Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system

PubMed Central

Kretschmer, Carola; Gruetzner, Ramona; Löfke, Christian; Dagdas, Yasin; Bürstenbinder, Katharina; Marillonnet, Sylvestre

2018-01-01

Standardized DNA assembly strategies facilitate the generation of multigene constructs from collections of building blocks in plant synthetic biology. A common syntax for hierarchical DNA assembly following the Golden Gate principle employing Type IIs restriction endonucleases was recently developed, and underlies the Modular Cloning and GoldenBraid systems. In these systems, transcriptional units and/or multigene constructs are assembled from libraries of standardized building blocks, also referred to as phytobricks, in several hierarchical levels and by iterative Golden Gate reactions. Here, a toolkit containing further modules for the novel DNA assembly standards was developed. Intended for use with Modular Cloning, most modules are also compatible with GoldenBraid. Firstly, a collection of approximately 80 additional phytobricks is provided, comprising e.g. modules for inducible expression systems, promoters or epitope tags. Furthermore, DNA modules were developed for connecting Modular Cloning and Gateway cloning, either for toggling between systems or for standardized Gateway destination vector assembly. Finally, first instances of a “peripheral infrastructure” around Modular Cloning are presented: While available toolkits are designed for the assembly of plant transformation constructs, vectors were created to also use coding sequence-containing phytobricks directly in yeast two hybrid interaction or bacterial infection assays. The presented material will further enhance versatility of hierarchical DNA assembly strategies. PMID:29847550

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Direct cloning of isogenic murine DNA in yeast and relevance of isogenicity for targeting in embryonic stem cells.

PubMed

Andréasson, Claes; Schick, Anna J; Pfeiffer, Susanne M; Sarov, Mihail; Stewart, Francis; Wurst, Wolfgang; Schick, Joel A

2013-01-01

Efficient gene targeting in embryonic stem cells requires that modifying DNA sequences are identical to those in the targeted chromosomal locus. Yet, there is a paucity of isogenic genomic clones for human cell lines and PCR amplification cannot be used in many mutation-sensitive applications. Here, we describe a novel method for the direct cloning of genomic DNA into a targeting vector, pRTVIR, using oligonucleotide-directed homologous recombination in yeast. We demonstrate the applicability of the method by constructing functional targeting vectors for mammalian genes Uhrf1 and Gfap. Whereas the isogenic targeting of the gene Uhrf1 showed a substantial increase in targeting efficiency compared to non-isogenic DNA in mouse E14 cells, E14-derived DNA performed better than the isogenic DNA in JM8 cells for both Uhrf1 and Gfap. Analysis of 70 C57BL/6-derived targeting vectors electroporated in JM8 and E14 cell lines in parallel showed a clear dependence on isogenicity for targeting, but for three genes isogenic DNA was found to be inhibitory. In summary, this study provides a straightforward methodological approach for the direct generation of isogenic gene targeting vectors.

Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

PubMed Central

Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

2014-01-01

Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

PubMed

Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

2004-12-15

cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

The thiostrepton-resistance-encoding gene in Streptomyces laurentii is located within a cluster of ribosomal protein operons.

PubMed

Smith, T M; Jiang, Y F; Shipley, P; Floss, H G

1995-10-16

A common approach to identify and clone biosynthetic gene from an antibiotic-producing streptomycete is to clone the resistance gene for the antibiotic of interest and then use that gene to clone DNA that is linked to it. As a first step toward cloning the genes responsible for the biosynthesis of thiostrepton (Th) in Streptomyces laurentii (Sl), the Th resistance-encoding gene (tsnR) was cloned as a 1.5-kb BamHI-PvuII fragment in Escherichia coli (Ec), and shown to confer Th resistance when introduced into S. lividans TK24. The tsnR-containing DNA fragment was used as a probe to isolate clones from cosmid libraries of DNA in the Ec cosmid vector SuperCos, and pOJ446 (an Ec/streptomycete) cosmid vector. Sequence and genetic analysis of the DNA flanking the tsnR indicates that the Sl tsnR is not closely linked to biosynthetic genes. Instead it is located within a cluster of ribosomal protein operons.

pPCV, a versatile vector for cloning PCR products.

PubMed

Janner, Christiane R; Brito, Ana Lívia P; Moraes, Lidia Maria P; Reis, Viviane Cb; Torres, Fernando Ag

2013-01-01

The efficiency of PCR product cloning depends on the nature of the DNA polymerase employed because amplicons may have blunt-ends or 3' adenosines overhangs. Therefore, for amplicon cloning, available commercial vectors are either blunt-ended or have a single 3' overhanging thymidine. The aim of this work was to offer in a single vector the ability to clone both types of PCR products. For that purpose, a minimal polylinker was designed to include restriction sites for EcoRV and XcmI which enable direct cloning of amplicons bearing blunt-ends or A-overhangs, respectively, still offering blue/white selection. When tested, the resulting vector, pPCV, presented high efficiency cloning of both types of amplicons.

Cloning of Pf3, a filamentous bacteriophage of Pseudomonas aeruginosa, into the pBD214 vector of Bacillus subtilis.

PubMed Central

Putterman, D G; Gryczan, T J; Dubnau, D; Day, L A

1983-01-01

The genome of Pf3, a filamentous single-stranded DNA bacteriophage of Pseudomonas aeruginosa (a gram-negative organism) was cloned into pBD214, a plasmid cloning vector of Bacillus subtilis (a gram-positive organism). Cloning in the gram-positive organism was done to avoid anticipated lethal effects. The entire Pf3 genome was inserted in each orientation at a unique Bc/I site within a thymidylate synthetase gene (from B. subtilis phage beta 22) on the plasmid. Additional clones were made by inserting EcoRI fragments of Pf3 DNA into a unique EcoRI site within this gene. Images PMID:6306273

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

A pair of new BAC and BIBAC vectors that facilitate BAC/BIBAC library construction and intact large genomic DNA insert exchange.

PubMed

Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong

2011-10-11

Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

[Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

PubMed

Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

2014-08-01

To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

Construction of human artificial chromosome vectors by recombineering.

PubMed

Kotzamanis, George; Cheung, Wing; Abdulrazzak, Hassan; Perez-Luz, Sara; Howe, Steven; Cooke, Howard; Huxley, Clare

2005-05-23

Human artificial chromosomes (HACs) can be formed de novo by transfection of large fragments of cloned alphoid DNA into human HT1080 cells in tissue culture. In order to generate HACs carrying a gene of interest, one can either co-transfect the alphoid DNA and the gene of interest, or one can clone both into a single vector prior to transfection. Here we describe linking approximately 70 kb of alphoid DNA onto a 156-kb BAC carrying the human HPRT gene using Red homologous recombination in the EL350 Escherichia coli host [Lee et al., Genomics 73 (2001) 56-65]. A selectable marker and EGFP marker were then added by loxP/Cre recombination using the arabinose inducible cre gene in the EL350 bacteria. The final construct generates minichromosomes in HT1080 cells and the HPRT gene is expressed. The retrofitting vector can be used to add the approximately 70 kb of alphoid DNA to any BAC carrying a gene of interest to generate a HAC vector. The method can also be used to link any unrelated BAC or PAC insert onto another BAC clone. The EL350 bacteria are an excellent host for building up complex vectors by a combination of homologous and loxP/Cre recombination.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Cloning and study of the pectate lyase gene of Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

1986-04-01

The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

PubMed

Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

2016-08-01

Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

Transformation of Rhodococcus fascians by High-Voltage Electroporation and Development of R. fascians Cloning Vectors

PubMed Central

Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van

1990-01-01

The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

Simplified methods for the construction of RNA and DNA virus infectious clones.

PubMed

Nagata, Tatsuya; Inoue-Nagata, Alice Kazuko

2015-01-01

Infectious virus clones are one of the most powerful tools in plant pathology, molecular biology, and biotechnology. The construction of infectious clones of RNA and DNA viruses, however, usually requires laborious cloning and subcloning steps. In addition, instability of the RNA virus genome is frequently reported after its introduction into the vector and transference to Escherichia coli. These difficulties hamper the cloning procedures, making it tedious and cumbersome. This chapter describes two protocols for a simple construction of infectious viruses, an RNA virus, the tobamovirus Pepper mild mottle virus, and a DNA virus, a bipartite begomovirus. For this purpose, the strategy of overlap-extension PCR was used for the construction of infectious tobamovirus clone and of rolling circle amplification (RCA) for the construction of a dimeric form of the begomovirus clone.

Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

DTIC Science & Technology

1986-11-26

cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

Cloning and heterologous expression of blasticidin S biosynthetic genes from Streptomyces griseochromogenes.

PubMed

Cone, M C; Petrich, A K; Gould, S J; Zabriskie, T M

1998-06-01

Two small chromosomal DNA fragments (2.6 and 4.8 kb) from the blasticidin S producer Streptomyces griseochromogenes were cloned in the high copy number vector pIJ702 and shown to confer increased resistance to blasticidin S upon S. lividans TK24. These fragments were used to screen a library of S. griseochromogenes DNA prepared in the cosmid shuttle vector pOJ446. Cosmids containing DNA inserts of at least 23 kb were identified which hybridized to one or the other resistance fragment, but not to both. Transformation of S. lividans TK24 with several cosmids hybridizing with the 4.8 kb resistance fragment resulted in clones that produced cytosylglucuronic acid, the first intermediate of the blasticidin S biosynthetic pathway, and other blasticidin-related metabolites. A strain of S. lividans TK24 harboring both the 4.8 kb-hybridizing cosmid and the 2.6 kb resistance fragment cloned in pIJ702 produced 12.5 times as much demethylblasticidin S as the transformant harboring the cosmid alone.

Varicella zoster virus DNA exists as two isomers.

PubMed Central

Ecker, J R; Hyman, R W

1982-01-01

Fragments of varicella zoster virus DNA produced by EcoRI endonuclease cleavage were cloned in vector pACYC 184 and those produced by HindIII cleavage were cloned in pBR322. Restriction enzyme cleavage maps established by double digestion and blot hybridization showed that varicella zoster virus DNA has a Mr of 80 +/- 3 x 10(6) and exists as a population of two isomers. Images PMID:6275385

Cloning of a very virulent plus, 686 strain of Marek’s disease virus as a bacterial artificial chromosome

USDA-ARS?s Scientific Manuscript database

Bacterial artificial chromosome (BAC) vectors were first developed to facilitate propagation and manipulation of large DNA fragments. This technology was later used to clone full-length genomes of large DNA viruses to study viral gene function. Marek’s disease virus (MDV) is a highly oncogenic herpe...

An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

PubMed

Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

2012-07-01

cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli

PubMed Central

Jacobus, Ana Paula; Gross, Jeferson

2015-01-01

PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528

Construction of New Campylobacter Cloning Vectors and a New Mutational Cat Cassette

DTIC Science & Technology

1993-01-01

mutational cat cassette PE - 61102A PR - 3M161102 6. AUTHOR(S) TA - BS13AK Yao R, Aim RA, Trust TJ, Guerry P WU- 1291 7. PERFORMING ORGANIZATION NAME(S) AND...mutational cat cassette %~ccesion For (Site-specific mutagenesis; recombinant DNA; multiple cloning site; PCR; shuttle vectors) NTIS CRA&I OTIC TAB E...campylobacter portion of these vectors, only three CAT , Cm acetyllraaseriase; car, gene encoding CAT , Cm, restriction sites in the IacZ MCS remain unique

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, J.J.; Quesada, M.A.; Randesi, M.

1999-07-27

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector. The cloning vector has an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe. 1 fig.

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

1999-07-27

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

Method for producing labeled single-stranded nucleic acid probes

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

1999-10-19

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment. More specifically, the method comprises providing a recombinant DNA construct comprising a DNA segment of interest inserted in a cloning vector, the cloning vector having an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment of interest. The recombinant DNA construct is then contacted with the protein pII encoded by gene II of phage f1 thereby generating a single-stranded nick. The nicked DNA is then contacted with E. coli Exonuclease III thereby expanding the single-stranded nick into a single-stranded gap. The single-stranded gapped DNA is then contacted with a single-strand-specific endonuclease thereby producing a linearized DNA molecule containing a double-stranded deletion corresponding in size to the single-stranded gap. The DNA treated in this manner is then incubated with DNA ligase under conditions appropriate for ligation. Also disclosed is a method for producing single-stranded DNA probes. In this embodiment, single-stranded gapped DNA, produced as described above, is contacted with a DNA polymerase in the presence of labeled nucleotides to fill in the gap. This DNA is then linearized by digestion with a restriction enzyme which cuts outside the DNA segment of interest. The product of this digestion is then denatured to produce a labeled single-stranded nucleic acid probe.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feyereisen-Koener, J.M.

Double-stranded cDNA was prepared from infectious hematopoietic necrosis virus mRNA and cloned into the plasmid vector pUC8. A coprotein (G-protein) of infectious hematopoietic necrosis virus was selected by hybridization to a /sup 32/P-labeled probe. The restriction map and nucleotide sequence of the mRNA encoding the glycoprotein of infectious hematopoietic necrosis virus was determined using this full-length cDNA clone.

Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dunn, J.J.; Barbour, A.G.

1996-11-05

A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface proteinmore » A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.« less

A phage display vector optimized for the generation of human antibody combinatorial libraries and the molecular cloning of monoclonal antibody fragments.

PubMed

Solforosi, Laura; Mancini, Nicasio; Canducci, Filippo; Clementi, Nicola; Sautto, Giuseppe Andrea; Diotti, Roberta Antonia; Clementi, Massimo; Burioni, Roberto

2012-07-01

A novel phagemid vector, named pCM, was optimized for the cloning and display of antibody fragment (Fab) libraries on the surface of filamentous phage. This vector contains two long DNA "stuffer" fragments for easier differentiation of the correctly cut forms of the vector. Moreover, in pCM the fragment at the heavy-chain cloning site contains an acid phosphatase-encoding gene allowing an easy distinction of the Escherichia coli cells containing the unmodified form of the phagemid versus the heavy-chain fragment coding cDNA. In pCM transcription of heavy-chain Fd/gene III and light chain is driven by a single lacZ promoter. The light chain is directed to the periplasm by the ompA signal peptide, whereas the heavy-chain Fd/coat protein III is trafficked by the pelB signal peptide. The phagemid pCM was used to generate a human combinatorial phage display antibody library that allowed the selection of a monoclonal Fab fragment antibody directed against the nucleoprotein (NP) of Influenza A virus.

Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

DOEpatents

Dunn, John J.; Barbour, Alan G.

1996-11-05

A method is provided herein for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed.

Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

DOEpatents

Dunn, J.J.; Barbour, A.G.

1996-11-05

A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.

Phage-mediated horizontal gene transfer of both prophage and heterologous DNA by ϕBB-1, a bacteriophage of Borrelia burgdorferi.

PubMed

Eggers, Christian H; Gray, Carlie M; Preisig, Alexander M; Glenn, Danielle M; Pereira, Jessica; Ayers, Ryan W; Alshahrani, Mohammad; Acabbo, Christopher; Becker, Maria R; Bruenn, Kimberly N; Cheung, Timothy; Jendras, Taylor M; Shepley, Aron B; Moeller, John T

2016-12-01

Horizontal gene transfer (HGT) in Borrelia burgdorferi, the Lyme disease agent, is likely mediated by bacteriophage. Studies of the B. burgdorferi phage, ϕBB-1 and its role in HGT have been hindered by the lack of an assay for readily characterizing phage-mediated DNA movement (transduction). Here we describe an in vitro assay in which a clone of B. burgdorferi strain CA-11.2A encoding kanamycin resistance on a ϕBB-1 prophage is co-cultured with different clones encoding gentamicin resistance on a shuttle vector; transduction is monitored by enumerating colonies selected in the presence of both kanamycin and gentamicin. When both clones used in the assay were derived from CA-11.2A, the frequency of transduction was 1.23 × 10 -6 transductants per cell, and could be increased 5-fold by exposing the phage-producing strain to 5% ethanol. Transduction was also demonstrated between the CA-11.2A clone and clones of both high-passage B. burgdorferi strain B31 and low-passage, virulent B. burgdorferi strain 297, although with lower transduction frequencies. The transductant in the 297 background produced phage capable of transducing another B. burgdorferi clone: this is the first experimental demonstration of transduction from a clone of a virulent strain. In addition to prophage DNA, small Escherichia coli-derived shuttle vectors were also transduced between co-cultured B. burgdorferi strains, suggesting both a broad role for the phage in the HGT of heterologous DNA and a potential use of the phage as a molecular tool. These results enhance our understanding of phage-mediated transduction as a mechanism of HGT in the Lyme disease spirochetes. Furthermore, the reagents and techniques developed herein will facilitate future studies of phage-mediated HGT, especially within the tick vector and vertebrate host. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

PubMed

Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

1989-10-01

A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

Randomly picked cosmid clones overlap the pyrB and oriC gap in the physical map of the E. coli chromosome.

PubMed Central

Knott, V; Rees, D J; Cheng, Z; Brownlee, G G

1988-01-01

Sets of overlapping cosmid clones generated by random sampling and fingerprinting methods complement data at pyrB (96.5') and oriC (84') in the published physical map of E. coli. A new cloning strategy using sheared DNA, and a low copy, inducible cosmid vector were used in order to reduce bias in libraries, in conjunction with micro-methods for preparing cosmid DNA from a large number of clones. Our results are relevant to the design of the best approach to the physical mapping of large genomes. PMID:2834694

Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

PubMed Central

Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

2015-01-01

Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

[Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

PubMed

Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

2009-04-01

This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

Construction of a food-grade cloning vector for Lactobacillus plantarum and its utilization in a food model.

PubMed

Rattanachaikunsopon, Pongsak; Phumkhachorn, Parichat

2012-01-01

The development of Lactobacillus plantarum to be used in starter cultures in the food industry has been limited because of the lack of a food-grade cloning vector for the bacterium. In this study, the plasmid pFLP1 was constructed by joining 2 DNA fragments derived from food-approved organisms. The 5.2-kb BamHI/KpnI DNA fragment of pRV566 containing the theta-type replicon of Lactobacillus sakei was ligated to the BamHI/KpnI DNA fragment of a 2.9-kb lactococcal cadmium resistance determinant amplified from pND918. The 8.1-kb newly constructed plasmid could transform L. plantarum N014, a bacteriocin-producing bacteria originally isolated from nham, a traditional Thai fermented sausage. The resulting transformant, L. plantarum N014-FLP, and its parent strain were shown to be very similar in growth rate and bacteriocin activity. In addition, the plasmid was very stable in its host bacteria under nonselective pressure for 100 generations in MRS medium and for 5 days in a nham model. These results suggest that pFLP1 is a potential food-grade cloning vector for L. plantarum.

“Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

PubMed Central

2012-01-01

Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256

Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

ERIC Educational Resources Information Center

Szeberenyi, Jozsef

2008-01-01

Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Homeologous plastid DNA transformation in tobacco is mediated by multiple recombination events.

PubMed Central

Kavanagh, T A; Thanh, N D; Lao, N T; McGrath, N; Peter, S O; Horváth, E M; Dix, P J; Medgyesy, P

1999-01-01

Efficient plastid transformation has been achieved in Nicotiana tabacum using cloned plastid DNA of Solanum nigrum carrying mutations conferring spectinomycin and streptomycin resistance. The use of the incompletely homologous (homeologous) Solanum plastid DNA as donor resulted in a Nicotiana plastid transformation frequency comparable with that of other experiments where completely homologous plastid DNA was introduced. Physical mapping and nucleotide sequence analysis of the targeted plastid DNA region in the transformants demonstrated efficient site-specific integration of the 7.8-kb Solanum plastid DNA and the exclusion of the vector DNA. The integration of the cloned Solanum plastid DNA into the Nicotiana plastid genome involved multiple recombination events as revealed by the presence of discontinuous tracts of Solanum-specific sequences that were interspersed between Nicotiana-specific markers. Marked position effects resulted in very frequent cointegration of the nonselected peripheral donor markers located adjacent to the vector DNA. Data presented here on the efficiency and features of homeologous plastid DNA recombination are consistent with the existence of an active RecA-mediated, but a diminished mismatch, recombination/repair system in higher-plant plastids. PMID:10388829

Generation of Infectious Poliovirus with Altered Genetic Information from Cloned cDNA.

PubMed

Bujaki, Erika

2016-01-01

The effect of specific genetic alterations on virus biology and phenotype can be studied by a great number of available assays. The following method describes the basic protocol to generate infectious poliovirus with altered genetic information from cloned cDNA in cultured cells.The example explained here involves generation of a recombinant poliovirus genome by simply replacing a portion of the 5' noncoding region with a synthetic gene by restriction cloning. The vector containing the full length poliovirus genome and the insert DNA with the known mutation(s) are cleaved for directional cloning, then ligated and transformed into competent bacteria. The recombinant plasmid DNA is then propagated in bacteria and transcribed to RNA in vitro before RNA transfection of cultured cells is performed. Finally, viral particles are recovered from the cell culture.

Construction of broad-host-range cosmid cloning vectors: identification of genes necessary for growth of Methylobacterium organophilum on methanol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Allen, L.N.; Hanson, R.S.

Four new cloning vectors have been constructed from the broad-host-range cloning vector pRK290. These vectors, pLA2901, pLA2905, pLA2910, and pLA2917, confer resistance to kanamycin and tetracycline. The latter two are cosmid derivatives of pLA2901. The new vectors can be mobilized into, and are stably maintained in, a variety of gram-negative bacteria. A Sau3A genomic bank of Methylobacterium organophilum strain xx DNA has been constructed in pLA2917, and complementation analysis, with a variety of mutants unable to grow on methanol, revealed at least five separate regions necessary for growth on methanol. Complementation analysis and Tn5 mutagenesis data suggest that at leastmore » three genes are responsible for expression of active methanol dehydrogenase.« less

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

A Potential Food-Grade Cloning Vector for Streptococcus thermophilus That Uses Cadmium Resistance as the Selectable Marker

PubMed Central

Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.

2003-01-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023

A potential food-grade cloning vector for Streptococcus thermophilus that uses cadmium resistance as the selectable marker.

PubMed

Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W

2003-10-01

A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.

The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

2012-12-01

The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

Non-homologous end joining-mediated functional marker selection for DNA cloning in the yeast Kluyveromyces marxianus.

PubMed

Hoshida, Hisashi; Murakami, Nobutada; Suzuki, Ayako; Tamura, Ryoko; Asakawa, Jun; Abdel-Banat, Babiker M A; Nonklang, Sanom; Nakamura, Mikiko; Akada, Rinji

2014-01-01

The cloning of DNA fragments into vectors or host genomes has traditionally been performed using Escherichia coli with restriction enzymes and DNA ligase or homologous recombination-based reactions. We report here a novel DNA cloning method that does not require DNA end processing or homologous recombination, but that ensures highly accurate cloning. The method exploits the efficient non-homologous end-joining (NHEJ) activity of the yeast Kluyveromyces marxianus and consists of a novel functional marker selection system. First, to demonstrate the applicability of NHEJ to DNA cloning, a C-terminal-truncated non-functional ura3 selection marker and the truncated region were PCR-amplified separately, mixed and directly used for the transformation. URA3(+) transformants appeared on the selection plates, indicating that the two DNA fragments were correctly joined by NHEJ to generate a functional URA3 gene that had inserted into the yeast chromosome. To develop the cloning system, the shortest URA3 C-terminal encoding sequence that could restore the function of a truncated non-functional ura3 was determined by deletion analysis, and was included in the primers to amplify target DNAs for cloning. Transformation with PCR-amplified target DNAs and C-terminal truncated ura3 produced numerous transformant colonies, in which a functional URA3 gene was generated and was integrated into the chromosome with the target DNAs. Several K. marxianus circular plasmids with different selection markers were also developed for NHEJ-based cloning and recombinant DNA construction. The one-step DNA cloning method developed here is a relatively simple and reliable procedure among the DNA cloning systems developed to date. Copyright © 2013 John Wiley & Sons, Ltd.

Cloning strategy for producing brush-forming protein-based polymers.

PubMed

Henderson, Douglas B; Davis, Richey M; Ducker, William A; Van Cott, Kevin E

2005-01-01

Brush-forming polymers are being used in a variety of applications, and by using recombinant DNA technology, there exists the potential to produce protein-based polymers that incorporate unique structures and functions in these brush layers. Despite this potential, production of protein-based brush-forming polymers is not routinely performed. For the design and production of new protein-based polymers with optimal brush-forming properties, it would be desirable to have a cloning strategy that allows an iterative approach wherein the protein based-polymer product can be produced and evaluated, and then if necessary, it can be sequentially modified in a controlled manner to obtain optimal surface density and brush extension. In this work, we report on the development of a cloning strategy intended for the production of protein-based brush-forming polymers. This strategy is based on the assembly of modules of DNA that encode for blocks of protein-based polymers into a commercially available expression vector; there is no need for custom-modified vectors and no need for intermediate cloning vectors. Additionally, because the design of new protein-based biopolymers can be an iterative process, our method enables sequential modification of a protein-based polymer product. With at least 21 bacterial expression vectors and 11 yeast expression vectors compatible with this strategy, there are a number of options available for production of protein-based polymers. It is our intent that this strategy will aid in advancing the production of protein-based brush-forming polymers.

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

DNA modification and functional delivery into human cells using Escherichia coli DH10B

PubMed Central

Narayanan, Kumaran; Warburton, Peter E.

2003-01-01

The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ∼200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies. PMID:12711696

The vector homology problem in diagnostic nucleic acid hybridization of clinical specimens.

PubMed Central

Ambinder, R F; Charache, P; Staal, S; Wright, P; Forman, M; Hayward, S D; Hayward, G S

1986-01-01

Nucleic acid hybridization techniques using cloned probes are finding application in assays of clinical specimens in research and diagnostic laboratories. The probes that we and others have used are recombinant plasmids composed of viral inserts and bacterial plasmid vectors such as pBR322. We suspected that there was material homologous to pBR322 present in many clinical samples. because hybridization occurred in samples which lacked evidence of virus by other techniques. If the presence of this vector-homologous material was unrecognized, hybridization in the test sample might erroneously be interpreted as indicating the presence of viral sequences. In this paper we demonstrate specific hybridization of labeled pBR322 DNA with DNA from various clinical samples. Evidence is presented that nonspecific probe trapping could not account for this phenomenon. In mixing experiments, it is shown that contamination of clinical samples with bacteria would explain such a result. Approaches tested to circumvent this problem included the use of isolated insert probes, alternate cloning vectors, and cold competitor pBR322 DNA in prehybridization and hybridization mixes. None proved entirely satisfactory. We therefore emphasize that it is essential that all hybridization detection systems use a control probe of the vector alone in order to demonstrate the absence of material with vector homology in the specimen tested. Images PMID:3013928

Generation of an infectious clone of a new Korean isolate of apple chlorotic leaf spot virus (ACLSV) driven by dual 35S and T7 promoters in a versatile binary vector

USDA-ARS?s Scientific Manuscript database

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacter...

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

Combinations of various CpG motifs cloned into plasmid backbone modulate and enhance protective immunity of viral replicon DNA anthrax vaccines.

PubMed

Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei

2015-08-01

DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.

Cloning and Expression of cDNA for Rat Heme Oxygenase

NASA Astrophysics Data System (ADS)

Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

1985-12-01

Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

Hot Fusion: an efficient method to clone multiple DNA fragments as well as inverted repeats without ligase.

PubMed

Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.

Hot Fusion: An Efficient Method to Clone Multiple DNA Fragments as Well as Inverted Repeats without Ligase

PubMed Central

Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.

2014-01-01

Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825

Chromosomal localization of actin genes in the malaria mosquito Anopheles darlingi

PubMed Central

BRIDI, L. C.; SHARAKHOVA, M. V.; SHARAKHOV, I. V.; CORDEIRO, J.; AZEVEDO, G. M.; TADEI, W. P.; RAFAEL, M. S.

2012-01-01

Physical and genetic maps have been used for chromosomal localization of genes in vectors of infectious diseases. The availability of polytene chromosomes in malaria mosquitoes provides a unique opportunity to precisely map genes of interest. We report physical mapping of two actin genes on polytene chromosomes of the major malaria vector in Amazon Anopheles darlingi. The clones with the actin genes sequences were obtained from a cDNA library constructed from RNA isolated from adult females and males of An. darlingi. Each of the two clones was mapped to a unique site on the chromosomal arm 2L in subdivisions 21A (clone pl05-A04) and 23B (clone pl17-G06). The obtained results together with previous mapping data provide a suitable basis for comparative genomics and for establishing chromosomal homologies among major malaria vectors. PMID:22804344

Sequence of retrovirus provirus resembles that of bacterial transposable elements

NASA Astrophysics Data System (ADS)

Shimotohno, Kunitada; Mizutani, Satoshi; Temin, Howard M.

