR-CE analysis in under 20 min. A rapid assay for genomic Salmonella DNA was performed in under 45 min, demonstrating that challenging amplifications of diagnostically interesting targets can also be performed. Real-time monitoring of PCR target amplification in these integrated PCR-CE devices is also feasible. 33 refs., 6 figs.« less

Gene chips and arrays revealed: a primer on their power and their uses.

PubMed

Watson, S J; Akil, H

1999-03-01

This article provides an overview and general explanation of the rapidly developing area of gene chips and expression array technology. These are methods targeted at allowing the simultaneous study of thousands of genes or messenger RNAs under various physiological and pathological states. Their technical basis grows from the Human Genome Project. Both methods place DNA strands on glass computer chips (or microscope slides). Expression arrays start with complementary DNA (cDNA) clones derived from the EST data base, whereas Gene Chips synthesize oligonucleotides directly on the chip itself. Both are analyzed using image analysis systems, are capable of reading values from two different individuals at any one site, and can yield quantitative data for thousands of genes or mRNAs per slide. These methods promise to revolutionize molecular biology, cell biology, neuroscience and psychiatry. It is likely that this technology will radically open up our ability to study the actions and structure of the multiple genes involved in the complex genetics of brain disorders.

Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection

DTIC Science & Technology

2006-07-28

manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in

Electrochemical detection of methylated DNA on a microfluidic chip with nanoelectrokinetic pre-concentration.

PubMed

Hong, Sung A; Kim, Yong-June; Kim, Sung Jae; Yang, Sung

2018-06-01

DNA methylation is considered to be a promising marker for the early diagnosis and prognosis of cancer. However, direct detection of the methylated DNAs in clinically relevant samples is still challenging because of its extremely low concentration (~fM). Here, an integrated microfluidic chip is reported, which is capable of pre-concentrating the methylated DNAs using ion concentration polarization (ICP) and electrochemically detecting the pre-concentrated DNAs on a single chip. The proposed chip is the first demonstration of an electrochemical detection of both level and concentration of the methylated DNAs by integrating a DNA pre-concentration unit without gene amplification. Using the proposed chip, 500 fM to 500 nM of methylated DNAs is pre-concentrated by almost 100-fold in 10 min, resulting in a drastic improvement of the electrochemical detection threshold down to the fM level. The proposed chip is able to measure not only the DNA concentration, but also the level of methylation using human urine sample by performing a consecutive electrochemical sensing on a chip. For clinical application, the level as well as the concentration of methylation of glutathione-S transferase-P1 (GSTP1) and EGF-containing fibulin-like extracellular matrix protein 1 (EFEMP1), which are known to be closely associated with prostate cancer diagnosis, are electrochemically detected in human urine spiked with these genes. The developed chip shows a limit of detection (LoD) of 7.9 pM for GSTP1 and 11.8 pM for EFEMP1 and is able to detect the level of methylation in a wide range from 10% to 100% with the concentration variation from 50 pM to 500 nM. Copyright © 2018 Elsevier B.V. All rights reserved.

Optimization of applied voltages for on-chip concentration of DNA using nanoslit

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2017-12-01

On-chip sample concentration is an effective pretreatment to improve the detection sensitivity of lab-on-a-chip devices for biochemical analysis. In a previous study, we successfully achieved DNA sample concentration using a nanoslit fabricated in the microchannel of a device designed for DNA size separation. The nanoslit was a channel with a depth smaller than the diameter of a random coil-shaped DNA molecule. The concentration was achieved using the entropy trap at the boundary between the microchannel and the nanoslit. DNA molecules migrating toward the nanoslit owing to electrophoresis were trapped in front of the nanoslit and the concentration was enhanced over time. In this study, we successfully maximize the molecular concentration by optimizing the applied voltage for electrophoresis and verifying the effect of temperature. In addition, we propose a model formula that predicts the molecular concentration, the validity of which is confirmed through comparison with experimental results.

Assessment of DNA extracted from FTA® cards for use on the Illumina iSelect BeadChip

PubMed Central

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-01-01

Background As FTA® cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes ≥ 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. Findings An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. Conclusion We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform. PMID:19531223

Assessment of DNA extracted from FTA cards for use on the Illumina iSelect BeadChip.

PubMed

McClure, Matthew C; McKay, Stephanie D; Schnabel, Robert D; Taylor, Jeremy F

2009-06-16

As FTA cards provide an ideal medium for the field collection of DNA we sought to assess the quality of genomic DNA extracted from this source for use on the Illumina BovineSNP50 iSelect BeadChip which requires unbound, relatively intact (fragment sizes >or= 2 kb), and high-quality DNA. Bovine blood and nasal swab samples collected on FTA cards were extracted using the commercially available GenSolve kit with a minor modification. The call rate and concordance of genotypes from each sample were compared to those obtained from whole blood samples extracted by standard PCI extraction. An ANOVA analysis indicated no significant difference (P > 0.72) in BovineSNP50 genotype call rate between DNA extracted from FTA cards by the GenSolve kit or extracted from whole blood by PCI. Two sample t-tests demonstrated that the DNA extracted from the FTA cards produced genotype call and concordance rates that were not different to those produced by assaying DNA samples extracted by PCI from whole blood. We conclude that DNA extracted from FTA cards by the GenSolve kit is of sufficiently high quality to produce results comparable to those obtained from DNA extracted from whole blood when assayed by the Illumina iSelect technology. Additionally, we validate the use of nasal swabs as an alternative to venous blood or buccal samples from animal subjects for reliably producing high quality genotypes on this platform.

Droplet-based micro oscillating-flow PCR chip

NASA Astrophysics Data System (ADS)

Wang, Wei; Li, Zhi-Xin; Luo, Rong; Lü, Shu-Hai; Xu, Ai-Dong; Yang, Yong-Jun

2005-08-01

Polymerase chain reactions (PCR), thermally activated chemical reactions which are widely used for nucleic acid amplification, have recently received much attention in microelectromechanical systems and micro total analysis systems because a wide variety of DNA/RNA molecules can be enriched by PCR for further analyses. In the present work, a droplet-based micro oscillating-flow PCR chip was designed and fabricated by the silicon microfabrication technique. Three different temperature zones, which were stable at denaturation, extension and annealing temperatures and isolated from each other by a thin-wall linkage, were integrated with a single, simple and straight microchannel to form the chip's basic functional structure. The PCR mixture was injected into the chip as a single droplet and flowed through the three temperature zones in the main microchannel in an oscillating manner to achieve the temperature maintenance and transitions. The chip's thermal performance was theoretically analyzed and numerically simulated. The results indicated that the time needed for the temperature of the droplet to change to the target value is less than 1 s, and the root mean square error of temperature is less than 0.2 °C. A droplet of 1 µl PCR mixture with standard HPV (Human Papilloma Virus)-DNA sample inside was amplified by the present chip and the results were analyzed by slab gel electrophoresis with separation of DNA markers in parallel. The electrophoresis results demonstrated that the micro oscillating-flow PCR chip successfully amplified the HPV-DNA, with a processing time of about 15 min which is significantly reduced compared to that for the conventional PCR instrument.

Isolation of Microarray-Grade Total RNA, MicroRNA, and DNA from a Single PAXgene Blood RNA Tube

PubMed Central

Kruhøffer, Mogens; Dyrskjøt, Lars; Voss, Thorsten; Lindberg, Raija L.P.; Wyrich, Ralf; Thykjaer, Thomas; Orntoft, Torben F.

2007-01-01

We have developed a procedure for isolation of microRNA and genomic DNA in addition to total RNA from whole blood stabilized in PAXgene Blood RNA tubes. The procedure is based on automatic extraction on a BioRobot MDx and includes isolation of DNA from a fraction of the stabilized blood and recovery of small RNA species that are otherwise lost. The procedure presented here is suitable for large-scale experiments and is amenable to further automation. Procured total RNA and DNA was tested using Affymetrix Expression and single-nucleotide polymorphism GeneChips, respectively, and isolated microRNA was tested using spotted locked nucleic acid-based microarrays. We conclude that the yield and quality of total RNA, microRNA, and DNA from a single PAXgene blood RNA tube is sufficient for downstream microarray analysis. PMID:17690207

The GenoChip: A New Tool for Genetic Anthropology

PubMed Central

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G.; Greenspan, Bennett; Spencer Wells, R.

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project’s new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics. PMID:23666864

The GenoChip: a new tool for genetic anthropology.

PubMed

Elhaik, Eran; Greenspan, Elliott; Staats, Sean; Krahn, Thomas; Tyler-Smith, Chris; Xue, Yali; Tofanelli, Sergio; Francalacci, Paolo; Cucca, Francesco; Pagani, Luca; Jin, Li; Li, Hui; Schurr, Theodore G; Greenspan, Bennett; Spencer Wells, R

2013-01-01

The Genographic Project is an international effort aimed at charting human migratory history. The project is nonprofit and nonmedical, and, through its Legacy Fund, supports locally led efforts to preserve indigenous and traditional cultures. Although the first phase of the project was focused on uniparentally inherited markers on the Y-chromosome and mitochondrial DNA (mtDNA), the current phase focuses on markers from across the entire genome to obtain a more complete understanding of human genetic variation. Although many commercial arrays exist for genome-wide single-nucleotide polymorphism (SNP) genotyping, they were designed for medical genetic studies and contain medically related markers that are inappropriate for global population genetic studies. GenoChip, the Genographic Project's new genotyping array, was designed to resolve these issues and enable higher resolution research into outstanding questions in genetic anthropology. The GenoChip includes ancestry informative markers obtained for over 450 human populations, an ancient human (Saqqaq), and two archaic hominins (Neanderthal and Denisovan) and was designed to identify all known Y-chromosome and mtDNA haplogroups. The chip was carefully vetted to avoid inclusion of medically relevant markers. To demonstrate its capabilities, we compared the FST distributions of GenoChip SNPs to those of two commercial arrays. Although all arrays yielded similarly shaped (inverse J) FST distributions, the GenoChip autosomal and X-chromosomal distributions had the highest mean FST, attesting to its ability to discern subpopulations. The chip performances are illustrated in a principal component analysis for 14 worldwide populations. In summary, the GenoChip is a dedicated genotyping platform for genetic anthropology. With an unprecedented number of approximately 12,000 Y-chromosomal and approximately 3,300 mtDNA SNPs and over 130,000 autosomal and X-chromosomal SNPs without any known health, medical, or phenotypic relevance, the GenoChip is a useful tool for genetic anthropology and population genetics.

A label-free impedimetric DNA sensing chip integrated with AC electroosmotic stirring.

PubMed

Wu, Ching-Chou; Yang, Dong-Jie

2013-05-15

AC electroosmosis (ACEO) flow and label-free electrochemical impedance spectroscopy are employed to increase the hybridization rate and specifically detect target DNA (tDNA) concentrations. A low-ionic-strength solution, 6.1μS/cm 1mM Tris (pH 9.3), was used to produce ACEO and proved the feasibility of hybridization. Adequate voltage parameters for the simultaneous ACEO driving and DNA hybridization in the 1mM Tris solution were 1.5 Vpp and 200Hz. Moreover, an electrode set with a 1:4 ring width-to-disk diameter ratio exhibited a larger ACEO velocity above the disk electrode surface to improve collecting efficiency. The ACEO-integrated DNA sensing chips could reach 90% saturation hybridization within 117s. The linear range and detection limit of the sensors was 10aM-10pM and 10aM, respectively. The label-free impedimetric DNA sensing chips with integrated ACEO stirring can perform rapid hybridization and highly-sensitive detections to specifically measure tDNA concentrations. Copyright © 2013 Elsevier B.V. All rights reserved.

A Spiking Strategy for ChIP-chip Data Normalization in S. cerevisiae.

PubMed

Jeronimo, Célia; Robert, François

2017-01-01

Chromatin immunoprecipitation coupled to DNA microarrays (ChIP-chip) is widely used in the chromatin field, notably to map the position of histone variants or histone modifications along the genome. Often, the position and the occupancy of these epigenetic marks are to be compared between different experiments. It is now increasingly recognized that such cross-sample comparison is better done using externally added exogenous controls for normalization but no such method has been described for ChIP-chip. Here we describe a spiking normalization strategy that makes use of phiX174 phage DNA as a spiked control for normalization of ChIP-chip signals across different experiments.

The characterization of four gene expression analysis in circulating tumor cells made by Multiplex-PCR from the AdnaTest kit on the lab-on-a-chip Agilent DNA 1000 platform.

PubMed

Škereňová, Markéta; Mikulová, Veronika; Čapoun, Otakar; Zima, Tomáš

2016-01-01

Nowadays, on-a-chip capillary electrophoresis is a routine method for the detection of PCR fragments. The Agilent 2100 Bioanalyzer was one of the first commercial devices in this field. Our project was designed to study the characteristics of Agilent DNA 1000 kit in PCR fragment analysis as a part of circulating tumour cell (CTC) detection technique. Despite the common use of this kit a complex analysis of the results from a long-term project is still missing. A commercially available Agilent DNA 1000 kit was used as a final step in the CTC detection (AdnaTest) for the determination of the presence of PCR fragments generated by Multiplex PCR. Data from 30 prostate cancer patients obtained during two years of research were analyzed to determine the trueness and precision of the PCR fragment size determination. Additional experiments were performed to demonstrate the precision (repeatability, reproducibility) and robustness of PCR fragment concentration determination. The trueness and precision of the size determination was below 3% and 2% respectively. The repeatability of the concentration determination was below 15%. The difference in concentration determination increases when Multiplex-PCR/storage step is added between the two measurements of one sample. The characteristics established in our study are in concordance with the manufacturer's specifications established for a ladder as a sample. However, the concentration determination may vary depending on chip preparation, sample storage and concentration. The 15% variation of concentration determination repeatability was shown to be partly proportional and can be suppressed by proper normalization.

Microfluidic magnetic fluidized bed for DNA analysis in continuous flow mode.

PubMed

Hernández-Neuta, Iván; Pereiro, Iago; Ahlford, Annika; Ferraro, Davide; Zhang, Qiongdi; Viovy, Jean-Louis; Descroix, Stéphanie; Nilsson, Mats

2018-04-15

Magnetic solid phase substrates for biomolecule manipulation have become a valuable tool for simplification and automation of molecular biology protocols. However, the handling of magnetic particles inside microfluidic chips for miniaturized assays is often challenging due to inefficient mixing, aggregation, and the advanced instrumentation required for effective actuation. Here, we describe the use of a microfluidic magnetic fluidized bed approach that enables dynamic, highly efficient and simplified magnetic bead actuation for DNA analysis in a continuous flow platform with minimal technical requirements. We evaluate the performance of this approach by testing the efficiency of individual steps of a DNA assay based on padlock probes and rolling circle amplification. This assay comprises common nucleic acid analysis principles, such as hybridization, ligation, amplification and restriction digestion. We obtained efficiencies of up to 90% for these reactions with high throughput processing up to 120μL of DNA dilution at flow rates ranging from 1 to 5μL/min without compromising performance. The fluidized bed was 20-50% more efficient than a commercially available solution for microfluidic manipulation of magnetic beads. Moreover, to demonstrate the potential of this approach for integration into micro-total analysis systems, we optimized the production of a low-cost polymer based microarray and tested its analytical performance for integrated single-molecule digital read-out. Finally, we provide the proof-of-concept for a single-chamber microfluidic chip that combines the fluidized bed with the polymer microarray for a highly simplified and integrated magnetic bead-based DNA analyzer, with potential applications in diagnostics. Copyright © 2017 Elsevier B.V. All rights reserved.

How SNP chips will advance our knowledge of factors controlling puberty and aid in selecting replacement females

USDA-ARS?s Scientific Manuscript database

The promise of genomic selection is that genetic potential can be accurately predicted from genotypes. Simple deoxyribonucleic acid (DNA) tests might replace low accuracy predictions based on performance and pedigree for expensive or lowly heritable measures of puberty and fertility. The promise i...

Whole mitochondrial genome screening in maternally inherited non-syndromic hearing impairment using a microarray resequencing mitochondrial DNA chip.

PubMed

Lévêque, Marianne; Marlin, Sandrine; Jonard, Laurence; Procaccio, Vincent; Reynier, Pascal; Amati-Bonneau, Patrizia; Baulande, Sylvain; Pierron, Denis; Lacombe, Didier; Duriez, Françoise; Francannet, Christine; Mom, Thierry; Journel, Hubert; Catros, Hélène; Drouin-Garraud, Valérie; Obstoy, Marie-Françoise; Dollfus, Hélène; Eliot, Marie-Madeleine; Faivre, Laurence; Duvillard, Christian; Couderc, Remy; Garabedian, Eréa-Noël; Petit, Christine; Feldmann, Delphine; Denoyelle, Françoise

2007-11-01

Mitochondrial DNA (mtDNA) mutations have been implicated in non-syndromic hearing loss either as primary or as predisposing factors. As only a part of the mitochondrial genome is usually explored in deafness, its prevalence is probably under-estimated. Among 1350 families with non-syndromic sensorineural hearing loss collected through a French collaborative network, we selected 29 large families with a clear maternal lineage and screened them for known mtDNA mutations in 12S rRNA, tRNASer(UCN) and tRNALeu(UUR) genes. When no mutation could be identified, a whole mitochondrial genome screening was performed, using a microarray resequencing chip: the MitoChip version 2.0 developed by Affymetrix Inc. Known mtDNA mutations was found in nine of the 29 families, which are described in the article: five with A1555G, two with the T7511C, one with 7472insC and one with A3243G mutation. In the remaining 20 families, the resequencing Mitochip detected 258 mitochondrial homoplasmic variants and 107 potentially heteroplasmic variants. Controls were made by direct sequencing on selected fragments and showed a high sensibility of the MitoChip but a low specificity, especially for heteroplasmic variations. An original analysis on the basis of species conservation, frequency and phylogenetic investigation was performed to select the more probably pathogenic variants. The entire genome analysis allowed us to identify five additional families with a putatively pathogenic mitochondrial variant: T669C, C1537T, G8078A, G12236A and G15077A. These results indicate that the new MitoChip platform is a rapid and valuable tool for identification of new mtDNA mutations in deafness.

In situ synthesis of protein arrays.

PubMed

He, Mingyue; Stoevesandt, Oda; Taussig, Michael J

2008-02-01

In situ or on-chip protein array methods use cell free expression systems to produce proteins directly onto an immobilising surface from co-distributed or pre-arrayed DNA or RNA, enabling protein arrays to be created on demand. These methods address three issues in protein array technology: (i) efficient protein expression and availability, (ii) functional protein immobilisation and purification in a single step and (iii) protein on-chip stability over time. By simultaneously expressing and immobilising many proteins in parallel on the chip surface, the laborious and often costly processes of DNA cloning, expression and separate protein purification are avoided. Recently employed methods reviewed are PISA (protein in situ array) and NAPPA (nucleic acid programmable protein array) from DNA and puromycin-mediated immobilisation from mRNA.

Optimization of multiplexed PCR on an integrated microfluidic forensic platform for rapid DNA analysis.

PubMed

Estes, Matthew D; Yang, Jianing; Duane, Brett; Smith, Stan; Brooks, Carla; Nordquist, Alan; Zenhausern, Frederic

2012-12-07

This study reports the design, prototyping, and assay development of multiplexed polymerase chain reaction (PCR) on a plastic microfluidic device. Amplification of 17 DNA loci is carried out directly on-chip as part of a system for continuous workflow processing from sample preparation (SP) to capillary electrophoresis (CE). For enhanced performance of on-chip PCR amplification, improved control systems have been developed making use of customized Peltier assemblies, valve actuators, software, and amplification chemistry protocols. Multiple enhancements to the microfluidic chip design have been enacted to improve the reliability of sample delivery through the various on-chip modules. This work has been enabled by the encapsulation of PCR reagents into a solid phase material through an optimized Solid Phase Encapsulating Assay Mix (SPEAM) bead-based hydrogel fabrication process. SPEAM bead technology is reliably coupled with precise microfluidic metering and dispensing for efficient amplification and subsequent DNA short tandem repeat (STR) fragment analysis. This provides a means of on-chip reagent storage suitable for microfluidic automation, with the long shelf-life necessary for point-of-care (POC) or field deployable applications. This paper reports the first high quality 17-plex forensic STR amplification from a reference sample in a microfluidic chip with preloaded solid phase reagents, that is designed for integration with up and downstream processing.

Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

PubMed

Lee, Seong-Hun

2014-11-01

There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

Self-powered integrated microfluidic point-of-care low-cost enabling (SIMPLE) chip

PubMed Central

Yeh, Erh-Chia; Fu, Chi-Cheng; Hu, Lucy; Thakur, Rohan; Feng, Jeffrey; Lee, Luke P.

2017-01-01

Portable, low-cost, and quantitative nucleic acid detection is desirable for point-of-care diagnostics; however, current polymerase chain reaction testing often requires time-consuming multiple steps and costly equipment. We report an integrated microfluidic diagnostic device capable of on-site quantitative nucleic acid detection directly from the blood without separate sample preparation steps. First, we prepatterned the amplification initiator [magnesium acetate (MgOAc)] on the chip to enable digital nucleic acid amplification. Second, a simplified sample preparation step is demonstrated, where the plasma is separated autonomously into 224 microwells (100 nl per well) without any hemolysis. Furthermore, self-powered microfluidic pumping without any external pumps, controllers, or power sources is accomplished by an integrated vacuum battery on the chip. This simple chip allows rapid quantitative digital nucleic acid detection directly from human blood samples (10 to 105 copies of methicillin-resistant Staphylococcus aureus DNA per microliter, ~30 min, via isothermal recombinase polymerase amplification). These autonomous, portable, lab-on-chip technologies provide promising foundations for future low-cost molecular diagnostic assays. PMID:28345028

Programmable lab-on-a-chip system for single cell analysis

NASA Astrophysics Data System (ADS)

Thalhammer, S.

2009-05-01

The collection, selection, amplification and detection of minimum genetic samples became a part of everyday life in medical and biological laboratories, to analyze DNA-fragments of pathogens, patient samples and traces on crime scenes. About a decade ago, a handful of researchers began discussing an intriguing idea. Could the equipment needed for everyday chemistry and biology procedures be shrunk to fit on a chip in the size of a fingernail? Miniature devices for, say, analysing DNA and proteins should be faster and cheaper than conventional versions. Lab-on-a-chip is an advanced technology that integrates a microfluidic system on a microscale chip device. The "laboratory" is created by means of channels, mixers, reservoirs, diffusion chambers, integrated electrodes, pumps, valves and more. With lab-ona- chip technology, complete laboratories on a square centimetre can be created. Here, a multifunctional programmable Lab-on-a-Chip driven by nanofluidics and controlled by surface acoustic waves (SAW) is presented. This system combines serial DNA-isolation-, amplification- and array-detection-process on a modified glass-platform. The fluid actuation is controlled via SAW by interdigital transducers implemented in the chemical modified chip surface. The chemical surface modification allows fluid handling in the sub-microliter range. Minute amount of sample material is extracted by laser-based microdissection out of e.g. histological sections at the single cell level. A few picogram of genetic material are isolated and transferred via a low-pressure transfer system (SPATS) onto the chip. Subsequently the genetic material inside single droplets, which behave like "virtual" beaker, is transported to the reaction and analysis centers on the chip surface via surface acoustic waves, mainly known as noise dumping filters in mobile phones. At these "biological reactors" the genetic material is processed, e.g. amplified via polymerase chain reaction methods, and genetically characterized.

Development of a digital microfluidic platform for point of care testing

PubMed Central

Sista, Ramakrishna; Hua, Zhishan; Thwar, Prasanna; Sudarsan, Arjun; Srinivasan, Vijay; Eckhardt, Allen; Pollack, Michael; Pamula, Vamsee

2009-01-01

Point of care testing is playing an increasingly important role in improving the clinical outcome in health care management. The salient features of a point of care device are quick results, integrated sample preparation and processing, small sample volumes, portability, multifunctionality and low cost. In this paper, we demonstrate some of these salient features utilizing an electrowetting-based Digital Microfluidic platform. We demonstrate the performance of magnetic bead-based immunoassays (cardiac troponin I) on a digital microfluidic cartridge in less than 8 minutes using whole blood samples. Using the same microfluidic cartridge, a 40-cycle real-time polymerase chain reaction was performed within 12 minutes by shuttling a droplet between two thermal zones. We further demonstrate, on the same cartridge, the capability to perform sample preparation for bacterial and fungal infectious disease pathogens (methicillin-resistance Staphylococcus aureus and Candida albicans) and for human genomic DNA using magnetic beads. In addition to rapid results and integrated sample preparation, electrowetting-based digital microfluidic instruments are highly portable because fluid pumping is performed electronically. All the digital microfluidic chips presented here were fabricated on printed circuit boards utilizing mass production techniques that keep the cost of the chip low. Due to the modularity and scalability afforded by digital microfluidics, multifunctional testing capability, such as combinations within and between immunoassays, DNA amplification, and enzymatic assays, can be brought to the point of care at a relatively low cost because a single chip can be configured in software for different assays required along the path of care. PMID:19023472

Micro flow-through PCR in a PMMA chip fabricated by KrF excimer laser.

PubMed

Yao, Liying; Liu, Baoan; Chen, Tao; Liu, Shibing; Zuo, Tiechuan

2005-09-01

As the third PCR technology, micro flow-through PCR chip can amplify DNA specifically in an exponential fashion in vitro. Nowadays many academies in the world have successfully amplified DNA using their own-made flow-through PCR chip. In this paper, the ablation principle of PMMA at 248 nm excimer laser was studied, then a PMMA based flow-through PCR chip with 20 cycles was fabricated by excimer laser at 19 kv and 18 mm/min. The chip was bonded together with another cover chip at 105( composite function)C, 160 N and 20 minutes. In the end, it was integrated with electrical thermal thin films and Pt 100 temperature sensors. The temperature controllers was built standard PID digital temperature controller, the temperature control precision was +/- 0.2( composite function)C. The temperature grads between the three temperature zones were 16.5 and 22.2( composite function)C respectively, the gaps between the temperature zones could realize heat insulation.

The development and validation of EpiComet-Chip, a modified high-throughput comet assay for the assessment of DNA methylation status.

PubMed

Townsend, Todd A; Parrish, Marcus C; Engelward, Bevin P; Manjanatha, Mugimane G

2017-08-01

DNA damage and alterations in global DNA methylation status are associated with multiple human diseases and are frequently correlated with clinically relevant information. Therefore, assessing DNA damage and epigenetic modifications, including DNA methylation, is critical for predicting human exposure risk of pharmacological and biological agents. We previously developed a higher-throughput platform for the single cell gel electrophoresis (comet) assay, CometChip, to assess DNA damage and genotoxic potential. Here, we utilized the methylation-dependent endonuclease, McrBC, to develop a modified alkaline comet assay, "EpiComet," which allows single platform evaluation of genotoxicity and global DNA methylation [5-methylcytosine (5-mC)] status of single-cell populations under user-defined conditions. Further, we leveraged the CometChip platform to create an EpiComet-Chip system capable of performing quantification across simultaneous exposure protocols to enable unprecedented speed and simplicity. This system detected global methylation alterations in response to exposures which included chemotherapeutic and environmental agents. Using EpiComet-Chip on 63 matched samples, we correctly identified single-sample hypermethylation (≥1.5-fold) at 87% (20/23), hypomethylation (≥1.25-fold) at 100% (9/9), with a 4% (2/54) false-negative rate (FNR), and 10% (4/40) false-positive rate (FPR). Using a more stringent threshold to define hypermethylation (≥1.75-fold) allowed us to correctly identify 94% of hypermethylation (17/18), but increased our FPR to 16% (7/45). The successful application of this novel technology will aid hazard identification and risk characterization of FDA-regulated products, while providing utility for investigating epigenetic modes of action of agents in target organs, as the assay is amenable to cultured cells or nucleated cells from any tissue. Environ. Mol. Mutagen. 58:508-521, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Magnetoresistive DNA chips based on ac field focusing of magnetic labels

NASA Astrophysics Data System (ADS)

Ferreira, H. A.; Cardoso, F. A.; Ferreira, R.; Cardoso, S.; Freitas, P. P.

2006-04-01

A study was made on the sensitivity of a magnetoresistive DNA-chip platform being developed for cystic fibrosis diagnostics. The chip, comprised of an array of 2.5×80 μm2 U-shaped spin-valve sensors integrated within current line structures for magnetic label manipulation, enabled the detection at 30 Hz of 250 nm magnetic nanoparticles from 100 pM down to the pM range (or a target DNA concentration of 500 pM). It was observed that the sensor response increased linearly with label concentration. Noise spectra obtained for these sensors showed a thermal noise of 10-17 V2/Hz with a 1/f knee at 50 kHz at a 1 mA sense current, showing that lower detection limits are possible.

DNA microarrays of baculovirus genomes: differential expression of viral genes in two susceptible insect cell lines.

PubMed

Yamagishi, J; Isobe, R; Takebuchi, T; Bando, H

2003-03-01

We describe, for the first time, the generation of a viral DNA chip for simultaneous expression measurements of nearly all known open reading frames (ORFs) in the best-studied members of the family Baculoviridae, Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and Bombyx mori nucleopolyhedrovirus (BmNPV). In this study, a viral DNA chip (Ac-BmNPV chip) was fabricated and used to characterize the viral gene expression profile for AcMNPV in different cell types. The viral chip is composed of microarrays of viral DNA prepared by robotic deposition of PCR-amplified viral DNA fragments on glass for ORFs in the NPV genome. Viral gene expression was monitored by hybridization to the DNA fragment microarrays with fluorescently labeled cDNAs prepared from infected Spodoptera frugiperda, Sf9 cells and Trichoplusia ni, TnHigh-Five cells, the latter a major producer of baculovirus and recombinant proteins. A comparison of expression profiles of known ORFs in AcMNPV elucidated six genes (ORF150, p10, pk2, and three late gene expression factor genes lef-3, p35 and lef- 6) the expression of each of which was regulated differently in the two cell lines. Most of these genes are known to be closely involved in the viral life cycle such as in DNA replication, late gene expression and the release of polyhedra from infected cells. These results imply that the differential expression of these viral genes accounts for the differences in viral replication between these two cell lines. Thus, these fabricated microarrays of NPV DNA which allow a rapid analysis of gene expression at the viral genome level should greatly speed the functional analysis of large genomes of NPV.

Real-time and label-free ring-resonator monitoring of solid-phase recombinase polymerase amplification.

PubMed

Sabaté Del Río, Jonathan; Steylaerts, Tim; Henry, Olivier Y F; Bienstman, Peter; Stakenborg, Tim; Van Roy, Wim; O'Sullivan, Ciara K

2015-11-15

In this work we present the use of a silicon-on-insulator (SOI) chip featuring an array of 64 optical ring resonators used as refractive index sensors for real-time and label-free DNA detection. Single ring functionalisation was achieved using a click reaction after precise nanolitre spotting of specific hexynyl-terminated DNA capture probes to link to an azido-silanised chip surface. To demonstrate detectability using the ring resonators and to optimise conditions for solid-phase amplification, hybridisation between short 25-mer single stranded DNA (ssDNA) fragments and a complementary capture probe immobilised on the surface of the ring resonators was carried out and detected through the shift in the resonant wavelength. Using the optimised conditions demonstrated via the solid-phase hybridisation, a 144-bp double stranded DNA (dsDNA) was then detected directly using recombinase and polymerase proteins through on-chip target amplification and solid-phase elongation of immobilised forward primers on specific rings, at a constant temperature of 37°C and in less than 60min, achieving a limit of detection of 7.8·10(-13)M (6·10(5) copies in 50µL). The use of an automatic liquid handler injection instrument connected to an integrated resealable chip interface (RCI) allowed programmable multiple injection protocols. Air plugs between different solutions were introduced to prevent intermixing and a proportional-integral-derivative (PID) temperature controller minimised temperature based drifts. Published by Elsevier B.V.

Progress in the application of DNA microarrays.

PubMed Central

Lobenhofer, E K; Bushel, P R; Afshari, C A; Hamadeh, H K

2001-01-01

Microarray technology has been applied to a variety of different fields to address fundamental research questions. The use of microarrays, or DNA chips, to study the gene expression profiles of biologic samples began in 1995. Since that time, the fundamental concepts behind the chip, the technology required for making and using these chips, and the multitude of statistical tools for analyzing the data have been extensively reviewed. For this reason, the focus of this review will be not on the technology itself but on the application of microarrays as a research tool and the future challenges of the field. PMID:11673116

ChIP and ChIP-Related Techniques: Expanding the Fields of Application and Improving ChIP Performance.

PubMed

Visa, Neus; Jordán-Pla, Antonio

2018-01-01

Protein-DNA interactions in vivo can be detected and quantified by chromatin immunoprecipitation (ChIP). ChIP has been instrumental for the advancement of epigenetics and has set the groundwork for the development of a number of ChIP-related techniques that have provided valuable information about the organization and function of genomes. Here, we provide an introduction to ChIP and discuss the applications of ChIP in different research areas. We also review some of the strategies that have been devised to improve ChIP performance.

Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

PubMed

Raghav, Sunil Kumar; Deplancke, Bart

2012-01-01

Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

Real-time, multiplexed electrochemical DNA detection using an active complementary metal-oxide-semiconductor biosensor array with integrated sensor electronics.

PubMed

Levine, Peter M; Gong, Ping; Levicky, Rastislav; Shepard, Kenneth L

2009-03-15

Optical biosensing based on fluorescence detection has arguably become the standard technique for quantifying extents of hybridization between surface-immobilized probes and fluorophore-labeled analyte targets in DNA microarrays. However, electrochemical detection techniques are emerging which could eliminate the need for physically bulky optical instrumentation, enabling the design of portable devices for point-of-care applications. Unlike fluorescence detection, which can function well using a passive substrate (one without integrated electronics), multiplexed electrochemical detection requires an electronically active substrate to analyze each array site and benefits from the addition of integrated electronic instrumentation to further reduce platform size and eliminate the electromagnetic interference that can result from bringing non-amplified signals off chip. We report on an active electrochemical biosensor array, constructed with a standard complementary metal-oxide-semiconductor (CMOS) technology, to perform quantitative DNA hybridization detection on chip using targets conjugated with ferrocene redox labels. A 4 x 4 array of gold working electrodes and integrated potentiostat electronics, consisting of control amplifiers and current-input analog-to-digital converters, on a custom-designed 5 mm x 3 mm CMOS chip drive redox reactions using cyclic voltammetry, sense DNA binding, and transmit digital data off chip for analysis. We demonstrate multiplexed and specific detection of DNA targets as well as real-time monitoring of hybridization, a task that is difficult, if not impossible, with traditional fluorescence-based microarrays.

Purification and preconcentration of genomic DNA from whole cell lysates using photoactivated polycarbonate (PPC) microfluidic chips

PubMed Central

Witek, Małgorzata A.; Llopis, Shawn D.; Wheatley, Abigail; McCarley, Robin L.; Soper, Steven A.

2006-01-01

We discuss the use of a photoactivated polycarbonate (PPC) microfluidic chip for the solid-phase, reversible immobilization (SPRI) and purification of genomic DNA (gDNA) from whole cell lysates. The surface of polycarbonate was activated by UV radiation resulting in a photo-oxidation reaction, which produced a channel surface containing carboxylate groups. The gDNA was selectively captured on this photoactivated surface in an immobilization buffer, which consisted of 3% polyethylene glycol, 0.4 M NaCl and 70% ethanol. The methodology reported herein is similar to conventional SPRI in that surface-confined carboxylate groups are used for the selective immobilization of DNA; however, no magnetic beads or a magnetic field are required. As observed by UV spectroscopy, a load of ∼7.6 ± 1.6 µg/ml of gDNA was immobilized onto the PPC bed. The recovery of DNA following purification was estimated to be 85 ± 5%. The immobilization and purification assay using this PPC microchip could be performed within ∼25 min as follows: (i) DNA immobilization ∼6 min, (ii) chip washout with ethanol 10 min, and (iii) drying and gDNA desorption ∼6 min. The PPC microchip could also be used for subsequent assays with no substantial loss in recovery, no observable carryover and no need for ‘reactivation’ of the PC surface with UV light. PMID:16757572

[Development of molecular detection of food-borne pathogenic bacteria using miniaturized microfluidic devices].

PubMed

Iván, Kristóf; Maráz, Anna

2015-12-20

Detection and identification of food-borne pathogenic bacteria are key points for the assurance of microbiological food safety. Traditional culture-based methods are more and more replaced by or supplemented with nucleic acid based molecular techniques, targeting specific (preferably virulence) genes in the genomes. Internationally validated DNA amplification - most frequently real-time polymerase chain reaction - methods are applied by the food microbiological testing laboratories for routine analysis, which will result not only in shortening the time for results but they also improve the performance characteristics (e.g. sensitivity, specificity) of the methods. Beside numerous advantages of the polymerase chain reaction based techniques for routine microbiological analysis certain drawbacks have to be mentioned, such as the high cost of the equipment and reagents, as well as the risk of contamination of the laboratory environment by the polymerase chain reaction amplicons, which require construction of an isolated laboratory system. Lab-on-a-chip systems can integrate most of these laboratory processes within a miniaturized device that delivers the same specificity and reliability as the standard protocols. The benefits of miniaturized devices are: simple - often automated - use, small overall size, portability, sterility due to single use possibility. These miniaturized rapid diagnostic tests are being researched and developed at the best research centers around the globe implementing various sample preparation and molecular DNA amplification methods on-chip. In parallel, the aim of the authors' research is to develop microfluidic Lab-on-a-chip devices for the detection and identification of food-borne pathogenic bacteria.

Highly sensitive detection of human IgG using a novel bio-barcode assay combined with DNA chip technology

NASA Astrophysics Data System (ADS)

Liu, Zhenbao; Zhou, Bo; Wang, Haiqing; Lu, Feng; Liu, Tianjun; Song, Cunxian; Leng, Xigang

2013-09-01

A simple and ultrasensitive detection of human IgG based on signal amplification using a novel bio-barcode assay and DNA chip technology was developed. The sensing platform was a sandwich system made up of antibody-modified magnetic microparticles (Ab-MMPs)/human IgG/Cy3-labeled single-stranded DNA and antibody-modified gold nanoparticles (Cy3-ssDNA-Ab-AuNPs). The MMPs (2.5 μm in diameter) modified with mouse anti-human IgG monoclonal-antibodies could capture human IgG and further be separated and enriched via a magnetic field. The AuNPs (13 nm in diameter) conjugated with goat anti-human IgG polyclonal-antibodies and Cy3-ssDNA could further combine with the human IgG/Ab-MMP complex. The Cy3-ssDNA on AuNPs was then released by TCEP to hybridize with the DNA chip, thus generating a detectable signal by the fluorescence intensity of Cy3. In order to improve detection sensitivity, a three-level cascaded signal amplification was developed: (1) The MMP enrichment as the first-level; (2) Large quantities of Cy3-ssDNA on AuNPs as the second-level; (3) The Cy3-ssDNA conjugate with DNA chip as the third-level. The highly sensitive technique showed an increased response of the fluorescence intensity to the increased concentration of human IgG through a detection range from 1 pg mL-1 to 10 ng mL-1. This sensing technique could not only improve the detection sensitivity for the low concentration of human IgG but also present a robust and efficient signal amplification model. The detection method has good stability, specificity, and reproducibility and could be applied in the detection of human IgG in the real samples.

Ultra-High-Speed DNA Fragment Separations Using Microfabricated Capillary Array Electrophoresis Chips

NASA Astrophysics Data System (ADS)

Woolley, Adam T.; Mathies, Richard A.

1994-11-01

Capillary electrophoresis arrays have been fabricated on planar glass substrates by photolithographic masking and chemical etching techniques. The photolithographically defined channel patterns were etched in a glass substrate, and then capillaries were formed by thermally bonding the etched substrate to a second glass slide. High-resolution electrophoretic separations of φX174 Hae III DNA restriction fragments have been performed with these chips using a hydroxyethyl cellulose sieving matrix in the channels. DNA fragments were fluorescently labeled with dye in the running buffer and detected with a laser-excited, confocal fluorescence system. The effects of variations in the electric field, procedures for injection, and sizes of separation and injection channels (ranging from 30 to 120 μm) have been explored. By use of channels with an effective length of only 3.5 cm, separations of φX174 Hae III DNA fragments from ≈70 to 1000 bp are complete in only 120 sec. We have also demonstrated high-speed sizing of PCR-amplified HLA-DQα alleles. This work establishes methods for high-speed, high-throughput DNA separations on capillary array electrophoresis chips.

THE MELTING MECHANISM OF DNA TETHERED TO A SURFACE

PubMed Central

QAMHIEH, KHAWLA; WONG, KA-YIU; LYNCH, GILLIAN C.; PETTITT, B. MONTGOMERY

2009-01-01

The details of melting of DNA immobilized on a chip or nanoparticle determines the sensitivity and operating characteristics of many analytical and synthetic biotechnological devices. Yet, little is known about the differences in how the DNA melting occurs between a homogeneous solution and that on a chip. We used molecular dynamics simulations to explore possible pathways for DNA melting on a chip. Simulation conditions were chosen to ensure that melting occurred in a submicrosecond timescale. The temperature was set to 400 K and the NaCl concentration was set to 0.1 M. We found less symmetry than in the solution case where for oligomeric double-stranded nucleic acids both ends melted with roughly equal probability. On a prepared silica surface we found melting is dominated by fraying from the end away from the surface. Strand separation was hindered by nonspecific surface adsorption at this temperature. At elevated temperatures the melted DNA was attracted to even uncharged organically coated surfaces demonstrating surface fouling. While hybridization is not the simple reverse of melting, this simulation has implications for the kinetics of hybridization. PMID:19802357

Ultralocalized thermal reactions in subnanoliter droplets-in-air.

PubMed

Salm, Eric; Guevara, Carlos Duarte; Dak, Piyush; Dorvel, Brian Ross; Reddy, Bobby; Alam, Muhammad Ashraf; Bashir, Rashid

2013-02-26

Miniaturized laboratory-on-chip systems promise rapid, sensitive, and multiplexed detection of biological samples for medical diagnostics, drug discovery, and high-throughput screening. Within miniaturized laboratory-on-chips, static and dynamic droplets of fluids in different immiscible media have been used as individual vessels to perform biochemical reactions and confine the products. Approaches to perform localized heating of these individual subnanoliter droplets can allow for new applications that require parallel, time-, and space-multiplex reactions on a single integrated circuit. Our method positions droplets on an array of individual silicon microwave heaters on chip to precisely control the temperature of droplets-in-air, allowing us to perform biochemical reactions, including DNA melting and detection of single base mismatches. We also demonstrate that ssDNA probe molecules can be placed on heaters in solution, dried, and then rehydrated by ssDNA target molecules in droplets for hybridization and detection. This platform enables many applications in droplets including hybridization of low copy number DNA molecules, lysing of single cells, interrogation of ligand-receptor interactions, and rapid temperature cycling for amplification of DNA molecules.

On-chip quantitative detection of pathogen genes by autonomous microfluidic PCR platform.

PubMed

Tachibana, Hiroaki; Saito, Masato; Shibuya, Shogo; Tsuji, Koji; Miyagawa, Nobuyuki; Yamanaka, Keiichiro; Tamiya, Eiichi

2015-12-15

Polymerase chain reaction (PCR)-based genetic testing has become a routine part of clinical diagnoses and food testing. In these fields, rapid, easy-to-use, and cost-efficient PCR chips are expected to be appeared for providing such testing on-site. In this study, a new autonomous disposable plastic microfluidic PCR chip was created, and was utilized for quantitative detection of pathogenic microorganisms. To control the capillary flow of the following solution in the PCR microchannel, a driving microchannel was newly designed behind the PCR microchannel. This allowed the effective PCR by simply dropping the PCR solution onto the inlet without any external pumps. In order to achieve disposability, injection-molded cyclo-olefin polymer (COP) of a cost-competitive plastic was used for the PCR chip. We discovered that coating the microchannel walls with non-ionic surfactant produced a suitable hydrophilic surface for driving the capillary flow through the 1250-mm long microchannel. As a result, quantitative real-time PCR with the lowest initial concentration of human, Escherichia coli (E. coli), and pathogenic E. coli O157 genomic DNA of 4, 0.0019, 0.031 pg/μl, respectively, was successfully achieved in less than 18 min. Our results indicate that the platform presented in this study provided a rapid, easy-to-use, and low-cost real-time PCR system that could be potentially used for on-site gene testing. Copyright © 2015 Elsevier B.V. All rights reserved.

DNA transformation via local heat shock

NASA Astrophysics Data System (ADS)

Li, Sha; Meadow Anderson, L.; Yang, Jui-Ming; Lin, Liwei; Yang, Haw

2007-07-01

This work describes transformation of foreign DNA into bacterial host cells by local heat shock using a microfluidic system with on-chip, built-in platinum heaters. Plasmid DNA encoding ampicillin resistance and a fluorescent protein can be effectively transformed into the DH5α chemically competent E. coli using this device. Results further demonstrate that only one-thousandth of volume is required to obtain transformation efficiencies as good as or better than conventional practices. As such, this work complements other lab-on-a-chip technologies for potential gene cloning/therapy and protein expression applications.

Single molecule actuation and detection on a lab-on-a-chip magnetoresistive platform

NASA Astrophysics Data System (ADS)

Chaves, R. C.; Bensimon, D.; Freitas, P. P.

2011-03-01

On-chip magnetic tweezers based on current loops were integrated with magnetoresistive sensors. Magnetic forces up to 1.0±0.3pN are produced to actuate on DNA anchored to the surface of a flow cell and labeled with micrometer-sized magnetic beads. The levitation of the beads stretches the immobilized DNA. The relative position of the magnetic beads is monitored using spin-valve sensors. A bead vertical displacement resolution of 60nm is derived for DNA molecular motor activity in a tweezer steady current regime.

ChIP-re-ChIP: Co-occupancy Analysis by Sequential Chromatin Immunoprecipitation.

PubMed

Beischlag, Timothy V; Prefontaine, Gratien G; Hankinson, Oliver

2018-01-01

Chromatin immunoprecipitation (ChIP) exploits the specific interactions between DNA and DNA-associated proteins. It can be used to examine a wide range of experimental parameters. A number of proteins bound at the same genomic location can identify a multi-protein chromatin complex where several proteins work together to regulate gene transcription or chromatin configuration. In many instances, this can be achieved using sequential ChIP; or simply, ChIP-re-ChIP. Whether it is for the examination of specific transcriptional or epigenetic regulators, or for the identification of cistromes, the ability to perform a sequential ChIP adds a higher level of power and definition to these analyses. In this chapter, we describe a simple and reliable method for the sequential ChIP assay.

Miniaturized devices towards an integrated lab-on-a-chip platform for DNA diagnostics

NASA Astrophysics Data System (ADS)

Kaprou, G.; Papadakis, G.; Kokkoris, G.; Papadopoulos, V.; Kefala, I.; Papageorgiou, D.; Gizeli, E.; Tserepi, A.

2015-06-01

Microfluidics is an emerging technology enabling the development of Lab-on-a-chip (LOC) systems for clinical diagnostics, drug discovery and screening, food safety and environmental analysis. LOC systems integrate and scale down one or several laboratory functions on a single chip of a few mm2 to cm2 in size, and account for many advantages on biochemical analyses, such as low sample and reagent consumption, low cost, reduced analysis time, portability and point-of-need compatibility. Currently, available nucleic acid diagnostic tests take advantage of Polymerase Chain Reaction (PCR) that allows exponential amplification of portions of nucleic acid sequences that can be used as indicators for the identification of various diseases. Here, we present a comparison between static chamber and continuous flow miniaturized PCR devices, in terms of energy consumption for devices fabricated on the same material stack, with identical sample volume and channel dimensions. The comparison is implemented by a computational study coupling heat transfer in both solid and fluid, mass conservation of species, and joule heating. Based on the conclusions of this study, we develop low-cost and fast DNA amplification devices for both PCR and isothermal amplification, and we implement them in the detection of mutations related to breast cancer. The devices are fabricated by mass production amenable technologies on printed circuit board (PCB) substrates, where copper facilitates the incorporation of on-chip microheaters, defining the thermal zones necessary for PCR or isothermal amplification methods.

Advances in on-chip photodetection for applications in miniaturized genetic analysis systems

NASA Astrophysics Data System (ADS)

Namasivayam, Vijay; Lin, Rongsheng; Johnson, Brian; Brahmasandra, Sundaresh; Razzacki, Zafar; Burke, David T.; Burns, Mark A.

2004-01-01

Microfabrication techniques have become increasingly popular in the development of next generation DNA analysis devices. Improved on-chip fluorescence detection systems may have applications in developing portable hand-held instruments for point-of-care diagnostics. Miniaturization of fluorescence detection involves construction of ultra-sensitive photodetectors that can be integrated onto a fluidic platform combined with the appropriate optical emission filters. We have previously demonstrated integration PIN photodiodes onto a microfabricated electrophoresis channel for separation and detection of DNA fragments. In this work, we present an improved detector structure that uses a PINN+ photodiode with an on-chip interference filter and a robust liquid barrier layer. This new design yields high sensitivity (detection limit of 0.9 ng µl-1 of DNA), low-noise (S/N ~ 100/1) and enhanced quantum efficiencies (>80%) over the entire visible spectrum. Applications of these photodiodes in various areas of DNA analysis such as microreactions (PCR), separations (electrophoresis) and microfluidics (drop sensing) are presented.

Standardization of Spore Inactivation Method for PMA-PhyloChip Analysis

NASA Technical Reports Server (NTRS)

Schrader, Michael

2011-01-01

In compliance with the Committee on Space Research (COSPAR) planetary protection policy, National Aeronautics and Space Administration (NASA) monitors the total microbial burden of spacecraft as a means for minimizing the inadvertent transfer of viable contaminant microorganisms to extraterrestrial environments (forward contamination). NASA standard assay-based counts are used both as a proxy for relative surface cleanliness and to estimate overall microbial burden as well as to assess whether forward planetary protection risk criteria are met for a given mission, which vary by the planetary body to be explored and whether or not life detection missions are present. Despite efforts to reduce presence of microorganisms from spacecraft prior to launch, microbes have been isolated from spacecraft and associated surfaces within the extreme conditions of clean room facilities using state of the art molecular technologies. Development of a more sensitive method that will better enumerate all viable microorganisms from spacecraft and associated surfaces could support future life detection missions. Current culture-based (NASA standard spore assay) and nucleic-acid-based polymerase chain reaction (PCR) methods have significant shortcomings in this type of analysis. The overall goal of this project is to evaluate and validate a new molecular method based on the use of a deoxyribonucleic acid (DNA) intercalating agent propidium monoazide (PMA). This is used in combination with DNA microarray (PhyloChip) which has been shown to identify very low levels of organisms on spacecraft associated surfaces. PMA can only penetrate the membrane of dead cells. Once penetrated, it intercalates the DNA and, upon photolysis using visible light it produces stable DNA monoadducts. This allows DNA to be unavailable for further PCR analysis. The specific aim of this study is to standardize the spore inactivation method for PMA-PhyloChip analysis. We have used the bacterial spores Bacillus subtilis 168 (standard laboratory isolate) as a test organism.

On-Chip Synthesis of Protein Microarrays from DNA Microarrays Via Coupled In Vitro Transcription and Translation for Surface Plasmon Resonance Imaging Biosensor Applications

PubMed Central

Seefeld, Ting H.; Halpern, Aaron R.; Corn, Robert M.

2012-01-01

Protein microarrays are fabricated from double-stranded DNA (dsDNA) microarrays by a one-step, multiplexed enzymatic synthesis in an on-chip microfluidic format and then employed for antibody biosensing measurements with surface plasmon resonance imaging (SPRI). A microarray of dsDNA elements (denoted as generator elements) that encode either a His-tagged green fluorescent protein (GFP) or a His-tagged luciferase protein is utilized to create multiple copies of messenger RNA (mRNA) in a surface RNA polymerase reaction; the mRNA transcripts are then translated into proteins by cell-free protein synthesis in a microfluidic format. The His-tagged proteins diffuse to adjacent Cu(II)-NTA microarray elements (denoted as detector elements) and are specifically adsorbed. The net result is the on-chip, cell-free synthesis of a protein microarray that can be used immediately for SPRI protein biosensing. The dual element format greatly reduces any interference from the nonspecific adsorption of enzyme or proteins. SPRI measurements for the detection of the antibodies anti-GFP and anti-luciferase were used to verify the formation of the protein microarray. This convenient on-chip protein microarray fabrication method can be implemented for multiplexed SPRI biosensing measurements in both clinical and research applications. PMID:22793370

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, G.L.; He, Z.; DeSantis, T.Z.

Microarrays have proven to be a useful and high-throughput method to provide targeted DNA sequence information for up to many thousands of specific genetic regions in a single test. A microarray consists of multiple DNA oligonucleotide probes that, under high stringency conditions, hybridize only to specific complementary nucleic acid sequences (targets). A fluorescent signal indicates the presence and, in many cases, the abundance of genetic regions of interest. In this chapter we will look at how microarrays are used in microbial ecology, especially with the recent increase in microbial community DNA sequence data. Of particular interest to microbial ecologists, phylogeneticmore » microarrays are used for the analysis of phylotypes in a community and functional gene arrays are used for the analysis of functional genes, and, by inference, phylotypes in environmental samples. A phylogenetic microarray that has been developed by the Andersen laboratory, the PhyloChip, will be discussed as an example of a microarray that targets the known diversity within the 16S rRNA gene to determine microbial community composition. Using multiple, confirmatory probes to increase the confidence of detection and a mismatch probe for every perfect match probe to minimize the effect of cross-hybridization by non-target regions, the PhyloChip is able to simultaneously identify any of thousands of taxa present in an environmental sample. The PhyloChip is shown to reveal greater diversity within a community than rRNA gene sequencing due to the placement of the entire gene product on the microarray compared with the analysis of up to thousands of individual molecules by traditional sequencing methods. A functional gene array that has been developed by the Zhou laboratory, the GeoChip, will be discussed as an example of a microarray that dynamically identifies functional activities of multiple members within a community. The recent version of GeoChip contains more than 24,000 50mer oligonucleotide probes and covers more than 10,000 gene sequences in 150 gene categories involved in carbon, nitrogen, sulfur, and phosphorus cycling, metal resistance and reduction, and organic contaminant degradation. GeoChip can be used as a generic tool for microbial community analysis, and also link microbial community structure to ecosystem functioning. Examples of the application of both arrays in different environmental samples will be described in the two subsequent sections.« less

Course 8: Biological Physics in Silico

NASA Astrophysics Data System (ADS)

Austin, R. H.

1 Why micro/nanofabrication? Lecture 1a: Hydrodynamic Transport 1 Introduction: The need to control flows in 2 1/2 D 2 Somewhat simple hydrodynamics in 2 1/2 D 3 The N-port injector idea 4 Conclusion Lecture 1b: Dielectrophoresis and Microfabrication 1 Introduction 2 Methods 3 Results 4 Data and analysis 5 Origin of the low frequency dielectrophoretic force in DNA 6 Conclusion Lecture 2a: Hex Arrays 1 Introduction 2 Experimental approach 3 Conclusions Lecture 2b: The DNA Prism 1 Introduction 2 Design 3 Results 4 Conclusions Lecture 2c: Bigger is Better in Rachets 1 The problems with insulators in rachets 2 An experimental test 3 Conclusions Lecture 3: Going After Epigenetics 1 Introduction 2 The nearfield scanner 3 The chip 4 Experiments with molecules 5 Conclusions Lecture 4: Fractionating Cells 1 Introduction 2 Blood specifics 3 Magnetic separation 4 Microfabrication 5 Magnetic field gradients 6 Device interface 7 A preliminary blood cell run 8 Conclusions Lecture 5: Protein Folding on a Chip 1 Introduction 2 Technology 3 Experiments 4 Conclusions

Microchip-based cell lysis and DNA extraction from sperm cells for application to forensic analysis.

PubMed

Bienvenue, Joan M; Duncalf, Natalie; Marchiarullo, Daniel; Ferrance, Jerome P; Landers, James P

2006-03-01

The current backlog of casework is among the most significant challenges facing crime laboratories at this time. While the development of next-generation microchip-based technology for expedited forensic casework analysis offers one solution to this problem, this will require the adaptation of manual, large-volume, benchtop chemistry to small volume microfluidic devices. Analysis of evidentiary materials from rape kits where semen or sperm cells are commonly found represents a unique set of challenges for on-chip cell lysis and DNA extraction that must be addressed for successful application. The work presented here details the development of a microdevice capable of DNA extraction directly from sperm cells for application to the analysis of sexual assault evidence. A variety of chemical lysing agents are assessed for inclusion in the extraction protocol and a method for DNA purification from sperm cells is described. Suitability of the extracted DNA for short tandem repeat (STR) analysis is assessed and genetic profiles shown. Finally, on-chip cell lysis methods are evaluated, with results from fluorescence visualization of cell rupture and DNA extraction from an integrated cell lysis and purification with subsequent STR amplification presented. A method for on-chip cell lysis and DNA purification is described, with considerations toward inclusion in an integrated microdevice capable of both differential cell sorting and DNA extraction. The results of this work demonstrate the feasibility of incorporating microchip-based cell lysis and DNA extraction into forensic casework analysis.

A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

NASA Astrophysics Data System (ADS)

Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

2011-09-01

Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells.

A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins

PubMed Central

Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R.

2011-01-01

Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. PMID:21974603

A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins.

PubMed

Ahmad, Habib; Sutherland, Alex; Shin, Young Shik; Hwang, Kiwook; Qin, Lidong; Krom, Russell-John; Heath, James R

2011-09-01

Microfluidics flow-patterning has been utilized for the construction of chip-scale miniaturized DNA and protein barcode arrays. Such arrays have been used for specific clinical and fundamental investigations in which many proteins are assayed from single cells or other small sample sizes. However, flow-patterned arrays are hand-prepared, and so are impractical for broad applications. We describe an integrated robotics/microfluidics platform for the automated preparation of such arrays, and we apply it to the batch fabrication of up to eighteen chips of flow-patterned DNA barcodes. The resulting substrates are comparable in quality with hand-made arrays and exhibit excellent substrate-to-substrate consistency. We demonstrate the utility and reproducibility of robotics-patterned barcodes by utilizing two flow-patterned chips for highly parallel assays of a panel of secreted proteins from single macrophage cells. © 2011 American Institute of Physics

Oligonucleotide-arrayed TFT photosensor applicable for DNA chip technology.

PubMed

Tanaka, Tsuyoshi; Hatakeyama, Keiichi; Sawaguchi, Masahiro; Iwadate, Akihito; Mizutani, Yasushi; Sasaki, Kazuhiro; Tateishi, Naofumi; Takeyama, Haruko; Matsunaga, Tadashi

2006-09-05

A thin film transistor (TFT) photosensor fabricated by semiconductor integrated circuit (IC) technology was applied to DNA chip technology. The surface of the TFT photosensor was coated with TiO2 using a vapor deposition technique for the fabrication of optical filters. The immobilization of thiolated oligonucleotide probes onto a TiO2-coated TFT photosensor using gamma-aminopropyltriethoxysilane (APTES) and N-(gamma-maleimidobutyloxy) sulfosuccinimide ester (GMBS) was optimized. The coverage value of immobilized oligonucleotides reached a plateau at 33.7 pmol/cm2, which was similar to a previous analysis using radioisotope-labeled oligonucleotides. The lowest detection limits were 0.05 pmol/cm2 for quantum dot and 2.1 pmol/cm2 for Alexa Fluor 350. Furthermore, single nucleotide polymorphism (SNP) detection was examined using the oligonucleotide-arrayed TFT photosensor. A SNP present in the aldehyde dehydrogenase 2 (ALDH2) gene was used as a target. The SNPs in ALDH2*1 and ALDH2*2 target DNA were detected successfully using the TFT photosensor. DNA hybridization in the presence of both ALDH2*1 and ALDH2*2 target DNA was observed using both ALDH2*1 and ALDH2*2 detection oligonucleotides-arrayed TFT photosensor. Use of the TFT photosensor will allow the development of a disposable photodetecting device for DNA chip systems. (c) 2006 Wiley Periodicals, Inc.

Self-priming compartmentalization digital LAMP for point-of-care.

PubMed

Zhu, Qiangyuan; Gao, Yibo; Yu, Bingwen; Ren, Hao; Qiu, Lin; Han, Sihai; Jin, Wei; Jin, Qinhan; Mu, Ying

2012-11-21

Digital nucleic acid amplification provides unprecedented opportunities for absolute nucleic acid quantification by counting of single molecules. This technique is useful for molecular genetic analysis in cancer, stem cell, bacterial, non-invasive prenatal diagnosis in which many biologists are interested. This paper describes a self-priming compartmentalization (SPC) microfluidic chip platform for performing digital loop-mediated amplification (LAMP). The energy for the pumping is pre-stored in the degassed bulk PDMS by exploiting the high gas solubility of PDMS; therefore, no additional structures other than channels and reservoirs are required. The sample and oil are sequentially sucked into the channels, and the pressure difference of gas dissolved in PDMS allows sample self-compartmentalization without the need for further chip manipulation such as with pneumatic microvalves and control systems, and so on. The SPC digital LAMP chip can be used like a 384-well plate, so, the world-to-chip fluidic interconnections are avoided. The microfluidic chip contains 4 separate panels, each panel contains 1200 independent 6 nL chambers and can be used to detect 4 samples simultaneously. Digital LAMP on the microfluidic chip was tested quantitatively by using β-actin DNA from humans. The self-priming compartmentalization behavior is roughly predictable using a two-dimensional model. The uniformity of compartmentalization was analyzed by fluorescent intensity and fraction of volume. The results showed that the feasibility and flexibility of the microfluidic chip platform for amplifying single nucleic acid molecules in different chambers made by diluting and distributing sample solutions. The SPC chip has the potential to meet the requirements of a general laboratory: power-free, valve-free, operating at isothermal temperature, inexpensive, sensitive, economizing labour time and reagents. The disposable analytical devices with appropriate air-tight packaging should be useful for point-of-care, and enabling it to become one of the common tools for biology research, especially, in point-of-care testing.