1980-06-01

The nucleotide sequences of the terminal regions of an infectious integrated retrovirus cloned in the modified λ phage cloning vector Charon 4A have been elucidated. There is a 569-base pair direct repeat at both ends of the viral DNA. The cell-virus junctions at each end consist of a 5-base pair direct repeat of cell DNA next to a 3-base pair inverted repeat of viral DNA. This structure resembles that of a transposable element and is consistent with the protovirus hypothesis that retroviruses evolved from the cell genome.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly.

PubMed

Andreou, Andreas I; Nakayama, Naomi

2018-01-01

Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid) render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile-simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation.

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Characterization of infectious Murray Valley encephalitis virus derived from a stably cloned genome-length cDNA.

PubMed

Hurrelbrink, R J; Nestorowicz, A; McMinn, P C

1999-12-01

An infectious cDNA clone of Murray Valley encephalitis virus prototype strain 1-51 (MVE-1-51) was constructed by stably inserting genome-length cDNA into the low-copy-number plasmid vector pMC18. Designated pMVE-1-51, the clone consisted of genome-length cDNA of MVE-1-51 under the control of a T7 RNA polymerase promoter. The clone was constructed by using existing components of a cDNA library, in addition to cDNA of the 3' terminus derived by RT-PCR of poly(A)-tailed viral RNA. Upon comparison with other flavivirus sequences, the previously undetermined sequence of the 3' UTR was found to contain elements conserved throughout the genus FLAVIVIRUS: RNA transcribed from pMVE-1-51 and subsequently transfected into BHK-21 cells generated infectious virus. The plaque morphology, replication kinetics and antigenic profile of clone-derived virus (CDV-1-51) was similar to the parental virus in vitro. Furthermore, the virulence properties of CDV-1-51 and MVE-1-51 (LD(50) values and mortality profiles) were found to be identical in vivo in the mouse model. Through site-directed mutagenesis, the infectious clone should serve as a valuable tool for investigating the molecular determinants of virulence in MVE virus.

A Modified Gibson Assembly Method for Cloning Large DNA Fragments with High GC Contents.

PubMed

Li, Lei; Jiang, Weihong; Lu, Yinhua

2018-01-01

Gibson one-step, isothermal assembly method (Gibson assembly) can be used to efficiently assemble large DNA molecules by in vitro recombination involving a 5'-exonuclease, a DNA polymerase and a DNA ligase. In the past few years, this robust DNA assembly method has been widely applied to seamlessly construct genes, genetic pathways and even entire genomes. Here, we expand this method to clone large DNA fragments with high GC contents, such as antibiotic biosynthetic gene clusters from Streptomyces . Due to the low isothermal condition (50 °C) in the Gibson reaction system, the complementary overlaps with high GC contents are proposed to easily form mismatched linker pairings, which leads to low assembly efficiencies mainly due to vector self-ligation. So, we modified this classic method by the following two steps. First, a pair of universal terminal single-stranded DNA overhangs with high AT contents are added to the ends of the BAC vector. Second, two restriction enzyme sites are introduced into the respective sides of the designed overlaps to achieve the hierarchical assembly of large DNA molecules. The optimized Gibson assembly method facilitates fast acquisition of large DNA fragments with high GC contents from Streptomyces.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Reverse genetics in high throughput: rapid generation of complete negative strand RNA virus cDNA clones and recombinant viruses thereof.

PubMed

Nolden, T; Pfaff, F; Nemitz, S; Freuling, C M; Höper, D; Müller, T; Finke, Stefan

2016-04-05

Reverse genetics approaches are indispensable tools for proof of concepts in virus replication and pathogenesis. For negative strand RNA viruses (NSVs) the limited number of infectious cDNA clones represents a bottleneck as clones are often generated from cell culture adapted or attenuated viruses, with limited potential for pathogenesis research. We developed a system in which cDNA copies of complete NSV genomes were directly cloned into reverse genetics vectors by linear-to-linear RedE/T recombination. Rapid cloning of multiple rabies virus (RABV) full length genomes and identification of clones identical to field virus consensus sequence confirmed the approache's reliability. Recombinant viruses were recovered from field virus cDNA clones. Similar growth kinetics of parental and recombinant viruses, preservation of field virus characters in cell type specific replication and virulence in the mouse model were confirmed. Reduced titers after reporter gene insertion indicated that the low level of field virus replication is affected by gene insertions. The flexibility of the strategy was demonstrated by cloning multiple copies of an orthobunyavirus L genome segment. This important step in reverse genetics technology development opens novel avenues for the analysis of virus variability combined with phenotypical characterization of recombinant viruses at a clonal level.

Environmental Control Of A Genetic Process

NASA Technical Reports Server (NTRS)

Khosla, Chaitan; Bailey, James E.

1991-01-01

E. coli bacteria altered to contain DNA sequence encoding production of hemoglobin made to produce hemoglobin at rates decreasing with increases in concentration of oxygen in culture media. Represents amplification of part of method described in "Cloned Hemoglobin Genes Enhance Growth Of Cells" (NPO-17517). Manipulation of promoter/regulator DNA sequences opens promising new subfield of recombinant-DNA technology for environmental control of expression of selected DNA sequences. New recombinant-DNA fusion gene products, expression vectors, and nucleotide-base sequences will emerge. Likely applications include such aerobic processes as manufacture of cloned proteins and synthesis of metabolites, production of chemicals by fermentation, enzymatic degradation, treatment of wastes, brewing, and variety of oxidative chemical reactions.

Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

1991-01-01

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

DNA Microarrays for Aptamer Identification and Structural Characterization

DTIC Science & Technology

2012-09-01

appropriate vector (which has a unique set of factors affecting cloning efficiency) and transformed into competent bacterial cells to spatially...818-822. 2) Tuerk, C. and Gold, L., “Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

Targeting vector construction through recombineering.

PubMed

Malureanu, Liviu A

2011-01-01

Gene targeting in mouse embryonic stem cells is an essential, yet still very expensive and highly time-consuming, tool and method to study gene function at the organismal level or to create mouse models of human diseases. Conventional cloning-based methods have been largely used for generating targeting vectors, but are hampered by a number of limiting factors, including the variety and location of restriction enzymes in the gene locus of interest, the specific PCR amplification of repetitive DNA sequences, and cloning of large DNA fragments. Recombineering is a technique that exploits the highly efficient homologous recombination function encoded by λ phage in Escherichia coli. Bacteriophage-based recombination can recombine homologous sequences as short as 30-50 bases, allowing manipulations such as insertion, deletion, or mutation of virtually any genomic region. The large availability of mouse genomic bacterial artificial chromosome (BAC) libraries covering most of the genome facilitates the retrieval of genomic DNA sequences from the bacterial chromosomes through recombineering. This chapter describes a successfully applied protocol and aims to be a detailed guide through the steps of generation of targeting vectors through recombineering.

An in silico DNA cloning experiment for the biochemistry laboratory.

PubMed

Elkins, Kelly M

2011-01-01

This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.

Characterization of replication-competent retroviruses from nonhuman primates with virus-induced T-cell lymphomas and observations regarding the mechanism of oncogenesis.

PubMed Central

Vanin, E F; Kaloss, M; Broscius, C; Nienhuis, A W

1994-01-01

Rapidly progressive T-cell lymphomas were observed in 3 of 10 rhesus monkeys several months after autologous transplantation of enriched bone marrow stem cells that had been transduced with a retroviral vector preparation containing replication-competent virus (R. E. Donahue, S. W. Kessler, D. Bodice, K. McDonagh, C. Dunbar, S. Goodman, B. Agricola, E. Byrne, M. Raffeld, R. Moen, J. Bacher, K. M. Zsebo, and A. W. Nienhuis, J. Exp. Med. 176:1124-1135, 1992). The animals with lymphoma appeared to be tolerant to retroviral antigens in that their sera lacked antibodies reactive with viral proteins and contained 10(4) to 10(5) infectious virus particles per ml. By molecular cloning and DNA sequencing, we have now demonstrated that the serum from one of the monkeys contained a replication-competent retrovirus that arose by recombination between vector and packaging encoding sequences (vector/helper [V/H] recombinant) in the producer clone used for transduction of bone marrow stem cells. Southern blot analysis demonstrated 14 or 25 copies of this genome per cell where present in two animals. The genome of a second replication-competent virus was also recovered by molecular cloning; it arose by recombination involving the genome of the V/H recombinant and endogenous murine retroviral genomes in the producer clone. Twelve copies of this amphotropic virus/mink cell focus-forming virus genome were present in tumor DNA of one animal, but it was not found in tumor DNA of the other two animals with lymphoma. Southern blot analysis of DNA from various tissues demonstrated common insertion site bands in several samples of tumor DNA from one animal, suggesting clonal origin of the lymphoma. Our data are most consistent with a pathogenic mechanism in which chronic productive retroviral infection allowed insertional mutagenesis of critical growth control genes, leading to cell transformation and clonal tumor evolution. Images PMID:8207799

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

Simple Method for Markerless Gene Deletion in Multidrug-Resistant Acinetobacter baumannii

PubMed Central

Oh, Man Hwan; Lee, Je Chul; Kim, Jungmin

2015-01-01

The traditional markerless gene deletion technique based on overlap extension PCR has been used for generating gene deletions in multidrug-resistant Acinetobacter baumannii. However, the method is time-consuming because it requires restriction digestion of the PCR products in DNA cloning and the construction of new vectors containing a suitable antibiotic resistance cassette for the selection of A. baumannii merodiploids. Moreover, the availability of restriction sites and the selection of recombinant bacteria harboring the desired chimeric plasmid are limited, making the construction of a chimeric plasmid more difficult. We describe a rapid and easy cloning method for markerless gene deletion in A. baumannii, which has no limitation in the availability of restriction sites and allows for easy selection of the clones carrying the desired chimeric plasmid. Notably, it is not necessary to construct new vectors in our method. This method utilizes direct cloning of blunt-end DNA fragments, in which upstream and downstream regions of the target gene are fused with an antibiotic resistance cassette via overlap extension PCR and are inserted into a blunt-end suicide vector developed for blunt-end cloning. Importantly, the antibiotic resistance cassette is placed outside the downstream region in order to enable easy selection of the recombinants carrying the desired plasmid, to eliminate the antibiotic resistance cassette via homologous recombination, and to avoid the necessity of constructing new vectors. This strategy was successfully applied to functional analysis of the genes associated with iron acquisition by A. baumannii ATCC 19606 and to ompA gene deletion in other A. baumannii strains. Consequently, the proposed method is invaluable for markerless gene deletion in multidrug-resistant A. baumannii. PMID:25746991

Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

PubMed Central

Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

2015-01-01

Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.

PubMed

Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C

1979-08-01

A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.

High yield of functional metagenomic library from mangroves constructed in fosmid vector.

PubMed

Gonçalves, A C S; dos Santos, A C F; dos Santos, T F; Pessoa, T B A; Dias, J C T; Rezende, R P

2015-10-02

In the present study, metagenomic technique and fosmid vectors were used to construct a library of clones for exploring the biotechnological potential of mangrove soils by isolation of functional genes encoding hydrolytic enzymes. The library was built with genomic DNA from the soil samples of mangrove sediments and the functional screening of 1824 clones (~64 Mbp) was performed to detect the hydrolytic activity specific for cellulases, amylases (at acidic, neutral and basic pH), lipases/esterases, proteases, and nitrilases. Significant numbers of clones, positive for the tested enzyme activities were obtained. Our results indicate the importance and biotechnological potential of mangrove soils especially when compared to those obtained using other soil metagenomic libraries.

Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

1983-11-30

The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants.

PubMed

Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

PubMed Central

Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science. PMID:29300787

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1991-03-26

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

High-Throughput Cloning and Expression Library Creation for Functional Proteomics

PubMed Central

Festa, Fernanda; Steel, Jason; Bian, Xiaofang; Labaer, Joshua

2013-01-01

The study of protein function usually requires the use of a cloned version of the gene for protein expression and functional assays. This strategy is particular important when the information available regarding function is limited. The functional characterization of the thousands of newly identified proteins revealed by genomics requires faster methods than traditional single gene experiments, creating the need for fast, flexible and reliable cloning systems. These collections of open reading frame (ORF) clones can be coupled with high-throughput proteomics platforms, such as protein microarrays and cell-based assays, to answer biological questions. In this tutorial we provide the background for DNA cloning, discuss the major high-throughput cloning systems (Gateway® Technology, Flexi® Vector Systems, and Creator™ DNA Cloning System) and compare them side-by-side. We also report an example of high-throughput cloning study and its application in functional proteomics. This Tutorial is part of the International Proteomics Tutorial Programme (IPTP12). Details can be found at http://www.proteomicstutorials.org. PMID:23457047

High-throughput cloning and expression library creation for functional proteomics.

PubMed

Festa, Fernanda; Steel, Jason; Bian, Xiaofang; Labaer, Joshua

2013-05-01

The study of protein function usually requires the use of a cloned version of the gene for protein expression and functional assays. This strategy is particularly important when the information available regarding function is limited. The functional characterization of the thousands of newly identified proteins revealed by genomics requires faster methods than traditional single-gene experiments, creating the need for fast, flexible, and reliable cloning systems. These collections of ORF clones can be coupled with high-throughput proteomics platforms, such as protein microarrays and cell-based assays, to answer biological questions. In this tutorial, we provide the background for DNA cloning, discuss the major high-throughput cloning systems (Gateway® Technology, Flexi® Vector Systems, and Creator(TM) DNA Cloning System) and compare them side-by-side. We also report an example of high-throughput cloning study and its application in functional proteomics. This tutorial is part of the International Proteomics Tutorial Programme (IPTP12). © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly

PubMed Central

Andreou, Andreas I.

2018-01-01

Synthetic biology builds upon the foundation of engineering principles, prompting innovation and improvement in biotechnology via a design-build-test-learn cycle. A community-wide standard in DNA assembly would enable bio-molecular engineering at the levels of predictivity and universality in design and construction that are comparable to other engineering fields. Golden Gate Assembly technology, with its robust capability to unidirectionally assemble numerous DNA fragments in a one-tube reaction, has the potential to deliver a universal standard framework for DNA assembly. While current Golden Gate Assembly frameworks (e.g. MoClo and Golden Braid) render either high cloning capacity or vector toolkit simplicity, the technology can be made more versatile—simple, streamlined, and cost/labor-efficient, without compromising capacity. Here we report the development of a new Golden Gate Assembly framework named Mobius Assembly, which combines vector toolkit simplicity with high cloning capacity. It is based on a two-level, hierarchical approach and utilizes a low-frequency cutter to reduce domestication requirements. Mobius Assembly embraces the standard overhang designs designated by MoClo, Golden Braid, and Phytobricks and is largely compatible with already available Golden Gate part libraries. In addition, dropout cassettes encoding chromogenic proteins were implemented for cost-free visible cloning screening that color-code different cloning levels. As proofs of concept, we have successfully assembled up to 16 transcriptional units of various pigmentation genes in both operon and multigene arrangements. Taken together, Mobius Assembly delivers enhanced versatility and efficiency in DNA assembly, facilitating improved standardization and automation. PMID:29293531

Multiple Antibiotic Resistance Plasmids Allow Scalable,
PCR-Mediated DNA Manipulation and Near-Zero Background Cloning

PubMed Central

Arnak, Remigiusz; Altun, Burcin; Tosato, Valentina

2016-01-01

Summary We have constructed two plasmids that can be used for cloning as templates for PCR- -based gene disruption, mutagenesis and the construction of DNA chromosome translocation cassettes. To our knowledge, these plasmids are the first vectors that confer resistance to ampicillin, kanamycin and hygromycin B in bacteria, and to geneticin (G418) and hygromycin B in Saccharomyces cerevisiae simultaneously. The option of simultaneously using up to three resistance markers provides a highly stringent control of recombinant selection and the almost complete elimination of background resistance, while unique restriction sites allow easy cloning of chosen genetic material. Moreover, we successfully used these new vectors as PCR templates for the induction of chromosome translocation in budding yeast by the bridge-induced translocation system. Cells in which translocation was induced carried chromosomal rearrangements as expected and exhibited resistance to both, G418 and hygromycin B. These features make our constructs very handy tools for many molecular biology applications. PMID:27956856

Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

DOEpatents

Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

1987-08-28

A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Library Resources for Bac End Sequencing. Final Technical Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pieter J. de Jong

2000-10-01

Studies directed towards the specific aims outlined for this research award are summarized. The RPCI II Human Bac Library has been expanded by the addition of 6.9-fold genomic coverage. This segment has been generated from a MBOI partial digest of the same anonymous donor DNA used for the rest of the library. A new cloning vector, pTARBAC1, has been constructed and used in the construction of RPCI-II segment 5. This new cloning vector provides a new strategy in identifying targeted genomic regions and will greatly facilitate a large-scale analysis for positional cloning. A new maleCS7BC/6J mouse BAC library has beenmore » constructed. RPCI-23 contain 576 plates (approx 210,000 clones) and represents approximately 11-fold coverage of the mouse genome.« less

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Utilization of a tobacco rattle virus vector to clone an Nicotiana benthamiana cDNA library for VIGS

USDA-ARS?s Scientific Manuscript database

Virus-induced gene silencing (VIGS) is an efficient and rapid method to identify plant gene functions. One of the most widely used VIGS vectors is Tobacco rattle virus (TRV) which has been used successfully for RNA interference (RNAi) in N. benthamiana and tomato. We previously modified a TRV VIGS v...

Genomic resources for gene discovery, functional genome annotation, and evolutionary studies of maize and its close relatives.

PubMed

Wang, Chao; Shi, Xue; Liu, Lin; Li, Haiyan; Ammiraju, Jetty S S; Kudrna, David A; Xiong, Wentao; Wang, Hao; Dai, Zhaozhao; Zheng, Yonglian; Lai, Jinsheng; Jin, Weiwei; Messing, Joachim; Bennetzen, Jeffrey L; Wing, Rod A; Luo, Meizhong

2013-11-01

Maize is one of the most important food crops and a key model for genetics and developmental biology. A genetically anchored and high-quality draft genome sequence of maize inbred B73 has been obtained to serve as a reference sequence. To facilitate evolutionary studies in maize and its close relatives, much like the Oryza Map Alignment Project (OMAP) (www.OMAP.org) bacterial artificial chromosome (BAC) resource did for the rice community, we constructed BAC libraries for maize inbred lines Zheng58, Chang7-2, and Mo17 and maize wild relatives Zea mays ssp. parviglumis and Tripsacum dactyloides. Furthermore, to extend functional genomic studies to maize and sorghum, we also constructed binary BAC (BIBAC) libraries for the maize inbred B73 and the sorghum landrace Nengsi-1. The BAC/BIBAC vectors facilitate transfer of large intact DNA inserts from BAC clones to the BIBAC vector and functional complementation of large DNA fragments. These seven Zea Map Alignment Project (ZMAP) BAC/BIBAC libraries have average insert sizes ranging from 92 to 148 kb, organellar DNA from 0.17 to 2.3%, empty vector rates between 0.35 and 5.56%, and genome equivalents of 4.7- to 8.4-fold. The usefulness of the Parviglumis and Tripsacum BAC libraries was demonstrated by mapping clones to the reference genome. Novel genes and alleles present in these ZMAP libraries can now be used for functional complementation studies and positional or homology-based cloning of genes for translational genomics.

Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

PubMed

Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

2016-01-15

Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

A fosmid cloning strategy for detecting the widest possible spectrum of microbes from the international space station drinking water system.

PubMed

Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A; Venkateswaran, Kasthuri

2012-12-01

In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing.

Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

PubMed

Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

2013-05-01

Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

USGS Publications Warehouse

Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

2001-01-01

This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

Construction of a metagenomic DNA library of sponge symbionts and screening of antibacterial metabolites

NASA Astrophysics Data System (ADS)

Chen, Juan; Zhu, Tianjiao; Li, Dehai; Cui, Chengbin; Fang, Yuchun; Liu, Hongbing; Liu, Peipei; Gu, Qianqun; Zhu, Weiming

2006-04-01

To study the bioactive metabolites produced by sponge-derived uncultured symbionts, a metagenomic DNA library of the symbionts of sponge Gelliodes gracilis was constructed. The average size of DNA inserts in the library was 20 kb. This library was screened for antibiotic activity using paper dise assaying. Two clones displayed the antibacterial activity against Micrococcus tetragenus. The metabolites of these two clones were analyzed through HPLC. The result showed that their metabolites were quite different from those of the host E. coli DH5α and the host containing vector pHZ132. This study may present a new approach to exploring bioactive metabolites of sponge symbionts.

Systematic cloning of human minisatellites from ordered array charomid libraries.

PubMed

Armour, J A; Povey, S; Jeremiah, S; Jeffreys, A J

1990-11-01

We present a rapid and efficient method for the isolation of minisatellite loci from human DNA. The method combines cloning a size-selected fraction of human MboI DNA fragments in a charomid vector with hybridization screening of the library in ordered array. Size-selection of large MboI fragments enriches for the longer, more variable minisatellites and reduces the size of the library required. The library was screened with a series of multi-locus probes known to detect a large number of hypervariable loci in human DNA. The gridded library allowed both the rapid processing of positive clones and the comparative evaluation of the different multi-locus probes used, in terms of both the relative success in detecting hypervariable loci and the degree of overlap between the sets of loci detected. We report 23 new human minisatellite loci isolated by this method, which map to 14 autosomes and the sex chromosomes.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Construction of a novel porcine circovirus type 2 infectious clone as a basis for the development of a PCV2 iDNA vaccine.

PubMed

Wang, Wei-Cheng; Zeng, Zhi-Yong; Tang, De-Yuan; Liang, Hai-Ying; Liu, Zhao; Dai, Zhen-Jiang

2015-08-01

Porcine circovirus-associated disease is a highly contagious disease that has significant economic consequences. The disease is prevalent in many countries and regions. To generate a genetic marker strain of PCV2, a Sal I restriction enzyme site was inserted into the PCV2 clone as a genetic marker by applying iDNA infectious clone technology. The iDNA represents plasmids that encode the full-length DNA genome of PCV2 assembled in a pcDNA3.1-based vectors. The mutant PCV2 was rescued by transfecting an infectious clone into PK-15 cells and was characterised by an immunoperoxidase monolayer assay (IPMA). The viral genome could be differentiated from the wild-type parent by PCR and restriction fragment length polymorphism (PCR-RFLP). Kunming mice were inoculated with the PCV2 infectious clone or rescued virus via intranasal and intraperitoneal routes. Seroconversion to PCV2-specific antibody appeared in the majority of mice from the two inoculated groups at 7 days postinoculation (DPI), and the specific antibody level was steady for at least 42 days. Viraemia, beginning at 7 DPI and lasting 4 weeks, was detected in the majority of the pigs from the two inoculated groups. The animal experiments revealed that the PCV2 infectious clone and rescued virus both could replicate in mice and induce mice to generate anti-PCV2 antibodies. The infectious clones of PCV2 will be useful for further research investigating a potential tractable iDNA vaccine by reverse genetics technology for attenuated virulance. Copyright © 2015 Elsevier B.V. All rights reserved.

Large inserts for big data: artificial chromosomes in the genomic era.

PubMed

Tocchetti, Arianna; Donadio, Stefano; Sosio, Margherita

2018-05-01

The exponential increase in available microbial genome sequences coupled with predictive bioinformatic tools is underscoring the genetic capacity of bacteria to produce an unexpected large number of specialized bioactive compounds. Since most of the biosynthetic gene clusters (BGCs) present in microbial genomes are cryptic, i.e. not expressed under laboratory conditions, a variety of cloning systems and vectors have been devised to harbor DNA fragments large enough to carry entire BGCs and to allow their transfer in suitable heterologous hosts. This minireview provides an overview of the vectors and approaches that have been developed for cloning large BGCs, and successful examples of heterologous expression.

Successful application of FTA Classic Card technology and use of bacteriophage phi29 DNA polymerase for large-scale field sampling and cloning of complete maize streak virus genomes.

PubMed

Owor, Betty E; Shepherd, Dionne N; Taylor, Nigel J; Edema, Richard; Monjane, Adérito L; Thomson, Jennifer A; Martin, Darren P; Varsani, Arvind

2007-03-01

Leaf samples from 155 maize streak virus (MSV)-infected maize plants were collected from 155 farmers' fields in 23 districts in Uganda in May/June 2005 by leaf-pressing infected samples onto FTA Classic Cards. Viral DNA was successfully extracted from cards stored at room temperature for 9 months. The diversity of 127 MSV isolates was analysed by PCR-generated RFLPs. Six representative isolates having different RFLP patterns and causing either severe, moderate or mild disease symptoms, were chosen for amplification from FTA cards by bacteriophage phi29 DNA polymerase using the TempliPhi system. Full-length genomes were inserted into a cloning vector using a unique restriction enzyme site, and sequenced. The 1.3-kb PCR product amplified directly from FTA-eluted DNA and used for RFLP analysis was also cloned and sequenced. Comparison of cloned whole genome sequences with those of the original PCR products indicated that the correct virus genome had been cloned and that no errors were introduced by the phi29 polymerase. This is the first successful large-scale application of FTA card technology to the field, and illustrates the ease with which large numbers of infected samples can be collected and stored for downstream molecular applications such as diversity analysis and cloning of potentially new virus genomes.

Preparation and screening of an arrayed human genomic library generated with the P1 cloning system.

PubMed Central

Shepherd, N S; Pfrogner, B D; Coulby, J N; Ackerman, S L; Vaidyanathan, G; Sauer, R H; Balkenhol, T C; Sternberg, N

1994-01-01

We describe here the construction and initial characterization of a 3-fold coverage genomic library of the human haploid genome that was prepared using the bacteriophage P1 cloning system. The cloned DNA inserts were produced by size fractionation of a Sau3AI partial digest of high molecular weight genomic DNA isolated from primary cells of human foreskin fibroblasts. The inserts were cloned into the pAd10sacBII vector and packaged in vitro into P1 phage. These were used to generate recombinant bacterial clones, each of which was picked robotically from an agar plate into a well of a 96-well microtiter dish, grown overnight, and stored at -70 degrees C. The resulting library, designated DMPC-HFF#1 series A, consists of approximately 130,000-140,000 recombinant clones that were stored in 1500 microtiter dishes. To screen the library, clones were combined in a pooling strategy and specific loci were identified by PCR analysis. On average, the library contains two or three different clones for each locus screened. To date we have identified a total of 17 clones containing the hypoxanthine-guanine phosphoribosyltransferase, human serum albumin-human alpha-fetoprotein, p53, cyclooxygenase I, human apurinic endonuclease, beta-polymerase, and DNA ligase I genes. The cloned inserts average 80 kb in size and range from 70 to 95 kb, with one 49-kb insert and one 62-kb insert. Images PMID:8146166

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Cloning vector

DOEpatents

Guilfoyle, Richard A.; Smith, Lloyd M.

1994-01-01

A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site.

Cloning vector

DOEpatents

Guilfoyle, R.A.; Smith, L.M.

1994-12-27

A vector comprising a filamentous phage sequence containing a first copy of filamentous phage gene X and other sequences necessary for the phage to propagate is disclosed. The vector also contains a second copy of filamentous phage gene X downstream from a promoter capable of promoting transcription in a bacterial host. In a preferred form of the present invention, the filamentous phage is M13 and the vector additionally includes a restriction endonuclease site located in such a manner as to substantially inactivate the second gene X when a DNA sequence is inserted into the restriction site. 2 figures.

Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

PubMed

Ken, C F; Lin, C T; Wu, J L; Shaw, J F

2000-06-01

A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

A Fosmid Cloning Strategy for Detecting the Widest Possible Spectrum of Microbes from the International Space Station Drinking Water System

PubMed Central

Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A.; Venkateswaran, Kasthuri

2012-01-01

In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing. PMID:23346038

Development of RAPD-SCAR markers for different Ganoderma species authentication by improved RAPD amplification and molecular cloning.

PubMed

Fu, J J; Mei, Z Q; Tania, M; Yang, L Q; Cheng, J L; Khan, M A

2015-05-25

The sequence-characterized amplified region (SCAR) is a valuable molecular technique for the genetic identification of any species. This method is mainly derived from the molecular cloning of the amplified DNA fragments achieved from the random amplified polymorphic DNA (RAPD). In this study, we collected DNA from 10 species of Ganoderma mushroom and amplified the DNA using an improved RAPD technique. The amplified fragments were then cloned into a T-vector, and positive clones were screened, indentified, and sequenced for the development of SCAR markers. After designing PCR primers and optimizing PCR conditions, 4 SCAR markers, named LZ1-4, LZ2-2, LZ8-2, and LZ9-15, were developed, which were specific to Ganoderma gibbosum (LZ1-4 and LZ8-2), Ganoderma sinense (LZ2-2 and LZ8-2), Ganoderma tropicum (LZ8-2), and Ganoderma lucidum HG (LZ9-15). These 4 novel SCAR markers were deposited into GenBank with the accession Nos. KM391935, KM391936, KM391937, and KM391938, respectively. Thus, in this study we developed specific SCAR markers for the identification and authentication of different Ganoderma species.

An infectious full-length cDNA clone of duck Tembusu virus, a newly emerging flavivirus causing duck egg drop syndrome in China.

PubMed

Li, Shuang; Zhang, Lijiao; Wang, Yongyue; Wang, Shuxia; Sun, Haigang; Su, Wenliang; He, Weiyong; Han, Bo; Su, Jingliang

2013-01-01

Duck Tembusu virus (TMUV) is a recently identified pathogenic flavivirus that causes severe egg drop and encephalitis in Chinese ducks and geese. It has been found to be most closely related to the mosquito-origin Tembusu virus and chicken Sitiawan virus reported in Malaysia. However, the ecological characteristics and the pathogenesis of duck TMUV are largely unknown. We report the construction of full-length cDNA clone of duck TMUV strain JXSP. The virus genome was reverse transcribed, amplified as seven overlapping fragments and successively ligated into the low copy number vector pWSK29 under the control of a T7 promoter. Transfection of BHK-21 cells with the transcribed RNA from the full-length cDNA clone resulted in production of highly infectious progeny virus. In vitro growth characteristics in BHK-21 cells and virulence in ducklings and BALB/c mice were similar for the rescued and parental viruses. This stable infectious cDNA clone will be a valuable tool for studying the genetic determinants of duck TMUV. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

PubMed

Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

2017-07-01

We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

Saccharomyces cerevisiae Shuttle vectors.

PubMed

Gnügge, Robert; Rudolf, Fabian

2017-05-01

Yeast shuttle vectors are indispensable tools in yeast research. They enable cloning of defined DNA sequences in Escherichia coli and their direct transfer into Saccharomyces cerevisiae cells. There are three types of commonly used yeast shuttle vectors: centromeric plasmids, episomal plasmids and integrating plasmids. In this review, we discuss the different plasmid systems and their characteristic features. We focus on their segregational stability and copy number and indicate how to modify these properties. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Intracellular screen to identify metagenomic clones that induce or inhibit a quorum-sensing biosensor.

PubMed

Williamson, Lynn L; Borlee, Bradley R; Schloss, Patrick D; Guan, Changhui; Allen, Heather K; Handelsman, Jo

2005-10-01

The goal of this study was to design and evaluate a rapid screen to identify metagenomic clones that produce biologically active small molecules. We built metagenomic libraries with DNA from soil on the floodplain of the Tanana River in Alaska. We extracted DNA directly from the soil and cloned it into fosmid and bacterial artificial chromosome vectors, constructing eight metagenomic libraries that contain 53,000 clones with inserts ranging from 1 to 190 kb. To identify clones of interest, we designed a high throughput "intracellular" screen, designated METREX, in which metagenomic DNA is in a host cell containing a biosensor for compounds that induce bacterial quorum sensing. If the metagenomic clone produces a quorum-sensing inducer, the cell produces green fluorescent protein (GFP) and can be identified by fluorescence microscopy or captured by fluorescence-activated cell sorting. Our initial screen identified 11 clones that induce and two that inhibit expression of GFP. The intracellular screen detected quorum-sensing inducers among metagenomic clones that a traditional overlay screen would not. One inducing clone carries a LuxI homologue that directs the synthesis of an N-acyl homoserine lactone quorum-sensing signal molecule. The LuxI homologue has 62% amino acid sequence identity to its closest match in GenBank, AmfI from Pseudomonas fluorescens, and is on a 78-kb insert that contains 67 open reading frames. Another inducing clone carries a gene with homology to homocitrate synthase. Our results demonstrate the power of an intracellular screen to identify functionally active clones and biologically active small molecules in metagenomic libraries.

Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

PubMed Central

Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

1982-01-01

Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

Highly abundant and stage-specific mRNAs in the obligate pathogen Bremia lactucae.

PubMed

Judelson, H S; Michelmore, R W

1990-01-01

Germinating spores of the obligate pathogen Bremia lactucae (lettuce downy mildew) contain several unusually abundant species of mRNA. Thirty-nine cDNA clones corresponding to prevalent transcripts were isolated from a library synthesized using poly(A)+ RNA from germinating spores; these clones represented only five distinct classes. Each corresponding mRNA accounted for from 0.4 to 9 percent by mass of poly(A)+ RNA from germinating spores and together represented greater than 20 percent of the mRNA. The expression of the corresponding genes, and a gene encoding Hsp70, was analyzed in spores during germination and during growth in planta. The Hsp70 mRNA and mRNA from one abundant cDNA clone (ham34) were expressed constitutively. Two clones (ham9 and ham12) hybridized only to mRNA from spores and germinating spores. Two clones (ham37 and ham27) showed hybridization specific to germinating spores. Quantification of the number of genes homologous to each cDNA clone indicated that four clones corresponded to one or two copies per haploid genome, and one hybridized to an approximately 11-member family of genes. A sequence of the gene corresponding to ham34 was obtained to investigate its function and to identify sequences conferring high levels of gene expression for use in constructing vectors for the transformation of B. lactucae.

Development of three full-length infectious cDNA clones of distinct brassica yellows virus genotypes for agrobacterium-mediated inoculation.

PubMed

Zhang, Xiao-Yan; Dong, Shu-Wei; Xiang, Hai-Ying; Chen, Xiang-Ru; Li, Da-Wei; Yu, Jia-Lin; Han, Cheng-Gui

2015-02-02

Brassica yellows virus is a newly identified species in the genus of Polerovirus within the family Luteoviridae. Brassica yellows virus (BrYV) is prevalently distributed throughout Mainland China and South Korea, is an important virus infecting cruciferous crops. Based on six BrYV genomic sequences of isolates from oilseed rape, rutabaga, radish, and cabbage, three genotypes, BrYV-A, BrYV-B, and BrYV-C, exist, which mainly differ in the 5' terminal half of the genome. BrYV is an aphid-transmitted and phloem-limited virus. The use of infectious cDNA clones is an alternative means of infecting plants that allows reverse genetic studies to be performed. In this study, full-length cDNA clones of BrYV-A, recombinant BrYV5B3A, and BrYV-C were constructed under control of the cauliflower mosaic virus 35S promoter. An agrobacterium-mediated inoculation system of Nicotiana benthamiana was developed using these cDNA clones. Three days after infiltration with full-length BrYV cDNA clones, necrotic symptoms were observed in the inoculated leaves of N. benthamiana; however, no obvious symptoms appeared in the upper leaves. Reverse transcription-PCR (RT-PCR) and western blot detection of samples from the upper leaves showed that the maximum infection efficiency of BrYVs could reach 100%. The infectivity of the BrYV-A, BrYV-5B3A, and BrYV-C cDNA clones was further confirmed by northern hybridization. The system developed here will be useful for further studies of BrYV, such as host range, pathogenicity, viral gene functions, and plant-virus-vector interactions, and especially for discerning the differences among the three genotypes. Copyright © 2014 Elsevier B.V. All rights reserved.

A Food-Grade Cloning System for Industrial Strains of Lactococcus lactis

PubMed Central

Sørensen, Kim I.; Larsen, Rasmus; Kibenich, Annette; Junge, Mette P.; Johansen, Eric

2000-01-01

We have previously reported the construction of a food-grade cloning vector for Lactococcus using the ochre suppressor, supB, as the selective marker. This vector, pFG1, causes only a slight growth inhibition in the laboratory strain MG1363 but is unstable in the industrial strains tested. As supB suppresses both amber and ochre stop codons, which are present in 82% of all known lactococcal genes, this undesirable finding may result from the accumulation of elongated mistranslated polypeptides. Here, we report the development of a new food-grade cloning vector, pFG200, which is suitable for overexpressing a variety of genes in industrial strains of Lactococcus lactis. The vector uses an amber suppressor, supD, as selectable marker and consists entirely of Lactococcus DNA, with the exception of a small polylinker region. Using suppressible pyrimidine auxotrophs, selection and maintenance are efficient in any pyrimidine-free medium including milk. Importantly, the presence of this vector in a variety of industrial strains has no significant effect on the growth rate or the rate of acidification in milk, making this an ideal system for food-grade modification of industrially relevant L. lactis strains. The usefulness of this system is demonstrated by overexpressing the pepN gene in a number of industrial backgrounds. PMID:10742196

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids

PubMed Central

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-01-01

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins. PMID:26473830

Homologous Recombination-Independent Large Gene Cassette Knock-in in CHO Cells Using TALEN and MMEJ-Directed Donor Plasmids.

PubMed

Sakuma, Tetsushi; Takenaga, Mitsumasa; Kawabe, Yoshinori; Nakamura, Takahiro; Kamihira, Masamichi; Yamamoto, Takashi

2015-10-09

Gene knock-in techniques have rapidly evolved in recent years, along with the development and maturation of genome editing technology using programmable nucleases. We recently reported a novel strategy for microhomology-mediated end-joining-dependent integration of donor DNA by using TALEN or CRISPR/Cas9 and optimized targeting vectors, named PITCh (Precise Integration into Target Chromosome) vectors. Here we describe TALEN and PITCh vector-mediated integration of long gene cassettes, including a single-chain Fv-Fc (scFv-Fc) gene, in Chinese hamster ovary (CHO) cells, with comparison of targeting and cloning efficiency among several donor design and culture conditions. We achieved 9.6-kb whole plasmid integration and 7.6-kb backbone-free integration into a defined genomic locus in CHO cells. Furthermore, we confirmed the reasonable productivity of recombinant scFv-Fc protein of the knock-in cells. Using our protocol, the knock-in cell clones could be obtained by a single transfection and a single limiting dilution using a 96-well plate, without constructing targeting vectors containing long homology arms. Thus, the study described herein provides a highly practical strategy for gene knock-in of large DNA in CHO cells, which accelerates high-throughput generation of cell lines stably producing any desired biopharmaceuticals, including huge antibody proteins.

A simple procedure for parallel sequence analysis of both strands of 5'-labeled DNA.

PubMed

Razvi, F; Gargiulo, G; Worcel, A

1983-08-01

Ligation of a 5'-labeled DNA restriction fragment results in a circular DNA molecule carrying the two 32Ps at the reformed restriction site. Double digestions of the circular DNA with the original enzyme and a second restriction enzyme cleavage near the labeled site allows direct chemical sequencing of one 5'-labeled DNA strand. Similar double digestions, using an isoschizomer that cleaves differently at the 32P-labeled site, allows direct sequencing of the now 3'-labeled complementary DNA strand. It is possible to directly sequence both strands of cloned DNA inserts by using the above protocol and a multiple cloning site vector that provides the necessary restriction sites. The simultaneous and parallel visualization of both DNA strands eliminates sequence ambiguities. In addition, the labeled circular molecules are particularly useful for single-hit DNA cleavage studies and DNA footprint analysis. As an example, we show here an analysis of the micrococcal nuclease-induced breaks on the two strands of the somatic 5S RNA gene of Xenopus borealis, which suggests that the enzyme may recognize and cleave small AT-containing palindromes along the DNA helix.

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed Central

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-01-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus. PMID:9097439

Genetic manipulation of Bacillus methanolicus, a gram-positive, thermotolerant methylotroph.

PubMed

Cue, D; Lam, H; Dillingham, R L; Hanson, R S; Flickinger, M C

1997-04-01

We report the fist genetic transformation system, shuttle vectors, and integrative vectors for the thermotolerant, methylotrophic bacterium Bacillus methanolicus. By using a polyethylene glycol-mediated transformation procedure, we have successfully transformed B. methanolicus with both integrative and multicopy plasmids. For plasmids with a single BmeTI recognition site, dam methylation of plasmid DNA (in vivo or in vitro) was found to enhance transformation efficiency from 7- to 11-fold. Two low-copy-number Escherichia coli-B, methanolicus shuttle plasmids, pDQ507 and pDQ508, are described. pDQ508 caries the replication origin cloned from a 17-kb endogenous B. methanolicus plasmid, pBM1. pDQ507 carries a cloned B. methanolicus DNA fragment, pmr-1, possibly of chromosomal origin, that supports maintenance of pDQ507 as a circular, extrachromosomal DNA molecule. Deletion analysis of pDQ507 indicated two regions required for replication, i.e., a 90-bp AT-rich segment containing a 46-bp imperfect, inverted repeat sequence and a second region 65% homologous to the B. subtilis dpp operon. We also evaluated two E. coli-B. subtilis vectors, pEN1 and pHP13, for use as E. coli-B. methanolicus shuttle vectors. The plasmids pHP13, pDQ507, and pDQ508 were segregationally and structurally stable in B. methanolicus for greater than 60 generations of growth under nonselective conditions; pEN1 was segregationally unstable. Single-stranded plasmid DNA was detected in B. methanolicus transformants carrying either pEN1, pHP13, or pDQ508, suggesting that pDQ508, like the B. subtilis plasmids, is replicated by a rolling-circle mechanism. These studies provide the basic tools for the genetic manipulation of B. methanolicus.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

A stable shuttle vector system for efficient genetic complementation of Helicobacter pylori strains by transformation and conjugation.

PubMed

Heuermann, D; Haas, R

1998-03-01

A versatile plasmid shuttle vector system was constructed, which is useful for genetic complementation of Helicobacter pylori strains or mutants with cloned genes of homologous or heterologous origin. The individual plasmid vectors consist of the minimal essential genetic elements, including an origin of replication for Escherichia coli, a H. pylori-specific replicon originally identified on a small cryptic H. pylori plasmid, an oriT sequence and a multiple cloning site. Shuttle plasmid pHel2 carries a chloramphenicol resistance cassette (catGC) and pHel3 contains a kanamycin resistance gene (aphA-3) as the selectable marker; both are functional in E. coli and H. pylori. The shuttle plasmids were introduced into the H. pylori strain P1 by natural transformation. A efficiency of 7.0 x 10(-7) and 4.7 x 10(-7) transformants per viable recipient was achieved with pHel2 and pHel3, respectively, and both vectors showed stable, autonomous replication in H. pylori. An approximately 100-fold higher H. pylori transformation rate was obtained when the shuttle vectors for transformation were isolated from the homologous H. pylori strain, rather than E. coli, indicating that DNA restriction and modification mechanisms play a crucial role in plasmid transformation. Interestingly, both shuttle vectors could also be mobilized efficiently from E. coli into different H. pylori recipients, with pHel2 showing an efficiency of 2.0 x 10(-5) transconjugants per viable H. pylori P1 recipient. Thus, DNA restriction seems to be strongly reduced or absent during conjugal transfer. The functional complementation of a recA-deficient H. pylori mutant by the cloned H. pylori recA+ gene, and the expression of the heterologous green fluorescent protein (GFP) in H. pylori demonstrate the general usefulness of this system, which will significantly facilitate the molecular analysis of H. pylori virulence factors in the future.

Rapid Amplification of Plasmid and Phage DNA Using Phi29 DNA Polymerase and Multiply-Primed Rolling Circle Amplification

PubMed Central

Dean, Frank B.; Nelson, John R.; Giesler, Theresa L.; Lasken, Roger S.

2001-01-01

We describe a simple method of using rolling circle amplification to amplify vector DNA such as M13 or plasmid DNA from single colonies or plaques. Using random primers and φ29 DNA polymerase, circular DNA templates can be amplified 10,000-fold in a few hours. This procedure removes the need for lengthy growth periods and traditional DNA isolation methods. Reaction products can be used directly for DNA sequencing after phosphatase treatment to inactivate unincorporated nucleotides. Amplified products can also be used for in vitro cloning, library construction, and other molecular biology applications. PMID:11381035

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Isolation of a complementary DNA clone for thyroid microsomal antigen. Homology with the gene for thyroid peroxidase.

PubMed Central

Seto, P; Hirayu, H; Magnusson, R P; Gestautas, J; Portmann, L; DeGroot, L J; Rapoport, B

1987-01-01

The thyroid microsomal antigen (MSA) in autoimmune thyroid disease is a protein of approximately 107 kD. We screened a human thyroid cDNA library constructed in the expression vector lambda gt11 with anti-107-kD monoclonal antibodies. Of five clones obtained, the recombinant beta-galactosidase fusion protein from one clone (PM-5) was confirmed to react with the monoclonal antiserum. The complementary DNA (cDNA) insert from PM-5 (0.8 kb) was used as a probe on Northern blot analysis to estimate the size of the mRNA coding for the MSA. The 2.9-kb messenger RNA (mRNA) species observed was the same size as that coding for human thyroid peroxidase (TPO). The probe did not bind to human liver mRNA, indicating the thyroid-specific nature of the PM-5-related mRNA. The nucleotide sequence of PM-5 (842 bp) was determined and consisted of a single open reading frame. Comparison of the nucleotide sequence of PM-5 with that presently available for pig TPO indicates 84% homology. In conclusion, a cDNA clone representing part of the microsomal antigen has been isolated. Sequence homology with porcine TPO, as well as identity in the size of the mRNA species for both the microsomal antigen and TPO, indicate that the microsomal antigen is, at least in part, TPO. Images PMID:3654979

A Sequence-Independent Strategy for Detection and Cloning of Circular DNA Virus Genomes by Using Multiply Primed Rolling-Circle Amplification

PubMed Central

Rector, Annabel; Tachezy, Ruth; Van Ranst, Marc

2004-01-01

The discovery of novel viruses has often been accomplished by using hybridization-based methods that necessitate the availability of a previously characterized virus genome probe or knowledge of the viral nucleotide sequence to construct consensus or degenerate PCR primers. In their natural replication cycle, certain viruses employ a rolling-circle mechanism to propagate their circular genomes, and multiply primed rolling-circle amplification (RCA) with φ29 DNA polymerase has recently been applied in the amplification of circular plasmid vectors used in cloning. We employed an isothermal RCA protocol that uses random hexamer primers to amplify the complete genomes of papillomaviruses without the need for prior knowledge of their DNA sequences. We optimized this RCA technique with extracted human papillomavirus type 16 (HPV-16) DNA from W12 cells, using a real-time quantitative PCR assay to determine amplification efficiency, and obtained a 2.4 × 104-fold increase in HPV-16 DNA concentration. We were able to clone the complete HPV-16 genome from this multiply primed RCA product. The optimized protocol was subsequently applied to a bovine fibropapillomatous wart tissue sample. Whereas no papillomavirus DNA could be detected by restriction enzyme digestion of the original sample, multiply primed RCA enabled us to obtain a sufficient amount of papillomavirus DNA for restriction enzyme analysis, cloning, and subsequent sequencing of a novel variant of bovine papillomavirus type 1. The multiply primed RCA method allows the discovery of previously unknown papillomaviruses, and possibly also other circular DNA viruses, without a priori sequence information. PMID:15113879

Molecular cloning and characterization of arginine kinase gene of Toxocara canis.

PubMed

Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok

2015-06-01

Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

PubMed

Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

2015-12-01

The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

cDNA cloning and analysis of betaine aldehyde dehydrogenase, a salt inducible enzyme in sugar beet

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCue, K.F.; Hanson, A.D.

1990-05-01

Betaine accumulates and serves as a compatible osmolyte in some plants subjected to drought or salinity stress. The last enzyme in the betaine biosynthetic pathway is betaine aldehyde dehydrogenase (BADH). The activity of BADH increases in response to increasing salinity levels. This increase in activity corresponds to an increase in protein detectable by immunoblotting, and to an increase in the translatable BADH mRNA. BADH was cloned from a cDNA library constructed in {lambda}gt10 using poly(A){sup +} RNA from sugar beets salinized to 500 mM NaCl. cDNAs were size selected (>1kb) before ligation into the vector, and the library was screenedmore » with a spinach BADH cDNA probe. Three nearly full length clones obtained were confirmed as BADH by their nucleotide and deduced amino acid homology to spinach BADH. Clones averaged 1.8 kb and contained open reading frames of 500 amino acids at 80% identity with spinach BADH. RNA gel blot analysis of poly(A){sup +} RNA indicated that salinization to 500 mM NaCl resulted in a 5-fold increase of BADH mRNA level.« less

FungalBraid: A GoldenBraid-based modular cloning platform for the assembly and exchange of DNA elements tailored to fungal synthetic biology.

PubMed

Hernanz-Koers, Miguel; Gandía, Mónica; Garrigues, Sandra; Manzanares, Paloma; Yenush, Lynne; Orzaez, Diego; Marcos, Jose F

2018-07-01

Current challenges in the study and biotechnological exploitation of filamentous fungi are the optimization of DNA cloning and fungal genetic transformation beyond model fungi, the open exchange of ready-to-use and standardized genetic elements among the research community, and the availability of universal synthetic biology tools and rules. The GoldenBraid (GB) cloning framework is a Golden Gate-based DNA cloning system developed for plant synthetic biology through Agrobacterium tumefaciens-mediated genetic transformation (ATMT). In this study, we develop reagents for the adaptation of GB version 3.0 from plants to filamentous fungi through: (i) the expansion of the GB toolbox with the domestication of fungal-specific genetic elements; (ii) the design of fungal-specific GB structures; and (iii) the ATMT and gene disruption of the plant pathogen Penicillium digitatum as a proof of concept. Genetic elements domesticated into the GB entry vector pUPD2 include promoters, positive and negative selection markers and terminators. Interestingly, some GB elements can be directly exchanged between plants and fungi, as demonstrated with the marker hph for Hyg R or the fluorescent protein reporter YFP. The iterative modular assembly of elements generates an endless number of diverse transcriptional units and other higher order combinations in the pDGB3α/pDGB3Ω destination vectors. Furthermore, the original plant GB syntax was adapted here to incorporate specific GB structures for gene disruption through homologous recombination and dual selection. We therefore have successfully adapted the GB technology for the ATMT of fungi. We propose the name of FungalBraid (FB) for this new branch of the GB technology that provides open, exchangeable and collaborative resources to the fungal research community. Copyright © 2018 Elsevier Inc. All rights reserved.

Cloning and determination of the transcription termination site of ribosomal RNA gene of the mouse.

PubMed Central

Kominami, R; Mishima, Y; Urano, Y; Sakai, M; Muramatsu, M

1982-01-01

A Eco RI 6.6 kb DNA fragment containing the 3'-end of 28S ribosomal RNA gene of the mouse was detected by Southern blot hybridization, and cloned in a lambda-phage vector. The site of transcription termination and the processed 3'-end of 28S RNA were determined on the cloned fragment and the surrounding nucleotide sequence determined. The 3'-terminal nucleotides of mouse 28S RNA are similar to those of yeast, Drosophila and Xenopus although the homology was lost drastically beyond the 3'-end of 28S RNA. 45S precursor RNA terminated at 30 nucleotides downstream from the 3'-end of 28S RNA gene. A structure of a dyad symmetry with a loop was found immediately prior to the termination site of 45S RNA. The rDNA termination site thus shares some common features with termination sites recognized by other RNA polymerases. Images PMID:6281727

Infectious mutants of cassava latent virus generated in vivo from intact recombinant DNA clones containing single copies of the genome.

PubMed Central

Stanley, J; Townsend, R

1986-01-01

Intact recombinant DNAs containing single copies of either component of the cassava latent virus genome can elicit infection when mechanically inoculated to host plants in the presence of the appropriate second component. Characterisation of infectious mutant progeny viruses, by analysis of virus-specific supercoiled DNA intermediates, indicates that most if not all of the cloning vector has been deleted, achieved at least in some cases by intermolecular recombination in vivo between DNAs 1 and 2. Significant rearrangements within the intergenic region of DNA 2, predominantly external to the common region, can be tolerated without loss of infectivity suggesting a somewhat passive role in virus multiplication for the sequences in question. Although packaging constraints might impose limits on the amount of DNA within geminate particles, isolation of an infectious coat protein mutant defective in virion production suggests that packaging is not essential for systemic spread of the viral DNA. Images PMID:2875435

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

2012-01-06

Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

Corruption of genomic databases with anomalous sequence.

PubMed

Lamperti, E D; Kittelberger, J M; Smith, T F; Villa-Komaroff, L

1992-06-11

We describe evidence that DNA sequences from vectors used for cloning and sequencing have been incorporated accidentally into eukaryotic entries in the GenBank database. These incorporations were not restricted to one type of vector or to a single mechanism. Many minor instances may have been the result of simple editing errors, but some entries contained large blocks of vector sequence that had been incorporated by contamination or other accidents during cloning. Some cases involved unusual rearrangements and areas of vector distant from the normal insertion sites. Matches to vector were found in 0.23% of 20,000 sequences analyzed in GenBank Release 63. Although the possibility of anomalous sequence incorporation has been recognized since the inception of GenBank and should be easy to avoid, recent evidence suggests that this problem is increasing more quickly than the database itself. The presence of anomalous sequence may have serious consequences for the interpretation and use of database entries, and will have an impact on issues of database management. The incorporated vector fragments described here may also be useful for a crude estimate of the fidelity of sequence information in the database. In alignments with well-defined ends, the matching sequences showed 96.8% identity to vector; when poorer matches with arbitrary limits were included, the aggregate identity to vector sequence was 94.8%.

Targeted disruption of the murine Facc gene: Towards the establishment of a mouse model for Fanconi anemia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, M.; Auerbach, W.; Buchwald, M.

1994-09-01

Fanconi anemia (FA) is an autosomal recessive disease characterized by bone marrow failure, congenital malformations and predisposition to malignancies. The gene responsible for the defect in FA group C has been cloned and designated the Fanconi Anemia Complementation Group C gene (FACC). A murine cDNA for this gene (Facc) was also cloned. Here we report our progress in the establishment of a mouse model for FA. The mouse Facc cDNA was used as probe to screen a genomic library of mouse strain 129. More than twenty positive clones were isolated. Three of them were mapped and found to be overlappingmore » clones, encompassing the genomic region from exon 8 to the end of the 3{prime} UTR of the mouse cDNA. A targeting vector was constructed using the most 5{prime} mouse genomic sequence available. The end result of the homologous recombination is that exon 8 is deleted and the neo gene is inserted. The last exon, exon 14, is essential for the complementing function of the FACC gene product; the disruption in the middle of the murine Facc gene should render this locus biologically inactive. This targeting vector was linearized and electroporated into R1 embryonic stem (ES) cells which were derived from the 129 mouse. Of 102 clones screened, 19 positive cell lines were identified. Four targeted cell lines have been used to produce chimeric mice. 129-derived ES cells were aggregated ex vivo into the morulas derived from CD1 mice and then implanted into foster mothers. 22 chimeras have been obtained. Moderately and strongly chimeric mice have been bred to test for germline transmission. Progeny with the expected coat color derived from 2 chimeras are currently being examined to confirm transmission of the targeted allele.« less

RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

PubMed

Musiyenko, Alla; Bitko, Vira; Barik, Sailen

2007-07-01

Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

Development of infectious cDNA clones of citrus yellow vein clearing virus using a novel and rapid strategy.

PubMed

Cui, Tian Tian; Bin, Yu; Yan, Jian Hong; Mei, Peng Ying; Li, Zhong An; Zhou, Chang Yong; Song, Zhen

2018-05-04

Yellow vein clearing disease (YVCD) causes significant economic losses in lemon and other species of citrus. Usually, citrus yellow vein clearing virus (CYVCV) is considered to be the causal agent of YVCD. However, mixed infection of CYVCV and Indian citrus ringspot virus (ICRSV) or other pathogens is often detected in citrus plants with YVCD. In this study, we re-examined the causal agent of YVCD to fulfill Koch's postulates. First, the full-length genome of CYVCV isolate AY (CYVCV-AY) was amplified by long-distance RT-PCR from a Eureka lemon [Citrus limon (L) Brum. f.] tree with typical YVCD symptoms. The genomic cDNAs were then cloned into a ternary Yeast-Escherichia coli-Agrobacterium tumefaciens shuttle vector, pCY, using transformation-associated recombination (TAR) strategy, and 15 full-length cDNA clones of CYVCV-AY were obtained. Subsequently, four of these clones were selected randomly and inoculated on Jincheng [C. sinensis (L) Osbeck] seedlings through Agrobacterium-mediated vacuum-infiltration, and it was found that 80 to 100% of inoculated plants were infected with CYVCV by RT-PCR at 20 to 40 days post inoculation (dpi) and by direct tissue blot immunoassay at 60 dpi. The progeny of CYVCV-AY from cDNA clones caused typical symptoms of YVCD such as yellow vein clearing, leaf distortion, and chlorosis, which were the same as that elicited by wild-type virus. Finally, the regeneration of CYVCV-AY genome was confirmed by long-distance RT-PCR in lemon trees inoculated with the infectious cDNA clone. These results proved that CYVCV was the primary causal agent of YVCD. This is the first report on the development of infectious cDNA clones of CYVCV, which lays the foundation for further studies on viral gene functions and virus-host interactions.

Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

PubMed

Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

2016-08-30

The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

J Genes for Heavy Chain Immunoglobulins of Mouse

NASA Astrophysics Data System (ADS)

Newell, Nanette; Richards, Julia E.; Tucker, Philip W.; Blattner, Frederick R.

1980-09-01

A 15.8-kilobase pair fragment of BALB/c mouse liver DNA, cloned in the Charon 4Aλ phage vector system, was shown to contain the μ heavy chain constant region (CHμ ) gene for the mouse immunoglobulin M. In addition, this fragment of DNA contains at least two J genes, used to code for the carboxyl terminal portion of heavy chain variable regions. These genes are located in genomic DNA about eight kilobase pairs to the 5' side of the CHμ gene. The complete nucleotide sequence of a 1120-base pair stretch of DNA that includes the two J genes has been determined.

Geminivirus vectors for high-level expression of foreign proteins in plant cells.

PubMed

Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

2003-02-20

Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

Efficient repair of DNA double-strand breaks in malignant cells with structural instability

PubMed Central

Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V.; Nakahara, Kenneth; Aplan, Peter D.

2009-01-01

Aberrant repair of DNA double strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1α) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1α promoter from the TK gene, or deletion of either the EF1α promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR. PMID:19909760

Efficient repair of DNA double-strand breaks in malignant cells with structural instability.

PubMed

Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V; Nakahara, Kenneth; Aplan, Peter D

2010-01-05

Aberrant repair of DNA double-strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1alpha) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1alpha promoter from the TK gene, or deletion of either the EF1alpha promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR.

Streptococcus mutans genes that code for extracellular proteins in Escherichia coli K-12.

PubMed

Holt, R G; Abiko, Y; Saito, S; Smorawinska, M; Hansen, J B; Curtiss, R

1982-10-01

Chromosomal DNA from Streptococcus mutans 6715 (serotype g) was cloned into Escherichia coli K-12 by using the cosmid pJC74 cloning vector and a bacteriophage lambda in vitro packaging system. Rabbit antiserum against S. mutans extracellular proteins was used for immunological screening of the clone bank. Twenty-one clones produced weak to strong precipitin bands around the colonies, but only after the lambda c1857 prophage was induced by being heated to lyse the E. coli cells. None of the clones expressed enzyme activity for several known S. mutans extracellular enzymes. One of these clones contained a 45-kilobase recombinant plasmid designated pYA721. An 8.5-kilobase fragment of S. mutans DNA from pYA721 was isolated and recloned into the BamHI restriction site of the plasmid vector pACYC184 to construct pYA726. pYA726 contained all, or nearly all, of the gene for a surface protein antigen (the spaA protein) of S. mutans 6715. This was deduced from immunological studies in which extracts of cells harboring pYA726 reacted with antisera against both purified 6715 spaA protein (about 210,000 daltons) and the immunologically similar antigen I/II of serotype c strains of S. mutans. In addition, the S. mutans spaA protein was found to possess at least one antigenic determinant not present on the protein specified by pYA726. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of E. coli clone extracts revealed that pYA726 produced a polypeptide with a molecular mass of about 180,000 daltons which was predominantly found in the periplasmic space of E. coli cells. Antisera to the spaA protein of S. mutans reacted with extracellular protein from representative strains of S. mutans serotypes a, c, d, e, f, and g, but not b.

Use of virion DNA as a cloning vector for the construction of mutant and recombinant herpesviruses.

PubMed

Duboise, S M; Guo, J; Desrosiers, R C; Jung, J U

1996-10-15

We have developed improved procedures for the isolation of deletion mutant, point mutant, and recombinant herpesvirus saimiri. These procedures take advantage of the absence of NotI and AscI restriction enzyme sites within the viral genome and use reporter genes for the identification of recombinant viruses. Genes for secreted engineered alkaline phosphatase and green fluorescent protein were placed under simian virus 40 early promoter control and flanked by NotI and AscI restriction sites. When permissive cells were cotransfected with herpesvirus saimiri virion DNA and one of the engineered reporter genes cloned within herpesvirus saimiri sequences, recombinant viruses were readily identified and purified on the basis of expression of the reporter gene. Digestion of recombinant virion DNA with NotI or AscI was used to delete the reporter gene from the recombinant herpesvirus saimiri. Replacement of the reporter gene can be achieved by NotI or AscI digestion of virion DNA and ligation with a terminally matched fragment or, alternatively, by homologous recombination in cotransfected cells. Any gene can, in theory, be cloned directly into the virion DNA when flanked by the appropriate NotI or AscI sites. These procedures should be widely applicable in their general form to most or all herpesviruses that replicate permissively in cultured cells.

Cross index for improving cloning selectivity by partially filling in 5'-extensions of DNA produced by type II restriction endonucleases.

PubMed Central

Korch, C

1987-01-01

A cross index is presented for using the improved selectivity offered by the Hung and Wensink (Nucl. Acids Res. 12, 1863-1874, 1984) method of partially filling in 5'-extensions produced by type II restriction endonucleases. After this treatment, DNA fragments which normally cannot be ligated to one another, can be joined providing that complementary cohesive ends have been generated. The uses of this technique, which include the prevention of DNA fragments (both vector and insert) auto-annealing, are discussed. PMID:3033600

[Cloning and sequence analysis of tomato fruit-specific E8 promoter from Lycopersicon esculentum (Zhongshu No.5)].

PubMed

Zhou, Xiao-hong; Chen, Xiao-guang; Zhang, Xiao-dong; Wang, Ya-nan; Li, Lin; Xi, Jia-fei; Hu, Jian-jun

2003-01-01

To obtain the gene encoding tomato fruit-specific E8 promoter therefore to prepare for exogenous gene transcription and expression in transgenic tomato fruit. The cotyledons of tomato Lycopersicon esculentum (Zhongshu No.5) were collected for extracting the genomic DNA of this plant. The fruit-specific E81.1 and E82.2 promoter DNA were then amplified by PCR, the product of which was subcloned into pGEM-T vector. After identification by restriction enzymes, the recombinant T-vectors were subjected to sequence analysis. The fragments of the promoter as amplified by PCR were of predicted length. Digestion with Xba I and Hind III /BamH I proved correct insertion of the target fragments with expected length into the recombinant T vectors. As indicated by homology analysis, the resultant tomato fruit-specific E8 promoter was highly conservative, and E82.2 promoter of Zhongshu No.5, with GenBank submission number of AF515784, proved to share 99% homology with E82.2 promoter of Zhongshu No.5 Cherry as reported by Deikman J. Tomato fruit-specific E8 promoter of Zhongshu No.5 has been successfully cloned, thus making possible the subsequent research in oral vaccine of transgenic tomato.

Ability of herpes simplex virus vectors to boost immune responses to DNA vectors and to protect against challenge by simian immunodeficiency virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaur, Amitinder; Sanford, Hannah B.; Garry, Deirdre

2007-01-20

The immunogenicity and protective capacity of replication-defective herpes simplex virus (HSV) vector-based vaccines were examined in rhesus macaques. Three macaques were inoculated with recombinant HSV vectors expressing Gag, Env, and a Tat-Rev-Nef fusion protein of simian immunodeficiency virus (SIV). Three other macaques were primed with recombinant DNA vectors expressing Gag, Env, and a Pol-Tat-Nef-Vif fusion protein prior to boosting with the HSV vectors. Robust anti-Gag and anti-Env cellular responses were detected in all six macaques. Following intravenous challenge with wild-type, cloned SIV239, peak and 12-week plasma viremia levels were significantly lower in vaccinated compared to control macaques. Plasma SIV RNAmore » in vaccinated macaques was inversely correlated with anti-Rev ELISPOT responses on the day of challenge (P value < 0.05), anti-Tat ELISPOT responses at 2 weeks post challenge (P value < 0.05) and peak neutralizing antibody titers pre-challenge (P value 0.06). These findings support continued study of recombinant herpesviruses as a vaccine approach for AIDS.« less

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

EPA Science Inventory

Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

Expression from cloned DNA of biologically active glycoprotein C of herpes simplex virus type 1 in mammalian cells.

PubMed

Ghosh-Choudhury, N; Butcher, M; Ghosh, H P

1990-03-01

A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.

Isolation and characterization of a cDNA clone coding for a glutathione S-transferase class delta enzyme from the biting midge Culicoides variipennis sonorensis Wirth and Jones.

PubMed

Abdallah, M A; Pollenz, R S; Droog, F N; Nunamaker, R A; Tabachnick, W J; Murphy, K E

2000-12-01

Culicoides variipennis sonorensis is the primary vector of bluetongue viruses in North America. Glutathione S-transferases (GSTs) are enzymes that catalyze nucleophilic substitutions, converting reactive lipophilic molecules into soluble conjugates. Increased GST activity is associated with development of insecticide resistance. Described here is the isolation of the first cDNA encoding a C. variipennis GST. The clone consists of 720 translated bases encoding a protein with a M(r) of approximately 24,800 composed of 219 amino acids. The deduced amino acid sequence is similar (64%-74%) to class Delta (previously named Theta) GSTs from the dipteran genera Musca, Drosophila, Lucilia and Anopheles. The cDNA was subcloned into pET-11b, expressed in Epicurian coli BL21 (DE3) and has a specific activity of approximately 28,000 units/mg for the substrate 1-chloro-2,4-dinitrobenzene.

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

Biological properties of Beet soil-borne mosaic virus and Beet necrotic yellow vein virus cDNA clones produced by isothermal in vitro recombination: Insights for reassortant appearance.

PubMed

Laufer, Marlene; Mohammad, Hamza; Maiss, Edgar; Richert-Pöggeler, Katja; Dall'Ara, Mattia; Ratti, Claudio; Gilmer, David; Liebe, Sebastian; Varrelmann, Mark

2018-05-01

Two members of the Benyviridae family and genus Benyvirus, Beet soil-borne mosaic virus (BSBMV) and Beet necrotic yellow vein virus (BNYVV), possess identical genome organization, host range and high sequence similarity; they infect Beta vulgaris with variable symptom expression. In the US, mixed infections are described with limited information about viral interactions. Vectors suitable for agroinoculation of all genome components of both viruses were constructed by isothermal in vitro recombination. All 35S promoter-driven cDNA clones allowed production of recombinant viruses competent for Nicotiana benthamiana and Beta macrocarpa systemic infection and Polymyxa betae transmission and were compared to available BNYVV B-type clone. BNYVV and BSBMV RNA1 + 2 reassortants were viable and spread long-distance in N. benthamiana with symptoms dependent on the BNYVV type. Small genomic RNAs were exchangeable and systemically infected B. macrocarpa. These infectious clones represent a powerful tool for the identification of specific molecular host-pathogen determinants. Copyright © 2018 Elsevier Inc. All rights reserved.

New ligation independent cloning vectors for expression of recombinant proteins with a self-cleaving CPD/6xHis-tag.

PubMed

Biancucci, Marco; Dolores, Jazel S; Wong, Jennifer; Grimshaw, Sarah; Anderson, Wayne F; Satchell, Karla J F; Kwon, Keehwan

2017-01-05

Recombinant protein purification is a crucial step for biochemistry and structural biology fields. Rapid robust purification methods utilize various peptide or protein tags fused to the target protein for affinity purification using corresponding matrices and to enhance solubility. However, affinity/solubility-tags often need to be removed in order to conduct functional and structural studies, adding complexities to purification protocols. In this work, the Vibrio cholerae MARTX toxin Cysteine Protease Domain (CPD) was inserted in a ligation-independent cloning (LIC) vector to create a C-terminal 6xHis-tagged inducible autoprocessing enzyme tag, called "the CPD-tag". The pCPD and alternative pCPD/ccdB cloning vectors allow for easy insertion of DNA and expression of the target protein fused to the CPD-tag, which is removed at the end of the purification step by addition of the inexpensive small molecule inositol hexakisphosphate to induce CPD autoprocessing. This process is demonstrated using a small bacterial membrane localization domain and for high yield purification of the eukaryotic small GTPase KRas. Subsequently, pCPD was tested with 40 proteins or sub-domains selected from a high throughput crystallization pipeline. pCPD vectors are easily used LIC compatible vectors for expression of recombinant proteins with a C-terminal CPD/6xHis-tag. Although intended only as a strategy for rapid tag removal, this pilot study revealed the CPD-tag may also increase expression and solubility of some recombinant proteins.

Generation of a Lineage II Powassan Virus (Deer Tick Virus) cDNA Clone: Assessment of Flaviviral Genetic Determinants of Tick and Mosquito Vector Competence.

PubMed

Kenney, Joan L; Anishchenko, Michael; Hermance, Meghan; Romo, Hannah; Chen, Ching-I; Thangamani, Saravanan; Brault, Aaron C

2018-05-21

The Flavivirus genus comprises a diverse group of viruses that utilize a wide range of vertebrate hosts and arthropod vectors. The genus includes viruses that are transmitted solely by mosquitoes or vertebrate hosts as well as viruses that alternate transmission between mosquitoes or ticks and vertebrates. Nevertheless, the viral genetic determinants that dictate these unique flaviviral host and vector specificities have been poorly characterized. In this report, a cDNA clone of a flavivirus that is transmitted between ticks and vertebrates (Powassan lineage II, deer tick virus [DTV]) was generated and chimeric viruses between the mosquito/vertebrate flavivirus, West Nile virus (WNV), were constructed. These chimeric viruses expressed the prM and E genes of either WNV or DTV in the heterologous nonstructural (NS) backbone. Recombinant chimeric viruses rescued from cDNAs were characterized for their capacity to grow in vertebrate and arthropod (mosquito and tick) cells as well as for in vivo vector competence in mosquitoes and ticks. Results demonstrated that the NS elements were insufficient to impart the complete mosquito or tick growth phenotypes of parental viruses; however, these NS genetic elements did contribute to a 100- and 100,000-fold increase in viral growth in vitro in tick and mosquito cells, respectively. Mosquito competence was observed only with parental WNV, while infection and transmission potential by ticks were observed with both DTV and WNV-prME/DTV chimeric viruses. These data indicate that NS genetic elements play a significant, but not exclusive, role for vector usage of mosquito- and tick-borne flaviviruses.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

[Construction of thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene].

PubMed

Wei, Qing; Liu, Yi-Min; Wang, Hui; Zhao, Xiao-Lin; Ren, Tie-ling; Xiao, Yong-mei

2006-09-01

To construct Thr461 --> Asn461 and Ile462 --> Val462 mutation vector of P4501A1 gene and to provide scientific base for deeply researching on the function of cytochrome 1A1 gene (CYP1A1) and the mechanism of carcinogenesis. According to cDNA sequence of human CYP1A1 gene, universal primers (Pm3/Pm4) and mutant primers (Pt15/Pt16 and Pt17/Pt18) containing restriction enzyme site and mutation site were designed. The first set of primers involving Pm3/Pt16 and Pm3/Pt18 amplified a forward 1.5kb fragment from pGEM-T-CYP1A1 plasmid. The second set of primers involving Pt15/Pm4 and Pt17/Pm4 amplified a reverse 177-bp fragment from 10ng pGEM-T-CYP1A1 plasmid. The third set of primers involving Pm3/Pm4 amplified a 1.5kb fragment from the fomer PCR amplifications. The third PCR products were separated, purified and recovered from 1% agarose gel, then inserted into pMD-T vector. Subsequently the conjunct products were transformed into E. coil strain DH-5alpha., then the single clone was screened out and plasmids were extracted from such clone finally verified by restriction endonuclease analysis and sequencing. A 1.5kb fragment of tricycle PCR amplifications were digested by restriction endonucleases (BamHI and SailI) and sequenced bidirectionally by universal primers(T7p and SP6). The results verified that the cloned fragment including Asn461 and Val462 mutant site had 99.9% homology with the human cDNA of CYP1A1 gene in Genebank. The objective fragment containing Asn461 and Va462 mutant site with cDNA of the CYP1A1 gene has been successfully constructed in this experiment.

Kilo-sequencing: an ordered strategy for rapid DNA sequence data acquisition.

PubMed Central

Barnes, W M; Bevan, M

1983-01-01

A strategy for rapid DNA sequence acquisition in an ordered, nonrandom manner, while retaining all of the conveniences of the dideoxy method with M13 transducing phage DNA template, is described. Target DNA 3 to 14 kb in size can be stably carried by our M13 vectors. Suitable targets are stretches of DNA which lack an enzyme recognition site which is unique on our cloning vectors and adjacent to the sequencing primer; current sites that are so useful when lacking are Pst, Xba, HindIII, BglII, EcoRI. By an in vitro procedure, we cut RF DNA once randomly and once specifically, to create thousands of deletions which start at the unique restriction site adjacent to the dideoxy sequencing primer and extend various distances across the target DNA. Phage carrying a desired size of deletions, whose DNA as template will give rise to DNA sequence data in a desired location along the target DNA, may be purified by electrophoresis alive on agarose gels. Phage running in the same location on the agarose gel thus conveniently give rise to nucleotide sequence data from the same kilobase of target DNA. Images PMID:6298723

Trichoderma virens β-glucosidase I (BGLI) gene; expression in Saccharomyces cerevisiae including docking and molecular dynamics studies.

PubMed

Wickramasinghe, Gammadde Hewa Ishan Maduka; Rathnayake, Pilimathalawe Panditharathna Attanayake Mudiyanselage Samith Indika; Chandrasekharan, Naduviladath Vishvanath; Weerasinghe, Mahindagoda Siril Samantha; Wijesundera, Ravindra Lakshman Chundananda; Wijesundera, Wijepurage Sandhya Sulochana

2017-06-21

Cellulose, a linear polymer of β 1-4, linked glucose, is the most abundant renewable fraction of plant biomass (lignocellulose). It is synergistically converted to glucose by endoglucanase (EG) cellobiohydrolase (CBH) and β-glucosidase (BGL) of the cellulase complex. BGL plays a major role in the conversion of randomly cleaved cellooligosaccharides into glucose. As it is well known, Saccharomyces cerevisiae can efficiently convert glucose into ethanol under anaerobic conditions. Therefore, S.cerevisiae was genetically modified with the objective of heterologous extracellular expression of the BGLI gene of Trichoderma virens making it capable of utilizing cellobiose to produce ethanol. The cDNA and a genomic sequence of the BGLI gene of Trichoderma virens was cloned in the yeast expression vector pGAPZα and separately transformed to Saccharomyces cerevisiae. The size of the BGLI cDNA clone was 1363 bp and the genomic DNA clone contained an additional 76 bp single intron following the first exon. The gene was 90% similar to the DNA sequence and 99% similar to the deduced amino acid sequence of 1,4-β-D-glucosidase of T. atroviride (AC237343.1). The BGLI activity expressed by the recombinant genomic clone was 3.4 times greater (1.7 x 10 -3  IU ml -1 ) than that observed for the cDNA clone (5 x 10 -4  IU ml -1 ). Furthermore, the activity was similar to the activity of locally isolated Trichoderma virens (1.5 x 10 -3  IU ml -1 ). The estimated size of the protein was 52 kDA. In fermentation studies, the maximum ethanol production by the genomic and the cDNA clones were 0.36 g and 0.06 g /g of cellobiose respectively. Molecular docking results indicated that the bare protein and cellobiose-protein complex behave in a similar manner with considerable stability in aqueous medium. The deduced binding site and the binding affinity of the constructed homology model appeared to be reasonable. Moreover, it was identified that the five hydrogen bonds formed between the amino acid residues of BGLI and cellobiose are mainly involved in the integrity of enzyme-substrate association. The BGLI activity was remarkably higher in the genomic DNA clone compared to the cDNA clone. Cellobiose was successfully fermented into ethanol by the recombinant S.cerevisiae genomic DNA clone. It has the potential to be used in the industrial production of ethanol as it is capable of simultaneous saccharification and fermentation of cellobiose. Homology modeling, docking studies and molecular dynamics simulation studies will provide a realistic model for further studies in the modification of active site residues which could be followed by mutation studies to improve the catalytic action of BGLI.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Development of Gutless Adenoviral Vectors Encoding Anti Angiogenic Proteins for Therapy of Prostate Cancer

DTIC Science & Technology

2005-01-01

PRINCIPAL INVESTIGATOR: Calvin J. Kuo, M.D., Ph.D. CONTRACTING ORGANIZATION : Stanford University Stanford, California 94305-5401 REPORT DATE: January...cloned in between the I-Scel site and the T’. This extra DNA fragment is used as a stuffer DNA in order to increase the size of the viral genome up to...regularly increasing sizes above the 2 fragments specific for the virus left and right ends can only be explained by the phenomenon known as ’postreplicative

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

A prototype subunit vaccine to IHN virus is being developed by recombinant DNA techniques. The techniques involve the isolation and characterization of the glycoprotein gene, which encodes the viral protein responsible for inducing a protective immune response in fish. The viral glycoprotein gene has been cloned and a restriction map of the cloned gene has been prepared. Preliminary DNA sequence analysis of the cloned gene has been initiated so that manipulation of the gene for maximum expression in appropriate plasmid vectors is possible. A recombinant plasmid containing the viral gene inserted in the proper orientation adjacent to a very strongmore » lambda promoter and ribosome binding site has been constructed. Evaluation of this recombinant plasmid for gene expression is being conducted. Immunization trials with purified viral glycoprotein indicate that fish are protected against lethal doses of IHNV after immersion and intraperitoneal methods of immunization. In addition, cross protection immunization trials indicate that Type 2 and Type 1 IHN virus produce glycoproteins that are cross-protective.« less

[Experimental study on TCRbeta idiotypic antigenic determinants DNA vaccine to induce anti-lymphoma antibodies].

PubMed

Zhang, Yeping; Zhu, Ping; Shi, Yongjin; Liu, Jihua; Pu, Dingfang; Cao, Xianghong; Zhu, Qiang; Wang, Yijia; Ma, Mingxin; Yu, Jiren

2002-02-01

To investigate the anti-human CEM lymphoma cell activities induced by TCR idiotypic DNA vaccine containing different antigen determinants in BALB/c mice. The specific rearranged gene fragment encoding TCRVbeta region of CEM cell line was obtained by RT-PCR technique. The PCR product was cloned into eukaryocytic expression vector pcDNA3, which was used as DNA vaccine and template for PCR amplifying different antigen determinant. Gene fragments encoding different antigen determinant were amplified and cloned into pcDNA3, separately. The experimental mice were immunized by intramuscular injection of the DNA vaccines. The specific anti-idiotype antibodies were detected by indirect immunofluorescence assay. TCRbetaV of CEM cell line contains five antigen determinants. Specific anti-idiotype antibody was detected in all of the six mice immunized with DNA vaccine containing all the five determinants (the highest titer was 1:480). Although the antibody could also be detected in four of the six mice immunized with DNA vaccine containing four of the five antigen determinants, the antibody titer was lower (the highest titer was 1:80). DNA vaccine containing two of the five determinants could not induce the specific antibody. The idiotypic DNA vaccine containing the whole TCRbetaV five antigen determinants could induce the specific anti-lymphoma idiotypic antibody in BALB/c mice.

Introduction of plasmid DNA into an ST398 livestock-associated methicillin-resistant Staphylococcus aureus strain

USDA-ARS?s Scientific Manuscript database

MRS926 is a livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) strain of sequence type (ST) 398. In order to facilitate in vitro and in vivo studies of this strain, we sought to tag it with a fluorescent marker. We cloned a codon-optimized gene for TurboGFP into a shuttle vector...

Microdissection and molecular manipulation of single chromosomes in woody fruit trees with small chromosomes using pomelo (Citrus grandis) as a model. I. Construction of single chromosomal DNA libraries.

PubMed

Huang, D; Wu, W; Zhou, Y; Hu, Z; Lu, L

2004-05-01

Construction of single chromosomal DNA libraries by means of chromosome microdissection and microcloning will be useful for genomic research, especially for those species that have not been extensively studied genetically. Application of the technology of microdissection and microcloning to woody fruit plants has not been reported hitherto, largely due to the generally small sizes of metaphase chromosomes and the difficulty of chromosome preparation. The present study was performed to establish a method for single chromosome microdissection and microcloning in woody fruit species using pomelo as a model. The standard karyotype of a pomelo cultivar ( Citrus grandis cv. Guanxi) was established based on 20 prometaphase photomicrographs. According to the standard karyotype, chromosome 1 was identified and isolated with fine glass microneedles controlled by a micromanipulator. DNA fragments ranging from 0.3 kb to 2 kb were acquired from the isolated single chromosome 1 via two rounds of PCR mediated by Sau3A linker adaptors and then cloned into T-easy vectors to generate a DNA library of chromosome 1. Approximately 30,000 recombinant clones were obtained. Evaluation based on 108 randomly selected clones showed that the sizes of the cloned inserts varied from 0.5 kb to 1.5 kb with an average of 860 bp. Our research suggests that microdissection and microcloning of single small chromosomes in woody plants is feasible.

Construction and applications of exon-trapping gene-targeting vectors with a novel strategy for negative selection.

PubMed

Saito, Shinta; Ura, Kiyoe; Kodama, Miho; Adachi, Noritaka

2015-06-30

Targeted gene modification by homologous recombination provides a powerful tool for studying gene function in cells and animals. In higher eukaryotes, non-homologous integration of targeting vectors occurs several orders of magnitude more frequently than does targeted integration, making the gene-targeting technology highly inefficient. For this reason, negative-selection strategies have been employed to reduce the number of drug-resistant clones associated with non-homologous vector integration, particularly when artificial nucleases to introduce a DNA break at the target site are unavailable or undesirable. As such, an exon-trap strategy using a promoterless drug-resistance marker gene provides an effective way to counterselect non-homologous integrants. However, constructing exon-trapping targeting vectors has been a time-consuming and complicated process. By virtue of highly efficient att-mediated recombination, we successfully developed a simple and rapid method to construct plasmid-based vectors that allow for exon-trapping gene targeting. These exon-trap vectors were useful in obtaining correctly targeted clones in mouse embryonic stem cells and human HT1080 cells. Most importantly, with the use of a conditionally cytotoxic gene, we further developed a novel strategy for negative selection, thereby enhancing the efficiency of counterselection for non-homologous integration of exon-trap vectors. Our methods will greatly facilitate exon-trapping gene-targeting technologies in mammalian cells, particularly when combined with the novel negative selection strategy.

Open resource metagenomics: a model for sharing metagenomic libraries.

PubMed

Neufeld, J D; Engel, K; Cheng, J; Moreno-Hagelsieb, G; Rose, D R; Charles, T C

2011-11-30

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM(2)BL [1]). The CM(2)BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project.

Open resource metagenomics: a model for sharing metagenomic libraries

PubMed Central

Neufeld, J.D.; Engel, K.; Cheng, J.; Moreno-Hagelsieb, G.; Rose, D.R.; Charles, T.C.

2011-01-01

Both sequence-based and activity-based exploitation of environmental DNA have provided unprecedented access to the genomic content of cultivated and uncultivated microorganisms. Although researchers deposit microbial strains in culture collections and DNA sequences in databases, activity-based metagenomic studies typically only publish sequences from the hits retrieved from specific screens. Physical metagenomic libraries, conceptually similar to entire sequence datasets, are usually not straightforward to obtain by interested parties subsequent to publication. In order to facilitate unrestricted distribution of metagenomic libraries, we propose the adoption of open resource metagenomics, in line with the trend towards open access publishing, and similar to culture- and mutant-strain collections that have been the backbone of traditional microbiology and microbial genetics. The concept of open resource metagenomics includes preparation of physical DNA libraries, preferably in versatile vectors that facilitate screening in a diversity of host organisms, and pooling of clones so that single aliquots containing complete libraries can be easily distributed upon request. Database deposition of associated metadata and sequence data for each library provides researchers with information to select the most appropriate libraries for further research projects. As a starting point, we have established the Canadian MetaMicroBiome Library (CM2BL [1]). The CM2BL is a publicly accessible collection of cosmid libraries containing environmental DNA from soils collected from across Canada, spanning multiple biomes. The libraries were constructed such that the cloned DNA can be easily transferred to Gateway® compliant vectors, facilitating functional screening in virtually any surrogate microbial host for which there are available plasmid vectors. The libraries, which we are placing in the public domain, will be distributed upon request without restriction to members of both the academic research community and industry. This article invites the scientific community to adopt this philosophy of open resource metagenomics to extend the utility of functional metagenomics beyond initial publication, circumventing the need to start from scratch with each new research project. PMID:22180823

An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.

PubMed

Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J

2018-05-01

A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.