Oligonucleotide Microarray for 16S rRNA Gene-Based Detection of All Recognized Lineages of Sulfate-Reducing Prokaryotes in the Environment

PubMed Central

Loy, Alexander; Lehner, Angelika; Lee, Natuschka; Adamczyk, Justyna; Meier, Harald; Ernst, Jens; Schleifer, Karl-Heinz; Wagner, Michael

2002-01-01

For cultivation-independent detection of sulfate-reducing prokaryotes (SRPs) an oligonucleotide microarray consisting of 132 16S rRNA gene-targeted oligonucleotide probes (18-mers) having hierarchical and parallel (identical) specificity for the detection of all known lineages of sulfate-reducing prokaryotes (SRP-PhyloChip) was designed and subsequently evaluated with 41 suitable pure cultures of SRPs. The applicability of SRP-PhyloChip for diversity screening of SRPs in environmental and clinical samples was tested by using samples from periodontal tooth pockets and from the chemocline of a hypersaline cyanobacterial mat from Solar Lake (Sinai, Egypt). Consistent with previous studies, SRP-PhyloChip indicated the occurrence of Desulfomicrobium spp. in the tooth pockets and the presence of Desulfonema- and Desulfomonile-like SRPs (together with other SRPs) in the chemocline of the mat. The SRP-PhyloChip results were confirmed by several DNA microarray-independent techniques, including specific PCR amplification, cloning, and sequencing of SRP 16S rRNA genes and the genes encoding the dissimilatory (bi)sulfite reductase (dsrAB). PMID:12324358

Fully Integrated Microfluidic Device for Direct Sample-to-Answer Genetic Analysis

NASA Astrophysics Data System (ADS)

Liu, Robin H.; Grodzinski, Piotr

Integration of microfluidics technology with DNA microarrays enables building complete sample-to-answer systems that are useful in many applications such as clinic diagnostics. In this chapter, a fully integrated microfluidic device [1] that consists of microfluidic mixers, valves, pumps, channels, chambers, heaters, and a DNA microarray sensor to perform DNA analysis of complex biological sample solutions is present. This device can perform on-chip sample preparation (including magnetic bead-based cell capture, cell preconcentration and purification, and cell lysis) of complex biological sample solutions (such as whole blood), polymerase chain reaction, DNA hybridization, and electrochemical detection. A few novel microfluidic techniques were developed and employed. A micromix-ing technique based on a cavitation microstreaming principle was implemented to enhance target cell capture from whole blood samples using immunomagnetic beads. This technique was also employed to accelerate DNA hybridization reaction. Thermally actuated paraffin-based microvalves were developed to regulate flows. Electrochemical pumps and thermopneumatic pumps were integrated on the chip to provide pumping of liquid solutions. The device is completely self-contained: no external pressure sources, fluid storage, mechanical pumps, or valves are necessary for fluid manipulation, thus eliminating possible sample contamination and simplifying device operation. Pathogenic bacteria detection from ~mL whole blood samples and single-nucleotide polymorphism analysis directly from diluted blood were demonstrated. The device provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus has a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota

PubMed Central

Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R.; Peyret, Pierre; Forano, Evelyne

2018-01-01

Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen. PMID:29487591

FibroChip, a Functional DNA Microarray to Monitor Cellulolytic and Hemicellulolytic Activities of Rumen Microbiota.

PubMed

Comtet-Marre, Sophie; Chaucheyras-Durand, Frédérique; Bouzid, Ourdia; Mosoni, Pascale; Bayat, Ali R; Peyret, Pierre; Forano, Evelyne

2018-01-01

Ruminants fulfill their energy needs for growth primarily through microbial breakdown of plant biomass in the rumen. Several biotic and abiotic factors influence the efficiency of fiber degradation, which can ultimately impact animal productivity and health. To provide more insight into mechanisms involved in the modulation of fibrolytic activity, a functional DNA microarray targeting genes encoding key enzymes involved in cellulose and hemicellulose degradation by rumen microbiota was designed. Eight carbohydrate-active enzyme (CAZyme) families (GH5, GH9, GH10, GH11, GH43, GH48, CE1, and CE6) were selected which represented 392 genes from bacteria, protozoa, and fungi. The DNA microarray, designated as FibroChip, was validated using targets of increasing complexity and demonstrated sensitivity and specificity. In addition, FibroChip was evaluated for its explorative and semi-quantitative potential. Differential expression of CAZyme genes was evidenced in the rumen bacterium Fibrobacter succinogenes S85 grown on wheat straw or cellobiose. FibroChip was used to identify the expressed CAZyme genes from the targeted families in the rumen of a cow fed a mixed diet based on grass silage. Among expressed genes, those encoding GH43, GH5, and GH10 families were the most represented. Most of the F. succinogenes genes detected by the FibroChip were also detected following RNA-seq analysis of RNA transcripts obtained from the rumen fluid sample. Use of the FibroChip also indicated that transcripts of fiber degrading enzymes derived from eukaryotes (protozoa and anaerobic fungi) represented a significant proportion of the total microbial mRNA pool. FibroChip represents a reliable and high-throughput tool that enables researchers to monitor active members of fiber degradation in the rumen.

Epigenetic changes in leukocytes after 8 weeks of resistance exercise training.

PubMed

Denham, Joshua; Marques, Francine Z; Bruns, Emma L; O'Brien, Brendan J; Charchar, Fadi J

2016-06-01

Regular engagement in resistance exercise training elicits many health benefits including improvement to muscular strength, hypertrophy and insulin sensitivity, though the underpinning molecular mechanisms are poorly understood. The purpose of this study was to determine the influence 8 weeks of resistance exercise training has on leukocyte genome-wide DNA methylation and gene expression in healthy young men. Eight young (21.1 ± 2.2 years) men completed one repetition maximum (1RM) testing before completing 8 weeks of supervised, thrice-weekly resistance exercise training comprising three sets of 8-12 repetitions with a load equivalent to 80 % of 1RM. Blood samples were collected at rest before and after the 8-week training intervention. Genome-wide DNA methylation and gene expression were assessed on isolated leukocyte DNA and RNA using the 450K BeadChip and HumanHT-12 v4 Expression BeadChip (Illumina), respectively. Resistance exercise training significantly improved upper and lower body strength concurrently with diverse genome-wide DNA methylation and gene expression changes (p ≤ 0. 01). DNA methylation changes occurred at multiple regions throughout the genome in context with genes and CpG islands, and in genes relating to axon guidance, diabetes and immune pathways. There were multiple genes with increased expression that were enriched for RNA processing and developmental proteins. Growth factor genes-GHRH and FGF1-showed differential methylation and mRNA expression changes after resistance training. Our findings indicate that resistance exercise training improves muscular strength and is associated with reprogramming of the leukocyte DNA methylome and transcriptome.

Two-step activation of paper batteries for high power generation: design and fabrication of biofluid- and water-activated paper batteries

NASA Astrophysics Data System (ADS)

Lee, Ki Bang

2006-11-01

Two-step activation of paper batteries has been successfully demonstrated to provide quick activation and to supply high power to credit card-sized biosystems on a plastic chip. A stack of a magnesium layer (an anode), a fluid guide (absorbent paper), a highly doped filter paper with copper chloride (a cathode) and a copper layer as a current collector is laminated between two transparent plastic films into a high power biofluid- and water-activated battery. The battery is activated by two-step activation: (1) after placing a drop of biofluid/water-based solution on the fluid inlet, the surface tension first drives the fluid to soak the fluid guide; (2) the fluid in the fluid guide then penetrates into the heavily doped filter paper with copper chloride to start the battery reaction. The fabricated half credit card-sized battery was activated by saliva, urine and tap water and delivered a maximum voltage of 1.56 V within 10 s after activation and a maximum power of 15.6 mW. When 10 kΩ and 1 KΩ loads are used, the service time with water, urine and saliva is measured as more than 2 h. An in-series battery of 3 V has been successfully tested to power two LEDs (light emitting diodes) and an electric driving circuit. As such, this high power paper battery could be integrated with on-demand credit card-sized biosystems such as healthcare test kits, biochips, lab-on-a-chip, DNA chips, protein chips or even test chips for water quality checking or chemical checking.

OS082. CHIPS-Child: Testing the developmental origins hypothesis.

PubMed

Magee, L A; Synnes, A

2012-07-01

CHIPS-Child is a natural test of the Developmental Origins of Health and Disease hypothesis (DOHaD) [1,2]. Reduced fetal growth rate is associated with adult cardiovascular risk markers (e.g., obesity) and disease [3,4]. Evidence worldwide indicates that this relationship is independent of birth weight. The leading theory describes 'developmental programming'in utero leading to permanent alteration of the fetal genome. While those changes are adaptive in utero, they may be maladaptive postnatally. To directly test, for the first time in humans, whether differential blood pressure (BP) control in pregnancy has developmental programming effects, independent of birth weight. We predict that, like famine or protein malnutrition, 'tight' (vs. 'less tight') control of maternal BP will be associated with fetal under-nutrition and effects will be consistent with developmental programming. CHIPS-Child is a parallel, ancillary study to the CHIPS randomized controlled trial (RCT). CHIPS is designed to determine whether 'less tight' control [target diastolic BP (dBP) 100mmHg] or 'tight' control [target dBP 85mmHg] of non-proteinuric hypertension in pregnancy is better for the baby without increasing maternal risk. CHIPS-Child will examine offspring of CHIPS participants non-invasively at 12m corrected post-gestational age (±2m) for anthropometry, hair cortisol, buccal swabs for epigenetic testing and a maternal questionnaire about infant feeding practices and background. Annual contact will be maintained in years 2-5 and will include annual parental measurement of the child's height, weight and waist circumference. CHIPS will recruit 1028 women. We estimate that 80% of CHIPS centres will participate in CHIPS-Child, approximately 97% of babies will survive, and 90% of children will be followed to 12m resulting in a sample size of 626. Power will be >80% to detect a between-group difference of ⩾0.25 in 'change in z-score for weight' between birth and 12m (2-sided alpha=0.05, SD 1). Recruitment has begun. The primary outcome will be the between-group difference in early postnatal weight gain ('change in z score for weight') between birth and 12m (p<0.05). Secondary:outcomes are (i) hypothalamic pituitary adrenal axis function (hair cortisol for overall cortisol production); and (ii) between-groups differences in DNA methylation, using targeted (genes associated with growth, obesity, cardiovascular disease, and/or a developmental programming effect) and global (genome-wide microarray) methods. CHIPS-Child offers a unique opportunity to both clarify whether differential dBP control in pregnancy has developmental programming effects and contribute to our understanding of human biology and diversity in a way that a cross-sectional or other observational studies cannot. Copyright © 2012. Published by Elsevier B.V.

ChIP-chip versus ChIP-seq: Lessons for experimental design and data analysis

PubMed Central

2011-01-01

Background Chromatin immunoprecipitation (ChIP) followed by microarray hybridization (ChIP-chip) or high-throughput sequencing (ChIP-seq) allows genome-wide discovery of protein-DNA interactions such as transcription factor bindings and histone modifications. Previous reports only compared a small number of profiles, and little has been done to compare histone modification profiles generated by the two technologies or to assess the impact of input DNA libraries in ChIP-seq analysis. Here, we performed a systematic analysis of a modENCODE dataset consisting of 31 pairs of ChIP-chip/ChIP-seq profiles of the coactivator CBP, RNA polymerase II (RNA PolII), and six histone modifications across four developmental stages of Drosophila melanogaster. Results Both technologies produce highly reproducible profiles within each platform, ChIP-seq generally produces profiles with a better signal-to-noise ratio, and allows detection of more peaks and narrower peaks. The set of peaks identified by the two technologies can be significantly different, but the extent to which they differ varies depending on the factor and the analysis algorithm. Importantly, we found that there is a significant variation among multiple sequencing profiles of input DNA libraries and that this variation most likely arises from both differences in experimental condition and sequencing depth. We further show that using an inappropriate input DNA profile can impact the average signal profiles around genomic features and peak calling results, highlighting the importance of having high quality input DNA data for normalization in ChIP-seq analysis. Conclusions Our findings highlight the biases present in each of the platforms, show the variability that can arise from both technology and analysis methods, and emphasize the importance of obtaining high quality and deeply sequenced input DNA libraries for ChIP-seq analysis. PMID:21356108

Design and synthesis of target-responsive aptamer-cross-linked hydrogel for visual quantitative detection of ochratoxin A.

PubMed

Liu, Rudi; Huang, Yishun; Ma, Yanli; Jia, Shasha; Gao, Mingxuan; Li, Jiuxing; Zhang, Huimin; Xu, Dunming; Wu, Min; Chen, Yan; Zhu, Zhi; Yang, Chaoyong

2015-04-01

A target-responsive aptamer-cross-linked hydrogel was designed and synthesized for portable and visual quantitative detection of the toxin Ochratoxin A (OTA), which occurs in food and beverages. The hydrogel network forms by hybridization between one designed DNA strand containing the OTA aptamer and two complementary DNA strands grafting on linear polyacrylamide chains. Upon the introduction of OTA, the aptamer binds with OTA, leading to the dissociation of the hydrogel, followed by release of the preloaded gold nanoparticles (AuNPs), which can be observed by the naked eye. To enable sensitive visual and quantitative detection, we encapsulated Au@Pt core-shell nanoparticles (Au@PtNPs) in the hydrogel to generate quantitative readout in a volumetric bar-chart chip (V-Chip). In the V-Chip, Au@PtNPs catalyzes the oxidation of H2O2 to generate O2, which induces movement of an ink bar to a concentration-dependent distance for visual quantitative readout. Furthermore, to improve the detection limit in complex real samples, we introduced an immunoaffinity column (IAC) of OTA to enrich OTA from beer. After the enrichment, as low as 1.27 nM (0.51 ppb) OTA can be detected by the V-Chip, which satisfies the test requirement (2.0 ppb) by the European Commission. The integration of a target-responsive hydrogel with portable enrichment by IAC, as well as signal amplification and quantitative readout by a simple microfluidic device, offers a new method for portable detection of food safety hazard toxin OTA.

A Bayesian deconvolution strategy for immunoprecipitation-based DNA methylome analysis

PubMed Central

Down, Thomas A.; Rakyan, Vardhman K.; Turner, Daniel J.; Flicek, Paul; Li, Heng; Kulesha, Eugene; Gräf, Stefan; Johnson, Nathan; Herrero, Javier; Tomazou, Eleni M.; Thorne, Natalie P.; Bäckdahl, Liselotte; Herberth, Marlis; Howe, Kevin L.; Jackson, David K.; Miretti, Marcos M.; Marioni, John C.; Birney, Ewan; Hubbard, Tim J. P.; Durbin, Richard; Tavaré, Simon; Beck, Stephan

2009-01-01

DNA methylation is an indispensible epigenetic modification of mammalian genomes. Consequently there is great interest in strategies for genome-wide/whole-genome DNA methylation analysis, and immunoprecipitation-based methods have proven to be a powerful option. Such methods are rapidly shifting the bottleneck from data generation to data analysis, necessitating the development of better analytical tools. Until now, a major analytical difficulty associated with immunoprecipitation-based DNA methylation profiling has been the inability to estimate absolute methylation levels. Here we report the development of a novel cross-platform algorithm – Bayesian Tool for Methylation Analysis (Batman) – for analyzing Methylated DNA Immunoprecipitation (MeDIP) profiles generated using arrays (MeDIP-chip) or next-generation sequencing (MeDIP-seq). The latter is an approach we have developed to elucidate the first high-resolution whole-genome DNA methylation profile (DNA methylome) of any mammalian genome. MeDIP-seq/MeDIP-chip combined with Batman represent robust, quantitative, and cost-effective functional genomic strategies for elucidating the function of DNA methylation. PMID:18612301

An integrated semiconductor device enabling non-optical genome sequencing.

PubMed

Rothberg, Jonathan M; Hinz, Wolfgang; Rearick, Todd M; Schultz, Jonathan; Mileski, William; Davey, Mel; Leamon, John H; Johnson, Kim; Milgrew, Mark J; Edwards, Matthew; Hoon, Jeremy; Simons, Jan F; Marran, David; Myers, Jason W; Davidson, John F; Branting, Annika; Nobile, John R; Puc, Bernard P; Light, David; Clark, Travis A; Huber, Martin; Branciforte, Jeffrey T; Stoner, Isaac B; Cawley, Simon E; Lyons, Michael; Fu, Yutao; Homer, Nils; Sedova, Marina; Miao, Xin; Reed, Brian; Sabina, Jeffrey; Feierstein, Erika; Schorn, Michelle; Alanjary, Mohammad; Dimalanta, Eileen; Dressman, Devin; Kasinskas, Rachel; Sokolsky, Tanya; Fidanza, Jacqueline A; Namsaraev, Eugeni; McKernan, Kevin J; Williams, Alan; Roth, G Thomas; Bustillo, James

2011-07-20

The seminal importance of DNA sequencing to the life sciences, biotechnology and medicine has driven the search for more scalable and lower-cost solutions. Here we describe a DNA sequencing technology in which scalable, low-cost semiconductor manufacturing techniques are used to make an integrated circuit able to directly perform non-optical DNA sequencing of genomes. Sequence data are obtained by directly sensing the ions produced by template-directed DNA polymerase synthesis using all-natural nucleotides on this massively parallel semiconductor-sensing device or ion chip. The ion chip contains ion-sensitive, field-effect transistor-based sensors in perfect register with 1.2 million wells, which provide confinement and allow parallel, simultaneous detection of independent sequencing reactions. Use of the most widely used technology for constructing integrated circuits, the complementary metal-oxide semiconductor (CMOS) process, allows for low-cost, large-scale production and scaling of the device to higher densities and larger array sizes. We show the performance of the system by sequencing three bacterial genomes, its robustness and scalability by producing ion chips with up to 10 times as many sensors and sequencing a human genome.

Real-time Tracking of DNA Fragment Separation by Smartphone.

PubMed

Tao, Chunxian; Yang, Bo; Li, Zhenqing; Zhang, Dawei; Yamaguchi, Yoshinori

2017-06-01

Slab gel electrophoresis (SGE) is the most common method for the separation of DNA fragments; thus, it is broadly applied to the field of biology and others. However, the traditional SGE protocol is quite tedious, and the experiment takes a long time. Moreover, the chemical consumption in SGE experiments is very high. This work proposes a simple method for the separation of DNA fragments based on an SGE chip. The chip is made by an engraving machine. Two plastic sheets are used for the excitation and emission wavelengths of the optical signal. The fluorescence signal of the DNA bands is collected by smartphone. To validate this method, 50, 100, and 1,000 bp DNA ladders were separated. The results demonstrate that a DNA ladder smaller than 5,000 bp can be resolved within 12 min and with high resolution when using this method, indicating that it is an ideal substitute for the traditional SGE method.

Programming Cell Adhesion for On-Chip Sequential Boolean Logic Functions.

PubMed

Qu, Xiangmeng; Wang, Shaopeng; Ge, Zhilei; Wang, Jianbang; Yao, Guangbao; Li, Jiang; Zuo, Xiaolei; Shi, Jiye; Song, Shiping; Wang, Lihua; Li, Li; Pei, Hao; Fan, Chunhai

2017-08-02

Programmable remodelling of cell surfaces enables high-precision regulation of cell behavior. In this work, we developed in vitro constructed DNA-based chemical reaction networks (CRNs) to program on-chip cell adhesion. We found that the RGD-functionalized DNA CRNs are entirely noninvasive when interfaced with the fluidic mosaic membrane of living cells. DNA toehold with different lengths could tunably alter the release kinetics of cells, which shows rapid release in minutes with the use of a 6-base toehold. We further demonstrated the realization of Boolean logic functions by using DNA strand displacement reactions, which include multi-input and sequential cell logic gates (AND, OR, XOR, and AND-OR). This study provides a highly generic tool for self-organization of biological systems.

Analytical study of a microfludic DNA amplification chip using water cooling effect.

PubMed

Chen, Jyh Jian; Shen, Chia Ming; Ko, Yu Wei

2013-04-01

A novel continuous-flow polymerase chain reaction (PCR) chip has been analyzed in our work. Two temperature zones are controlled by two external controllers and the other temperature zone at the chip center is controlled by the flow rate of the fluid inside a channel under the glass chip. By employing a water cooling channel at the chip center, the sequence of denaturation, annealing, and extension can be created due to the forced convection effect. The required annealing temperature of PCR less than 313 K can also be demonstrated in this chip. The Poly(methyl methacrylate) (PMMA) cooling channel with the thin aluminum cover is utilized to enhance the temperature uniformity. The size of this chip is 76 mm × 26 mm × 3 mm. This device represents the first demonstration of water cooling thermocycling within continuous-flow PCR microfluidics. The commercial software CFD-ACE+(TM) is utilized to determine the distances between the heating assemblies within the chip. We investigate the influences of various chip materials, operational parameters of the cooling channel and geometric parameters of the chip on the temperature uniformity on the chip surface. Concerning the temperature uniformity of the working zones and the lowest temperature at the annealing zone, the air gap spacing of 1 mm and the cooling channel thicknesses of 1 mm of the PMMA channel with an aluminum cover are recommended in our design. The hydrophobic surface of the PDMS channel was modified by filling it with 20 % Tween 20 solution and then adding bovine serum albumin (BSA) solution to the PCR mixture. DNA fragments with different lengths (372 bp and 478 bp) are successfully amplified with the device.

[GSTP1, APC and RASSF1 gene methylation in prostate cancer samples: comparative analysis of MS-HRM method and Infinium HumanMethylation450 BeadChip beadchiparray diagnostic value].

PubMed

Skorodumova, L O; Babalyan, K A; Sultanov, R; Vasiliev, A O; Govorov, A V; Pushkar, D Y; Prilepskaya, E A; Danilenko, S A; Generozov, E V; Larin, A K; Kostryukova, E S; Sharova, E I

2016-11-01

There is a clear need in molecular markers for prostate cancer (PC) risk stratification. Alteration of DNA methylation is one of processes that occur during ÐÑ progression. Methylation-sensitive PCR with high resolution melting curve analysis (MS-HRM) can be used for gene methylation analysis in routine laboratory practice. This method requires very small amounts of DNA for analysis. Numerous results have been accumulated on DNA methylation in PC samples analyzed by the Infinium HumanMethylation450 BeadChip (HM450). However, the consistency of MS-HRM results with chip hybridization results has not been examined yet. The aim of this study was to assess the consistency of results of GSTP1, APC and RASSF1 gene methylation analysis in ÐÑ biopsy samples obtained by MS-HRM and chip hybridization. The methylation levels of each gene determined by MS-HRM were statistically different in the group of PC tissue samples and the samples without signs of tumor growth. Chip hybridization data analysis confirmed the results obtained with the MS-HRM. Differences in methylation levels between tumor tissue and histologically intact tissue of each sample determined by MS-HRM and chip hybridization, were consistent with each other. Thus, we showed that the assessment of GSTP1, APC and RASSF1 gene methylation analysis using MS-HRM is suitable for the design of laboratory assays that will differentiate the PC tissue from the tissue without signs of tumor growth.

Diagnostic value of protein chips constructed by lung-cancer-associated markers selected by the T7 phage display library.

PubMed

Li, Hong-Mei; Guo, Kang; Yu, Zhuang; Feng, Rui; Xu, Ping

2015-07-01

Traditional diagnostic technology with tumor biomarkers is inefficient, expensive and requires a large number of serum samples. The purpose of this study was to construct human lung cancer protein chips with new lung cancer biomarkers screened by the T7-phage display library, and improve the early diagnosis rate of lung cancer. A T7-phage cDNA display library was constructed of fresh samples from 30 lung cancer patients. With biopanning and high-throughput screening, we gained the immunogenic phage clones from the cDNA library. The insert of selected phage was blasted at GeneBank for alignment to find the exact or the most similar known genes. Protein chips were then constructed and used to assay their expression level in lung cancer serum from 217 cases of lung cancer groups:80 cases of benign lung disease and 220 healthy controls. After four rounds of Biopanning and two rounds of enzyme-linked immunosorbent assay, 12 phage monoclonal samples were selected from 2880 phage monoclonal samples. After blasting at GeneBank, six similar genes were used to construct diagnostic protein chips. The protein chips were then used to assay expression level in lung cancer serum. The expression level of six genes in lung cancer groups was significantly higher than those in the other two groups (P < 0.05). In this study, we successfully constructed diagnostic protein chips with biomarkers selected from the lung cancer T7-phage cDNA library, which can be used for the early screening of lung cancer patients.

First all-in-one diagnostic tool for DNA intelligence: genome-wide inference of biogeographic ancestry, appearance, relatedness, and sex with the Identitas v1 Forensic Chip.

PubMed

Keating, Brendan; Bansal, Aruna T; Walsh, Susan; Millman, Jonathan; Newman, Jonathan; Kidd, Kenneth; Budowle, Bruce; Eisenberg, Arthur; Donfack, Joseph; Gasparini, Paolo; Budimlija, Zoran; Henders, Anjali K; Chandrupatla, Hareesh; Duffy, David L; Gordon, Scott D; Hysi, Pirro; Liu, Fan; Medland, Sarah E; Rubin, Laurence; Martin, Nicholas G; Spector, Timothy D; Kayser, Manfred

2013-05-01

When a forensic DNA sample cannot be associated directly with a previously genotyped reference sample by standard short tandem repeat profiling, the investigation required for identifying perpetrators, victims, or missing persons can be both costly and time consuming. Here, we describe the outcome of a collaborative study using the Identitas Version 1 (v1) Forensic Chip, the first commercially available all-in-one tool dedicated to the concept of developing intelligence leads based on DNA. The chip allows parallel interrogation of 201,173 genome-wide autosomal, X-chromosomal, Y-chromosomal, and mitochondrial single nucleotide polymorphisms for inference of biogeographic ancestry, appearance, relatedness, and sex. The first assessment of the chip's performance was carried out on 3,196 blinded DNA samples of varying quantities and qualities, covering a wide range of biogeographic origin and eye/hair coloration as well as variation in relatedness and sex. Overall, 95 % of the samples (N = 3,034) passed quality checks with an overall genotype call rate >90 % on variable numbers of available recorded trait information. Predictions of sex, direct match, and first to third degree relatedness were highly accurate. Chip-based predictions of biparental continental ancestry were on average ~94 % correct (further support provided by separately inferred patrilineal and matrilineal ancestry). Predictions of eye color were 85 % correct for brown and 70 % correct for blue eyes, and predictions of hair color were 72 % for brown, 63 % for blond, 58 % for black, and 48 % for red hair. From the 5 % of samples (N = 162) with <90 % call rate, 56 % yielded correct continental ancestry predictions while 7 % yielded sufficient genotypes to allow hair and eye color prediction. Our results demonstrate that the Identitas v1 Forensic Chip holds great promise for a wide range of applications including criminal investigations, missing person investigations, and for national security purposes.

Nanofluidic Lab-On-Chip Technology for DNA Identification

DTIC Science & Technology

2013-09-30

samples Fluorescently labeled (FAM tag) DNA oligomers (10, 20, and 50 bases long) were purchased with standard desalting and additional HPLC purification...A.2 DNA samples: DNA oligomers (10, 20, 50 nt long) were purchased with standard desalting and additional HPLC purification for the 50 base

Applications and theory of electrokinetic enrichment in micro-nanofluidic chips.

PubMed

Chen, Xueye; Zhang, Shuai; Zhang, Lei; Yao, Zhen; Chen, Xiaodong; Zheng, Yue; Liu, Yanlin

2017-09-01

This review reports the progress on the recent development of electrokinetic enrichment in micro-nanofluidic chips. The governing equations of electrokinetic enrichment in micro-nanofluidic chips are given. Various enrichment applications including protein analysis, DNA analysis, bacteria analysis, viruses analysis and cell analysis are illustrated and discussed. The advantages and difficulties of each enrichment method are expatiated. This paper will provide a particularly convenient and valuable reference to those who intend to research the electrokinetic enrichment based on micro-nanofluidic chips.

Pulsatile release of biomolecules from polydimethylsiloxane (PDMS) chips with hydrolytically degradable seals.

PubMed

Intra, Janjira; Glasgow, Justin M; Mai, Hoang Q; Salem, Aliasger K

2008-05-08

We demonstrate, for the first time, a robust novel polydimethylsiloxane (PDMS) chip that can provide controlled pulsatile release of DNA based molecules, proteins and oligonucleotides without external stimuli or triggers. The PDMS chip with arrays of wells was constructed by replica molding. Poly(lactic acid-co-glycolic acid) (PLGA) polymer films of varying composition and thickness were used as seals to the wells. The composition, molecular weight and thickness of the PLGA films were all parameters used to control the degradation rate of the seals and therefore the release profiles. Degradation of the films followed the PLGA composition order of 50:50 PLGA>75:25 PLGA>85:15 PLGA at all time-points beyond week 1. Scanning electron microscopy images showed that films were initially smooth, became porous and ruptured as the osmotic pressure pushed the degrading PLGA film outwards. Pulsatile release of DNA was controlled by the composition and thickness of the PLGA used to seal the well. Transfection experiments in a model Human Embryonic Kidney 293 (HEK293) cell line showed that plasmid DNA loaded in the wells was functional after pulsatile release in comparison to control plasmid DNA at all time-points. Thicker films degraded faster than thinner films and could be used to fine-tune the release of DNA over day length periods. Finally the PDMS chip was shown to provide repeated sequential release of CpG oligonucleotides and a model antigen, Ovalbumin (OVA), indicating significant potential for this device for vaccinations or applications that require defined complex release patterns of a variety of chemicals, drugs and biomolecules.

Advances in Testing Techniques for Digital Microfluidic Biochips

PubMed Central

Shukla, Vineeta; Hussin, Fawnizu Azmadi; Hamid, Nor Hisham; Zain Ali, Noohul Basheer

2017-01-01

With the advancement of digital microfluidics technology, applications such as on-chip DNA analysis, point of care diagnosis and automated drug discovery are common nowadays. The use of Digital Microfluidics Biochips (DMFBs) in disease assessment and recognition of target molecules had become popular during the past few years. The reliability of these DMFBs is crucial when they are used in various medical applications. Errors found in these biochips are mainly due to the defects developed during droplet manipulation, chip degradation and inaccuracies in the bio-assay experiments. The recently proposed Micro-electrode-dot Array (MEDA)-based DMFBs involve both fluidic and electronic domains in the micro-electrode cell. Thus, the testing techniques for these biochips should be revised in order to ensure proper functionality. This paper describes recent advances in the testing technologies for digital microfluidics biochips, which would serve as a useful platform for developing revised/new testing techniques for MEDA-based biochips. Therefore, the relevancy of these techniques with respect to testing of MEDA-based biochips is analyzed in order to exploit the full potential of these biochips. PMID:28749411

Advances in Testing Techniques for Digital Microfluidic Biochips.

PubMed

Shukla, Vineeta; Hussin, Fawnizu Azmadi; Hamid, Nor Hisham; Zain Ali, Noohul Basheer

2017-07-27

With the advancement of digital microfluidics technology, applications such as on-chip DNA analysis, point of care diagnosis and automated drug discovery are common nowadays. The use of Digital Microfluidics Biochips (DMFBs) in disease assessment and recognition of target molecules had become popular during the past few years. The reliability of these DMFBs is crucial when they are used in various medical applications. Errors found in these biochips are mainly due to the defects developed during droplet manipulation, chip degradation and inaccuracies in the bio-assay experiments. The recently proposed Micro-electrode-dot Array (MEDA)-based DMFBs involve both fluidic and electronic domains in the micro-electrode cell. Thus, the testing techniques for these biochips should be revised in order to ensure proper functionality. This paper describes recent advances in the testing technologies for digital microfluidics biochips, which would serve as a useful platform for developing revised/new testing techniques for MEDA-based biochips. Therefore, the relevancy of these techniques with respect to testing of MEDA-based biochips is analyzed in order to exploit the full potential of these biochips.

Cohort analysis of a single nucleotide polymorphism on DNA chips.

PubMed

Schwonbeck, Susanne; Krause-Griep, Andrea; Gajovic-Eichelmann, Nenad; Ehrentreich-Förster, Eva; Meinl, Walter; Glatt, Hansrüdi; Bier, Frank F

2004-11-15

A method has been developed to determine SNPs on DNA chips by applying a flow-through bioscanner. As a practical application we demonstrated the fast and simple SNP analysis of 24 genotypes in an array of 96 spots with a single hybridisation and dissociation experiment. The main advantage of this methodical concept is the parallel and fast analysis without any need of enzymatic digestion. Additionally, the DNA chip format used is appropriate for parallel analysis up to 400 spots. The polymorphism in the gene of the human phenol sulfotransferase SULT1A1 was studied as a model SNP. Biotinylated PCR products containing the SNP (The SNP summary web site: ) (mutant) and those containing no mutation (wild-type) were brought onto the chips coated with NeutrAvidin using non-contact spotting. This was followed by an analysis which was carried out in a flow-through biochip scanner while constantly rinsing with buffer. After removing the non-biotinylated strand a fluorescent probe was hybridised, which is complementary to the wild-type sequence. If this probe binds to a mutant sequence, then one single base is not fully matching. Thereby, the mismatched hybrid (mutant) is less stable than the full-matched hybrid (wild-type). The final step after hybridisation on the chip involves rinsing with a buffer to start dissociation of the fluorescent probe from the immobilised DNA strand. The online measurement of the fluorescence intensity by the biochip scanner provides the possibility to follow the kinetics of the hybridisation and dissociation processes. According to the different stability of the full-match and the mismatch, either visual discrimination or kinetic analysis is possible to distinguish SNP-containing sequence from the wild-type sequence.

A Rapid Method for Optimizing Running Temperature of Electrophoresis through Repetitive On-Chip CE Operations

PubMed Central

Kaneda, Shohei; Ono, Koichi; Fukuba, Tatsuhiro; Nojima, Takahiko; Yamamoto, Takatoki; Fujii, Teruo

2011-01-01

In this paper, a rapid and simple method to determine the optimal temperature conditions for denaturant electrophoresis using a temperature-controlled on-chip capillary electrophoresis (CE) device is presented. Since on-chip CE operations including sample loading, injection and separation are carried out just by switching the electric field, we can repeat consecutive run-to-run CE operations on a single on-chip CE device by programming the voltage sequences. By utilizing the high-speed separation and the repeatability of the on-chip CE, a series of electrophoretic operations with different running temperatures can be implemented. Using separations of reaction products of single-stranded DNA (ssDNA) with a peptide nucleic acid (PNA) oligomer, the effectiveness of the presented method to determine the optimal temperature conditions required to discriminate a single-base substitution (SBS) between two different ssDNAs is demonstrated. It is shown that a single run for one temperature condition can be executed within 4 min, and the optimal temperature to discriminate the SBS could be successfully found using the present method. PMID:21845077

DNA FROM ANCIENT STONE TOOLS AND BONES EXCAVATED AT BUGAS-HOLDING, WYOMING

EPA Science Inventory

Traces of DNA may preserve on ancient stone tools. We examined 24 chipped stone artifacts recovered from the Bugas-Holding site in northwestern Wyoming for the presence of DNA residues, and we compared DNA preservation in bones and stone tools from the same stratigraphic context...

Avatar DNA Nanohybrid System in Chip-on-a-Phone

NASA Astrophysics Data System (ADS)

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-05-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording.

Avatar DNA Nanohybrid System in Chip-on-a-Phone

PubMed Central

Park, Dae-Hwan; Han, Chang Jo; Shul, Yong-Gun; Choy, Jin-Ho

2014-01-01

Long admired for informational role and recognition function in multidisciplinary science, DNA nanohybrids have been emerging as ideal materials for molecular nanotechnology and genetic information code. Here, we designed an optical machine-readable DNA icon on microarray, Avatar DNA, for automatic identification and data capture such as Quick Response and ColorZip codes. Avatar icon is made of telepathic DNA-DNA hybrids inscribed on chips, which can be identified by camera of smartphone with application software. Information encoded in base-sequences can be accessed by connecting an off-line icon to an on-line web-server network to provide message, index, or URL from database library. Avatar DNA is then converged with nano-bio-info-cogno science: each building block stands for inorganic nanosheets, nucleotides, digits, and pixels. This convergence could address item-level identification that strengthens supply-chain security for drug counterfeits. It can, therefore, provide molecular-level vision through mobile network to coordinate and integrate data management channels for visual detection and recording. PMID:24824876

Lab-on-a-chip enabled HLA diagnostic: combined sample preparation and real time PCR for HLA-B57 diagnosis

NASA Astrophysics Data System (ADS)

Gärtner, Claudia; Becker, Holger; Hlawatsch, Nadine; Klemm, Richard; Moche, Christian; Schattschneider, Sebastian; Frank, Rainer; Willems, Andreas

2015-05-01

The diverse human HLA (human leukocyte antigen) system is responsible for antigen presentation and recognition. It is essential for the immune system to maintain a stable defense line, but also is also involved in autoimmunity as well as metabolic disease. HLA-haplotype (HLA-B27), for instance, is associated with inflammatory diseases such as Bechterew's disease. The administration of the HIV drug Abacavir in combination with another HLA-haplotype (HLAB57) is associated with severe hypersensitivity reactions. Accordingly, the HLA status has to be monitored for diagnosis or prior to start of therapy. Along this line, a miniaturized microfluidic platform has been developed allowing performing the complete analytical process from "sample-in" to "answer-out" in a point-of-care environment. The main steps of the analytical cascade inside the integrated system are blood cell lysis and DNA isolation, DNA purification, real-time PCR and quantitative monitoring of the rise of a fluorescent signal appearing during the PCR based sequence amplification. All bio-analytical steps were intended to be performed inside one chip and will be actuated, controlled and monitored by a matching device. This report will show that all required processes are established and tested and all device components work well and interact with the functional modules on the chips in a harmonized fashion.

A paralleled readout system for an electrical DNA-hybridization assay based on a microstructured electrode array

NASA Astrophysics Data System (ADS)

Urban, Matthias; Möller, Robert; Fritzsche, Wolfgang

2003-02-01

DNA analytics is a growing field based on the increasing knowledge about the genome with special implications for the understanding of molecular bases for diseases. Driven by the need for cost-effective and high-throughput methods for molecular detection, DNA chips are an interesting alternative to more traditional analytical methods in this field. The standard readout principle for DNA chips is fluorescence based. Fluorescence is highly sensitive and broadly established, but shows limitations regarding quantification (due to signal and/or dye instability) and the need for sophisticated (and therefore high-cost) equipment. This article introduces a readout system for an alternative detection scheme based on electrical detection of nanoparticle-labeled DNA. If labeled DNA is present in the analyte solution, it will bind on complementary capture DNA immobilized in a microelectrode gap. A subsequent metal enhancement step leads to a deposition of conductive material on the nanoparticles, and finally an electrical contact between the electrodes. This detection scheme offers the potential for a simple (low-cost as well as robust) and highly miniaturizable method, which could be well-suited for point-of-care applications in the context of lab-on-a-chip technologies. The demonstrated apparatus allows a parallel readout of an entire array of microstructured measurement sites. The readout is combined with data-processing by an embedded personal computer, resulting in an autonomous instrument that measures and presents the results. The design and realization of such a system is described, and first measurements are presented.

A pilot study of gene expression analysis in workers with hand-arm vibration syndrome.

PubMed

Maeda, Setsuo; Yu, Xiaozhong; Wang, Rui-Sheng; Sakakibara, Hisataka

2008-04-01

The purpose of this pilot study was to examine differences in gene expressions by cDNA microarray analysis of hand-arm vibration syndrome (HAVS) patients. Vein blood samples were collected and total RNA was extracted. All blood samples were obtained in the morning in one visit after a standard light breakfast. We performed microarray analysis with the labeled cDNA prepared by reverse transcription from RNA samples, using the Human CHIP version 1 (DNA Chip Research Inc, Yokohama, Japan). There are 2,976 genes on the chip, and these genes were selected from a cDNA library prepared with human peripheral white blood cells (WBC). Different gene levels between the HAVS patients and controls, and between groups of HAVS with different levels of symptoms, were indicated by the randomized variance model. The most up-regulated genes were analyzed for their possible functions and association with the occurrence of HAVS. From the results of this pilot study, although the results were obtained a limited number of subjects, it would appear that cDNA microarray analysis of HAVS patients has potential as a new objective method of HAVS diagnosis. Further research is needed to examine the gene expression with increased numbers of patients at different stages of HAVS.

Rapid self-assembly of DNA on a microfluidic chip

PubMed Central

Zheng, Yao; Footz, Tim; Manage, Dammika P; Backhouse, Christopher James

2005-01-01

Background DNA self-assembly methods have played a major role in enabling methods for acquiring genetic information without having to resort to sequencing, a relatively slow and costly procedure. However, even self-assembly processes tend to be very slow when they rely upon diffusion on a large scale. Miniaturisation and integration therefore hold the promise of greatly increasing this speed of operation. Results We have developed a rapid method for implementing the self-assembly of DNA within a microfluidic system by electrically extracting the DNA from an environment containing an uncharged denaturant. By controlling the parameters of the electrophoretic extraction and subsequent analysis of the DNA we are able to control when the hybridisation occurs as well as the degree of hybridisation. By avoiding off-chip processing or long thermal treatments we are able to perform this hybridisation rapidly and can perform hybridisation, sizing, heteroduplex analysis and single-stranded conformation analysis within a matter of minutes. The rapidity of this analysis allows the sampling of transient effects that may improve the sensitivity of mutation detection. Conclusions We believe that this method will aid the integration of self-assembly methods upon microfluidic chips. The speed of this analysis also appears to provide information upon the dynamics of the self-assembly process. PMID:15717935

Chromatin immunoprecipitation in microfluidic droplets: towards fast and cheap analyses.

PubMed

Teste, Bruno; Champ, Jerome; Londono-Vallejo, Arturo; Descroix, Stéphanie; Malaquin, Laurent; Viovy, Jean-Louis; Draskovic, Irena; Mottet, Guillaume

2017-01-31

Genetic organization is governed by the interaction of DNA with histone proteins, and differential modifications of these proteins is a fundamental mechanism of gene regulation. Histone modifications are primarily studied through chromatin immunoprecipitation (ChIP) assays, however conventional ChIP procedures are time consuming, laborious and require a large number of cells. Here we report for the first time the development of ChIP in droplets based on a microfluidic platform combining nanoliter droplets, magnetic beads (MB) and magnetic tweezers (MT). The droplet approach enabled compartmentalization and improved mixing, while reducing the consumption of samples and reagents in an integrated workflow. Anti-histone antibodies grafted to MB were used as a solid support to capture and transfer the target chromatin from droplets to droplets in order to perform chromatin immunoprecipitation, washing, elution and purification of DNA. We designed a new ChIP protocol to investigate four different types of modified histones with known roles in gene activation or repression. We evaluated the performances of this new ChIP in droplet assay in comparison with conventional methods. The proposed technology dramatically reduces analytical time from a few days to 7 hours, simplifies the ChIP protocol and decreases the number of cells required by 100 fold while maintaining a high degree of sensitivity and specificity. Therefore this droplet-based ChIP assay represents a new, highly advantageous and convenient approach to epigenetic analyses.

Detection of M. tuberculosis using DNA chips combined with an image analysis system.

PubMed

Huang, T-S; Liu, Y-C; Bair, C-H; Sy, C-L; Chen, Y-S; Tu, H-Z; Chen, B-C

2008-01-01

To develop a packaged DNA chip assay (the DR. MTBC Screen assay) for direct detection of the Mycobacterium tuberculosis complex. We described a DNA chip assay based on the IS6110 gene that can be used for the detection of M. tuberculosis complex. Probes were spotted onto the polystyrene strips in the wells of 96-well microtitre plates and used for hybridisation with biotin-labelled amplicon to yield a pattern of visualised positive spots. The plate image was scanned, analysed and interpreted automatically. The results corresponded well with those obtained by conventional culture as well as clinical diagnosis, with sensitivity and specificity rates of respectively 83.8% and 94.2%, and 84.6% and 96.3%. We conclude that the DR. MTBC Screen assay can detect M. tuberculosis complex rapidly in respiratory specimens, readily adapts to routine work and provides a flexible choice to meet different cost-effectiveness and automation needs in TB-endemic countries. The cost for reagents is around US$10 per sample.

Total integrated slidable and valveless solid phase extraction-polymerase chain reaction-capillary electrophoresis microdevice for mini Y chromosome short tandem repeat genotyping.

PubMed

Kim, Yong Tae; Lee, Dohwan; Heo, Hyun Young; Sim, Jeong Eun; Woo, Kwang Man; Kim, Do Hyun; Im, Sung Gap; Seo, Tae Seok

2016-04-15

A fully integrated slidable and valveless microsystem, which performs solid phase DNA extraction (SPE), micro-polymerase chain reaction (μPCR) and micro-capillary electrophoresis (μCE) coupled with a portable genetic analyser, has been developed for forensic genotyping. The use of a slidable chip, in which a 1 μL-volume of the PCR chamber was patterned at the center, does not necessitate any microvalves and tubing systems for fluidic control. The functional micro-units of SPE, μPCR, and μCE were fabricated on a single glass wafer by conventional photolithography, and the integrated microdevice consists of three layers: from top to bottom, a slidable chip, a channel wafer in which a SPE chamber, a mixing microchannel, and a CE microchannel were fabricated, and a Ti/Pt resistance temperature detector (RTD) wafer. The channel glass wafer and the RTD glass wafer were thermally bonded, and the slidable chip was placed on the designated functional unit. The entire process from the DNA extraction using whole human blood sample to identification of target Y chromosomal short tandem repeat (STR) loci was serially carried out with simply sliding the slidable chamber from one to another functional unit. Monoplex and multiplex detection of amelogenin and mini Y STR loci were successfully analysed on the integrated slidable SPE-μPCR-μCE microdevice by using 1 μL whole human blood within 60 min. The proposed advanced genetic analysis microsystem is capable of point-of-care DNA testing with sample-in-answer-out capability, more importantly, without use of complicated microvalves and microtubing systems for liquid transfer. Copyright © 2015 Elsevier B.V. All rights reserved.

Bio-Inspired Microsystem for Robust Genetic Assay Recognition

PubMed Central

Lue, Jaw-Chyng; Fang, Wai-Chi

2008-01-01

A compact integrated system-on-chip (SoC) architecture solution for robust, real-time, and on-site genetic analysis has been proposed. This microsystem solution is noise-tolerable and suitable for analyzing the weak fluorescence patterns from a PCR prepared dual-labeled DNA microchip assay. In the architecture, a preceding VLSI differential logarithm microchip is designed for effectively computing the logarithm of the normalized input fluorescence signals. A posterior VLSI artificial neural network (ANN) processor chip is used for analyzing the processed signals from the differential logarithm stage. A single-channel logarithmic circuit was fabricated and characterized. A prototype ANN chip with unsupervised winner-take-all (WTA) function was designed, fabricated, and tested. An ANN learning algorithm using a novel sigmoid-logarithmic transfer function based on the supervised backpropagation (BP) algorithm is proposed for robustly recognizing low-intensity patterns. Our results show that the trained new ANN can recognize low-fluorescence patterns better than an ANN using the conventional sigmoid function. PMID:18566679

A comparative study of ChIP-seq sequencing library preparation methods.

PubMed

Sundaram, Arvind Y M; Hughes, Timothy; Biondi, Shea; Bolduc, Nathalie; Bowman, Sarah K; Camilli, Andrew; Chew, Yap C; Couture, Catherine; Farmer, Andrew; Jerome, John P; Lazinski, David W; McUsic, Andrew; Peng, Xu; Shazand, Kamran; Xu, Feng; Lyle, Robert; Gilfillan, Gregor D

2016-10-21

ChIP-seq is the primary technique used to investigate genome-wide protein-DNA interactions. As part of this procedure, immunoprecipitated DNA must undergo "library preparation" to enable subsequent high-throughput sequencing. To facilitate the analysis of biopsy samples and rare cell populations, there has been a recent proliferation of methods allowing sequencing library preparation from low-input DNA amounts. However, little information exists on the relative merits, performance, comparability and biases inherent to these procedures. Notably, recently developed single-cell ChIP procedures employing microfluidics must also employ library preparation reagents to allow downstream sequencing. In this study, seven methods designed for low-input DNA/ChIP-seq sample preparation (Accel-NGS® 2S, Bowman-method, HTML-PCR, SeqPlex™, DNA SMART™, TELP and ThruPLEX®) were performed on five replicates of 1 ng and 0.1 ng input H3K4me3 ChIP material, and compared to a "gold standard" reference PCR-free dataset. The performance of each method was examined for the prevalence of unmappable reads, amplification-derived duplicate reads, reproducibility, and for the sensitivity and specificity of peak calling. We identified consistent high performance in a subset of the tested reagents, which should aid researchers in choosing the most appropriate reagents for their studies. Furthermore, we expect this work to drive future advances by identifying and encouraging use of the most promising methods and reagents. The results may also aid judgements on how comparable are existing datasets that have been prepared with different sample library preparation reagents.

Knowledge-based image processing for on-off type DNA microarray

NASA Astrophysics Data System (ADS)

Kim, Jong D.; Kim, Seo K.; Cho, Jeong S.; Kim, Jongwon

2002-06-01

This paper addresses the image processing technique for discriminating whether the probes are hybrized with target DNA in the Human Papilloma Virus (HPV) DNA Chip designed for genotyping HPV. In addition to the probes, the HPV DNA chip has markers that always react with the sample DNA. The positions of probe-dots in the final scanned image are fixed relative to the marker-dot locations with a small variation according to the accuracy of the dotter and the scanner. The probes are duplicated 4 times for the diagnostic stability. The prior knowledges such as the maker relative distance and the duplication information of probes is integrated into the template matching technique with the normalized correlation measure. Results show that the employment of both of the prior knowledges is to simply average the template matching measures over the positions of the markers and probes. The eventual proposed scheme yields stable marker locating and probe classification.

Automated array-based genomic profiling in chronic lymphocytic leukemia: Development of a clinical tool and discovery of recurrent genomic alterations

PubMed Central

Schwaenen, Carsten; Nessling, Michelle; Wessendorf, Swen; Salvi, Tatjana; Wrobel, Gunnar; Radlwimmer, Bernhard; Kestler, Hans A.; Haslinger, Christian; Stilgenbauer, Stephan; Döhner, Hartmut; Bentz, Martin; Lichter, Peter

2004-01-01

B cell chronic lymphocytic leukemia (B-CLL) is characterized by a highly variable clinical course. Recurrent chromosomal imbalances provide significant prognostic markers. Risk-adapted therapy based on genomic alterations has become an option that is currently being tested in clinical trials. To supply a robust tool for such large scale studies, we developed a comprehensive DNA microarray dedicated to the automated analysis of recurrent genomic imbalances in B-CLL by array-based comparative genomic hybridization (matrix–CGH). Validation of this chip in a series of 106 B-CLL cases revealed a high specificity and sensitivity that fulfils the criteria for application in clinical oncology. This chip is immediately applicable within clinical B-CLL treatment trials that evaluate whether B-CLL cases with distinct chromosomal abnormalities should be treated with chemotherapy of different intensities and/or stem cell transplantation. Through the control set of DNA fragments equally distributed over the genome, recurrent genomic imbalances were discovered: trisomy of chromosome 19 and gain of the MYCN oncogene correlating with an elevation of MYCN mRNA expression. PMID:14730057

Digital quantification of DNA via isothermal amplification on a self-driven microfluidic chip featuring hydrophilic film-coated polydimethylsiloxane.

PubMed

Ma, Yu-Dong; Chang, Wen-Hsin; Luo, Kang; Wang, Chih-Hung; Liu, Shih-Yuan; Yen, Wen-Hsiang; Lee, Gwo-Bin

2018-01-15

Loop-mediated isothermal amplification (LAMP) is a DNA amplification approach characterized by high sensitivity and specificity. In "digital LAMP", small quantities of both template DNA and reagents are encapsulated within a droplet or microwell, allowing for analysis of precious nucleic acid samples in shorter amounts of time relative to traditional DNA amplification protocols (e.g., PCR) with an improved limit of detection. In this study, an integrated, self-driven microfluidic chip was designed to carry out digital LAMP. The entire quantification process could be automatically performed on this chip via capillary forces enabled through microwells comprised of polydimethylsiloxane (PDMS) surfaces coated with a hydrophilic film; no external pumps were required. Moreover, digitized droplets could be separated from each other by normally-closed microvalves. The contact angle of the hydrophilic film-coated PDMS surface was only 14.3°. This is the first time that a rapid (30min) and simple method has been used to create hydrophilic PDMS surfaces that allow for digital LAMP to be performed in a self-driven microfluidic device. As a proof of concept, amplification of a gene specific to a vancomycin-resistant Enterococcus strain was performed on the developed microfluidic chip within 30min, and the limit of detection was only 11 copies with a volume of 30μL. This device may therefore become a promising tool for clinical diagnosis and point-of-care applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Modulation-frequency encoded multi-color fluorescent DNA analysis in an optofluidic chip.

PubMed

Dongre, Chaitanya; van Weerd, Jasper; Besselink, Geert A J; Vazquez, Rebeca Martinez; Osellame, Roberto; Cerullo, Giulio; van Weeghel, Rob; van den Vlekkert, Hans H; Hoekstra, Hugo J W M; Pollnau, Markus

2011-02-21

We introduce a principle of parallel optical processing to an optofluidic lab-on-a-chip. During electrophoretic separation, the ultra-low limit of detection achieved with our set-up allows us to record fluorescence from covalently end-labeled DNA molecules. Different sets of exclusively color-labeled DNA fragments-otherwise rendered indistinguishable by spatio-temporal coincidence-are traced back to their origin by modulation-frequency-encoded multi-wavelength laser excitation, fluorescence detection with a single ultrasensitive, albeit color-blind photomultiplier, and Fourier analysis decoding. As a proof of principle, fragments obtained by multiplex ligation-dependent probe amplification from independent human genomic segments, associated with genetic predispositions to breast cancer and anemia, are simultaneously analyzed.

Scalable Device for Automated Microbial Electroporation in a Digital Microfluidic Platform.

PubMed

Madison, Andrew C; Royal, Matthew W; Vigneault, Frederic; Chen, Liji; Griffin, Peter B; Horowitz, Mark; Church, George M; Fair, Richard B

2017-09-15

Electrowetting-on-dielectric (EWD) digital microfluidic laboratory-on-a-chip platforms demonstrate excellent performance in automating labor-intensive protocols. When coupled with an on-chip electroporation capability, these systems hold promise for streamlining cumbersome processes such as multiplex automated genome engineering (MAGE). We integrated a single Ti:Au electroporation electrode into an otherwise standard parallel-plate EWD geometry to enable high-efficiency transformation of Escherichia coli with reporter plasmid DNA in a 200 nL droplet. Test devices exhibited robust operation with more than 10 transformation experiments performed per device without cross-contamination or failure. Despite intrinsic electric-field nonuniformity present in the EP/EWD device, the peak on-chip transformation efficiency was measured to be 8.6 ± 1.0 × 10 8 cfu·μg -1 for an average applied electric field strength of 2.25 ± 0.50 kV·mm -1 . Cell survival and transformation fractions at this electroporation pulse strength were found to be 1.5 ± 0.3 and 2.3 ± 0.1%, respectively. Our work expands the EWD toolkit to include on-chip microbial electroporation and opens the possibility of scaling advanced genome engineering methods, like MAGE, into the submicroliter regime.

Recombinant drugs-on-a-chip: The usage of capillary electrophoresis and trends in miniaturized systems - A review.

PubMed

Morbioli, Giorgio Gianini; Mazzu-Nascimento, Thiago; Aquino, Adriano; Cervantes, Cesar; Carrilho, Emanuel

2016-09-07

We present here a critical review covering conventional analytical tools of recombinant drug analysis and discuss their evolution towards miniaturized systems foreseeing a possible unique recombinant drug-on-a-chip device. Recombinant protein drugs and/or pro-drug analysis require sensitive and reproducible analytical techniques for quality control to ensure safety and efficacy of drugs according to regulatory agencies. The versatility of miniaturized systems combined with their low-cost could become a major trend in recombinant drugs and bioprocess analysis. Miniaturized systems are capable of performing conventional analytical and proteomic tasks, allowing for interfaces with other powerful techniques, such as mass spectrometry. Microdevices can be applied during the different stages of recombinant drug processing, such as gene isolation, DNA amplification, cell culture, protein expression, protein separation, and analysis. In addition, organs-on-chips have appeared as a viable alternative to testing biodrug pharmacokinetics and pharmacodynamics, demonstrating the capabilities of the miniaturized systems. The integration of individual established microfluidic operations and analytical tools in a single device is a challenge to be overcome to achieve a unique recombinant drug-on-a-chip device. Copyright © 2016 Elsevier B.V. All rights reserved.

Quantized correlation coefficient for measuring reproducibility of ChIP-chip data.

PubMed

Peng, Shouyong; Kuroda, Mitzi I; Park, Peter J

2010-07-27

Chromatin immunoprecipitation followed by microarray hybridization (ChIP-chip) is used to study protein-DNA interactions and histone modifications on a genome-scale. To ensure data quality, these experiments are usually performed in replicates, and a correlation coefficient between replicates is used often to assess reproducibility. However, the correlation coefficient can be misleading because it is affected not only by the reproducibility of the signal but also by the amount of binding signal present in the data. We develop the Quantized correlation coefficient (QCC) that is much less dependent on the amount of signal. This involves discretization of data into set of quantiles (quantization), a merging procedure to group the background probes, and recalculation of the Pearson correlation coefficient. This procedure reduces the influence of the background noise on the statistic, which then properly focuses more on the reproducibility of the signal. The performance of this procedure is tested in both simulated and real ChIP-chip data. For replicates with different levels of enrichment over background and coverage, we find that QCC reflects reproducibility more accurately and is more robust than the standard Pearson or Spearman correlation coefficients. The quantization and the merging procedure can also suggest a proper quantile threshold for separating signal from background for further analysis. To measure reproducibility of ChIP-chip data correctly, a correlation coefficient that is robust to the amount of signal present should be used. QCC is one such measure. The QCC statistic can also be applied in a variety of other contexts for measuring reproducibility, including analysis of array CGH data for DNA copy number and gene expression data.

Assessment of HPV-mRNA test to predict recurrent disease in patients previously treated for CIN 2/3.

PubMed

Frega, Antonio; Sesti, Francesco; Lombardi, Danila; Votano, Sergio; Sopracordevole, Francesco; Catalano, Angelica; Milazzo, Giusi Natalia; Lombardo, Riccardo; Assorgi, Chiara; Olivola, Sara; Chiusuri, Valentina; Ricciardi, Enzo; French, Deborah; Moscarini, Massimo

2014-05-01

The use of HPV-mRNA test in the follow-up after LEEP is still matter of debate, with regard to its capacity of prediction relapse. The aim of the present study is to evaluate the reliability of HPV-mRNA test to predict the residual and recurrent disease, and its accuracy in the follow-up of patients treated for CIN 2/3. Multicenter prospective cohort study. Patients who underwent LEEP after a biopsy diagnosing CIN 2/3 were followed at 3, 6, 12, 24 and 36 months. Each check up included cytology, colposcopy, HPV-DNA test (LiPA) and HPV-mRNA test (PreTect HPV Proofer Kit NorChip). Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), of HPV-DNA test and HPV-mRNA test to predict relapse, recurrent and residual disease. Using multiple logistic regression, the statistical significant variables as assessed in univariate analysis were entered and investigated as predictors of relapse disease. The mRNA-test in predicting a residual disease had a sensitivity of 52% and a NPV of 91%, whereas DNA-test had 100% and 100%, respectively. On the contrary in the prediction of recurrent disease mRNA-test had a sensitivity and a NPV of 73.5% and 97%, whereas DNA-test had 44% and 93%. On the multivariate analysis, age, cytology, HPV DNA and mRNA test achieved the role of independent predictors of relapse. HPV-mRNA test has a higher sensitivity and a higher NPV in predicting recurrent disease, for this reason it should be used in the follow-up of patients treated with LEEP for CIN 2/3 in order to individualize the timing of check up. Copyright © 2014 Elsevier B.V. All rights reserved.

Isotachophoresis for fractionation and recovery of cytoplasmic RNA and nucleus from single cells.

PubMed

Kuriyama, Kentaro; Shintaku, Hirofumi; Santiago, Juan G

2015-07-01

There is a substantial need for simultaneous analyses of RNA and DNA from individual single cells. Such analysis provides unique evidence of cell-to-cell differences and the correlation between gene expression and genomic mutation in highly heterogeneous cell populations. We present a novel microfluidic system that leverages isotachophoresis to fractionate and isolate cytoplasmic RNA and genomic DNA (gDNA) from single cells. The system uniquely enables independent, sequence-specific analyses of these critical markers. Our system uses a microfluidic chip with a simple geometry and four end-channel electrodes, and completes the entire process in <5 min, including lysis, purification, fractionation, and delivery to DNA and RNA output reservoirs, each containing high quality and purity aliquots with no measurable cross-contamination of cytoplasmic RNA versus gDNA. We demonstrate our system with simultaneous, sequence-specific quantitation using off-chip RT-qPCR and qPCR for simultaneous cytoplasmic RNA and gDNA analyses, respectively. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantum dot-based microfluidic biosensor for cancer detection

NASA Astrophysics Data System (ADS)

Ghrera, Aditya Sharma; Pandey, Chandra Mouli; Ali, Md. Azahar; Malhotra, Bansi Dhar

2015-05-01

We report results of the studies relating to fabrication of an impedimetric microfluidic-based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium-tin-oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir-Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system has been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10-15 M to 10-11 M.

DIVERSITY in binding, regulation, and evolution revealed from high-throughput ChIP.

PubMed

Mitra, Sneha; Biswas, Anushua; Narlikar, Leelavati

2018-04-01

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data processing.

PubMed

Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

2016-10-01

Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

Another expert system rule inference based on DNA molecule logic gates

NASA Astrophysics Data System (ADS)

WÄ siewicz, Piotr

2013-10-01

With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

Trapping and Collection of Lymphocytes Using Microspot Array Chip and Magnetic Beads

NASA Astrophysics Data System (ADS)

Hashioka, Shingi; Obata, Tsutomu; Tokimitsu, Yoshiharu; Fujiki, Satoshi; Nakazato, Hiroyoshi; Muraguchi, Atsushi; Kishi, Hiroyuki; Tanino, Katsumi

2006-04-01

A microspot array chip, which has microspots of a magnetic thin film patterned on a glass substrate, was fabricated for trapping individual cells and for measuring their cellular response. The chip was easily fabricated by conventional semiconductor fabrication techniques on a mass production level as a disposable medical device. When a solution of lymphocyte-bound-magnetic beads was poured into the magnetized chip, each lymphocyte was trapped on each microspot of the magnetic thin film. The trapped cells were easily recovered from the chip using a micromanipulator. The micro-spot array chip can be utilized for arraying live cells and for measuring the response of each cell. The chip will be useful for preparing on array of different kinds of cells and for analyzing cellular response at the single cell level. The chip will be particularly useful for detecting antigen-specific B-lymphocytes and antigen-specific antibody complementary deoxyribonucleic acid (cDNA).