Cloning and expression of cyclophilin from Platanus orientalis pollens in Escherichia coli

PubMed Central

Sankian, Mojtaba; Vahedi, Fatemeh; Pazouki, Nazanin; Moghadam, Malihe; Jabbari Azad, Farahzad; Varasteh, Abdol-Reza

2012-01-01

Background: Allergy is a clinical disorder affecting the human population with wide geographical distribution. Platanus orientalis (P. orientalis) trees are planted in many countries and their pollen causes allergic reactions. Cyclophilin has recently been identified as one of the most important allergens of P. orientalis pollen. We aimed to clone and purify this allergen in Escherichia coli for further studies and therapeutic and diagnostic purposes for allergy to P. orientalis. Methods: RNA was extracted from P. orientalis. A full-length fragment encoding cyclophilin was prepared by polymerase chain reaction amplification of the first-strand cDNA synthesized from P. orientalis RNA. The cDNA was inserted into the pET32b (+) vector, and the construct transformed into E. coli Top10 and BL21 cells. The expressed protein was purified by the CuSO4 method. Results: The cDNA for the cyclophilin of P. orientalis pollen was cloned, and a specific reactivity of recombinant cyclophin was confirmed by immunoblotting using sera from patients allergic to P. orientalis pollen. Conclusion: The recombinant cyclophilin has a potential for immunologic assays for evaluation of allergy to P. orientalis pollen. PMID:26989705

Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

PubMed

Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

2009-07-01

Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

Assessing the potential for AAV vector genotoxicity in a murine model

PubMed Central

Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

2011-01-01

Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

Cloning and expression of phosphoglycerate mutase from the psychrophilic yeast, Glaciozyma antarctica PI12

NASA Astrophysics Data System (ADS)

Jaafar, Nardiah Rizwana; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul; Mahadi, Nor Muhammad

2015-09-01

The conversion of 3-phosphoglycerate to 2-phosphoglycerate during glycolysis and gluconeogenesis is catalyzed by phosphoglycerate mutase (PGM). Better understanding of metabolic reactions performed by this enzyme has been studied extensively in prokaryotes and eukaryotes. Here, we report a phosphoglycerate mutase from the psychrophilic yeast, Glaciozyma antarctica. cDNA encoding for PGM from G. antarctica PI12, a psychrophilic yeast isolated from sea ice at Casey Station, Antarctica was amplified. The gene was then cloned into a cloning vector and sequenced, which verified its identity as the gene putatively encoding for PGM. The recombinant protein was expressed in Escherichia coli BL21 (DE3) as inclusion bodies and this was confirmed by SDS-PAGE and Western blot.

Cloning and expression of delta-1-pyrroline-5-carboxylate dehydrogenase in Escherichia coli DH5α improves phosphate solubilization.

PubMed

Gong, Mingbo; Tang, Chaoxi; Zhu, Changxiong

2014-11-01

A primary cDNA library of Penicillium oxalicum I1 was constructed using the switching mechanism at the 5' end of the RNA transcript (SMART) technique. A total of 106 clones showed halos in tricalcium phosphate (TCP) medium, and clone I-40 showed clear halos. The full-length cDNA of clone I-40 was 1355 bp with a complete open reading frame (ORF) of 1032 bp, encoding a protein of 343 amino acids. Multiple alignment analysis revealed a high degree of homology between the ORF of clone I-40 and delta-1-pyrroline-5-carboxylate dehydrogenase (P5CDH) of other fungi. The ORF expression vector was constructed and transformed into Escherichia coli DH5α. The transformant (ORF-1) with the P5CDH gene secreted organic acid in medium with TCP as the sole source of phosphate. Acetic acid and α-ketoglutarate were secreted in 4 and 24 h, respectively. ORF-1 decreased the pH of the medium from 6.62 to 3.45 and released soluble phosphate at 0.172 mg·mL(-1) in 28 h. Expression of the P. oxalicum I1 p5cdh gene in E. coli could enhance organic acid secretion and phosphate-solubilizing ability.

Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

PubMed

Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

2016-09-01

Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

PubMed Central

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

PubMed

Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

2011-01-01

Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

PubMed

Osipiuk, J; Joachimiak, A

1997-09-12

We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Genetics of bacteria that utilize one carbon compounds: Final report, March 1, 1982-February 29, 1988

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less

Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

PubMed

Graham, L A; Bendena, W G; Walker, V K

1996-02-01

The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

[Construction and expression of recombinant human serum albumin-EPO fusion protein].

PubMed

Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

2011-05-01

OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

PubMed

Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

2005-04-01

A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

PubMed

Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

2005-11-01

A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

PubMed

Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

2011-12-10

Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

Generation, Analysis and Functional Annotation of Expressed Sequence Tags from the Sheepshead Minnow (Cyprinodon variegatus)

DTIC Science & Technology

2010-01-01

any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a...CA) were cloned using the pGEM-T Easy Vector System (Promega, Madison, WI) and Electromax DH10B T1 Phage Resistant Cells (Invitrogen, Carlsbad, CA...reactions were performed using 75ng of plasmid DNA template and a M13 (-40) forward primer according to the manufac- turer’s protocol for DNA sequencing of

Molecular Mechanisms of Cytopathogenicity of Primate Lymphotropic Retroviruses: Relevance to Treatment and Vaccine for AIDS

DTIC Science & Technology

1989-03-10

fragment of the HIV-1 genome was isolated from XBH10 and inserted into an M13 phage vector. Mutations were introduced by use of 25-mer oligonucleotides which... M13 by Eco RI and religated into the corresponding position of pHXB2gpt. The mutant AS was prepared directly from pHXB2gpt by digestion with Nde I and...detect immunocomplexes. Molecular Cloning and Sequencing of Proviral DNA A X phage library was constructed from the genomic DNA isolated from Hut78 cells

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

An Efficient Method for High-Fidelity BAC/PAC Retrofitting with a Selectable Marker for Mammalian Cell Transfection

PubMed Central

Wang, Zunde; Engler, Peter; Longacre, Angelika; Storb, Ursula

2001-01-01

Large-scale genomic sequencing projects have provided DNA sequence information for many genes, but the biological functions for most of them will only be known through functional studies. Bacterial artificial chromosomes (BACs) and P1-derived artificial chromosomes (PACs) are large genomic clones stably maintained in bacteria and are very important in functional studies through transfection because of their large size and stability. Because most BAC or PAC vectors do not have a mammalian selection marker, transfecting mammalian cells with genes cloned in BACs or PACs requires the insertion into the BAC/PAC of a mammalian selectable marker. However, currently available procedures are not satisfactory in efficiency and fidelity. We describe a very simple and efficient procedure that allows one to retrofit dozens of BACs in a day with no detectable deletions or unwanted recombination. We use a BAC/PAC retrofitting vector that, on transformation into competent BAC or PAC strains, will catalyze the specific insertion of itself into BAC/PAC vectors through in vivo cre/loxP site-specific recombination. PMID:11156622

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

2000-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Metatranscriptomics of Soil Eukaryotic Communities.

PubMed

Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

2016-01-01

Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

ECB deacylase mutants

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

2002-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Recombination of polynucleotide sequences using random or defined primers

DOEpatents

Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

2001-01-01

A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

Simple cloning strategy using GFPuv gene as positive/negative indicator.

PubMed

Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato

2011-09-15

Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

Molecular cloning and characterization of Bacillus alvei thiol-dependent cytolytic toxin expressed in Escherichia coli.

PubMed

Geoffroy, C; Alouf, J E

1988-07-01

A chromosomal DNA fragment from Bacillus alvei, encoding a thiol-dependent haemolytic product known as alveolysin (Mr 60,000, pI 5.0) was cloned in Escherichia coli SK1592, using pBR322 as the vector plasmid. Only a single haemolysin-positive clone was identified, by testing for haemolysis on blood agar plates. The haemolytic material was associated with the host bacterial cell. It was released by ultrasonic disruption and purified 267-fold. A 64 kDa polypeptide of pI 8.2 cofractionated with haemolytic activity during gel filtration chromatography and isoelectric focusing. It behaved identically to alveolysin in its activation by thiols, inactivation by thiol group reagents, inhibition by cholesterol, and neutralization, immunoprecipitation and immunoblotting by immune sera raised against alveolysin and streptolysin O.

Phage Display Breast Carcinoma cDNA Libraries: Isolation of Clones Which Specifically Bind to Membrane Glycoproteins, Mucins, and Endothelial Cell Surface

DTIC Science & Technology

1999-07-01

nutrients and waste and UV 2237 fibrosarcoma sublines (17). Expression of elimination, cell surfaces are also important for the galectin-1, another member of...10B capsid protein. Therefore, this GAG CGG AAA ATG GCA GAC AAT TTT TCG CTC CAT ... vector was chosen to assess the feasibility of phage met Ala Asp

Cloning of a human hepatocyte growth factor/scatter factor transcription variant from a gastric cancer cell line HSC-39.

PubMed

Yokozaki, H; Tahara, H; Oue, N; Tahara, E

2000-01-01

A new transcription variant of hepatocyte growth factor/scatter factor (HGF/SF) was cloned from human gastric cancer cell line HSC-39. Northern blot analysis of eight human gastric cancer cell lines (TMK-1, MKN-1, MKN-7, MKN-28, MKN-45, MKN-74, KATO-III and HSC-39) demonstrated that HSC-39 cells expressed a 1.3 kb abnormal HGF/SF transcript. Screening of 1 x 10(6) colonies of cDNA library from HSC-39 constructed in pAP3neo mammalian expression vector selected four positive clones containing HGF/SF transcript. Among them, two contained a 1.3 kbp insert detecting the identical transcript to that obtained with HGF/SF probe by Northern blotting. Deoxynucleotide sequencing of the 1.3 kbp insert revealed that it was composed of a part of HGF/SF cDNA from exon 14 to exon 18, corresponding to the whole sequence of HGF/SF light chain, with 5' 75 nucleotides unrelated to any sequence involved in HGF/SF.

Cloning, sequencing, and analysis of the griseusin polyketide synthase gene cluster from Streptomyces griseus.

PubMed Central

Yu, T W; Bibb, M J; Revill, W P; Hopwood, D A

1994-01-01

A fragment of DNA was cloned from the Streptomyces griseus K-63 genome by using genes (act) for the actinorhodin polyketide synthase (PKS) of Streptomyces coelicolor as a probe. Sequencing of a 5.4-kb segment of the cloned DNA revealed a set of five gris open reading frames (ORFs), corresponding to the act PKS genes, in the following order: ORF1 for a ketosynthase, ORF2 for a chain length-determining factor, ORF3 for an acyl carrier protein, ORF5 for a ketoreductase, and ORF4 for a cyclase-dehydrase. Replacement of the gris genes with a marker gene in the S. griseus genome by using a single-stranded suicide vector propagated in Escherichia coli resulted in loss of the ability to produce griseusins A and B, showing that the five gris genes do indeed encode the type II griseusin PKS. These genes, encoding a PKS that is programmed differently from those for other aromatic PKSs so far available, will provide further valuable material for analysis of the programming mechanism by the construction and analysis of strains carrying hybrid PKS. Images PMID:8169211

Molecular cloning, sequencing, and expression of Eimeria tenella HSP70 partial gene.

PubMed

Bogado, A L G; Martins, G F; Sasse, J P; Guimarães, J da S; Garcia, J L

2017-03-15

Members of the Eimeria genus are protozoan parasites of the subphylum Apicomplexa (Eimeriidae family), and belong to the coccidia group. Eimeria tenella is one of the most pathogenic species owing to its ability to penetrate the mucosa, and cause inflammation and damage. It is an obligate intracellular parasite that causes disease by destroying the host cells during multiplication. Heat shock protein 70 (HSP70) is a molecular chaperone that prevents cellular stress. The objective of this study was to clone, sequence, and express E. tenella HSP70 protein. After selecting the region of highest hydrophilicity in the hsp70 gene, we cloned complementary DNA (cDNA) into a pTrcHis2-TOPO vector and transformed it into TOP10 Escherichia coli cells; after induction, the bacteria expressed a 23-kDa protein with insoluble expression levels of approximately 5 mg/L. In summary, the partial hsp70 gene was successfully expressed in E. coli, producing a 23-kDa protein under insoluble conditions, and the antigen characteristics predicted by hydrophilicity analysis suggest the development of a vaccine for use in avian coccidiosis.

[Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

PubMed

Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

2010-03-01

The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

Improved vectors for transcriptional/translational signal screening in corynebacteria using the melC operon from Streptomyces glaucescens as reporter.

PubMed

Adham, Sirin A I; Rodríguez, Sonia; Ramos, Angelina; Santamaría, Ramón I; Gil, José A

2003-07-01

The tyrosinase operon ( melC) from Streptomyces glaucescens was cloned and functionally expressed in Brevibacterium lactofermentum and Corynebacterium glutamicum under the control of the promoter of the kan gene from Tn 5. Recombinant corynebacterial cells containing the tyrosinase operon produced melanin on agar plates and in liquid culture when supplemented with copper and tyrosine. A conjugative bifunctional replacement vector for transcriptional/translational signal screening (pEMel-1) was constructed using expression of the melC operon from S. glaucescens, which can be used for cloning promoter sequences as EcoRI- NdeI fragments. When the DNA fragments with promoter activity such as cspBp or trpp were inserted into pEMel-1, B. lactofermentum harboring the chimeric plasmids produced melanin at different stages of growth, allowing temporal detection of promoter activity. The vector was also used to detect the activity of a Streptomyces promoter ( xysAp), which was inactive in B. lactofermentum, after PCR mutagenesis. The melC operon can be used for the visual, inexpensive (compared to the high price of starch azure for amylase detection), and non-selective (in contrast to the kan or cat genes) screening of several thousand clones at high colony density without killing of the transformants due to the presence of iodine (as in the case of amylase assay).

Development of an infectious clone and replicon system of norovirus GII.4.

PubMed

Oliveira, L M; Blawid, R; Orílio, A F; Andrade, B Y G; Souza, A C A; Nagata, T

2018-08-01

Human norovirus (HuNoV) is one of the main causes of acute gastroenteritis worldwide and is responsible for at least 20% of all cases. The detailed molecular mechanism of this norovirus remains unknown due to the lack of a suitable in vitro culturing system. An infectious clone of HuNoV would be a useful tool for elucidating the processes of viral infection and the mechanisms of replication. We developed an infectious cDNA clone of HuNoV using the rapid technique of Gibson Assembly. The complete genome of the HuNoV GII.4 Sydney subtype was cloned into a previously modified pcDNA3.1-based plasmid vector downstream from a cytomegaloviral promoter. We monitored the viral infection in vitro by inserting the reporter gene of the green fluorescent protein (GFP) between the NTPase and p22 genes, also by Gibson Assembly, to construct a HuNoV-GFP replicon. Human Caco-2 cells were transfected with the full-length genomic clone and the replicon containing GFP. The gene encoding the VP1/VP2 capsid protein was expressed, which was indirect evidence of the synthesis of subgenomic RNAs and thus the negative strand of the genome. We successfully constructed the infectious clone and its replicon containing GFP for the HuNoV GII.4 Sydney subtype, a valuable tool that will help the study of noroviral infection and replication. Copyright © 2018 Elsevier B.V. All rights reserved.

Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1

PubMed Central

Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming

2006-01-01

Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656

Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

PubMed

Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

2015-06-01

The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

PubMed Central

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270

In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

PubMed

Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

2017-01-01

Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

PubMed

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.

Cloning of an origin of DNA replication of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, S.; Taylor, J.H.

1980-09-01

DNA fragments of Xenopus laevis, the African frog, were cloned in the EcoRI site of the Eschrichia coli plasmid pACYC189 and tested for ability to initiate and complete replication of the recombinant plasmid when injected into unfertilized eggs of X. laevis. After measurement of the (/sup 3/H)-thymidine incorporation per egg for a number of recombinant plasmids, pSW14 and pSW9, which respectively contain a small segment (550 base pairs) and several kilobases of frog DNA, were selected for more extensive analysis. In spite of the small size of th segment in pSW14, it incorporates in 2 hr at least 3 timesmore » as much labeled thymidine as either pSW9 or the vector alone. To determine the number of replications of pSW14, a novel method was employed. The results showed that about 50% of the labeled, supercoiled DNA recovered from eggs after 4 hr was sensitive to EcoRI digestion, which indicates that most of the DNA that incorporated (/sup 3/H)thymidine had replicated twice during the 4 hr in the unfertilized eggs of X. laevis. We conclude the pSW14 has a functional origin in the Xenopus DNA segment.« less

Reverse Genetics for Newcastle Disease Virus as a Vaccine Vector.

PubMed

Kim, Shin-Hee; Samal, Siba K

2018-02-22

Newcastle disease virus (NDV) is an economically important pathogen in the poultry industry worldwide. Recovery of infectious NDV from cDNA using reverse genetics has made it possible to manipulate the genome of NDV. This has greatly contributed to our understanding of the molecular biology and pathogenesis of NDV. Furthermore, NDV has modular genome and accommodates insertion of a foreign gene as a transcriptional unit, thus enabling NDV as a vaccine vector against diseases of humans and animals. Avirulent NDV strains (e.g., LaSota and B1) have been commonly used as vaccine vectors. In this protocol, we have described reverse genetics of NDV to be used as a vaccine vector by exemplifying the recovery of NDV vectored avian influenza virus vaccine. Specifically, cloning and recovery of NDV expressing the hemagglutinin protein of highly pathogenic influenza virus were explained. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Molecular Cloning and Characterization of cDNA Encoding a Putative Stress-Induced Heat-Shock Protein from Camelus dromedarius

PubMed Central

Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.

2011-01-01

Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074

DNA content analysis allows discrimination between Trypanosoma cruzi and Trypanosoma rangeli.

PubMed

Naves, Lucila Langoni; da Silva, Marcos Vinícius; Fajardo, Emanuella Francisco; da Silva, Raíssa Bernardes; De Vito, Fernanda Bernadelli; Rodrigues, Virmondes; Lages-Silva, Eliane; Ramírez, Luis Eduardo; Pedrosa, André Luiz

2017-01-01

Trypanosoma cruzi, a human protozoan parasite, is the causative agent of Chagas disease. Currently the species is divided into six taxonomic groups. The genome of the CL Brener clone has been estimated to be 106.4-110.7 Mb, and DNA content analyses revealed that it is a diploid hybrid clone. Trypanosoma rangeli is a hemoflagellate that has the same reservoirs and vectors as T. cruzi; however, it is non-pathogenic to vertebrate hosts. The haploid genome of T. rangeli was previously estimated to be 24 Mb. The parasitic strains of T. rangeli are divided into KP1(+) and KP1(-). Thus, the objective of this study was to investigate the DNA content in different strains of T. cruzi and T. rangeli by flow cytometry. All T. cruzi and T. rangeli strains yielded cell cycle profiles with clearly identifiable G1-0 (2n) and G2-M (4n) peaks. T. cruzi and T. rangeli genome sizes were estimated using the clone CL Brener and the Leishmania major CC1 as reference cell lines because their genome sequences have been previously determined. The DNA content of T. cruzi strains ranged from 87,41 to 108,16 Mb, and the DNA content of T. rangeli strains ranged from 63,25 Mb to 68,66 Mb. No differences in DNA content were observed between KP1(+) and KP1(-) T. rangeli strains. Cultures containing mixtures of the epimastigote forms of T. cruzi and T. rangeli strains resulted in cell cycle profiles with distinct G1 peaks for strains of each species. These results demonstrate that DNA content analysis by flow cytometry is a reliable technique for discrimination between T. cruzi and T. rangeli isolated from different hosts.

Identification of the Propionicin F Bacteriocin Immunity Gene (pcfI) and Development of a Food-Grade Cloning System for Propionibacterium freudenreichii▿ †

PubMed Central

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F.

2007-01-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 107 transformants/μg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive PpampS promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by ∼91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains. PMID:17933941

Identification of the propionicin F bacteriocin immunity gene (pcfI) and development of a food-grade cloning system for Propionibacterium freudenreichii.

PubMed

Brede, Dag Anders; Lothe, Sheba; Salehian, Zhian; Faye, Therese; Nes, Ingolf F

2007-12-01

This report describes the first functional analysis of a bacteriocin immunity gene from Propionibacterium freudenreichii and its use as a selection marker for food-grade cloning. Cloning of the pcfI gene (previously orf5 [located as part of the pcfABC propionicin F operon]) rendered the sensitive host 1,000-fold more tolerant to the propionicin F bacteriocin. The physiochemical properties of the 127-residue large PcfI protein resemble those of membrane-bound immunity proteins from bacteriocin systems found in lactic acid bacteria. The high level of immunity conferred by pcfI allowed its use as a selection marker for plasmid transformation in P. freudenreichii. Electroporation of P. freudenreichii IFO12426 by use of the pcfI expression plasmid pSL102 and propionicin F selection (200 bacteriocin units/ml) yielded 10(7) transformants/microg DNA. The 2.7-kb P. freudenreichii food-grade cloning vector pSL104 consists of the pLME108 replicon, a multiple cloning site, and pcfI expressed from the constitutive P(pampS) promoter for selection. The pSL104 vector efficiently facilitated cloning of the propionicin T1 bacteriocin in P. freudenreichii. High-level propionicin T1 production (640 BU/ml) was obtained with the IFO12426 strain, and the food-grade propionicin T1 expression plasmid pSL106 was maintained by approximately 91% of the cells over 25 generations in the absence of selection. To the best of our knowledge this is the first report of an efficient cloning system that facilitates the generation of food-grade recombinant P. freudenreichii strains.

The Adenovirus Genome Contributes to the Structural Stability of the Virion

PubMed Central

Saha, Bratati; Wong, Carmen M.; Parks, Robin J.

2014-01-01

Adenovirus (Ad) vectors are currently the most commonly used platform for therapeutic gene delivery in human gene therapy clinical trials. Although these vectors are effective, many researchers seek to further improve the safety and efficacy of Ad-based vectors through detailed characterization of basic Ad biology relevant to its function as a vector system. Most Ad vectors are deleted of key, or all, viral protein coding sequences, which functions to not only prevent virus replication but also increase the cloning capacity of the vector for foreign DNA. However, radical modifications to the genome size significantly decreases virion stability, suggesting that the virus genome plays a role in maintaining the physical stability of the Ad virion. Indeed, a similar relationship between genome size and virion stability has been noted for many viruses. This review discusses the impact of the genome size on Ad virion stability and emphasizes the need to consider this aspect of virus biology in Ad-based vector design. PMID:25254384

Microplastics as a vector for the transport of the bacterial fish pathogen species Aeromonas salmonicida.

PubMed

Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika

2017-12-15

Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

A simple and efficient method for agroinfection of Vernonia cinerea with infectious clones of Vernonia yellow vein virus.

PubMed

Packialakshmi, R M; Usha, R

2011-12-01

Vernonia yellow vein virus (VeYVV) is a distinct monopartite begomovirus associated with a satellite DNA β. After constructing dimers of both DNA A and DNA β in binary vectors, a number of infection methods were attempted. However, only a modified stem-prick method produced up to 83% infection in the natural host Vernonia cinerea, thus, fulfilling the Koch's postulate. The presence of the viral DNA in the agroinfected plants was confirmed by rolling circle amplification (RCA), followed by Southern hybridization. DNA β induces typical symptoms of Vernonia yellow vein disease (VeYVD) when co-agroinoculated with the begomovirus to Vernonia and also leads to the accumulation of DNA A systemically. VeYVV represents a new member of the emerging group of monopartite begomoviruses requiring a satellite component for symptom induction.

A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins1

PubMed Central

Eschenfeldt, William H.; Stols, Lucy; Millard, Cynthia Sanville; Joachimiak, Andrzej; Donnelly, Mark I.

2009-01-01

Summary Fifteen related ligation-independent cloning vectors were constructed for high-throughput cloning and purification of proteins. The vectors encode a TEV protease site for removal of tags that facilitate protein purification (his-tag) or improve solubility (MBP, GST). Specialized vectors allow coexpression and copurification of interacting proteins, or in vivo removal of MBP by TVMV protease to improve screening and purification. All target genes and vectors are processed by the same protocols, which we describe here. PMID:18988021

Generation of Five Human Lactoferrin Transgenic Cloned Goats Using Fibroblast Cells and Their Methylation Status of Putative Differential Methylation Regions of IGF2R and H19 Imprinted Genes

PubMed Central

Sun, Yanyan; Zhang, Yanli; Wang, Ziyu; Song, Yang; Wang, Feng

2013-01-01

Background Somatic cell nuclear transfer (SCNT) is a promising technique to produce transgenic cloned mammalian, including transgenic goats which may produce Human Lactoferrin (hLF). However, success percentage of SCNT is low, because of gestational and neonatal failure of transgenic embryos. According to the studies on cattle and mice, DNA methylation of some imprinted genes, which plays a vital role in the reprogramming of embryo in NT maybe an underlying mechanism. Methodology/Principal Findings Fibroblast cells were derived from the ear of a two-month-old goat. The vector expressing hLF was constructed and transfected into fibroblasts. G418 selection, EGFP expression, PCR, and cell cycle distribution were applied sequentially to select transgenic cells clones. After NT and embryo transfer, five transgenic cloned goats were obtained from 240 cloned transgenic embryos. These transgenic goats were identified by 8 microsatellites genotyping and southern blot. Of the five transgenic goats, 3 were lived after birth, while 2 were dead during gestation. We compared differential methylation regions (DMR) pattern of two paternally imprinted genes (H19 and IGF2R) of the ear tissues from the lived transgenic goats, dead transgenic goats, and control goats from natural reproduction. Hyper-methylation pattern appeared in cloned aborted goats, while methylation status was relatively normal in cloned lived goats compared with normal goats. Conclusions/Significance In this study, we generated five hLF transgenic cloned goats by SCNT. This is the first time the DNA methylation of lived and dead transgenic cloned goats was compared. The results demonstrated that the methylation status of DMRs of H19 and IGF2R were different in lived and dead transgenic goats and therefore this may be potentially used to assess the reprogramming status of transgenic cloned goats. Understanding the pattern of gene imprinting may be useful to improve cloning techniques in future. PMID:24204972

Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

PubMed

Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

1999-10-06

The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

Complete nucleotide sequences and construction of full-length infectious cDNA clones of Cucumber green mottle virus (CGMMV) in a versatile newly developed binary vector including both 35S and T7 promoters

USDA-ARS?s Scientific Manuscript database

Seed-transmitted viruses have caused significant damage to watermelon crops in Korea in recent years, with Cucumber green mottle mosaic virus (CGMMV) infection widespread as a result of infected seed lots. To determine the likely origin of CGMMV infection, we collected CGMMV isolates from watermelon...

iPSC-Derived MSCs that Are Genetically Engineered for Systemic Bone Augmentation

DTIC Science & Technology

2013-08-01

cloned into a pJET1.2 vector (Fermentas, Glen Burnie, MD) and sequenced by MCLAB (San Francisco, CA). Karyotyping and G-banding. GTG -banding chromosome...publication [25]. Karyotyping and G-banding Giemsa ( GTG )-banding chromosome analysis was carried out in the LLU Radiation Research Laboratories. Standard...banding GTG -banding chromosome analysis was carried out in the LLU Radiation Research Laboratories. Standard DNA spectral karyo- typing procedures

Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

NASA Astrophysics Data System (ADS)

Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

1980-09-01

A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

PubMed

Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

2015-09-01

Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier Inc. All rights reserved.

[Replication of Streptomyces plasmids: the DNA nucleotide sequence of plasmid pSB 24.2].

PubMed

Bolotin, A P; Sorokin, A V; Aleksandrov, N N; Danilenko, V N; Kozlov, Iu I

1985-11-01

The nucleotide sequence of DNA in plasmid pSB 24.2, a natural deletion derivative of plasmid pSB 24.1 isolated from S. cyanogenus was studied. The plasmid amounted by its size to 3706 nucleotide pairs. The G-C composition was equal to 73 per cent. The analysis of the DNA structure in plasmid pSB 24.2 revealed the protein-encoding sequence of DNA, the continuity of which was significant for replication of the plasmid containing more than 1300 nucleotide pairs. The analysis also revealed two A-T-rich areas of DNA, the G-C composition of which was less than 55 per cent and a DNA area with a branched pin structure. The results may be of value in investigation of plasmid replication in actinomycetes and experimental cloning of DNA with this plasmid as a vector.

GoldenBraid: An Iterative Cloning System for Standardized Assembly of Reusable Genetic Modules

PubMed Central

Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I.; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego

2011-01-01

Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop (“braid”) topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described. PMID:21750718

GoldenBraid: an iterative cloning system for standardized assembly of reusable genetic modules.