Microfabricated plastic chips by hot embossing methods and their applications for DNA separation and detection

NASA Astrophysics Data System (ADS)

Lee, Gwo-Bin; Chen, Shu-Hui; Huang, Guan-Ruey; Lin, Yen-Heng; Sung, Wang-Chou

2000-08-01

Design and fabrication of microfluidic devices on polymethylmethacrylate (PMMA) substrates using novel microfabrication methods are described. The image of microfluidic devices is transferred from quartz master templates possessing inverse image of the devices to plastic plates by using hot embossing method. The micro channels on master templates are formed by the combination of metal etch mask and wet chemical etching. The micromachined quartz templates can be used repeatedly to fabricate cheap and disposable plastic devices. The reproducibility of the hot embossing method is evaluated after using 10 channels on different plastics. The relative standard deviation of the plastic channel profile from ones on quartz templates is less than 1%. In this study, the PMMA chips have been demonstrated as a micro capillary electrophoresis ((mu) -CE) device for DNA separation and detection. The capability of the fabricated chip for electrophoretic injection and separation is characterized via the analysis of DNA fragments (phi) X174. Results indicate that all of the 11 DNA fragments of the size marker could be identified in less than 3 minutes with relative standard deviations less than 0.4% and 8% for migration time and peak area, respectively. Moreover, with the use of near IR dye, fluorescence signals of the higher molecular weight fragments ($GTR 603 bp in length) could be detected at total DNA concentrations as low as 0.1 (mu) g/mL. In addition to DNA fragments (phi) X174, DNA sizing of hepatitis C viral (HCV) amplicon is also achieved using microchip electrophoresis fabricated on PMMA substrate.

System and method for a parallel immunoassay system

DOEpatents

Stevens, Fred J.

2002-01-01

A method and system for detecting a target antigen using massively parallel immunoassay technology. In this system, high affinity antibodies of the antigen are covalently linked to small beads or particles. The beads are exposed to a solution containing DNA-oligomer-mimics of the antigen. The mimics which are reactive with the covalently attached antibody or antibodies will bind to the appropriate antibody molecule on the bead. The particles or beads are then washed to remove any unbound DNA-oligomer-mimics and are then immobilized or trapped. The bead-antibody complexes are then exposed to a test solution which may contain the targeted antigens. If the antigen is present it will replace the mimic since it has a greater affinity for the respective antibody. The particles are then removed from the solution leaving a residual solution. This residual solution is applied a DNA chip containing many samples of complimentary DNA. If the DNA tag from a mimic binds with its complimentary DNA, it indicates the presence of the target antigen. A flourescent tag can be used to more easily identify the bound DNA tag.

Single DNA imaging and length quantification through a mobile phone microscope

NASA Astrophysics Data System (ADS)

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2016-03-01

The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

Microfluidic Arrayed Lab-On-A-Chip for Electrochemical Capacitive Detection of DNA Hybridization Events.

PubMed

Ben-Yoav, Hadar; Dykstra, Peter H; Bentley, William E; Ghodssi, Reza

2017-01-01

A microfluidic electrochemical lab-on-a-chip (LOC) device for DNA hybridization detection has been developed. The device comprises a 3 × 3 array of microelectrodes integrated with a dual layer microfluidic valved manipulation system that provides controlled and automated capabilities for high throughput analysis of microliter volume samples. The surface of the microelectrodes is functionalized with single-stranded DNA (ssDNA) probes which enable specific detection of complementary ssDNA targets. These targets are detected by a capacitive technique which measures dielectric variation at the microelectrode-electrolyte interface due to DNA hybridization events. A quantitative analysis of the hybridization events is carried out based on a sensing modeling that includes detailed analysis of energy storage and dissipation components. By calculating these components during hybridization events the device is able to demonstrate specific and dose response sensing characteristics. The developed microfluidic LOC for DNA hybridization detection offers a technology for real-time and label-free assessment of genetic markers outside of laboratory settings, such as at the point-of-care or in-field environmental monitoring.

Silver Nanoscale Hexagonal Column Chips for Detecting Cell-free DNA and Circulating Nucleosomes in Cancer Patients.

PubMed

Ito, Hiroaki; Hasegawa, Katsuyuki; Hasegawa, Yuuki; Nishimaki, Tadashi; Hosomichi, Kazuyoshi; Kimura, Satoshi; Ohba, Motoi; Yao, Hiroshi; Onimaru, Manabu; Inoue, Ituro; Inoue, Haruhiro

2015-05-21

Blood tests, which are commonly used for cancer screening, generally have low sensitivity. Here, we developed a novel rapid and simple method to generate silver nanoscale hexagonal columns (NHCs) for use in surface-enhanced Raman scattering (SERS). We reported that the intensity of SERS spectra of clinical serum samples obtained from gastrointestinal cancer patients is was significantly higher than that of SERS spectra of clinical serum samples obtained from non-cancer patients. We estimated the combined constituents on silver NHCs by using a field emission-type scanning electron microscope, Raman microscopes, and a 3D laser scanning confocal microscope. We obtained the Raman scattering spectra of samples of physically fractured cells and clinical serum. No spectra were obtained for chemically lysed cultured cells and DNA, RNA, and protein extracted from cultured cells. We believe that our method, which uses SERS with silver NHCs to detect circulating nucleosomes bound by methylated cell-free DNA, may be successfully implemented in blood tests for cancer screening.

Digital PCR on an integrated self-priming compartmentalization chip.

PubMed

Zhu, Qiangyuan; Qiu, Lin; Yu, Bingwen; Xu, Yanan; Gao, Yibo; Pan, Tingting; Tian, Qingchang; Song, Qi; Jin, Wei; Jin, Qinhan; Mu, Ying

2014-03-21

An integrated on-chip valve-free and power-free microfluidic digital PCR device is for the first time developed by making use of a novel self-priming compartmentalization and simple dehydration control to realize 'divide and conquer' for single DNA molecule detection. The high gas solubility of PDMS is exploited to provide the built-in power of self-priming so that the sample and oil are sequentially sucked into the device to realize sample self-compartmentalization based on surface tension. The lifespan of its self-priming capability was about two weeks tested using an air-tight packaging bottle sealed with a small amount of petroleum jelly, which is significant for a practical platform. The SPC chip contains 5120 independent 5 nL microchambers, allowing the samples to be compartmentalized completely. Using this platform, three different abundances of lung cancer related genes are detected to demonstrate the feasibility and flexibility of the microchip for amplifying a single nucleic acid molecule. For maximal accuracy, within less than 5% of the measurement deviation, the optimal number of positive chambers is between 400 and 1250 evaluated by the Poisson distribution, which means one panel can detect an average of 480 to 4804 template molecules. This device without world-to-chip connections eliminates the constraint of the complex pipeline control, and is an integrated on-chip platform, which would be a significant improvement to digital PCR automation and more user-friendly.

Genome wide approaches to identify protein-DNA interactions.

PubMed

Ma, Tao; Ye, Zhenqing; Wang, Liguo

2018-05-29

Transcription factors are DNA-binding proteins that play key roles in many fundamental biological processes. Unraveling their interactions with DNA is essential to identify their target genes and understand the regulatory network. Genome-wide identification of their binding sites became feasible thanks to recent progress in experimental and computational approaches. ChIP-chip, ChIP-seq, and ChIP-exo are three widely used techniques to demarcate genome-wide transcription factor binding sites. This review aims to provide an overview of these three techniques including their experiment procedures, computational approaches, and popular analytic tools. ChIP-chip, ChIP-seq, and ChIP-exo have been the major techniques to study genome-wide in vivo protein-DNA interaction. Due to the rapid development of next-generation sequencing technology, array-based ChIP-chip is deprecated and ChIP-seq has become the most widely used technique to identify transcription factor binding sites in genome-wide. The newly developed ChIP-exo further improves the spatial resolution to single nucleotide. Numerous tools have been developed to analyze ChIP-chip, ChIP-seq and ChIP-exo data. However, different programs may employ different mechanisms or underlying algorithms thus each will inherently include its own set of statistical assumption and bias. So choosing the most appropriate analytic program for a given experiment needs careful considerations. Moreover, most programs only have command line interface so their installation and usage will require basic computation expertise in Unix/Linux. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Automated Microfluidic Platform for Serial Polymerase Chain Reaction and High-Resolution Melting Analysis.

PubMed

Cao, Weidong; Bean, Brian; Corey, Scott; Coursey, Johnathan S; Hasson, Kenton C; Inoue, Hiroshi; Isano, Taisuke; Kanderian, Sami; Lane, Ben; Liang, Hongye; Murphy, Brian; Owen, Greg; Shinoda, Nobuhiko; Zeng, Shulin; Knight, Ivor T

2016-06-01

We report the development of an automated genetic analyzer for human sample testing based on microfluidic rapid polymerase chain reaction (PCR) with high-resolution melting analysis (HRMA). The integrated DNA microfluidic cartridge was used on a platform designed with a robotic pipettor system that works by sequentially picking up different test solutions from a 384-well plate, mixing them in the tips, and delivering mixed fluids to the DNA cartridge. A novel image feedback flow control system based on a Canon 5D Mark II digital camera was developed for controlling fluid movement through a complex microfluidic branching network without the use of valves. The same camera was used for measuring the high-resolution melt curve of DNA amplicons that were generated in the microfluidic chip. Owing to fast heating and cooling as well as sensitive temperature measurement in the microfluidic channels, the time frame for PCR and HRMA was dramatically reduced from hours to minutes. Preliminary testing results demonstrated that rapid serial PCR and HRMA are possible while still achieving high data quality that is suitable for human sample testing. © 2015 Society for Laboratory Automation and Screening.

Transcriptional effect of an Aframomum angustifolium seed extract on human cutaneous cells using low-density DNA chips.

PubMed

Bonnet-Duquennoy, Mathilde; Dumas, Marc; Debacker, Adeline; Lazou, Kristell; Talbourdet, Sylvie; Franchi, Jocelyne; Heusèle, Catherine; André, Patrice; Schnebert, Sylvianne; Bonté, Frédéric; Kurfürst, Robin

2007-06-01

Studying photoexposed and photoprotected skin biopsies from young and aged women, it has been found that a specific zone, composed of the basal layers of the epidermis, the dermal epidermal junction, and the superficial dermis, is major target of aging and reactive oxygen species. We showed that this zone is characterized by significant variations at a transcriptional and/or protein levels. Using low-density DNA chip technology, we evaluated the effect of a natural mixture of Aframomum angustifolium seed extract containing labdane diterpenoids on these aging markers. Expression profiles of normal human fibroblasts (NHF) were studied using a customized cDNA macroarray system containing genes covering dermal structure, inflammatory responses, and oxidative stress defense mechanisms. For normal human keratinocyte (NHK) investigations, we chose OLISA technique, a sensitive and quantitative method developed by BioMérieux specifically designed to investigate cell death, proliferation, epidermal structure, differentiation, and oxidative stress defense response. We observed that this extract strongly modified gene expression profiles of treated NHK, but weakly for NHF. This extract regulated antioxidant defenses, dermal-epidermal junction components, and epidermal renewal-related genes. Using low-density DNA chip technology, we identified new potential actions of A. angustifolium seed extract on skin aging.

Transcriptome Analysis of Lactococcus lactis in Coculture with Saccharomyces cerevisiae▿

PubMed Central

Maligoy, Mathieu; Mercade, Myriam; Cocaign-Bousquet, Muriel; Loubiere, Pascal

2008-01-01

The study of microbial interactions in mixed cultures remains an important conceptual and methodological challenge for which transcriptome analysis could prove to be the essential method for improving our understanding. However, the use of whole-genome DNA chips is often restricted to the pure culture of the species for which the chips were designed. In this study, massive cross-hybridization was observed between the foreign cDNA and the specific Lactococcus lactis DNA chip. A very simple method is proposed to considerably decrease this nonspecific hybridization, consisting of adding the microbial partner's DNA. A correlation was established between the resulting cross-hybridization and the phylogenetic distance between the microbial partners. The response of L. lactis to the presence of Saccharomyces cerevisiae was analyzed during the exponential growth phase in fermentors under defined growth conditions. Although no differences between growth kinetics were observed for the pure and the mixed cultures of L. lactis, the mRNA levels of 158 genes were significantly modified. More particularly, a strong reorientation of pyrimidine metabolism was observed when L. lactis was grown in mixed cultures. These changes in transcript abundance were demonstrated to be regulated by the ethanol produced by the yeast and were confirmed by an independent method (quantitative reverse transcription-PCR). PMID:17993564

Ultrafast, efficient separations of large-sized dsDNA in a blended polymer matrix by microfluidic chip electrophoresis: A Design of Experiments approach

PubMed Central

Sun, Mingyun; Lin, Jennifer S.

2012-01-01

Double-stranded (ds) DNA fragments over a wide size range were successfully separated in blended polymer matrices by microfluidic chip electrophoresis. Novel blended polymer matrices composed of two types of polymers with three different molar masses were developed to provide improved separations of large dsDNA without negatively impacting the separation of small dsDNA. Hydroxyethyl celluloses (HECs) with average molar masses of ~27 kDa and ~1 MDa were blended with a second class of polymer, high-molar mass (~7 MDa) linear polyacrylamide (LPA). Fast and highly efficient separations of commercially available DNA ladders were achieved on a borosilicate glass microchip. A distinct separation of a 1 Kb DNA extension ladder (200 bp to 40,000 bp) was completed in 2 minutes. An orthogonal Design of Experiments (DOE) was used to optimize experimental parameters for DNA separations over a wide size range. We find that the two dominant factors are the applied electric field strength and the inclusion of a high concentration of low-molar mass polymer in the matrix solution. These two factors exerted different effects on the separations of small dsDNA fragments below 1 kbp, medium dsDNA fragments between 1 kbp and 10 kbp, and large dsDNA fragments above 10 kbp. PMID:22009451

Application of DNA Chip Scanning Technology for Automatic Detection of Chlamydia trachomatis and Chlamydia pneumoniae Inclusions

PubMed Central

Bogdanov, Anita; Endrész, Valeria; Urbán, Szabolcs; Lantos, Ildikó; Deák, Judit; Burián, Katalin; Önder, Kamil; Ayaydin, Ferhan; Balázs, Péter

2014-01-01

Chlamydiae are obligate intracellular bacteria that propagate in the inclusion, a specific niche inside the host cell. The standard method for counting chlamydiae is immunofluorescent staining and manual counting of chlamydial inclusions. High- or medium-throughput estimation of the reduction in chlamydial inclusions should be the basis of testing antichlamydial compounds and other drugs that positively or negatively influence chlamydial growth, yet low-throughput manual counting is the common approach. To overcome the time-consuming and subjective manual counting, we developed an automatic inclusion-counting system based on a commercially available DNA chip scanner. Fluorescently labeled inclusions are detected by the scanner, and the image is processed by ChlamyCount, a custom plug-in of the ImageJ software environment. ChlamyCount was able to measure the inclusion counts over a 1-log-unit dynamic range with a high correlation to the theoretical counts. ChlamyCount was capable of accurately determining the MICs of the novel antimicrobial compound PCC00213 and the already known antichlamydial antibiotics moxifloxacin and tetracycline. ChlamyCount was also able to measure the chlamydial growth-altering effect of drugs that influence host-bacterium interaction, such as gamma interferon, DEAE-dextran, and cycloheximide. ChlamyCount is an easily adaptable system for testing antichlamydial antimicrobials and other compounds that influence Chlamydia-host interactions. PMID:24189259

Solid-phase based on-chip DNA purification through a valve-free stepwise injection of multiple reagents employing centrifugal force combined with a hydrophobic capillary barrier pressure.

PubMed

Zhang, Hainan; Tran, Hong Hanh; Chung, Bong Hyun; Lee, Nae Yoon

2013-03-21

In this paper, we demonstrate a simple technique for sequentially introducing multiple sample liquids into microchannels driven by centrifugal force combined with a hydrophobic barrier pressure and apply the technique for performing solid-phase based on-chip DNA purification. Three microchannels with varying widths, all equipped with independent sample reservoirs at the inlets, were fabricated on a hydrophobic elastomer, poly(dimethylsiloxane) (PDMS). First, glass beads were packed inside the reaction chamber, and a whole cell containing the DNA extract was introduced into the widest channel by applying centrifugal force for physical adsorption of the DNA onto the glass beads. Next, washing and elution solutions were sequentially introduced into the intermediate and narrowest microchannels, respectively, by gradually increasing the amount of centrifugal force. Through a precise manipulation of the centrifugal force, the DNA adsorbed onto the glass beads was successfully washed and eluted in a continuous manner without the need to introduce each solution manually. A stepwise injection of liquids was successfully demonstrated using multiple ink solutions, the results of which corresponded well with the theoretical analyses. As a practical application, the D1S80 locus of human genomic DNA, which is widely used for forensic purposes, was successfully purified using the microdevice introduced in this study, as demonstrated through successful target amplification. This will pave the way for the construction of a control-free valve system for realizing on-chip DNA purification, which is one of the most labor-intensive and hard-to-miniaturize components, on a greatly simplified and miniaturized platform employing hydrophobic PDMS.

Quantum dot-based microfluidic biosensor for cancer detection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghrera, Aditya Sharma; School of Engineering and Technology, ITM University, Gurgaon-122017; Pandey, Chandra Mouli

2015-05-11

We report results of the studies relating to fabrication of an impedimetric microfluidic–based nucleic acid sensor for quantification of DNA sequences specific to chronic myelogenous leukemia (CML). The sensor chip is prepared by patterning an indium–tin–oxide (ITO) coated glass substrate via wet chemical etching method followed by sealing with polydimethylsiloxane (PDMS) microchannel for fluid control. The fabricated microfluidic chip comprising of a patterned ITO substrate is modified by depositing cadmium selenide quantum dots (QCdSe) via Langmuir–Blodgett technique. Further, the QCdSe surface has been functionalized with specific DNA probe for CML detection. The probe DNA functionalized QCdSe integrated miniaturized system hasmore » been used to monitor target complementary DNA concentration by measuring the interfacial charge transfer resistance via hybridization. The presence of complementary DNA in buffer solution significantly results in decreased electro-conductivity of the interface due to presence of a charge barrier for transport of the redox probe ions. The microfluidic DNA biosensor exhibits improved linearity in the concentration range of 10{sup −15} M to 10{sup −11} M.« less

The Optimization of Electrophoresis on a Glass Microfluidic Chip and its Application in Forensic Science.

PubMed

Han, Jun P; Sun, Jing; Wang, Le; Liu, Peng; Zhuang, Bin; Zhao, Lei; Liu, Yao; Li, Cai X

2017-11-01

Microfluidic chips offer significant speed, cost, and sensitivity advantages, but numerous parameters must be optimized to provide microchip electrophoresis detection. Experiments were conducted to study the factors, including sieving matrices (the concentration and type), surface modification, analysis temperature, and electric field strengths, which all impact the effectiveness of microchip electrophoresis detection of DNA samples. Our results showed that the best resolution for ssDNA was observed using 4.5% w/v (7 M urea) lab-fabricated LPA gel, dynamic wall coating of the microchannel, electrophoresis temperatures between 55 and 60°C, and electrical fields between 350 and 450 V/cm on the microchip-based capillary electrophoresis (μCE) system. One base-pair resolution could be achieved in the 19-cm-length microchannel. Furthermore, both 9947A standard genomic DNA and DNA extracted from blood spots were demonstrated to be successfully separated with well-resolved DNA peaks in 8 min. Therefore, the microchip electrophoresis system demonstrated good potential for rapid forensic DNA analysis. © 2017 American Academy of Forensic Sciences.

Development of a CMOS-compatible PCR chip: comparison of design and system strategies

NASA Astrophysics Data System (ADS)

Erill, Ivan; Campoy, Susana; Rus, José; Fonseca, Luis; Ivorra, Antoni; Navarro, Zenón; Plaza, José A.; Aguiló, Jordi; Barbé, Jordi

2004-11-01

In the last decade research in chips for DNA amplification through the polymerase chain reaction (PCR) has been relatively abundant, but has taken very diverse approaches, leaving little common ground for a straightforward comparison of results. Here we report the development of a line of PCR chips that is fully compatible with complementary-metal-oxide-semiconductor (CMOS) technology and its revealing use as a general platform to test and compare a wide range of experimental parameters involved in PCR-chip design and operation. Peltier-heated and polysilicon thin-film driven PCR chips have been produced and directly compared in terms of efficiency, speed and power consumption, showing that thin-film systems run faster and more efficiently than Peltier-based ones, but yield inferior PCR products. Serpentine-like chamber designs have also been compared with standard rectangular designs and with the here reported rhomboidal chamber shape, showing that serpentine-like chambers do not have detrimental effects in PCR efficiency when using non-flow-through schemes, and that chamber design has a strong impact on sample insertion/extraction yields. With an accurate temperature control (±0.2 °C) we have optimized reaction kinetics to yield sound PCR amplifications of 25 µl mixtures in 20 min and with 24.4 s cycle times, confirming that a titrated amount of bovine albumin serum (BSA, 2.5 µg µl-1) is essential to counteract polymerase adsorption at chip walls. The reported use of a CMOS-compatible technological process paves the way for an easy adaption to foundry requirements and for a scalable integration of electro-optic detection and control circuitry.

eSensor: an electrochemical detection-based DNA microarray technology enabling sample-to-answer molecular diagnostics

NASA Astrophysics Data System (ADS)

Liu, Robin H.; Longiaru, Mathew

2009-05-01

DNA microarrays are becoming a widespread tool used in life science and drug screening due to its many benefits of miniaturization and integration. Microarrays permit a highly multiplexed DNA analysis. Recently, the development of new detection methods and simplified methodologies has rapidly expanded the use of microarray technologies from predominantly gene expression analysis into the arena of diagnostics. Osmetech's eSensor® is an electrochemical detection platform based on a low-to- medium density DNA hybridization array on a cost-effective printed circuit board substrate. eSensor® has been cleared by FDA for Warfarin sensitivity test and Cystic Fibrosis Carrier Detection. Other genetic-based diagnostic and infectious disease detection tests are under development. The eSensor® platform eliminates the need for an expensive laser-based optical system and fluorescent reagents. It allows one to perform hybridization and detection in a single and small instrument without any fluidic processing and handling. Furthermore, the eSensor® platform is readily adaptable to on-chip sample-to-answer genetic analyses using microfluidics technology. The eSensor® platform provides a cost-effective solution to direct sample-to-answer genetic analysis, and thus have a potential impact in the fields of point-of-care genetic analysis, environmental testing, and biological warfare agent detection.

Multifunctional sample preparation kit and on-chip quantitative nucleic acid sequence-based amplification tests for microbial detection.

PubMed

Zhao, Xinyan; Dong, Tao

2012-10-16

This study reports a quantitative nucleic acid sequence-based amplification (Q-NASBA) microfluidic platform composed of a membrane-based sampling module, a sample preparation cassette, and a 24-channel Q-NASBA chip for environmental investigations on aquatic microorganisms. This low-cost and highly efficient sampling module, having seamless connection with the subsequent steps of sample preparation and quantitative detection, is designed for the collection of microbial communities from aquatic environments. Eight kinds of commercial membrane filters are relevantly analyzed using Saccharomyces cerevisiae, Escherichia coli, and Staphylococcus aureus as model microorganisms. After the microorganisms are concentrated on the membrane filters, the retentate can be easily conserved in a transport medium (TM) buffer and sent to a remote laboratory. A Q-NASBA-oriented sample preparation cassette is originally designed to extract DNA/RNA molecules directly from the captured cells on the membranes. Sequentially, the extract is analyzed within Q-NASBA chips that are compatible with common microplate readers in laboratories. Particularly, a novel analytical algorithmic method is developed for simple but robust on-chip Q-NASBA assays. The reported multifunctional microfluidic system could detect a few microorganisms quantitatively and simultaneously. Further research should be conducted to simplify and standardize ecological investigations on aquatic environments.

Protein Chips for Detection of Salmonella spp. from Enrichment Culture

PubMed Central

Poltronieri, Palmiro; Cimaglia, Fabio; De Lorenzis, Enrico; Chiesa, Maurizio; Mezzolla, Valeria; Reca, Ida Barbara

2016-01-01

Food pathogens are the cause of foodborne epidemics, therefore there is a need to detect the pathogens in food productions rapidly. A pre-enrichment culture followed by selective agar plating are standard detection methods. Molecular methods such as qPCR have provided a first rapid protocol for detection of pathogens within 24 h of enrichment culture. Biosensors also may provide a rapid tool to individuate a source of Salmonella contamination at early times of pre-enrichment culture. Forty mL of Salmonella spp. enrichment culture were processed by immunoseparation using the Pathatrix, as in AFNOR validated qPCR protocols. The Salmonella biosensor combined with immunoseparation showed a limit of detection of 100 bacteria/40 mL, with a 400 fold increase to previous results. qPCR analysis requires processing of bead-bound bacteria with lysis buffer and DNA clean up, with a limit of detection of 2 cfu/50 μL. Finally, a protein chip was developed and tested in screening and identification of 5 common pathogen species, Salmonella spp., E. coli, S. aureus, Campylobacter spp. and Listeria spp. The protein chip, with high specificity in species identification, is proposed to be integrated into a Lab-on-Chip system, for rapid and reproducible screening of Salmonella spp. and other pathogen species contaminating food productions. PMID:27110786

Active substrates improving sensitivity in biomedical fluorescence microscopy

NASA Astrophysics Data System (ADS)

Le Moal, E.; Leveque-Fort, S.; Fort, E.; Lacharme, J.-P.; Fontaine-Aupart, M.-P.; Ricolleau, C.

2005-08-01

Fluorescence is widely used as a spectroscopic tool or for biomedical imaging, in particular for DNA chips. In some cases, detection of very low molecular concentrations and precise localization of biomarkers are limited by the weakness of the fluorescence signal. We present a new method based on sample substrates that improve fluorescence detection sensitivity. These active substrates consist in glass slides covered with metal (gold or silver) and dielectric (alumina) films and can directly be used with common microscope set-up. Fluorescence enhancement affects both excitation and decay rates and is strongly dependant on the distance to the metal surface. Furthermore, fluorescence collection is improved since fluorophore emission lobes are advantageously modified close to a reflective surface. Finally, additional improvements are achieved by structuring the metallic layer. Substrates morphology was mapped by Atomic Force Microscopy (AFM). Substrates optical properties were studied using mono- and bi-photonic fluorescence microscopy with time resolution. An original set-up was implemented for spatial radiation pattern's measurement. Detection improvement was then tested on commercial devices. Several biomedical applications are presented. Enhancement by two orders of magnitude are achieved for DNA chips and signal-to-noise ratio is greatly increased for cells imaging.

Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

PubMed Central

2016-01-01

Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709

An integrated workflow for analysis of ChIP-chip data.

PubMed

Weigelt, Karin; Moehle, Christoph; Stempfl, Thomas; Weber, Bernhard; Langmann, Thomas

2008-08-01

Although ChIP-chip is a powerful tool for genome-wide discovery of transcription factor target genes, the steps involving raw data analysis, identification of promoters, and correlation with binding sites are still laborious processes. Therefore, we report an integrated workflow for the analysis of promoter tiling arrays with the Genomatix ChipInspector system. We compare this tool with open-source software packages to identify PU.1 regulated genes in mouse macrophages. Our results suggest that ChipInspector data analysis, comparative genomics for binding site prediction, and pathway/network modeling significantly facilitate and enhance whole-genome promoter profiling to reveal in vivo sites of transcription factor-DNA interactions.

Microfluidic Chip-Based Detection and Intraspecies Strain Discrimination of Salmonella Serovars Derived from Whole Blood of Septic Mice

PubMed Central

Patterson, Adriana S.; Heithoff, Douglas M.; Ferguson, Brian S.; Soh, H. Tom; Mahan, Michael J.

2013-01-01

Salmonella is a zoonotic pathogen that poses a considerable public health and economic burden in the United States and worldwide. Resultant human diseases range from enterocolitis to bacteremia to sepsis and are acutely dependent on the particular serovar of Salmonella enterica subsp. enterica, which comprises over 99% of human-pathogenic S. enterica isolates. Point-of-care methods for detection and strain discrimination of Salmonella serovars would thus have considerable benefit to medical, veterinary, and field applications that safeguard public health and reduce industry-associated losses. Here we describe a single, disposable microfluidic chip that supports isothermal amplification and sequence-specific detection and discrimination of Salmonella serovars derived from whole blood of septic mice. The integrated microfluidic electrochemical DNA (IMED) chip consists of an amplification chamber that supports loop-mediated isothermal amplification (LAMP), a rapid, single-temperature amplification method as an alternative to PCR that offers advantages in terms of sensitivity, reaction speed, and amplicon yield. The amplification chamber is connected via a microchannel to a detection chamber containing a reagentless, multiplexed (here biplex) sensing array for sequence-specific electrochemical DNA (E-DNA) detection of the LAMP products. Validation of the IMED device was assessed by the detection and discrimination of S. enterica subsp. enterica serovars Typhimurium and Choleraesuis, the causative agents of enterocolitis and sepsis in humans, respectively. IMED chips conferred rapid (under 2 h) detection and discrimination of these strains at clinically relevant levels (<1,000 CFU/ml) from whole, unprocessed blood collected from septic animals. The IMED-based chip assay shows considerable promise as a rapid, inexpensive, and portable point-of-care diagnostic platform for the detection and strain-specific discrimination of microbial pathogens. PMID:23354710

DNA methylome profiling of maternal peripheral blood and placentas reveal potential fetal DNA markers for non-invasive prenatal testing.

PubMed

Xiang, Yuqian; Zhang, Junyu; Li, Qiaoli; Zhou, Xinyao; Wang, Teng; Xu, Mingqing; Xia, Shihui; Xing, Qinghe; Wang, Lei; He, Lin; Zhao, Xinzhi

2014-09-01

Utilizing epigenetic (DNA methylation) differences to differentiate between maternal peripheral blood (PBL) and fetal (placental) DNA has been a promising strategy for non-invasive prenatal testing (NIPT). However, the differentially methylated regions (DMRs) have yet to be fully ascertained. In the present study, we performed genome-wide comparative methylome analysis between maternal PBL and placental DNA from pregnancies of first trimester by methylated DNA immunoprecipitation-sequencing (MeDIP-Seq) and Infinium HumanMethylation450 BeadChip assays. A total of 36 931 DMRs and 45 804 differentially methylated sites (DMSs) covering the whole genome, exclusive of the Y chromosome, were identified via MeDIP-Seq and Infinium 450k array, respectively, of which 3759 sites in 2188 regions were confirmed by both methods. Not only did we find the previously reported potential fetal DNA markers in our identified DMRs/DMSs but also we verified fully the identified DMRs/DMSs in the validation round by MassARRAY EpiTYPER. The screened potential fetal DNA markers may be used for NIPT on aneuploidies and other chromosomal diseases, such as cri du chat syndrome and velo-cardio-facial syndrome. In addition, these potential markers may have application in the early diagnosis of placental dysfunction, such as pre-eclampsia. © The Author 2014. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Towards a DNA Nanoprocessor: Reusable Tile-Integrated DNA Circuits.

PubMed

Gerasimova, Yulia V; Kolpashchikov, Dmitry M

2016-08-22

Modern electronic microprocessors use semiconductor logic gates organized on a silicon chip to enable efficient inter-gate communication. Here, arrays of communicating DNA logic gates integrated on a single DNA tile were designed and used to process nucleic acid inputs in a reusable format. Our results lay the foundation for the development of a DNA nanoprocessor, a small and biocompatible device capable of performing complex analyses of DNA and RNA inputs. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Jllumina - A comprehensive Java-based API for statistical Illumina Infinium HumanMethylation450 and MethylationEPIC data processing.

PubMed

Almeida, Diogo; Skov, Ida; Lund, Jesper; Mohammadnejad, Afsaneh; Silva, Artur; Vandin, Fabio; Tan, Qihua; Baumbach, Jan; Röttger, Richard

2016-12-18

Measuring differential methylation of the DNA is the nowadays most common approach to linking epigenetic modifications to diseases (called epigenome-wide association studies, EWAS). For its low cost, its efficiency and easy handling, the Illumina HumanMethylation450 BeadChip and its successor, the Infinium MethylationEPIC BeadChip, is the by far most popular techniques for conduction EWAS in large patient cohorts. Despite the popularity of this chip technology, raw data processing and statistical analysis of the array data remains far from trivial and still lacks dedicated software libraries enabling high quality and statistically sound downstream analyses. As of yet, only R-based solutions are freely available for low-level processing of the Illumina chip data. However, the lack of alternative libraries poses a hurdle for the development of new bioinformatic tools, in particular when it comes to web services or applications where run time and memory consumption matter, or EWAS data analysis is an integrative part of a bigger framework or data analysis pipeline. We have therefore developed and implemented Jllumina, an open-source Java library for raw data manipulation of Illumina Infinium HumanMethylation450 and Infinium MethylationEPIC BeadChip data, supporting the developer with Java functions covering reading and preprocessing the raw data, down to statistical assessment, permutation tests, and identification of differentially methylated loci. Jllumina is fully parallelizable and publicly available at http://dimmer.compbio.sdu.dk/download.html.

Single-nucleotide polymorphism genotyping on optical thin-film biosensor chips.

PubMed

Zhong, Xiao-Bo; Reynolds, Robert; Kidd, Judith R; Kidd, Kenneth K; Jenison, Robert; Marlar, Richard A; Ward, David C

2003-09-30

Single-nucleotide polymorphisms (SNPs) constitute the bulk of human genetic variation and provide excellent markers to identify genetic factors contributing to complex disease susceptibility. A rapid, sensitive, and inexpensive assay is important for large-scale SNP scoring. Here we report the development of a multiplex SNP detection system using silicon chips coated to create a thin-film optical biosensor. Allele-discriminating, aldehyde-labeled oligonucleotides are arrayed and covalently attached to a hydrazinederivatized chip surface. Target sequences (e.g., PCR amplicons) then are hybridized in the presence of a mixture of biotinylated detector probes, one for each SNP, and a thermostable DNA ligase. After a stringent wash (0.01 M NaOH), ligation of biotinylated detector probes to perfectly matched capture oligomers is visualized as a color change on the chip surface (gold to blue/purple) after brief incubations with an anti-biotin IgG-horseradish peroxidase conjugate and a precipitable horseradish peroxidase substrate. Testing of PCR fragments is completed in 30-40 min. Up to several hundred SNPs can be assayed on a 36-mm2 chip, and SNP scoring can be done by eye or with a simple digital-camera system. This assay is extremely robust, exhibits high sensitivity and specificity, and is format-flexible and economical. In studies of mutations associated with risk for venous thrombosis and genotyping/haplotyping of African-American samples, we document high-fidelity analysis with 0 misassignments in 500 assays performed in duplicate.

Validation of candidate gene markers for marker-assisted selection of potato cultivars with improved tuber quality.

PubMed

Li, Li; Tacke, Eckhard; Hofferbert, Hans-Reinhardt; Lübeck, Jens; Strahwald, Josef; Draffehn, Astrid M; Walkemeier, Birgit; Gebhardt, Christiane

2013-04-01

Tuber yield, starch content, starch yield and chip color are complex traits that are important for industrial uses and food processing of potato. Chip color depends on the quantity of reducing sugars glucose and fructose in the tubers, which are generated by starch degradation. Reducing sugars accumulate when tubers are stored at low temperatures. Early and efficient selection of cultivars with superior yield, starch yield and chip color is hampered by the fact that reliable phenotypic selection requires multiple year and location trials. Application of DNA-based markers early in the breeding cycle, which are diagnostic for superior alleles of genes that control natural variation of tuber quality, will reduce the number of clones to be evaluated in field trials. Association mapping using genes functional in carbohydrate metabolism as markers has discovered alleles of invertases and starch phosphorylases that are associated with tuber quality traits. Here, we report on new DNA variants at loci encoding ADP-glucose pyrophosphorylase and the invertase Pain-1, which are associated with positive or negative effect with chip color, tuber starch content and starch yield. Marker-assisted selection (MAS) and marker validation were performed in tetraploid breeding populations, using various combinations of 11 allele-specific markers associated with tuber quality traits. To facilitate MAS, user-friendly PCR assays were developed for specific candidate gene alleles. In a multi-parental population of advanced breeding clones, genotypes were selected for having different combinations of five positive and the corresponding negative marker alleles. Genotypes combining five positive marker alleles performed on average better than genotypes with four negative alleles and one positive allele. When tested individually, seven of eight markers showed an effect on at least one quality trait. The direction of effect was as expected. Combinations of two to three marker alleles were identified that significantly improved average chip quality after cold storage and tuber starch content. In F1 progeny of a single-cross combination, MAS with six markers did not give the expected result. Reasons and implications for MAS in potato are discussed.

Critical stages of a biodetection platform development from sensor chip fabrication to surface chemistry and assay development

NASA Astrophysics Data System (ADS)

Uludag, Yildiz

2014-06-01

Once viewed solely as a tool to analyse biomolecular interactions, biosensors are gaining widespread interest for diagnostics, biological defense, environmental and quality assurance in agriculture/food industries. Advanced micro fabrication techniques have facilitated integration of microfluidics with sensing functionalities on the same chip making system automation more convenient1. Biosensor devices relying on lab-on-a-chip technologies and nanotechnology has attracted much of attention in recent years for biological defense research and development. However, compared with the numerous publications and patents available, the commercialization of biosensors technology has significantly lagged behind the research output. This paper reviews the reasons behind the slow commercialisation of biosensors with an insight to the critical stages of a biosensor development from the sensor chip fabrication to surface chemistry applications and nanotechnology applications in sensing with case studies. In addition, the paper includes the description of a new biodetection platform based on Real-time Electrochemical ProfilingTM (REPTM) that comprises novel electrode arrays and nanoparticle based sensing. The performance of the REPTM platform has been tested for the detection of Planktothrix agardhii, one of the toxic bloom-forming cyanobacteria, usually found in shallow fresh water sources that can be used for human consumption. The optimised REPTM assay allowed the detection of P. agardhii DNA down to 6 pM. This study, showed the potential of REPTM as a new biodetection platform for toxic bacteria and hence further studies will involve the development of a portable multi-analyte biosensor based on REPTM technology for on-site testing.

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Simultaneous detection of human CYP2C19 polymorphisms and antibiotic resistance of Helicobacter pylori using a personalised diagnosis kit.

PubMed

Zhang, Jun; Zhong, Jing; Ding, Jian; Shi, Jiemin; Tang, Tao; Liu, Qiqi; Huang, Huilian; Dai, Licheng; Yang, Ningmin

2018-06-01

A personalised diagnosis kit for Helicobacter pylori that employs visual gene chip technology for the simultaneous detection of CYP2C19 polymorphisms and clarithromycin/levofloxacin antibiotic resistance was evaluated. Gastric antrum mucosa biopsy specimens of 394 patients were tested using the kit. DNA sequencing and antibiotic susceptibility testing of the H. pylori were also performed. In total, 267 (67.8%) of the 394 specimens were positive for H. pylori using the kit and DNA sequencing, and 136 (34.5%) were positive by culturing. For human CYP2C19 and the bacterial 23S rRNA and gyrA genes, the concordance rates were 92.4% (364/394), 96.6% (258/267) and 97.0% (259/267) between the kit and DNA sequencing results, respectively. For clarithromycin and levofloxacin resistance, the concordance rates were 90.4% (123/136) and 81.6% (111/136) between the kit and antibiotic susceptibility testing results. The personalised diagnosis kit for H. pylori provides useful information for the choice of proton pump inhibitor and antibiotic in combination therapy. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

Probe classification of on-off type DNA microarray images with a nonlinear matching measure

NASA Astrophysics Data System (ADS)

Ryu, Munho; Kim, Jong Dae; Min, Byoung Goo; Kim, Jongwon; Kim, Y. Y.

2006-01-01

We propose a nonlinear matching measure, called counting measure, as a signal detection measure that is defined as the number of on pixels in the spot area. It is applied to classify probes for an on-off type DNA microarray, where each probe spot is classified as hybridized or not. The counting measure also incorporates the maximum response search method, where the expected signal is obtained by taking the maximum among the measured responses of the various positions and sizes of the spot template. The counting measure was compared to existing signal detection measures such as the normalized covariance and the median for 2390 patient samples tested on the human papillomavirus (HPV) DNA chip. The counting measure performed the best regardless of whether or not the maximum response search method was used. The experimental results showed that the counting measure combined with the positional search was the most preferable.

Fabrication of microfluidic integrated biosensor

NASA Astrophysics Data System (ADS)

Adam, Tijjani; Dhahi, Th S.; Mohammed, Mohammed; Hashim, U.; Noriman, N. Z.; Dahham, Omar S.

2017-09-01

An event of miniaturizing for sensor systems to carry out biological diagnostics are gaining wade spread acceptance. The system may contain several different sensor units for the detection of specific analyte, the analyte to be detected might be any kind of biological molecules (DNA, mRNA or proteins) or chemical substances. In most cases, the detection is based on receptor-ligand binding like DNA hybridization or antibody-antigen interaction, achieving this on a nanostructure. DNA or protein must be attached to certain locations within the structure. Critical for this is to have a robust binding chemistry to the surface in the microstructure. Here we successfully designed and fabricated microfluidics element for passive fluid delivery into polysilicon Nanowire sensing domain, we further demonstrated a very simple and effective way of integrating the two devices to give full functionalities of laboratory on a single chip. The sensing element was successfully surface modified and tested on real biomedical clinical sample for evaluation and validation.

A detailed protocol for chromatin immunoprecipitation in the yeast Saccharomyces cerevisiae.

PubMed

Grably, Melanie; Engelberg, David

2010-01-01

Critical cellular processes such as DNA replication, DNA damage repair, and transcription are mediated and regulated by DNA-binding proteins. Many efforts have been invested therefore in developing methods that monitor the dynamics of protein-DNA association. As older techniques such as DNA footprinting, and electrophoretic mobility shift assays (EMSA) could be applied mostly in vitro, the development of the chromatin immunoprecipitation (ChIP) method, which allows quantitative measurement of protein-bound DNA most accurately in vivo, revolutionized our capabilities of understanding the mechanisms underlying the aforementioned processes. Furthermore, this powerful tool could be applied at the genomic-scale providing a global picture of the protein-DNA complexes at the entire genome.The procedure is conceptually simple; involves rapid crosslinking of proteins to DNA by the addition of formaldehyde to the culture, shearing the DNA and immunoprecipitating the protein of interest while covalently bound to its DNA targets. Following decrosslinking, DNA that was coimmunoprecipitated could be amplified by PCR or could serve as a probe of a genomic microarray to identify all DNA fragments that were bound to the protein.Although simple in principle, the method is not trivial to implement and the results might be misleading if proper controls are not included in the experiment. In this chapter, we provide therefore a highly detailed protocol of ChIP assay as is applied successfully in our laboratory. We pay special attention to describe every small detail, in order that any investigator could readily and successfully apply this important and powerful technology.

Product assurance technology efforts: Technical accomplishments

NASA Technical Reports Server (NTRS)

1985-01-01

Product assurance technology topics addressed include: wafer acceptance procedures, test chips, test structures, test chip methodology, fault models, and the Combined Release and Radiation Effects Satellite test chip.

Market surveillance on non-halal additives incorporated in surimi based products using polymerase chain reaction (PCR)-southern hybridization analysis

NASA Astrophysics Data System (ADS)

Aravindran, S.; Sahilah, A. M.; Aminah, A.

2014-09-01

Halal surveillance on halal ingredients incorporated in surimi based products were studied using polymerase chain reaction (PCR)-southern hybridization on chip analysis. The primers used in this technique were targeted on mitochondria DNA (mtDNA) of cytochrome b (cyt b) gene sequence which able to differentiate 7 type (beef, chicken, duck, goat, buffalo, lamb and pork) of species on a single chip. 17 (n = 17*3) different brands of surimi-based product were purchased randomly from Selangor local market in January 2013. Of 17 brands, 3 (n = 3*3) brands were positive for chicken DNA, 1 (n = 1*3) brand was positive for goat DNA, and the remainder 13 brands (n = 13*3) have no DNA species detected. The sensitivity of PCR-southern hybridization primers to detect each meat species was 0.1 ng. In the present study, it is evidence that PCR-Southern Hybridization analysis offered a reliable result due to its highly specific and sensitive properties in detecting non-halal additive such as plasma protein incorporation in surimi-based product.

A lab-on-chip for biothreat detection using single-molecule DNA mapping.

PubMed

Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

2011-03-07

Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

Product assurance technology for procuring reliable, radiation-hard, custom LSI/VLSI electronics

NASA Technical Reports Server (NTRS)

Buehler, M. G.; Allen, R. A.; Blaes, B. R.; Hicks, K. A.; Jennings, G. A.; Lin, Y.-S.; Pina, C. A.; Sayah, H. R.; Zamani, N.

1989-01-01

Advanced measurement methods using microelectronic test chips are described. These chips are intended to be used in acquiring the data needed to qualify Application Specific Integrated Circuits (ASIC's) for space use. Efforts were focused on developing the technology for obtaining custom IC's from CMOS/bulk silicon foundries. A series of test chips were developed: a parametric test strip, a fault chip, a set of reliability chips, and the CRRES (Combined Release and Radiation Effects Satellite) chip, a test circuit for monitoring space radiation effects. The technical accomplishments of the effort include: (1) development of a fault chip that contains a set of test structures used to evaluate the density of various process-induced defects; (2) development of new test structures and testing techniques for measuring gate-oxide capacitance, gate-overlap capacitance, and propagation delay; (3) development of a set of reliability chips that are used to evaluate failure mechanisms in CMOS/bulk: interconnect and contact electromigration and time-dependent dielectric breakdown; (4) development of MOSFET parameter extraction procedures for evaluating subthreshold characteristics; (5) evaluation of test chips and test strips on the second CRRES wafer run; (6) two dedicated fabrication runs for the CRRES chip flight parts; and (7) publication of two papers: one on the split-cross bridge resistor and another on asymmetrical SRAM (static random access memory) cells for single-event upset analysis.

Development of DNA Pillar Chip Final Report CRADA No. TSB-2035-01

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ness, K. D.; Long, G. W.

This was a collaborative effort between The Regents of the University of California, Lawrence Livermore National Laboratory (LLNL) and Tetracore, to demonstrate a proof of principal device for the capture and controlled release of DNA moving within a flow stream.

Molecular Detection of Invasive Species in Heterogeneous Mixtures Using a Microfluidic Carbon Nanotube Platform

PubMed Central

Mahon, Andrew R.; Barnes, Matthew A.; Senapati, Satyajyoti; Feder, Jeffrey L.; Darling, John A.; Chang, Hsueh-Chia; Lodge, David M.

2011-01-01

Screening methods to prevent introductions of invasive species are critical for the protection of environmental and economic benefits provided by native species and uninvaded ecosystems. Coastal ecosystems worldwide remain vulnerable to damage from aquatic species introductions, particularly via ballast water discharge from ships. Because current ballast management practices are not completely effective, rapid and sensitive screening methods are needed for on-site testing of ships in transit. Here, we describe a detection technology based on a microfluidic chip containing DNA oligonucleotide functionalized carbon nanotubes. We demonstrate the efficacy of the chip using three ballast-transported species either established (Dreissena bugensis) or of potential threat (Eriocheir sinensis and Limnoperna fortuneii) to the Laurentian Great Lakes. With further refinement for on-board application, the technology could lead to real-time ballast water screening to improve ship-specific management and control decisions. PMID:21364993

Miniaturized technology for DNA typing: cassette PCR.

PubMed

Manage, Dammika P; Pilarski, Linda M

2015-01-01

With the smaller size, low cost, and rapid testing capabilities, miniaturized lab-on-a-chip devices can change the way medical diagnostics are currently performed in the health-care system. We have demonstrated such a device that is self-contained, simple, disposable, and inexpensive. It is capable of performing DNA amplification on an inexpensive instrument suitable for near point of care settings. This technology will enable on the spot evaluation of patients in the clinic for faster medical decision-making and more informed therapeutic choices. Our device, a gel capillary cassette, termed cassette PCR, contains capillary reaction units each holding a defined primer set, with arrays of capillary reaction units for simultaneously detecting multiple targets. With the exception of the sample to be tested, each capillary reaction unit holds all the reagents needed for PCR in a desiccated form that can be stored at room temperature for up to 3 months and even longer in colder conditions. It relies on capillary forces for sample delivery of microliter volumes through capillaries, hence avoiding the need for pumps or valves. In the assembled cassette, the wax architecture supporting the capillaries melts during the PCR and acts as a vapor barrier as well as segregating capillaries with different primer sets. No other chip sealing techniques are required. Cassette PCR accepts raw samples such as urine, genital swabs, and blood. The cassette is made with off-the-shelf components and contains integrated positive and negative controls.

25-Hydroxyvitamin D in pregnancy and genome wide cord blood DNA methylation in two pregnancy cohorts (MoBa and ALSPAC).

PubMed

Suderman, M; Stene, L C; Bohlin, J; Page, C M; Holvik, K; Parr, C L; Magnus, M C; Håberg, S E; Joubert, B R; Wu, M C; London, S J; Relton, C; Nystad, W

2016-05-01

The aim of the study was to investigate whether maternal mid-pregnancy 25-hydroxyvitamin D concentrations are associated with cord blood DNA methylation. DNA methylation was assessed using the Illumina HumanMethylation450 BeadChip, and maternal plasma 25-hydroxyvitamin D was measured in 819 mothers/newborn pairs participating in the Norwegian Mother and Child Cohort (MoBa) and 597 mothers/newborn pairs participating in the Avon Longitudinal Study of Parents and Children (ALSPAC). Across 473,731CpG DNA methylation sites in cord blood DNA, none were strongly associated with maternal 25-hydroxyvitamin D after adjusting for multiple tests (false discovery rate (FDR)>0.5; 473,731 tests). A meta-analysis of the results from both cohorts, using the Fisher method for combining p-values, also did not strengthen findings (FDR>0.2). Further exploration of a set of CpG sites in the proximity of four a priori defined candidate genes (CYP24A1, CYP27B1, CYP27A1 and CYP2R1) did not result in any associations with FDR<0.05 (56 tests). In this large genome wide assessment of the potential influence of maternal vitamin D status on DNA methylation, we did not find any convincing associations in 1416 newborns. If true associations do exist, their identification might require much larger consortium studies, expanded genomic coverage, investigation of alternative cell types or measurements of 25-hydroxyvitamin D at different gestational time points. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Ultrasensitive Label-free Electronic Chip for DNA Analysis Using Carbon Nanotube Nanoelectrode Arrays

NASA Technical Reports Server (NTRS)

Li, Jun; Koehne, Jessica; Chen, Hua; Cassell, Alan; Ng, Hou Tee; Ye, Qi; Han, Jie; Meyyappan, M.

2004-01-01

There is a strong need for faster, cheaper, and simpler methods for nucleic acid analysis in today s clinical tests. Nanotechnologies can potentially provide solutions to these requirements by integrating nanomaterials with biofunctionalities. Dramatic improvement in the sensitivity and multiplexing can be achieved through the high-degree miniaturization. Here, we present our study in the development of an ultrasensitive label-free electronic chip for DNA/RNA analysis based on carbon nanotube nanoelectrode arrays. A reliable nanoelectrode array based on vertically aligned multi-walled carbon nanotubes (MWNTs) embedded in a SiO2 matrix is fabricated using a bottom-up approach. Characteristic nanoelectrode behavior is observed with a low-density MWNT nanoelectrode array in measuring both the bulk and surface immobilized redox species. The open-end of MWNTs are found to present similar properties as graphite edge-plane electrodes, with a wide potential window, flexible chemical functionalities, and good biocompatibility. A BRCA1 related oligonucleotide probe with 18 bases is covalently functionalized at the open ends of the MWNTs and specifically hybridized with an oligonucleotide target as well as a PCR amplicon. The guanine bases in the target molecules are employed as the signal moieties for the electrochemical measurements. Ru(bpy)3(2+) mediator is used to further amplify the guanine oxidation signal. This technique has been employed for direct electrochemical detection of label-free PCR amplicon through specific hybridization with the BRCAl probe. The detection limit is estimated to be less than approximately 1000 DNA molecules, approaching the limit of the sensitivity by laser-based fluorescence techniques in DNA microarray. This system provides a general electronic platform for rapid molecular diagnostics in applications requiring ultrahigh sensitivity, high-degree of miniaturization, simple sample preparation, and low- cost operation.

Comparison of the performance of Ion Torrent chips in noninvasive prenatal trisomy detection.

PubMed

Wang, Yanlin; Wen, Zujia; Shen, Jiawei; Cheng, Weiwei; Li, Jun; Qin, Xiaolan; Ma, Duan; Shi, Yongyong

2014-07-01

Semiconductor high-throughput sequencing, represented by Ion Torrent PGM/Proton, proves to be feasible in the noninvasive prenatal diagnosis of fetal aneuploidies. It is commendable that, with less data and relevant cost also, an accurate result can be achieved owing to the high sensitivity and specificity of such kind of technology. We conducted a comparative analysis of the performance of four different Ion chips in detecting fetal chromosomal aneuploidies. Eight maternal plasma DNA samples, including four pregnancies with normal fetuses and four with trisomy 21 fetuses, were sequenced on Ion Torrent 314/316/318/PI chips, respectively. Results such as read mapped ratio, correlation coefficient and phred quality score were calculated and parallelly compared. All samples were correctly classified even with low-throughput chip, and, among the four chips, the 316 chip had the highest read mapped ratio, correlation coefficient, mean read length and phred quality score. All chips were well consistent with each other. Our results showed that all Ion chips are applicable in noninvasive prenatal fetal aneuploidy diagnosis. We recommend researchers or clinicians to use the appropriate chip with barcoding technology on the basis of the sample number.

Atom Optics for Bose-Einstein Condensates (BEC)

DTIC Science & Technology

2012-04-25

Electron Micrograph of the Top View of Test Chip A .......................................29 11. A Scanning Electron Micrograph of the Cross...Sectional View of Test Chip A .....................29 12. A Scanning Electron Micrograph of the Top View of Test Chip B...30 13. A Scanning Electron Micrograph of the Cross Sectional View of Test Chip B .....................30 14. Toner Masks for Etching

The easy road to genome-wide medium density SNP screening in a non-model species: development and application of a 10 K SNP-chip for the house sparrow (Passer domesticus).

PubMed

Hagen, Ingerid J; Billing, Anna M; Rønning, Bernt; Pedersen, Sindre A; Pärn, Henrik; Slate, Jon; Jensen, Henrik

2013-05-01

With the advent of next generation sequencing, new avenues have opened to study genomics in wild populations of non-model species. Here, we describe a successful approach to a genome-wide medium density Single Nucleotide Polymorphism (SNP) panel in a non-model species, the house sparrow (Passer domesticus), through the development of a 10 K Illumina iSelect HD BeadChip. Genomic DNA and cDNA derived from six individuals were sequenced on a 454 GS FLX system and generated a total of 1.2 million sequences, in which SNPs were detected. As no reference genome exists for the house sparrow, we used the zebra finch (Taeniopygia guttata) reference genome to determine the most likely position of each SNP. The 10 000 SNPs on the SNP-chip were selected to be distributed evenly across 31 chromosomes, giving on average one SNP per 100 000 bp. The SNP-chip was screened across 1968 individual house sparrows from four island populations. Of the original 10 000 SNPs, 7413 were found to be variable, and 99% of these SNPs were successfully called in at least 93% of all individuals. We used the SNP-chip to demonstrate the ability of such genome-wide marker data to detect population sub-division, and compared these results to similar analyses using microsatellites. The SNP-chip will be used to map Quantitative Trait Loci (QTL) for fitness-related phenotypic traits in natural populations. © 2013 Blackwell Publishing Ltd.

A versatile electrowetting-based digital microfluidic platform for quantitative homogeneous and heterogeneous bio-assays

NASA Astrophysics Data System (ADS)

Vergauwe, Nicolas; Witters, Daan; Ceyssens, Frederik; Vermeir, Steven; Verbruggen, Bert; Puers, Robert; Lammertyn, Jeroen

2011-05-01

Electrowetting-on-dielectric (EWOD) lab-on-a-chip systems have already proven their potential within a broad range of bio-assays. Nevertheless, research on the analytical performance of those systems is limited, yet crucial for a further breakthrough in the diagnostic field. Therefore, this paper presents the intrinsic possibilities of an EWOD lab-on-a-chip as a versatile platform for homogeneous and heterogeneous bio-assays with high analytical performance. Both droplet dispensing and splitting cause variations in droplet size, thereby directly influencing the assay's performance. The extent to which they influence the performance is assessed by a theoretical sensitivity analysis, which allows the definition of a basic framework for the reduction of droplet size variability. Taking advantage of the optimized droplet manipulations, both homogeneous and heterogeneous bio-assays are implemented in the EWOD lab-on-a-chip to demonstrate the analytical capabilities and versatility of the device. A fully on-chip enzymatic assay is realized with high analytical performance. It demonstrates the promising capabilities of an EWOD lab-on-a-chip in food-related and medical applications, such as nutritional and blood analyses. Further, a magnetic bio-assay for IgE detection using superparamagnetic nanoparticles is presented whereby the nanoparticles are used as solid carriers during the bio-assay. Crucial elements are the precise manipulation of the superparamagnetic nanoparticles with respect to dispensing and separation. Although the principle of using nano-carriers is demonstrated for protein detection, it can be easily extended to a broader range of bio-related applications like DNA sensing. In heterogeneous bio-assays the chip surface is actively involved during the execution of the bio-assay. Through immobilization of specific biological compounds like DNA, proteins and cells a reactive chip surface is realized, which enhances the bio-assay performance. To demonstrate this potential, on-chip adhesion islands are fabricated to immobilize MCF-7 human breast cancer cells. Viability studies are performed to assess the functionalization efficiency.

The correlation of methylation levels measured using Illumina 450K and EPIC BeadChips in blood samples

PubMed Central

Logue, Mark W; Smith, Alicia K; Wolf, Erika J; Maniates, Hannah; Stone, Annjanette; Schichman, Steven A; McGlinchey, Regina E; Milberg, William; Miller, Mark W

2017-01-01

Aim: We examined concordance of methylation levels across the Illumina Infinium HumanMethylation450 BeadChip and the Infinium MethylationEPIC BeadChip. Methods: We computed the correlation for 145 whole blood DNA samples at each of the 422,524 CpG sites measured by both chips. Results: The correlation at some sites was high (up to r = 0.95), but many sites had low correlation (55% had r < 0.20). The low correspondence between 450K and EPIC measured methylation values at many loci was largely due to the low variability in methylation values for the majority of the CpG sites in blood. Conclusion: Filtering out probes based on the observed correlation or low variability may increase reproducibility of BeadChip-based epidemiological studies. PMID:28809127

Study of interaction of antimutagenic 1,4-dihydropyridine AV-153-Na with DNA-damaging molecules and its impact on DNA repair activity.

PubMed

Leonova, Elina; Rostoka, Evita; Sauvaigo, Sylvie; Baumane, Larisa; Selga, Turs; Sjakste, Nikolajs

2018-01-01

1,4-dihydropyridines (1,4-DHP) possesses important biochemical and pharmacological properties, including antioxidant and antimutagenic activities. It was shown that the antimutagenic 1,4-dihydropyridine AV-153-Na interacts with DNA. The aim of the current study was to test the capability of the compound to scavenge peroxynitrite and hydroxyl radical, to test intracellular distribution of the compound, and to assess the ability of the compound to modify the activity of DNA repair enzymes and to protect the DNA in living cells against peroxynitrite-induced damage. Peroxynitrite decomposition was assayed by UV spectroscopy, hydroxyl radical scavenging-by EPR spectroscopy. DNA breakage was determined by the "comet method", activity of DNA repair enzymes-using Glyco-SPOT and ExSy-SPOT assays. Intracellular distribution of the compound was studied by laser confocal scanning fluorescence microscopy. Fluorescence spectroscopy titration and circular dichroism spectroscopy were used to study interactions of the compound with human serum albumin. Some ability to scavenge hydroxyl radical by AV-153-Na was detected by the EPR method, but it turned out to be incapable of reacting chemically with peroxynitrite. However, AV-153-Na effectively decreased DNA damage produced by peroxynitrite in cultured HeLa cells. The Glyco-SPOT test essentially revealed an inhibition by AV-153-Na of the enzymes involved thymine glycol repair. Results with ExSy-SPOT chip indicate that AV-153-Na significantly stimulates excision/synthesis repair of 8-oxoguanine (8-oxoG), abasic sites (AP sites) and alkylated bases. Laser confocal scanning fluorescence microscopy demonstrated that within the cells AV-153-Na was found mostly in the cytoplasm; however, a stain in nucleolus was also detected. Binding to cytoplasmic structures might occur due to high affinity of the compound to proteins revealed by spectroscopical methods. Activation of DNA repair enzymes after binding to DNA appears to be the basis for the antimutagenic effects of AV-153-Na.

Computational method and system for modeling, analyzing, and optimizing DNA amplification and synthesis

DOEpatents

Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.

2010-05-04

A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.

Analysis of DNA-chip and antigen-chip data: studies of cancer, stem cells and autoimmune diseases

NASA Astrophysics Data System (ADS)

Domany, Eytan

2005-07-01

Biology has undergone a revolution during the past decade. Deciphering the human genome has opened new horizons, among which the advent of DNA microarrays has been perhaps the most significant. These miniature measuring devices report the levels at which tens of thousands of genes are expressed in a collection of cells of interest (such as tissue from a tumor). I describe here briefly this technology and present an example of how analysis of data obtained from such high throughput experiments provides insights of possible clinical and therapeutic relevance for Acute Lymphoblastic Leukemia. Next, I describe how gene expression data is used to deduce a new design principle, " Just In Case", used by stem cells. Finally I briefly review a different novel technology, of antigen chips, which provide a fingerprint of a subject's immune system and may become a predictive clinical tool. The work reviewed here was done in collaboration with numerous colleagues and students.

Microfluidic integration of parallel solid-phase liquid chromatography.

PubMed

Huft, Jens; Haynes, Charles A; Hansen, Carl L

2013-03-05

We report the development of a fully integrated microfluidic chromatography system based on a recently developed column geometry that allows for robust packing of high-performance separation columns in poly(dimethylsiloxane) microfluidic devices having integrated valves made by multilayer soft lithography (MSL). The combination of parallel high-performance separation columns and on-chip plumbing was used to achieve a fully integrated system for on-chip chromatography, including all steps of automated sample loading, programmable gradient generation, separation, fluorescent detection, and sample recovery. We demonstrate this system in the separation of fluorescently labeled DNA and parallel purification of reverse transcription polymerase chain reaction (RT-PCR) amplified variable regions of mouse immunoglobulin genes using a strong anion exchange (AEX) resin. Parallel sample recovery in an immiscible oil stream offers the advantage of low sample dilution and high recovery rates. The ability to perform nucleic acid size selection and recovery on subnanogram samples of DNA holds promise for on-chip genomics applications including sequencing library preparation, cloning, and sample fractionation for diagnostics.

A disposable, self-contained PCR chip.

PubMed

Kim, Jitae; Byun, Doyoung; Mauk, Michael G; Bau, Haim H

2009-02-21

A disposable, self-contained polymerase chain reaction (PCR) chip with on-board stored, just-on-time releasable, paraffin-passivated, dry reagents is described. During both storage and sample preparation, the paraffin immobilizes and protects the stored reagents. Fluid flow through the reactor leaves the reagents undisturbed. Prior to the amplification step, the chamber is filled with target analyte suspended in water. Upon heating the PCR chamber to the DNA's denaturation temperature, the paraffin melts and moves out of the way, and the reagents are released and hydrated. To better understand the reagent release process, a scaled up model of the reactor was constructed and the paraffin migration was visualized. Experiments were carried out with a 30 microl reactor demonstrating detectable amplification (with agarose gel electrophoresis) of 10 fg ( approximately 200 copies) of lambda DNA template. The in-reactor storage and on-time release of the PCR reagents reduce the number of needed operations and significantly simplifies the flow control that would, otherwise, be needed in lab-on-chip devices.