PubMed

Sarrion-Perdigones, Alejandro; Falconi, Erica Elvira; Zandalinas, Sara I; Juárez, Paloma; Fernández-del-Carmen, Asun; Granell, Antonio; Orzaez, Diego

2011-01-01

Synthetic Biology requires efficient and versatile DNA assembly systems to facilitate the building of new genetic modules/pathways from basic DNA parts in a standardized way. Here we present GoldenBraid (GB), a standardized assembly system based on type IIS restriction enzymes that allows the indefinite growth of reusable gene modules made of standardized DNA pieces. The GB system consists of a set of four destination plasmids (pDGBs) designed to incorporate multipartite assemblies made of standard DNA parts and to combine them binarily to build increasingly complex multigene constructs. The relative position of type IIS restriction sites inside pDGB vectors introduces a double loop ("braid") topology in the cloning strategy that allows the indefinite growth of composite parts through the succession of iterative assembling steps, while the overall simplicity of the system is maintained. We propose the use of GoldenBraid as an assembly standard for Plant Synthetic Biology. For this purpose we have GB-adapted a set of binary plasmids for A. tumefaciens-mediated plant transformation. Fast GB-engineering of several multigene T-DNAs, including two alternative modules made of five reusable devices each, and comprising a total of 19 basic parts are also described.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

PubMed

Abolhassani, Mohsen; Roux, Kenneth H

2009-06-01

Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

Novel Antigen Identification Method for Discovery of Protective Malaria Antigens by Rapid Testing of DNA Vaccines Encoding Exons from the Parasite Genome

PubMed Central

Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.

2004-01-01

We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966

Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.

PubMed

Yue, Chang-Wu; Zhang, Yi-Zheng

2009-03-01

A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.

Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

PubMed

Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

2012-10-01

A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

Delimitation of essential genes of cassava latent virus DNA 2.

PubMed Central

Etessami, P; Callis, R; Ellwood, S; Stanley, J

1988-01-01

Insertion and deletion mutagenesis of both extended open reading frames (ORFs) of cassava latent virus DNA 2 destroys infectivity. Infectivity is restored by coinoculating constructs that contain single mutations within different ORFs. Although frequent intermolecular recombination produces dominant parental-type virus, mutants can be retained within the virus population indicating that they are competent for replication and suggesting that rescue can occur by complementation of trans acting gene products. By cloning specific fragments into DNA 1 coat protein deletion vectors we have delimited the DNA 2 coding regions and provide substantive evidence that both are essential for virus infection. Although a DNA 2 component is unique to whitefly-transmitted geminiviruses, the results demonstrate that neither coding region is involved solely in insect transmission. The requirement for a bipartite genome for whitefly-transmitted geminiviruses is discussed. Images PMID:3387209

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

PubMed Central

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

PubMed

Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

1998-01-01

Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

Enhanced expression of EGFP gene in CHSE-214 cells by an ARS element from mud loach (Misgurnus mizolepis).

PubMed

Kim, Moo-Sang; Lim, Hak-Seob; Ahn, Sang Jung; Jeong, Yong-Kee; Kim, Chul Geun; Lee, Hyung Ho

2007-11-01

The origins of replication are associated with nuclear matrices or are found in close proximity to matrix attachment regions (MARs). In this report, fish MARs were cloned into an autonomously replicating sequence (ARS) cloning vector and were screened for ARS elements in Saccharomyces cerevisiae. Sixteen clones were isolated that were able to grow on the selective plates. In particular, an ARS905 that shows high efficiency among them was selected for this study. Southern hybridization indicated the autonomous replication of the transformation vector containing the ARS905 element. DNA sequences analysis showed that the ARS905 contained two ARS consensus sequences as well as MAR motifs, such as AT tracts, ORI patterns, and ATC tracts. In vitro matrix binding analysis, major matrix binding activity and ARS function coincided in a subfragment of the ARS905. To analyze the effects of ARS905 on expression of a reporter gene, an ARS905(E1158) with ARS activity was inserted into pBaEGFP(+) containing mud loach beta-actin promoter, EGFP as a reporter gene, and SV40 poly(A) signal. The pBaEGFP(+)-ARS905(E1158) was transfected into a fish cell line, CHSE-214. The intensity of EGFP transfected cells was a 7-fold of the control at 11days post-transfection. These results indicate that ARS905 enhances the expression of the EGFP gene and that it should be as a component of expression vectors in further fish biotechnological studies.

Genetic tagging of tumor cells with retrovirus vectors: Clonal analysis of tumor growth and metastasis in vivo

DOE Office of Scientific and Technical Information (OSTI.GOV)

Korczak; Robson, I.B.; Lamarche, C.

1988-08-01

Retrovirus vector infection was used to introduce large numbers of unique genetic markers into tumor cell populations for the purpose of analyzing comparative changes in the clonal composition of metastatic versus that of nonmetastatic tumors during their progressive growth in vivo. The cell lines were SP1, a nonmetastatic, aneuploid mouse mammary adenocarcinoma, and SP1HU9L, a metastatic variant of SP1. Cells were infected with ..delta..e..delta..rhoMoTn, a replication-defective retrovirus vector which possesses the dominant selectable neo gene and crippled long terminal repeats. G418/sup r/ colonies were obtained at a frequency of 4 x 10/sup -3/. Southern blot analysis of a number ofmore » clones provided evidence of random and heritable integration of one or two copies of the proviral DNA. Clonal equation of primary tumor growth and the nature of lineage relationships among spontaneous metastases and primary tumors were analyzed by subcutaneously injecting 10/sup 5/ cells from a pooled mixture of 3.6 x 10/sup 2/ G418/sup r/ SP1HU9L or 10/sup 4/ G418/sup r/ SP1 colonies into syngeneic CBA/J mice. The most striking finding was the relative clonal homogeneity of advanced primary tumors; they invariably consisted of a small number (less than 10) of distinct clones despite the fact that hundreds of thousands of uniquely marked clones had been injected.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

A universal mini-vector and an annealing of PCR products (APP)-based cloning strategy for convenient molecular biological manipulations.

PubMed

Liu, Xia; Li, Tuoping; Hart, Darren J; Gao, Song; Wang, Hongling; Gao, Herui; Xu, Shumin; Zhang, Yifeng; Liu, Yifei; An, Yingfeng

2018-03-18

Currently, the most widely used strategies for molecular cloning are sticky-end ligation-based cloning, TA cloning, blunt-end ligation-based cloning and ligase-independent cloning. In this study we have developed a novel mini-vector pANY1 which can simultaneously meet the requirements of all these cloning strategies. In addition, the selection of appropriate restriction digestion sites is difficult in some cases because of the presence of internal sites. In this study, an annealing of PCR products (APP)-based sticky-end cloning strategy was introduced to avoid this issue. Additionally, false positives occur during molecular cloning, which increases the workload of isolating positive clones. The plasmid pANY1 contains a ccdB cassette between multiple cloning sites, which efficiently avoids these false positives. Therefore, this mini-vector should serve as a useful tool with wide applications in biosciences, agriculture, food technologies, etc. Copyright © 2018 Elsevier Inc. All rights reserved.

LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

PubMed

Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

2017-08-01

DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p < 0.05) at day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

NASA Astrophysics Data System (ADS)

Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

2003-04-01

From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of streptococcus pneumontae

DOEpatents

Lacks, Sanford A.

1990-01-01

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252.

GFP is Efficiently Expressed by Wheat Streak Mosaic Virus Using a Range of Tritimovirus NIa Cleavage Sites and Forms Dense Aggregates in Cereal Hosts

USDA-ARS?s Scientific Manuscript database

Wheat streak mosaic virus (WSMV)-based transient expression vector was developed to express GFP as a marker protein. The GFP cistron was engineered between the P1 and HC-Pro cistrons in an infectious cDNA clone of WSMV. The cleavage sites, P3/6KI, 6KI/CI, NIa/NIb, or NIb/CP, from WSMV were fused to ...

Recombinant plasmids for encoding restriction enzymes DpnI and DpnII of Streptococcus pneumontae

DOEpatents

Lacks, S.A.

1990-10-02

Chromosomal DNA cassettes containing genes encoding either the DpnI or DpnII restriction endonucleases from Streptococcus pneumoniae are cloned into a streptococcal vector, pLS101. Large amounts of the restriction enzymes are produced by cells containing the multicopy plasmids, pLS202 and pLS207, and their derivatives pLS201, pLS211, pLS217, pLS251 and pLS252. 9 figs.

Lentiviral-Mediated Gene Therapy in Fanconi Anemia-A Mice Reveals Long-Term Engraftment and Continuous Turnover of Corrected HSCs.

PubMed

Molina-Estevez, F Javier; Nowrouzi, Ali; Lozano, M Luz; Galy, Anne; Charrier, Sabine; von Kalle, Christof; Guenechea, Guillermo; Bueren, Juan A; Schmidt, Manfred

2015-01-01

Fanconi anemia is a DNA repair-deficiency syndrome mainly characterized by cancer predisposition and bone marrow failure. Trying to restore the hematopoietic function in these patients, lentiviral vector-mediated gene therapy trials have recently been proposed. However, because no insertional oncogenesis studies have been conducted so far in DNA repair-deficiency syndromes such as Fanconi anemia, we have carried out a genome-wide screening of lentiviral insertion sites after the gene correction of Fanca(-/-) hematopoietic stem cells (HSCs), using LAM-PCR and 454-pyrosequencing. Our studies first demonstrated that transduction of Fanca(-/-) HSCs with a lentiviral vector designed for clinical application efficiently corrects the phenotype of Fanconi anemia repopulating cells without any sign of toxicity. The identification of more than 6,500 insertion sites in primary and secondary recipients showed a polyclonal pattern of reconstitution, as well as a continuous turnover of corrected Fanca(-/-) HSC clones, without evidences of selection towards specific common integration sites. Taken together our data show, for the first time in a DNA repair-deficiency syndrome, that lentiviral vector-mediated gene therapy efficiently corrects the phenotype of affected HSCs and promotes a healthy pattern of clonal turnover in vivo. These studies will have a particular impact in the development of new gene therapy trials in patients affected by DNA repair syndromes, particularly in Fanconi anemia.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

Molecular cloning, expression and characterization of a functional GSTmu class from the cattle tick Boophilus annulatus.

PubMed

Shahein, Yasser Ezzat; El Sayed El-Hakim, Amr; Abouelella, Amira Mohamed Kamal; Hamed, Ragaa Reda; Allam, Shaimaa Abdul-Moez; Farid, Nevin Mahmoud

2008-03-25

A full-length cDNA of a glutathione S-transferase (GST) was cloned from a cDNA library of the local Egyptian cattle tick Boophilus annulatus. The 672 bp cloned fragment was sequenced and showed an open reading frame encoding a protein of 223 amino acids. Comparison of the deduced amino acid sequence with GSTs from other species revealed that the sequence is closely related to the mammalian mu-class GST. The cloned gene was expressed in E. coli under T7 promotor of pET-30b vector, and purified under native conditions. The purified enzyme appeared as a single band on 12% SDS-PAGE and has a molecular weight of 30.8 kDa including the histidine tag of the vector. The purified enzyme was assayed upon the chromogenic substrate 1-chloro-2,4-dinitrobenzene (CDNB) and the recombinant enzyme showed high level of activity even in the presence of the beta-galactosidase region on its 5' end and showed maximum activity at pH 7.5. The Km values for CDNB and GSH were 0.57 and 0.79 mM, respectively. The over expressed rBaGST showed high activity toward CDNB (121 units/mg protein) and less toward DCNB (29.3 units/mg protein). rBaGST exhibited peroxidatic activity on cumene hydroperoxide sharing this property with GSTs belonging to the GST alpha class. I50 values for cibacron blue and bromosulfophthalein were 0.22 and 8.45 microM, respectively, sharing this property with the mammalian GSTmu class. Immunoblotting revealed the presence of the GST molecule in B. annulatus protein extracts; whole tick, larvae, gut, salivary gland and ovary. Homologues to the GSTmu were also detected in other tick species as Hyalomma dromedarii and Rhipicephalus sp. while in Ornithodoros moubata, GSTmu homologue could not be detected.

Cloning and heterologous expression of genes from the kinamycin biosynthetic pathway of Streptomyces murayamaensis.

PubMed

Gould, S J; Hong, S T; Carney, J R

1998-01-01

The genes for most of the biosynthesis of the kinamycin antibiotics have been cloned and heterologously expressed. Genomic DNA of Streptomyces murayamaensis was partially digested with MboI and a library of approximately 40 kb fragments in E. coli XL1-BlueMR was prepared using the cosmid vector pOJ446. Hybridization with the actI probe from the actinorhodin polyketide synthase genes identified two clusters of polyketide genes. After transferal of these clusters to S. lividans ZX7, expression of one cluster was established by HPLC with photodiode array detection. Peaks were identified from the kin cluster for dehydrorabelomycin, kinobscurinone, and stealthin C, which are known intermediates in kinamycin biosynthesis. Two shunt metabolites, kinafluorenone and seongomycin were also identified. The structure of the latter was determined from a quantity obtained from large-scale fermentation of one of the clones.

Use of the piggyBac transposon to create stable packaging cell lines for the production of clinical-grade self-inactivating γ-retroviral vectors.

PubMed

Feldman, Steven A; Xu, Hui; Black, Mary A; Park, Tristen S; Robbins, Paul F; Kochenderfer, James N; Morgan, Richard A; Rosenberg, Steven A

2014-08-01

Efforts to improve the biosafety of γ-retroviral-mediated gene therapy have resulted in a shift toward the use of self-inactivating (SIN) γ-retroviral vectors. However, scale-up and manufacturing of such vectors requires significant optimization of transient transfection-based processes or development of novel platforms for the generation of stable producer cell clones. To that end, we describe the use of the piggybac transposon to generate stable producer cell clones for the production of SIN γ-retroviral vectors. The piggybac transposon is a universal tool allowing for the stable integration of SIN γ-retroviral constructs into murine (PG13) and human 293-based Phoenix (GALV and RD114, respectively) packaging cell lines without reverse transcription. Following transposition, a high-titer clone is selected for manufacture of a master cell bank and subsequent γ-retroviral vector supernatant production. Packaging cell clones created using the piggybac transposon have comparable titers to non-SIN vectors generated via conventional methods. We describe herein the use of the piggybac transposon for the production of stable packaging cell clones for the manufacture of clinical-grade SIN γ-retroviral vectors for ex vivo gene therapy clinical trials.

Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

PubMed

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-03-06

Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

PubMed Central

Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

2006-01-01

Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

Cloning, Expression and Characteristics of a Novel Alkalistable and Thermostable Xylanase Encoding Gene (Mxyl) Retrieved from Compost-Soil Metagenome

PubMed Central

Verma, Digvijay; Kawarabayasi, Yutaka; Miyazaki, Kentaro; Satyanarayana, Tulasi

2013-01-01

Background The alkalistable and thermostable xylanases are in high demand for pulp bleaching in paper industry and generating xylooligosaccharides by hydrolyzing xylan component of agro-residues. The compost-soil samples, one of the hot environments, are expected to be a rich source of microbes with thermostable enzymes. Methodology/Principal Findings Metagenomic DNA from hot environmental samples could be a rich source of novel biocatalysts. While screening metagenomic library constructed from DNA extracted from the compost-soil in the p18GFP vector, a clone (TSDV-MX1) was detected that exhibited clear zone of xylan hydrolysis on RBB xylan plate. The sequencing of 6.321 kb DNA insert and its BLAST analysis detected the presence of xylanase gene that comprised 1077 bp. The deduced protein sequence (358 amino acids) displayed homology with glycosyl hydrolase (GH) family 11 xylanases. The gene was subcloned into pET28a vector and expressed in E. coli BL21 (DE3). The recombinant xylanase (rMxyl) exhibited activity over a broad range of pH and temperature with optima at pH 9.0 and 80°C. The recombinant xylanase is highly thermostable having T1/2 of 2 h at 80°C and 15 min at 90°C. Conclusion/Significance This is the first report on the retrieval of xylanase gene through metagenomic approach that encodes an enzyme with alkalistability and thermostability. The recombinant xylanase has a potential application in paper and pulp industry in pulp bleaching and generating xylooligosaccharides from the abundantly available agro-residues. PMID:23382818

Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites.

PubMed

Pinto, Filipe; Pacheco, Catarina C; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C; Urchueguía, Javier F; Tamagnini, Paula

2015-12-01

The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Construction of Poxviruses as Cloning Vectors: Insertion of the Thymidine Kinase Gene from Herpes Simplex Virus into the DNA of Infectious Vaccinia Virus

NASA Astrophysics Data System (ADS)

Panicali, Dennis; Paoletti, Enzo

1982-08-01

We have constructed recombinant vaccinia viruses containing the thymidine kinase gene from herpes simplex virus. The gene was inserted into the genome of a variant of vaccinia virus that had undergone spontaneous deletion as well as into the 120-megadalton genome of the large prototypic vaccinia variant. This was accomplished via in vivo recombination by contransfection of eukaryotic tissue culture cells with cloned BamHI-digested thymidine kinase gene from herpes simplex virus containing flanking vaccinia virus DNA sequences and infectious rescuing vaccinia virus. Pure populations of the recombinant viruses were obtained by replica filter techniques or by growth of the recombinant virus in biochemically selective medium. The herpes simplex virus thymidine kinase gene, as an insert in vaccinia virus, is transcribed in vivo and in vitro, and the fidelity of in vivo transcription into a functional gene product was detected by the phosphorylation of 5-[125I]iodo-2'-deoxycytidine.

Mitochondrial Gene Therapy: Advances in Mitochondrial Gene Cloning, Plasmid Production, and Nanosystems Targeted to Mitochondria.

PubMed

Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana

2017-03-06

Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.

Molecular genetics of Streptococcus thermophilus.

PubMed

Mercenier, A

1990-09-01

The metabolism and genetics of Streptococcus thermophilus (presently Streptococcus salivarius ssp. thermophilus) have only been investigated recently despite its widespread use in milk fermentation processes. The development of recombinant DNA technology has allowed impressive progress to be made in the knowledge of thermophilic dairy streptococci. In particular, it has permitted a careful analysis of phenotypically altered variants which were derived from a mother strain by plasmid or chromosomal DNA reorganization. While natural phage defense mechanisms of S. thermophilus remain poorly documented, information on the bacteriophages responsible for fermentation failures has accumulated. The lysogenic state of two S. thermophilus strains has also been demonstrated for the first time. Gene transfer techniques for this species have been established and improved to the point that targeted manipulation of their chromosomal determinants is now feasible. Cloning and expression vectors have been constructed, and a few heterologous genes were successfully expressed in S. thermophilus. The first homologous genes, involved in carbohydrate utilization, have been cloned and sequenced, shedding some light on the molecular organization of key metabolic steps.

[Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

PubMed

Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

2008-01-01

To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

A new double right border binary vector for producing marker-free transgenic plants

PubMed Central

2013-01-01

Background Once a transgenic plant is developed, the selectable marker gene (SMG) becomes unnecessary in the plant. In fact, the continued presence of the SMG in the transgenic plant may cause unexpected pleiotropic effects as well as environmental or biosafety issues. Several methods for removal of SMGs that have been reported remain inaccessible due to protection by patents, while development of new ones is expensive and cost prohibitive. Here, we describe the development of a new vector for producing marker-free plants by simply adapting an ordinary binary vector to the double right border (DRB) vector design using conventional cloning procedures. Findings We developed the DRB vector pMarkfree5.0 by placing the bar gene (representing genes of interest) between two copies of T-DNA right border sequences. The β-glucuronidase (gus) and nptII genes (representing the selectable marker gene) were cloned next followed by one copy of the left border sequence. When tested in a model species (tobacco), this vector system enabled the generation of 55.6% kanamycin-resistant plants by Agrobacterium-mediated transformation. The frequency of cotransformation of the nptII and bar transgenes using the vector was 66.7%. Using the leaf bleach and Basta assays, we confirmed that the nptII and bar transgenes were coexpressed and segregated independently in the transgenic plants. This enable separation of the transgenes in plants cotransformed using pMarkfree5.0. Conclusions The results suggest that the DRB system developed here is a practical and effective approach for separation of gene(s) of interest from a SMG and production of SMG-free plants. Therefore this system could be instrumental in production of “clean” plants containing genes of agronomic importance. PMID:24207020

Cloning of hydrogenase genes and fine structure analysis of an operon essential for H/sub 2/ metabolism in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sankar, P.; Lee, J.H.; Shanmugam, K.T.

1985-04-01

Escherichia coli has two unlinked genes that code for hydrogenase synthesis and activity. The DNA fragments containing the two genes (hydA and hydB) were cloned into a plasmid vector, pBR322. The plasmids containing the hyd genes (pSE-290 and pSE-111 carrying the hydA and hydB genes, respectively) were used to genetically map a total of 51 mutant strains with defects in hydrogenase activity. A total of 37 mutants carried a mutation in the hydB gene, whereas the remaining 14 hyd were hydA. This complementation analysis also established the presence of two new genes, so far unidentified, one coding for formate dehydrogenase-2more » (fdv) and another producing an electron transport protein (fhl) coupling formate dehydrogenase-2 to hydrogenase. Three of the four genes, hydB, fhl, and fdv, may constitute a single operon, and all three genes are carried by a 5.6-kilobase-pair chromosomal DNA insert in plasmid pSE-128. Plasmids carrying a part of this 5.6-kilobase-pair DNA (pSE-130) or fragments derived from this DNA in different orientations (pSE-126 and pSE-129) inhibited the production of active formate hydrogenlyase. This inhibition occurred even in a prototrophic E. coli, strain K-10, but only during an early induction period. These results, based on complementation analysis with cloned DNA fragments, show that both hydA and hydB genes are essential for the production of active hydrogenase. For the expression of active formate hydrogenlyase, two other gene products, fhl and fdv are also needed. All four genes map between 58 and 59 min in the E. coli chromosome.« less

Expression of sunflower cytoplasmic male sterility-associated open reading frame, orfH522 induces male sterility in transgenic tobacco plants.

PubMed

Nizampatnam, Narasimha Rao; Doodhi, Harinath; Kalinati Narasimhan, Yamini; Mulpuri, Sujatha; Viswanathaswamy, Dinesh Kumar

2009-03-01

Sterility in the universally exploited PET1-CMS system of sunflower is associated with the expression of orfH522, a novel mitochondrial gene. Definitive evidence that ORFH522 is directly responsible for male sterility is lacking. To test the hypothesis that ORFH522 is sufficient to induce male sterility, a set of chimeric constructs were developed. The cDNA of orfH522 was cloned in-frame with yeast coxIV pre-sequence, and was expressed under tapetum-specific promoter TA29 (construct designated as TCON). For developing control vectors, orfH522 was cloned without the transit peptide under TA29 promoter (TON) or orfH522 was cloned with or without transit peptide under the constitutive CaMV35S promoter (SCOP and SOP). Among several independent transformants obtained with each of the gene cassettes, one third of the transgenics (6/17) with TCON were completely male sterile while more than 10 independent transformants obtained with each of the control vectors were fertile. The male sterile plants were morphologically similar to fertile plants, but had anthers that remained below the stigmatic surface at anthesis. RT-PCR analysis of the sterile plants confirmed the anther-specific expression of orfH522 and bright-field microscopy demonstrated ablation of the tapetal cell layer. Premature DNA fragmentation and programmed cell death was observed at meiosis stage in the anthers of sterile plants. Stable transmission of induced male sterility trait was confirmed in test cross progeny. This constitutes the first report at demonstrating the induction of male sterility by introducing orfH522 gene that could be useful for genetic engineering of male sterility.

Clones from a shooty tobacco crown gall tumor I: deletions, rearrangements and amplifications resulting in irregular T-DNA structures and organizations.

PubMed

Peerbolte, R; Leenhouts, K; Hooykaas-van Slogteren, G M; Hoge, J H; Wullems, G J; Schilperoort, R A

1986-07-01

Transformed clones from a shooty tobacco crown gall tumor, induced byAgrobacterium tumefaciens strain LBA1501, having a Tn1831 insertion in the auxin locus, were investigated for their T-DNA structure and expression. In addition to clones with the expected phenotype, i.e. phytohormone autonomy, regeneration of non-rooting shoots and octopine synthesis (Aut(+)Reg(+)Ocs(+) 'type I' clones), clones were obtained with an aberrant phenotype. Among these were the Aut(-)Reg(-)Ocs(+) 'type II' clones. Two shooty type I clones and three type II callus clones (all randomly chosen) as well as a rooting shoot regenerated from a type II clone via a high kinetin treatment, all had a T-DNA structure which differed significantly from 'regular' T-DNA structures. No Tn1831 DNA sequences were detected in these clones. The two type I clones were identical: they both contained the same highly truncated T-DNA segments. One TL-DNA segment of approximately 0.7 kb, originating form the left part of the TL-region, was present at one copy per diploid tobacco genome. Another segment with a maximum size of about 7 kb was derived from the right hand part of the TL-region and was present at minimally two copies. Three copies of a truncated TR-DNA segment were detected, probably starting at the right TR-DNA border repeat and ending halfway the regular TR-region. Indications have been obtained that at least some of the T-DNA segments are closely linked, sometimes via intervening plant DNA sequences. The type I clones harbored TL-DNA transcripts 4, 6a/b and 3 as well as TR-DNA transcript 0'. The type II clones harbored three to six highly truncated T-DNA segments, originating from the right part of the TL-region. In addition they had TR-DNA segments, similar to those of the type I clones. On Northern blots TR-DNA transcripts 0' and 1' were detected as well as the TL-DNA transcripts 3 and 6a/b and an 1800 bp hybrid transcript (tr.Y) containing gene 6b sequences. Possible origins of the observed irregularities in T-DNA structures are discussed in relation to fidelity of transformation of plant cells viaAgrobacterium.

JPRS Report, Science & Technology, Japan, Government and Private Sector Joint R&D Projects

DTIC Science & Technology

1988-08-16

is that if this system uses exogenous genes represented by the DNA that codes for hepatitis B surface antigen, polyvaccines can be produced easily...that can express in large quantities molecular clones of genetic products is awaited. Vectors using cells of higher mammals including man have been...functions of IVM and MMD using cultured spinal nerve cells with a great advantage that the same sample can be used for both electrophysiological and

Role of the Neddylation Enzyme Uba3, A New Estrogen Receptor Corepressor in Breast Cancer

DTIC Science & Technology

2006-09-01

cells acquire ICI 182,780 resistance while retaining expres- sion of ER. MATERIALS AND METHODS Materials The following antibodies and reagents were used...protein assay kit; FBS and csFBS (Hy- Clone Laboratories, Inc., Logan, UT); LipofectAMINE Plus Reagent , geneticin, and other cell culture reagents were...plasmid DNA (adjusted by corresponding empty vectors) by using LipofectAMINE Plus Reagent according to the manufacturer’s guidelines. Five hours later

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Back to BAC: The Use of Infectious Clone Technologies for Viral Mutagenesis

PubMed Central

Hall, Robyn N.; Meers, Joanne; Fowler, Elizabeth; Mahony, Timothy

2012-01-01

Bacterial artificial chromosome (BAC) vectors were first developed to facilitate the propagation and manipulation of large DNA fragments in molecular biology studies for uses such as genome sequencing projects and genetic disease models. To facilitate these studies, methodologies have been developed to introduce specific mutations that can be directly applied to the mutagenesis of infectious clones (icBAC) using BAC technologies. This has resulted in rapid identification of gene function and expression at unprecedented rates. Here we review the major developments in BAC mutagenesis in vitro. This review summarises the technologies used to construct and introduce mutations into herpesvirus icBAC. It also explores developing technologies likely to provide the next leap in understanding these important viruses. PMID:22470833

Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

PubMed

Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

2014-09-01

Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

BASIC: A Simple and Accurate Modular DNA Assembly Method.

PubMed

Storch, Marko; Casini, Arturo; Mackrow, Ben; Ellis, Tom; Baldwin, Geoff S

2017-01-01

Biopart Assembly Standard for Idempotent Cloning (BASIC) is a simple, accurate, and robust DNA assembly method. The method is based on linker-mediated DNA assembly and provides highly accurate DNA assembly with 99 % correct assemblies for four parts and 90 % correct assemblies for seven parts [1]. The BASIC standard defines a single entry vector for all parts flanked by the same prefix and suffix sequences and its idempotent nature means that the assembled construct is returned in the same format. Once a part has been adapted into the BASIC format it can be placed at any position within a BASIC assembly without the need for reformatting. This allows laboratories to grow comprehensive and universal part libraries and to share them efficiently. The modularity within the BASIC framework is further extended by the possibility of encoding ribosomal binding sites (RBS) and peptide linker sequences directly on the linkers used for assembly. This makes BASIC a highly versatile library construction method for combinatorial part assembly including the construction of promoter, RBS, gene variant, and protein-tag libraries. In comparison with other DNA assembly standards and methods, BASIC offers a simple robust protocol; it relies on a single entry vector, provides for easy hierarchical assembly, and is highly accurate for up to seven parts per assembly round [2].

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

PubMed Central

Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

1998-01-01

A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and acquired human diseases affecting cells of erythroid lineage. PMID:9573295

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

PubMed

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

Anti-digoxin Fab variants generated by phage display.