Simultaneous detection of multiple HPV DNA via bottom-well microfluidic chip within an infra-red PCR platform.

PubMed

Liu, Wenjia; Warden, Antony; Sun, Jiahui; Shen, Guangxia; Ding, Xianting

2018-03-01

Portable Polymerase Chain Reaction (PCR) devices combined with microfluidic chips or lateral flow stripes have shown great potential in the field of point-of-need testing (PoNT) as they only require a small volume of patient sample and are capable of presenting results in a short time. However, the detection for multiple targets in this field leaves much to be desired. Herein, we introduce a novel PCR platform by integrating a bottom-well microfluidic chip with an infra-red (IR) excited temperature control method and fluorescence co-detection of three PCR products. Microfluidic chips are utilized to partition different samples into individual bottom-wells. The oil phase in the main channel contains multi-walled carbon nanotubes which were used as a heat transfer medium that absorbs energy from the IR-light-emitting diode (LED) and transfers heat to the water phase below. Cyclical rapid heating and cooling necessary for PCR are achieved by alternative power switching of the IR-LED and Universal Serial Bus (USB) mini-fan with a pulse width modulation scheme. This design of the IR-LED PCR platform is economic, compact, and fully portable, making it a promising application in the field of PoNT. The bottom-well microfluidic chip and IR-LED PCR platform were combined to fulfill a three-stage thermal cycling PCR for 40 cycles within 90 min for Human Papilloma Virus (HPV) detection. The PCR fluorescent signal was successfully captured at the end of each cycle. The technique introduced here has broad applications in nucleic acid amplification and PoNT devices.

On-chip PMA labeling of foodborne pathogenic bacteria for viable qPCR and qLAMP detection

USDA-ARS?s Scientific Manuscript database

Propidium monoazide (PMA) is a membrane impermeable molecule that covalently bonds to double stranded DNA when exposed to light and inhibits the polymerase activity, thus enabling DNA amplification detection protocols that discriminate between viable and non-viable entities. Here, we present a micro...

Biotechnology for Solar System Exploration

NASA Astrophysics Data System (ADS)

Steele, A.; Maule, J.; Toporski, J.; Parro-Garcia, V.; Briones, C.; Schweitzer, M.; McKay, D.

With the advent of a new era of astrobiology missions in the exploration of the solar system and the search for evidence of life elsewhere, we present a new approach to this goal, the integration of biotechnology. We have reviewed the current list of biotechnology techniques, which are applicable to miniaturization, automatization and integration into a combined flight platform. Amongst the techniques reviewed are- The uses of antibodies- Fluorescent detection strategies- Protein and DNA chip technology- Surface plasmon resonance and its relation to other techniques- Micro electronic machining (MEMS where applicable to biologicalsystems)- nanotechnology (e.g. molecular motors)- Lab-on-a-chip technology (including PCR)- Mass spectrometry (i.e. MALDI-TOF)- Fluid handling and extraction technologies- Chemical Force Microscopy (CFM)- Raman Spectroscopy We have begun to integrate this knowledge into a single flight instrument approach for the sole purpose of combining several mutually confirming tests for life, organic and/or microbial contamination, as well as prebiotic and abiotic organic chemicals. We will present several innovative designs for new instrumentation including pro- engineering design drawings of a protein chip reader for space flight and fluid handling strategies. We will also review the use of suitable extraction methodologies for use on different solar system bodies.

3D printed high density, reversible, chip-to-chip microfluidic interconnects.

PubMed

Gong, Hua; Woolley, Adam T; Nordin, Gregory P

2018-02-13

Our latest developments in miniaturizing 3D printed microfluidics [Gong et al., Lab Chip, 2016, 16, 2450; Gong et al., Lab Chip, 2017, 17, 2899] offer the opportunity to fabricate highly integrated chips that measure only a few mm on a side. For such small chips, an interconnection method is needed to provide the necessary world-to-chip reagent and pneumatic connections. In this paper, we introduce simple integrated microgaskets (SIMs) and controlled-compression integrated microgaskets (CCIMs) to connect a small device chip to a larger interface chip that implements world-to-chip connections. SIMs or CCIMs are directly 3D printed as part of the device chip, and therefore no additional materials or components are required to make the connection to the larger 3D printed interface chip. We demonstrate 121 chip-to-chip interconnections in an 11 × 11 array for both SIMs and CCIMs with an areal density of 53 interconnections per mm 2 and show that they withstand fluid pressures of 50 psi. We further demonstrate their reusability by testing the devices 100 times without seal failure. Scaling experiments show that 20 × 20 interconnection arrays are feasible and that the CCIM areal density can be increased to 88 interconnections per mm 2 . We then show the utility of spatially distributed discrete CCIMs by using an interconnection chip with 28 chip-to-world interconnects to test 45 3D printed valves in a 9 × 5 array. Each valve is only 300 μm in diameter (the smallest yet reported for 3D printed valves). Every row of 5 valves is tested to at least 10 000 actuations, with one row tested to 1 000 000 actuations. In all cases, there is no sign of valve failure, and the CCIM interconnections prove an effective means of using a single interface chip to test a series of valve array chips.

A proposed holistic approach to on-chip, off-chip, test, and package interconnections

NASA Astrophysics Data System (ADS)

Bartelink, Dirk J.

1998-11-01

The term interconnection has traditionally implied a `robust' connection from a transistor or a group of transistors in an IC to the outside world, usually a PC board. Optimum system utilization is done from outside the IC. As an alternative, this paper addresses `unimpeded' transistor-to-transistor interconnection aimed at reaching the high circuit densities and computational capabilities of neighboring IC's. In this view, interconnections are not made to some human-centric place outside the IC world requiring robustness—except for system input and output connections. This unimpeded interconnect style is currently available only through intra-chip signal traces in `system-on-a-chip' implementations, as exemplified by embedded DRAMs. Because the traditional off-chip penalty in performance and wiring density is so large, a merging of complex process technologies is the only option today. It is suggested that, for system integration to move forward, the traditional robustness requirement inherited from conventional packaging interconnect and IC manufacturing test must be discarded. Traditional system assembly from vendor parts requires robustness under shipping, inspection and assembly. The trend toward systems on a chip signifies willingness by semiconductor companies to design and fabricate whole systems in house, so that `in-house' chip-to-chip assembly is not beyond reach. In this scenario, bare chips never leave the controlled environment of the IC fabricator while the two major contributors to off-chip signal penalty, ESD protection and the need to source a 50-ohm test head, are avoided. With in-house assembly, ESD protection can be eliminated with the precautions already familiar in plasma etching. Test interconnection impacts the fundamentals of IC manufacturing, particularly with clock speeds approaching 1GHz, and cannot be an afterthought. It should be an integral part of the chip-to-chip interconnection bandwidth optimization, because—as we must recognize—test is also performed using IC's. A system interconnection is proposed using multiple chips fabricated with conventional silicon processes, including MEMS technology. The system resembles an MCM that can be joined without committing to final assembly to perform at-speed testing. 50-Ohm test probes never load the circuit; only intended neighboring chips are ever connected. A `back-plane' chip provides the connection layers for both inter- and intra-chip signals and also serves as the probe card, in analogy with membrane probes now used for single-chip testing. Intra-chip connections, which require complicated connections during test that exactly match the product, are then properly made and all waveforms and loading conditions under test will be identical to those of the product. The major benefit is that all front-end chip technologies can be merged—logic, memory, RF, even passives. ESD protection is required only on external system connections. Manufacturing test information will accurately characterize process faults and thus avoid the Known-Good-Die problem that has slowed the arrival of conventional MCM's.

Detecting a single molecule using a micropore-nanopore hybrid chip

PubMed Central

2013-01-01

Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing. PMID:24261484

Detecting a single molecule using a micropore-nanopore hybrid chip.

PubMed

Liu, Lei; Zhu, Lizhong; Ni, Zhonghua; Chen, Yunfei

2013-11-21

Nanopore-based DNA sequencing and biomolecule sensing have attracted more and more attention. In this work, novel sensing devices were built on the basis of the chips containing nanopore arrays in polycarbonate (PC) membranes and micropores in Si3N4 films. Using the integrated chips, the transmembrane ionic current induced by biomolecule's translocation was recorded and analyzed, which suggested that the detected current did not change linearly as commonly expected with increasing biomolecule concentration. On the other hand, detailed translocation information (such as translocation gesture) was also extracted from the discrete current blockages in basic current curves. These results indicated that the nanofluidic device based on the chips integrated by micropores and nanopores possessed comparative potentials in biomolecule sensing.

Next Generation Instrumentation Bus Test Plan for Fibre Channel

DTIC Science & Technology

1999-09-30

sample for port testing. The heart of the Fibre Xpress network cards is the tachyon chip from Hewlett Packard. The tachyon chip is basically a single...be to test the protocols. 1.5.1.1 Tachyon chip The user’s manual for the Tachyon controller chip identifies the following FC-AL specification

Epigenetic Guardian: A Review of the DNA Methyltransferase DNMT3A in Acute Myeloid Leukaemia and Clonal Haematopoiesis.

PubMed

Chaudry, Sabah F; Chevassut, Timothy J T

2017-01-01

Acute myeloid leukaemia (AML) is a haematological malignancy characterized by clonal stem cell proliferation and aberrant block in differentiation. Dysfunction of epigenetic modifiers contributes significantly to the pathogenesis of AML. One frequently mutated gene involved in epigenetic modification is DNMT3A (DNA methyltransferase-3-alpha), a DNA methyltransferase that alters gene expression by de novo methylation of cytosine bases at CpG dinucleotides. Approximately 22% of AML and 36% of cytogenetically normal AML cases carry DNMT3A mutations and around 60% of these mutations affect the R882 codon. These mutations have been associated with poor prognosis and adverse survival outcomes for AML patients. Advances in whole-exome sequencing techniques have recently identified a large number of DNMT3A mutations present in clonal cells in normal elderly individuals with no features of haematological malignancy. Categorically distinct from other preleukaemic conditions, this disorder has been termed clonal haematopoiesis of indeterminate potential (CHIP). Further insight into the mutational landscape of CHIP may illustrate the consequence of particular mutations found in DNMT3A and identify specific "founder" mutations responsible for clonal expansion that may contribute to leukaemogenesis. This review will focus on current research and understanding of DNMT3A mutations in both AML and CHIP.

The impact of methylation quantitative trait loci (mQTLs) on active smoking-related DNA methylation changes.

PubMed

Gao, Xu; Thomsen, Hauke; Zhang, Yan; Breitling, Lutz Philipp; Brenner, Hermann

2017-01-01

Methylation quantitative trait loci (mQTLs) are the genetic variants that may affect the DNA methylation patterns of CpG sites. However, their roles in influencing the disturbances of smoking-related epigenetic changes have not been well established. This study was conducted to address whether mQTLs exist in the vicinity of smoking-related CpG sites (± 50 kb) and to examine their associations with smoking exposure and all-cause mortality in older adults. We obtained DNA methylation profiles in whole blood samples by Illumina Infinium Human Methylation 450 BeadChip array of two independent subsamples of the ESTHER study (discovery set, n  = 581; validation set, n  = 368) and their corresponding genotyping data using the Illumina Infinium OncoArray BeadChip. After correction for multiple testing (FDR), we successfully identified that 70 out of 151 previously reported smoking-related CpG sites were significantly associated with 192 SNPs within the 50 kb search window of each locus. The 192 mQTLs significantly influenced the active smoking-related DNA methylation changes, with percentage changes ranging from 0.01 to 18.96%, especially for the weakly/moderately smoking-related CpG sites. However, these identified mQTLs were not directly associated with active smoking exposure or all-cause mortality. Our findings clearly demonstrated that if not dealt with properly, the mQTLs might impair the power of epigenetic-based models of smoking exposure to a certain extent. In addition, such genetic variants could be the key factor to distinguish between the heritable and smoking-induced impact on epigenome disparities. These mQTLs are of special importance when DNA methylation markers measured by Illumina Infinium assay are used for any comparative population studies related to smoking-related cancers and chronic diseases.

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Genetic identification of missing persons: DNA analysis of human remains and compromised samples.

PubMed

Alvarez-Cubero, M J; Saiz, M; Martinez-Gonzalez, L J; Alvarez, J C; Eisenberg, A J; Budowle, B; Lorente, J A

2012-01-01

Human identification has made great strides over the past 2 decades due to the advent of DNA typing. Forensic DNA typing provides genetic data from a variety of materials and individuals, and is applied to many important issues that confront society. Part of the success of DNA typing is the generation of DNA databases to help identify missing persons and to develop investigative leads to assist law enforcement. DNA databases house DNA profiles from convicted felons (and in some jurisdictions arrestees), forensic evidence, human remains, and direct and family reference samples of missing persons. These databases are essential tools, which are becoming quite large (for example the US Database contains 10 million profiles). The scientific, governmental and private communities continue to work together to standardize genetic markers for more effective worldwide data sharing, to develop and validate robust DNA typing kits that contain the reagents necessary to type core identity genetic markers, to develop technologies that facilitate a number of analytical processes and to develop policies to make human identity testing more effective. Indeed, DNA typing is integral to resolving a number of serious criminal and civil concerns, such as solving missing person cases and identifying victims of mass disasters and children who may have been victims of human trafficking, and provides information for historical studies. As more refined capabilities are still required, novel approaches are being sought, such as genetic testing by next-generation sequencing, mass spectrometry, chip arrays and pyrosequencing. Single nucleotide polymorphisms offer the potential to analyze severely compromised biological samples, to determine the facial phenotype of decomposed human remains and to predict the bioancestry of individuals, a new focus in analyzing this type of markers. Copyright © 2012 S. Karger AG, Basel.

Detection of influenza A virus subtypes using a solid-phase PCR microplate chip assay.

PubMed

Sun, Xin-Cheng; Wang, YunLong; Yang, Liping; Zhang, HuiRu

2015-01-01

A rapid and sensitive microplate chip based on solid PCR was developed to identify influenza A subtypes. A simple ultraviolet cross-linking method was used to immobilize DNA probes on pretreated microplates. Solid-phase PCR was proven to be a convenient method for influenza A screening. The sensitivity of the microplate chip was 10(-3) μg/mL for the enzymatic colorimetric method and 10(-4) μg/mL for the fluorescence method. The 10 sets of primers and probes for the microplate chip were highly specific and did not interfere with each other. These results suggest that the microplate chip based on solid PCR can be used to rapidly detect universal influenza A and its subtypes. This platform can also be used to detect other pathogenic microorganisms. Copyright © 2014 Elsevier B.V. All rights reserved.

Suitability of shredded tyres as a substitute for a landfill leachate collection medium.

PubMed

Park, Jae K; Edil, Tuncer B; Kim, Jae Y; Huh, Mock; Lee, Sung Ho; Lee, Jung Jun

2003-06-01

A series of tests were conducted to investigate the fate of heavy metals and gasoline components in a simulated landfill, consisting of a 30 cm thick clay liner and a leachate collection layer containing tyres as well as in two test cells installed in a landfill. Arsenic, selenium, mercury, barium, and lead concentrations were lower while zinc concentration was higher in the tank containing tyre-chips than the tank without tyre-chips. When samples were filtered, however, concentrations of zinc as well as other inorganics were lower in the tank containing tyre-chips, indicating that metals in the leachate exposed to tyre-chips travel more slowly in a subsurface environment due to filtering effect. In a test cell study, arsenic, cobalt, lead and nickel concentrations were lower in the cell containing tyre-chips than in the cell without tyre-chips, except iron and zinc. Both tests indicate that some inorganic contaminants are sorbed to tyre-chips. Gasoline components were also significantly sorbed by tyre-chips in field cell tests. Although tyre-chips are known to leach organic and inorganic contaminants, concentrations in field conditions will be lower than the reported experimental results since the tests were performed under worst-case scenarios. If tyre-chips are used in areas where contamination levels are high, then they can be used as a sorbent for environmental clean-up.

Progress in ion torrent semiconductor chip based sequencing.

PubMed

Merriman, Barry; Rothberg, Jonathan M

2012-12-01

In order for next-generation sequencing to become widely used as a diagnostic in the healthcare industry, sequencing instrumentation will need to be mass produced with a high degree of quality and economy. One way to achieve this is to recast DNA sequencing in a format that fully leverages the manufacturing base created for computer chips, complementary metal-oxide semiconductor chip fabrication, which is the current pinnacle of large scale, high quality, low-cost manufacturing of high technology. To achieve this, ideally the entire sensory apparatus of the sequencer would be embodied in a standard semiconductor chip, manufactured in the same fab facilities used for logic and memory chips. Recently, such a sequencing chip, and the associated sequencing platform, has been developed and commercialized by Ion Torrent, a division of Life Technologies, Inc. Here we provide an overview of this semiconductor chip based sequencing technology, and summarize the progress made since its commercial introduction. We described in detail the progress in chip scaling, sequencing throughput, read length, and accuracy. We also summarize the enhancements in the associated platform, including sample preparation, data processing, and engagement of the broader development community through open source and crowdsourcing initiatives. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Using dual-polarization interferometry to study surface-initiated DNA hybridization chain reactions in real time.

PubMed

Huang, Fujian; Xu, Pingping; Liang, Haojun

2014-01-15

In this study we used dual-polarization interferometry to investigate DNA hybridization chain reactions (HCRs) at solid-liquid interfaces. We monitored the effects of variations in mass, thickness, and density of the immobilized initiator on the subsequent HCRs at various salt concentrations. At low salt concentrations, the single-stranded DNA (ssDNA) initiator was attached uniformly to the chip surface. At high salt concentrations, it lay on the surface at the onset of the immobilization process, but the approaching ssDNA forced the pre-immobilized ssDNA strands to extend into solution as a result of increased electrostatic repulsion between the pre-adsorbed and approaching ssDNA chains. Injection of a mixture of H1 and H2 increased the mass and thickness of the films initially, but thereafter the thickness decreased. These changes indicate that the long double-stranded DNA that formed lay on the surface, rather than extended into the solution, thereby suppressing the subsequent initiation activity of the released single-strand parts of H1 and H2. Increasing the salt concentration increased the HCR efficiency and reaction rate. The HCR efficiency of the initiator ssDNA immobilized on its 5' end was higher than that immobilized on its 3' end, suggesting that the released single-strand parts of H1 and H2 close to the chip surface decreased the initiation activity relative to those of the ones extending into solution. © 2013 Elsevier B.V. All rights reserved.

Integration of solid-state nanopores in a 0.5 μm cmos foundry process

PubMed Central

Uddin, A; Yemenicioglu, S; Chen, C-H; Corigliano, E; Milaninia, K; Theogarajan, L

2013-01-01

High-bandwidth and low-noise nanopore sensor and detection electronics are crucial in achieving single-DNA base resolution. A potential way to accomplish this goal is to integrate solid-state nanopores within a CMOS platform, in close proximity to the biasing electrodes and custom-designed amplifier electronics. Here we report the integration of solid-state nanopore devices in a commercial complementary metal-oxide semiconductor (CMOS) potentiostat chip implemented in On-Semiconductor’s 0.5 μm technology. Nanopore membranes incorporating electrodes are fabricated by post-CMOS micromachining utilizing the N+ polysilicon/SiO2/N+ polysilicon capacitor structure available in the aforementioned process. Nanopores are created in the CMOS process by drilling in a transmission electron microscope and shrinking by atomic layer deposition. We also describe a batch fabrication method to process a large of number of electrode-embedded nanopores with sub-10 nm diameter across CMOS-compatible wafers by electron beam lithography and atomic layer deposition. The CMOS-compatibility of our fabrication process is verified by testing the electrical functionality of on-chip circuitry. We observe high current leakage with the CMOS nanopore devices due to the ionic diffusion through the SiO2 membrane. To prevent this leakage, we coat the membrane with Al2O3 which acts as an efficient diffusion barrier against alkali ions. The resulting nanopore devices also exhibit higher robustness and lower 1/f noise as compared to SiO2 and SiNx. Furthermore, we propose a theoretical model for our low-capacitance CMOS nanopore devices, showing good agreement with the experimental value. In addition, experiments and theoretical models of translocation studies are presented using 48.5 kbp λ-DNA in order to prove the functionality of on-chip pores coated with Al2O3. PMID:23519330

Development of a High-Throughput Resequencing Array for the Detection of Pathogenic Mutations in Osteogenesis Imperfecta

PubMed Central

Wang, Yao; Cui, Yazhou; Zhou, Xiaoyan; Han, Jinxiang

2015-01-01

Objective Osteogenesis imperfecta (OI) is a rare inherited skeletal disease, characterized by bone fragility and low bone density. The mutations in this disorder have been widely reported to be on various exonal hotspots of the candidate genes, including COL1A1, COL1A2, CRTAP, LEPRE1, and FKBP10, thus creating a great demand for precise genetic tests. However, large genome sizes make the process daunting and the analyses, inefficient and expensive. Therefore, we aimed at developing a fast, accurate, efficient, and cheaper sequencing platform for OI diagnosis; and to this end, use of an advanced array-based technique was proposed. Method A CustomSeq Affymetrix Resequencing Array was established for high-throughput sequencing of five genes simultaneously. Genomic DNA extraction from 13 OI patients and 85 normal controls and amplification using long-range PCR (LR-PCR) were followed by DNA fragmentation and chip hybridization, according to standard Affymetrix protocols. Hybridization signals were determined using GeneChip Sequence Analysis Software (GSEQ). To examine the feasibility, the outcome from new resequencing approach was validated by conventional capillary sequencing method. Result Overall call rates using resequencing array was 96–98% and the agreement between microarray and capillary sequencing was 99.99%. 11 out of 13 OI patients with pathogenic mutations were successfully detected by the chip analysis without adjustment, and one mutation could also be identified using manual visual inspection. Conclusion A high-throughput resequencing array was developed that detects the disease-associated mutations in OI, providing a potential tool to facilitate large-scale genetic screening for OI patients. Through this method, a novel mutation was also found. PMID:25742658

On testing VLSI chips for the big Viterbi decoder

NASA Technical Reports Server (NTRS)

Hsu, I. S.

1989-01-01

A general technique that can be used in testing very large scale integrated (VLSI) chips for the Big Viterbi Decoder (BVD) system is described. The test technique is divided into functional testing and fault-coverage testing. The purpose of functional testing is to verify that the design works functionally. Functional test vectors are converted from outputs of software simulations which simulate the BVD functionally. Fault-coverage testing is used to detect and, in some cases, to locate faulty components caused by bad fabrication. This type of testing is useful in screening out bad chips. Finally, design for testability, which is included in the BVD VLSI chip design, is described in considerable detail. Both the observability and controllability of a VLSI chip are greatly enhanced by including the design for the testability feature.

An Integrated Lab-on-Chip for Rapid Identification and Simultaneous Differentiation of Tropical Pathogens

PubMed Central

Sato, Mitsuharu; Watthanaworawit, Wanitda; Ling, Clare L.; Mauduit, Marjorie; Malleret, Benoît; Grüner, Anne-Charlotte; Tan, Rosemary; Nosten, François H.; Snounou, Georges; Rénia, Laurent; Ng, Lisa F. P.

2014-01-01

Tropical pathogens often cause febrile illnesses in humans and are responsible for considerable morbidity and mortality. The similarities in clinical symptoms provoked by these pathogens make diagnosis difficult. Thus, early, rapid and accurate diagnosis will be crucial in patient management and in the control of these diseases. In this study, a microfluidic lab-on-chip integrating multiplex molecular amplification and DNA microarray hybridization was developed for simultaneous detection and species differentiation of 26 globally important tropical pathogens. The analytical performance of the lab-on-chip for each pathogen ranged from 102 to 103 DNA or RNA copies. Assay performance was further verified with human whole blood spiked with Plasmodium falciparum and Chikungunya virus that yielded a range of detection from 200 to 4×105 parasites, and from 250 to 4×107 PFU respectively. This lab-on-chip was subsequently assessed and evaluated using 170 retrospective patient specimens in Singapore and Thailand. The lab-on-chip had a detection sensitivity of 83.1% and a specificity of 100% for P. falciparum; a sensitivity of 91.3% and a specificity of 99.3% for P. vivax; a positive 90.0% agreement and a specificity of 100% for Chikungunya virus; and a positive 85.0% agreement and a specificity of 100% for Dengue virus serotype 3 with reference methods conducted on the samples. Results suggested the practicality of an amplification microarray-based approach in a field setting for high-throughput detection and identification of tropical pathogens. PMID:25078474

Cytology and human papillomavirus testing 6 to 12 months after ASCUS or LSIL cytology in organized screening to predict high-grade cervical neoplasia between screening rounds.

PubMed

Tropé, Ameli; Sjøborg, Katrine D; Nygård, Mari; Røysland, Kjetil; Campbell, Suzanne; Alfsen, G Cecilie; Jonassen, Christine M

2012-06-01

We carried out a prospective study comparing the performance of human papillomavirus (HPV) E6/E7 mRNA (PreTect HPV-Proofer; NorChip, Klokkarstua, Norway) and DNA (Amplicor HPV test; Roche Diagnostics, Basel, Switzerland) triage testing of women 6 to 12 months after atypical-squamous-cells-of-undetermined-significance (ASCUS) or low-grade-squamous-intraepithelial-lesion (LSIL) cytology in organized screening to predict high-grade cervical intraepithelial neoplasia of grade 2 or worse (CIN2+) between screening rounds. Between January 2005 and April 2008, 692 study women with screening-detected ASCUS/LSIL cytology 6 to 12 months earlier returned for HPV mRNA and DNA testing and repeat cytology. The median follow-up time was 3 years, using existing health care facilities. Follow-up test results were available for 625 women. Of the 145 CIN2+ cases detected during the study period, 95 (65.5%) were HPV mRNA positive 6 to 12 months after screening-detected ASCUS/LSIL, 44 (30.4%) were HPV mRNA negative, and 6 (4.1%) were invalid. The corresponding HPV DNA results were 139 (95.9%), 5 (3.4%), and 1 (0.7%), respectively. The cumulative incidences of CIN2+ 3 years after a negative HPV mRNA and DNA test were 10.3% (95% confidence interval [CI], 7.2 to 13.3%) and 1.8% (95% CI, 0.0 to 3.6%), respectively. The cumulative incidences of CIN2+ 3 years after positive HPV mRNA and DNA tests were 52.8% (95% CI, 40.1 to 60.1%) and 41.3% (95% CI, 35.5 to 46.6%), respectively. In conclusion, both positive HPV mRNA and DNA test results have a high enough long-term prediction of CIN2+ risk to consider referral to colposcopy as good practice when performed in delayed triage of women with ASCUS/LSIL cytology. In addition, the low CIN2+ risk among women with a negative Amplicor HPV test in our study confirms its safe use in a clinical setting.

Cytology and Human Papillomavirus Testing 6 to 12 Months after ASCUS or LSIL Cytology in Organized Screening To Predict High-Grade Cervical Neoplasia between Screening Rounds

PubMed Central

Sjøborg, Katrine D.; Nygård, Mari; Røysland, Kjetil; Campbell, Suzanne; Alfsen, G. Cecilie; Jonassen, Christine M.

2012-01-01

We carried out a prospective study comparing the performance of human papillomavirus (HPV) E6/E7 mRNA (PreTect HPV-Proofer; NorChip, Klokkarstua, Norway) and DNA (Amplicor HPV test; Roche Diagnostics, Basel, Switzerland) triage testing of women 6 to 12 months after atypical-squamous-cells-of-undetermined-significance (ASCUS) or low-grade-squamous-intraepithelial-lesion (LSIL) cytology in organized screening to predict high-grade cervical intraepithelial neoplasia of grade 2 or worse (CIN2+) between screening rounds. Between January 2005 and April 2008, 692 study women with screening-detected ASCUS/LSIL cytology 6 to 12 months earlier returned for HPV mRNA and DNA testing and repeat cytology. The median follow-up time was 3 years, using existing health care facilities. Follow-up test results were available for 625 women. Of the 145 CIN2+ cases detected during the study period, 95 (65.5%) were HPV mRNA positive 6 to 12 months after screening-detected ASCUS/LSIL, 44 (30.4%) were HPV mRNA negative, and 6 (4.1%) were invalid. The corresponding HPV DNA results were 139 (95.9%), 5 (3.4%), and 1 (0.7%), respectively. The cumulative incidences of CIN2+ 3 years after a negative HPV mRNA and DNA test were 10.3% (95% confidence interval [CI], 7.2 to 13.3%) and 1.8% (95% CI, 0.0 to 3.6%), respectively. The cumulative incidences of CIN2+ 3 years after positive HPV mRNA and DNA tests were 52.8% (95% CI, 40.1 to 60.1%) and 41.3% (95% CI, 35.5 to 46.6%), respectively. In conclusion, both positive HPV mRNA and DNA test results have a high enough long-term prediction of CIN2+ risk to consider referral to colposcopy as good practice when performed in delayed triage of women with ASCUS/LSIL cytology. In addition, the low CIN2+ risk among women with a negative Amplicor HPV test in our study confirms its safe use in a clinical setting. PMID:22518869

Design and qualification of the SEU/TD Radiation Monitor chip

NASA Technical Reports Server (NTRS)

Buehler, Martin G.; Blaes, Brent R.; Soli, George A.; Zamani, Nasser; Hicks, Kenneth A.

1992-01-01

This report describes the design, fabrication, and testing of the Single-Event Upset/Total Dose (SEU/TD) Radiation Monitor chip. The Radiation Monitor is scheduled to fly on the Mid-Course Space Experiment Satellite (MSX). The Radiation Monitor chip consists of a custom-designed 4-bit SRAM for heavy ion detection and three MOSFET's for monitoring total dose. In addition the Radiation Monitor chip was tested along with three diagnostic chips: the processor monitor and the reliability and fault chips. These chips revealed the quality of the CMOS fabrication process. The SEU/TD Radiation Monitor chip had an initial functional yield of 94.6 percent. Forty-three (43) SEU SRAM's and 14 Total Dose MOSFET's passed the hermeticity and final electrical tests and were delivered to LL.

DNA Copy Number Signature to Predict Recurrence in Early Stage Ovarian Cancer

DTIC Science & Technology

2016-08-01

AWARD NUMBER: W81XWH-14-1-0194 TITLE: DNA Copy Number Signature to Predict Recurrence in Early-Stage Ovarian Cancer PRINCIPAL INVESTIGATOR...SUBTITLE 5a. CONTRACT NUMBER DNA Copy Number Signature to Predict Recurrence in Early-Stage Ovarian Cancer 5b. GRANT NUMBER W81XWH-14-1-0194 5c. PROGRAM...determine the copy number gain and loss for early stage high grade ovarian cancers through IlluminaHumanOmniExpress-FFPE BeadChip system • Subtask 1 DNA

UW VLSI chip tester

NASA Astrophysics Data System (ADS)

McKenzie, Neil

1989-12-01

We present a design for a low-cost, functional VLSI chip tester. It is based on the Apple MacIntosh II personal computer. It tests chips that have up to 128 pins. All pin drivers of the tester are bidirectional; each pin is programmed independently as an input or an output. The tester can test both static and dynamic chips. Rudimentary speed testing is provided. Chips are tested by executing C programs written by the user. A software library is provided for program development. Tests run under both the Mac Operating System and A/UX. The design is implemented using Xilinx Logic Cell Arrays. Price/performance tradeoffs are discussed.

DNA microarrays for identifying fishes.

PubMed

Kochzius, M; Nölte, M; Weber, H; Silkenbeumer, N; Hjörleifsdottir, S; Hreggvidsson, G O; Marteinsson, V; Kappel, K; Planes, S; Tinti, F; Magoulas, A; Garcia Vazquez, E; Turan, C; Hervet, C; Campo Falgueras, D; Antoniou, A; Landi, M; Blohm, D

2008-01-01

In many cases marine organisms and especially their diverse developmental stages are difficult to identify by morphological characters. DNA-based identification methods offer an analytically powerful addition or even an alternative. In this study, a DNA microarray has been developed to be able to investigate its potential as a tool for the identification of fish species from European seas based on mitochondrial 16S rDNA sequences. Eleven commercially important fish species were selected for a first prototype. Oligonucleotide probes were designed based on the 16S rDNA sequences obtained from 230 individuals of 27 fish species. In addition, more than 1200 sequences of 380 species served as sequence background against which the specificity of the probes was tested in silico. Single target hybridisations with Cy5-labelled, PCR-amplified 16S rDNA fragments from each of the 11 species on microarrays containing the complete set of probes confirmed their suitability. True-positive, fluorescence signals obtained were at least one order of magnitude stronger than false-positive cross-hybridisations. Single nontarget hybridisations resulted in cross-hybridisation signals at approximately 27% of the cases tested, but all of them were at least one order of magnitude lower than true-positive signals. This study demonstrates that the 16S rDNA gene is suitable for designing oligonucleotide probes, which can be used to differentiate 11 fish species. These data are a solid basis for the second step to create a "Fish Chip" for approximately 50 fish species relevant in marine environmental and fisheries research, as well as control of fisheries products.

Gene Therapy for Fracture Repair

DTIC Science & Technology

2007-05-01

Methods: We have adopted the Agilent rat oligomer chip to analyze our fracture RNA in our microarray analysis. This chip has 20,046 unique gene...signal during fluorescent labeling of the cDNA. This approach is highly advantageous for reducing the RNA input into the system, minimizing the numbers...perform the analysis on these extremely limited samples without pooling the RNA from multiple individuals. We are therefore able to analyze the

Adaptable gene-specific dye bias correction for two-channel DNA microarrays.

PubMed

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank C P

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available.

Adaptable gene-specific dye bias correction for two-channel DNA microarrays

PubMed Central

Margaritis, Thanasis; Lijnzaad, Philip; van Leenen, Dik; Bouwmeester, Diane; Kemmeren, Patrick; van Hooff, Sander R; Holstege, Frank CP

2009-01-01

DNA microarray technology is a powerful tool for monitoring gene expression or for finding the location of DNA-bound proteins. DNA microarrays can suffer from gene-specific dye bias (GSDB), causing some probes to be affected more by the dye than by the sample. This results in large measurement errors, which vary considerably for different probes and also across different hybridizations. GSDB is not corrected by conventional normalization and has been difficult to address systematically because of its variance. We show that GSDB is influenced by label incorporation efficiency, explaining the variation of GSDB across different hybridizations. A correction method (Gene- And Slide-Specific Correction, GASSCO) is presented, whereby sequence-specific corrections are modulated by the overall bias of individual hybridizations. GASSCO outperforms earlier methods and works well on a variety of publically available datasets covering a range of platforms, organisms and applications, including ChIP on chip. A sequence-based model is also presented, which predicts which probes will suffer most from GSDB, useful for microarray probe design and correction of individual hybridizations. Software implementing the method is publicly available. PMID:19401678

ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

PubMed Central

He, Qiye; Johnston, Jeff; Zeitlinger, Julia

2014-01-01

Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision.

PubMed

Perreault, Andrea A; Venters, Bryan J

2016-12-23

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5' DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

Novel approach for deriving genome wide SNP analysis data from archived blood spots

PubMed Central

2012-01-01

Background The ability to transport and store DNA at room temperature in low volumes has the advantage of optimising cost, time and storage space. Blood spots on adapted filter papers are popular for this, with FTA (Flinders Technology Associates) Whatman™TM technology being one of the most recent. Plant material, plasmids, viral particles, bacteria and animal blood have been stored and transported successfully using this technology, however the method of porcine DNA extraction from FTA Whatman™TM cards is a relatively new approach, allowing nucleic acids to be ready for downstream applications such as PCR, whole genome amplification, sequencing and subsequent application to single nucleotide polymorphism microarrays has hitherto been under-explored. Findings DNA was extracted from FTA Whatman™TM cards (following adaptations of the manufacturer’s instructions), whole genome amplified and subsequently analysed to validate the integrity of the DNA for downstream SNP analysis. DNA was successfully extracted from 288/288 samples and amplified by WGA. Allele dropout post WGA, was observed in less than 2% of samples and there was no clear evidence of amplification bias nor contamination. Acceptable call rates on porcine SNP chips were also achieved using DNA extracted and amplified in this way. Conclusions DNA extracted from FTA Whatman cards is of a high enough quality and quantity following whole genomic amplification to perform meaningful SNP chip studies. PMID:22974252

Comprehensive Census of Bacteria in Clean Rooms by Using DNA Microarray and Cloning Methods▿ †

PubMed Central

La Duc, Myron T.; Osman, Shariff; Vaishampayan, Parag; Piceno, Yvette; Andersen, Gary; Spry, J. A.; Venkateswaran, Kasthuri

2009-01-01

A census of clean room surface-associated bacterial populations was derived from the results of both the cloning and sequencing of 16S rRNA genes and DNA microarray (PhyloChip) analyses. Samples from the Lockheed Martin Aeronautics Multiple Testing Facility (LMA-MTF), the Kennedy Space Center Payload Hazard and Servicing Facility (KSC-PHSF), and the Jet Propulsion Laboratory Spacecraft Assembly Facility (JPL-SAF) clean rooms were collected during the various assembly phases of the Phoenix and Mars Science Laboratory (MSL) spacecraft. Clone library-derived analyses detected a larger bacterial diversity prior to the arrival of spacecraft hardware in these clean room facilities. PhyloChip results were in agreement with this trend but also unveiled the presence of anywhere from 9- to 70-fold more bacterial taxa than cloning approaches. Among the facilities sampled, the JPL-SAF (MSL mission) housed a significantly less diverse bacterial population than either the LMA-MTF or KSC-PHSF (Phoenix mission). Bacterial taxa known to thrive in arid conditions were frequently detected in MSL-associated JPL-SAF samples, whereas proteobacterial lineages dominated Phoenix-associated KSC-PHSF samples. Comprehensive bacterial censuses, such as that reported here, will help space-faring nations preemptively identify contaminant biomatter that may compromise extraterrestrial life detection experiments. The robust nature and high sensitivity of DNA microarray technologies should prove beneficial to a wide range of scientific, electronic, homeland security, medical, and pharmaceutical applications and to any other ventures with a vested interest in monitoring and controlling contamination in exceptionally clean environments. PMID:19700540

Comprehensive census of bacteria in clean rooms by using DNA microarray and cloning methods.

PubMed

La Duc, Myron T; Osman, Shariff; Vaishampayan, Parag; Piceno, Yvette; Andersen, Gary; Spry, J A; Venkateswaran, Kasthuri

2009-10-01

A census of clean room surface-associated bacterial populations was derived from the results of both the cloning and sequencing of 16S rRNA genes and DNA microarray (PhyloChip) analyses. Samples from the Lockheed Martin Aeronautics Multiple Testing Facility (LMA-MTF), the Kennedy Space Center Payload Hazard and Servicing Facility (KSC-PHSF), and the Jet Propulsion Laboratory Spacecraft Assembly Facility (JPL-SAF) clean rooms were collected during the various assembly phases of the Phoenix and Mars Science Laboratory (MSL) spacecraft. Clone library-derived analyses detected a larger bacterial diversity prior to the arrival of spacecraft hardware in these clean room facilities. PhyloChip results were in agreement with this trend but also unveiled the presence of anywhere from 9- to 70-fold more bacterial taxa than cloning approaches. Among the facilities sampled, the JPL-SAF (MSL mission) housed a significantly less diverse bacterial population than either the LMA-MTF or KSC-PHSF (Phoenix mission). Bacterial taxa known to thrive in arid conditions were frequently detected in MSL-associated JPL-SAF samples, whereas proteobacterial lineages dominated Phoenix-associated KSC-PHSF samples. Comprehensive bacterial censuses, such as that reported here, will help space-faring nations preemptively identify contaminant biomatter that may compromise extraterrestrial life detection experiments. The robust nature and high sensitivity of DNA microarray technologies should prove beneficial to a wide range of scientific, electronic, homeland security, medical, and pharmaceutical applications and to any other ventures with a vested interest in monitoring and controlling contamination in exceptionally clean environments.

Flip-chip assembly and reliability using gold/tin solder bumps

NASA Astrophysics Data System (ADS)

Oppermann, Hermann; Hutter, Matthias; Klein, Matthias; Reichl, Herbert

2004-09-01

Au/Sn solder bumps are commonly used for flip chip assembly of optoelectronic and RF devices. They allow a fluxless assembly which is required to avoid contamination at optical interfaces. Flip chip assembly experiments were carried out using as plated Au/Sn bumps without prior bump reflow. An RF and reliability test vehicles comprise a GaAs chip which was flip chip soldered on a silicon substrate. Temperature cycling tests with and without underfiller were performed and the results are presented. The different failure modes for underfilled and non-underfilled samples were discussed and compared. Additional reliability tests were performed with flip chip bonding by gold thermocompression for comparison. The test results and the failure modes are discussed in detail.

Development of bufferless gel electrophoresis chip for easy preparation and rapid DNA separation.

PubMed

Oleksandrov, Sergiy; Aman, Abdurazak; Lim, Wanyoung; Kim, Younghee; Bae, Nam Ho; Lee, Kyoung G; Lee, Seok Jae; Park, Sungsu

2018-02-01

This work presents a handy, fast, and compact bufferless gel electrophoresis chip (BGEC), which consists of precast agarose gel confined in a disposable plastic body with electrodes. It does not require large volumes of buffer to fill reservoirs, or the process of immersing the gel in the buffer. It withstands voltages up to 28.4 V/cm, thereby allowing DNA separation within 10 min with a similar separation capability to the standard gel electrophoresis. The results suggest that our BGEC is highly suitable for in situ gel electrophoresis in forensic, epidemiological settings and crime scenes where standard gel electrophoresis equipment cannot be brought in while quick results are needed. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip.

PubMed

Ankireddy, Seshadri Reddy; Kim, Jongsung

2015-01-01

Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn(2+) because of the strong coordination interactions. In the presence of adenosine, Zn(2+) cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes.

Dopamine-functionalized InP/ZnS quantum dots as fluorescence probes for the detection of adenosine in microfluidic chip

PubMed Central

Ankireddy, Seshadri Reddy; Kim, Jongsung

2015-01-01

Microbeads are frequently used as solid supports for biomolecules such as proteins and nucleic acids in heterogeneous microfluidic assays. Chip-based, quantum dot (QD)-bead-biomolecule probes have been used for the detection of various types of DNA. In this study, we developed dopamine (DA)-functionalized InP/ZnS QDs (QDs-DA) as fluorescence probes for the detection of adenosine in microfluidic chips. The photoluminescence (PL) intensity of the QDs-DA is quenched by Zn2+ because of the strong coordination interactions. In the presence of adenosine, Zn2+ cations preferentially bind to adenosine, and the PL intensity of the QDs-DA is recovered. A polydimethylsiloxane-based microfluidic chip was fabricated, and adenosine detection was confirmed using QDs-DA probes. PMID:26347351

An epigenome-wide association analysis of cardiac autonomic responses among a population of welders.

PubMed

Zhang, Jinming; Liu, Zhonghua; Umukoro, Peter E; Cavallari, Jennifer M; Fang, Shona C; Weisskopf, Marc G; Lin, Xihong; Mittleman, Murray A; Christiani, David C

2017-02-01

DNA methylation is one of the potential epigenetic mechanisms associated with various adverse cardiovascular effects; however, its association with cardiac autonomic dysfunction, in particular, is unknown. In the current study, we aimed to identify epigenetic variants associated with alterations in cardiac autonomic responses. Cardiac autonomic responses were measured with two novel markers: acceleration capacity (AC) and deceleration capacity (DC). We examined DNA methylation levels at more than 472,506 CpG probes through the Illumina Infinium HumanMethylation450 BeadChip assay. We conducted separate linear mixed models to examine associations of DNA methylation levels at each CpG with AC and DC. One CpG (cg26829071) located in the GPR133 gene was negatively associated with DC values after multiple testing corrections through false discovery rate. Our study suggests the potential functional importance of methylation in cardiac autonomic responses. Findings from the current study need to be replicated in future studies in a larger population.

Divergent dispersion behavior of ssDNA fragments during microchip electrophoresis in pDMA and LPA entangled polymer networks

PubMed Central

Fredlake, Christopher P.; Hert, Daniel G.; Niedringhaus, Thomas P.; Lin, Jennifer S.; Barron, Annelise E.

2015-01-01

Resolution of DNA fragments separated by electrophoresis in polymer solutions (“matrices”) is determined by both the spacing between peaks and the width of the peaks. Prior research on the development of high-performance separation matrices has been focused primarily on optimizing DNA mobility and matrix selectivity, and gave less attention to peak broadening. Quantitative data are rare for peak broadening in systems in which high electric field strengths are used (> 150 V/cm), which is surprising since capillary and microchip-based systems commonly run at these field strengths. Here, we report results for a study of band broadening behavior for ssDNA fragments on a glass microfluidic chip, for electric field strengths up to 320 V/cm. We compare dispersion coefficients obtained in a poly(N,N-dimethylacrylamide) (pDMA) separation matrix that was developed for chip-based DNA sequencing with a commercially available linear polyacrylamide (LPA) matrix commonly used in capillaries. Much larger DNA dispersion coefficients were measured in the LPA matrix as compared to the pDMA matrix, and the dependences of dispersion coefficient on DNA size and electric field strength were found to differ quite starkly in the two matrices. These observations lead us to propose that DNA migration mechanisms differ substantially in our custom pDMA matrix compared to the commercially available LPA matrix. We discuss the implications of these results in terms of developing optimal matrices for specific separation (microchip or capillary) platforms. PMID:22648809

Development of a practical NF1 genetic testing method through the pilot analysis of five Japanese families with neurofibromatosis type 1.

PubMed

Okumura, Akiko; Ozaki, Mamoru; Niida, Yo

2015-08-01

Mutation analysis of NF1, the responsible gene for neurofibromatosis type 1 (NF1), is still difficult due to its large size, lack of mutational hotspots, the presence of many pseudogenes, and its wide spectrum of mutations. To develop a simple and inexpensive NF1 genetic testing for clinical use, we analyzed five Japanese families with NF1 as a pilot study. Our original method, CEL endonuclease mediated heteroduplex incision with polyacrylamide gel electrophoresis and silver staining (CHIPS) was optimized for NF1 mutation screening, and reverse transcription polymerase chain reaction (RT-PCR) was performed to determine the effect of transcription. Also, we employed DNA microarray analysis to evaluate the break points of the large deletion. A new nonsense mutation, p.Gln209(∗), was detected in family 1 and the splicing donor site mutation, c.2850+1G>T, was detected in family 2. In family 3, c.4402A>G was detected in exon 34 and the p.Ser1468Gly missense mutation was predicted. However mRNA analysis revealed that this substitution created an aberrant splicing acceptor site, thereby causing the p.Phe1457(∗) nonsense mutation. In the other two families, type-1 and unique NF1 microdeletions were detected by DNA microarray analysis. Our results show that the combination of CHIPS and RT-PCR effectively screen and characterize NF1 point mutations, and both DNA and RNA level analysis are required to understand the nature of the NF1 mutation. Our results also suggest the possibility of a higher incidence and unique profile of NF1 large deletions in the Japanese population as compared to previous studies performed in Europe. Copyright © 2014 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Robust Bioinformatics Recognition with VLSI Biochip Microsystem

NASA Technical Reports Server (NTRS)

Lue, Jaw-Chyng L.; Fang, Wai-Chi

2006-01-01

A microsystem architecture for real-time, on-site, robust bioinformatic patterns recognition and analysis has been proposed. This system is compatible with on-chip DNA analysis means such as polymerase chain reaction (PCR)amplification. A corresponding novel artificial neural network (ANN) learning algorithm using new sigmoid-logarithmic transfer function based on error backpropagation (EBP) algorithm is invented. Our results show the trained new ANN can recognize low fluorescence patterns better than the conventional sigmoidal ANN does. A differential logarithmic imaging chip is designed for calculating logarithm of relative intensities of fluorescence signals. The single-rail logarithmic circuit and a prototype ANN chip are designed, fabricated and characterized.

missMethyl: an R package for analyzing data from Illumina's HumanMethylation450 platform.

PubMed

Phipson, Belinda; Maksimovic, Jovana; Oshlack, Alicia

2016-01-15

DNA methylation is one of the most commonly studied epigenetic modifications due to its role in both disease and development. The Illumina HumanMethylation450 BeadChip is a cost-effective way to profile >450 000 CpGs across the human genome, making it a popular platform for profiling DNA methylation. Here we introduce missMethyl, an R package with a suite of tools for performing normalization, removal of unwanted variation in differential methylation analysis, differential variability testing and gene set analysis for the 450K array. missMethyl is an R package available from the Bioconductor project at www.bioconductor.org. alicia.oshlack@mcri.edu.au Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

FUNDAMENTALS OF VITAMIN D HORMONE-REGULATED GENE EXPRESSION

PubMed Central

Pike, J. Wesley; Meyer, Mark B.

2014-01-01

Initial research focused upon several known genetic targets provided early insight into the mechanism of action of the vitamin D hormone (1,25-dihydroxyvitamin D3 (1,25(OH)2D3)). Recently, however, a series of technical advances involving the coupling of chromatin immunoprecipitation (ChIP) to unbiased methodologies that initially involved tiled DNA microarrays (ChIP-chip analysis) and now Next Generation DNA Sequencing techniques (ChIP-Seq analysis) has opened new avenues of research into the mechanisms through which 1,25(OH)2D3 regulates gene expression. In this review, we summarize briefly the results of this early work and then focus on more recent studies in which ChIP-chip and ChIP-seq analyses have been used to explore the mechanisms of 1,25(OH)2D3 action on a genome-wide scale providing specific target genes as examples. The results of this work have advanced our understanding of the mechanisms involved at both genetic and epigenetic levels and have revealed a series of new principles through which the vitamin D hormone functions to control the expression of genes. PMID:24239506

Helicase dependent OnChip-amplification and its use in multiplex pathogen detection.

PubMed

Andresen, Dennie; von Nickisch-Rosenegk, Markus; Bier, Frank F

2009-05-01

The need for fast, specific and sensitive multiparametric detection methods is an ever growing demand in molecular diagnostics. Here we report on a newly developed method, the helicase dependent OnChip amplification (OnChip-HDA). This approach integrates the analysis and detection in one single reaction thus leading to time and cost savings in multiparametric analysis. HDA is an isothermal amplification method that is not depending on thermocycling as known from PCR due to the helicases' ability to unwind DNA double-strands. We have combined the HDA with microarray based detection, making it suitable for multiplex detection. As an example we used the OnChip HDA in single and multiplex amplifications for the detection of the two pathogens N. gonorrhoeae and S. aureus directly on surface bound primers. We have successfully shown the OnChip-HDA and applied it for single- and duplex-detection of the pathogens N. gonorrhoeae and S. aureus. We have developed a new method, the OnChip-HDA for the multiplex detection of pathogens. Its simplicity in reaction setup and potential for miniaturization and multiparametric analysis is advantageous for the integration in miniaturized Lab on Chip systems, e.g. needed in point of care diagnostics.

Chip morphology as a performance predictor during high speed end milling of soda lime glass

NASA Astrophysics Data System (ADS)

Bagum, M. N.; Konneh, M.; Abdullah, K. A.; Ali, M. Y.

2018-01-01

Soda lime glass has application in DNA arrays and lab on chip manufacturing. Although investigation revealed that machining of such brittle material is possible using ductile mode under controlled cutting parameters and tool geometry, it remains a challenging task. Furthermore, ability of ductile machining is usually assed through machined surface texture examination. Soda lime glass is a strain rate and temperature sensitive material. Hence, influence on attainment of ductile surface due to adiabatic heat generated during high speed end milling using uncoated tungsten carbide tool is investigated in this research. Experimental runs were designed using central composite design (CCD), taking spindle speed, feed rate and depth of cut as input variable and tool-chip contact point temperature (Ttc) and the surface roughness (Rt) as responses. Along with machined surface texture, Rt and chip morphology was examined to assess machinability of soda lime glass. The relation between Ttc and chip morphology was examined. Investigation showed that around glass transition temperature (Tg) ductile chip produced and subsequently clean and ductile final machined surface produced.

See what you eat--broad GMO screening with microarrays.

PubMed

von Götz, Franz

2010-03-01

Despite the controversy of whether genetically modified organisms (GMOs) are beneficial or harmful for humans, animals, and/or ecosystems, the number of cultivated GMOs is increasing every year. Many countries and federations have implemented safety and surveillance systems for GMOs. Potent testing technologies need to be developed and implemented to monitor the increasing number of GMOs. First, these GMO tests need to be comprehensive, i.e., should detect all, or at least the most important, GMOs on the market. This type of GMO screening requires a high degree of parallel tests or multiplexing. To date, DNA microarrays have the highest number of multiplexing capabilities when nucleic acids are analyzed. This trend article focuses on the evolution of DNA microarrays for GMO testing. Over the last 7 years, combinations of multiplex PCR detection and microarray detection have been developed to qualitatively assess the presence of GMOs. One example is the commercially available DualChip GMO (Eppendorf, Germany; http://www.eppendorf-biochip.com), which is the only GMO screening system successfully validated in a multicenter study. With use of innovative amplification techniques, promising steps have recently been taken to make GMO detection with microarrays quantitative.

Structure of the human gastric bacterial community in relation to Helicobacter pylori status.

PubMed

Maldonado-Contreras, Ana; Goldfarb, Kate C; Godoy-Vitorino, Filipa; Karaoz, Ulas; Contreras, Mónica; Blaser, Martin J; Brodie, Eoin L; Dominguez-Bello, Maria G

2011-04-01

The human stomach is naturally colonized by Helicobacter pylori, which, when present, dominates the gastric bacterial community. In this study, we aimed to characterize the structure of the bacterial community in the stomach of patients of differing H. pylori status. We used a high-density 16S rRNA gene microarray (PhyloChip, Affymetrix, Inc.) to hybridize 16S rRNA gene amplicons from gastric biopsy DNA of 10 rural Amerindian patients from Amazonas, Venezuela, and of two immigrants to the United States (from South Asia and Africa, respectively). H. pylori status was determined by PCR amplification of H. pylori glmM from gastric biopsy samples. Of the 12 patients, 8 (6 of the 10 Amerindians and the 2 non-Amerindians) were H. pylori glmM positive. Regardless of H. pylori status, the PhyloChip detected Helicobacteriaceae DNA in all patients, although with lower relative abundance in patients who were glmM negative. The G2-chip taxonomy analysis of PhyloChip data indicated the presence of 44 bacterial phyla (of which 16 are unclassified by the Taxonomic Outline of the Bacteria and Archaea taxonomy) in a highly uneven community dominated by only four phyla: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Positive H. pylori status was associated with increased relative abundance of non-Helicobacter bacteria from the Proteobacteria, Spirochetes and Acidobacteria, and with decreased abundance of Actinobacteria, Bacteroidetes and Firmicutes. The PhyloChip detected richness of low abundance phyla, and showed marked differences in the structure of the gastric bacterial community according to H. pylori status.

Carbodiimide-mediated immobilization of acidic biomolecules on reversed-charge zwitterionic sensor chip surfaces.

PubMed

Risse, Fabian; Gedig, Erk T; Gutmann, Jochen S

2018-04-30

The carbodiimide-mediated amine coupling of protein ligands to sensor chips coated with anionic polycarboxylate hydrogels, such as carboxymethyl dextran, is the predominant covalent immobilization procedure utilized in optical biosensors, namely surface plasmon resonance (SPR) biosensors. Usually, electrostatic interactions at a slightly acidic pH and low ionic strength are employed to efficiently accumulate neutral and basic ligands on the chip surface, which are then covalently coupled by surface-bound active N-hydroxysuccinimide (NHS) esters. Unfortunately, this approach is not suitable for acidic proteins or other ligands with low isoelectric points (IEPs), such as nucleic acids, because the charge density of the polycarboxylates is greatly reduced at acidic pH or because electrostatic attraction cannot be achieved. To overcome these drawbacks, we have established a charge-reversal approach that allows the preconcentration of acidic proteins above their IEPs. A precisely controlled amount of tertiary amines is applied to reverse the previous anionic surface charge while maintaining carbodiimide compatibility with future protein immobilization. The mechanism of this reversed-charge immobilization approach was demonstrated employing protein A as a model protein and using attenuated total reflectance Fourier transform infrared spectroscopy, dynamic contact angle measurements, colorimetric quantification, and SPR analysis to characterize surface derivatization. Furthermore, even though it had previously proven impossible to preconcentrate DNA electrostatically and to covalently couple it to polyanionic chip surfaces, we demonstrated that our approach allowed DNA to be preconcentrated and immobilized in good yields. Graphical abstract Principle of the covalent immobilization of acidic ligands on reversed-charge zwitterionic sensor chip surfaces.

Structure of the human gastric bacterial community in relation to Helicobacter pylori status

PubMed Central

Maldonado-Contreras, Ana; Goldfarb, Kate C; Godoy-Vitorino, Filipa; Karaoz, Ulas; Contreras, Mónica; Blaser, Martin J; Brodie, Eoin L; Dominguez-Bello, Maria G

2011-01-01

The human stomach is naturally colonized by Helicobacter pylori, which, when present, dominates the gastric bacterial community. In this study, we aimed to characterize the structure of the bacterial community in the stomach of patients of differing H. pylori status. We used a high-density 16S rRNA gene microarray (PhyloChip, Affymetrix, Inc.) to hybridize 16S rRNA gene amplicons from gastric biopsy DNA of 10 rural Amerindian patients from Amazonas, Venezuela, and of two immigrants to the United States (from South Asia and Africa, respectively). H. pylori status was determined by PCR amplification of H. pylori glmM from gastric biopsy samples. Of the 12 patients, 8 (6 of the 10 Amerindians and the 2 non-Amerindians) were H. pylori glmM positive. Regardless of H. pylori status, the PhyloChip detected Helicobacteriaceae DNA in all patients, although with lower relative abundance in patients who were glmM negative. The G2-chip taxonomy analysis of PhyloChip data indicated the presence of 44 bacterial phyla (of which 16 are unclassified by the Taxonomic Outline of the Bacteria and Archaea taxonomy) in a highly uneven community dominated by only four phyla: Proteobacteria, Firmicutes, Actinobacteria and Bacteroidetes. Positive H. pylori status was associated with increased relative abundance of non-Helicobacter bacteria from the Proteobacteria, Spirochetes and Acidobacteria, and with decreased abundance of Actinobacteria, Bacteroidetes and Firmicutes. The PhyloChip detected richness of low abundance phyla, and showed marked differences in the structure of the gastric bacterial community according to H. pylori status. PMID:20927139

Development and validation of a 48-target analytical method for high-throughput monitoring of genetically modified organisms.

PubMed

Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

2015-01-05

The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection.

Development and Validation of A 48-Target Analytical Method for High-throughput Monitoring of Genetically Modified Organisms

PubMed Central

Li, Xiaofei; Wu, Yuhua; Li, Jun; Li, Yunjing; Long, Likun; Li, Feiwu; Wu, Gang

2015-01-01

The rapid increase in the number of genetically modified (GM) varieties has led to a demand for high-throughput methods to detect genetically modified organisms (GMOs). We describe a new dynamic array-based high throughput method to simultaneously detect 48 targets in 48 samples on a Fludigm system. The test targets included species-specific genes, common screening elements, most of the Chinese-approved GM events, and several unapproved events. The 48 TaqMan assays successfully amplified products from both single-event samples and complex samples with a GMO DNA amount of 0.05 ng, and displayed high specificity. To improve the sensitivity of detection, a preamplification step for 48 pooled targets was added to enrich the amount of template before performing dynamic chip assays. This dynamic chip-based method allowed the synchronous high-throughput detection of multiple targets in multiple samples. Thus, it represents an efficient, qualitative method for GMO multi-detection. PMID:25556930

Ultralow power trapping and fluorescence detection of single particles on an optofluidic chip.

PubMed

Kühn, S; Phillips, B S; Lunt, E J; Hawkins, A R; Schmidt, H

2010-01-21

The development of on-chip methods to manipulate particles is receiving rapidly increasing attention. All-optical traps offer numerous advantages, but are plagued by large required power levels on the order of hundreds of milliwatts and the inability to act exclusively on individual particles. Here, we demonstrate a fully integrated electro-optical trap for single particles with optical excitation power levels that are five orders of magnitude lower than in conventional optical force traps. The trap is based on spatio-temporal light modulation that is implemented using networks of antiresonant reflecting optical waveguides. We demonstrate the combination of on-chip trapping and fluorescence detection of single microorganisms by studying the photobleaching dynamics of stained DNA in E. coli bacteria. The favorable size scaling facilitates the trapping of single nanoparticles on integrated optofluidic chips.

Chip, Chip, Hooray!

ERIC Educational Resources Information Center

Kelly, Susan

2001-01-01

Presents a science laboratory using different brands of potato chips in which students test their oiliness, size, thickness, saltiness, quality, and cost, then analyze the results to determine the best chip. Gives a brief history of potato chips. (YDS)

A Versatile Microfluidic Device for Automating Synthetic Biology.

PubMed

Shih, Steve C C; Goyal, Garima; Kim, Peter W; Koutsoubelis, Nicolas; Keasling, Jay D; Adams, Paul D; Hillson, Nathan J; Singh, Anup K

2015-10-16

New microbes are being engineered that contain the genetic circuitry, metabolic pathways, and other cellular functions required for a wide range of applications such as producing biofuels, biobased chemicals, and pharmaceuticals. Although currently available tools are useful in improving the synthetic biology process, further improvements in physical automation would help to lower the barrier of entry into this field. We present an innovative microfluidic platform for assembling DNA fragments with 10× lower volumes (compared to that of current microfluidic platforms) and with integrated region-specific temperature control and on-chip transformation. Integration of these steps minimizes the loss of reagents and products compared to that with conventional methods, which require multiple pipetting steps. For assembling DNA fragments, we implemented three commonly used DNA assembly protocols on our microfluidic device: Golden Gate assembly, Gibson assembly, and yeast assembly (i.e., TAR cloning, DNA Assembler). We demonstrate the utility of these methods by assembling two combinatorial libraries of 16 plasmids each. Each DNA plasmid is transformed into Escherichia coli or Saccharomyces cerevisiae using on-chip electroporation and further sequenced to verify the assembly. We anticipate that this platform will enable new research that can integrate this automated microfluidic platform to generate large combinatorial libraries of plasmids and will help to expedite the overall synthetic biology process.

Polymer-based microfluidic chips for isothermal amplification of nucleic acids

NASA Astrophysics Data System (ADS)

Posmitnaya, Y. S.; Rudnitskaya, G. E.; Tupik, A. N.; Lukashenko, T. A.; Bukatin, A. C.; Evstrapov, A. A.

2017-11-01

Creation of low-cost compact devices based on microfluidic platforms for biological and medical research depends on the degree of development and enhancement of prototyping technologies. Two designs of polymer and hybrid microfluidic devices fabricated by soft lithography and intended for isothermal amplification and polymerase chain reaction are presented in this paper. The digital helicase-dependent isothermal amplification was tested in the device containing a droplet generator. Polymerase chain reaction was carried out in the hybrid microfluidic device having ten reaction chambers. A synthesized cDNA fragment of GAPDH housekeeping gene was used as a target.

Combining genomic and proteomic approaches for epigenetics research

PubMed Central

Han, Yumiao; Garcia, Benjamin A

2014-01-01

Epigenetics is the study of changes in gene expression or cellular phenotype that do not change the DNA sequence. In this review, current methods, both genomic and proteomic, associated with epigenetics research are discussed. Among them, chromatin immunoprecipitation (ChIP) followed by sequencing and other ChIP-based techniques are powerful techniques for genome-wide profiling of DNA-binding proteins, histone post-translational modifications or nucleosome positions. However, mass spectrometry-based proteomics is increasingly being used in functional biological studies and has proved to be an indispensable tool to characterize histone modifications, as well as DNA–protein and protein–protein interactions. With the development of genomic and proteomic approaches, combination of ChIP and mass spectrometry has the potential to expand our knowledge of epigenetics research to a higher level. PMID:23895656

A microfluidic flow injection system for DNA assay with fluids driven by an on-chip integrated pump based on capillary and evaporation effects.

PubMed

Xu, Zhang-Run; Zhong, Chong-Hui; Guan, Yan-Xia; Chen, Xu-Wei; Wang, Jian-Hua; Fang, Zhao-Lun

2008-10-01

A miniaturized flow injection analysis (FIA) system integrating a micropump on a microfluidic chip based on capillary and evaporation effects was developed. The pump was made by fixing a filter paper plug with a vent tube at the channel end, it requires no peripheral equipment and provides steady flow in the microl min(-1) range for FIA operation. Valve-free sample injection was achieved at nanolitre level using an array of slotted vials. The practical applicability of the system was demonstrated by DNA assay with laser-induced fluorescence (LIF) detection. A precision of 1.6% RSD (10.0 ng microl(-1), n=15) was achieved with a sampling throughput of 76 h(-1) and sample consumption of 95 nl.

Construction of a microfluidic chip, using dried-down reagents, for LATE-PCR amplification and detection of single-stranded DNA.

PubMed

Jia, Yanwei; Mak, Pui-In; Massey, Conner; Martins, Rui P; Wangh, Lawrence J

2013-12-07

LATE-PCR is an advanced form of non-symmetric PCR that efficiently generates single-stranded DNA which can readily be characterized at the end of amplification by hybridization to low-temperature fluorescent probes. We demonstrate here for the first time that monoplex and duplex LATE-PCR amplification and probe target hybridization can be carried out in double layered PDMS microfluidics chips containing dried reagents. Addition of a set of reagents during dry down overcomes the common problem of single-stranded oligonucleotide binding to PDMS. These proof-of-principle results open the way to construction of inexpensive point-of-care devices that take full advantage of the analytical power of assays built using LATE-PCR and low-temperature probes.

A ChIP-chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response.

PubMed

Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

2009-03-01

IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP-chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response.

A ChIP–chip approach reveals a novel role for transcription factor IRF1 in the DNA damage response

PubMed Central

Frontini, Mattia; Vijayakumar, Meeraa; Garvin, Alexander; Clarke, Nicole

2009-01-01

IRF1 is a transcription factor that regulates key processes in the immune system and in tumour suppression. To gain further insight into IRF1's role in these processes, we searched for new target genes by performing chromatin immunoprecipitation coupled to a CpG island microarray (ChIP–chip). Using this approach we identified 202 new IRF1-binding sites with high confidence. Functional categorization of the target genes revealed a surprising cadre of new roles that can be linked to IRF1. One of the major functional categories was the DNA damage response pathway. In order to further validate our findings, we show that IRF1 can regulate the mRNA expression of a number of the DNA damage response genes in our list. In particular, we demonstrate that the mRNA and protein levels of the DNA repair protein BRIP1 [Fanconi anemia gene J (FANC J)] are upregulated after IRF1 over-expression. We also demonstrate that knockdown of IRF1 by siRNA results in loss of BRIP1 expression, abrogation of BRIP1 foci after DNA interstrand crosslink (ICL) damage and hypersensitivity to the DNA crosslinking agent, melphalan; a characteristic phenotype of FANC J cells. Taken together, our data provides a more complete understanding of the regulatory networks controlled by IRF1 and reveals a novel role for IRF1 in regulating the ICL DNA damage response. PMID:19129219

Integrated circuit-based instrumentation for microchip capillary electrophoresis.

PubMed

Behnam, M; Kaigala, G V; Khorasani, M; Martel, S; Elliott, D G; Backhouse, C J

2010-09-01

Although electrophoresis with laser-induced fluorescence (LIF) detection has tremendous potential in lab on chip-based point-of-care disease diagnostics, the wider use of microchip electrophoresis has been limited by the size and cost of the instrumentation. To address this challenge, the authors designed an integrated circuit (IC, i.e. a microelectronic chip, with total silicon area of <0.25 cm2, less than 5 mmx5 mm, and power consumption of 28 mW), which, with a minimal additional infrastructure, can perform microchip electrophoresis with LIF detection. The present work enables extremely compact and inexpensive portable systems consisting of one or more complementary metal-oxide-semiconductor (CMOS) chips and several other low-cost components. There are, to the authors' knowledge, no other reports of a CMOS-based LIF capillary electrophoresis instrument (i.e. high voltage generation, switching, control and interface circuit combined with LIF detection). This instrument is powered and controlled using a universal serial bus (USB) interface to a laptop computer. The authors demonstrate this IC in various configurations and can readily analyse the DNA produced by a standard medical diagnostic protocol (end-labelled polymerase chain reaction (PCR) product) with a limit of detection of approximately 1 ng/microl (approximately 1 ng of total DNA). The authors believe that this approach may ultimately enable lab-on-a-chip-based electrophoretic instruments that cost on the order of several dollars.

Using Chromatin Immunoprecipitation in Toxicology: A Step-by-Step Guide to Increasing Efficiency, Reducing Variability, and Expanding Applications.

PubMed

McCullough, Shaun D; On, Doan M; Bowers, Emma C

2017-05-02

Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and response to environmental stimuli. More than 130 unique histone modifications have been described to date, and chromatin immunoprecipitation (ChIP) allows for the exploration of their associations with the regulatory regions of target genes and other DNA/chromatin-associated proteins across the genome. Many variations of ChIP have been developed in the 30 years since its earliest version came into use, which makes it challenging for users to integrate the procedure into their research programs. Furthermore, the differences in ChIP protocols can confound efforts to increase reproducibility across studies. The streamlined ChIP procedure presented here can be readily applied to samples from a wide range of in vitro studies (cell lines and primary cells) and clinical samples (peripheral leukocytes) in toxicology. We also provide detailed guidance on the optimization of critical protocol parameters, such as chromatin fixation, fragmentation, and immunoprecipitation, to increase efficiency and improve reproducibility. Expanding toxicoepigenetic studies to more readily include histone modifications will facilitate a more comprehensive understanding of the role of the epigenome in environmental exposure effects and the integration of epigenetic data in mechanistic toxicology, adverse outcome pathways, and risk assessment. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.

An accessible micro-capillary electrophoresis device using surface-tension-driven flow

PubMed Central

Mohanty, Swomitra K.; Warrick, Jay; Gorski, Jack; Beebe, David J.

2010-01-01

We present a rapidly fabricated micro-capillary electrophoresis chip that utilizes surface-tension-driven flow for sample injection and extraction of DNA. Surface-tension-driven flow (i.e. passive pumping) injects a fixed volume of sample that can be predicted mathematically. Passive pumping eliminates the need for tubing, valves, syringe pumps, and other equipment typically needed for interfacing with microelectrophoresis chips. This method requires a standard micropipette to load samples before separation, and remove the resulting bands after analysis. The device was made using liquid phase photopolymerization to rapidly fabricate the chip without the need of special equipment typically associated with the construction of microelectrophoresis chips (e.g. cleanroom). Batch fabrication time for the device presented here was 1.5 h including channel coating time to suppress electroosmotic flow. Devices were constructed out of poly-isobornyl acrylate and glass. A standard microscope with a UV source was used for sample detection. Separations were demonstrated using Promega BenchTop 100 bp ladder in hydroxyl ethyl cellulose (HEC) and oligonucleotides of 91 and 118 bp were used to characterize sample injection and extraction of DNA bands. The end result was an inexpensive micro-capillary electrophoresis device that uses tools (e.g. micropipette, electrophoretic power supplies, and microscopes) already present in most labs for sample manipulation and detection, making it more accessible for potential end users. PMID:19425002

Design and integration of an all-in-one biomicrofluidic chip

PubMed Central

Liu, Liyu; Cao, Wenbin; Wu, Jingbo; Wen, Weijia; Chang, Donald Choy; Sheng, Ping

2008-01-01

We demonstrate a highly integrated microfluidic chip with the function of DNA amplification. The integrated chip combines giant electrorheological-fluid actuated micromixer and micropump with a microheater array, all formed using soft lithography. Internal functional components are based on polydimethylsiloxane (PDMS) and silver∕carbon black-PDMS composites. The system has the advantages of small size with a high degree of integration, high polymerase chain reaction efficiency, digital control and simple fabrication at low cost. This integration approach shows promise for a broad range of applications in chemical synthesis and biological sensing∕analysis, as different components can be combined to target desired functionalities, with flexible designs of different microchips easily realizable through soft lithography. PMID:19693370

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines

PubMed Central

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours’ biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription–quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes. PMID:29263807

Genome-wide methylation analysis identifies genes silenced in non-seminoma cell lines.

PubMed

Noor, Dzul Azri Mohamed; Jeyapalan, Jennie N; Alhazmi, Safiah; Carr, Matthew; Squibb, Benjamin; Wallace, Claire; Tan, Christopher; Cusack, Martin; Hughes, Jaime; Reader, Tom; Shipley, Janet; Sheer, Denise; Scotting, Paul J

2016-01-01

Silencing of genes by DNA methylation is a common phenomenon in many types of cancer. However, the genome-wide effect of DNA methylation on gene expression has been analysed in relatively few cancers. Germ cell tumours (GCTs) are a complex group of malignancies. They are unique in developing from a pluripotent progenitor cell. Previous analyses have suggested that non-seminomas exhibit much higher levels of DNA methylation than seminomas. The genomic targets that are methylated, the extent to which this results in gene silencing and the identity of the silenced genes most likely to play a role in the tumours' biology have not yet been established. In this study, genome-wide methylation and expression analysis of GCT cell lines was combined with gene expression data from primary tumours to address this question. Genome methylation was analysed using the Illumina infinium HumanMethylome450 bead chip system and gene expression was analysed using Affymetrix GeneChip Human Genome U133 Plus 2.0 arrays. Regulation by methylation was confirmed by demethylation using 5-aza-2-deoxycytidine and reverse transcription-quantitative PCR. Large differences in the level of methylation of the CpG islands of individual genes between tumour cell lines correlated well with differential gene expression. Treatment of non-seminoma cells with 5-aza-2-deoxycytidine verified that methylation of all genes tested played a role in their silencing in yolk sac tumour cells and many of these genes were also differentially expressed in primary tumours. Genes silenced by methylation in the various GCT cell lines were identified. Several pluripotency-associated genes were identified as a major functional group of silenced genes.

Universal nondestructive mm-wave integrated circuit test fixture

NASA Technical Reports Server (NTRS)

Romanofsky, Robert R. (Inventor); Shalkhauser, Kurt A. (Inventor)

1990-01-01

Monolithic microwave integrated circuit (MMIC) test includes a bias module having spring-loaded contacts which electrically engage pads on a chip carrier disposed in a recess of a base member. RF energy is applied to and passed from the chip carrier by chamfered edges of ridges in the waveguide passages of housings which are removably attached to the base member. Thru, Delay, and Short calibration standards having dimensions identical to those of the chip carrier assure accuracy and reliability of the test. The MMIC chip fits in an opening in the chip carrier with the boundaries of the MMIC lying on movable reference planes thereby establishing accuracy and flexibility.

Rapid and Low-Cost CRP Measurement by Integrating a Paper-Based Microfluidic Immunoassay with Smartphone (CRP-Chip).

PubMed

Dong, Meili; Wu, Jiandong; Ma, Zimin; Peretz-Soroka, Hagit; Zhang, Michael; Komenda, Paul; Tangri, Navdeep; Liu, Yong; Rigatto, Claudio; Lin, Francis

2017-03-26

Traditional diagnostic tests for chronic diseases are expensive and require a specialized laboratory, therefore limiting their use for point-of-care (PoC) testing. To address this gap, we developed a method for rapid and low-cost C-reactive protein (CRP) detection from blood by integrating a paper-based microfluidic immunoassay with a smartphone (CRP-Chip). We chose CRP for this initial development because it is a strong biomarker of prognosis in chronic heart and kidney disease. The microfluidic immunoassay is realized by lateral flow and gold nanoparticle-based colorimetric detection of the target protein. The test image signal is acquired and analyzed using a commercial smartphone with an attached microlens and a 3D-printed chip-phone interface. The CRP-Chip was validated for detecting CRP in blood samples from chronic kidney disease patients and healthy subjects. The linear detection range of the CRP-Chip is up to 2 μg/mL and the detection limit is 54 ng/mL. The CRP-Chip test result yields high reproducibility and is consistent with the standard ELISA kit. A single CRP-Chip can perform the test in triplicate on a single chip within 15 min for less than 50 US cents of material cost. This CRP-Chip with attractive features of low-cost, fast test speed, and integrated easy operation with smartphones has the potential to enable future clinical PoC chronic disease diagnosis and risk stratification by parallel measurements of a panel of protein biomarkers.

Mismatch and G-Stack Modulated Probe Signals on SNP Microarrays

PubMed Central

Binder, Hans; Fasold, Mario; Glomb, Torsten

2009-01-01

Background Single nucleotide polymorphism (SNP) arrays are important tools widely used for genotyping and copy number estimation. This technology utilizes the specific affinity of fragmented DNA for binding to surface-attached oligonucleotide DNA probes. We analyze the variability of the probe signals of Affymetrix GeneChip SNP arrays as a function of the probe sequence to identify relevant sequence motifs which potentially cause systematic biases of genotyping and copy number estimates. Methodology/Principal Findings The probe design of GeneChip SNP arrays enables us to disentangle different sources of intensity modulations such as the number of mismatches per duplex, matched and mismatched base pairings including nearest and next-nearest neighbors and their position along the probe sequence. The effect of probe sequence was estimated in terms of triple-motifs with central matches and mismatches which include all 256 combinations of possible base pairings. The probe/target interactions on the chip can be decomposed into nearest neighbor contributions which correlate well with free energy terms of DNA/DNA-interactions in solution. The effect of mismatches is about twice as large as that of canonical pairings. Runs of guanines (G) and the particular type of mismatched pairings formed in cross-allelic probe/target duplexes constitute sources of systematic biases of the probe signals with consequences for genotyping and copy number estimates. The poly-G effect seems to be related to the crowded arrangement of probes which facilitates complex formation of neighboring probes with at minimum three adjacent G's in their sequence. Conclusions The applied method of “triple-averaging” represents a model-free approach to estimate the mean intensity contributions of different sequence motifs which can be applied in calibration algorithms to correct signal values for sequence effects. Rules for appropriate sequence corrections are suggested. PMID:19924253

Gas Sensor Test Chip

NASA Technical Reports Server (NTRS)

Buehler, M.; Ryan, M.

1995-01-01

A new test chip is being developed to characterize conducting polymers used in gas sensors. The chip, a seven-layer cofired alumina substrate with gold electrodes, contains 11 comb and U- bend test structures. These structures are designed to measure the sheet resistance, conduction anisotropy, and peripheral conduction of spin-coated films that are not subsequently patterned.

Thermal-Aware Test Access Mechanism and Wrapper Design Optimization for System-on-Chips

NASA Astrophysics Data System (ADS)

Yu, Thomas Edison; Yoneda, Tomokazu; Chakrabarty, Krishnendu; Fujiwara, Hideo

Rapid advances in semiconductor manufacturing technology have led to higher chip power densities, which places greater emphasis on packaging and temperature control during testing. For system-on-chips, peak power-based scheduling algorithms have been used to optimize tests under specified power constraints. However, imposing power constraints does not always solve the problem of overheating due to the non-uniform distribution of power across the chip. This paper presents a TAM/Wrapper co-design methodology for system-on-chips that ensures thermal safety while still optimizing the test schedule. The method combines a simplified thermal-cost model with a traditional bin-packing algorithm to minimize test time while satisfying temperature constraints. Furthermore, for temperature checking, thermal simulation is done using cycle-accurate power profiles for more realistic results. Experiments show that even a minimal sacrifice in test time can yield a considerable decrease in test temperature as well as the possibility of further lowering temperatures beyond those achieved using traditional power-based test scheduling.

Ultra-thin silicon (UTSi) on insulator CMOS transceiver and time-division multiplexed switch chips for smart pixel integration

NASA Astrophysics Data System (ADS)

Zhang, Liping; Sawchuk, Alexander A.

2001-12-01

We describe the design, fabrication and functionality of two different 0.5 micron CMOS optoelectronic integrated circuit (OEIC) chips based on the Peregrine Semiconductor Ultra-Thin Silicon on insulator technology. The Peregrine UTSi silicon- on-sapphire (SOS) technology is a member of the silicon-on- insulator (SOI) family. The low-loss synthetic sapphire substrate is optically transparent and has good thermal conductivity and coefficient of thermal expansion properties, which meet the requirements for flip-chip bonding of VCSELs and other optoelectronic input-output components. One chip contains transceiver and network components, including four channel high-speed CMOS transceiver modules, pseudo-random bit stream (PRBS) generators, a voltage controlled oscillator (VCO) and other test circuits. The transceiver chips can operate in both self-testing mode and networking mode. An on- chip clock and true-single-phase-clock (TSPC) D-flip-flop have been designed to generate a PRBS at over 2.5 Gb/s for the high-speed transceiver arrays to operate in self-testing mode. In the networking mode, an even number of transceiver chips forms a ring network through free-space or fiber ribbon interconnections. The second chip contains four channel optical time-division multiplex (TDM) switches, optical transceiver arrays, an active pixel detector and additional test devices. The eventual applications of these chips will require monolithic OEICs with integrated optical input and output. After fabrication and testing, the CMOS transceiver array dies will be packaged with 850 nm vertical cavity surface emitting lasers (VCSELs), and metal-semiconductor- metal (MSM) or GaAs p-i-n detector die arrays to achieve high- speed optical interconnections. The hybrid technique could be either wire bonding or flip-chip bonding of the CMOS SOS smart-pixel arrays with arrays of VCSELs and photodetectors onto an optoelectronic chip carrier as a multi-chip module (MCM).

P53 Mutation Analysis to Predict Tumor Response in Patients Undergoing Neoadjuvant Treatment for Locally Advanced Breast Cancer

DTIC Science & Technology

2006-10-01

then sequenced (for GeneChip- positiv SSCP (for GeneChip-negative). We have received a total of 43 core breast biopsy DNA samples from the UNC... quantitative luciferase reporter. Both reporters exploit a “rheostatable” promoter for p53 expression and utilize the “delitto perfetto” in vivo... quantitative luciferase-based assay is also being used to characterize the altered function sistent an tion T mutants in greater detail. Preliminary

Measuring Sister Chromatid Cohesion Protein Genome Occupancy in Drosophila melanogaster by ChIP-seq.

PubMed

Dorsett, Dale; Misulovin, Ziva

2017-01-01

This chapter presents methods to conduct and analyze genome-wide chromatin immunoprecipitation of the cohesin complex and the Nipped-B cohesin loading factor in Drosophila cells using high-throughput DNA sequencing (ChIP-seq). Procedures for isolation of chromatin, immunoprecipitation, and construction of sequencing libraries for the Ion Torrent Proton high throughput sequencer are detailed, and computational methods to calculate occupancy as input-normalized fold-enrichment are described. The results obtained by ChIP-seq are compared to those obtained by ChIP-chip (genomic ChIP using tiling microarrays), and the effects of sequencing depth on the accuracy are analyzed. ChIP-seq provides similar sensitivity and reproducibility as ChIP-chip, and identifies the same broad regions of occupancy. The locations of enrichment peaks, however, can differ between ChIP-chip and ChIP-seq, and low sequencing depth can splinter broad regions of occupancy into distinct peaks.

Continuous-flow, microfluidic, qRT-PCR system for RNA virus detection.

PubMed

Fernández-Carballo, B Leticia; McBeth, Christine; McGuiness, Ian; Kalashnikov, Maxim; Baum, Christoph; Borrós, Salvador; Sharon, Andre; Sauer-Budge, Alexis F

2018-01-01

One of the main challenges in the diagnosis of infectious diseases is the need for rapid and accurate detection of the causative pathogen in any setting. Rapid diagnosis is key to avoiding the spread of the disease, to allow proper clinical decisions to be made in terms of patient treatment, and to mitigate the rise of drug-resistant pathogens. In the last decade, significant interest has been devoted to the development of point-of-care reverse transcription polymerase chain reaction (PCR) platforms for the detection of RNA-based viral pathogens. We present the development of a microfluidic, real-time, fluorescence-based, continuous-flow reverse transcription PCR system. The system incorporates a disposable microfluidic chip designed to be produced industrially with cost-effective roll-to-roll embossing methods. The chip has a long microfluidic channel that directs the PCR solution through areas heated to different temperatures. The solution first travels through a reverse transcription zone where RNA is converted to complementary DNA, which is later amplified and detected in real time as it travels through the thermal cycling area. As a proof of concept, the system was tested for Ebola virus detection. Two different master mixes were tested, and the limit of detection of the system was determined, as was the maximum speed at which amplification occurred. Our results and the versatility of our system suggest its promise for the detection of other RNA-based viruses such as Zika virus or chikungunya virus, which constitute global health threats worldwide. Graphical abstract Photograph of the RT-PCR thermoplastic chip.

Epigenetic regulation of neuronal immediate early genes is associated with decline in their expression and memory consolidation in scopolamine-induced amnesic mice.

PubMed

Srivas, Sweta; Thakur, Mahendra K

2017-09-01

Recently, we reported a correlation of scopolamine mediated decline in memory consolidation with increase in the expression of DNA methyltransferase 1 (DNMT1) and histone deacetylase 2 (HDAC2) in the mouse hippocampus. Memory consolidation is a protein synthesis-dependent process which involves the expression of synaptic plasticity genes, particularly neuronal immediate early genes (IEGs). However, the mechanism of regulation of these genes during decline in memory is poorly understood. Therefore, we have studied the epigenetic regulation of expression of neuronal IEGs in scopolamine-induced amnesic mice. Scopolamine significantly impaired memory consolidation as tested by radial arm maze, and the expression of neuronal IEGs was downregulated in the hippocampus as revealed by qRT-PCR and Western blotting. Further, methylated DNA immunoprecipitation (MeDIP) analysis showed increase in DNA methylation, while chromatin immunoprecipitation (ChIP) revealed decrease in H3K9/14 acetylation at the promoter of neuronal IEGs. Taken together, the present study shows that increased DNA methylation and decreased histone acetylation at the promoter of neuronal IEGs are associated with decline in their expression and memory consolidation during scopolamine-induced amnesia. These findings suggest that the epigenetic regulation through altered DNA methylation and histone acetylation might be explored further to develop potential therapeutic interventions for amnesia.

Recovery Based Nanowire Field-Effect Transistor Detection of Pathogenic Avian Influenza DNA

NASA Astrophysics Data System (ADS)

Lin, Chih-Heng; Chu, Chia-Jung; Teng, Kang-Ning; Su, Yi-Jr; Chen, Chii-Dong; Tsai, Li-Chu; Yang, Yuh-Shyong

2012-02-01

Fast and accurate diagnosis is critical in infectious disease surveillance and management. We proposed a DNA recovery system that can easily be adapted to DNA chip or DNA biosensor for fast identification and confirmation of target DNA. This method was based on the re-hybridization of DNA target with a recovery DNA to free the DNA probe. Functionalized silicon nanowire field-effect transistor (SiNW FET) was demonstrated to monitor such specific DNA-DNA interaction using high pathogenic strain virus hemagglutinin 1 (H1) DNA of avian influenza (AI) as target. Specific electric changes were observed in real-time for AI virus DNA sensing and device recovery when nanowire surface of SiNW FET was modified with complementary captured DNA probe. The recovery based SiNW FET biosensor can be further developed for fast identification and further confirmation of a variety of influenza virus strains and other infectious diseases.

Identification of human papillomavirus (HPV) subtype in oral cancer patients through microarray technology.

PubMed

Kim, Soung Min; Kwon, Ik Jae; Myoung, Hoon; Lee, Jong Ho; Lee, Suk Keun

2018-02-01

Human papilloma virus (HPV) is the main source of cervical cancer. Many recent studies have revealed the prevalence and prognosis of HPV associated with oropharyngeal squamous cell carcinoma, but fewer reports have evaluated HPV in oral squamous cell carcinoma (OSCC). The purpose of this study was to determine the prevalence and prognosis of HPV associated with OSCC according to HPV and tumor types. We used a DNA chip kit (MY-HPV chip kit ® , Mygene Co., Korea) to detect high-risk HPV subtypes (16, 18, 31, 33, 35, 39, 45, 51, 52, 54, 56, 58) and low-risk subtypes (6, 11, 34, 40, 42, 43, 44) among 187 patients. The prevalence was determined by Chi-square and Fisher's exact tests, and the prognosis was calculated by the Kaplan-Meier method and the log-rank test. The overall prevalence of HPV in OSCC was 7.0% for all HPV positives and 4.3% for high-risk HPV positives. The prevalence of HPV was significantly higher in individuals under 65 years old and in those with tumors in the tongue and gum regions. The prognosis did not differ between the HPV-positive and -negative groups. Although the prevalence of HPV-positive cases in OSCC was low (7.0, 4.3%) and the prognosis did not depend on HPV positivity, HPV-associated OSCC should be considered in the evaluation and treatment of oral cancer patients. In addition, separating high- and low-risk groups based on the HPV status of other body parts might not be appropriate. The DNA microarray method can accurately detect known HPV subtypes simultaneously, but has limitations in detecting new subtypes. Vaccines can also be used to prevent HPV-associated OSCC in patients, so further studies on the prognosis and efficacy of vaccines should be undertaken.

High-performance genetic analysis on microfabricated capillary array electrophoresis plastic chips fabricated by injection molding.

PubMed

Dang, Fuquan; Tabata, Osamu; Kurokawa, Masaya; Ewis, Ashraf A; Zhang, Lihua; Yamaoka, Yoshihisa; Shinohara, Shouji; Shinohara, Yasuo; Ishikawa, Mitsuru; Baba, Yoshinobu

2005-04-01

We have developed a novel technique for mass production of microfabricated capillary array electrophoresis (mu-CAE) plastic chips for high-speed, high-throughput genetic analysis. The mu-CAE chips, containing 10 individual separation channels of 50-microm width, 50-microm depth, and a 100-microm lane-to-lane spacing at the detection region and a sacrificial channel network, were fabricated on a poly(methyl methacrylate) substrate by injection molding and then bonded manually using a pressure-sensitive sealing tape within several seconds at room temperature. The conditions for injection molding and bonding were carefully characterized to yield mu-CAE chips with well-defined channel and injection structures. A CCD camera equipped with an image intensifier was used to monitor simultaneously the separation in a 10-channel array with laser-induced fluorescence detection. High-performance electrophoretic separations of phiX174 HaeIII DNA restriction fragments and PCR products related to the human beta-globin gene and SP-B gene (the surfactant protein B) have been demonstrated on mu-CAE plastic chips using a methylcellulose sieving matrix in individual channels. The current work demonstrated greatly simplified the fabrication process as well as a detection scheme for mu-CAE chips and will bring the low-cost mass production and application of mu-CAE plastic chips for genetic analysis.

Diagnosis and therapy with CRISPR advanced CRISPR based tools for point of care diagnostics and early therapies.

PubMed

Uppada, Vanita; Gokara, Mahesh; Rasineni, Girish Kumar

2018-05-20

Molecular diagnostics is of critical importance to public health worldwide. It facilitates not only detection and characterization of diseases, but also monitors drug responses, assists in the identification of genetic modifiers and disease susceptibility. Based upon DNA variation, a wide range of molecular-based tests are available to assess/diagnose diseases. The CRISPR-Cas9 system has recently emerged as a versatile tool for biological and medical research. In this system, a single guide RNA (sgRNA) directs the endonuclease Cas9 to a targeted DNA sequence for site-specific manipulation. As designing CRISPR-guided nucleases can be done easily and relatively fast, the CRISPR/Cas9 system has evolved as widely used DNA editing tool. This technique led to a large number of gene editing studies in variety of organisms. CRISPR/Cas9-mediated diagnosis and therapy has picked up pace due to specificity and accuracy of CRISPR. The aim is not only to identify specific pathogens, especially virus but also to repair disease-causing alleles by changing the DNA sequence at the exact location on the chromosome. At present, PCR-based molecular diagnostic testing predominates; however, alternative technologies aimed at reducing genome complexity without PCR are anticipated to gain momentum in the coming years. Furthermore, development of integrated chip devices should allow point-of-care testing and facilitate genetic readouts from single cells and molecules. Together with molecular based therapy CRISPR based diagnostic testing will be a revolution in modern health care settings. In this review, we emphasize on current developing diagnostic techniques based upon CRISPR Cas approach along with short insights on its therapeutic usage. Copyright © 2018 Elsevier B.V. All rights reserved.

Portable low-power thermal cycler with dual thin-film Pt heaters for a polymeric PCR chip.

PubMed

Jeong, Sangdo; Lim, Juhun; Kim, Mi-Young; Yeom, JiHye; Cho, Hyunmin; Lee, Hyunjung; Shin, Yong-Beom; Lee, Jong-Hyun

2018-01-29

Polymerase chain reaction (PCR) has been widely used for major definite diagnostic tool, but very limited its place used only indoor such as hospital or diagnosis lab. For the rapid on-site detection of pathogen in an outdoor environment, a low-power cordless polymerase chain reaction (PCR) thermal cycler is crucial module. At this point of view, we proposed a low-power PCR thermal cycler that could be operated in an outdoor anywhere. The disposable PCR chip was made of a polymeric (PI/PET) film to reduce the thermal mass. A dual arrangement of the Pt heaters, which were positioned on the top and bottom of the PCR chip, improved the temperature uniformity. The temperature sensor, which was made of the same material as the heater, utilized the temperature dependence of the Pt resistor to ensure simple fabrication of the temperature sensor. Cooling the PCR chip using dual blower fans enabled thermal cycling to operate with a lower power than that of a Peltier element with a high power consumption. The PCR components were electrically connected to a control module that could be operated with a Li-ion battery (12 V), and the PCR conditions (temperature, time, cycle, etc.) were inputted on a touch screen. For 30 PCR cycles, the accumulated power consumption of heating and cooling was 7.3 Wh, which is easily available from a compact battery. Escherichia coli genomic DNA (510 bp) was amplified using the proposed PCR thermal cycler and the disposable PCR chip. A similar DNA amplification capability was confirmed using the proposed portable and low-power thermal cycler compared with a conventional thermal cycler.

Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids.

PubMed

Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

2016-01-01

Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.

Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids

PubMed Central

Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

2016-01-01

Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005

Microfluidic "Pouch" Chips for Immunoassays and Nucleic Acid Amplification Tests.

PubMed

Mauk, Michael G; Liu, Changchun; Qiu, Xianbo; Chen, Dafeng; Song, Jinzhao; Bau, Haim H

2017-01-01

Microfluidic cassettes ("chips") for processing and analysis of clinical specimens and other sample types facilitate point-of-care (POC) immunoassays and nucleic acid based amplification tests. These single-use test chips can be self-contained and made amenable to autonomous operation-reducing or eliminating supporting instrumentation-by incorporating laminated, pliable "pouch" and membrane structures for fluid storage, pumping, mixing, and flow control. Materials and methods for integrating flexible pouch compartments and diaphragm valves into hard plastic (e.g., acrylic and polycarbonate) microfluidic "chips" for reagent storage, fluid actuation, and flow control are described. We review several versions of these pouch chips for immunoassay and nucleic acid amplification tests, and describe related fabrication techniques. These protocols thus offer a "toolbox" of methods for storage, pumping, and flow control functions in microfluidic devices.

Programmable synaptic chip for electronic neural networks

NASA Technical Reports Server (NTRS)

Moopenn, A.; Langenbacher, H.; Thakoor, A. P.; Khanna, S. K.

1988-01-01

A binary synaptic matrix chip has been developed for electronic neural networks. The matrix chip contains a programmable 32X32 array of 'long channel' NMOSFET binary connection elements implemented in a 3-micron bulk CMOS process. Since the neurons are kept off-chip, the synaptic chip serves as a 'cascadable' building block for a multi-chip synaptic network as large as 512X512 in size. As an alternative to the programmable NMOSFET (long channel) connection elements, tailored thin film resistors are deposited, in series with FET switches, on some CMOS test chips, to obtain the weak synaptic connections. Although deposition and patterning of the resistors require additional processing steps, they promise substantial savings in silicon area. The performance of synaptic chip in a 32-neuron breadboard system in an associative memory test application is discussed.

Free-solution electrophoretic separations of DNA–drag-tag conjugates on glass microchips with no polymer network and no loss of resolution at increased electric field strength

PubMed Central

Albrecht, Jennifer Coyne; Kerby, Matthew B.; Niedringhaus, Thomas P.; Lin, Jennifer S.; Wang, Xiaoxiao; Barron, Annelise E.

2012-01-01

Here, we demonstrate the potential for high-resolution electrophoretic separations of ssDNA-protein conjugates in borosilicate glass microfluidic chips, with no sieving media and excellent repeatability. Using polynucleotides of two different lengths conjugated to moderately cationic protein polymer drag-tags, we measured separation efficiency as a function of applied electric field. In excellent agreement with prior theoretical predictions of Slater et al., resolution is found to remain constant as applied field is increased up to 700 V/cm, the highest field we were able to apply. This remarkable result illustrates the fundamentally different physical limitations of Free-Solution Conjugate Electrophoresis (FSCE)-based DNA separations relative to matrix-based DNA electrophoresis. Single-stranded DNA separations in “gels” have always shown rapidly declining resolution as the field strength is increased; this is especially true for ssDNA > 400 bases in length. FSCE’s ability to decouple DNA peak resolution from applied electric field suggests the future possibility of ultra-rapid FSCE sequencing on chips. We investigated sources of peak broadening for FSCE separations on borosilicate glass microchips, using six different protein polymer drag-tags. For drag-tags with four or more positive charges, electrostatic and adsorptive interactions with pHEA-coated microchannel walls led to appreciable band-broadening, while much sharper peaks were seen for bioconjugates with nearly charge-neutral protein drag-tags. PMID:21500207

CHIP involves in non-small cell lung cancer prognosis through VEGF pathway.

PubMed

Tingting, Qian; Jiao, Wang; Qingfeng, Wang; Yancheng, Liu; Shijun, Y U; Zhaoqi, Wang; Dongmei, Sun; ShiLong, Wang

2016-10-01

CHIP (c-terminal Hsp70-interacting protein) is an E3 ligase playing vital roles in various cancers. The VEGF pathway has become an important therapeutic target in non-small cell lung cancer (NSCLC). However, little is known about the role of CHIP and the relationship between CHIP and VEGF-VEGFR2 (VEGF receptor 2) pathway in NSCLC. In this study we aimed to investigate the clinical function of CHIP in NSCLC and explore the relevant regulatory mechanism. QRT-PCR was performed to detect CHIP expression in NSCLC tissues. The association of CHIP expression and clinical parameters was analyzed using the Chi-square test. Kaplan- Meier and Cox analyses were performed to identify the role of CHIP in the prognosis of NSCLC patients. ELISA test was used to detect the VEGF secretion of NSCLC cells and western blot were used to detected the protein expression of VEGFR2 in NSCLC cells. and the results revealed that CHIP expression was decreased in NSCLC tissues and significantly correlated with clinical stages, lymph node metastasis and distant metastasis (P<0.05). Moreover, Kaplan-Meier and Cox regression analyses showed that patients with negative expression of CHIP had a shorter survival time and CHIP could be an independent prognostic biomarker. In addition, ELISA tests showed that CHIP negatively regulated the secretion level of VEGF. Furthermore, western blot assay indicated that the VEGFR2 protein level was reduced after CHIP over-expression. Taken together, our findings demonstrate for the first time that CHIP may serve as a promising prognostic biomarker for NSCLC patients and it may be involved in NSCLC angiogenesis through regulating VEGF secretion and expression of VEGFR2. Copyright © 2016. Published by Elsevier Masson SAS.

MethLAB: a graphical user interface package for the analysis of array-based DNA methylation data.

PubMed

Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K; Conneely, Karen N

2012-03-01

Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data.

DNA methylation alterations in response to pesticide exposure in vitro

PubMed Central

Zhang, Xiao; Wallace, Andrew D.; Du, Pan; Kibbe, Warren A.; Jafari, Nadereh; Xie, Hehuang; Lin, Simon; Baccarelli, Andrea; Soares, Marcelo Bento; Hou, Lifang

2013-01-01

Although pesticides are subject to extensive carcinogenicity testing before regulatory approval, pesticide exposure has repeatedly been associated with various cancers. This suggests that pesticides may cause cancer via non-mutagenicity mechanisms. The present study provides evidence to support the hypothesis that pesticide-induced cancer may be mediated in part by epigenetic mechanisms. We examined whether exposure to 7 commonly used pesticides (i.e., fonofos, parathion, terbufos, chlorpyrifos, diazinon, malathion, and phorate) induces DNA methylation alterations in vitro. We conducted genome-wide DNA methylation analyses on DNA samples obtained from the human hematopoietic K562 cell line exposed to ethanol (control) and several OPs using the Illumina Infinium HumanMethylation27 BeadChip. Bayesian-adjusted t-tests were used to identify differentially methylated gene promoter CpG sites. In this report, we present our results on three pesticides (fonofos, parathion, and terbufos) that clustered together based on principle component analysis and hierarchical clustering. These three pesticides induced similar methylation changes in the promoter regions of 712 genes, while also exhibiting their own OP-specific methylation alterations. Functional analysis of methylation changes specific to each OP, or common to all three OPs, revealed that differential methylation was associated with numerous genes that are involved in carcinogenesis-related processes. Our results provide experimental evidence that pesticides may modify gene promoter DNA methylation levels, suggesting that epigenetic mechanisms may contribute to pesticide-induced carcinogenesis. Further studies in other cell types and human samples are required, as well as determining the impact of these methylation changes on gene expression. PMID:22847954

MethLAB

PubMed Central

Kilaru, Varun; Barfield, Richard T; Schroeder, James W; Smith, Alicia K

2012-01-01

Recent evidence suggests that DNA methylation changes may underlie numerous complex traits and diseases. The advent of commercial, array-based methods to interrogate DNA methylation has led to a profusion of epigenetic studies in the literature. Array-based methods, such as the popular Illumina GoldenGate and Infinium platforms, estimate the proportion of DNA methylated at single-base resolution for thousands of CpG sites across the genome. These arrays generate enormous amounts of data, but few software resources exist for efficient and flexible analysis of these data. We developed a software package called MethLAB (http://genetics.emory.edu/conneely/MethLAB) using R, an open source statistical language that can be edited to suit the needs of the user. MethLAB features a graphical user interface (GUI) with a menu-driven format designed to efficiently read in and manipulate array-based methylation data in a user-friendly manner. MethLAB tests for association between methylation and relevant phenotypes by fitting a separate linear model for each CpG site. These models can incorporate both continuous and categorical phenotypes and covariates, as well as fixed or random batch or chip effects. MethLAB accounts for multiple testing by controlling the false discovery rate (FDR) at a user-specified level. Standard output includes a spreadsheet-ready text file and an array of publication-quality figures. Considering the growing interest in and availability of DNA methylation data, there is a great need for user-friendly open source analytical tools. With MethLAB, we present a timely resource that will allow users with no programming experience to implement flexible and powerful analyses of DNA methylation data. PMID:22430798

Multi-platform metabolomics and a genetic approach support the authentication of agarwood produced by Aquilaria crassna and Aquilaria malaccensis.

PubMed

Nguyen, Huy Truong; Min, Jung-Eun; Long, Nguyen Phuoc; Thanh, Ma Chi; Le, Thi Hong Van; Lee, Jeongmi; Park, Jeong Hill; Kwon, Sung Won

2017-08-05

Agarwood, the resinous heartwood produced by some Aquilaria species such as Aquilaria crassna, Aquilaria malaccensis and Aquilaria sinensis, has been traditionally and widely used in medicine, incenses and especially perfumes. However, up to now, the authentication of agarwood has been largely based on morphological characteristics, a method which is prone to errors and lacks reproducibility. Hence, in this study, we applied metabolomics and a genetic approach to the authentication of two common agarwood chips, those produced by Aquilaria crassna and Aquilaria malaccensis. Primary metabolites, secondary metabolites and DNA markers of agarwood were authenticated by 1 H NMR metabolomics, GC-MS metabolomics and DNA-based techniques, respectively. The results indicated that agarwood chips could be classified accurately by all the methods illustrated in this study. Additionally, the pros and cons of each method are also discussed. To the best of our knowledge, our research is the first study detailing all the differences in the primary and secondary metabolites, as well as the DNA markers between the agarwood produced by these two species. Copyright © 2017 Elsevier B.V. All rights reserved.

A Predictive Approach to Network Reverse-Engineering

NASA Astrophysics Data System (ADS)

Wiggins, Chris

2005-03-01

A central challenge of systems biology is the ``reverse engineering" of transcriptional networks: inferring which genes exert regulatory control over which other genes. Attempting such inference at the genomic scale has only recently become feasible, via data-intensive biological innovations such as DNA microrrays (``DNA chips") and the sequencing of whole genomes. In this talk we present a predictive approach to network reverse-engineering, in which we integrate DNA chip data and sequence data to build a model of the transcriptional network of the yeast S. cerevisiae capable of predicting the response of genes in unseen experiments. The technique can also be used to extract ``motifs,'' sequence elements which act as binding sites for regulatory proteins. We validate by a number of approaches and present comparison of theoretical prediction vs. experimental data, along with biological interpretations of the resulting model. En route, we will illustrate some basic notions in statistical learning theory (fitting vs. over-fitting; cross- validation; assessing statistical significance), highlighting ways in which physicists can make a unique contribution in data- driven approaches to reverse engineering.

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

PhyloChip Tackles Coral Disease

ScienceCinema

Todd DeSantis

2017-12-09

Scientists at Berkeley Lab and the University of California, Merced are using an innovative DNA array developed at Berkeley Lab to catalog the microbes that live among coral in the tropical waters off the coast of Puerto Rico.

Thermoresponsive N-alkoxyalkylacrylamide polymers as a sieving matrix for high-resolution DNA separations on a microfluidic chip

PubMed Central

Root, Brian E.; Hammock, Mallory L.; Barron, Annelise E.

2012-01-01

In recent years, there has been an increasing demand for a wide range of DNA separations that require the development of materials to meet the needs of high resolution and high throughput. Here, we demonstrate the use of thermoresponsive N-alkoxyalkylacrylamide polymers as a sieving matrix for DNA separations on a microfluidic chip. The viscosities of the N-alkoxyalkylacrylamide polymers are more than an order of magnitude lower than that of a linear polyacrylamide of corresponding molecular weight, allowing rapid loading of the microchip. At 25 °C, N-alkoxyalkylacrylamide polymers can provide improved DNA separations compared to LPA in terms of reduced separation time and increased separation efficiency, particularly for the larger DNA fragments. The improved separation efficiency in N-alkoxyalkylacrylamide polymers is attributed to the peak widths increasing only slightly with DNA fragment size, while the peak widths increase appreciably above 150 bp using an LPA matrix. Upon elevating the temperature to 50 °C, the increase in viscosity of the N-alkoxyalkylacrylamide solutions is dependent upon their overall degree of hydrophobicity. The most hydrophobic polymers exhibit an LCST below 50 °C, undergoing a coil-to-globule transition followed by chain aggregation. DNA separation efficiency at 50 °C therefore decreases significantly with increasing hydrophobic character of the polymers, and no separations were possible with solutions with an LCST below 50 °C. The work reported here demonstrates the potential for this class of polymer to be used for applications such as PCR product and RFLP sizing, and provides insight into the effect of polymer hydrophobicity on DNA separations. PMID:19053065

Nucleic acid extraction techniques and application to the microchip.

PubMed

Price, Carol W; Leslie, Daniel C; Landers, James P

2009-09-07

As recently as the early 1990s, DNA purification was time-consuming, requiring the use of toxic, hazardous reagents. The advent of solid phase extraction techniques and the availability of commercial kits for quick and reliable DNA extraction has relegated those early techniques largely to the history books. High quality DNA can now be extracted from whole blood, serum, saliva, urine, stool, cerebral spinal fluid, tissues, and cells in less time without sacrificing recovery. Having achieved such a radical change in the methodology of DNA extraction, focus has shifted to adapting these methods to a miniaturized system, or "lab-on-a-chip" (A. Manz, N. Graber and H. M. Widmer, Sens. Actuators, B, 1990, 1, 244-248). Manz et al.'s concept of a "miniaturized total chemical analysis system" (microTAS) involved a silicon chip that incorporated sample pretreatment, separation and detection. This review will focus on the first of these steps, sample pretreatment in the form of DNA purification. The intention of this review is to provide an overview of the fundamentals of nucleic acid purification and solid phase extraction (SPE) and to discuss specific microchip DNA extraction successes and challenges. In order to fully appreciate the advances in DNA purification, a brief review of the history of DNA extraction is provided so that the reader has an understanding of the impact that the development of SPE techniques have had. This review will highlight the different methods of nucleic acid extraction (Table 1), including relevant citations, but without an exhaustive summary of the literature. A recent review by Wen et al. (J. Wen, L. A. Legendre, J. M. Bienvenue and J. P. Landers, Anal. Chem., 2008, 80, 6472-6479) covers solid phase extraction methods with a greater focus on their incorporation into integrated microfluidic systems.

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Integration of solid-state nanopores in a 0.5 μm CMOS foundry process.

PubMed

Uddin, A; Yemenicioglu, S; Chen, C-H; Corigliano, E; Milaninia, K; Theogarajan, L

2013-04-19

High-bandwidth and low-noise nanopore sensor and detection electronics are crucial in achieving single-DNA-base resolution. A potential way to accomplish this goal is to integrate solid-state nanopores within a CMOS platform, in close proximity to the biasing electrodes and custom-designed amplifier electronics. Here we report the integration of solid-state nanopore devices in a commercial complementary metal-oxide-semiconductor (CMOS) potentiostat chip implemented in On-Semiconductor's 0.5 μm technology. Nanopore membranes incorporating electrodes are fabricated by post-CMOS micromachining utilizing the n+ polysilicon/SiO2/n+ polysilicon capacitor structure available in the aforementioned process. Nanopores are created in the CMOS process by drilling in a transmission electron microscope and shrinking by atomic layer deposition. We also describe a batch fabrication method to process a large of number of electrode-embedded nanopores with sub-10 nm diameter across CMOS-compatible wafers by electron beam lithography and atomic layer deposition. The CMOS-compatibility of our fabrication process is verified by testing the electrical functionality of on-chip circuitry. We observe high current leakage with the CMOS nanopore devices due to the ionic diffusion through the SiO2 membrane. To prevent this leakage, we coat the membrane with Al2O3, which acts as an efficient diffusion barrier against alkali ions. The resulting nanopore devices also exhibit higher robustness and lower 1/f noise as compared to SiO2 and SiNx. Furthermore, we propose a theoretical model for our low-capacitance CMOS nanopore devices, showing good agreement with the experimental value. In addition, experiments and theoretical models of translocation studies are presented using 48.5 kbp λ-DNA in order to prove the functionality of on-chip pores coated with Al2O3.

Natural diversity of potato (Solanum tuberosum) invertases

PubMed Central

2010-01-01

Background Invertases are ubiquitous enzymes that irreversibly cleave sucrose into fructose and glucose. Plant invertases play important roles in carbohydrate metabolism, plant development, and biotic and abiotic stress responses. In potato (Solanum tuberosum), invertases are involved in 'cold-induced sweetening' of tubers, an adaptive response to cold stress, which negatively affects the quality of potato chips and French fries. Linkage and association studies have identified quantitative trait loci (QTL) for tuber sugar content and chip quality that colocalize with three independent potato invertase loci, which together encode five invertase genes. The role of natural allelic variation of these genes in controlling the variation of tuber sugar content in different genotypes is unknown. Results For functional studies on natural variants of five potato invertase genes we cloned and sequenced 193 full-length cDNAs from six heterozygous individuals (three tetraploid and three diploid). Eleven, thirteen, ten, twelve and nine different cDNA alleles were obtained for the genes Pain-1, InvGE, InvGF, InvCD141 and InvCD111, respectively. Allelic cDNA sequences differed from each other by 4 to 9%, and most were genotype specific. Additional variation was identified by single nucleotide polymorphism (SNP) analysis in an association-mapping population of 219 tetraploid individuals. Haplotype modeling revealed two to three major haplotypes besides a larger number of minor frequency haplotypes. cDNA alleles associated with chip quality, tuber starch content and starch yield were identified. Conclusions Very high natural allelic variation was uncovered in a set of five potato invertase genes. This variability is a consequence of the cultivated potato's reproductive biology. Some of the structural variation found might underlie functional variation that influences important agronomic traits such as tuber sugar content. The associations found between specific invertase alleles and chip quality, tuber starch content and starch yield will facilitate the selection of superior potato genotypes in breeding programs. PMID:21143910

Integration of Genome-Wide Computation DRE Search, AhR ChIP-chip and Gene Expression Analyses of TCDD-Elicited Responses in the Mouse Liver

PubMed Central

2011-01-01

Background The aryl hydrocarbon receptor (AhR) is a ligand-activated transcription factor (TF) that mediates responses to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Integration of TCDD-induced genome-wide AhR enrichment, differential gene expression and computational dioxin response element (DRE) analyses further elucidate the hepatic AhR regulatory network. Results Global ChIP-chip and gene expression analyses were performed on hepatic tissue from immature ovariectomized mice orally gavaged with 30 μg/kg TCDD. ChIP-chip analysis identified 14,446 and 974 AhR enriched regions (1% false discovery rate) at 2 and 24 hrs, respectively. Enrichment density was greatest in the proximal promoter, and more specifically, within ± 1.5 kb of a transcriptional start site (TSS). AhR enrichment also occurred distal to a TSS (e.g. intergenic DNA and 3' UTR), extending the potential gene expression regulatory roles of the AhR. Although TF binding site analyses identified over-represented DRE sequences within enriched regions, approximately 50% of all AhR enriched regions lacked a DRE core (5'-GCGTG-3'). Microarray analysis identified 1,896 number of TCDD-responsive genes (|fold change| ≥ 1.5, P1(t) > 0.999). Integrating this gene expression data with our ChIP-chip and DRE analyses only identified 625 differentially expressed genes that involved an AhR interaction at a DRE. Functional annotation analysis of differentially regulated genes associated with AhR enrichment identified overrepresented processes related to fatty acid and lipid metabolism and transport, and xenobiotic metabolism, which are consistent with TCDD-elicited steatosis in the mouse liver. Conclusions Details of the AhR regulatory network have been expanded to include AhR-DNA interactions within intragenic and intergenic genomic regions. Moreover, the AhR can interact with DNA independent of a DRE core suggesting there are alternative mechanisms of AhR-mediated gene regulation. PMID:21762485

Loss of the Nuclear Pool of Ubiquitin Ligase CHIP/STUB1 in Breast Cancer Unleashes the MZF1-Cathepsin Pro-oncogenic Program.

PubMed

Luan, Haitao; Mohapatra, Bhopal; Bielecki, Timothy A; Mushtaq, Insha; Mirza, Sameer; Jennings, Tameka A; Clubb, Robert J; An, Wei; Ahmed, Dena; El-Ansari, Rokaya; Storck, Matthew D; Mishra, Nitish K; Guda, Chittibabu; Sheinin, Yuri M; Meza, Jane L; Raja, Srikumar; Rakha, Emad A; Band, Vimla; Band, Hamid

2018-05-15

CHIP/STUB1 ubiquitin ligase is a negative co-chaperone for HSP90/HSC70, and its expression is reduced or lost in several cancers, including breast cancer. Using an extensive and well-annotated breast cancer tissue collection, we identified the loss of nuclear but not cytoplasmic CHIP to predict more aggressive tumorigenesis and shorter patient survival, with loss of CHIP in two thirds of ErbB2 + and triple-negative breast cancers (TNBC) and in one third of ER + breast cancers. Reduced CHIP expression was seen in breast cancer patient-derived xenograft tumors and in ErbB2 + and TNBC cell lines. Ectopic CHIP expression in ErbB2 + lines suppressed in vitro oncogenic traits and in vivo xenograft tumor growth. An unbiased screen for CHIP-regulated nuclear transcription factors identified many candidates whose DNA-binding activity was up- or downregulated by CHIP. We characterized myeloid zinc finger 1 (MZF1) as a CHIP target, given its recently identified role as a positive regulator of cathepsin B/L (CTSB/L)-mediated tumor cell invasion downstream of ErbB2. We show that CHIP negatively regulates CTSB/L expression in ErbB2 + and other breast cancer cell lines. CTSB inhibition abrogates invasion and matrix degradation in vitro and halts ErbB2 + breast cancer cell line xenograft growth. We conclude that loss of CHIP remodels the cellular transcriptome to unleash critical pro-oncogenic pathways, such as the matrix-degrading enzymes of the cathepsin family, whose components can provide new therapeutic opportunities in breast and other cancers with loss of CHIP expression. Significance: These findings reveal a novel targetable pathway of breast oncogenesis unleashed by the loss of tumor suppressor ubiquitin ligase CHIP/STUB1. Cancer Res; 78(10); 2524-35. ©2018 AACR . ©2018 American Association for Cancer Research.

Rapid and Low-Cost CRP Measurement by Integrating a Paper-Based Microfluidic Immunoassay with Smartphone (CRP-Chip)

PubMed Central

Dong, Meili; Wu, Jiandong; Ma, Zimin; Peretz-Soroka, Hagit; Zhang, Michael; Komenda, Paul; Tangri, Navdeep; Liu, Yong; Rigatto, Claudio; Lin, Francis

2017-01-01

Traditional diagnostic tests for chronic diseases are expensive and require a specialized laboratory, therefore limiting their use for point-of-care (PoC) testing. To address this gap, we developed a method for rapid and low-cost C-reactive protein (CRP) detection from blood by integrating a paper-based microfluidic immunoassay with a smartphone (CRP-Chip). We chose CRP for this initial development because it is a strong biomarker of prognosis in chronic heart and kidney disease. The microfluidic immunoassay is realized by lateral flow and gold nanoparticle-based colorimetric detection of the target protein. The test image signal is acquired and analyzed using a commercial smartphone with an attached microlens and a 3D-printed chip–phone interface. The CRP-Chip was validated for detecting CRP in blood samples from chronic kidney disease patients and healthy subjects. The linear detection range of the CRP-Chip is up to 2 μg/mL and the detection limit is 54 ng/mL. The CRP-Chip test result yields high reproducibility and is consistent with the standard ELISA kit. A single CRP-Chip can perform the test in triplicate on a single chip within 15 min for less than 50 US cents of material cost. This CRP-Chip with attractive features of low-cost, fast test speed, and integrated easy operation with smartphones has the potential to enable future clinical PoC chronic disease diagnosis and risk stratification by parallel measurements of a panel of protein biomarkers. PMID:28346363

Detection of DNA hybridization by ABEI electrochemiluminescence in DNA-chip compatible assembly.

PubMed

Calvo-Muñoz, M-L; Dupont-Filliard, A; Billon, M; Guillerez, S; Bidan, G; Marquette, C; Blum, L

2005-04-01

The electrochemiluminescence (ECL) of a luminol derivate (ABEI) generated both by a carbon electrode and a polypyrrole-coated carbon electrode was examined. It was found that the polypyrrole film (ppy) did not inhibit the ECL. After that, ABEI anchored on a single stranded DNA target (ODNt) has been used for the ECL detection of the hybridization between a complementary single stranded DNA probe (ODNp) covalently linked to a polypyrrole support and the ODNt. The ECL detection has been performed using a DNA sensor having a low surface concentration of ODNp probes, constituted of a polypyrrole copolymer electrosynthesized from a pyrrole-ODNp/pyrrole monomer ratio of 1/20,000.

A self-testing dynamic RAM chip

NASA Astrophysics Data System (ADS)

You, Y.; Hayes, J. P.

1985-02-01

A novel approach to making very large dynamic RAM chips self-testing is presented. It is based on two main concepts: on-chip generation of regular test sequences with very high fault coverage, and concurrent testing of storage-cell arrays to reduce overall testing time. The failure modes of a typical 64 K RAM employing one-transistor cells are analyzed to identify their test requirements. A comprehensive test generation algorithm that can be implemented with minimal modification to a standard cell layout is derived. The self-checking peripheral circuits necessary to implement this testing algorithm are described, and the self-testing RAM is briefly evaluated.

Parallel confocal detection of single biomolecules using diffractive optics and integrated detector units.

PubMed

Blom, H; Gösch, M

2004-04-01

The past few years we have witnessed a tremendous surge of interest in so-called array-based miniaturised analytical systems due to their value as extremely powerful tools for high-throughput sequence analysis, drug discovery and development, and diagnostic tests in medicine (see articles in Issue 1). Terminologies that have been used to describe these array-based bioscience systems include (but are not limited to): DNA-chip, microarrays, microchip, biochip, DNA-microarrays and genome chip. Potential technological benefits of introducing these miniaturised analytical systems include improved accuracy, multiplexing, lower sample and reagent consumption, disposability, and decreased analysis times, just to mention a few examples. Among the many alternative principles of detection-analysis (e.g.chemiluminescence, electroluminescence and conductivity), fluorescence-based techniques are widely used, examples being fluorescence resonance energy transfer, fluorescence quenching, fluorescence polarisation, time-resolved fluorescence, and fluorescence fluctuation spectroscopy (see articles in Issue 11). Time-dependent fluctuations of fluorescent biomolecules with different molecular properties, like molecular weight, translational and rotational diffusion time, colour and lifetime, potentially provide all the kinetic and thermodynamic information required in analysing complex interactions. In this mini-review article, we present recent extensions aimed to implement parallel laser excitation and parallel fluorescence detection that can lead to even further increase in throughput in miniaturised array-based analytical systems. We also report on developments and characterisations of multiplexing extension that allow multifocal laser excitation together with matched parallel fluorescence detection for parallel confocal dynamical fluorescence fluctuation studies at the single biomolecule level.

Integrated air stream micromixer for performing bioanalytical assays on a plastic chip.

PubMed

Geissler, Matthias; Li, Kebin; Zhang, Xuefeng; Clime, Liviu; Robideau, Gregg P; Bilodeau, Guillaume J; Veres, Teodor

2014-10-07

This paper describes the design, functioning and use of an integrated mixer that relies on air flux to agitate microliter entities of fluid in an embedded microfluidic cavity. The system was fabricated from multiple layers of a thermoplastic elastomer and features circuits for both liquid and air supply along with pneumatic valves for process control. Internally-dyed polymer particles have been used to visualize flow within the fluid phase during agitation. Numerical modelling of the micromixer revealed an overall efficacy of 10(-1) to 10(-2) for momentum transfer at the air-water interface. Simulation of air vortex dynamics showed dependency of the flow pattern on the velocity of the flux entering the cavity. Three bioanalytical assays have been performed as proof-of-concept demonstrations. In a first assay, cells of Listeria monocytogenes were combined with magnetic nanoparticles (NPs), resulting in high-density coverage of the bacteria's surface with NPs after 1 min of agitation. This finding is contrasted by a control experiment without agitation for which interaction between bacteria and NPs remains low. In a second one, capture and release of genomic DNA from fungi through adsorption onto magnetic beads was tested and shown to be improved by agitation compared to non-agitated controls. A third assay finally involved fluorescently-labelled target oligonucleotide strands and polystyrene particles modified with DNA capture probes to perform detection of nucleic acids on beads. Excellent selectivity was obtained in a competitive hybridization process using a multiplexed micromixer chip design.

Drosophila CHIP protects against mitochondrial dysfunction by acting downstream of Pink1 in parallel with Parkin.

PubMed

Chen, Jia; Xue, Jin; Ruan, Jingsong; Zhao, Juan; Tang, Beisha; Duan, Ranhui

2017-12-01

Mitochondrial kinase PTEN-induced putative kinase 1 (PINK1) and E3 ubiquitin ligase Parkin function in a common pathway to regulate mitochondrial homeostasis contributing to the pathogenesis of Parkinson disease. The carboxyl terminus of Hsc70-interacting protein (CHIP) acts as a heat shock protein 70/heat shock protein 90 cochaperone to mediate protein folding or as an E3 ubiquitin ligase to target proteins for degradation. In this study, overexpression of Drosophila CHIP suppressed a range of Pink1 mutant phenotypes in flies, including abnormal wing posture, thoracic indentation, locomotion defects, muscle degeneration, and loss of dopaminergic neurons. Mitochondrial defects of Pink1 mutant, such as excessive fusion, reduced ATP content, and crista disorganization, were rescued by CHIP but not its ligase-dead mutants. Similar phenotypes and mitochondrial impairment were ameliorated in Parkin mutant flies by wild-type CHIP. Inactivation of CHIP with null fly mutants resulted in mitochondrial defects, such as reduced thoracic ATP content at 3 d old, decreased thoracic mitochondrial DNA content, and defective mitochondrial morphology at 60 d old. CHIP mutants did not exacerbate the phenotypes of Pink1 mutant flies but markedly shortened the life span of Parkin mutant flies. These results indicate that CHIP is involved in mitochondrial integrity and may act downstream of Pink1 in parallel with Parkin.-Chen, J., Xue, J., Ruan, J., Zhao, J., Tang, B., Duan, R. Drosophila CHIP protects against mitochondrial dysfunction by acting downstream of Pink1 in parallel with Parkin. © FASEB.

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle.