PubMed

Murata, Viviane Midori; Schmidt, Mariana Costa Braga; Kalil, Jorge; Tsuruta, Lilian Rumi; Moro, Ana Maria

2013-06-01

Digoxin is a pharmaceutical used in the control of cardiac dysfunction. Its therapeutic window is narrow, with effect dosage very close to the toxic dosage. To counteract the toxic effect, polyclonal Fab fragments are commercially available. Our study is based on a monoclonal anti-digoxin antibody, which would provide a product with a specific potency and more precise dosage for the detoxification of patients under digoxin treatment. Phage display technology was used to select variants with high affinity. From an anti-digoxin hybridoma, RNA was extracted for subsequent cDNA synthesis. Specific primers were used for the LC and Fd amplifications, then cloned sequentially in a phagemid vector (pComb3X) for the combinatorial Fab library construction. Clones were selected for their ability to bind to digoxin-BSA. The presence of light and heavy chains was checked, randomly selected clones then sequenced and induced to produce soluble Fabs, and subsequently analyzed for anti-digoxin expression. Out of ten clones randomly chosen, six resulted positive expression of the product. The sequencing of these revealed two identical clones and one presenting a pseudogene in the LC. Four clones presenting variations in the framework1 showed binding to digoxin-BSA by ELISA and western blotting. The specific binding was further confirmed by Biacore(®), which allowed ranking of the clones. The development of these clones allowed the selection of variants with higher affinity than the original version.

Nonradioactive Screening Method for Isolation of Disease-Specific Probes To Diagnose Plant Diseases Caused by Mycoplasmalike Organisms

PubMed Central

Lee, Ing-Ming; Davis, Robert E.; DeWitt, Natalie D.

1990-01-01

DNA fragments of tomato big bud (BB) mycoplasmalike organism (MLO) in diseased periwinkle plants (Catharanthus roseus L.) were cloned to pSP6 plasmid vectors and amplified in Escherichia coli JM83. A nonradioactive method was developed and used to screen for MLO-specific recombinants. Cloned DNA probes were prepared by nick translation of the MLO recombinant plasmids by using biotinylated nucleotides. The probes all hybridized with nucleic acid from BB MLO-infected, but not healthy, plants. Results from dot hybridization analyses indicated that several MLOs, e.g., those of Italian tomato big bud, periwinkle little leaf, and clover phyllody, are closely related to BB MLO. The Maryland strain of aster yellows and maize bushy stunt MLOs are also related to BB MLO. Among the remaining MLOs used in this study, Vinca virescence and elm yellows MLOs may be very distantly related, if at all, to BB MLO. Potato witches' broom, clover proliferation, ash yellows, western X, and Canada X MLOs are distantly related to BB MLO. Southern hybridization analyses revealed that BB MLO contains extrachromosomal DNA that shares sequence homologies with extrachromosomal DNAs from aster yellows and periwinkle little leaf MLOs. Images PMID:16348195

Cloning and sequencing of a gene encoding a novel extracellular neutral proteinase from Streptomyces sp. strain C5 and expression of the gene in Streptomyces lividans 1326.

PubMed Central

Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R

1992-01-01

The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

A novel approach for Escherichia coli genome editing combining in vivo cloning and targeted long-length chromosomal insertion.

PubMed

Hook, Ch D; Samsonov, V V; Ublinskaya, A A; Kuvaeva, T M; Andreeva, E V; Gorbacheva, L Yu; Stoynova, N V

2016-11-01

Despite the abundance of genetic manipulation approaches, particularly for Escherichia coli, new techniques and increased flexibility in the application of existing techniques are required to address novel aims. The most widely used approaches for chromosome editing are based on bacteriophage site-specific and λRed/RecET-mediated homologous recombination. In the present study, these techniques were combined to develop a novel approach for in vivo cloning and targeted long-length chromosomal insertion. This approach permits direct λRed-mediated cloning of DNA fragment with lengths of 10kb or greater from the E. coli chromosome into the plasmid vector pGL2, which carries the ori of pSC101, the ϕ80-attP site of ϕ80 phage, and an excisable Cm R marker bracketed by λ-attL/attR sites. In pGL2-based recombinant plasmids, the origin of replication can be eliminated in vitro via hydrolysis by SceI endonuclease and recircularization by DNA ligase. The resulting ori-less circular recombinant DNA can be used for targeted insertion of the cloned sequence into the chromosome at a selected site via ϕ80 phage-specific integrase-mediated recombination using the Dual-In/Out approach (Minaeva et al., 2008). At the final stage of chromosomal editing, the Cm R -marker can be excised from the chromosome due to expression of the λint/xis genes. Notably, the desired fragment can be inserted as multiple copies in the chromosome by combining insertions at different sites in one strain using the P1 general transduction technique (Moore, 2011). The developed approach is useful for the construction of plasmidless, markerless recombinant strains for fundamental and industrial purposes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular cloning of the mouse gene coding for {alpha}{sub 2}-macroglobulin and targeting of the gene in embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Umans, L.; Serneels, L.; Hilliker, C.

1994-08-01

The authors have cloned the mouse gene coding for {alpha}{sub 2}-macroglobulin in overlapping {lambda} clones and have analyzed its structure. The gene contains 36 exons, coding for the 4.8-kb cDNA that we cloned previously. Including putative control elements in the 5{prime} flanking region, the gene covers about 45 kb. A region of 3.8 kb, stretching from 835 bases upstream of the cDNA start site to exon 4, including all intervening sequences, was sequenced completely. The analysis demonstrated that the putative promoter region of the mouse A2M gene differed considerably from the known promoter sequences of the human A2M gene andmore » of the rat acute-phas A2M gene. Comparison of the exon-intron structure of all known genes of the A2M family confirmed that the rat acute phase A2M gene is more closely related to the human gene than to the mouse A2M gene. To generate mice with the A2M gene inactivated, an insertion type of construct containing 7.5 kb of genomic DNA of the mouse strain 129/J, encompassing exons 16 to 19, was synthesized. A hygromycin marker gene was embedded in intron 17. After electroporation, 198 hygromycin-resistant ES cell lines were isolated and analyzed by Southern blotting. Five ES cell lines were obtained with one allele of the mouse A2M gene targeted by this insertion construct, demonstrating that the position and the characteristics of the vector served the intended goal.« less

Cloning and expression of N22 region of Torque Teno virus (TTV) genome and use of peptide in developing immunoassay for TTV antibodies

PubMed Central

2014-01-01

Background Torque Teno Virus (TTV) is a DNA virus with high rate of prevalence globally. Since its discovery in 1997, several studies have questioned the role of this virus in causing disease. However, it still remains an enigma. Although methods are available for detection of TTV infection, there is still a need for simple, rapid and reliable method for screening of this virus in human population. Present investigation describes the cloning and expression of N22 region of TTV-genome and the use of expressed peptide in development of immunoassay to detect anti-TTV antibodies in serum. Since TTV genotype-1 is more common in India, the serum positive for genotype-1 was used as source of N22 for expression purpose. Methods Full length N22 region of ORF1 from TTV genotype-1 was amplified and cloned in pGEM®-T Easy vector. After cloning, the amplicon was transformed and expressed as a fusion protein containing hexa-histidine tag in pET-28a(+) vector using BL21 E. coli cells as host. Expression was conducted both in LB medium as well as ZYP-5052 auto-induction medium. The expressed peptide was purified using metal-chelate affinity chromatography and used as antigen in developing a blot immunoassay. Results Analysis of translated product by SDS-PAGE and western blotting demonstrated the presence of 25 kDa polypeptide produced after expression. Solubility studies showed the polypeptide to be associated with insoluble fraction. The use of this peptide as antigen in blot assay produced prominent spot on membrane treated with sera from TTV-infected patients. Analysis of sera from 75 patients with liver and renal diseases demonstrated a successful implication of N22 polypeptide based immunoassay in screening sera for anti-TTV antibodies. Comparison of the immunoassay developed using expressed N22 peptide with established PCR method for TTV-DNA detection showed good coherence between TTV-DNA and presence of anti-TTV antibodies in the sera analysed. Conclusions This concludes that TTV N22 region may be expressed and safely used as antigen for blot assay to detect anti-TTV antibodies in sera. PMID:24884576

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

Telomerase-mediated life-span extension of human primary fibroblasts by human artificial chromosome (HAC) vector

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shitara, Shingo; Kakeda, Minoru; Nagata, Keiko

2008-05-09

Telomerase-mediated life-span extension enables the expansion of normal cells without malignant transformation, and thus has been thought to be useful in cell therapies. Currently, integrating vectors including the retrovirus are used for human telomerase reverse transcriptase (hTERT)-mediated expansion of normal cells; however, the use of these vectors potentially causes unexpected insertional mutagenesis and/or activation of oncogenes. Here, we established normal human fibroblast (hPF) clones retaining non-integrating human artificial chromosome (HAC) vectors harboring the hTERT expression cassette. In hTERT-HAC/hPF clones, we observed the telomerase activity and the suppression of senescent-associated SA-{beta}-galactosidase activity. Furthermore, the hTERT-HAC/hPF clones continued growing beyond 120 daysmore » after cloning, whereas the hPF clones retaining the silent hTERT-HAC senesced within 70 days. Thus, hTERT-HAC-mediated episomal expression of hTERT allows the extension of the life-span of human primary cells, implying that gene delivery by non-integrating HAC vectors can be used to control cellular proliferative capacity of primary cultured cells.« less

Walleye dermal sarcoma virus: expression of a full-length clone or the rv-cyclin (orf a) gene is cytopathic to the host and human tumor cells.

PubMed

Xu, Kun; Zhang, Ting Ting; Wang, Ling; Zhang, Cun Fang; Zhang, Long; Ma, Li Xia; Xin, Ying; Ren, Chong Hua; Zhang, Zhi Qiang; Yan, Qiang; Martineau, Daniel; Zhang, Zhi Ying

2013-02-01

Walleye dermal sarcoma virus (WDSV) is etiologically associated with a skin tumor, walleye dermal sarcoma (WDS), which develops in the fall and regresses in the spring. WDSV genome contains, in addition to gag, pol and env, three open reading frames (orfs) designated orf a (rv-cyclin), orf b and orf c. Unintegrated linear WDSV provirus DNA isolated from infected tumor cells was used to construct a full-length WDSV provirus clone pWDSV, while orf a was cloned into pSVK3 to construct the expression vector porfA. Stable co-transfection of a walleye cell line (W12) with pWDSV and pcDNA3 generated fewer and smaller G418-resistant colonies compared to the control. By Northern blot analysis, several small transcripts (2.8, 1.8, 1.2, and 0.8 kb) were detected using a WDSV LTR-specific probe. By RT-PCR and Southern blot analysis, three cDNAs (2.4, 1.6 and 0.8 kb) were identified, including both orf a and orf b messenger. Furthermore stable co-transfection of both a human lung adenocarcinoma cell line (SPC-A-1) and a cervical cancer cell line (HeLa) with pcDNA3 and ether porfA or pWDSV also generated fewer and smaller G418-resistant colonies. We conclude that expression of the full-length WDSV clone or the orf a gene inhibits the host fish and human tumor cell growth, and Orf A protein maybe a potential factor which contributes to the seasonal tumor development and regression. This is the first fish provirus clone that has been expressed in cell culture system, which will provide a new in vitro model for tumor research and oncotherapy study.

pHg/pSILBAγ vector system for efficient gene silencing in homobasidiomycetes: optimization of ihpRNA – triggering in the mycorrhizal fungus Laccaria bicolor

PubMed Central

Kemppainen, Minna J.; Pardo, Alejandro G.

2010-01-01

Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319

Development of the gateway recycling cloning system for multiple linking of expression cassettes in a defined order, and direction on gateway compatible binary vectors.

PubMed

Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi

2013-01-01

We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.

Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

PubMed Central

Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

2013-01-01

Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

Exploitation of rolling circle amplification for the construction of large phage-display antibody libraries.

PubMed

Shahsavarian, Melody A; Le Minoux, Damien; Matti, Kalyankumar M; Kaveri, Srini; Lacroix-Desmazes, Sébastien; Boquet, Didier; Friboulet, Alain; Avalle, Bérangère; Padiolleau-Lefèvre, Séverine

2014-05-01

Phage display antibody libraries have proven to have a significant role in the discovery of therapeutic antibodies and polypeptides with desired biological and physicochemical properties. Obtaining a large and diverse phage display antibody library, however, is always a challenging task. Various steps of this technique can still undergo optimization in order to obtain an efficient library. In the construction of a single chain fragment variable (scFv) phage display library, the cloning of the scFv fragments into a phagemid vector is of crucial importance. An efficient restriction enzyme digestion of the scFv DNA leads to its proper ligation with the phagemid followed by its successful cloning and expression. Here, we are reporting a different approach to enhance the efficiency of the restriction enzyme digestion step. We have exploited rolling circle amplification (RCA) to produce a long strand of DNA with tandem repeats of scFv sequences, which is found to be highly susceptible to restriction digestion. With this important modification, we are able to construct a large phage display antibody library of naive SJL/J mice. The size of the library is estimated as ~10(8) clones. The number of clones containing a scFv fragment is estimated at 90%. Hence, the present results could considerably aid the utilization of the phage-display technique in order to get an efficiently large antibody library. Copyright © 2014 Elsevier B.V. All rights reserved.

Construction of a self-cloning sake yeast that overexpresses alcohol acetyltransferase gene by a two-step gene replacement protocol.

PubMed

Hirosawa, I; Aritomi, K; Hoshida, H; Kashiwagi, S; Nishizawa, Y; Akada, R

2004-07-01

The commercial application of genetically modified industrial microorganisms has been problematic due to public concerns. We constructed a "self-cloning" sake yeast strain that overexpresses the ATF1 gene encoding alcohol acetyltransferase, to improve the flavor profile of Japanese sake. A constitutive yeast overexpression promoter, TDH3p, derived from the glyceraldehyde-3-phosphate dehydrogenase gene from sake yeast was fused to ATF1; and the 5' upstream non-coding sequence of ATF1 was further fused to TDH3p-ATF1. The fragment was placed on a binary vector, pGG119, containing a drug-resistance marker for transformation and a counter-selection marker for excision of unwanted DNA. The plasmid was integrated into the ATF1 locus of a sake yeast strain. This integration constructed tandem repeats of ATF1 and TDH3p-ATF1 sequences, between which the plasmid was inserted. Loss of the plasmid, which occurs through homologous recombination between either the TDH3p downstream ATF1 repeats or the TDH3p upstream repeat sequences, was selected by growing transformants on counter-selective medium. Recombination between the downstream repeats led to reversion to a wild type strain, but that between the upstream repeats resulted in a strain that possessed TDH3p-ATF1 without the extraneous DNA sequences. The self-cloning TDH3p-ATF1 yeast strain produced a higher amount of isoamyl acetate. This is the first expression-controlled self-cloning industrial yeast.

A versatile expression vector for the growth and amplification of unmodified phage display polypeptides.

PubMed

Winton, Alexander J; Baptiste, Janae L; Allen, Mark A

2018-09-01

Proteins and polypeptides represent nature's most complex and versatile polymer. They provide complicated shapes, diverse chemical functionalities, and tightly regulated and controlled sizes. Several disease states are related to the misfolding or overproduction of polypeptides and yet polypeptides are present in several therapeutic molecules. In addition to biological roles; short chain polypeptides have been shown to interact with and drive the bio-inspired synthesis or modification of inorganic materials. This paper outlines the development of a versatile cloning vector which allows for the expression of a short polypeptide by controlling the incorporation of a desired DNA coding insert. As a demonstration of the efficacy of the expression system, a solid binding polypeptide identified from M13 phage display was expressed and purified. The solid binding polypeptide was expressed as a soluble 6xHis-SUMO tagged construct. Expression was performed in E. coli using auto-induction followed by Ni-NTA affinity chromatography and ULP1 protease cleavage. Methodology demonstrates the production of greater than 8 mg of purified polypeptide per liter of E. coli culture. Isotopic labeling of the peptide is also demonstrated. The versatility of the designed cloning vector, use of the 6xHis-SUMO solubility partner, bacterial expression in auto-inducing media and the purification methodology make this expressionun vector a readily scalable and user-friendly system for the creation of desired peptide domains. Copyright © 2018. Published by Elsevier Inc.

Identification and characterization of microsatellite markers in the Chagas disease vector Triatoma dimidiata

PubMed Central

Anderson, Jennifer M.; Lai, James E.; Dotson, Ellen M.; Cordon-Rosales, Celia; Ponce, Carlos; Norris, Douglas E.; Ben Beard, C.

2014-01-01

Triatoma dimidiata, one of the major vectors of Chagas disease in Central America, is found in both domestic and peri-domestic habitats. Questions concerning population boundaries, infestation rates, insecticide resistance, and geographic dispersal of triatomine bugs persist and may be resolved using genetic markers such as microsatellites. Microsatellites are short tandem repeats found dispersed throughout a genome and can be useful for genotypic identification. We developed a plasmid library from the genomic DNA isolated from a single T. dimidiata adult collected in Guatamala. Ten thousand clones were screened using a probe consisting of nine microsatellite oligonucleotides. Eight loci appear polymorphic among populations found in Guatemala, Honduras, and Mexico, and thus are potentially useful for population genetic applications. PMID:12798021

Grafting fibroblasts genetically modified to produce L-dopa in a rat model of Parkinson disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolff, J.A.; Fisher, L.J.; Xu, L.

1989-11-01

Rat fibroblasts were infected with a retroviral vector containing the cDNA for rat tyrosine hydroxylase. A TH-positive clone was identified by biochemical assay and immunohistochemical staining. When supplemented in vitro with pterin cofactors required for TH activity, these cells produced L-dopa and released it into the cell cultured medium. Uninfected control cells and fibroblasts infected with the TH vector were grafted separately to the caudate of rats with unilateral 6-hydroxydopamine lesions of the nigrostriatal pathway. Only grafts containing TH-expressing fibroblasts were found to reduce rotational asymmetry. These results have general implications for the application of gene therapy to human neurologicalmore » disease and specific implications for Parkinson disease.« less

Construction of an infectious genomic clone of porcine parvovirus: effect of the 5'-end on DNA replication.

PubMed

Casal, J I; Diaz-Aroca, E; Ranz, A I; Manclus, J J

1990-08-01

The linear single-stranded DNA genome of the porcine parvovirus, an autonomous parvovirus, was cloned in duplex form into the bacterial plasmid pUC18 using a simple and reliable method. These clones were stable during propagation in Escherichia coli JM109. The recombinant clones of porcine parvovirus were infectious when transfected into monolayers of swine testes cells as identified by the development of cytopathic effect, indirect immunofluorescence with specific antiserum, and hemagglutination assays. DNA isolated from progeny virus arising from transfected infectious clones was found to be indistinguishable from wild-type DNA by restriction enzyme analysis. Defective genomes could also be detected in the progeny DNA even though the infection was initiated with homogeneous, cloned DNA. The presence of the turn of the 5'-end loop seems to be necessary to get stable infectious clones.

Physical mapping of complex genomes

DOEpatents

Evans, G.A.

1993-06-15

A method for the simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts in the pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert in the common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed.

cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

PubMed

Huang, Shengbing; Song, Wei; Lin, Qishui

2005-08-01

A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.

PubMed

Kröger, M; Tschesche, H

1997-09-01

The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1989-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Modular protein expression by RNA trans-splicing enables flexible expression of antibody formats in mammalian cells from a dual-host phage display vector.

PubMed

Shang, Yonglei; Tesar, Devin; Hötzel, Isidro

2015-10-01

A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

A multisite gateway-based toolkit for targeted gene expression and hairpin RNA silencing in tomato fruits.

PubMed

Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio

2009-04-01

A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

PubMed

Trigoso, Yvonne D; Evans, Russell C; Karsten, William E; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification.

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

PubMed Central

Trigoso, Yvonne D.; Evans, Russell C.; Karsten, William E.; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5’and 3’ terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40–50 mgs of protein, an improvement on the previous protein expression and multistep purification. PMID:26815040

[Cloning and expression of Micrococcus luteus IAM 14879 Rpf and its role in the recovery of the VBNC state in Rhodococcus sp. DS471].

PubMed

Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira

2012-01-01

The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.

Cloning and high level expression of gene encoding ES antigen from Trichinella spiralis muscle larvae.

PubMed

Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S

1994-01-01

The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.

Sources of Blood Meals of Sylvatic Triatoma guasayana near Zurima, Bolivia, Assayed with qPCR and 12S Cloning

PubMed Central

Lucero, David E.; Ribera, Wilma; Pizarro, Juan Carlos; Plaza, Carlos; Gordon, Levi W.; Peña, Reynaldo; Morrissey, Leslie A.; Rizzo, Donna M.; Stevens, Lori

2014-01-01

Background In this study we compared the utility of two molecular biology techniques, cloning of the mitochondrial 12S ribosomal RNA gene and hydrolysis probe-based qPCR, to identify blood meal sources of sylvatic Chagas disease insect vectors collected with live-bait mouse traps (also known as Noireau traps). Fourteen T. guasayana were collected from six georeferenced trap locations in the Andean highlands of the department of Chuquisaca, Bolivia. Methodology/Principal Findings We detected four blood meals sources with the cloning assay: seven samples were positive for human (Homo sapiens), five for chicken (Gallus gallus) and unicolored blackbird (Agelasticus cyanopus), and one for opossum (Monodelphis domestica). Using the qPCR assay we detected chicken (13 vectors), and human (14 vectors) blood meals as well as an additional blood meal source, Canis sp. (4 vectors). Conclusions/Significance We show that cloning of 12S PCR products, which avoids bias associated with developing primers based on a priori knowledge, detected blood meal sources not previously considered and that species-specific qPCR is more sensitive. All samples identified as positive for a specific blood meal source by the cloning assay were also positive by qPCR. However, not all samples positive by qPCR were positive by cloning. We show the power of combining the cloning assay with the highly sensitive hydrolysis probe-based qPCR assay provides a more complete picture of blood meal sources for insect disease vectors. PMID:25474154

PlasmoGEM, a database supporting a community resource for large-scale experimental genetics in malaria parasites.

PubMed

Schwach, Frank; Bushell, Ellen; Gomes, Ana Rita; Anar, Burcu; Girling, Gareth; Herd, Colin; Rayner, Julian C; Billker, Oliver

2015-01-01

The Plasmodium Genetic Modification (PlasmoGEM) database (http://plasmogem.sanger.ac.uk) provides access to a resource of modular, versatile and adaptable vectors for genome modification of Plasmodium spp. parasites. PlasmoGEM currently consists of >2000 plasmids designed to modify the genome of Plasmodium berghei, a malaria parasite of rodents, which can be requested by non-profit research organisations free of charge. PlasmoGEM vectors are designed with long homology arms for efficient genome integration and carry gene specific barcodes to identify individual mutants. They can be used for a wide array of applications, including protein localisation, gene interaction studies and high-throughput genetic screens. The vector production pipeline is supported by a custom software suite that automates both the vector design process and quality control by full-length sequencing of the finished vectors. The PlasmoGEM web interface allows users to search a database of finished knock-out and gene tagging vectors, view details of their designs, download vector sequence in different formats and view available quality control data as well as suggested genotyping strategies. We also make gDNA library clones and intermediate vectors available for researchers to produce vectors for themselves. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

PubMed

Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

2008-12-01

Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

Production of Human Papilloma Virus Type 16 E6 Oncoprotein as a Recombinant Protein in Eukaryotic Cells

PubMed Central

Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM

2012-01-01

Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534

Production of Transgenic Pigs with an Introduced Missense Mutation of the Bone Morphogenetic Protein Receptor Type IB Gene Related to Prolificacy.

PubMed

Zhao, Xueyan; Yang, Qiang; Zhao, Kewei; Jiang, Chao; Ren, Dongren; Xu, Pan; He, Xiaofang; Liao, Rongrong; Jiang, Kai; Ma, Junwu; Xiao, Shijun; Ren, Jun; Xing, Yuyun

2016-07-01

In the last few decades, transgenic animal technology has witnessed an increasingly wide application in animal breeding. Reproductive traits are economically important to the pig industry. It has been shown that the bone morphogenetic protein receptor type IB (BMPR1B) A746G polymorphism is responsible for the fertility in sheep. However, this causal mutation exits exclusively in sheep and goat. In this study, we attempted to create transgenic pigs by introducing this mutation with the aim to improve reproductive traits in pigs. We successfully constructed a vector containing porcine BMPR1B coding sequence (CDS) with the mutant G allele of A746G mutation. In total, we obtained 24 cloned male piglets using handmade cloning (HMC) technique, and 12 individuals survived till maturation. A set of polymerase chain reactions indicated that 11 of 12 matured boars were transgene-positive individuals, and that the transgenic vector was most likely disrupted during cloning. Of 11 positive pigs, one (No. 11) lost a part of the terminator region but had the intact promoter and the CDS regions. cDNA sequencing showed that the introduced allele (746G) was expressed in multiple tissues of transgene-positive offspring of No.11. Western blot analysis revealed that BMPR1B protein expression in multiple tissues of transgene-positive F1 piglets was 0.5 to 2-fold higher than that in the transgene-negative siblings. The No. 11 boar showed normal litter size performance as normal pigs from the same breed. Transgene-positive F1 boars produced by No. 11 had higher semen volume, sperm concentration and total sperm per ejaculate than the negative siblings, although the differences did not reached statistical significance. Transgene-positive F1 sows had similar litter size performance to the negative siblings, and more data are needed to adequately assess the litter size performance. In conclusion, we obtained 24 cloned transgenic pigs with the modified porcine BMPR1B CDS using HMC. cDNA sequencing and western blot indicated that the exogenous BMPR1B CDS was successfully expressed in host pigs. The transgenic pigs showed normal litter size performance. However, no significant differences in litter size were found between transgene-positive and negative sows. Our study provides new insight into producing cloned transgenic livestock related to reproductive traits.

Current and future resources for functional metagenomics

PubMed Central

Lam, Kathy N.; Cheng, Jiujun; Engel, Katja; Neufeld, Josh D.; Charles, Trevor C.

2015-01-01

Functional metagenomics is a powerful experimental approach for studying gene function, starting from the extracted DNA of mixed microbial populations. A functional approach relies on the construction and screening of metagenomic libraries—physical libraries that contain DNA cloned from environmental metagenomes. The information obtained from functional metagenomics can help in future annotations of gene function and serve as a complement to sequence-based metagenomics. In this Perspective, we begin by summarizing the technical challenges of constructing metagenomic libraries and emphasize their value as resources. We then discuss libraries constructed using the popular cloning vector, pCC1FOS, and highlight the strengths and shortcomings of this system, alongside possible strategies to maximize existing pCC1FOS-based libraries by screening in diverse hosts. Finally, we discuss the known bias of libraries constructed from human gut and marine water samples, present results that suggest bias may also occur for soil libraries, and consider factors that bias metagenomic libraries in general. We anticipate that discussion of current resources and limitations will advance tools and technologies for functional metagenomics research. PMID:26579102

Current and future resources for functional metagenomics.

PubMed

Lam, Kathy N; Cheng, Jiujun; Engel, Katja; Neufeld, Josh D; Charles, Trevor C

2015-01-01

Functional metagenomics is a powerful experimental approach for studying gene function, starting from the extracted DNA of mixed microbial populations. A functional approach relies on the construction and screening of metagenomic libraries-physical libraries that contain DNA cloned from environmental metagenomes. The information obtained from functional metagenomics can help in future annotations of gene function and serve as a complement to sequence-based metagenomics. In this Perspective, we begin by summarizing the technical challenges of constructing metagenomic libraries and emphasize their value as resources. We then discuss libraries constructed using the popular cloning vector, pCC1FOS, and highlight the strengths and shortcomings of this system, alongside possible strategies to maximize existing pCC1FOS-based libraries by screening in diverse hosts. Finally, we discuss the known bias of libraries constructed from human gut and marine water samples, present results that suggest bias may also occur for soil libraries, and consider factors that bias metagenomic libraries in general. We anticipate that discussion of current resources and limitations will advance tools and technologies for functional metagenomics research.

Cloning and expression in Escherichia coli of Vibrio parahaemolyticus thermostable direct hemolysin and thermolabile hemolysin genes.

PubMed

Taniguchi, H; Ohta, H; Ogawa, M; Mizuguchi, Y

1985-05-01

Two hemolysin genes of Vibrio parahaemolyticus WP1, a thermostable direct (TSD) hemolysin gene and a thermolabile hemolysin gene, were cloned into the pBR322 vector in Escherichia coli K-12 C600. A large amount of the TSD hemolysin produced in E. coli K-12 accumulated in the periplasmic space. The TSD hemolysin gene was localized on a 0.9-kilobase HindIII-BamHI fragment by identifying qualitatively the production of the TSD hemolysin by a reverse passive hemagglutination assay in the osmotic shock fluid. The thermolabile hemolysin gene was isolated on a 1.3-kilobase HindIII-PstI fragment by selection with the hemolysin on blood agar. Southern blot hybridization and colony hybridization experiments indicated that the TSD hemolysin gene was present in the chromosomal DNA of 15 Kanagawa phenomenon-positive strains but not in 14 negative strains, whereas the thermolabile hemolysin gene was detected in all strains. No homologous DNA sequences to TSD and thermolabile hemolysin genes were detected in the chromosomes of Vibrio cholerae, Vibrio vulnificus, non-O1 V. cholerae, and Vibrio anguillarum.