PubMed

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3'-UTR GeneChips), genome-wide protein-DNA binding assays and protein-protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/

GermOnline 4.0 is a genomics gateway for germline development, meiosis and the mitotic cell cycle

PubMed Central

Lardenois, Aurélie; Gattiker, Alexandre; Collin, Olivier; Chalmel, Frédéric; Primig, Michael

2010-01-01

GermOnline 4.0 is a cross-species database portal focusing on high-throughput expression data relevant for germline development, the meiotic cell cycle and mitosis in healthy versus malignant cells. It is thus a source of information for life scientists as well as clinicians who are interested in gene expression and regulatory networks. The GermOnline gateway provides unlimited access to information produced with high-density oligonucleotide microarrays (3′-UTR GeneChips), genome-wide protein–DNA binding assays and protein–protein interaction studies in the context of Ensembl genome annotation. Samples used to produce high-throughput expression data and to carry out genome-wide in vivo DNA binding assays are annotated via the MIAME-compliant Multiomics Information Management and Annotation System (MIMAS 3.0). Furthermore, the Saccharomyces Genomics Viewer (SGV) was developed and integrated into the gateway. SGV is a visualization tool that outputs genome annotation and DNA-strand specific expression data produced with high-density oligonucleotide tiling microarrays (Sc_tlg GeneChips) which cover the complete budding yeast genome on both DNA strands. It facilitates the interpretation of expression levels and transcript structures determined for various cell types cultured under different growth and differentiation conditions. Database URL: www.germonline.org/ PMID:21149299

Assay for Listeria monocytogenes cells in whole blood using isotachophoresis and recombinase polymerase amplification.

PubMed

Eid, Charbel; Santiago, Juan G

2016-12-19

We present a new approach which enables lysis, extraction, and detection of inactivated Listeria monocytogenes cells from blood using isotachophoresis (ITP) and recombinase polymerase amplification (RPA). We use an ITP-compatible alkaline and proteinase K approach for rapid and effective lysis. We then perform ITP purification to separate bacterial DNA from whole blood contaminants using a microfluidic device that processes 25 μL sample volume. Lysis, mixing, dispensing, and on-chip ITP purification are completed in a total of less than 50 min. We transfer extracted DNA directly into RPA master mix for isothermal incubation and detection, an additional 25 min. We first validate our assay in the detection of purified genomic DNA spiked into whole blood, and demonstrate a limit of detection of 16.7 fg μL -1 genomic DNA, the equivalent of 5 × 10 3 cells per mL. We then show detection of chemically-inactivated L. monocytogenes cells spiked into whole blood, and demonstrate a limit of detection of 2 × 10 4 cells per mL. Lastly, we show preliminary experimental data demonstrating the feasibility of the integration of ITP purification with RPA detection on a microfluidic chip. Our results suggest that ITP purification is compatible with RPA detection, and has potential to extend the applicability of RPA to whole blood.

Rapid genotyping of common MeCP2 mutations with an electronic DNA microchip using serial differential hybridization.

PubMed

Thistlethwaite, William A; Moses, Linda M; Hoffbuhr, Kristen C; Devaney, Joseph M; Hoffman, Eric P

2003-05-01

Rett syndrome is a neurodevelopmental disorder that affects females almost exclusively, and in which eight common point mutations on the X-linked MeCP2 gene are knows to cause over 70% of mutation-positive cases. We explored the use of a novel platform to detect the eight common mutations in Rett syndrome patients to expedite and simplify the process of identification of known genotypes. The Nanogen workstation consists of a two-color assay based on electric hybridization and thermal discrimination, all performed on an electronically active NanoChip. This genotyping platform was tested on 362 samples of a pre-determined genotype, which had been previously identified by a combination of DHPLC (denaturing high performance liquid chromatography) and direct sequencing. This genotyping technique proved to be rapid, facile, and displayed a specificity of 100% with 3% ambiguity. In addition, we present consecutive testing of seven mutations on a single pad of the NanoChip. This was accomplished by tagging down two amplimers together and serially hybridizing for seven different loci, allowing us to genotype samples for seven of the eight common Rett mutations on a single pad. This novel method displayed the same level of specificity and accuracy as the single amplimer reactions, and proved to be faster and more economical.

Description of the EuroTARGET cohort: A European collaborative project on TArgeted therapy in renal cell cancer-GEnetic- and tumor-related biomarkers for response and toxicity.

PubMed

van der Zanden, Loes F M; Vermeulen, Sita H; Oskarsdottir, Arna; Maurits, Jake S F; Diekstra, Meta H M; Ambert, Valentin; Cambon-Thomsen, Anne; Castellano, Daniel; Fritsch, Achim; Garcia Donas, Jesus; Guarch Troyas, Rosa; Guchelaar, Henk-Jan; Hartmann, Arndt; Hulsbergen-van de Kaa, Christina; Jaehde, Ulrich; Junker, Kerstin; Martinez-Cardus, Anna; Masson, Gisli; Oosterwijk-Wakka, Jeannette; Radu, Marius T; Rafnar, Thorunn; Rodriguez-Antona, Cristina; Roessler, Max; Ruijtenbeek, Rob; Stefansson, Kari; Warren, Anne; Wessels, Lodewyk; Eisen, Tim; Kiemeney, Lambertus A L M; Oosterwijk, Egbert

2017-08-01

For patients with metastatic renal cell cancer (mRCC), treatment choice is mainly based on clinical parameters. With many treatments available and the limited response to treatment and associated toxicities, there is much interest in identifying better biomarkers for personalized treatment. EuroTARGET aims to identify and characterize host- and tumor-related biomarkers for prediction of response to tyrosine kinase inhibitor therapy in mRCC. Here, we describe the EuroTARGET mRCC patient cohort. EuroTARGET is a European collaborative project designed as an observational study for which patients with mRCC were recruited prospectively in 62 centers. In addition, 462 patients with mRCC from previous studies were included. Detailed clinical information (baseline and follow-up) from all patients was entered in web-based case record forms. Blood was collected for germline DNA and pharmacokinetic/pharmacodynamic analyses and, where available, fresh-frozen tumor material was collected to perform tumor DNA, RNA, kinome, and methylome analyses. In total, 1,210 patients with mRCC were included. Of these, 920 received a tyrosine kinase inhibitor as first-line targeted treatment (sunitinib [N = 713, 78%], sorafenib [N = 41, 4%], or pazopanib [N = 166, 18%]) and had at least 6 months of outcome assessment (median follow-up 15.3 months [interquartile range: 8.5-30.2 months]). Germline DNA samples were available from 824 of these patients, fresh-frozen tumor material from 142 patients, fresh-frozen normal kidney tissue from 95 patients, and tissue microarrays created from formalin-fixed paraffin-embedded tumor material from 247 patients. Of the 920 patients, germline DNA variant chip data were successfully generated for 811 patients (Illumina HumanOmniExpress BeadChip). For 80 patients, next-generation exome sequencing of germline and tumor DNA was performed, tumor RNA sequencing was performed for 124 patients, kinome activity measured and processed for 121 patients (PamChip), and methylome data (Illumina Infinium HumanMethylation450 BeadChip) were created for 116 RCC tissues (and 23 normal kidney tissues). For 73 out of the 920 patients, all platform data types were generated. In addition, 40 patients were included in a pharmacokinetic/pharmacodynamic phase IV substudy. Analysis of EuroTARGET cohort data will contribute to personalization of therapy for patients with mRCC. The extensive clinical data and multiplatform EuroTARGET data will be freely available. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Lab-on-chip components for molecular detection

NASA Astrophysics Data System (ADS)

Adam, Tijjani; Dhahi, Th S.; Mohammed, Mohammed; Hashim, U.; Noriman, N. Z.; Dahham, Omar S.

2017-09-01

We successfully fabricated Lab on chip components and integrated for possible use in biomedical application. The sensor was fabricated by using conventional photolithography method integrated with PDMS micro channels for smooth delivery of sample to the sensing domain. The sensor was silanized and aminated with 3-Aminopropyl triethoxysilane (APTES) to functionalize the surface with biomolecules and create molecular binding chemistry. The resulting Si-O-Si- components were functionalized with oligonucleotides probe of HPV, which interacted with the single stranded HPV DNA target to create a field across on the device. The fabrication, immobilization and hybridization processes were characterized with current voltage (I-V) characterization (KEITHLEY, 6487). The sensor show selectivity for the HPV DNA target in a linear range from concentration 0.1 nM to 1 µM. This strategy presented a simple, rapid and sensitive platform for HPV detection and would become a powerful tool for pathogenic microorganisms screening in clinical diagnosis.

Baseball Bats and Chocolate Chip Cookies: The Judicial Treatment of DNA in the Myriad Genetics Litigation

PubMed Central

Binnie, Ian; Park-Thompson, Vanessa

2015-01-01

In June 2013, the U.S. Supreme Court rendered a controversial ruling that naturally occurring DNA segments are “products of nature” and therefore not patentable subject matter. At this intersection between science and law, in litigation of crucial importance to patients, science, and multibillion-dollar biotech enterprises, the appellate judges sidestepped genetics and engaged in a war of metaphors from diamonds to chocolate chip cookies. This case is not an outlier. Apprehensive judges and juries in both Canada and the United States find many convenient excuses to avoid coming to grips with the underlying science in patent cases. But this is simply not acceptable. Legal rulings must be, and must seem to be, well grounded, as a matter of both law and science. The legitimacy of court decisions in the eyes of the stakeholders and the broader public depends on it. PMID:25524722

Scalable amplification of strand subsets from chip-synthesized oligonucleotide libraries

PubMed Central

Schmidt, Thorsten L.; Beliveau, Brian J.; Uca, Yavuz O.; Theilmann, Mark; Da Cruz, Felipe; Wu, Chao-Ting; Shih, William M.

2015-01-01

Synthetic oligonucleotides are the main cost factor for studies in DNA nanotechnology, genetics and synthetic biology, which all require thousands of these at high quality. Inexpensive chip-synthesized oligonucleotide libraries can contain hundreds of thousands of distinct sequences, however only at sub-femtomole quantities per strand. Here we present a selective oligonucleotide amplification method, based on three rounds of rolling-circle amplification, that produces nanomole amounts of single-stranded oligonucleotides per millilitre reaction. In a multistep one-pot procedure, subsets of hundreds or thousands of single-stranded DNAs with different lengths can selectively be amplified and purified together. These oligonucleotides are used to fold several DNA nanostructures and as primary fluorescence in situ hybridization probes. The amplification cost is lower than other reported methods (typically around US$ 20 per nanomole total oligonucleotides produced) and is dominated by the use of commercial enzymes. PMID:26567534

Microplate-based platform for combined chromatin and DNA methylation immunoprecipitation assays

PubMed Central

2011-01-01

Background The processes that compose expression of a given gene are far more complex than previously thought presenting unprecedented conceptual and mechanistic challenges that require development of new tools. Chromatin structure, which is regulated by DNA methylation and histone modification, is at the center of gene regulation. Immunoprecipitations of chromatin (ChIP) and methylated DNA (MeDIP) represent a major achievement in this area that allow researchers to probe chromatin modifications as well as specific protein-DNA interactions in vivo and to estimate the density of proteins at specific sites genome-wide. Although a critical component of chromatin structure, DNA methylation has often been studied independently of other chromatin events and transcription. Results To allow simultaneous measurements of DNA methylation with other genomic processes, we developed and validated a simple and easy-to-use high throughput microplate-based platform for analysis of DNA methylation. Compared to the traditional beads-based MeDIP the microplate MeDIP was more sensitive and had lower non-specific binding. We integrated the MeDIP method with a microplate ChIP assay which allows measurements of both DNA methylation and histone marks at the same time, Matrix ChIP-MeDIP platform. We illustrated several applications of this platform to relate DNA methylation, with chromatin and transcription events at selected genes in cultured cells, human cancer and in a model of diabetic kidney disease. Conclusion The high throughput capacity of Matrix ChIP-MeDIP to profile tens and potentially hundreds of different genomic events at the same time as DNA methylation represents a powerful platform to explore complex genomic mechanism at selected genes in cultured cells and in whole tissues. In this regard, Matrix ChIP-MeDIP should be useful to complement genome-wide studies where the rich chromatin and transcription database resources provide fruitful foundation to pursue mechanistic, functional and diagnostic information at genes of interest in health and disease. PMID:22098709

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Tagging of Test Tubes with Electronic p-Chips for Use in Biorepositories.

PubMed

Mandecki, Wlodek; Kopacka, Wesley M; Qian, Ziye; Ertwine, Von; Gedzberg, Katie; Gruda, Maryann; Reinhardt, David; Rodriguez, Efrain

2017-08-01

A system has been developed to electronically tag and track test tubes used in biorepositories. The system is based on a light-activated microtransponder, also known as a "p-Chip." One of the pressing problems with storing and retrieving biological samples at low temperatures is the difficulty of reliably reading the identification (ID) number that links each storage tube with the database containing sample details. Commonly used barcodes are not always reliable at low temperatures because of poor adhesion of the label to the test tube and problems with reading under conditions of frost and ice accumulation. Traditional radio frequency identification (RFID) tags are not cost effective and are too large for this application. The system described herein consists of the p-Chip, p-Chip-tagged test tubes, two ID readers (for single tubes or for racks of tubes), and software. We also describe a robot that is configured for retrofitting legacy test tubes in biorepositories with p-Chips while maintaining the temperature of the sample below -50°C at all times. The main benefits of the p-Chip over other RFID devices are its small size (600 × 600 × 100 μm) that allows even very small tubes or vials to be tagged, low cost due to the chip's unitary construction, durability, and the ability to read the ID through frost and ice.

Modified naphthalene diimide as a suitable tetraplex DNA ligand: application to cancer diagnosis and anti-cancer drug

NASA Astrophysics Data System (ADS)

Takenaka, Shigeori

2017-07-01

It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.

Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.

The bacterial diversity associated with citrus leaf midribs was characterized 1 from citrus groves that contained the Huanglongbing (HLB) pathogen, which has yet to be cultivated in vitro. We employed a combination of high-density phylogenetic 16S rDNA microarray and 16S rDNA clone library sequencing to determine the microbial community composition of symptomatic and asymptomatic citrus midribs. Our results revealed that citrus leaf midribs can support a diversity of microbes. PhyloChip analysis indicated that 47 orders of bacteria from 15 phyla were present in the citrus leaf midribs while 20 orders from phyla were observed with the cloning and sequencing method.more » PhyloChip arrays indicated that nine taxa were significantly more abundant in symptomatic midribs compared to asymptomatic midribs. Candidatus Liberibacter asiaticus (Las) was detected at a very low level in asymptomatic plants, but was over 200 times more abundant in symptomatic plants. The PhyloChip analysis was further verified by sequencing 16S rDNA clone libraries, which indicated the dominance of Las in symptomatic leaves. These data implicate Las as the pathogen responsible for HLB disease. Citrus is the most important commercial fruit crop in Florida. In recent years, citrus Huanglongbing (HLB), also called citrus greening, has severely affected Florida's citrus production and hence has drawn an enormous amount of attention. HLB is one of the most devastating diseases of citrus (6,13), characterized by blotchy mottling with green islands on leaves, as well as stunting, fruit decline, and small, lopsided fruits with poor coloration. The disease tends to be associated with a phloem-limited fastidious {alpha}-proteobacterium given a provisional Candidatus status (Candidatus Liberobacter spp. later changed to Candidatus Liberibacter spp.) in nomenclature (18,25,34). Previous studies indicate that HLB infection causes disorder in the phloem and severely impairs the translocation of assimilates in host plants (5,27,40). Tatineni and colleagues discovered that the HLB bacteria were unevenly distributed in phloem of bark tissue, vascular tissue of the leaf midrib, roots, and different floral and fruit parts (43). Unsuccessful attempts in culturing the pathogen are notably hampering efforts to understand its biology and pathogenesis mechanism. Using a modified Koch's Postulates approach, Jagoueix and colleagues were able to re-infect periwinkle plants from a mixed microbial community harvested from HLB diseased plants (25). Emergence of the disease in otherwise healthy plants led to the conclusion that HLB was associated with Candidatus Liberibacter sp. based on its 16S rDNA sequence (18,25). Currently, three species of the pathogen are recognized from trees with HLB disease based on 16S rDNA sequence: Ca. Liberibacter asiaticus (Las), Ca. Liberibacter africanus (Laf), and Ca. Liberibacter americanus (Lam); Las is the most prevalent species among HLB diseased trees (5,12,18,25,44). Las is naturally transmitted to citrus by the psyllid, Diaphorina citri Kuwayama, and can be artificially transmitted by grafting from citrus to citrus and dodder (Cuscuta campestris) to periwinkle (Catharanthus roseus) or tobacco (Nicotiana tabacum Xanthi) (5). Based on current research regarding the associations of Liberibacter in planta there is not enough evidence to implicate Liberibacter as the definitive causal agent of HLB disease due to its resistance to cultivation in vitro. It is possible that HLB disease may be the result of complex etiology where Liberibacter interacts with other endophytic bacteria. However, there is not enough evidence regarding its association(s) in planta to make this conclusion, nor is it known whether associated microbial communities play a role in expression of pathogenic traits. The main objective of the study was to test the hypothesis that other bacteria besides Ca. Liberibacter spp. are associated with citrus greening disease. The differences between the relative abundance, species richness and phylogenetic diversity of the microbial communities associated with the leaf midribs of HLB symptomatic and asymptomatic citrus trees were investigated using high-density 16S rDNA microarray PhyloChip and 16S rRNA gene clone library methods.« less

Genetic testing for retinal dystrophies and dysfunctions: benefits, dilemmas and solutions.

PubMed

Koenekoop, Robert K; Lopez, Irma; den Hollander, Anneke I; Allikmets, Rando; Cremers, Frans P M

2007-07-01

Human retinal dystrophies have unparalleled genetic and clinical diversity and are currently linked to more than 185 genetic loci. Genotyping is a crucial exercise, as human gene-specific clinical trials to study photoreceptor rescue are on their way. Testing confirms the diagnosis at the molecular level and allows for a more precise prognosis of the possible future clinical evolution. As treatments are gene-specific and the 'window of opportunity' is time-sensitive; accurate, rapid and cost-effective genetic testing will play an ever-increasing crucial role. The gold standard is sequencing but is fraught with excessive costs, time, manpower issues and finding non-pathogenic variants. Therefore, no centre offers testing of all currently 132 known genes. Several new micro-array technologies have emerged recently, that offer rapid, cost-effective and accurate genotyping. The new disease chips from Asper Ophthalmics (for Stargardt dystrophy, Leber congenital amaurosis [LCA], Usher syndromes and retinitis pigmentosa) offer an excellent first pass opportunity. All known mutations are placed on the chip and in 4 h a patient's DNA is screened. Identification rates (identifying at least one disease-associated mutation) are currently approximately 70% (Stargardt), approximately 60-70% (LCA) and approximately 45% (Usher syndrome subtype 1). This may be combined with genotype-phenotype correlations that suggest the causal gene from the clinical appearance (e.g. preserved para-arteriolar retinal pigment epithelium suggests the involvement of the CRB1 gene in LCA). As approximately 50% of the retinal dystrophy genes still await discovery, these technologies will improve dramatically as additional novel mutations are added. Genetic testing will then become standard practice to complement the ophthalmic evaluation.

Genome-wide analysis of replication timing by next-generation sequencing with E/L Repli-seq.

PubMed

Marchal, Claire; Sasaki, Takayo; Vera, Daniel; Wilson, Korey; Sima, Jiao; Rivera-Mulia, Juan Carlos; Trevilla-García, Claudia; Nogues, Coralin; Nafie, Ebtesam; Gilbert, David M

2018-05-01

This protocol is an extension to: Nat. Protoc. 6, 870-895 (2014); doi:10.1038/nprot.2011.328; published online 02 June 2011Cycling cells duplicate their DNA content during S phase, following a defined program called replication timing (RT). Early- and late-replicating regions differ in terms of mutation rates, transcriptional activity, chromatin marks and subnuclear position. Moreover, RT is regulated during development and is altered in diseases. Here, we describe E/L Repli-seq, an extension of our Repli-chip protocol. E/L Repli-seq is a rapid, robust and relatively inexpensive protocol for analyzing RT by next-generation sequencing (NGS), allowing genome-wide assessment of how cellular processes are linked to RT. Briefly, cells are pulse-labeled with BrdU, and early and late S-phase fractions are sorted by flow cytometry. Labeled nascent DNA is immunoprecipitated from both fractions and sequenced. Data processing leads to a single bedGraph file containing the ratio of nascent DNA from early versus late S-phase fractions. The results are comparable to those of Repli-chip, with the additional benefits of genome-wide sequence information and an increased dynamic range. We also provide computational pipelines for downstream analyses, for parsing phased genomes using single-nucleotide polymorphisms (SNPs) to analyze RT allelic asynchrony, and for direct comparison to Repli-chip data. This protocol can be performed in up to 3 d before sequencing, and requires basic cellular and molecular biology skills, as well as a basic understanding of Unix and R.

Phospholipid Polymer Biointerfaces for Lab-on-a-Chip Devices.

PubMed

Xu, Yan; Takai, Madoka; Ishihara, Kazuhiko

2010-06-01

This review summarizes recent achievements and progress in the development of various functional 2-methacryloyloxyethyl phosphorylcholine (MPC) polymer biointerfaces for lab-on-a-chip devices and applications. As phospholipid polymers, MPC polymers can form cell-membrane-like surfaces by surface chemistry and physics and thereby provide biointerfaces capable of suppressing protein adsorption and many subsequent biological responses. In order to enable application to microfluidic devices, a number of MPC polymers with diverse functions have been specially designed and synthesized by incorporating functional units such as charge and active ester for generating the microfluidic flow and conjugating biomolecules, respectively. Furthermore, these polymers were incorporated with silane or hydrophobic moiety to construct stable interfaces on various substrate materials such as glass, quartz, poly(methyl methacrylate), and poly(dimethylsiloxane), via a silane-coupling reaction or hydrophobic interactions. The basic interfacial properties of these interfaces have been characterized from multiple aspects of chemistry, physics, and biology, and the suppression of nonspecific bioadsorption and control of microfluidic flow have been successfully achieved using these biointerfaces on a chip. Further, many chip-based biomedical applications such as immunoassays and DNA separation have been accomplished by integrating these biointerfaces on a chip. Therefore, functional phospholipid polymer interfaces are promising and useful for application to lab-on-a-chip devices in biomedicine.

Sub-micro-liter Electrochemical Single-Nucleotide-Polymorphism Detector for Lab-on-a-Chip System

NASA Astrophysics Data System (ADS)

Tanaka, Hiroyuki; Fiorini, Paolo; Peeters, Sara; Majeed, Bivragh; Sterken, Tom; de Beeck, Maaike Op; Hayashi, Miho; Yaku, Hidenobu; Yamashita, Ichiro

2012-04-01

A sub-micro-liter single-nucleotide-polymorphism (SNP) detector for lab-on-a-chip applications is developed. This detector enables a fast, sensitive, and selective SNP detection directly from human blood. The detector is fabricated on a Si substrate by a standard complementary metal oxide semiconductor/micro electro mechanical systems (CMOS/MEMS) process and Polydimethylsiloxane (PDMS) molding. Stable and reproducible measurements are obtained by implementing an on-chip Ag/AgCl electrode and encapsulating the detector. The detector senses the presence of SNPs by measuring the concentration of pyrophosphoric acid generated during selective DNA amplification. A 0.5-µL-volume detector enabled the successful performance of the typing of a SNP within the ABO gene using human blood. The measured sensitivity is 566 pA/µM.

Droplet-Based Segregation and Extraction of Concentrated Samples

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buie, C R; Buckley, P; Hamilton, J

2007-02-23

Microfluidic analysis often requires sample concentration and separation techniques to isolate and detect analytes of interest. Complex or scarce samples may also require an orthogonal separation and detection method or off-chip analysis to confirm results. To perform these additional steps, the concentrated sample plug must be extracted from the primary microfluidic channel with minimal sample loss and dilution. We investigated two extraction techniques; injection of immiscible fluid droplets into the sample stream (''capping'''') and injection of the sample into an immiscible fluid stream (''extraction''). From our results we conclude that capping is the more effective partitioning technique. Furthermore, this functionalitymore » enables additional off-chip post-processing procedures such as DNA/RNA microarray analysis, realtime polymerase chain reaction (RT-PCR), and culture growth to validate chip performance.« less

Epigenome analysis of pluripotent stem cells

PubMed Central

Ricupero, Christopher L.; Swerdel, Mavis R.; Hart, Ronald P.

2015-01-01

Summary Mis-regulation of gene expression due to epigenetic abnormalities has been linked with complex genetic disorders, psychiatric illness and cancer. In addition, the dynamic epigenetic changes that occur in pluripotent stem cells are believed to impact regulatory networks essential for proper lineage development. Chromatin immunoprecipitation (ChIP) is a technique used to isolate and enrich chromatin fragments using antibodies against specific chromatin modifications, such as DNA binding proteins or covalent histone modifications. Until recently, many ChIP protocols required millions of cells for each immunoprecipitation. This severely limited analysis of rare cell populations or post-mitotic, differentiated cell lines. Here, we describe a low cell number ChIP protocol with next generation sequencing and analysis, that has the potential to uncover novel epigenetic regulatory pathways that were previously difficult or impossible to obtain. PMID:23546758

Genome–wide association study of carcass weight in commercial Hanwoo cattle

PubMed Central

Edea, Zewdu; Jeoung, Yeong Ho; Shin, Sung-Sub; Ku, Jaeul; Seo, Sungbo; Kim, Il-Hoi; Kim, Sang-Wook

2018-01-01

Objective The objective of the present study was to validate genes and genomic regions associated with carcass weight using a low-density single nucleotide polymorphism (SNP) Chip in Hanwoo cattle breed. Methods Commercial Hanwoo steers (n = 220) were genotyped with 20K GeneSeek genomic profiler BeadChip. After applying the quality control of criteria of a call rate ≥90% and minor allele frequency (MAF) ≥0.01, a total of 15,235 autosomal SNPs were left for genome-wide association (GWA) analysis. The GWA tests were performed using single-locus mixed linear model. Age at slaughter was fitted as fixed effect and sire included as a covariate. The level of genome-wide significance was set at 3.28×10−6 (0.05/15,235), corresponding to Bonferroni correction for 15,235 multiple independent tests. Results By employing EMMAX approach which is based on a mixed linear model and accounts for population stratification and relatedness, we identified 17 and 16 loci significantly (p<0.001) associated with carcass weight for the additive and dominant models, respectively. The second most significant (p = 0.000049) SNP (ARS-BFGL-NGS-28234) on bovine chromosome 4 (BTA4) at 21 Mb had an allele substitution effect of 43.45 kg. Some of the identified regions on BTA2, 6, 14, 22, and 24 were previously reported to be associated with quantitative trait loci for carcass weight in several beef cattle breeds. Conclusion This is the first genome-wide association study using SNP chips on commercial Hanwoo steers, and some of the loci newly identified in this study may help to better DNA markers that determine increased beef production in commercial Hanwoo cattle. Further studies using a larger sample size will allow confirmation of the candidates identified in this study. PMID:29103288

Fully solution-processed organic light-emitting electrochemical cells (OLEC) with inkjet-printed micro-lenses for disposable lab-on-chip applications at ambient conditions

NASA Astrophysics Data System (ADS)

Shu, Zhe; Pabst, Oliver; Beckert, Erik; Eberhardt, Ramona; Tünnermann, Andreas

2016-02-01

Microfluidic lab-on-chip devices can be used for chemical and biological analyses such as DNA tests or environmental monitoring. Such devices integrate most of the basic functionalities needed for scientific analysis on a microfluidic chip. When using such devices, cost and space-intensive lab equipment is no longer necessary. However, in order to make a monolithic and cost-efficient/disposable microfluidic sensing device, direct integration of the excitation light source for fluorescent sensing is often required. To achieve this, we introduce a fully solution processable deviation of OLEDs, organic light-emitting electrochemical cells (OLECs), as a low-cost excitation light source for a disposable microfluidic sensing platform. By mixing metal ions and a solid electrolyte with light-emitting polymers as active materials, an in-situ doping and in-situ PN-junction can be generated within a three layer sandwich device. Thanks to this doping effect, work function adaptation is not necessary and air-stable electrode can be used. An ambient manufacturing process for fully solution-processed OLECs is presented, which consist of a spin-coated blue light-emitting polymer plus dopants on an ITO cathode and an inkjet-printed PEDOT:PSS transparent top anode. A fully transparent blue OLEC is able to obtain light intensity > 2500 cd/m2 under pulsed driving mode and maintain stable after 1000 cycles, which fulfils requirements for simple fluorescent on-chip sensing applications. However, because of the large refractive index difference between substrates and air, about 80% of emitted light is trapped inside the device. Therefore, inkjet printed micro-lenses on the rear side are introduced here to further increase light-emitting brightness.

Plasmonic nanoparticles-decorated diatomite biosilica: extending the horizon of on-chip chromatography and label-free biosensing.

PubMed

Kong, Xianming; Li, Erwen; Squire, Kenny; Liu, Ye; Wu, Bo; Cheng, Li-Jing; Wang, Alan X

2017-11-01

Diatomite consists of fossilized remains of ancient diatoms and is a type of naturally abundant photonic crystal biosilica with multiple unique physical and chemical functionalities. In this paper, we explored the fluidic properties of diatomite as the matrix for on-chip chromatography and, simultaneously, the photonic crystal effects to enhance the plasmonic resonances of metallic nanoparticles for surface-enhanced Raman scattering (SERS) biosensing. The plasmonic nanoparticle-decorated diatomite biosilica provides a lab-on-a-chip capability to separate and detect small molecules from mixture samples with ultra-high detection sensitivity down to 1 ppm. We demonstrate the significant potential for biomedical applications by screening toxins in real biofluid, achieving simultaneous label-free biosensing of phenethylamine and miR21cDNA in human plasma with unprecedented sensitivity and specificity. To the best of our knowledge, this is the first time demonstration to detect target molecules from real biofluids by on-chip chromatography-SERS techniques. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Considerations on Experimental Design and Data Analysis of Chromatin Immunoprecipitation Experiments.

PubMed

Jordán-Pla, Antonio; Visa, Neus

2018-01-01

Arguably one of the most valuable techniques to study chromatin organization, ChIP is the method of choice to map the contacts established between proteins and genomic DNA. Ever since its inception, more than 30 years ago, ChIP has been constantly evolving, improving, and expanding its capabilities and reach. Despite its widespread use by many laboratories across a wide variety of disciplines, ChIP assays can be sometimes challenging to design, and are often sensitive to variations in practical implementation.In this chapter, we provide a general overview of the ChIP method and its most common variations, with a special focus on ChIP-seq. We try to address some of the most important aspects that need to be taken into account in order to design and perform experiments that generate the most reproducible, high-quality data. Some of the main topics covered include the use of properly characterized antibodies, alternatives to chromatin preparation, the need for proper controls, and some recommendations about ChIP-seq data analysis.

Nanophotonic Trapping for Precise Manipulation of Biomolecular Arrays

PubMed Central

Soltani, Mohammad; Lin, Jun; Forties, Robert A.; Inman, James T.; Saraf, Summer N.; Fulbright, Robert M.; Lipson, Michal; Wang, Michelle D.

2014-01-01

Optical trapping is a powerful manipulation and measurement technique widely employed in the biological and materials sciences1–8. Miniaturizing optical trap instruments onto optofluidic platforms holds promise for high throughput lab-on-chip applications9–16. However, a persistent challenge with existing optofluidic devices has been controlled and precise manipulation of trapped particles. Here we report a new class of on-chip optical trapping devices. Using photonic interference functionalities, an array of stable, three-dimensional on-chip optical traps is formed at the antinodes of a standing-wave evanescent field on a nanophotonic waveguide. By employing the thermo-optic effect via integrated electric microheaters, the traps can be repositioned at high speed (~ 30 kHz) with nanometer precision. We demonstrate sorting and manipulation of individual DNA molecules. In conjunction with laminar flows and fluorescence, we also show precise control of the chemical environment of a sample with simultaneous monitoring. Such a controllable trapping device has the potential for high-throughput precision measurements on chip. PMID:24776649

Nanophotonic trapping for precise manipulation of biomolecular arrays.

PubMed

Soltani, Mohammad; Lin, Jun; Forties, Robert A; Inman, James T; Saraf, Summer N; Fulbright, Robert M; Lipson, Michal; Wang, Michelle D

2014-06-01

Optical trapping is a powerful manipulation and measurement technique widely used in the biological and materials sciences. Miniaturizing optical trap instruments onto optofluidic platforms holds promise for high-throughput lab-on-a-chip applications. However, a persistent challenge with existing optofluidic devices has been achieving controlled and precise manipulation of trapped particles. Here, we report a new class of on-chip optical trapping devices. Using photonic interference functionalities, an array of stable, three-dimensional on-chip optical traps is formed at the antinodes of a standing-wave evanescent field on a nanophotonic waveguide. By employing the thermo-optic effect via integrated electric microheaters, the traps can be repositioned at high speed (∼30 kHz) with nanometre precision. We demonstrate sorting and manipulation of individual DNA molecules. In conjunction with laminar flows and fluorescence, we also show precise control of the chemical environment of a sample with simultaneous monitoring. Such a controllable trapping device has the potential to achieve high-throughput precision measurements on chip.

A Review of the Application of Body-on-a-Chip for Drug Test and Its Latest Trend of Incorporating Barrier Tissue.

PubMed

Jin, Haoyi; Yu, Yanqiu

2016-10-01

High-quality preclinical bioassay models are essential for drug research and development. We reviewed the emerging body-on-a-chip technology, which serves as a promising model to overcome the limitations of traditional bioassay models, and introduced existing models of body-on-a-chip, their constitutional details, application for drug testing, and individual features of these models. We put special emphasis on the latest trend in this field of incorporating barrier tissue into body-on-a-chip and discussed several remaining challenges of current body-on-a-chip. © 2015 Society for Laboratory Automation and Screening.

ON EDGE CHIPPING TESTING AND SOME PERSONAL PERSPECTIVES ON THE STATE OF THE ART OF MECHANICAL TESTING

PubMed Central

Quinn, G. D.

2014-01-01

Objective The edge chipping test is used to measure the fracture resistance of dental restoration ceramics and resin composites. This paper focuses on the progress of evaluating chipping resistance of these materials and also on the progress of standardization of this test method. This paper also makes observations about the state of the art of mechanical testing of ceramic and composite restorative materials in general. Interlaboratory comparative studies (“round robins”) are recommended. Methods An edge chipping machine was used to evaluate dozens of materials including porcelains, glass ceramics, aluminas, zirconias, filled resin-composites, new hybrid ceramic-resin composites, laminated composite ceramics, and even polymethyl methacrylate based denture materials. Force versus distance data were collected over a broad range with different indenters. Several chipping resistance parameters were quantified. Results Older restorative materials such as feldspathic porcelains and veneering materials had limited chipping resistance, but more modern ceramics and filled composites show significant improvements. A yttria-partially stabilized zirconia had the greatest resistance to chipping. Much of the early work on edge chipping resistance of brittle materials emphasized linear force versus distance trends obtained with relatively blunt Rockwell C indenters. More recently, trends for dental restorative materials with alternative sharper indenters have been nonlinear. A new phenomenological model with a simple quadratic function fits all data exceptionally well. It is loosely based on an energy balance between indenter work and fracture and deformation energies in the chipped material. Significance Although a direct comparison of our laboratory scale tests on idealized simple geometries to clinical outcomes has not yet been done, anecdotal evidence suggests the procedure does produce clinically relevant rankings and outcomes. Despite the variations in the trends and indenters, comparisons between materials can easily be made by chipping convenient block-shaped specimens with sharp conical 120°, Vickers, or Rockwell C indenters at a defined edge distance of 0.5 mm. Broad distance ranges are recommended for trend evaluation. This work has provided important information for standardization. PMID:25244927

Role of messenger RNA-ribosome complex in complementary DNA display.

PubMed

Naimuddin, Mohammed; Ohtsuka, Isao; Kitamura, Koichiro; Kudou, Motonori; Kimura, Shinnosuke

2013-07-15

In vitro display technologies such as ribosome display and messenger RNA (mRNA)/complementary DNA (cDNA) display are powerful methods that can generate library diversities on the order of 10(10-14). However, in mRNA and cDNA display methods, the end use diversity is two orders of magnitude lower than initial diversity and is dependent on the downstream processes that act as limiting factors. We found that in our previous cDNA display protocol, the purification of protein fusions by the use of streptavidin matrices from cell-free translation mixtures had poor efficiency (∼10-15%) that seriously affected the diversity of the purified library. Here, we have investigated and optimized the protocols that provided remarkable purification efficiencies. The stalled ribosome in the mRNA-ribosome complex was found to impede this purification efficiency. Among the various conditions tested, destabilization of ribosomes by appropriate concentration of metal chelating agents in combination with an optimal temperature of 30°C were found to be crucial and effective for nearly complete isolation of protein fusions from the cell-free translation system. Thus, this protocol provided 8- to 10-fold increased efficiency of purification over the previous method and results in retaining the diversity of the library by approximately an order of magnitude-important for directed evolution. We also discuss the possible effects in the fabrication of protein chips. Copyright © 2013 Elsevier Inc. All rights reserved.

Genome-wide and locus-specific DNA hypomethylation in G9a deficient mouse embryonic stem cells.

PubMed

Ikegami, Kohta; Iwatani, Misa; Suzuki, Masako; Tachibana, Makoto; Shinkai, Yoichi; Tanaka, Satoshi; Greally, John M; Yagi, Shintaro; Hattori, Naka; Shiota, Kunio

2007-01-01

In the mammalian genome, numerous CpG-rich loci define tissue-dependent and differentially methylated regions (T-DMRs). Euchromatin from different cell types differs in terms of its tissue-specific DNA methylation profile as defined by these T-DMRs. G9a is a euchromatin-localized histone methyltransferase (HMT) and catalyzes methylation of histone H3 at lysines 9 and 27 (H3-K9 and -K27). To test whether HMT activity influences euchromatic cytosine methylation, we analyzed the DNA methylation status of approximately 2000 CpG-rich loci, which are predicted in silico, in G9a(-/-) embryonic stem cells by restriction landmark genomic scanning (RLGS). While the RLGS profile of wild-type cells contained about 1300 spots, 32 new spots indicating DNA demethylation were seen in the profile of G9a(-/-) cells. Virtual-image RLGS (Vi-RLGS) allowed us to identify the genomic source of ten of these spots. These were confirmed to be cytosine demethylated, not just at the Not I site detected by the RLGS but extending over several kilobase pairs in cis. Chromatin immunoprecipitation (ChIP) confirmed these loci to be targets of G9a, with decreased H3-K9 and/or -K27 dimethylation in the G9a(-/-) cells. These data indicate that G9a site-selectively contributes to DNA methylation.

UGT2B17 and SULT1A1 gene copy number variation (CNV) detection by LabChip microfluidic technology.

PubMed

Gaedigk, Andrea; Gaedigk, Roger; Leeder, J Steven

2010-05-01

Gene copy number variations (CNVs) are increasingly recognized to play important roles in the expression of genes and hence on their respective enzymatic activities. This has been demonstrated for a number of drug metabolizing genes, such as UDP-glucuronosyltransferases 2B17 (UGT2B17) and sulfotransferase 1A1 (SULT1A1), which are subject to genetic heterogeneity, including CNV. Quantitative assays to assess gene copy number are therefore becoming an integral part of accurate genotype assessment and phenotype prediction. In this study, we evaluated a microfluidics-based system, the Bio-Rad Experion system, to determine the power and utility of this platform to detect UGT2B17 and SULT1A1 CNV in DNA samples derived from blood and tissue. UGT2B17 is known to present with 0, 1 or 2 and SULT1A1 with up to 5 gene copies. Distinct clustering (p<0.001) into copy number groups was achieved for both genes. DNA samples derived from blood exhibited less inter-run variability compared to DNA samples obtained from liver tissue. This variability may be caused by tissue-specific PCR inhibitors as it could be overcome by using DNA from another tissue, or after the DNA had undergone whole genome amplification. This method produced results comparable to those reported for other quantitative test platforms.

Creating a Tiny Human Body on a Chip

ScienceCinema

Hunsberger, Maren; Soscia, Dave; Moya, Monica

2018-06-21

LLNL science communicator Maren Hunsberger takes us "Inside the Lab" to learn about the iChip (In-vitro Chip-based Human Investigational Platform) project at Lawrence Livermore National Laboratory. "One application of the iChip system would be to develop new pharmaceutical drugs," explains Dave Soscia, LLNL postdoc. "When you test in a mouse for example, it's not as close to the human system as you can get. If we can take human cells and put them on devices and actually mimic the structure and function of the organ systems in the human, we can actually replace animal testing and even make a better system for testing pharmaceutical drugs."

Genome-wide Mapping Reveals Conservation of Promoter DNA Methylation Following Chicken Domestication

PubMed Central

Li, Qinghe; Wang, Yuanyuan; Hu, Xiaoxiang; Zhao, Yaofeng; Li, Ning

2015-01-01

It is well-known that environment influences DNA methylation, however, the extent of heritable DNA methylation variation following animal domestication remains largely unknown. Using meDIP-chip we mapped the promoter methylomes for 23,316 genes in muscle tissues of ancestral and domestic chickens. We systematically examined the variation of promoter DNA methylation in terms of different breeds, differentially expressed genes, SNPs and genes undergo genetic selection sweeps. While considerable changes in DNA sequence and gene expression programs were prevalent, we found that the inter-strain DNA methylation patterns were highly conserved in promoter region between the wild and domestic chicken breeds. Our data suggests a global preservation of DNA methylation between the wild and domestic chicken breeds in either a genome-wide or locus-specific scale in chick muscle tissues. PMID:25735894

Detection of cystic fibrosis mutations in a GeneChip{trademark} assay format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyada, C.G.; Cronin, M.T.; Kim, S.M.

1994-09-01

We are developing assays for the detection of cystic fibrosis mutations based on DNA hybridization. A DNA sample is amplified by PCR, labeled by incorporating a fluorescein-tagged dNTP, enzymatically treated to produce smaller fragments and hybridized to a series of short (13-16 bases) oligonucleotides synthesized on a glass surface via photolithography. The hybrids are detected by eqifluorescence and mutations are identified by the specific pattern of hybridization. In a GeneChip assay, the chip surface is composed of a series of subarrays, each being specific for a particular mutation. Each subarray is further subdivided into a series of probes (40 total),more » half based on the mutant sequence and the remainder based on the wild-type sequence. For each of the subarrays, there is a redundancy in the number of probes that should hybridize to either a wild-type or a mutant target. The multiple probe strategy provides sequence information for a short five base region overlapping the mutation site. In addition, homozygous wild-type and mutant as well as heterozygous samples are each identified by a specific pattern of hybridization. The small size of each probe feature (250 x 250 {mu}m{sup 2}) permits the inclusion of additional probes required to generate sequence information by hybridization.« less

A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation.

PubMed

Nohara, Kazunari; Chen, Zheng; Yoo, Seung-Hee

2017-07-06

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.

A poly(dimethylsiloxane) microfluidic sheet reversibly adhered on a glass plate for creation of emulsion droplets for droplet digital PCR.

PubMed

Nakashoji, Yuta; Tanaka, Hironari; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

2017-01-01

A PDMS microfluidic chip with T-junction channel geometry, two inlet reservoirs, and one outlet reservoir was reversibly adhered on a glass plate through the viscoelastic properties of PDMS. This formed a detachable microfluidic device for creation of water-in-oil emulsion droplets that were used as discrete reaction compartments for the droplet digital PCR. The PDMS/glass device could continuously produce monodisperse droplets without leakage of fluids using a vacuum-driven autonomous micropumping method. This droplet preparation technique only required evacuation of air dissolved in the PDMS before loading of oil and aqueous phases into separate inlet reservoirs. Degassing of the PDMS chip at approximately 300 Pa for 1.5 h in a vacuum desiccator gave 40 000 droplets in 80 min, which corresponded to a generation frequency of up to nine droplets per second. Over multiple runs the droplet creation was very reproducible, and the size reproducibility of generated droplets (polydispersity of up to 4.1%) was comparable to that acquired using other microfluidic droplet preparation techniques. Because the PDMS chip can be peeled off the glass plate, blocked channels can easily be fixed when they arise, and this extends the lifetime of the chip. Single DNA molecules partitioned into the droplets were successfully amplified by PCR. In addition, the droplet digital PCR platform allowed absolute quantification of low copy numbers of target DNA, and was robust against instrumental variance. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Emerging metrology for high-throughput nanomaterial genotoxicology.

PubMed

Nelson, Bryant C; Wright, Christa W; Ibuki, Yuko; Moreno-Villanueva, Maria; Karlsson, Hanna L; Hendriks, Giel; Sims, Christopher M; Singh, Neenu; Doak, Shareen H

2017-01-01

The rapid development of the engineered nanomaterial (ENM) manufacturing industry has accelerated the incorporation of ENMs into a wide variety of consumer products across the globe. Unintentionally or not, some of these ENMs may be introduced into the environment or come into contact with humans or other organisms resulting in unexpected biological effects. It is thus prudent to have rapid and robust analytical metrology in place that can be used to critically assess and/or predict the cytotoxicity, as well as the potential genotoxicity of these ENMs. Many of the traditional genotoxicity test methods [e.g. unscheduled DNA synthesis assay, bacterial reverse mutation (Ames) test, etc.,] for determining the DNA damaging potential of chemical and biological compounds are not suitable for the evaluation of ENMs, due to a variety of methodological issues ranging from potential assay interferences to problems centered on low sample throughput. Recently, a number of sensitive, high-throughput genotoxicity assays/platforms (CometChip assay, flow cytometry/micronucleus assay, flow cytometry/γ-H2AX assay, automated 'Fluorimetric Detection of Alkaline DNA Unwinding' (FADU) assay, ToxTracker reporter assay) have been developed, based on substantial modifications and enhancements of traditional genotoxicity assays. These new assays have been used for the rapid measurement of DNA damage (strand breaks), chromosomal damage (micronuclei) and for detecting upregulated DNA damage signalling pathways resulting from ENM exposures. In this critical review, we describe and discuss the fundamental measurement principles and measurement endpoints of these new assays, as well as the modes of operation, analytical metrics and potential interferences, as applicable to ENM exposures. An unbiased discussion of the major technical advantages and limitations of each assay for evaluating and predicting the genotoxic potential of ENMs is also provided. Published by Oxford University Press on behalf of the UK Environmental Mutagen Society 2016.

Testing and operating a multiprocessor chip with processor redundancy

DOEpatents

Bellofatto, Ralph E; Douskey, Steven M; Haring, Rudolf A; McManus, Moyra K; Ohmacht, Martin; Schmunkamp, Dietmar; Sugavanam, Krishnan; Weatherford, Bryan J

2014-10-21

A system and method for improving the yield rate of a multiprocessor semiconductor chip that includes primary processor cores and one or more redundant processor cores. A first tester conducts a first test on one or more processor cores, and encodes results of the first test in an on-chip non-volatile memory. A second tester conducts a second test on the processor cores, and encodes results of the second test in an external non-volatile storage device. An override bit of a multiplexer is set if a processor core fails the second test. In response to the override bit, the multiplexer selects a physical-to-logical mapping of processor IDs according to one of: the encoded results in the memory device or the encoded results in the external storage device. On-chip logic configures the processor cores according to the selected physical-to-logical mapping.

Focusing analytes from 50 μL into 500 pL: On-chip focusing from large sample volumes using isotachophoresis.

PubMed

van Kooten, Xander F; Truman-Rosentsvit, Marianna; Kaigala, Govind V; Bercovici, Moran

2017-09-05

The use of on-chip isotachophoresis assays for diagnostic applications is often limited by the small volumes of standard microfluidic channels. Overcoming this limitation is particularly important for detection of 'discrete' biological targets (such as bacteria) at low concentrations, where the volume of processed liquid in a standard microchannel might not contain any targets. We present a novel microfluidic chip that enables ITP focusing of target analytes from initial sample volumes of 50 μL into a concentrated zone with a volume of 500 pL, corresponding to a 100,000-fold increase in mean concentration, and a 300,000-fold increase in peak concentration. We present design considerations for limiting sample dispersion in such large-volume focusing (LVF) chips and discuss the trade-off between assay time and Joule heating, which ultimately governs the scalability of LVF designs. Finally, we demonstrate a 100-fold improvement of ITP focusing performance in the LVF chip as compared to conventional microchannels, and apply this enhancement to achieve highly sensitive detection of both molecular targets (DNA, down to 10 fM) and whole bacteria (down to 100 cfu/mL).

Silicon Integrated Cavity Optomechanical Transducer

NASA Astrophysics Data System (ADS)

Zou, Jie; Miao, Houxun; Michels, Thomas; Liu, Yuxiang; Srinivasan, Kartik; Aksyuk, Vladimir

2013-03-01

Cavity optomechanics enables measurements of mechanical motion at the fundamental limits of precision imposed by quantum mechanics. However, the need to align and couple devices to off-chip optical components hinders development, miniaturization and broader application of ultrahigh sensitivity chip-scale optomechanical transducers. Here we demonstrate a fully integrated and optical fiber pigtailed optomechanical transducer with a high Q silicon micro-disk cavity near-field coupled to a nanoscale cantilever. We detect the motion of the cantilever by measuring the resonant frequency shift of the whispering gallery mode of the micro-disk. The sensitivity near the standard quantum limit can be reached with sub-uW optical power. Our on-chip approach combines compactness and stability with great design flexibility: the geometry of the micro-disk and cantilever can be tailored to optimize the mechanical/optical Q factors and tune the mechanical frequency over two orders of magnitudes. Electrical transduction in addition to optical transduction was also demonstrated and both can be used to effectively cool the cantilever. Moreover, cantilevers with sharp tips overhanging the chip edge were fabricated to potentially allow the mechanical cantilever to be coupled to a wide range of off-chip systems, such as spins, DNA, nanostructures and atoms on clean surfaces.

AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

EPA Science Inventory

The application of new molecular biological tools to environmental toxicology was discussed at an international workshop attended by
approximately 60 government, academic, and industrial scientists. The sequencing of the human genome, development of microarrays and
DNA chip...

Engagement of Metal Debris into a Gear Mesh

NASA Technical Reports Server (NTRS)

Handschuh, Robert F.; Krantz, Timothy L.

2009-01-01

A series of bench top experiments was conducted to determine the effects of metallic debris being dragged through meshing gear teeth. A test rig that is typically used to conduct contact fatigue experiments was used for these tests. Several sizes of drill material, shim stock, and pieces of gear teeth were introduced and then driven through the meshing region. The level of torque required to drive the "chip" through the gear mesh was measured. From the data gathered, chip size sufficient to jam the mechanism can be determined. INTRODUCTION In some space mechanisms the loading can be so high that there is some possibility that a gear chip might be liberated while in operation of the mechanism [1-5]. Also, due to the closely packed nature of some space mechanisms and the fact that a space grease is used for lubrication, chips that are released can then be introduced to other gear meshes within this mechanism. In this instance, it is desirable to know the consequences of a gear chip entering in between meshing gear teeth. To help provide some understanding, a series of bench-top experiments was conducted to engage chips of simulated and gear material fragments into a meshing gear pair. One purpose of the experiments was to determine the relationship of chip size to the torque required to rotate the gear set through the mesh cycle. The second purpose was to determine the condition of the gear chip material after engagement by the meshing gears, primarily to determine if the chip would break into pieces and to observe the motion of the chip as the engagement was completed. This document also presents preliminary testing done with metal debris other than chips from gears, namely steel shim stock and drill bits of various sizes and diameters.

Nonlinear matching measure for the analysis of on-off type DNA microarray images

NASA Astrophysics Data System (ADS)

Kim, Jong D.; Park, Misun; Kim, Jongwon

2003-07-01

In this paper, we propose a new nonlinear matching measure for automatic analysis of the on-off type DNA microarray images in which the hybridized spots are detected by the template matching method. The targeting spots of HPV DNA chips are designed for genotyping the human papilloma virus(HPV). The proposed measure is obtained by binarythresholding over the whole template region and taking the number of white pixels inside the spotted area. This measure is evaluated in terms of the accuracy of the estimated marker location to show better performance than the normalized covariance.

Development of micropump-actuated negative pressure pinched injection for parallel electrophoresis on array microfluidic chip.

PubMed

Li, Bowei; Jiang, Lei; Xie, Hua; Gao, Yan; Qin, Jianhua; Lin, Bingcheng

2009-09-01

A micropump-actuated negative pressure pinched injection method is developed for parallel electrophoresis on a multi-channel LIF detection system. The system has a home-made device that could individually control 16-port solenoid valves and a high-voltage power supply. The laser beam is excitated and distributes to the array separation channels for detection. The hybrid Glass-PDMS microfluidic chip comprises two common reservoirs, four separation channels coupled to their respective pneumatic micropumps and two reference channels. Due to use of pressure as a driving force, the proposed method has no sample bias effect for separation. There is only one high-voltage supply needed for separation without relying on the number of channels, which is significant for high-throughput analysis, and the time for sample loading is shortened to 1 s. In addition, the integrated micropumps can provide the versatile interface for coupling with other function units to satisfy the complicated demands. The performance is verified by separation of DNA marker and Hepatitis B virus DNA samples. And this method is also expected to show the potential throughput for the DNA analysis in the field of disease diagnosis.

[Association between obesity and DNA methylation among the 7-16 year-old twins].

PubMed

Li, C X; Gao, Y; Gao, W J; Yu, C Q; Lyu, J; Lyu, R R; Duan, J L; Sun, Y; Guo, X H; Wang, S F; Zhou, B; Wang, G; Cao, W H; Li, L M

2018-04-10

Objective: On whole-genome scale, we tried to explore the correlation between obesity-related traits and DNA methylation sites, based on discordant monozygotic twin pairs. Methods: A total of 90 pairs of 6-17 year-old twins were recruited in Chaoyang district, Yanqing district and Fangshan district in Beijing in 2016. Information on twins was gathered through a self-designed questionnaire and results: from physical examination, including height, weight and waist circumference of the subjects under study. DNA methylation detection was chosen on the Illumina Human Methylation EPIC BeadChip. R 3.3.1 language was used to read the DNA methylation signal under quality control on samples and probes. Ebayes function of empirical Bayes paired moderated t -test was used to identify the differential methylated CpG sites (DMCs). VarFit function of empirical Bayes paired moderated Levene test was used to identify the differentially variables CpG sits (DVCs) in obese and normal groups. Results According to the obesity discordance criteria, we collected 23 pairs of twins (age range 7 to 16 years), including 12 male pairs. A total of 817 471 qualified CpG loci were included in the genome-wide correlation analysis. According to the significance level of FDR set as <0.05, no positive sites would meet this standard. When DMC CpG site cg05684382, with the smallest P value (1.26E-06) as on chromosome 12, the DVC CpG site cg26188191 with the smallest P value (6.44E-06) appeared in CMIP gene on chromosome 16. Conclusions: In this study, we analyzed the genome-wide DNA methylation and its correlation with obesity traits. After multiple testing corrections, no positive sites were found to have associated with obesity. However, results from the correlation analysis demonstrated sites cg05684382 (chr: 12) and cg26188191 (chr: 16) might have played a role in the development of obesity. This study provides a methodologic reference for the studies on discordance twins related problems.

Creating a Tiny Human Body on a Chip

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunsberger, Maren; Soscia, Dave; Moya, Monica

LLNL science communicator Maren Hunsberger takes us "Inside the Lab" to learn about the iChip (In-vitro Chip-based Human Investigational Platform) project at Lawrence Livermore National Laboratory. "One application of the iChip system would be to develop new pharmaceutical drugs," explains Dave Soscia, LLNL postdoc. "When you test in a mouse for example, it's not as close to the human system as you can get. If we can take human cells and put them on devices and actually mimic the structure and function of the organ systems in the human, we can actually replace animal testing and even make a bettermore » system for testing pharmaceutical drugs."« less

DNA MemoChip: Long-Term and High Capacity Information Storage and Select Retrieval.

PubMed

Stefano, George B; Wang, Fuzhou; Kream, Richard M

2018-02-26

Over the course of history, human beings have never stopped seeking effective methods for information storage. From rocks to paper, and through the past several decades of using computer disks, USB sticks, and on to the thin silicon "chips" and "cloud" storage of today, it would seem that we have reached an era of efficiency for managing innumerable and ever-expanding data. Astonishingly, when tracing this technological path, one realizes that our ancient methods of informational storage far outlast paper (10,000 vs. 1,000 years, respectively), let alone the computer-based memory devices that only last, on average, 5 to 25 years. During this time of fast-paced information generation, it becomes increasingly difficult for current storage methods to retain such massive amounts of data, and to maintain appropriate speeds with which to retrieve it, especially when in demand by a large number of users. Others have proposed that DNA-based information storage provides a way forward for information retention as a result of its temporal stability. It is now evident that DNA represents a potentially economical and sustainable mechanism for storing information, as demonstrated by its decoding from a 700,000 year-old horse genome. The fact that the human genome is present in a cell, containing also the varied mitochondrial genome, indicates DNA's great potential for large data storage in a 'smaller' space.

Sensitive and accurate identification of protein–DNA binding events in ChIP-chip assays using higher order derivative analysis

PubMed Central

Barrett, Christian L.; Cho, Byung-Kwan

2011-01-01

Immuno-precipitation of protein–DNA complexes followed by microarray hybridization is a powerful and cost-effective technology for discovering protein–DNA binding events at the genome scale. It is still an unresolved challenge to comprehensively, accurately and sensitively extract binding event information from the produced data. We have developed a novel strategy composed of an information-preserving signal-smoothing procedure, higher order derivative analysis and application of the principle of maximum entropy to address this challenge. Importantly, our method does not require any input parameters to be specified by the user. Using genome-scale binding data of two Escherichia coli global transcription regulators for which a relatively large number of experimentally supported sites are known, we show that ∼90% of known sites were resolved to within four probes, or ∼88 bp. Over half of the sites were resolved to within two probes, or ∼38 bp. Furthermore, we demonstrate that our strategy delivers significant quantitative and qualitative performance gains over available methods. Such accurate and sensitive binding site resolution has important consequences for accurately reconstructing transcriptional regulatory networks, for motif discovery, for furthering our understanding of local and non-local factors in protein–DNA interactions and for extending the usefulness horizon of the ChIP-chip platform. PMID:21051353

On-chip wavelength multiplexed detection of cancer DNA biomarkers in blood

PubMed Central

Cai, H.; Stott, M. A.; Ozcelik, D.; Parks, J. W.; Hawkins, A. R.; Schmidt, H.

2016-01-01

We have developed an optofluidic analysis system that processes biomolecular samples starting from whole blood and then analyzes and identifies multiple targets on a silicon-based molecular detection platform. We demonstrate blood filtration, sample extraction, target enrichment, and fluorescent labeling using programmable microfluidic circuits. We detect and identify multiple targets using a spectral multiplexing technique based on wavelength-dependent multi-spot excitation on an antiresonant reflecting optical waveguide chip. Specifically, we extract two types of melanoma biomarkers, mutated cell-free nucleic acids —BRAFV600E and NRAS, from whole blood. We detect and identify these two targets simultaneously using the spectral multiplexing approach with up to a 96% success rate. These results point the way toward a full front-to-back chip-based optofluidic compact system for high-performance analysis of complex biological samples. PMID:28058082

Development of an Integrated Chip for Automatic Tracking and Positioning Manipulation for Single Cell Lysis

PubMed Central

Young, Chao-Wang; Hsieh, Jia-Ling; Ay, Chyung

2012-01-01

This study adopted a microelectromechanical fabrication process to design a chip integrated with electroosmotic flow and dielectrophoresis force for single cell lysis. Human histiocytic lymphoma U937 cells were driven rapidly by electroosmotic flow and precisely moved to a specific area for cell lysis. By varying the frequency of AC power, 15 V AC at 1 MHz of frequency configuration achieved 100% cell lysing at the specific area. The integrated chip could successfully manipulate single cells to a specific position and lysis. The overall successful rate of cell tracking, positioning, and cell lysis is 80%. The average speed of cell driving was 17.74 μm/s. This technique will be developed for DNA extraction in biomolecular detection. It can simplify pre-treatment procedures for biotechnological analysis of samples. PMID:22736957

Development of an integrated chip for automatic tracking and positioning manipulation for single cell lysis.

PubMed

Young, Chao-Wang; Hsieh, Jia-Ling; Ay, Chyung

2012-01-01

This study adopted a microelectromechanical fabrication process to design a chip integrated with electroosmotic flow and dielectrophoresis force for single cell lysis. Human histiocytic lymphoma U937 cells were driven rapidly by electroosmotic flow and precisely moved to a specific area for cell lysis. By varying the frequency of AC power, 15 V AC at 1 MHz of frequency configuration achieved 100% cell lysing at the specific area. The integrated chip could successfully manipulate single cells to a specific position and lysis. The overall successful rate of cell tracking, positioning, and cell lysis is 80%. The average speed of cell driving was 17.74 μm/s. This technique will be developed for DNA extraction in biomolecular detection. It can simplify pre-treatment procedures for biotechnological analysis of samples.

Enhancing Results of Microarray Hybridizations Through Microagitation

PubMed Central

Toegl, Andreas; Kirchner, Roland; Gauer, Christoph; Wixforth, Achim

2003-01-01

Protein and DNA microarrays have become a standard tool in proteomics/genomics research. In order to guarantee fast and reproducible hybridization results, the diffusion limit must be overcome. Surface acoustic wave (SAW) micro-agitation chips efficiently agitate the smallest sample volumes (down to 10 μL and below) without introducing any dead volume. The advantages are reduced reaction time, increased signal-to-noise ratio, improved homogeneity across the microarray, and better slide-to-slide reproducibility. The SAW micromixer chips are the heart of the Advalytix ArrayBooster, which is compatible with all microarrays based on the microscope slide format. PMID:13678150

Analysis pipelines and packages for Infinium HumanMethylation450 BeadChip (450k) data

PubMed Central

Morris, Tiffany J.; Beck, Stephan

2015-01-01

The Illumina HumanMethylation450 BeadChip has become a popular platform for interrogating DNA methylation in epigenome-wide association studies (EWAS) and related projects as well as resource efforts such as the International Cancer Genome Consortium (ICGC) and the International Human Epigenome Consortium (IHEC). This has resulted in an exponential increase of 450k data in recent years and triggered the development of numerous integrated analysis pipelines and stand-alone packages. This review will introduce and discuss the currently most popular pipelines and packages and is particularly aimed at new 450k users. PMID:25233806

Error correcting code with chip kill capability and power saving enhancement

DOEpatents

Gara, Alan G [Mount Kisco, NY; Chen, Dong [Croton On Husdon, NY; Coteus, Paul W [Yorktown Heights, NY; Flynn, William T [Rochester, MN; Marcella, James A [Rochester, MN; Takken, Todd [Brewster, NY; Trager, Barry M [Yorktown Heights, NY; Winograd, Shmuel [Scarsdale, NY

2011-08-30

A method and system are disclosed for detecting memory chip failure in a computer memory system. The method comprises the steps of accessing user data from a set of user data chips, and testing the user data for errors using data from a set of system data chips. This testing is done by generating a sequence of check symbols from the user data, grouping the user data into a sequence of data symbols, and computing a specified sequence of syndromes. If all the syndromes are zero, the user data has no errors. If one of the syndromes is non-zero, then a set of discriminator expressions are computed, and used to determine whether a single or double symbol error has occurred. In the preferred embodiment, less than two full system data chips are used for testing and correcting the user data.

Test probe for surface mounted leadless chip carrier

DOEpatents

Meyer, Kerry L.; Topolewski, John

1989-05-23

A test probe for a surface mounted leadless chip carrier is disclosed. The probed includes specially designed connector pins which allow size reductions in the probe. A thermoplastic housing provides spring action to ensure good mechanical and electrical contact between the pins and the contact strips of a leadless chip carrier. Other features include flexible wires molded into the housing and two different types of pins alternately placed in the housing. These features allow fabrication of a smaller and simpler test probe.

Test probe for surface mounted leadless chip carrier

DOEpatents

Meyer, K.L.; Topolewski, J.

1987-10-02

A test probe for a surface mounted leadless chip carrier is disclosed. The probe includes specially designed connector pins which allow size reductions in the probe. A thermoplastic housing provides spring action to ensure good mechanical and electrical contact between the pins and the contact strips of a leadless chip carrier. Other features include flexible wires molded into the housing and two different types of pins alternately placed in the housing. These features allow fabrication of a smaller and simpler test probe. 1 fig.

Advanced Initiation Systems Manufacturing Level 2 Milestone Completion Summary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chow, R; Schmidt, M

2009-10-01

Milestone Description - Advanced Initiation Systems Detonator Design and Prototype. Milestone Grading Criteria - Design new generation chip slapper detonator and manufacture a prototype using advanced manufacturing processes, such as all-dry chip metallization and solvent-less flyer coatings. The advanced processes have been developed for manufacturing detonators with high material compatibility and reliability to support future LEPs, e.g. the B61, and new weapons systems. Perform velocimetry measurements to determine slapper velocity as a function of flight distance. A prototype detonator assembly and stripline was designed for low-energy chip slappers. Pictures of the prototype detonator and stripline are shown. All-dry manufacturing processesmore » were used to address compatibility issues. KCP metallized the chips in a physical vapor deposition system through precision-aligned shadow masks. LLNL deposited a solvent-less polyimide flyer with a processes called SLIP, which stands for solvent-less vapor deposition followed by in-situ polymerization. LANL manufactured the high-surface-area (HSA) high explosive (HE) pellets. Test fires of two chip slapper designs, radius and bowtie, were performed at LLNL in the High Explosives Application Facility (HEAF). Test fires with HE were conducted to establish the threshold firing voltages. pictures of the chip slappers before and after test fires are shown. Velocimetry tests were then performed to obtain slapper velocities at or above the threshold firing voltages. Figure 5 shows the slapper velocity as a function of distance and time at the threshold voltage, for both radius and bowtie bridge designs. Both designs were successful at initiating the HE at low energy levels. Summary of Accomplishments are: (1) All-dry process for chip manufacture developed; (2) Solventless process for slapper materials developed; (3) High-surface area explosive pellets developed; (4) High performance chip slappers developed; (5) Low-energy chip slapper detonator designs; and (6) Low-voltage threshold chip slapper detonator demonstrated.« less

Genomic analyses of tropical beef cattle fertility based on genotyping pools of Brahman cows with unknown pedigree.

PubMed

Reverter, A; Porto-Neto, L R; Fortes, M R S; McCulloch, R; Lyons, R E; Moore, S; Nicol, D; Henshall, J; Lehnert, S A

2016-10-01

We introduce an innovative approach to lowering the overall cost of obtaining genomic EBV (GEBV) and encourage their use in commercial extensive herds of Brahman beef cattle. In our approach, the DNA genotyping of cow herds from 2 independent properties was performed using a high-density bovine SNP chip on DNA from pooled blood samples, grouped according to the result of a pregnancy test following their first and second joining opportunities. For the DNA pooling strategy, 15 to 28 blood samples from the same phenotype and contemporary group were allocated to pools. Across the 2 properties, a total of 183 pools were created representing 4,164 cows. In addition, blood samples from 309 bulls from the same properties were also taken. After genotyping and quality control, 74,584 remaining SNP were used for analyses. Pools and individual DNA samples were related by means of a "hybrid" genomic relationship matrix. The pooled genotyping analysis of 2 large and independent commercial populations of tropical beef cattle was able to recover significant and plausible associations between SNP and pregnancy test outcome. We discuss 24 SNP with significant association ( < 1.0 × 10) and mapped within 40 kb of an annotated gene. We have established a method to estimate the GEBV in young herd bulls for a trait that is currently unable to be predicted at all. In summary, our novel approach allowed us to conduct genomic analyses of fertility in 2 large commercial Brahman herds managed under extensive pastoral conditions.

Integrated microfluidic systems for cell lysis, mixing/pumping and DNA amplification

NASA Astrophysics Data System (ADS)

Lee, Chia-Yen; Lee, Gwo-Bin; Lin, Jr-Lung; Huang, Fu-Chun; Liao, Chia-Sheng

2005-06-01

The present paper reports a fully automated microfluidic system for the DNA amplification process by integrating an electroosmotic pump, an active micromixer and an on-chip temperature control system. In this DNA amplification process, the cell lysis is initially performed in a micro cell lysis reactor. Extracted DNA samples, primers and reagents are then driven electroosmotically into a mixing region where they are mixed by the active micromixer. The homogeneous mixture is then thermally cycled in a micro-PCR (polymerase chain reaction) chamber to perform DNA amplification. Experimental results show that the proposed device can successfully automate the sample pretreatment operation for DNA amplification, thereby delivering significant time and effort savings. The new microfluidic system, which facilitates cell lysis, sample driving/mixing and DNA amplification, could provide a significant contribution to ongoing efforts to miniaturize bio-analysis systems by utilizing a simple fabrication process and cheap materials.

KRAS mutation detection in colorectal cancer by a commercially available gene chip array compares well with Sanger sequencing.

PubMed

French, Deborah; Smith, Andrew; Powers, Martin P; Wu, Alan H B

2011-08-17

Binding of a ligand to the epidermal growth factor receptor (EGFR) stimulates various intracellular signaling pathways resulting in cell cycle progression, proliferation, angiogenesis and apoptosis inhibition. KRAS is involved in signaling pathways including RAF/MAPK and PI3K and mutations in this gene result in constitutive activation of these pathways, independent of EGFR activation. Seven mutations in codons 12 and 13 of KRAS comprise around 95% of the observed human mutations, rendering monoclonal antibodies against EGFR (e.g. cetuximab and panitumumab) useless in treatment of colorectal cancer. KRAS mutation testing by two different methodologies was compared; Sanger sequencing and AutoGenomics INFINITI® assay, on DNA extracted from colorectal cancers. Out of 29 colorectal tumor samples tested, 28 were concordant between the two methodologies for the KRAS mutations that were detected in both assays with the INFINITI® assay detecting a mutation in one sample that was indeterminate by Sanger sequencing and a third methodology; single nucleotide primer extension. This study indicates the utility of the AutoGenomics INFINITI® methodology in a clinical laboratory setting where technical expertise or access to equipment for DNA sequencing does not exist. Copyright © 2011 Elsevier B.V. All rights reserved.

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs.

PubMed

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Zel, Jana; Gruden, Kristina

2008-10-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1-25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification.

Investigation of DNA sequence recognition by a streptomycete MarR family transcriptional regulator through surface plasmon resonance and X-ray crystallography

PubMed Central

Stevenson, Clare E. M.; Assaad, Aoun; Chandra, Govind; Le, Tung B. K.; Greive, Sandra J.; Bibb, Mervyn J.; Lawson, David M.

2013-01-01

Consistent with their complex lifestyles and rich secondary metabolite profiles, the genomes of streptomycetes encode a plethora of transcription factors, the vast majority of which are uncharacterized. Herein, we use Surface Plasmon Resonance (SPR) to identify and delineate putative operator sites for SCO3205, a MarR family transcriptional regulator from Streptomyces coelicolor that is well represented in sequenced actinomycete genomes. In particular, we use a novel SPR footprinting approach that exploits indirect ligand capture to vastly extend the lifetime of a standard streptavidin SPR chip. We define two operator sites upstream of sco3205 and a pseudopalindromic consensus sequence derived from these enables further potential operator sites to be identified in the S. coelicolor genome. We evaluate each of these through SPR and test the importance of the conserved bases within the consensus sequence. Informed by these results, we determine the crystal structure of a SCO3205-DNA complex at 2.8 Å resolution, enabling molecular level rationalization of the SPR data. Taken together, our observations support a DNA recognition mechanism involving both direct and indirect sequence readout. PMID:23748564

NAIMA: target amplification strategy allowing quantitative on-chip detection of GMOs

PubMed Central

Morisset, Dany; Dobnik, David; Hamels, Sandrine; Žel, Jana; Gruden, Kristina

2008-01-01

We have developed a novel multiplex quantitative DNA-based target amplification method suitable for sensitive, specific and quantitative detection on microarray. This new method named NASBA Implemented Microarray Analysis (NAIMA) was applied to GMO detection in food and feed, but its application can be extended to all fields of biology requiring simultaneous detection of low copy number DNA targets. In a first step, the use of tailed primers allows the multiplex synthesis of template DNAs in a primer extension reaction. A second step of the procedure consists of transcription-based amplification using universal primers. The cRNA product is further on directly ligated to fluorescent dyes labelled 3DNA dendrimers allowing signal amplification and hybridized without further purification on an oligonucleotide probe-based microarray for multiplex detection. Two triplex systems have been applied to test maize samples containing several transgenic lines, and NAIMA has shown to be sensitive down to two target copies and to provide quantitative data on the transgenic contents in a range of 0.1–25%. Performances of NAIMA are comparable to singleplex quantitative real-time PCR. In addition, NAIMA amplification is faster since 20 min are sufficient to achieve full amplification. PMID:18710880

Fabrication and characterization of high-K dielectric integrated silicon nanowire sensor for DNA sensing application (Conference Presentation)

NASA Astrophysics Data System (ADS)

Jayakumar, Ganesh; Legallais, Maxime; Hellström, Per-Erik; Mouis, Mireille; Stambouli, Valérie; Ternon, Céline; Östling, Mikael

2016-09-01

1D silicon nanowires (SiNW) are attractive for charge based DNA sensing applications due to their small size and large surface to volume ratio. An ideal portable biosensor is expected to have repeatable and reliable sensitivity, selectivity, low production cost and small feature size. Instead of using tools such as e-beam that are capital and time intensive, we propose a low cost CMOS self-aligned-double-patterning I-line lithography process to fabricate 60 nm wide SiNW. DNA probes are grafted on a thin dielectric layer that is deposited on top of the SiNW surface. Here we used HfO2 instead of the usual SiO2. Indeed, compared to SiO2, HfO2 has been reported to have higher amount of OH groups on its surface leading to enhanced signal quality. We also report preliminary biosensor characterizations. After HfO2 functionalization and single-stranded DNA probe grafting onto the SiNWs, the sensors were first put in contact with fluorophore labelled complementary DNA targets in order to test the efficiency of DNA hybridization optically. Then, a sequence of hybridization, de-hybridization and re-hybridization steps was followed by Id-Vg measurements in order to measure the electrical response of the sensors to target DNA as well as recycling capability. After each step, SiNW devices exhibited a threshold voltage shift larger than device-to-device dispersion, showing that both complementary DNA hybridization and de-hybridization can be electrically detected. These results are very encouraging as they open new frontiers for heterogeneous integration of liquid interacting array of nano sensors with CMOS circuits to fabricate a complete lab on chip.

Sequence information signal processor for local and global string comparisons

DOEpatents

Peterson, John C.; Chow, Edward T.; Waterman, Michael S.; Hunkapillar, Timothy J.

1997-01-01

A sequence information signal processing integrated circuit chip designed to perform high speed calculation of a dynamic programming algorithm based upon the algorithm defined by Waterman and Smith. The signal processing chip of the present invention is designed to be a building block of a linear systolic array, the performance of which can be increased by connecting additional sequence information signal processing chips to the array. The chip provides a high speed, low cost linear array processor that can locate highly similar global sequences or segments thereof such as contiguous subsequences from two different DNA or protein sequences. The chip is implemented in a preferred embodiment using CMOS VLSI technology to provide the equivalent of about 400,000 transistors or 100,000 gates. Each chip provides 16 processing elements, and is designed to provide 16 bit, two's compliment operation for maximum score precision of between -32,768 and +32,767. It is designed to provide a comparison between sequences as long as 4,194,304 elements without external software and between sequences of unlimited numbers of elements with the aid of external software. Each sequence can be assigned different deletion and insertion weight functions. Each processor is provided with a similarity measure device which is independently variable. Thus, each processor can contribute to maximum value score calculation using a different similarity measure.

High-throughput screening platform for engineered nanoparticle-mediated genotoxicity using CometChip technology.

PubMed

Watson, Christa; Ge, Jing; Cohen, Joel; Pyrgiotakis, Georgios; Engelward, Bevin P; Demokritou, Philip

2014-03-25

The likelihood of intentional and unintentional engineered nanoparticle (ENP) exposure has dramatically increased due to the use of nanoenabled products. Indeed, ENPs have been incorporated in many useful products and have enhanced our way of life. However, there are many unanswered questions about the consequences of nanoparticle exposures, in particular, with regard to their potential to damage the genome and thus potentially promote cancer. In this study, we present a high-throughput screening assay based upon the recently developed CometChip technology, which enables evaluation of single-stranded DNA breaks, abasic sites, and alkali-sensitive sites in cells exposed to ENPs. The strategic microfabricated, 96-well design and automated processing improves efficiency, reduces processing time, and suppresses user bias in comparison to the standard comet assay. We evaluated the versatility of this assay by screening five industrially relevant ENP exposures (SiO2, ZnO, Fe2O3, Ag, and CeO2) on both suspension human lymphoblastoid (TK6) and adherent Chinese hamster ovary (H9T3) cell lines. MTT and CyQuant NF assays were employed to assess cellular viability and proliferation after ENP exposure. Exposure to ENPs at a dose range of 5, 10, and 20 μg/mL induced dose-dependent increases in DNA damage and cytotoxicity. Genotoxicity profiles of ZnO>Ag>Fe2O3>CeO2>SiO2 in TK6 cells at 4 h and Ag>Fe2O3>ZnO>CeO2>SiO2 in H9T3 cells at 24 h were observed. The presented CometChip platform enabled efficient and reliable measurement of ENP-mediated DNA damage, therefore demonstrating the efficacy of this powerful tool in nanogenotoxicity studies.

Impacts of chipping on surrogates for the longhorned beetle Anoplophora glabripennis (Coleoptera: Cerambycidae) in logs.

PubMed

Wang, B; Mastro, V C; McLane, W H

2000-12-01

As part of the eradication program for recent introductions of the longhorned beetle Anoplophora glabripennis (Motschulsky) in the United States, wood from infested trees is chipped and incinerated. Two tests were conducted to evaluate the efficiency of chipping wood from infested trees on the survival of the beetle. In the first test, plastic worms were used as surrogates for larvae of the beetle. Plastic worms of different sizes were placed in holes drilled in logs of sugar maple, Acer saccharum Marsh. In a second test, in addition to plastic worms, we used different instars and pupae of gypsy moth, Lymantria dispar (L.) (Lepidoptera: Lymantriidae); larvae of the beetle Phyllophaga annina Lewis (Coleoptera: Scarabaeidae); and larvae of an unidentified weevil (Coleoptera: Curculionidae). Although chipping did not result in an obvious damage to all plastic worms, it did kill all larvae and pupae of insects placed in holes of maple logs. The overall recovery rate (percent recovered) for the plastic worms was 96% in the first (1997) test, and 71 and 98% for 10 and 40 mm long plastic worms in the second (1998) test, respectively. Logistic regression analysis of the data from the first experiment indicates that larger worms receive more severe damage. Size of logs did not have a significant effect on the level of damage received by plastic worms. All recovered insects were severely damaged after chipping logs and we could not determine recovery rates. Results of the two tests indicate that chipping wood from infested trees without incineration of the resulting chips provides a highly effective method for destroying wood inhabiting insect pests such as A. glabripennis. The elimination of incineration saves considerable resources while effectively eliminating risks associated with movements of wood containing living wood-boring insects.

Curcumin inhibits hepatitis B virus infection by down-regulating cccDNA-bound histone acetylation.

PubMed

Wei, Zhi-Qiang; Zhang, Yong-Hong; Ke, Chang-Zheng; Chen, Hong-Xia; Ren, Pan; He, Yu-Lin; Hu, Pei; Ma, De-Qiang; Luo, Jie; Meng, Zhong-Ji

2017-09-14

To investigate the potential effect of curcumin on hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) and the underlying mechanism. A HepG2.2.15 cell line stably transfected with HBV was treated with curcumin, and HBV surface antigen (HBsAg) and e antigen (HBeAg) expression levels were assessed by ELISA. Intracellular HBV DNA replication intermediates and cccDNA were detected by Southern blot and real-time PCR, respectively. The acetylation levels of histones H3 and H4 were measured by Western blot. H3/H4-bound cccDNA was detected by chromatin immunoprecipitation (ChIP) assays. The deacetylase inhibitors trichostatin A and sodium butyrate were used to study the mechanism of action for curcumin. Additionally, short interfering RNAs (siRNAs) targeting HBV were tested along with curcumin. Curcumin treatment led to time- and dose-dependent reductions in HBsAg and HBeAg expression and significant reductions in intracellular HBV DNA replication intermediates and HBV cccDNA. After treatment with 20 μmol/L curcumin for 2 d, HBsAg and cccDNA levels in HepG2.2.15 cells were reduced by up to 57.7% ( P < 0.01) and 75.5% ( P < 0.01), respectively, compared with levels in non-treated cells. Meanwhile, time- and dose-dependent reductions in the histone H3 acetylation levels were also detected upon treatment with curcumin, accompanied by reductions in H3- and H4-bound cccDNA. Furthermore, the deacetylase inhibitors trichostatin A and sodium butyrate could block the effects of curcumin. Additionally, transfection of siRNAs targeting HBV enhanced the inhibitory effects of curcumin. Curcumin inhibits HBV gene replication via down-regulation of cccDNA-bound histone acetylation and has the potential to be developed as a cccDNA-targeting antiviral agent for hepatitis B.

Quantifying the benefits of improved rolling of chip seals : final report, June 2008.

DOT National Transportation Integrated Search

2008-06-01

This report presents an improvement in the rolling protocol for chip seals based on an evaluation of aggregate : retention performance and aggregate embedment depth. The flip-over test (FOT), Vialit test, modified sand circle : test, digital image pr...

Electrophoretic and field-effect graphene for all-electrical DNA array technology.

PubMed

Xu, Guangyu; Abbott, Jeffrey; Qin, Ling; Yeung, Kitty Y M; Song, Yi; Yoon, Hosang; Kong, Jing; Ham, Donhee

2014-09-05

Field-effect transistor biomolecular sensors based on low-dimensional nanomaterials boast sensitivity, label-free operation and chip-scale construction. Chemical vapour deposition graphene is especially well suited for multiplexed electronic DNA array applications, since its large two-dimensional morphology readily lends itself to top-down fabrication of transistor arrays. Nonetheless, graphene field-effect transistor DNA sensors have been studied mainly at single-device level. Here we create, from chemical vapour deposition graphene, field-effect transistor arrays with two features representing steps towards multiplexed DNA arrays. First, a robust array yield--seven out of eight transistors--is achieved with a 100-fM sensitivity, on par with optical DNA microarrays and at least 10 times higher than prior chemical vapour deposition graphene transistor DNA sensors. Second, each graphene acts as an electrophoretic electrode for site-specific probe DNA immobilization, and performs subsequent site-specific detection of target DNA as a field-effect transistor. The use of graphene as both electrode and transistor suggests a path towards all-electrical multiplexed graphene DNA arrays.

CHIPPING FRACTURE RESISTANCE OF DENTURE TOOTH MATERIALS

PubMed Central

Quinn, G. D.; Giuseppetti, A. A.; Hoffman, K. H.

2014-01-01

Objective The applicability of the edge chipping method to denture tooth materials was assessed. These are softer materials than those usually tested by edge chipping. The edge chipping fracture resistances of polymethylmethacrylate (PMMA) based and two filled resin composite denture tooth materials were compared. Methods An edge chipping machine was used to chip rectangular blocks and flattened anterior denture teeth. Force versus edge distance data were collected over a broad range of forces and distances. Between 20 and 65 chips were made per condition depending upon the material, the scatter, and the indenter type. Different indenter types were used including Rockwell C, sharp conical 120°, Knoop, and Vickers. The edge toughness, Te, was evaluated for different indenter types. Results The edge chipping data collected on the blocks matched the data collected from flattened teeth. High scatter, particularly at large distances and loads, meant that many tests (up to 64) were necessary to compare the denture tooth materials and to ascertain the appropriate data trends. A linear force – distance trend analysis was adequate for comparing these materials. A power law trend might be more appropriate, but the large scatter obscured the definitive determination of the precise trend. Different indenters produce different linear trends, with the ranking of: sharp conical 120°, Rockwell C, and Knoop, from lowest to highest edge toughness. Vickers indenter data were extremely scattered and a sensible trend could not be obtained. Edge toughness was inversely correlated to hardness. Significance Edge chipping data collected either from simple laboratory scale test blocks or from actual denture teeth may be used to evaluate denture materials. The edge chipping method’s applicability has been extended to another class of restorative materials. PMID:24674342

AN ECOLOGICAL PERSPECTIVE OF GENOMICS: ASSESSING ECOLOGICAL RISK THROUGH PARTNERSHIPS

EPA Science Inventory

A workshop attended by approximately 60 scientists from around the world met to discuss the application of new molecular biology tools to issues in environmental toxicology and chemistry. With the sequencing of the human genome, development of microarrays and DNA chips, and devel...

Scalable Low-Cost Fabrication of Disposable Paper Sensors for DNA Detection

PubMed Central

2015-01-01

Controlled integration of features that enhance the analytical performance of a sensor chip is a challenging task in the development of paper sensors. A critical issue in the fabrication of low-cost biosensor chips is the activation of the device surface in a reliable and controllable manner compatible with large-scale production. Here, we report stable, well-adherent, and repeatable site-selective deposition of bioreactive amine functionalities and biorepellant polyethylene glycol-like (PEG) functionalities on paper sensors by aerosol-assisted, atmospheric-pressure, plasma-enhanced chemical vapor deposition. This approach requires only 20 s of deposition time, compared to previous reports on cellulose functionalization, which takes hours. A detailed analysis of the near-edge X-ray absorption fine structure (NEXAFS) and its sensitivity to the local electronic structure of the carbon and nitrogen functionalities. σ*, π*, and Rydberg transitions in C and N K-edges are presented. Application of the plasma-processed paper sensors in DNA detection is also demonstrated. PMID:25423585

Scalable Low-Cost Fabrication of Disposable Paper Sensors for DNA Detection

DOE PAGES

Gandhiraman, Ram P.; Nordlund, Dennis; Jayan, Vivek; ...

2014-11-25

Controlled integration of features that enhance the analytical performance of a sensor chip is a challenging task in the development of paper sensors. A critical issue in the fabrication of low-cost biosensor chips is the activation of the device surface in a reliable and controllable manner compatible with large-scale production. Here, we report stable, well-adherent, and repeatable site-selective deposition of bioreactive amine functionalities and biorepellant polyethylene glycol-like (PEG) functionalities on paper sensors by aerosol-assisted, atmospheric-pressure, plasma-enhanced chemical vapor deposition. This approach requires only 20 s of deposition time, compared to previous reports on cellulose functionalization, which takes hours. We presentmore » a detailed analysis of the near-edge X-ray absorption fine structure (NEXAFS) and its sensitivity to the local electronic structure of the carbon and nitrogen functionalities. σ*, π*, and Rydberg transitions in C and N K-edges. Lastly, application of the plasma-processed paper sensors in DNA detection is also demonstrated.« less

A Decade of Boon or Burden: What Has the CHIP Ever Done for Cellular Protein Quality Control Mechanism Implicated in Neurodegeneration and Aging?

PubMed Central

Joshi, Vibhuti; Amanullah, Ayeman; Upadhyay, Arun; Mishra, Ribhav; Kumar, Amit; Mishra, Amit

2016-01-01

Cells regularly synthesize new proteins to replace old and abnormal proteins for normal cellular functions. Two significant protein quality control pathways inside the cellular milieu are ubiquitin proteasome system (UPS) and autophagy. Autophagy is known for bulk clearance of cytoplasmic aggregated proteins, whereas the specificity of protein degradation by UPS comes from E3 ubiquitin ligases. Few E3 ubiquitin ligases, like C-terminus of Hsc70-interacting protein (CHIP) not only take part in protein quality control pathways, but also plays a key regulatory role in other cellular processes like signaling, development, DNA damage repair, immunity and aging. CHIP targets misfolded proteins for their degradation through proteasome, as well as autophagy; simultaneously, with the help of chaperones, it also regulates folding attempts for misfolded proteins. The broad range of CHIP substrates and their associations with multiple pathologies make it a key molecule to work upon and focus for future therapeutic interventions. E3 ubiquitin ligase CHIP interacts and degrades many protein inclusions formed in neurodegenerative diseases. The presence of CHIP at various nodes of cellular protein-protein interaction network presents this molecule as a potential candidate for further research. In this review, we have explored a wide range of functionality of CHIP inside cells by a detailed presentation of its co-chaperone, E3 and E4 enzyme like functions, with central focus on its protein quality control roles in neurodegenerative diseases. We have also raised many unexplored but expected fundamental questions regarding CHIP functions, which generate hopes for its future applications in research, as well as drug discovery. PMID:27757073

Chip and scrub seal field test results for Hwy 17 and Hwy 35.

DOT National Transportation Integrated Search

2009-11-09

This report contains field test results from two pavements located in Mississippi containing chip seals and scrub seals. Limestone aggregate from the same source was used with PASS-CR emulsion. The pavements were tested at three intervals. One or bot...

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes.

PubMed

Fredlake, Christopher P; Hert, Daniel G; Kan, Cheuk-Wai; Chiesl, Thomas N; Root, Brian E; Forster, Ryan E; Barron, Annelise E

2008-01-15

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require approximately 70 min to deliver approximately 650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered "hybrid" mechanism of DNA electromigration, in which DNA molecules alternate rapidly between repeating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs.

Ultrafast DNA sequencing on a microchip by a hybrid separation mechanism that gives 600 bases in 6.5 minutes

PubMed Central

Fredlake, Christopher P.; Hert, Daniel G.; Kan, Cheuk-Wai; Chiesl, Thomas N.; Root, Brian E.; Forster, Ryan E.; Barron, Annelise E.

2008-01-01

To realize the immense potential of large-scale genomic sequencing after the completion of the second human genome (Venter's), the costs for the complete sequencing of additional genomes must be dramatically reduced. Among the technologies being developed to reduce sequencing costs, microchip electrophoresis is the only new technology ready to produce the long reads most suitable for the de novo sequencing and assembly of large and complex genomes. Compared with the current paradigm of capillary electrophoresis, microchip systems promise to reduce sequencing costs dramatically by increasing throughput, reducing reagent consumption, and integrating the many steps of the sequencing pipeline onto a single platform. Although capillary-based systems require ≈70 min to deliver ≈650 bases of contiguous sequence, we report sequencing up to 600 bases in just 6.5 min by microchip electrophoresis with a unique polymer matrix/adsorbed polymer wall coating combination. This represents a two-thirds reduction in sequencing time over any previously published chip sequencing result, with comparable read length and sequence quality. We hypothesize that these ultrafast long reads on chips can be achieved because the combined polymer system engenders a recently discovered “hybrid” mechanism of DNA electromigration, in which DNA molecules alternate rapidly between reptating through the intact polymer network and disrupting network entanglements to drag polymers through the solution, similar to dsDNA dynamics we observe in single-molecule DNA imaging studies. Most importantly, these results reveal the surprisingly powerful ability of microchip electrophoresis to provide ultrafast Sanger sequencing, which will translate to increased system throughput and reduced costs. PMID:18184818

Proteomics to study DNA-bound and chromatin-associated gene regulatory complexes

PubMed Central

Wierer, Michael; Mann, Matthias

2016-01-01

High-resolution mass spectrometry (MS)-based proteomics is a powerful method for the identification of soluble protein complexes and large-scale affinity purification screens can decode entire protein interaction networks. In contrast, protein complexes residing on chromatin have been much more challenging, because they are difficult to purify and often of very low abundance. However, this is changing due to recent methodological and technological advances in proteomics. Proteins interacting with chromatin marks can directly be identified by pulldowns with synthesized histone tails containing posttranslational modifications (PTMs). Similarly, pulldowns with DNA baits harbouring single nucleotide polymorphisms or DNA modifications reveal the impact of those DNA alterations on the recruitment of transcription factors. Accurate quantitation – either isotope-based or label free – unambiguously pinpoints proteins that are significantly enriched over control pulldowns. In addition, protocols that combine classical chromatin immunoprecipitation (ChIP) methods with mass spectrometry (ChIP-MS) target gene regulatory complexes in their in-vivo context. Similar to classical ChIP, cells are crosslinked with formaldehyde and chromatin sheared by sonication or nuclease digested. ChIP-MS baits can be proteins in tagged or endogenous form, histone PTMs, or lncRNAs. Locus-specific ChIP-MS methods would allow direct purification of a single genomic locus and the proteins associated with it. There, loci can be targeted either by artificial DNA-binding sites and corresponding binding proteins or via proteins with sequence specificity such as TAL or nuclease deficient Cas9 in combination with a specific guide RNA. We predict that advances in MS technology will soon make such approaches generally applicable tools in epigenetics. PMID:27402878

Chip-Based Sensors for Disease Diagnosis

NASA Astrophysics Data System (ADS)

Fang, Zhichao

Nucleic acid analysis is one of the most important disease diagnostic approaches in medical practice, and has been commonly used in cancer biomarker detection, bacterial speciation and many other fields in laboratory. Currently, the application of powerful research methods for genetic analysis, including the polymerase chain reaction (PCR), DNA sequencing, and gene expression profiling using fluorescence microarrays, are not widely used in hospitals and extended-care units due to high-cost, long detection times, and extensive sample preparation. Bioassays, especially chip-based electrochemical sensors, may be suitable for the next generation of rapid, sensitive, and multiplexed detection tools. Herein, we report three different microelectrode platforms with capabilities enabled by nano- and microtechnology: nanoelectrode ensembles (NEEs), nanostructured microelectrodes (NMEs), and hierarchical nanostructured microelectrodes (HNMEs), all of which are able to directly detect unpurified RNA in clinical samples without enzymatic amplification. Biomarkers that are cancer and infectious disease relevant to clinical medicine were chosen to be the targets. Markers were successfully detected with clinically-relevant sensitivity. Using peptide nucleic acids (PNAs) as probes and an electrocatalytic reporter system, NEEs were able to detect prostate cancer-related gene fusions in tumor tissue samples with 100 ng of RNA. The development of NMEs improved the sensitivity of the assay further to 10 aM of DNA target, and multiplexed detection of RNA sequences of different prostate cancer-related gene fusion types was achieved on the chip-based NMEs platform. An HNMEs chip integrated with a bacterial lysis device was able to detect as few as 25 cfu bacteria in 30 minutes and monitor the detection in real time. Bacterial detection could also be performed in neat urine samples. The development of these versatile clinical diagnostic tools could be extended to the detection of various cancers, genetic, and infectious diseases.

A Microwell-Printing Fabrication Strategy for the On-Chip Templated Biosynthesis of Protein Microarrays for Surface Plasmon Resonance Imaging

PubMed Central

Manuel, Gerald; Lupták, Andrej; Corn, Robert M.

2017-01-01

A two-step templated, ribosomal biosynthesis/printing method for the fabrication of protein microarrays for surface plasmon resonance imaging (SPRI) measurements is demonstrated. In the first step, a sixteen component microarray of proteins is created in microwells by cell free on chip protein synthesis; each microwell contains both an in vitro transcription and translation (IVTT) solution and 350 femtomoles of a specific DNA template sequence that together are used to create approximately 40 picomoles of a specific hexahistidine-tagged protein. In the second step, the protein microwell array is used to contact print one or more protein microarrays onto nitrilotriacetic acid (NTA)-functionalized gold thin film SPRI chips for real-time SPRI surface bioaffinity adsorption measurements. Even though each microwell array element only contains approximately 40 picomoles of protein, the concentration is sufficiently high for the efficient bioaffinity adsorption and capture of the approximately 100 femtomoles of hexahistidine-tagged protein required to create each SPRI microarray element. As a first example, the protein biosynthesis process is verified with fluorescence imaging measurements of a microwell array containing His-tagged green fluorescent protein (GFP), yellow fluorescent protein (YFP) and mCherry (RFP), and then the fidelity of SPRI chips printed from this protein microwell array is ascertained by measuring the real-time adsorption of various antibodies specific to these three structurally related proteins. This greatly simplified two-step synthesis/printing fabrication methodology eliminates most of the handling, purification and processing steps normally required in the synthesis of multiple protein probes, and enables the rapid fabrication of SPRI protein microarrays from DNA templates for the study of protein-protein bioaffinity interactions. PMID:28706572

Effect of thermal cycling ramp rate on CSP assembly reliability

NASA Technical Reports Server (NTRS)

Ghaffarian, R.

2001-01-01

A JPL-led chip scale package consortium of enterprises recently joined together to pool in-kind resources for developing the quality and reliability of chip scale packages for a variety of projects. The experience of the consortium in building more than 150 test vehicle assemblies, single and double sided multilayer PWBs, and the environmental test results has now been published as a chip scale package guidelines document.

DNA methylation profiling for a confirmatory test for blood, saliva, semen, vaginal fluid and menstrual blood.

PubMed

Lee, Hwan Young; Jung, Sang-Eun; Lee, Eun Hee; Yang, Woo Ick; Shin, Kyoung-Jin

2016-09-01

The ability to predict the type of tissues or cells from molecular profiles of crime scene samples has important practical implications in forensics. A previously reported multiplex assay using DNA methylation markers could only discriminate between 4 types of body fluids: blood, saliva, semen, and the body fluid which originates from female reproductive organ. In the present study, we selected 15 menstrual blood-specific CpG marker candidates based on analysis of 12 genome-wide DNA methylation profiles of vaginal fluid and menstrual blood. The menstrual blood-specificity of the candidate markers was confirmed by comparison with HumanMethylation450 BeadChip array data obtained for 58 samples including 12 blood, 12 saliva, 12 semen, 3 vaginal fluid, and 19 skin epidermis samples. Among 15CpG marker candidates, 3 were located in the promoter region of the SLC26A10 gene, and 2 of them (cg09696411 and cg18069290) showed high menstrual blood specificity. DNA methylation at the 2CpG markers was further tested by targeted bisulfite sequencing of 461 additional samples including 49 blood, 52 saliva, 34 semen, 125 vaginal fluid, and 201 menstrual blood. Because the 2 markers showed menstrual blood-specific methylation patterns, we modified our previous multiplex methylation SNaPshot reaction to include these 2 markers. In addition, a blood marker cg01543184 with cross reactivity to semen was replaced with cg08792630, and a semen-specific unmethylation marker cg17621389 was removed. The resultant multiplex methylation SNaPshot allowed positive identification of blood, saliva, semen, vaginal fluid and menstrual blood using the 9CpG markers which show a methylation signal only in the target body fluids. Because of the complexity in cell composition, menstrual bloods produced DNA methylation profiles that vary with menstrual cycle and sample collection methods, which are expected to provide more insight into forensic menstrual blood test. Moreover, because the developed multiplex methylation SNaPshot reaction includes the 4CpG markers of which specificities have been confirmed by multiple studies, it will facilitate confirmatory tests for body fluids that are frequently observed in forensic casework. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja

2006-06-16

The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips wasmore » three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation.« less

ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.

PubMed

Landt, Stephen G; Marinov, Georgi K; Kundaje, Anshul; Kheradpour, Pouya; Pauli, Florencia; Batzoglou, Serafim; Bernstein, Bradley E; Bickel, Peter; Brown, James B; Cayting, Philip; Chen, Yiwen; DeSalvo, Gilberto; Epstein, Charles; Fisher-Aylor, Katherine I; Euskirchen, Ghia; Gerstein, Mark; Gertz, Jason; Hartemink, Alexander J; Hoffman, Michael M; Iyer, Vishwanath R; Jung, Youngsook L; Karmakar, Subhradip; Kellis, Manolis; Kharchenko, Peter V; Li, Qunhua; Liu, Tao; Liu, X Shirley; Ma, Lijia; Milosavljevic, Aleksandar; Myers, Richard M; Park, Peter J; Pazin, Michael J; Perry, Marc D; Raha, Debasish; Reddy, Timothy E; Rozowsky, Joel; Shoresh, Noam; Sidow, Arend; Slattery, Matthew; Stamatoyannopoulos, John A; Tolstorukov, Michael Y; White, Kevin P; Xi, Simon; Farnham, Peggy J; Lieb, Jason D; Wold, Barbara J; Snyder, Michael

2012-09-01

Chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) has become a valuable and widely used approach for mapping the genomic location of transcription-factor binding and histone modifications in living cells. Despite its widespread use, there are considerable differences in how these experiments are conducted, how the results are scored and evaluated for quality, and how the data and metadata are archived for public use. These practices affect the quality and utility of any global ChIP experiment. Through our experience in performing ChIP-seq experiments, the ENCODE and modENCODE consortia have developed a set of working standards and guidelines for ChIP experiments that are updated routinely. The current guidelines address antibody validation, experimental replication, sequencing depth, data and metadata reporting, and data quality assessment. We discuss how ChIP quality, assessed in these ways, affects different uses of ChIP-seq data. All data sets used in the analysis have been deposited for public viewing and downloading at the ENCODE (http://encodeproject.org/ENCODE/) and modENCODE (http://www.modencode.org/) portals.

ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia

PubMed Central

Landt, Stephen G.; Marinov, Georgi K.; Kundaje, Anshul; Kheradpour, Pouya; Pauli, Florencia; Batzoglou, Serafim; Bernstein, Bradley E.; Bickel, Peter; Brown, James B.; Cayting, Philip; Chen, Yiwen; DeSalvo, Gilberto; Epstein, Charles; Fisher-Aylor, Katherine I.; Euskirchen, Ghia; Gerstein, Mark; Gertz, Jason; Hartemink, Alexander J.; Hoffman, Michael M.; Iyer, Vishwanath R.; Jung, Youngsook L.; Karmakar, Subhradip; Kellis, Manolis; Kharchenko, Peter V.; Li, Qunhua; Liu, Tao; Liu, X. Shirley; Ma, Lijia; Milosavljevic, Aleksandar; Myers, Richard M.; Park, Peter J.; Pazin, Michael J.; Perry, Marc D.; Raha, Debasish; Reddy, Timothy E.; Rozowsky, Joel; Shoresh, Noam; Sidow, Arend; Slattery, Matthew; Stamatoyannopoulos, John A.; Tolstorukov, Michael Y.; White, Kevin P.; Xi, Simon; Farnham, Peggy J.; Lieb, Jason D.; Wold, Barbara J.; Snyder, Michael

2012-01-01

Chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) has become a valuable and widely used approach for mapping the genomic location of transcription-factor binding and histone modifications in living cells. Despite its widespread use, there are considerable differences in how these experiments are conducted, how the results are scored and evaluated for quality, and how the data and metadata are archived for public use. These practices affect the quality and utility of any global ChIP experiment. Through our experience in performing ChIP-seq experiments, the ENCODE and modENCODE consortia have developed a set of working standards and guidelines for ChIP experiments that are updated routinely. The current guidelines address antibody validation, experimental replication, sequencing depth, data and metadata reporting, and data quality assessment. We discuss how ChIP quality, assessed in these ways, affects different uses of ChIP-seq data. All data sets used in the analysis have been deposited for public viewing and downloading at the ENCODE (http://encodeproject.org/ENCODE/) and modENCODE (http://www.modencode.org/) portals. PMID:22955991

Computational Identification of Diverse Mechanisms Underlying Transcription Factor-DNA Occupancy

PubMed Central

Cheng, Qiong; Kazemian, Majid; Pham, Hannah; Blatti, Charles; Celniker, Susan E.; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

2013-01-01

ChIP-based genome-wide assays of transcription factor (TF) occupancy have emerged as a powerful, high-throughput method to understand transcriptional regulation, especially on a global scale. This has led to great interest in the underlying biochemical mechanisms that direct TF-DNA binding, with the ultimate goal of computationally predicting a TF's occupancy profile in any cellular condition. In this study, we examined the influence of various potential determinants of TF-DNA binding on a much larger scale than previously undertaken. We used a thermodynamics-based model of TF-DNA binding, called “STAP,” to analyze 45 TF-ChIP data sets from Drosophila embryonic development. We built a cross-validation framework that compares a baseline model, based on the ChIP'ed (“primary”) TF's motif, to more complex models where binding by secondary TFs is hypothesized to influence the primary TF's occupancy. Candidates interacting TFs were chosen based on RNA-SEQ expression data from the time point of the ChIP experiment. We found widespread evidence of both cooperative and antagonistic effects by secondary TFs, and explicitly quantified these effects. We were able to identify multiple classes of interactions, including (1) long-range interactions between primary and secondary motifs (separated by ≤150 bp), suggestive of indirect effects such as chromatin remodeling, (2) short-range interactions with specific inter-site spacing biases, suggestive of direct physical interactions, and (3) overlapping binding sites suggesting competitive binding. Furthermore, by factoring out the previously reported strong correlation between TF occupancy and DNA accessibility, we were able to categorize the effects into those that are likely to be mediated by the secondary TF's effect on local accessibility and those that utilize accessibility-independent mechanisms. Finally, we conducted in vitro pull-down assays to test model-based predictions of short-range cooperative interactions, and found that seven of the eight TF pairs tested physically interact and that some of these interactions mediate cooperative binding to DNA. PMID:23935523

Performance oriented guidance for Mississippi chip seals - volume II.

DOT National Transportation Integrated Search

2013-12-01

A laboratory and field study was conducted related to long term chip seal performance. This reports primary : objective was to initiate development of a long term performance (LTP) test protocol for chip seals focused on : aggregate retention. Key...

Flip-chip bonded optoelectronic integration based on ultrathin silicon (UTSi) CMOS

NASA Astrophysics Data System (ADS)

Hong, Sunkwang; Ho, Tawei; Zhang, Liping; Sawchuk, Alexander A.

2003-06-01

We describe the design and test of flip-chip bonded optoelectronic CMOS devices based on Peregrine Semiconductor's 0.5 micron Ultra-Thin Silicon on sapphire (UTSi) technology. The UTSi process eliminates the substrate leakage that typically results in crosstalk and reduces parasitic capacitance to the substrate, providing many benefits compared to bulk silicon CMOS. The low-loss synthetic sapphire substrate is optically transparent and has a coefficient of thermal expansion suitable for flip-chip bonding of vertical cavity surface emitting lasers (VCSELs) and detectors. We have designed two different UTSi CMOS chips. One contains a flip-chip bonded 1 x 4 photodiode array, a receiver array, a double edge triggered D-flip flop-based 2047-pattern pseudo random bit stream (PRBS) generator and a quadrature-phase LC-voltage controlled oscillator (VCO). The other chip contains a flip-chip bonded 1 x 4 VCSEL array, a driver array based on high-speed low-voltage differential signals (LVDS) and a full-balanced differential LC-VCO. Each VCSEL driver and receiver has individual input and bias voltage adjustments. Each UTSi chip is mounted on different printed circuit boards (PCBs) which have holes with about 1 mm radius for optical output and input paths through the sapphire substrate. We discuss preliminary testing of these chips.

Multichannel microfluidic chip for rapid and reliable trapping and imaging plant-parasitic nematodes

NASA Astrophysics Data System (ADS)

Amrit, Ratthasart; Sripumkhai, Witsaroot; Porntheeraphat, Supanit; Jeamsaksiri, Wutthinan; Tangchitsomkid, Nuchanart; Sutapun, Boonsong

2013-05-01

Faster and reliable testing technique to count and identify nematode species resided in plant roots is therefore essential for export control and certification. This work proposes utilizing a multichannel microfluidic chip with an integrated flow-through microfilter to retain the nematodes in a trapping chamber. When trapped, it is rather simple and convenient to capture images of the nematodes and later identify their species by a trained technician. Multiple samples can be tested in parallel using the proposed microfluidic chip therefore increasing number of samples tested per day.

Organ-on-a-chip: development and clinical prospects toward toxicity assessment with an emphasis on bone marrow.

PubMed

Kim, Jeehye; Lee, Hanna; Selimović, Šeila; Gauvin, Robert; Bae, Hojae

2015-05-01

Conventional approaches for toxicity evaluation of drugs and chemicals, such as animal tests, can be impractical due to the large experimental scale and the immunological differences between species. Organ-on-a-chip models have recently been recognized as a prominent alternative to conventional toxicity tests aiming to simulate the human in vivo physiology. This review focuses on the organ-on-a-chip applications for high-throughput screening of candidate drugs against toxicity, with a particular emphasis on bone-marrow-on-a-chip. Studies in which organ-on-a-chip models have been developed and utilized to maximize the efficiency and predictability in toxicity assessment are introduced. The potential of these devices to replace tests of acute systemic toxicity in animals, and the challenges that are inherent in simulating the human immune system are also discussed. As a promising approach to overcome the limitations, we further focus on an in-depth analysis of the development of bone-marrow-on-a-chip that is capable of simulating human immune responses against external stimuli due to the key roles of marrow in immune systems with hematopoietic activities. Owing to the complex interactions between hematopoietic stem cells and marrow microenvironments, precise control of both biochemical and physical niches that are critical in maintenance of hematopoiesis remains a key challenge. Thus, recently developed bone-marrow-on-a-chip models support immunogenicity and immunotoxicity testing in long-term cultivation with repeated antigen stimulation. In this review, we provide an overview of clinical studies that have been carried out on bone marrow transplants in patients with immune-related diseases and future aspects of clinical and pharmaceutical application of bone-marrow-on-a-chip.

MOBE-ChIP: Probing Cell Type-Specific Binding Through Large-Scale Chromatin Immunoprecipitation.

PubMed

Wang, Shenqi; Lau, On Sun

2018-01-01

In multicellular organisms, the initiation and maintenance of specific cell types often require the activity of cell type-specific transcriptional regulators. Understanding their roles in gene regulation is crucial but probing their DNA targets in vivo, especially in a genome-wide manner, remains a technical challenge with their limited expression. To improve the sensitivity of chromatin immunoprecipitation (ChIP) for detecting the cell type-specific signals, we have developed the Maximized Objects for Better Enrichment (MOBE)-ChIP, where ChIP is performed at a substantially larger experimental scale and under low background conditions. Here, we describe the procedure in the study of transcription factors in the model plant Arabidopsis. However, with some modifications, the technique should also be implemented in other systems. Besides cell type-specific studies, MOBE-ChIP can also be used as a general strategy to improve ChIP signals.

From sample-to-answer: integrated genotyping and immunological analysis microfluidic platforms for the diagnostic and treatment of coeliac disease

NASA Astrophysics Data System (ADS)

Jung, M.; Höth, J.; Erwes, J.; Latta, D.; Strobach, X.; Hansen-Hagge, T.; Klemm, R.; Gärtner, C.; Demiris, T. M.; O'Sullivan, C.; Ritzi-Lehnert, M.; Drese, K. S.

2011-02-01

Taking advantage of microfluidics technology, a Lab-on-Chip system was developed offering the possibility of performing HLA (Human Leukocyte Antigen) typing to test genetic predisposition to coeliac disease and measure the level of immunodeficiency at the point-of-care. These analysis procedures are implemented on two different microfluidic cartridges, both having identical interfacial connections to the identical automated instrument. In order to assess the concentration of the targeted analytes in human blood, finger prick samples are processed to either extract genomic DNA carrying the coeliac disease gene or blood plasma containing the disease specific antibodies. We present here the different microfluidic modules integrated in a common platform, capable of automated sample preparation and analyte detection. In summary, this new microfluidic approach will dramatically reduce the costs of materials (polymer for the disposable chips and minute amount of bio-reagents) and minimize the time for analysis down to less than 20 minutes. In comparison to the state of the art detection of coeliac disease this work represents a tremendous improvement for the patient's quality of live and will significantly reduce the cost burden on the health care system.

WFC3/UVIS External CTE Monitor: Single-Chip CTE Measurements

NASA Astrophysics Data System (ADS)

Gosmeyer, C. M.; Baggett, S.

2016-12-01

We present the first results of single-chip measurements of charge transfer efficiency (CTE) in the UVIS channel of the Hubble Space Telescope Wide Field Camera 3 (HST/WFC3). This test was performed in Cycle 20 in two visits. In the first visit a field in the star cluster NGC 6583 was observed. In a second visit, the telescope returned to the field, but rotated by 180 degrees and with a shift in pointing that allowed the same stars to be imaged, near and far from the amplifiers, on the same chip of the two-chip UVIS field of-view. This dataset enables a measurement of CTE loss on each separate chip. The current CTE monitor measures CTE loss as an average of the two chips because it dithers by a chip-height to obtain observations of the same sources near and far from the amplifiers, instead of the more difficult to-schedule 180-degree rotation. We find that CTE loss is worse on Chip 1 than on Chip 2 across all cases for which we had data: short and long exposures and w! ith and without the pixel-based CTE correction. In the best case, for long exposures with the CTE correction applied, the max difference between the two chip's flux losses is 3%/2048 pixels. This case should apply for most science observations where the background is 12 e-/pixel. In the worst case of low-background short exposures, e.g. those without post-flash, the max difference between the two chips is 17% flux loss/2048 pixels. Uncertainties are <0.01% flux loss/2048 pixels. Because of the two chips' different CTE loss rates, we will consider adding this test as part of the routine yearly monitor and creating a chip-specific CTE correction software.

Laboratory study of fungal bioreceptivity of different fractions of composite flooring tiles showing efflorescence.

PubMed

Masaphy, Segula; Lavi, Ido; Sultz, Stephan; Zabari, Limor

2014-06-01

Fungi can grow in extreme habitats, such as natural stone and mineral building materials, sometimes causing deterioration. Efflorescence-concentrated salt deposits-results from water movement through building material; it can damage masonry materials and other bricks. Fungal isolate KUR1, capable of growth on, and dissolution of stone chips composing terrazzo-type floor tiles, was isolated from such tiles showing fiber-like crystalline efflorescence. The isolate's ribosomal DNA sequences were 100 % identical to those of Nigrospora sphaerica. The ability of KUR1 to colonize and degrade the different stone chips composing the tiles was studied in axenic culture experiments. When exposed to each of the different mineral chip types composed of dolomite, calcite, or calcite-apatite mineral in low-nutrition medium, the fungus showed selective nutrient consumption, and different growth and stone mineral dissolution rates. Micromorphological examination of the fungus-colonized chips by electron microscopy showed the production of a fungal biofilm with thin films around the hyphae on the surface of the examined chips and disintegration of the calcite-apatite fraction. More than 70 % dissolution of the introduced powdered (<1 mm particle size) mineral was obtained within 10 days of incubation for the soft calcite-apatite fraction.

Plug-and-play, infrared, laser-mediated PCR in a microfluidic chip.

PubMed

Pak, Nikita; Saunders, D Curtis; Phaneuf, Christopher R; Forest, Craig R

2012-04-01

Microfluidic polymerase chain reaction (PCR) systems have set milestones for small volume (100 nL-5 μL), amplification speed (100-400 s), and on-chip integration of upstream and downstream sample handling including purification and electrophoretic separation functionality. In practice, the microfluidic chips in these systems require either insertion of thermocouples or calibration prior to every amplification. These factors can offset the speed advantages of microfluidic PCR and have likely hindered commercialization. We present an infrared, laser-mediated, PCR system that features a single calibration, accurate and repeatable precision alignment, and systematic thermal modeling and management for reproducible, open-loop control of PCR in 1 μL chambers of a polymer microfluidic chip. Total cycle time is less than 12 min: 1 min to fill and seal, 10 min to amplify, and 1 min to recover the sample. We describe the design, basis for its operation, and the precision engineering in the system and microfluidic chip. From a single calibration, we demonstrate PCR amplification of a 500 bp amplicon from λ-phage DNA in multiple consecutive trials on the same instrument as well as multiple identical instruments. This simple, relatively low-cost plug-and-play design is thus accessible to persons who may not be skilled in assembly and engineering.

Direct electrical and mechanical characterization of in situ generated DNA between the tips of silicon nanotweezers (SNT).

PubMed

Karsten, Stanislav L; Kumemura, Momoko; Jalabert, Laurent; Lafitte, Nicolas; Kudo, Lili C; Collard, Dominique; Fujita, Hiroyuki

2016-05-24

Previously, we reported the application of micromachined silicon nanotweezers (SNT) integrated with a comb-drive actuator and capacitive sensors for capturing and mechanical characterization of DNA bundles. Here, we demonstrate direct DNA amplification on such a MEMS structure with subsequent electrical and mechanical characterization of a single stranded DNA (ssDNA) bundle generated between the tips of SNT via isothermal rolling circle amplification (RCA) and dielectrophoresis (DEP). An in situ generated ssDNA bundle was visualized and evaluated via electrical conductivity (I-V) and mechanical frequency response measurements. Colloidal gold nanoparticles significantly enhanced (P < 0.01) the electrical properties of thin ssDNA bundles. The proposed technology allows direct in situ synthesis of DNA with a predefined sequence on the tips of a MEMS sensor device, such as SNT, followed by direct DNA electrical and mechanical characterization. In addition, our data provides a "proof-of-principle" for the feasibility of the on-chip label free DNA detection device that can be used for a variety of biomedical applications focused on sequence specific DNA detection.

Occupancy of RNA Polymerase II Phosphorylated on Serine 5 (RNAP S5P) and RNAP S2P on Varicella-Zoster Virus Genes 9, 51, and 66 Is Independent of Transcript Abundance and Polymerase Location within the Gene.

PubMed

Henderson, Heather H; Timberlake, Kensey B; Austin, Zoe A; Badani, Hussain; Sanford, Bridget; Tremblay, Keriann; Baird, Nicholas L; Jones, Kenneth; Rovnak, Joel; Frietze, Seth; Gilden, Don; Cohrs, Randall J

2016-02-01

Regulation of gene transcription in varicella-zoster virus (VZV), a ubiquitous human neurotropic alphaherpesvirus, requires coordinated binding of multiple host and virus proteins onto specific regions of the virus genome. Chromatin immunoprecipitation (ChIP) is widely used to determine the location of specific proteins along a genomic region. Since the size range of sheared virus DNA fragments governs the limit of accurate protein localization, particularly for compact herpesvirus genomes, we used a quantitative PCR (qPCR)-based assay to determine the efficiency of VZV DNA shearing before ChIP, after which the assay was used to determine the relationship between transcript abundance and the occupancy of phosphorylated RNA polymerase II (RNAP) on the gene promoter, body, and terminus of VZV genes 9, 51, and 66. The abundance of VZV gene 9, 51, and 66 transcripts in VZV-infected human fetal lung fibroblasts was determined by reverse transcription-linked quantitative PCR. Our results showed that the C-terminal domain of RNAP is hyperphosphorylated at serine 5 (S5(P)) on VZV genes 9, 51, and 66 independently of transcript abundance and the location within the virus gene at both 1 and 3 days postinfection (dpi). In contrast, phosphorylated serine 2 (S2(P))-modified RNAP was not detected at any virus gene location at 3 dpi and was detected at levels only slightly above background levels at 1 dpi. Regulation of herpesvirus gene transcription is an elaborate choreography between proteins and DNA that is revealed by chromatin immunoprecipitation (ChIP). We used a quantitative PCR-based assay to determine fragment size after DNA shearing, a critical parameter in ChIP assays, and exposed a basic difference in the mechanism of transcription between mammalian cells and VZV. We found that hyperphosphorylation at serine 5 of the C-terminal domain of RNAP along the lengths of VZV genes (the promoter, body, and transcription termination site) was independent of mRNA abundance. In contrast, little to no enrichment of serine 3 phosphorylation of RNAP was detected at these virus gene regions. This is distinct from the findings for RNAP at highly regulated host genes, where RNAP S5(P) occupancy decreased and S2(P) levels increased as the polymerase transited through the gene. Overall, these results suggest that RNAP associates with human and virus transcriptional units through different mechanisms. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Adjunctive Effects of A Piscean Collagen-Based Controlled-Release Chlorhexidine Chip in the Treatment of Chronic Periodontitis: A Clinical and Microbiological Study

PubMed Central

John, Priya; Lazarus, Flemingson; Selvam, Arul; Prabhuji, Munivenkatappa Lakshmaiah Venkatesh

2015-01-01

Introduction PerioChip a bovine origin gelatine based CHX chip has shown beneficial effects in the management of Chronic Periodontitis. A new fish collagen based CHX chip similar to PerioChip is currently available; however this product has not been thoroughly researched. Aim The aim of the present study was to evaluate the effectiveness of a new Piscean collagen-based controlled-release chlorhexidine chip (CHX chip) as an adjunctive therapy to scaling and root planing (SRP). Settings and Design The study was conducted as a randomised, split-mouth, controlled clinical trial at Krishnadevaraya College of Dental Sciences, Bangalore, India. Materials and Methods In a split–mouth study involving 20 sites in 10 patients with chronic periodontitis, control sites received scaling and root planing and test sites received scaling and root planing (SRP) and the intrapocket CHX chip placement as an adjunct. Subgingival plaque samples were collected from both control and test sites at baseline, 11 days and 11 weeks and the anaerobic colony count were assessed. Clinical parameters that were recorded at baseline and 11 weeks were gingival index, Plaque index, Probing pocket depth (PPD), and Clinical attachment level (CAL). Plaque index was recorded additionally at 11 days. Results In the test group there was a statistically significant reduction in the total anaerobic colony count, gingival index and plaque scores from baseline as compared to control sites at all time intervals. An additional 0.8mm reduction in mean probing pocket depth was noted in the test group. Gain in Clinical attachment level was comparable in both groups. Conclusion The adjunctive use of the new collagen-based CHX chip yielded significant antimicrobial benefit accompanied by a reduction in probing depth and a clinical attachment level gain as compared to SRP alone. This suggests that it may be a useful treatment option of nonsurgical periodontal treatment of chronic periodontitis. PMID:26155567

GridPix detectors: Production and beam test results

NASA Astrophysics Data System (ADS)

Koppert, W. J. C.; van Bakel, N.; Bilevych, Y.; Colas, P.; Desch, K.; Fransen, M.; van der Graaf, H.; Hartjes, F.; Hessey, N. P.; Kaminski, J.; Schmitz, J.; Schön, R.; Zappon, F.

2013-12-01

The innovative GridPix detector is a Time Projection Chamber (TPC) that is read out with a Timepix-1 pixel chip. By using wafer post-processing techniques an aluminium grid is placed on top of the chip. When operated, the electric field between the grid and the chip is sufficient to create electron induced avalanches which are detected by the pixels. The time-to-digital converter (TDC) records the drift time enabling the reconstruction of high precision 3D track segments. Recently GridPixes were produced on full wafer scale, to meet the demand for more reliable and cheaper devices in large quantities. In a recent beam test the contribution of both diffusion and time walk to the spatial and angular resolutions of a GridPix detector with a 1.2 mm drift gap are studied in detail. In addition long term tests show that in a significant fraction of the chips the protection layer successfully quenches discharges, preventing harm to the chip.

Characterisation of capacitively coupled HV/HR-CMOS sensor chips for the CLIC vertex detector

NASA Astrophysics Data System (ADS)

Kremastiotis, I.

2017-12-01

The capacitive coupling between an active sensor and a readout ASIC has been considered in the framework of the CLIC vertex detector study. The CLICpix Capacitively Coupled Pixel Detector (C3PD) is a High-Voltage CMOS sensor chip produced in a commercial 180 nm HV-CMOS process for this purpose. The sensor was designed to be connected to the CLICpix2 readout chip. It therefore matches the dimensions of the readout chip, featuring a matrix of 128×128 square pixels with 25μm pitch. The sensor chip has been produced with the standard value for the substrate resistivity (~20 Ωcm) and it has been characterised in standalone testing mode, before receiving and testing capacitively coupled assemblies. The standalone measurement results show a rise time of ~20 ns for a power consumption of 5μW/pixel. Production of the C3PD HV-CMOS sensor chip with higher substrate resistivity wafers (~20, 80, 200 and 1000 Ωcm) is foreseen. The expected benefits of the higher substrate resistivity will be studied using future assemblies with the readout chip.

Melting analysis on microbeads in rapid temperature-gradient inside microchannels for single nucleotide polymorphisms detectiona)

PubMed Central

Li, Kan-Chien; Ding, Shih-Torng; Lin, En-Chung; Wang, Lon (Alex); Lu, Yen-Wen

2014-01-01

A continuous-flow microchip with a temperature gradient in microchannels was utilized to demonstrate spatial melting analysis on microbeads for clinical Single Nucleotide Polymorphisms (SNPs) genotyping on animal genomic DNA. The chip had embedded heaters and thermometers, which created a rapid and yet stable temperature gradient between 60 °C and 85 °C in a short distance as the detection region. The microbeads, which served as mobile supports carrying the target DNA and fluorescent dye, were transported across the temperature gradient. As the surrounding temperature increased, the fluorescence signals of the microbeads decayed with this relationship being acquired as the melting curve. Fast DNA denaturation, as a result of the improved heat transfer and thermal stability due to scaling, was also confirmed. Further, each individual microbead could potentially bear different sequences and pass through the detection region, one by one, for a series of melting analysis, with multiplex, high-throughput capability being possible. A prototype was tested with target DNA samples in different genotypes (i.e., wild and mutant types) with a SNP location from Landrace sows. The melting temperatures were obtained and compared to the ones using a traditional tube-based approach. The results showed similar levels of SNP discrimination, validating our proposed technique for scanning homozygotes and heterozygotes to distinguish single base changes for disease research, drug development, medical diagnostics, agriculture, and animal production. PMID:25553186

Novel epigenetic determinants of type 2 diabetes in Mexican-American families.

PubMed

Kulkarni, Hemant; Kos, Mark Z; Neary, Jennifer; Dyer, Thomas D; Kent, Jack W; Göring, Harald H H; Cole, Shelley A; Comuzzie, Anthony G; Almasy, Laura; Mahaney, Michael C; Curran, Joanne E; Blangero, John; Carless, Melanie A

2015-09-15

Although DNA methylation is now recognized as an important mediator of complex diseases, the extent to which the genetic basis of such diseases is accounted for by DNA methylation is unknown. In the setting of large, extended families representing a minority, high-risk population of the USA, we aimed to characterize the role of epigenome-wide DNA methylation in type 2 diabetes (T2D). Using Illumina HumanMethylation450 BeadChip arrays, we tested for association of DNA methylation at 446 356 sites with age, sex and phenotypic traits related to T2D in 850 pedigreed Mexican-American individuals. Robust statistical analyses showed that (i) 15% of the methylome is significantly heritable, with a median heritability of 0.14; (ii) DNA methylation at 14% of CpG sites is associated with nearby sequence variants; (iii) 22% and 3% of the autosomal CpG sites are associated with age and sex, respectively; (iv) 53 CpG sites were significantly associated with liability to T2D, fasting blood glucose and insulin resistance; (v) DNA methylation levels at five CpG sites, mapping to three well-characterized genes (TXNIP, ABCG1 and SAMD12) independently explained 7.8% of the heritability of T2D (vi) methylation at these five sites was unlikely to be influenced by neighboring DNA sequence variation. Our study has identified novel epigenetic indicators of T2D risk in Mexican Americans who have increased risk for this disease. These results provide new insights into potential treatment targets of T2D. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Array-based DNA methylation analysis in individuals with developmental delay/intellectual disability and normal molecular karyotype.

PubMed

Kolarova, Julia; Tangen, Imke; Bens, Susanne; Gillessen-Kaesbach, Gabriele; Gutwein, Jana; Kautza, Monika; Rydzanicz, Malgorzata; Stephani, Ulrich; Siebert, Reiner; Ammerpohl, Ole; Caliebe, Almuth

2015-08-01

Despite recent progress in molecular karyotyping and clinical sequencing the cause of intellectual disability in a considerable subset of individuals affected by this phenotype remains elusive. As intellectual disability is also a feature of various imprinting disorders and some monogenic forms of intellectual disability are caused by epigenetic modifiers we hypothesized that changes in DNA methylation might be associated with or even causative in some cases of intellectual disability. Therefore, we performed a DNA methylation analysis of peripheral blood samples from 82 patients with intellectual disability and additional features using the HumanMethylation450 BeadChip. The findings were compared to that of 19 normal controls. Differentially methylated loci were validated by bisulfite pyrosequencing. On a global level, we failed to detect a robust DNA methylation signature segregating individuals with intellectual disability from controls. Using an individual approach, we identified 157 regions showing individual DNA methylation changes in at least one patient. These correlated to 107 genes including genes linked to conditions associated with intellectual disability, namely COLEC11, SHANK2, GLI2 and KCNQ2, as well as imprinted genes like FAM50B and MEG3. The latter was suggestive of an undiagnosed Temple syndrome which could be confirmed by diagnostic tests. Subsequent in-depth analysis of imprinted loci revealed DNA methylation changes at additional imprinted loci, i.e. PPIEL, IGF2R, MEG8 and MCTS2/HM13, in up to five patients. Our findings indicate that imprinting disorders are rare but probably under-diagnosed in patients with intellectual disability and moreover point to DNA methylation changes as potential alternative means to identify deregulated genes involved in the pathogenesis of intellectual disability. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Portable SERS sensor for malachite green and other small dye molecules

NASA Astrophysics Data System (ADS)

Qiu, Suyan; Zhao, Fusheng; Li, Jingting; Shih, Wei-Chuan

2017-02-01

Sensitive detection of specific chemicals on site can be extremely powerful in many fields. Owing to its molecular fingerprinting capability, surface-enhanced Raman scattering has been one of the technological contenders. In this paper, we describe the novel use of DNA topological nanostructure on nanoporous gold nanoparticle (NPG-NP) array chip for chemical sensing. NPG-NP features large surface area and high-density plasmonic field enhancement known as "hotspots". Hence, NPG-NP array chip has found many applications in nanoplasmonic sensor development. This technique can provide novel label-free molecular sensing capability and enables high sensitivity and specificity detection using a portable Raman spectrometer.

High-bandwidth detection of short DNA in nanopipettes.

PubMed

Fraccari, Raquel L; Carminati, Marco; Piantanida, Giacomo; Leontidou, Tina; Ferrari, Giorgio; Albrecht, Tim

2016-12-12

Glass or quartz nanopipettes have found increasing use as tools for studying the biophysical properties of DNA and proteins, and as sensor devices. The ease of fabrication, favourable wetting properties and low capacitance are some of the inherent advantages, for example compared to more conventional, silicon-based nanopore chips. Recently, we have demonstrated high-bandwidth detection of double-stranded (ds) DNA with microsecond time resolution in nanopipettes, using custom-designed electronics. The electronics design has now been refined to include more sophisticated control features, such as integrated bias reversal and other features. Here, we exploit these capabilities and probe the translocation of short dsDNA in the 100 bp range, in different electrolytes. Single-stranded (ss) DNA of similar length are in use as capture probes, so label-free detection of their ds counterparts could therefore be of relevance in disease diagnostics.

Next Generation Programmable Bio-Nano-Chip System for On-Site Detection in Oral Fluids.

PubMed

Christodoulides, Nicolaos; De La Garza, Richard; Simmons, Glennon W; McRae, Michael P; Wong, Jorge; Newton, Thomas F; Kosten, Thomas R; Haque, Ahmed; McDevitt, John T

2015-11-23

Current on-site drug of abuse detection methods involve invasive sampling of blood and urine specimens, or collection of oral fluid, followed by qualitative screening tests using immunochromatographic cartridges. Test confirmation and quantitative assessment of a presumptive positive are then provided by remote laboratories, an inefficient and costly process decoupled from the initial sampling. Recently, a new noninvasive oral fluid sampling approach that is integrated with the chip-based Programmable Bio-Nano-Chip (p-BNC) platform has been developed for the rapid (~ 10 minutes), sensitive detection (~ ng/ml) and quantitation of 12 drugs of abuse. Furthermore, the system can provide the time-course of select drug and metabolite profiles in oral fluids. For cocaine, we observed three slope components were correlated with cocaine-induced impairment using this chip-based p-BNC detection modality. Thus, this p-BNC has significant potential for roadside drug testing by law enforcement officers. Initial work reported on chip-based drug detection was completed using 'macro' or "chip in the lab" prototypes, that included metal encased "flow cells", external peristaltic pumps and a bench-top analyzer system instrumentation. We now describe the next generation miniaturized analyzer instrumentation along with customized disposables and sampling devices. These tools will offer real-time oral fluid drug monitoring capabilities, to be used for roadside drug testing as well as testing in clinical settings as a non-invasive, quantitative, accurate and sensitive tool to verify patient adherence to treatment.

An acceptance test for chip seal projects based on image analysis.

DOT National Transportation Integrated Search

2016-05-01

Chip seal is one of the most popular preventive maintenance techniques performed by many DOTs, county road departments and cities. One of the most important parameters affecting performance of a chip seal is the percent aggregate embedment depth into...

Developmental validation of the DNAscan™ Rapid DNA Analysis™ instrument and expert system for reference sample processing.

PubMed

Della Manna, Angelo; Nye, Jeffrey V; Carney, Christopher; Hammons, Jennifer S; Mann, Michael; Al Shamali, Farida; Vallone, Peter M; Romsos, Erica L; Marne, Beth Ann; Tan, Eugene; Turingan, Rosemary S; Hogan, Catherine; Selden, Richard F; French, Julie L

2016-11-01

Since the implementation of forensic DNA typing in labs more than 20 years ago, the analysis procedures and data interpretation have always been conducted in a laboratory by highly trained and qualified scientific personnel. Rapid DNA technology has the potential to expand testing capabilities within forensic laboratories and to allow forensic STR analysis to be performed outside the physical boundaries of the traditional laboratory. The developmental validation of the DNAscan/ANDE Rapid DNA Analysis System was completed using a BioChipSet™ Cassette consumable designed for high DNA content samples, such as single source buccal swabs. A total of eight laboratories participated in the testing which totaled over 2300 swabs, and included nearly 1400 unique individuals. The goal of this extensive study was to obtain, document, analyze, and assess DNAscan and its internal Expert System to reliably genotype reference samples in a manner compliant with the FBI's Quality Assurance Standards (QAS) and the NDIS Operational Procedures. The DNAscan System provided high quality, concordant results for reference buccal swabs, including automated data analysis with an integrated Expert System. Seven external laboratories and NetBio, the developer of the technology, participated in the validation testing demonstrating the reproducibility and reliability of the system and its successful use in a variety of settings by numerous operators. The DNAscan System demonstrated limited cross reactivity with other species, was resilient in the presence of numerous inhibitors, and provided reproducible results for both buccal and purified DNA samples with sensitivity at a level appropriate for buccal swabs. The precision and resolution of the system met industry standards for detection of micro-variants and displayed single base resolution. PCR-based studies provided confidence that the system was robust and that the amplification reaction had been optimized to provide high quality results. The DNAscan integrated Expert System was examined as part of the Developmental Validation and successfully interpreted the over 2000 samples tested with over 99.998% concordant alleles. The system appropriately flagged samples for human review and failed both mixed samples and samples with insufficient genetic information. These results demonstrated the integrated Expert System makes correct allele calls without human intervention. Copyright © 2016 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

Redundancy approaches in bubble domain memories

NASA Technical Reports Server (NTRS)

Almasi, G. S.; Schuster, S. E.

1972-01-01

Fabrication of integrated circuit chips to compensate for faulty memory elements is discussed. Procedure for testing chips to determine extent of redundancy and faults is described. Mathematical model to define operation is presented. Schematic circuit diagram of test equipment is provided.

An engineering methodology for implementing and testing VLSI (Very Large Scale Integrated) circuits

NASA Astrophysics Data System (ADS)

Corliss, Walter F., II

1989-03-01

The engineering methodology for producing a fully tested VLSI chip from a design layout is presented. A 16-bit correlator, NPS CORN88, that was previously designed, was used as a vehicle to demonstrate this methodology. The study of the design and simulation tools, MAGIC and MOSSIM II, was the focus of the design and validation process. The design was then implemented and the chip was fabricated by MOSIS. This fabricated chip was then used to develop a testing methodology for using the digital test facilities at NPS. NPS CORN88 was the first full custom VLSI chip, designed at NPS, to be tested with the NPS digital analysis system, Tektronix DAS 9100 series tester. The capabilities and limitations of these test facilities are examined. NPS CORN88 test results are included to demonstrate the capabilities of the digital test system. A translator, MOS2DAS, was developed to convert the MOSSIM II simulation program to the input files required by the DAS 9100 device verification software, 91DVS. Finally, a tutorial for using the digital test facilities, including the DAS 9100 and associated support equipments, is included as an appendix.

Beam test results of a monolithic pixel sensor in the 0.18 μm tower-jazz technology with high resistivity epitaxial layer

NASA Astrophysics Data System (ADS)

Mattiazzo, S.; Aimo, I.; Baudot, J.; Bedda, C.; La Rocca, P.; Perez, A.; Riggi, F.; Spiriti, E.

2015-10-01

The ALICE experiment at CERN will undergo a major upgrade in the second Long LHC Shutdown in the years 2018-2019; this upgrade includes the full replacement of the Inner Tracking System (ITS), deploying seven layers of Monolithic Active Pixel Sensors (MAPS). For the development of the new ALICE ITS, the Tower-Jazz 0.18 μm CMOS imaging sensor process has been chosen as it is possible to use full CMOS in the pixel and different silicon wafers (including high resistivity epitaxial layers). A large test campaign has been carried out on several small prototype chips, designed to optimize the pixel sensor layout and the front-end electronics. Results match the target requirements both in terms of performance and of radiation hardness. Following this development, the first full scale chips have been designed, submitted and are currently under test, with promising results. A telescope composed of 4 planes of Mimosa-28 and 2 planes of Mimosa-18 chips is under development at the DAFNE Beam Test Facility (BTF) at the INFN Laboratori Nazionali di Frascati (LNF) in Italy with the final goal to perform a comparative test of the full scale prototypes. The telescope has been recently used to test a Mimosa-22THRb chip (a monolithic pixel sensor built in the 0.18 μm Tower-Jazz process) and we foresee to perform tests on the full scale chips for the ALICE ITS upgrade at the beginning of 2015. In this contribution we will describe some first measurements of spatial resolution, fake hit rate and detection efficiency of the Mimosa-22THRb chip obtained at the BTF facility in June 2014 with an electron beam of 500 MeV.

Circulating polymerase chain reaction chips utilizing multiple-membrane activation

NASA Astrophysics Data System (ADS)

Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

2007-02-01

This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

PhyloChip Tackles Coral Disease

ScienceCinema

DeSantis, Todd

2017-12-13

Scientists at Berkeley Lab and the University of California, Merced are using an innovative DNA array developed at Berkeley Lab to catalog the microbes that live among coral in the tropical waters off the coast of Puerto Rico. More info: http://newscenter.lbl.gov/feature-stories/2009/02/02/coral-reefs/

HIGH-THROUGHPUT PHYLOGENOMICS: FROM ANCIENT DNA TO SIGNATURES OF HUMAN ANIMAL HUSBANDRY

USDA-ARS?s Scientific Manuscript database

We utilized the Illumina BovineSNP50 BeadChip with 54,693 single nucleotide polymorphism loci developed for Bos taurus taurus to rapidly genotype 677 individuals representing 61 Pecoran (horned ruminant) species diverged by up to 29 million years. We produced a completely bifurcating tree, the first...

Using Chromatin Immunoprecipitation in Toxicology: A Step-by-Step Guide to Increasing Efficiency, Reducing Variability, and Expanding Applications

EPA Science Inventory

Histone modifications work in concert with DNA methylation to regulate cellular structure, function, and the response to environmental stimuli. More than 130 unique histone modifications have been described to date and chromatin immunoprecipitation (ChIP) allows for the explorat...

Current Status of Genotyping and Discovery Work at USMARC

USDA-ARS?s Scientific Manuscript database

The Illumina BovineSNP50 DNA chip has substantially changed the genetic and genomic research program at USMARC. It has enhanced our commitment to produce genetic tools that can be exported to beef cattle producers to further their selection goals in hard-to-measure traits such as feed efficiency, co...

EVALUATION OF DNA CHIPS (MICROARRAYS) FOR DETERMINING VIRULENCE FACTOR ACTIVITY RELATIONSHIPS (VFARS)

EPA Science Inventory

Computational toxicology is a rapid approach to screening for toxic effects and looking for common outcomes that can result in predictive models. The long term project will result in the development of a database of mRNA responses to known water-borne pathogens. An understanding...

Flip Chip on Organic Substrates: A Feasibility Study for Space Applications

DTIC Science & Technology

2017-03-01

scheme, a 1752 I/O land grid array (LGA) package with decoupling capacitors, heat sink and optional column attach [1] as shown in Figure 1...investigated the effect of moisture and current loading on the Class Y flip chip on ceramic reliability [ 2 ]. The UT1752FC Class Y technology has...chip assembly to ceramic test substrates, the FA10 die are assembled to build-up organic test substrates as shown in Figure 2 . These assemblies

Atom Chips on Direct Bonded Copper Substrates (Postprint)

DTIC Science & Technology

2012-01-19

joining of a thin sheet of pure copper to a ceramic substrate14 and is commonly used in power electronics due to its high current handling and heat...Squires et al. Rev. Sci. Instrum. 82, 023101 (2011) FIG. 1. A scanning electron micrograph of the top view of test chip A. the photolithographically...the etching pro- cesses and masking methods were quantified using a scanning electron microscope. Two test chips (A and B) are presented below and are

Floating Chip Mounting System Driven by Repulsive Force of Permanent Magnets for Multiple On-Site SPR Immunoassay Measurements

PubMed Central

Horiuchi, Tsutomu; Tobita, Tatsuya; Miura, Toru; Iwasaki, Yuzuru; Seyama, Michiko; Inoue, Suzuyo; Takahashi, Jun-ichi; Haga, Tsuneyuki; Tamechika, Emi

2012-01-01

We have developed a measurement chip installation/removal mechanism for a surface plasmon resonance (SPR) immunoassay analysis instrument designed for frequent testing, which requires a rapid and easy technique for changing chips. The key components of the mechanism are refractive index matching gel coated on the rear of the SPR chip and a float that presses the chip down. The refractive index matching gel made it possible to optically couple the chip and the prism of the SPR instrument easily via elastic deformation with no air bubbles. The float has an autonomous attitude control function that keeps the chip parallel in relation to the SPR instrument by employing the repulsive force of permanent magnets between the float and a float guide located in the SPR instrument. This function is realized by balancing the upward elastic force of the gel and the downward force of the float, which experiences a leveling force from the float guide. This system makes it possible to start an SPR measurement immediately after chip installation and to remove the chip immediately after the measurement with a simple and easy method that does not require any fine adjustment. Our sensor chip, which we installed using this mounting system, successfully performed an immunoassay measurement on a model antigen (spiked human-IgG) in a model real sample (non-homogenized milk) that included many kinds of interfering foreign substances without any sample pre-treatment. The ease of the chip installation/removal operation and simple measurement procedure are suitable for frequent on-site agricultural, environmental and medical testing. PMID:23202030

Lab-on-a-Chip

NASA Technical Reports Server (NTRS)

2004-01-01

Labs on chips are manufactured in many shapes and sizes and can be used for numerous applications, from medical tests to water quality monitoring to detecting the signatures of life on other planets. The eight holes on this chip are actually ports that can be filled with fluids or chemicals. Tiny valves control the chemical processes by mixing fluids that move in the tiny channels that look like lines, connecting the ports. Scientists at NASA's Marshall Space Flight Center (MSFC) in Huntsville, Alabama designed this chip to grow biological crystals on the International Space Station. Through this research, they discovered that this technology is ideally suited for solving the challenges of the Vision for Space Exploration. For example, thousands of chips the size of dimes could be loaded on a Martian rover looking for biosignatures of past or present life. Other types of chips could be placed in handheld devices used to monitor microbes in water or to quickly conduct medical tests on astronauts. (NASA/MSFC/D.Stoffer)

Tissue chips - innovative tools for drug development and disease modeling.

PubMed

Low, L A; Tagle, D A

2017-09-12

The high rate of failure during drug development is well-known, however recent advances in tissue engineering and microfabrication have contributed to the development of microphysiological systems (MPS), or 'organs-on-chips' that recapitulate the function of human organs. These 'tissue chips' could be utilized for drug screening and safety testing to potentially transform the early stages of the drug development process. They can also be used to model disease states, providing new tools for the understanding of disease mechanisms and pathologies, and assessing effectiveness of new therapies. In the future, they could be used to test new treatments and therapeutics in populations - via clinical trials-on-chips - and individuals, paving the way for precision medicine. Here we will discuss the wide-ranging and promising future of tissue chips, as well as challenges facing their development.

Ultra-dense magnetoresistive mass memory

NASA Technical Reports Server (NTRS)

Daughton, J. M.; Sinclair, R.; Dupuis, T.; Brown, J.

1992-01-01

This report details the progress and accomplishments of Nonvolatile Electronics (NVE), Inc., on the design of the wafer scale MRAM mass memory system during the fifth quarter of the project. NVE has made significant progress this quarter on the one megabit design in several different areas. A test chip, which will verify a working GMR bit with the dimensions required by the 1 Meg chip, has been designed, laid out, and is currently being processed in the NVE labs. This test chip will allow electrical specifications, tolerances, and processing issues to be finalized before construction of the actual chip, thus providing a greater assurance of success of the final 1 Meg design. A model has been developed to accurately simulate the parasitic effects of unselected sense lines. This model gives NVE the ability to perform accurate simulations of the array electronic and test different design concepts. Much of the circuit design for the 1 Meg chip has been completed and simulated and these designs are included. Progress has been made in the wafer scale design area to verify the reliable operation of the 16 K macrocell. This is currently being accomplished with the design and construction of two stand alone test systems which will perform life tests and gather data on reliabiliy and wearout mechanisms for analysis.

Genome-wide DNA Methylation Profiling of CpG Islands in Hypospadias

PubMed Central

Choudhry, Shweta; Deshpande, Archana; Qiao, Liang; Beckman, Kenneth; Sen, Saunak; Baskin, Laurence S.

2013-01-01

Purpose Hypospadias is one of the most frequent genital malformations in the male newborn, and results from abnormal penile and urethral development. The etiology of hypospadias remains largely unknown despite intensive investigations. Fetal androgens have a crucial role in genital differentiation. Recent studies have suggested that molecular mechanisms that underlie the effects of androgens on the fetus may involve disruption of epigenetic programming of gene expression during development. We assessed whether epigenetic modification of DNA methylation is associated with hypospadias in a case-control study of 12 hypospadias and 8 control subjects. Materials and Methods Genome-wide DNA methylation profiling was performed on the study subjects using the Illumina Infinium® HumanMethylation450 Bead-Chip, which enables the direct investigation of methylation status of more than 485,000 individual CpG sites throughout the genome. The methylation level at each CpG site was compared between cases and controls using the t test and logistic regression. Results We identified 14 CpG sites that were associated with hypospadias with p <0.00001. These CpG sites were in or near the SCARB1, MYBPH, SORBS1, LAMA4, HOXD11, MYO1D, EGFL7, C10orf41, LMAN1L and SULF1 genes. Two CpG sites in SCARB1 and MYBPH genes remained statistically significant after correction for multiple testing (p = 2.61×10−09, pcorrected = 0.008; p = 3.06×10−08, pcorrected = 0.02, respectively). Conclusions To our knowledge this is the first study to investigate hypospadias using a unique and novel epigenetic approach. Our findings suggest DNA methylation patterns are useful in identifying new genes such as SCARB1 and MYBPH that may be involved in the etiology of hypospadias. PMID:22906644

SINE transcription by RNA polymerase III is suppressed by histone methylation but not by DNA methylation

PubMed Central

Varshney, Dhaval; Vavrova-Anderson, Jana; Oler, Andrew J.; Cowling, Victoria H.; Cairns, Bradley R.; White, Robert J.

2015-01-01

Short interspersed nuclear elements (SINEs), such as Alu, spread by retrotransposition, which requires their transcripts to be copied into DNA and then inserted into new chromosomal sites. This can lead to genetic damage through insertional mutagenesis and chromosomal rearrangements between non-allelic SINEs at distinct loci. SINE DNA is heavily methylated and this was thought to suppress its accessibility and transcription, thereby protecting against retrotransposition. Here we provide several lines of evidence that methylated SINE DNA is occupied by RNA polymerase III, including the use of high-throughput bisulphite sequencing of ChIP DNA. We find that loss of DNA methylation has little effect on accessibility of SINEs to transcription machinery or their expression in vivo. In contrast, a histone methyltransferase inhibitor selectively promotes SINE expression and occupancy by RNA polymerase III. The data suggest that methylation of histones rather than DNA plays a dominant role in suppressing SINE transcription. PMID:25798578

A Boundary Scan Test Vehicle for Direct Chip Attach Testing

NASA Technical Reports Server (NTRS)

Parsons, Heather A.; DAgostino, Saverio; Arakaki, Genji

2000-01-01

To facilitate the new faster, better and cheaper spacecraft designs, smaller more mass efficient avionics and instruments are using higher density electronic packaging technologies such as direct chip attach (DCA). For space flight applications, these technologies need to have demonstrated reliability and reasonably well defined fabrication and assembly processes before they will be accepted as baseline designs in new missions. As electronics shrink in size, not only can repair be more difficult, but 49 probing" circuitry can be very risky and it becomes increasingly more difficult to identify the specific source of a problem. To test and monitor these new technologies, the Direct Chip Attach Task, under NASA's Electronic Parts and Packaging Program (NEPP), chose the test methodology of boundary scan testing. The boundary scan methodology was developed for interconnect integrity and functional testing at hard to access electrical nodes. With boundary scan testing, active devices are used and failures can be identified to the specific device and lead. This technology permits the incorporation of "built in test" into almost any circuit and thus gives detailed test access to the highly integrated electronic assemblies. This presentation will describe boundary scan, discuss the development of the boundary scan test vehicle for DCA and current plans for testing of direct chip attach configurations.

Heterologous oligonucleotide microarrays for transcriptomics in a non-model species; a proof-of-concept study of drought stress in Musa

PubMed Central

Davey, Mark W; Graham, Neil S; Vanholme, Bartel; Swennen, Rony; May, Sean T; Keulemans, Johan

2009-01-01

Background 'Systems-wide' approaches such as microarray RNA-profiling are ideally suited to the study of the complex overlapping responses of plants to biotic and abiotic stresses. However, commercial microarrays are only available for a limited number of plant species and development costs are so substantial as to be prohibitive for most research groups. Here we evaluate the use of cross-hybridisation to Affymetrix oligonucleotide GeneChip® microarrays to profile the response of the banana (Musa spp.) leaf transcriptome to drought stress using a genomic DNA (gDNA)-based probe-selection strategy to improve the efficiency of detection of differentially expressed Musa transcripts. Results Following cross-hybridisation of Musa gDNA to the Rice GeneChip® Genome Array, ~33,700 gene-specific probe-sets had a sufficiently high degree of homology to be retained for transcriptomic analyses. In a proof-of-concept approach, pooled RNA representing a single biological replicate of control and drought stressed leaves of the Musa cultivar 'Cachaco' were hybridised to the Affymetrix Rice Genome Array. A total of 2,910 Musa gene homologues with a >2-fold difference in expression levels were subsequently identified. These drought-responsive transcripts included many functional classes associated with plant biotic and abiotic stress responses, as well as a range of regulatory genes known to be involved in coordinating abiotic stress responses. This latter group included members of the ERF, DREB, MYB, bZIP and bHLH transcription factor families. Fifty-two of these drought-sensitive Musa transcripts were homologous to genes underlying QTLs for drought and cold tolerance in rice, including in 2 instances QTLs associated with a single underlying gene. The list of drought-responsive transcripts also included genes identified in publicly-available comparative transcriptomics experiments. Conclusion Our results demonstrate that despite the general paucity of nucleotide sequence data in Musa and only distant phylogenetic relations to rice, gDNA probe-based cross-hybridisation to the Rice GeneChip® is a highly promising strategy to study complex biological responses and illustrates the potential of such strategies for gene discovery in non-model species. PMID:19758430

Comparisons of Wet and Ovendry Analyses of Compression Debarking Tests on Wood Chips

Treesearch

Rodger A. Arola

1974-01-01

Compares the level of bark removal from chips and resultant wood losses when measured on both a wet and ovendry basis with several chip debarking trials for quaking aspen, jack pine, and sugar maple cut at different times of the year.

Nitrogen Cycle Evaluation (NiCE) Chip for the Simultaneous Analysis of Multiple N-Cycle Associated Genes.

PubMed

Oshiki, Mamoru; Segawa, Takahiro; Ishii, Satoshi

2018-02-02

Various microorganisms play key roles in the Nitrogen (N) cycle. Quantitative PCR (qPCR) and PCR-amplicon sequencing of the N cycle functional genes allow us to analyze the abundance and diversity of microbes responsible in the N transforming reactions in various environmental samples. However, analysis of multiple target genes can be cumbersome and expensive. PCR-independent analysis, such as metagenomics and metatranscriptomics, is useful but expensive especially when we analyze multiple samples and try to detect N cycle functional genes present at relatively low abundance. Here, we present the application of microfluidic qPCR chip technology to simultaneously quantify and prepare amplicon sequence libraries for multiple N cycle functional genes as well as taxon-specific 16S rRNA gene markers for many samples. This approach, named as N cycle evaluation (NiCE) chip, was evaluated by using DNA from pure and artificially mixed bacterial cultures and by comparing the results with those obtained by conventional qPCR and amplicon sequencing methods. Quantitative results obtained by the NiCE chip were comparable to those obtained by conventional qPCR. In addition, the NiCE chip was successfully applied to examine abundance and diversity of N cycle functional genes in wastewater samples. Although non-specific amplification was detected on the NiCE chip, this could be overcome by optimizing the primer sequences in the future. As the NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes, this tool should advance our ability to explore N cycling in various samples. Importance. We report a novel approach, namely Nitrogen Cycle Evaluation (NiCE) chip by using microfluidic qPCR chip technology. By sequencing the amplicons recovered from the NiCE chip, we can assess diversities of the N cycle functional genes. The NiCE chip technology is applicable to analyze the temporal dynamics of the N cycle gene transcriptions in wastewater treatment bioreactors. The NiCE chip can provide high-throughput format to quantify and prepare sequence libraries for multiple N cycle functional genes. While there is a room for future improvement, this tool should significantly advance our ability to explore the N cycle in various environmental samples. Copyright © 2018 American Society for Microbiology.

Lab on a chip genotyping for Brucella spp. based on 15-loci multi locus VNTR analysis.

PubMed

De Santis, Riccardo; Ciammaruconi, Andrea; Faggioni, Giovanni; D'Amelio, Raffaele; Marianelli, Cinzia; Lista, Florigio

2009-04-07

Brucellosis is an important zoonosis caused by the genus Brucella. In addition Brucella represents potential biological warfare agents due to the high contagious rates for humans and animals. Therefore, the strain typing epidemiological tool may be crucial for tracing back source of infection in outbreaks and discriminating naturally occurring outbreaks versus bioterroristic event. A Multiple Locus Variable-number tandem repeats (VNTR) Analysis (MLVA) assay based on 15 polymorphic markers was previously described. The obtained MLVA band profiles may be resolved by techniques ranging from low cost manual agarose gels to the more expensive capillary electrophoresis sequencing. In this paper a rapid, accurate and reproducible system, based on the Lab on a chip technology was set up for Brucella spp. genotyping. Seventeen DNA samples of Brucella strains isolated in Sicily, previously genotyped, and twelve DNA samples, provided by MLVA Brucella VNTR ring trial, were analyzed by MLVA-15 on Agilent 2100. The DNA fragment sizes produced by Agilent, compared with those expected, showed discrepancies; therefore, in order to assign the correct alleles to the Agilent DNA fragment sizes, a conversion table was produced. In order to validate the system twelve unknown DNA samples were analyzed by this method obtaining a full concordance with the VNTR ring trial results. In this paper we described a rapid and specific detection method for the characterization of Brucella isolates. The comparison of the MLVA typing data produced by Agilent system with the data obtained by standard sequencing or ethidium bromide slab gel electrophoresis showed a general concordance of the results. Therefore this platform represents a fair compromise among costs, speed and specificity compared to any conventional molecular typing technique.

Limitations and possibilities of low cell number ChIP-seq

PubMed Central

2012-01-01

Background Chromatin immunoprecipitation coupled with high-throughput DNA sequencing (ChIP-seq) offers high resolution, genome-wide analysis of DNA-protein interactions. However, current standard methods require abundant starting material in the range of 1–20 million cells per immunoprecipitation, and remain a bottleneck to the acquisition of biologically relevant epigenetic data. Using a ChIP-seq protocol optimised for low cell numbers (down to 100,000 cells / IP), we examined the performance of the ChIP-seq technique on a series of decreasing cell numbers. Results We present an enhanced native ChIP-seq method tailored to low cell numbers that represents a 200-fold reduction in input requirements over existing protocols. The protocol was tested over a range of starting cell numbers covering three orders of magnitude, enabling determination of the lower limit of the technique. At low input cell numbers, increased levels of unmapped and duplicate reads reduce the number of unique reads generated, and can drive up sequencing costs and affect sensitivity if ChIP is attempted from too few cells. Conclusions The optimised method presented here considerably reduces the input requirements for performing native ChIP-seq. It extends the applicability of the technique to isolated primary cells and rare cell populations (e.g. biobank samples, stem cells), and in many cases will alleviate the need for cell culture and any associated alteration of epigenetic marks. However, this study highlights a challenge inherent to ChIP-seq from low cell numbers: as cell input numbers fall, levels of unmapped sequence reads and PCR-generated duplicate reads rise. We discuss a number of solutions to overcome the effects of reducing cell number that may aid further improvements to ChIP performance. PMID:23171294

Lab-on-a-chip-based PCR-RFLP assay for the confirmed detection of short-length feline DNA in food.

PubMed

Ali, Md Eaqub; Al Amin, Md; Hamid, Sharifah Bee Abd; Hossain, M A Motalib; Mustafa, Shuhaimi

2015-01-01

Wider availability but lack of legal market trades has given feline meat a high potential for use as an adulterant in common meat and meat products. However, mixing of feline meat or its derivatives in food is a sensitive issue, since it is a taboo in most countries and prohibited in certain religions such as Islam and Judaism. Cat meat also has potential for contamination with of severe acute respiratory syndrome, anthrax and hepatitis, and its consumption might lead to an allergic reaction. We developed a very short-amplicon-length (69 bp) PCR assay, authenticated the amplified PCR products by AluI-restriction digestion followed by its separation and detection on a lab-on-a-chip-based automated electrophoretic system, and proved its superiority over the existing long-amplicon-based assays. Although it has been assumed that longer DNA targets are susceptible to breakdown under compromised states, scientific evidence for this hypothesis has been rarely documented. Strong evidence showed that shorter targets are more stable than the longer ones. We confirmed feline-specificity by cross-challenging the primers against 10 different species of terrestrial, aquatic and plant origins in the presence of a 141-bp site of an 18S rRNA gene as a universal eukaryotic control. RFLP analysis separated 43- and 26-bp fragments of AluI-digest in both the gel-image and electropherograms, confirming the original products. The tested detection limit was 0.01% (w/w) feline meat in binary and ternary admixed as well as meatball matrices. Shorter target, better stability and higher sensitivity mean such an assay would be valid for feline identification even in degraded specimens.

Intelligent structures technology

NASA Astrophysics Data System (ADS)

Crawley, Edward F.

1991-07-01

Viewgraphs on intelligent structures technology are presented. Topics covered include: embedding electronics; electrical and mechanical compatibility; integrated circuit chip packaged for embedding; embedding devices within composite structures; test of embedded circuit in G/E coupon; temperature/humidity/bias test; single-chip microcomputer control experiment; and structural shape determination.

Intelligent structures technology

NASA Technical Reports Server (NTRS)

Crawley, Edward F.

1991-01-01

Viewgraphs on intelligent structures technology are presented. Topics covered include: embedding electronics; electrical and mechanical compatibility; integrated circuit chip packaged for embedding; embedding devices within composite structures; test of embedded circuit in G/E coupon; temperature/humidity/bias test; single-chip microcomputer control experiment; and structural shape determination.

Characterization of radiation effects in 65 nm digital circuits with the DRAD digital radiation test chip

NASA Astrophysics Data System (ADS)

Jara Casas, L. M.; Ceresa, D.; Kulis, S.; Miryala, S.; Christiansen, J.; Francisco, R.; Gnani, D.

2017-02-01

A Digital RADiation (DRAD) test chip has been specifically designed to study the impact of Total Ionizing Dose (TID) (<1 Grad) and Single Event Upset (SEU) on digital logic gates in a 65 nm CMOS technology. Nine different versions of standard cell libraries are studied in this chip, basically differing in the device dimensions, Vt flavor and layout of the device. Each library has eighteen test structures specifically designed to characterize delay degradation and power consumption of the standard cells. For SEU study, a dedicated test structure based on a shift register is designed for each library. TID results up to 500 Mrad are reported.

On-chip isothermal, chemical cycling polymerase chain reaction (ccPCR)

NASA Astrophysics Data System (ADS)

Persat, Alexandre; Santiago, Juan

2008-11-01

We demonstrate a novel ccPCR technique for microfluidic DNA amplification where temperature is held constant in space and time. The polymerase chain reaction is a platform of choice for biological assays and typically based on a three-step thermal cycling: DNA denaturation, primers annealing and extension by an enzyme. We here demonstrate a novel technique where high concentration chemical denaturants (solvents) denature DNA. We leverage the high electrophoretic mobility of DNA and the electrical neutrality of denaturants to achieve chemical cycling. We focus DNA with isotachophoresis (ITP); a robust electrophoretic preconcentration technique which generates strong electric field gradients and protects the sample from dispersion. We apply a pressure-driven flow to balance electromigration velocity and keep the DNA sample stationary in a microchannel. We drive the DNA through a series of high denaturant concentration zones. DNA denatures at high denaturant concentration. At low denaturant concentration, the enzyme creates complementary strands. DNA reaction kinetics are slower than buffer reactions involved in ITP. We demonstrate successful ccPCR amplification for detection of E. Coli. The ccPCR has the potential for simpler chemistry than traditional PCR.

Prototyping of Silicon Strip Detectors for the Inner Tracker of the ALICE Experiment

NASA Astrophysics Data System (ADS)

Sokolov, Oleksiy

2006-04-01

The ALICE experiment at CERN will study heavy ion collisions at a center-of-mass energy 5.5˜TeV per nucleon. Particle tracking around the interaction region at radii r<45 cm is done by the Inner Tracking System (ITS), consisting of six cylindrical layers of silicon detectors. The outer two layers of the ITS use double-sided silicon strip detectors. This thesis focuses on testing of these detectors and performance studies of the detector module prototypes at the beam test. Silicon strip detector layers will require about 20 thousand HAL25 front-end readout chips and about 3.5 thousand hybrids each containing 6 HAL25 chips. During the assembly procedure, chips are bonded on a patterned TAB aluminium microcables which connect to all the chip input and output pads, and then the chips are assembled on the hybrids. Bonding failures at the chip or hybrid level may either render the component non-functional or deteriorate its the performance such that it can not be used for the module production. After each bonding operation, the component testing is done to reject the non-functional or poorly performing chips and hybrids. The LabView-controlled test station for this operation has been built at Utrecht University and was successfully used for mass production acceptance tests of chips and hybrids at three production labs. The functionality of the chip registers, bonding quality and analogue functionality of the chips and hybrids are addressed in the test. The test routines were optimized to minimize the testing time to make sure that testing is not a bottleneck of the mass production. For testing of complete modules the laser scanning station with 1060 nm diode laser has been assembled at Utrecht University. The testing method relies of the fact that a response of the detector module to a short collimated laser beam pulse resembles a response to a minimum ionizing particle. A small beam spot size (˜7 μm ) allows to deposit the charge in a narrow region and measure the response of individual detector channels. First several module prototypes have been studied with this setup, the strip gain and charge sharing function have been measured, the later is compared with the model predictions. It was also shown that for a laser beam of a high monochromaticity, interference in the sensor bulk significantly modulates the deposited charge and introduces a systematic error of the gain measurement. Signatures of disconnected strips and pinholes defects have been observed, the response of the disconnected strips to the laser beam has been correlated with the noise measurements. Beam test of four prototype modules have been carried out at PS accelerator at CERN using 7 GeV/c pions. It was demonstrated that the modules provide an excellent signal-to-noise ratio in the range 40-75. The estimated spatial resolution for the normally incident tracks is about 18 μm using the center-of-gravity cluster reconstruction method. A non-iterative method for spatial resolution determination was developed, it was shown that in order to determine the resolution of each individual detector in the telescope, the telescope should consist of at least 5 detectors. The detectors showed high detection efficiency, in the order 99%. It was shown that the particle loss occurs mostly in the defected regions near the noisy strips or strips with a very low gain. The efficiency of the sensor area with nominal characteristics is consistent with 100%.

Clinical progress of human papillomavirus genotypes and their persistent infection in subjects with atypical squamous cells of undetermined significance cytology: Statistical and latent Dirichlet allocation analysis

PubMed Central

Kim, Yee Suk; Lee, Sungin; Zong, Nansu; Kahng, Jimin

2017-01-01

The present study aimed to investigate differences in prognosis based on human papillomavirus (HPV) infection, persistent infection and genotype variations for patients exhibiting atypical squamous cells of undetermined significance (ASCUS) in their initial Papanicolaou (PAP) test results. A latent Dirichlet allocation (LDA)-based tool was developed that may offer a facilitated means of communication to be employed during patient-doctor consultations. The present study assessed 491 patients (139 HPV-positive and 352 HPV-negative cases) with a PAP test result of ASCUS with a follow-up period ≥2 years. Patients underwent PAP and HPV DNA chip tests between January 2006 and January 2009. The HPV-positive subjects were followed up with at least 2 instances of PAP and HPV DNA chip tests. The most common genotypes observed were HPV-16 (25.9%, 36/139), HPV-52 (14.4%, 20/139), HPV-58 (13.7%, 19/139), HPV-56 (11.5%, 16/139), HPV-51 (9.4%, 13/139) and HPV-18 (8.6%, 12/139). A total of 33.3% (12/36) patients positive for HPV-16 had cervical intraepithelial neoplasia (CIN)2 or a worse result, which was significantly higher than the prevalence of CIN2 of 1.8% (8/455) in patients negative for HPV-16 (P<0.001), while no significant association was identified for other genotypes in terms of genotype and clinical progress. There was a significant association between clearance and good prognosis (P<0.001). Persistent infection was higher in patients aged ≥51 years (38.7%) than in those aged ≤50 years (20.4%; P=0.036). Progression from persistent infection to CIN2 or worse (19/34, 55.9%) was higher than clearance (0/105, 0.0%; P<0.001). In the LDA analysis, using symmetric Dirichlet priors α=0.1 and β=0.01, and clusters (k)=5 or 10 provided the most meaningful groupings. Statistical and LDA analyses produced consistent results regarding the association between persistent infection of HPV-16, old age and long infection period with a clinical progression of CIN2 or worse. Therefore, LDA results may be presented as explanatory evidence during time-constrained patient-doctor consultations in order to deliver information regarding the patient's status. PMID:28587376

An integratable microfluidic cartridge for forensic swab samples lysis.

PubMed

Yang, Jianing; Brooks, Carla; Estes, Matthew D; Hurth, Cedric M; Zenhausern, Frederic

2014-01-01

Fully automated rapid forensic DNA analysis requires integrating several multistep processes onto a single microfluidic platform, including substrate lysis, extraction of DNA from the released lysate solution, multiplexed PCR amplification of STR loci, separation of PCR products by capillary electrophoresis, and analysis for allelic peak calling. Over the past several years, most of the rapid DNA analysis systems developed started with the reference swab sample lysate and involved an off-chip lysis of collected substrates. As a result of advancement in technology and chemistry, addition of a microfluidic module for swab sample lysis has been achieved in a few of the rapid DNA analysis systems. However, recent reports on integrated rapid DNA analysis systems with swab-in and answer-out capability lack any quantitative and qualitative characterization of the swab-in sample lysis module, which is important for downstream forensic sample processing. Maximal collection and subsequent recovery of the biological material from the crime scene is one of the first and critical steps in forensic DNA technology. Herein we present the design, fabrication and characterization of an integratable swab lysis cartridge module and the test results obtained from different types of commonly used forensic swab samples, including buccal, saliva, and blood swab samples, demonstrating the compatibility with different downstream DNA extraction chemistries. This swab lysis cartridge module is easy to operate, compatible with both forensic and microfluidic requirements, and ready to be integrated with our existing automated rapid forensic DNA analysis system. Following the characterization of the swab lysis module, an integrated run from buccal swab sample-in to the microchip CE electropherogram-out was demonstrated on the integrated prototype instrument. Therefore, in this study, we demonstrate that this swab lysis cartridge module is: (1) functionally, comparable with routine benchtop lysis, (2) compatible with various types of swab samples and chemistries, and (3) integratable to achieve a micro total analysis system (μTAS) for rapid DNA analysis. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Multi-Gene Detection and Identification of Mosquito-Borne RNA Viruses Using an Oligonucleotide Microarray

PubMed Central

Grubaugh, Nathan D.; McMenamy, Scott S.; Turell, Michael J.; Lee, John S.

2013-01-01

Background Arthropod-borne viruses are important emerging pathogens world-wide. Viruses transmitted by mosquitoes, such as dengue, yellow fever, and Japanese encephalitis viruses, infect hundreds of millions of people and animals each year. Global surveillance of these viruses in mosquito vectors using molecular based assays is critical for prevention and control of the associated diseases. Here, we report an oligonucleotide DNA microarray design, termed ArboChip5.1, for multi-gene detection and identification of mosquito-borne RNA viruses from the genera Flavivirus (family Flaviviridae), Alphavirus (Togaviridae), Orthobunyavirus (Bunyaviridae), and Phlebovirus (Bunyaviridae). Methodology/Principal Findings The assay utilizes targeted PCR amplification of three genes from each virus genus for electrochemical detection on a portable, field-tested microarray platform. Fifty-two viruses propagated in cell-culture were used to evaluate the specificity of the PCR primer sets and the ArboChip5.1 microarray capture probes. The microarray detected all of the tested viruses and differentiated between many closely related viruses such as members of the dengue, Japanese encephalitis, and Semliki Forest virus clades. Laboratory infected mosquitoes were used to simulate field samples and to determine the limits of detection. Additionally, we identified dengue virus type 3, Japanese encephalitis virus, Tembusu virus, Culex flavivirus, and a Quang Binh-like virus from mosquitoes collected in Thailand in 2011 and 2012. Conclusions/Significance We demonstrated that the described assay can be utilized in a comprehensive field surveillance program by the broad-range amplification and specific identification of arboviruses from infected mosquitoes. Furthermore, the microarray platform can be deployed in the field and viral RNA extraction to data analysis can occur in as little as 12 h. The information derived from the ArboChip5.1 microarray can help to establish public health priorities, detect disease outbreaks, and evaluate control programs. PMID:23967358

Expression and significance of CHIP in canine mammary gland tumors

PubMed Central

WANG, Huanan; YANG, Xu; JIN, Yipeng; PEI, Shimin; ZHANG, Di; MA, Wen; HUANG, Jian; QIU, Hengbin; ZHANG, Xinke; JIANG, Qiuyue; SUN, Weidong; ZHANG, Hong; LIN, Degui

2015-01-01

CHIP (Carboxy terminus of Hsc70 Interacting Protein) is an E3 ubiquitin ligase that can induce ubiquitination and degradation of several oncogenic proteins. The expression of CHIP is frequently lower in human breast cancer than in normal breast tissue. However, the expression and role of CHIP in the canine mammary gland tumor (CMGT) remain unclear. We investigated the potential correlation between CHIP expression and mammary gland tumor prognosis in female dogs. CHIP expression was measured in 54 dogs by immunohistochemistry and real-time RT-PCR. CHIP protein expression was significantly correlated with the histopathological diagnosis, outcome of disease and tumor classification. The transcriptional level of CHIP was significantly higher in normal tissues (P=0.001) and benign tumors (P=0.009) than it in malignant tumors. CHIP protein expression was significantly correlated with the transcriptional level of CHIP (P=0.0102). The log-rank test survival curves indicated that patients with low expression of CHIP had shorter overall periods of survival than those with higher CHIP protein expression (P=0.050). Our data suggest that CHIP may play an important role in the formation and development of CMGTs and serve as a valuable prognostic marker and potential target for genetic therapy. PMID:26156079

Differentiation of the seven major lyssavirus species by oligonucleotide microarray.

PubMed

Xi, Jin; Guo, Huancheng; Feng, Ye; Xu, Yunbin; Shao, Mingfu; Su, Nan; Wan, Jiayu; Li, Jiping; Tu, Changchun

2012-03-01

An oligonucleotide microarray, LyssaChip, has been developed and verified as a highly specific diagnostic tool for differentiation of the 7 major lyssavirus species. As with conventional typing microarray methods, the LyssaChip relies on sequence differences in the 371-nucleotide region coding for the nucleoprotein. This region was amplified using nested reverse transcription-PCR primers that bind to the 7 major lyssaviruses. The LyssaChip includes 57 pairs of species typing and corresponding control oligonucleotide probes (oligoprobes) immobilized on glass slides, and it can analyze 12 samples on a single slide within 8 h. Analysis of 111 clinical brain specimens (65 from animals with suspected rabies submitted to the laboratory and 46 of butchered dog brain tissues collected from restaurants) showed that the chip method was 100% sensitive and highly consistent with the "gold standard," a fluorescent antibody test (FAT). The chip method could detect rabies virus in highly decayed brain tissues, whereas the FAT did not, and therefore the chip test may be more applicable to highly decayed brain tissues than the FAT. LyssaChip may provide a convenient and inexpensive alternative for diagnosis and differentiation of rabies and rabies-related diseases.

Design and fabrication of a micron scale free-standing specimen for uniaxial micro-tensile tests

NASA Astrophysics Data System (ADS)

Tang, Jun; Wang, Hong; Li, Shi Chen; Liu, Rui; Mao, Sheng Ping; Li, Xue Ping; Zhang, Cong Chun; Ding, Guifu

2009-10-01

This paper presents a novel design and fabrication of test chips with a nickel free-standing specimen for the micro uniaxial tensile test. To fabricate test chips on the quartz substrate significantly reduces the fabrication time, minimizes the number of steps and eliminates the effect of the wet anisotropic etching process on mechanical properties. The test chip can be gripped tightly to the test machine and aligned accurately in the pulling direction; furthermore, the approximately straight design of the specimen rather than the traditional dog-bone structure enables the strain be directly measured by a displacement sensor. Both finite-element method (FEM) analysis and experimental results indicate the reliability of the new design. The test chip can also be extended to other materials. The experimental measured Young's modulus of a thin nickel film and the ultimate tensile strength are approximately 94.5 Gpa and 1.76 Gpa, respectively. The results were substantially supported by the experiment on larger gauge specimens by a commercial dynamic mechanical analysis (DMA) instrument. These specimens were electroplated under the same conditions. The low Young's modulus and the high ultimate tensile strength might be explained by the fine grain in the electroplated structure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Menglu; Tu, K. N., E-mail: kntu@ucla.edu; Kim, Dong Wook

Thermal-crosstalk induced thermomigration failure in un-powered microbumps has been found in 2.5D integrated circuit (IC) circuit. In 2.5D IC, a Si interposer was used between a polymer substrate and a device chip which has transistors. The interposer has no transistors. If transistors are added to the interposer chip, it becomes 3D IC. In our test structure, there are two Si chips placed horizontally on a Si interposer. The vertical connections between the interposer and the Si chips are through microbumps. We powered one daisy chain of the microbumps under one Si chip; however, the un-powered microbumps in the neighboring chipmore » are failed with big holes in the solder layer. We find that Joule heating from the powered microbumps is transferred horizontally to the bottom of the neighboring un-powered microbumps, and creates a large temperature gradient, in the order of 1000 °C/cm, through the un-powered microbumps in the neighboring chip, so the latter failed by thermomigration. In addition, we used synchrotron radiation tomography to compare three sets of microbumps in the test structure: microbumps under electromigration, microbumps under thermomigration, and microbumps under a constant temperature thermal annealing. The results show that the microbumps under thermomigration have the largest damage. Furthermore, simulation of temperature distribution in the test structure supports the finding of thermomigration.« less

Establishment and Application of a Visual DNA Microarray for the Detection of Food-borne Pathogens.

PubMed

Li, Yongjin

2016-01-01

The accurate detection and identification of food-borne pathogenic microorganisms is critical for food safety nowadays. In the present work, a visual DNA microarray was established and applied to detect pathogens commonly found in food, including Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in food samples. Multiplex PCR (mPCR) was employed to simultaneously amplify specific gene fragments, fimY for Salmonella, ipaH for Shigella, iap for L. monocytogenes and ECs2841 for E. coli O157:H7, respectively. Biotinylated PCR amplicons annealed to the microarray probes were then reacted with a streptavidin-alkaline phosphatase conjugate and nitro blue tetrazolium/5-bromo-4-chloro-3'-indolylphosphate, p-toluidine salt (NBT/BCIP); the positive results were easily visualized as blue dots formatted on the microarray surface. The performance of a DNA microarray was tested against 14 representative collection strains and mock-contamination food samples. The combination of mPCR and a visual micro-plate chip specifically and sensitively detected Salmonella enterica, Shigella flexneri, E. coli O157:H7 and Listeria monocytogenes in standard strains and food matrices with a sensitivity of ∼10(2) CFU/mL of bacterial culture. Thus, the developed method is advantageous because of its high throughput, cost-effectiveness and ease of use.

Droplet Microfluidics for Compartmentalized Cell Lysis and Extension of DNA from Single-Cells

NASA Astrophysics Data System (ADS)

Zimny, Philip; Juncker, David; Reisner, Walter

Current single cell DNA analysis methods suffer from (i) bias introduced by the need for molecular amplification and (ii) limited ability to sequence repetitive elements, resulting in (iii) an inability to obtain information regarding long range genomic features. Recent efforts to circumvent these limitations rely on techniques for sensing single molecules of DNA extracted from single-cells. Here we demonstrate a droplet microfluidic approach for encapsulation and biochemical processing of single-cells inside alginate microparticles. In our approach, single-cells are first packaged inside the alginate microparticles followed by cell lysis, DNA purification, and labeling steps performed off-chip inside this microparticle system. The alginate microparticles are then introduced inside a micro/nanofluidic system where the alginate is broken down via a chelating buffer, releasing long DNA molecules which are then extended inside nanofluidic channels for analysis via standard mapping protocols.

On-chip micropatterning of plastic (cylic olefin copolymer, COC) microfluidic channels for the fabrication of biomolecule microarrays using photografting methods.

PubMed

Pu, Qiaosheng; Oyesanya, Olufemi; Thompson, Bowlin; Liu, Shantang; Alvarez, Julio C

2007-01-30

This paper reports on the surface modification of plastic microfluidic channels to prepare different biomolecule micropatterns using ultraviolet (UV) photografting methods. The linkage chemistry is based upon UV photopolymerization of acryl monomers to generate thin films (0.01-6 microm) chemically linked to the organic backbone of the plastic surface. The commodity thermoplastic, cyclic olefin copolymer (COC) was selected to build microfluidic chips because of its significant UV transparency and easiness for microfabrication by molding techniques. Once the polyacrylic films were grafted on the COC surface using photomasks, micropatterns of proteins, DNA, and biotinlated conjugates were readily obtained by surface chemical reactions in one or two subsequent steps. The thickness of the photografted films can be tuned from several nanometers up to several micrometers, depending on the reaction conditions. The micropatterned films can be prepared inside the microfluidic channel (on-chip) or on open COC surfaces (off-chip) with densities of functional groups about 10(-7) mol/cm2. Characterization of these films was performed by attenuated-total-reflectance IR spectroscopy, fluorescence microscopy, profilometry, atomic force microscopy, and electrokinetic methods.

Binding of leachable components of polymethyl methacrylate (PMMA) and peptide on modified SPR chip

NASA Astrophysics Data System (ADS)

Szaloki, M.; Vitalyos, G.; Harfalvi, J.; Hegedus, Cs

2013-12-01

Many types of polymers are often used in dentistry, which may cause allergic reaction, mainly methyl methacrylate allergy due to the leachable, degradable components of polymerized dental products. The aim of this study was to investigate the interaction between the leachable components of PMMA and peptides by Fourier-transform Surface Plasmon Resonance (FT SPR). In our previous work binding of oligopeptides (Ph.D.-7 and Ph.D.-12 Peptide Library Kit) was investigated to PMMA surface by phage display technique. It was found that oligopeptides bounded specifically to PMMA surface. The most common amino acids were leucine and proline inside the amino acids sequences of DNA of phages. The binding of haptens, as formaldehyde and methacrylic acid, to frequent amino acids was to investigate on the modified gold SPR chip. Self assembled monolayer (SAM) modified the surface of gold chip and ensured the specific binding between the haptens and amino acids. It was found that amino acids bounded to modified SPR gold and the haptens bounded to amino acids by creating multilayer on the chip surface. By the application of phage display and SPR modern bioanalytical methods the interaction between allergens and peptides can be investigated.

RELIC: a novel dye-bias correction method for Illumina Methylation BeadChip.

PubMed

Xu, Zongli; Langie, Sabine A S; De Boever, Patrick; Taylor, Jack A; Niu, Liang

2017-01-03

The Illumina Infinium HumanMethylation450 BeadChip and its successor, Infinium MethylationEPIC BeadChip, have been extensively utilized in epigenome-wide association studies. Both arrays use two fluorescent dyes (Cy3-green/Cy5-red) to measure methylation level at CpG sites. However, performance difference between dyes can result in biased estimates of methylation levels. Here we describe a novel method, called REgression on Logarithm of Internal Control probes (RELIC) to correct for dye bias on whole array by utilizing the intensity values of paired internal control probes that monitor the two color channels. We evaluate the method in several datasets against other widely used dye-bias correction methods. Results on data quality improvement showed that RELIC correction statistically significantly outperforms alternative dye-bias correction methods. We incorporated the method into the R package ENmix, which is freely available from the Bioconductor website ( https://www.bioconductor.org/packages/release/bioc/html/ENmix.html ). RELIC is an efficient and robust method to correct for dye-bias in Illumina Methylation BeadChip data. It outperforms other alternative methods and conveniently implemented in R package ENmix to facilitate DNA methylation studies.

GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

1994-09-01

GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

New Face for Chromatin-Related Mesenchymal Modulator: n-CHD9 Localizes to Nucleoli and Interacts With Ribosomal Genes.

PubMed

Salomon-Kent, Ronit; Marom, Ronit; John, Sam; Dundr, Miroslav; Schiltz, Louis R; Gutierrez, Jose; Workman, Jerry; Benayahu, Dafna; Hager, Gordon L

2015-09-01

Mesenchymal stem cells' differentiation into several lineages is coordinated by a complex of transcription factors and co-regulators which bind to specific gene promoters. The Chromatin-Related Mesenchymal Modulator, CHD9 demonstrated in vitro its ability for remodeling activity to reposition nucleosomes in an ATP-dependent manner. Epigenetically, CHD9 binds with modified H3-(K9me2/3 and K27me3). Previously, we presented a role for CHD9 with RNA Polymerase II (Pol II)-dependent transcription of tissue specific genes. Far less is known about CHD9 function in RNA Polymerase I (Pol I) related transcription of the ribosomal locus that also drives specific cell fate. We here describe a new form, the nucleolar CHD9 (n-CHD9) that is dynamically associated with Pol I, fibrillarin, and upstream binding factor (UBF) in the nucleoli, as shown by imaging and molecular approaches. Inhibitors of transcription disorganized the nucleolar compartment of transcription sites where rDNA is actively transcribed. Collectively, these findings link n-CHD9 with RNA pol I transcription in fibrillar centers. Using chromatin immunoprecipitation (ChIP) and tilling arrays (ChIP- chip), we find an association of n-CHD9 with Pol I related to rRNA biogenesis. Our new findings support the role for CHD9 in chromatin regulation and association with rDNA genes, in addition to its already known function in transcription control of tissue specific genes. © 2015 Wiley Periodicals, Inc.

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Chromatin immunoprecipitation assays: application of ChIP-on-chip for defining dynamic transcriptional mechanisms in bone cells.

PubMed

van der Deen, Margaretha; Hassan, Mohammad Q; Pratap, Jitesh; Teplyuk, Nadiya M; Young, Daniel W; Javed, Amjad; Zaidi, Sayyed K; Lian, Jane B; Montecino, Martin; Stein, Janet L; Stein, Gary S; van Wijnen, Andre J

2008-01-01

Normal cell growth and differentiation of bone cells requires the sequential expression of cell type specific genes to permit lineage specification and development of cellular phenotypes. Transcriptional activation and repression of distinct sets of genes support the anabolic functions of osteoblasts and the catabolic properties of osteoclasts. Furthermore, metastasis of tumors to the bone environment is controlled by transcriptional mechanisms. Insights into the transcriptional regulation of genes in bone cells may provide a conceptual basis for improved therapeutic approaches to treat bone fractures, genetic osteopathologies, and/or cancer metastases to bone. Chromatin immunoprecipitation (ChIP) is a powerful technique to establish in vivo binding of transcription factors to the promoters of genes that are either activated or repressed in bone cells. Combining ChIP with genomic microarray analysis, colloquially referred to as "ChIP-on-chip," has become a valuable method for analysis of endogenous protein/DNA interactions. This technique permits assessment of chromosomal binding sites for transcription factors or the location of histone modifications at a genomic scale. This chapter discusses protocols for performing chromatin immunoprecipitation experiments, with a focus on ChIP-on-chip analysis. The information presented is based on the authors' experience with defining interactions of Runt-related (RUNX) transcription factors with bone-related genes within the context of the native nucleosomal organization of intact osteoblastic cells.

Deposition of chemically reactive and repellent sites on biosensor chips for reduced non-specific binding.

PubMed

Gandhiraman, R P; Gubala, V; Le, N C H; Nam, Le Cao Hoai; Volcke, C; Doyle, C; James, B; Daniels, S; Williams, D E

2010-08-01

The performances of new polymeric materials with excellent optical properties and good machinability have led the biomedical diagnostics industry to develop cheap disposable biosensor platforms appropriate for point of care applications. Zeonor, a type of cycloolefin polymer (COP), is one such polymer that presents an excellent platform for biosensor chips. These polymer substrates have to be modified to have suitable physico-chemical properties for immobilizing proteins. In this work, we have demonstrated the amine functionalization of COP substrates, by plasma enhanced chemical vapour deposition (PECVD), through codeposition of ethylene diamine and 3-aminopropyltriethoxysilane precursors, for building chemistries on the plastic chip. The elemental composition, adhesion, ageing and reactivity of the plasma polymerized film were examined. The Si-O functionality present in amino silane contributed for a good interfacial adhesion of the coating to COP substrates and also acted as a network building layer for plasma polymerization. Wet chemical modification was then carried out on the amine functionalized chips to create chemically reactive isothiocyanate sites and protein repellent fluorinated sites on the same chip. The density of the reactive and repellent sites was altered by choosing appropriate mixtures of homofunctional phenyldiisothiocyanate (PDITC), pentafluoroisothiocyanate (5FITC) and phenylisothiocyanate (PITC) compounds. By tailoring the density of reactive binding sites and protein repellent sites, the non-specific binding of ssDNA has been decreased to a significant extent. Copyright 2010 Elsevier B.V. All rights reserved.

Ignition propagation and heat effects of propellant chips embedded in castable inhibitor using a laser flux test bomb

NASA Technical Reports Server (NTRS)

Bolton, Douglas E., Jr.

1993-01-01

A castable inhibitor is applied to the aft face of the Space Shuttle Redesigned Solid Rocket Motor (RSRM) forward segment propellant grain to control propellant surface burn area. During fabrication, the propellant surface is trimmed prior to the inhibitor application. This produces a potential for small propellant chips to remain undetected on the propellant surface and contaminate the inhibitor during application. The concern was that undetected propellant chips in the inhibitor might provide a fuse path for premature propellant ignition underneath the inhibitor. To evaluate the fuse path potential, testing was performed on inhibitor samples with embedded propellant. The internal motor environment was simulated with a calibrated CO2 laser beam directed onto a sample which was placed in a 4100 kPa (600 psi) nitrogen pressurized bomb (laser bomb). The testing showed definitive results pertaining to fuse path formation. Embedded propellant chips did not autoignite until the receding heat affected inhibitor surface reached, or passed, the propellant chip. Samples with embedded propellant chips in alignment did not propagate ignition from one chip to another with separation distances as small as 0.010 cm(0.004 inc) and some as little as 0.0051 cm (0.002 in). Propellant chips with volumes approximately less than 0.025 cu cm (0.0015 cu in) (which did not propagate ignition) did not increase the inhibitor material decomposition depth more than the resulting void cavity of the burned out propellant chip. In addition, the depth of this void cavity did not increase until it was overtaken by the surrounding material decomposition depth. This was due, in part, to the retention of the protective inhibitor char layer. Samples with embedded propellant strings, whose thicknesses were below 0.023 cm (0.009 in), did not propagate ignition. Propellant string thicknesses above 0.038 cm (0.015 in) did propagate ignition. Test sample char and heat affected layer measurements and observations compared well with those from the Space Shuttle Solid Rocket Motor (SRM) Technical Evaluation Motor no. 9(TEM-9).