Molecular cloning and characterization of a gene regulating flowering time from Alfalfa (Medicago sativa L.).

PubMed

Zhang, Tiejun; Chao, Yuehui; Kang, Junmei; Ding, Wang; Yang, Qingchuan

2013-07-01

Genes that regulate flowering time play crucial roles in plant development and biomass formation. Based on the cDNA sequence of Medicago truncatula (accession no. AY690425), the LFY gene of alfalfa was cloned. Sequence similarity analysis revealed high homology with FLO/LFY family genes of other plants. When fused to the green fluorescent protein, MsLFY protein was localized in the nucleus of onion (Allium cepa L.) epidermal cells. The RT-qPCR analysis of MsLFY expression patterns showed that the expression of MsLFY gene was at a low level in roots, stems, leaves and pods, and the expression level in floral buds was the highest. The expression of MsLFY was induced by GA3 and long photoperiod. Plant expression vector was constructed and transformed into Arabidopsis by the agrobacterium-mediated methods. PCR amplification with the transgenic Arabidopsis genome DNA indicated that MsLFY gene had integrated in Arabidopsis genome. Overexpression of MsLFY specifically caused early flowering under long day conditions compared with non-transgenic plants. These results indicated MsLFY played roles in promoting flowering time.

An Engineered Virus Library as a Resource for the Spectrum-wide Exploration of Virus and Vector Diversity.

PubMed

Zhang, Wenli; Fu, Jun; Liu, Jing; Wang, Hailong; Schiwon, Maren; Janz, Sebastian; Schaffarczyk, Lukas; von der Goltz, Lukas; Ehrke-Schulz, Eric; Dörner, Johannes; Solanki, Manish; Boehme, Philip; Bergmann, Thorsten; Lieber, Andre; Lauber, Chris; Dahl, Andreas; Petzold, Andreas; Zhang, Youming; Stewart, A Francis; Ehrhardt, Anja

2017-05-23

Adenoviruses (Ads) are large human-pathogenic double-stranded DNA (dsDNA) viruses presenting an enormous natural diversity associated with a broad variety of diseases. However, only a small fraction of adenoviruses has been explored in basic virology and biomedical research, highlighting the need to develop robust and adaptable methodologies and resources. We developed a method for high-throughput direct cloning and engineering of adenoviral genomes from different sources utilizing advanced linear-linear homologous recombination (LLHR) and linear-circular homologous recombination (LCHR). We describe 34 cloned adenoviral genomes originating from clinical samples, which were characterized by next-generation sequencing (NGS). We anticipate that this recombineering strategy and the engineered adenovirus library will provide an approach to study basic and clinical virology. High-throughput screening (HTS) of the reporter-tagged Ad library in a panel of cell lines including osteosarcoma disease-specific cell lines revealed alternative virus types with enhanced transduction and oncolysis efficiencies. This highlights the usefulness of this resource. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

High copy and stable expression of the xylanase XynHB in Saccharomyces cerevisiae by rDNA-mediated integration.

PubMed

Fang, Cheng; Wang, Qinhong; Selvaraj, Jonathan Nimal; Zhou, Yuling; Ma, Lixin; Zhang, Guimin; Ma, Yanhe

2017-08-18

Xylanase is a widely-used additive in baking industry for enhancing dough and bread quality. Several xylanases used in baking industry were expressed in different systems, but their expression in antibiotic free vector system is highly essential and safe. In the present study, an alternative rDNA-mediated technology was developed to increase the copy number of target gene by integrating it into Saccharomyces cerevisiae genome. A xylanase-encoding gene xynHB from Bacillus sp. was cloned into pHBM367H and integrated into S. cerevisiae genome through rDNA-mediated recombination. Exogenous XynHB expressed by recombinant S. cerevisiae strain A13 exhibited higher degradation activity towards xylan than other transformants. The real-time PCR analysis on A13 genome revealed the presence of 13.64 copies of xynHB gene. Though no antibiotics have been used, the genetic stability and the xylanase activity of xynHB remained stable up to 1,011 generations of cultivation. S. cerevisiae strain A13 expressing xylanase reduced the required kneading time and increased the height and diameter of the dough size, which would be safe and effective in baking industry as no antibiotics-resistance risk. The new effective rDNA-mediated technology without using antibiotics here provides a way to clone other food related industrial enzymes for applications.

A Heterogeneous Nuclear Ribonucleoprotein A/B-Related Protein Binds to Single-Stranded DNA near the 5′ End or within the Genome of Feline Parvovirus and Can Modify Virus Replication

PubMed Central

Wang, Dai; Parrish, Colin R.

1999-01-01

Phage display of cDNA clones prepared from feline cells was used to identify host cell proteins that bound to DNA-containing feline panleukopenia virus (FPV) capsids but not to empty capsids. One gene found in several clones encoded a heterogeneous nuclear ribonucleoprotein (hnRNP)-related protein (DBP40) that was very similar in sequence to the A/B-type hnRNP proteins. DBP40 bound specifically to oligonucleotides representing a sequence near the 5′ end of the genome which is exposed on the outside of the full capsid but did not bind most other terminal sequences. Adding purified DBP40 to an in vitro fill-in reaction using viral DNA as a template inhibited the production of the second strand after nucleotide (nt) 289 but prior to nt 469. DBP40 bound to various regions of the viral genome, including a region between nt 295 and 330 of the viral genome which has been associated with transcriptional attenuation of the parvovirus minute virus of mice, which is mediated by a stem-loop structure of the DNA and cellular proteins. Overexpression of the protein in feline cells from a plasmid vector made them largely resistant to FPV infection. Mutagenesis of the protein binding site within the 5′ end viral genome did not affect replication of the virus. PMID:10438866

Cloning and characterization of a Pseudomonas mendocina KR1 gene cluster encoding toluene-4-monooxygenase.

PubMed Central

Yen, K M; Karl, M R; Blatt, L M; Simon, M J; Winter, R B; Fausset, P R; Lu, H S; Harcourt, A A; Chen, K K

1991-01-01

Pseudomonas mendocina KR1 metabolizes toluene as a carbon source by a previously unknown pathway. The initial step of the pathway is hydroxylation of toluene to form p-cresol by a multicomponent toluene-4-monooxygenase (T4MO) system. The T4MO enzyme system has broad substrate specificity and provides a new opportunity for biodegradation of toxic compounds and bioconversions. Its known activities include conversion of a variety of phenyl compounds into the phenolic derivatives and the complete degradation of trichloroethylene. We have cloned and characterized a gene cluster from KR1 that determines the offO activity. To clone the T4MO genes, KR1 DNA libraries were constructed in Escherichia coli HB101 by using a broad-host-range vector and transferred to a KR1 mutant able to grow on p-cresol but not on toluene. An insert consisting of two SacI fragments of identical size (10.2 kb) was shown to complement the mutant for growth on toluene. One of the SacI fragments, when cloned into the E. coli vector pUC19, was found to direct the synthesis of indigo dye. The indigo-forming property was correlated with the presence of T4MO activity. The T4MO genes were mapped to a 3.6-kb region, and the direction of transcription was determined. DNA sequencing and N-terminal amino acid determination identified a five-gene cluster, tmoABCDE, within this region. Expression of this cluster carrying a single mutation in each gene demonstrated that each of the five genes is essential for T4MO activity. Other evidence presented indicated that none of the tmo genes was involved in the regulation of the tmo gene cluster, in the control of substrate transport for the T4MO system, or in major processing of the products of the tmo genes. It was tentatively concluded that the tmoABCDE genes encode structural polypeptides of the T4MO enzyme system. One of the tmo genes was tentatively identified as a ferredoxin gene. Images PMID:1885512

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

PubMed

Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

2015-05-01

To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

A recombinant plasmid containing CpG motifs as a novel vaccine adjuvant for immune protection against herpes simplex virus 2.

PubMed

He, Zhuojing; Xu, Juan; Tao, Wei; Fu, Ting; He, Fang; Hu, Ruxi; Jia, Lan; Hong, Yan

2016-08-01

The aim of the present study was to evaluate the efficacy of a herpes simplex virus type 2 (HSV-2) DNA vaccine co‑immunized with a plasmid adjuvant containing CpG motifs. A novel eukaryotic expression plasmid vector containing kanamycin resistance gene (pcDNA3Kan) was acquired from pET‑28a(+) and pcDNA3 plasmids. A gene encoding full length HSV‑2 glycoprotein D (gD) was amplified from the pcDNA3‑gD plasmid, which was cloned into pcDNA3Kan resulting in the construction of the recombinant plasmid pcDNA3Kan‑gD (pgD). A DNA segment containing 8 CpG motifs was synthesized, and cloned into pcDNA3Kan, resulting in the recombinant plasmid pcDNA3Kan‑CpG (pCpG). Mice were co‑inoculated with pgD (used as a DNA vaccine) and pCpG (used as an adjuvant) by bilateral intramuscular injection. Mice inoculated with pgD+pCpG showed higher titers of antibodies than those inoculated with the DNA vaccine alone (P<0.05). In addition, mice inoculated with pgD+pCpG showed the highest percentage of CD4+ T cells in the blood of all the groups (P﹤0.05). Thus, the present study demonstrated that pCpG could stimulate the HSV‑2 DNA vaccine to induce a stronger cell‑mediated immune response than the DNA vaccine alone. The aim of the present study was to evaluate the efficacy of a HSV‑2 DNA vaccine (pgD) co‑immunized with a plasmid adjuvant containing CpG motifs (pCpG). Whether the pCpG would be able to stimulate the pgD to induce a stronger immune response compared with pgD alone.

Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

PubMed Central

Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

1991-01-01

The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

The salivary gland transcriptome of the eastern tree hole mosquito, Ochlerotatus triseriatus.

PubMed

Calvo, Eric; Sanchez-Vargas, Irma; Kotsyfakis, Michalis; Favreau, Amanda J; Barbian, Kent D; Pham, Van M; Olson, Kenneth E; Ribeiro, José M C

2010-05-01

Saliva of blood-sucking arthropods contains a complex mixture of peptides that affect their host's hemostasis, inflammation, and immunity. These activities can also modify the site of pathogen delivery and increase disease transmission. Saliva also induces hosts to mount an antisaliva immune response that can lead to skin allergies or even anaphylaxis. Accordingly, knowledge of the salivary repertoire, or sialome, of a mosquito is useful to provide a knowledge platform to mine for novel pharmacological activities, to develop novel vaccine targets for vector-borne diseases, and to develop epidemiological markers of vector exposure and candidate desensitization vaccines. The mosquito Ochlerotatus triseriatus is a vector of La Crosse virus and produces allergy in humans. In this work, a total of 1,575 clones randomly selected from an adult female O. triseriatus salivary gland cDNA library was sequenced and used to assemble a database that yielded 731 clusters of related sequences, 560 of which were singletons. Primer extension experiments were performed in selected clones to further extend sequence coverage, allowing for the identification of 159 protein sequences, 66 of which code for putative secreted proteins. Supplemental spreadsheets containing these data are available at http://exon.niaid.nih.gov/transcriptome/Ochlerotatus_triseriatus/S1/Ot-S1.xls and http://exon.niaid. nih.gov/transcriptome/Ochlerotatus_triseriatus/S2/Ot-S2.xls.

RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).

PubMed

Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed

2014-07-01

Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.

[Construction and characterization of liposomal magnetofection system in pig kidney cells].

PubMed

Chen, Wenjie; Cui, Haixin; Zhao, Xiang; Cui, Jinhui; Wang, Yan; Sun, Changjiao

2014-06-01

Magnetic nano gene vector is one of the non-viral gene vectors, modified by functional group to bind cationic transfect reagents. Coupling magnetofection with the universal lipofection we developed a novel somatic cell transfection method as the so-called liposomal magnetofection (LMF). This approach is potential to provide somatic cell cloning with stable genetic cell lines to cultivate transgenic animals. In order to construct such liposomal magnetic gene vectors complexes system, we used nano magnetic gene vector to combine with liposomal cationic transfect reagents by molecular self-assembly. This vectors system successfully carried exogenous gene and then transfected animal somatic cells. Here, we conducted atomic force microscopy (AFM), zeta potential-diameter analysis and other characterization experiments to investegate the size distribution and morphology of magnetic nanoparticles, the way of the vectors to load and concentrate DNA molecules. Our data reveal that, the LMF of Pig Kidney cells exhibited higher transfection efficiency comparing with the transfection mediated by the commercial lipofectamine2000. Moreover, LMF method overcomes the constraint of transient expression mediated by lipofection. Meanwhile, MTT assay showed low cytotoxicity of LMF. Hence, LMF is a feasible, low cytotoxic and effective method of cell transfection.

A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

PubMed Central

Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

2013-01-01

The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

PubMed Central

Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

1997-01-01

ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

Molecular cloning and in-silico characterization of high temperature stress responsive pAPX gene isolated from heat tolerant Indian wheat cv. Raj 3765.

PubMed

Padaria, Jasdeep Chatrath; Vishwakarma, Harinder; Biswas, Koushik; Jasrotia, Rahul Singh; Singh, Gyanendra Pratap

2014-10-10

Heat stress leads to accelerated production of reactive oxygen species (ROS) which causes a huge amount of oxidative damage to the cellular components of plants. A large number of heat stress related genes as HSPs, catalases, peroxidases are overexpressed at the time of stress. A potent stress responsive gene peroxisomal ascorbate peroxidase (TapAPX) obtained from heat stress (42 °C) responsive subtractive cDNA library from a thermo tolerant wheat cv. Raj3765 at anthesis stage was cloned, characterized and its role was validated under heat stress by proteomics and in-silico studies. In the present study we report the characterization at molecular and in-silico level of peroxisomal TapAPX gene isolated from heat tolerant wheat cultivar of India. qPCR studies of TapAPX gene displayed up to 203 fold level of expression at 42 °C heat stress exposure. A full length cDNA of 876 bp obtained by RACE deduced a protein of 292 amino acid residues which gives a complete 3D structure of pAPX by homology modeling. TapAPX cDNA was cloned in expression vector pET28 (a+) and the recombinant protein over-expressed in E. coli BL21 showed highest homology with APX protein as deduced by peptide mass fingerprinting. TapAPX gene from wheat cv Raj3765 has a distinct role in conferring thermo tolerance to the plants and thus can be used in crop improvement programmes for development of crops tolerant to high temperature.

Overproduction and partial purification of the Norrie disease gene product, norrin, from a recombinant baculovirus.

PubMed

Shastry, Barkur S; Trese, Michael T

2003-12-05

Abnormal vascularization of the peripheral retina and retinal detachment are common clinical characteristics of Norrie disease (ND), familial exudative vitreoretinopathy, Coats' disease, and retinopathy of prematurity. Although little is known about the molecular basis of these diseases, studies have shown that all of these diseases are associated with mutations in the ND gene. In spite of this, little is known about norrin, its molecular mechanism of action, and its functional relationship with the development of abnormal retinal vasculature. To obtain a large quantity of norrin for structural and functional studies, we have overproduced it in insect cells. For this purpose, a cDNA fragment (869 bp) was isolated from a human retinal cDNA library by amplification and was cloned into an expression vector. The purified plasmid was co-transfected with wild-type linearized Bac-N-Blue DNA into S. frugiperda Sf21 insect cells. The recombinant virus plaques were purified and clones were selected based on the level of recombinant protein expressed in Sf21 cells infected with a purified recombinant virus. From these, a high-titer stock was generated and subsequently used to prepare a fused protein on a large scale. The protein was partially purified by the process of immobilized metal affinity chromatography and the use of ion exchange chromatography

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, J.; Varner, J.E.

1985-07-01

Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Transgenic-cloned pigs systemically expressing red fluorescent protein, Kusabira-Orange.

PubMed

Matsunari, Hitomi; Onodera, Masafumi; Tada, Norihiro; Mochizuki, Hideki; Karasawa, Satoshi; Haruyama, Erika; Nakayama, Naoki; Saito, Hitoshi; Ueno, Satoshi; Kurome, Mayuko; Miyawaki, Atsushi; Nagashima, Hiroshi

2008-09-01

Genetically engineered pigs with cell markers such as fluorescent proteins are highly useful in lines of research that include the tracking of transplanted cells or tissues. In this study, we produced transgenic-cloned pigs carrying a gene for the newly developed red fluorescent protein, humanized Kusabira-Orange (huKO), which was cloned from the coral stone Fungia concinna. The nuclear transfer embryos, reconstructed with fetal fibroblast cells that had been transduced with huKO cDNA using retroviral vector D Delta Nsap, developed efficiently in vitro into blastocysts (28.0%, 37/132). Nearly all (94.6%, 35/37) of the cloned blastocysts derived from the transduced cells exhibited clear huKO gene expression. A total of 429 nuclear transfer embryos were transferred to four recipients, all of which became pregnant and gave birth to 18 transgenic-cloned offspring in total. All of the pigs highly expressed huKO fluorescence in all of the 23 organs and tissues analyzed, including the brain, eyes, intestinal and reproductive organs, skeletal muscle, bone, skin, and hoof. Furthermore, such expression was also confirmed by histological analyses of various tissues such as pancreatic islets, renal corpuscles, neuronal and glial cells, the retina, chondrocytes, and hematopoietic cells. These data demonstrate that transgenic-cloned pigs exhibiting systemic red fluorescence expression can be efficiently produced by nuclear transfer of somatic cells retrovirally transduced with huKO gene.

Reverse Genetics of Newcastle Disease Virus.

PubMed

Cardenas-Garcia, Stivalis; Afonso, Claudio L

2017-01-01

Reverse genetics allows for the generation of recombinant viruses or vectors used in functional studies, vaccine development, and gene therapy. This technique enables genetic manipulation and cloning of viral genomes, gene mutation through site-directed mutagenesis, along with gene insertion or deletion, among other studies. An in vitro infection-based system including the highly attenuated vaccinia virus Ankara strain expressing the T7 RNA polymerase from bacteriophage T7, with co-transfection of three helper plasmids and a full-length cDNA plasmid, was successfully developed to rescue genetically modified Newcastle disease viruses in 1999. In this chapter, the materials and the methods involved in rescuing Newcastle disease virus (NDV) from cDNA, utilizing site-directed mutagenesis and gene replacement techniques, are described in detail.

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

PubMed Central

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-01-01

AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

PubMed

Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

2003-03-01

To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

An Improved Single-Step Cloning Strategy Simplifies the Agrobacterium tumefaciens-Mediated Transformation (ATMT)-Based Gene-Disruption Method for Verticillium dahliae.

PubMed

Wang, Sheng; Xing, Haiying; Hua, Chenlei; Guo, Hui-Shan; Zhang, Jie

2016-06-01

The soilborne fungal pathogen Verticillium dahliae infects a broad range of plant species to cause severe diseases. The availability of Verticillium genome sequences has provided opportunities for large-scale investigations of individual gene function in Verticillium strains using Agrobacterium tumefaciens-mediated transformation (ATMT)-based gene-disruption strategies. Traditional ATMT vectors require multiple cloning steps and elaborate characterization procedures to achieve successful gene replacement; thus, these vectors are not suitable for high-throughput ATMT-based gene deletion. Several advancements have been made that either involve simplification of the steps required for gene-deletion vector construction or increase the efficiency of the technique for rapid recombinant characterization. However, an ATMT binary vector that is both simple and efficient is still lacking. Here, we generated a USER-ATMT dual-selection (DS) binary vector, which combines both the advantages of the USER single-step cloning technique and the efficiency of the herpes simplex virus thymidine kinase negative-selection marker. Highly efficient deletion of three different genes in V. dahliae using the USER-ATMT-DS vector enabled verification that this newly-generated vector not only facilitates the cloning process but also simplifies the subsequent identification of fungal homologous recombinants. The results suggest that the USER-ATMT-DS vector is applicable for efficient gene deletion and suitable for large-scale gene deletion in V. dahliae.

Molecular cloning, expression and purification of L-amino acid oxidase from the Malayan pit viper Calloselasma rhodostoma.

PubMed

Kommoju, Phaneeswara Rao; Macheroux, Peter; Ghisla, Sandro

2007-03-01

A cDNA encoding LAAO from the Malayan pit viper (Calloselasma rhodostoma) was cloned into an expression vector of the methylotropic yeast Pichia pastoris. The LAAO open reading frame was inserted after the alpha-MF-signal sequence. Upon induction soluble and active LAAO is produced and exported into the culture supernatant at a concentration of up to 0.4 mg/L. Recombinant LAAO was purified from this by ion exchange and molecular sieve chromatography to yield apparently homogeneous protein in quantities of approximately 0.25 mg/L growth medium. Expressed LAAO exhibits the same electrophoretic mobility as native LAAO (62 kDa) and exhibits approximately the same extent of glycosylation as authentic LAAO from snake venom. Catalytic properties and substrate specificity of recombinant LAAO are similar to those of native enzyme.

CRISPR/Cas9-Assisted Transformation-Efficient Reaction (CRATER) for Near-Perfect Selective Transformation

NASA Technical Reports Server (NTRS)

Rothschild, Lynn J.; Greenberg, Daniel T.; Takahashi, Jack R.; Thompson, Kirsten A.; Maheshwari, Akshay J.; Kent, Ryan E.; McCutcheon, Griffin; Shih, Joseph D.; Calvet, Charles; Devlin, Tyler D.;

Cloning and expression of L-asparaginase gene in Escherichia coli.

PubMed

Wang, Y; Qian, S; Meng, G; Zhang, S

2001-08-01

The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.

DNA methylation analysis on satellite I region in blastocysts obtained from somatic cell cloned cattle.

PubMed

Yamanaka, Ken-Ichi; Kaneda, Masahiro; Inaba, Yasushi; Saito, Koji; Kubota, Kaiyu; Sakatani, Miki; Sugimura, Satoshi; Imai, Kei; Watanabe, Shinya; Takahashi, Masashi

2011-08-01

Many observations have been made on cloned embryos and on adult clones by somatic cell nuclear transfer (SCNT), but it is still unclear whether the progeny of cloned animals is presenting normal epigenetic status. Here, in order to accumulate the information for evaluating the normality of cloned cattle, we analyzed the DNA methylation status on satellite I region in blastocysts obtained from cloned cattle. Embryos were produced by artificial insemination (AI) to non-cloned or cloned dams using semen from non-cloned or cloned sires. After 7 days of AI, embryos at blastocyst stage were collected by uterine flushing. The DNA methylation levels in embryos obtained by using semen and/or oocytes from cloned cattle were similar to those in in vivo embryos from non-cloned cattle. In contrast, the DNA methylation levels in SCNT embryos were significantly higher (P < 0.01) than those in in vivo embryos from non-cloned and cloned cattle, approximately similar to those in somatic cells used as donor cells. Thus, this study provides useful information that epigenetic status may be normal in the progeny of cloned cattle, suggesting the normality of germline cells in cloned cattle. 2011 The Authors. Animal Science Journal © 2011 Japanese Society of Animal Science.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

Cloning, expression and purification of a glycosylated form of the DNA-binding protein Dps from Salmonella enterica Typhimurium.

PubMed

Hanna, Ebert Seixas; Roque-Barreira, Maria-Cristina; Mendes, Guilherme Martines Teixeira; Soares, Sandro Gomes; Brocchi, Marcelo

2008-06-01

Dps, found in many eubacterial and archaebacterial species, appears to protect cells from oxidative stress and/or nutrient-limited environment. Dps has been shown to accumulate during the stationary phase, to bind to DNA non-specifically, and to form a crystalline structure that compacts and protects the chromosome. Our previous results have indicated that Dps is glycosylated at least for a certain period of the bacterial cell physiology and this glycosylation is thought to be orchestrated by some factors not yet understood, explaining our difficulties in standardizing the Dps purification process. In the present work, the open reading frame of the dps gene, together with all the upstream regulatory elements, were cloned into a PCR cloning vector. As a result, the expression of dps was also controlled by the plasmid system introduced in the bacterial cell. The gene was then over-expressed regardless of the growth phase of the culture and a glycosylated fraction was purified to homogeneity by lectin-immobilized chromatography assay. Unlike the high level expression of Dps in Salmonella cells, less than 1% of the recombinant protein was purified by affinity chromatography using jacalin column. Sequencing and mass spectrometry data confirmed the identity of the dps gene and the protein, respectively. In spite of the low level of purification of the jacalin-binding Dps, this work shall aid further investigations into the mechanism of Dps glycosylation.

Development of FQ-PCR method to determine the level of ADD1 expression in fatty and lean pigs.

PubMed

Cui, J X; Chen, W; Zeng, Y Q

2015-10-30

To determine how adipocyte determination and differentiation factor 1 (ADD1), a gene involved in the determination of pork quality, is regulated in Laiwu and Large pigs, we used TaqMan fluorescence quantitative real-time polymerase chain reaction (FQ-PCR) to detect differential expression in the longissimus muscle of Laiwu (fatty) and Large White (lean) pigs. In this study, the ADD1 and GAPDH cDNA sequences were cloned using a T-A cloning assay, and the clone sequences were consistent with those deposited in GenBank. Thus, the target fragment was successfully recombined into the vector, and its integrity was maintained. The standard curve and regression equation were established through the optimized FQ-PCR protocol. The standard curve of porcine ADD1 and GAPDH cDNA was determined, and its linear range extension could reach seven orders of magnitudes. The results showed that this method was used to quantify ADD1 expression in the longissimus muscle of two breeds of pig, and was found to be accurate, sensitive, and convenient. These results provide information regarding porcine ADD1 mRNA expression and the mechanism of adipocyte differentiation, and this study could help in the effort to meet the demands of consumers interested in the maintenance of health and prevention of obesity. Furthermore, it could lead to new approaches in the prevention and clinical treatment of this disease.

Versatile Gene-Specific Sequence Tags for Arabidopsis Functional Genomics: Transcript Profiling and Reverse Genetics Applications

PubMed Central

Hilson, Pierre; Allemeersch, Joke; Altmann, Thomas; Aubourg, Sébastien; Avon, Alexandra; Beynon, Jim; Bhalerao, Rishikesh P.; Bitton, Frédérique; Caboche, Michel; Cannoot, Bernard; Chardakov, Vasil; Cognet-Holliger, Cécile; Colot, Vincent; Crowe, Mark; Darimont, Caroline; Durinck, Steffen; Eickhoff, Holger; de Longevialle, Andéol Falcon; Farmer, Edward E.; Grant, Murray; Kuiper, Martin T.R.; Lehrach, Hans; Léon, Céline; Leyva, Antonio; Lundeberg, Joakim; Lurin, Claire; Moreau, Yves; Nietfeld, Wilfried; Paz-Ares, Javier; Reymond, Philippe; Rouzé, Pierre; Sandberg, Goran; Segura, Maria Dolores; Serizet, Carine; Tabrett, Alexandra; Taconnat, Ludivine; Thareau, Vincent; Van Hummelen, Paul; Vercruysse, Steven; Vuylsteke, Marnik; Weingartner, Magdalena; Weisbeek, Peter J.; Wirta, Valtteri; Wittink, Floyd R.A.; Zabeau, Marc; Small, Ian

2004-01-01

Microarray transcript profiling and RNA interference are two new technologies crucial for large-scale gene function studies in multicellular eukaryotes. Both rely on sequence-specific hybridization between complementary nucleic acid strands, inciting us to create a collection of gene-specific sequence tags (GSTs) representing at least 21,500 Arabidopsis genes and which are compatible with both approaches. The GSTs were carefully selected to ensure that each of them shared no significant similarity with any other region in the Arabidopsis genome. They were synthesized by PCR amplification from genomic DNA. Spotted microarrays fabricated from the GSTs show good dynamic range, specificity, and sensitivity in transcript profiling experiments. The GSTs have also been transferred to bacterial plasmid vectors via recombinational cloning protocols. These cloned GSTs constitute the ideal starting point for a variety of functional approaches, including reverse genetics. We have subcloned GSTs on a large scale into vectors designed for gene silencing in plant cells. We show that in planta expression of GST hairpin RNA results in the expected phenotypes in silenced Arabidopsis lines. These versatile GST resources provide novel and powerful tools for functional genomics. PMID:15489341

[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

PubMed

Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

2005-03-01

To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

Enhanced Tumor Growth and Invasiveness in Vivo by a Carboxyl-Terminal Fragment of α1-Proteinase Inhibitor Generated by Matrix Metalloproteinases

PubMed Central

Kataoka, Hiroaki; Uchino, Hirofumi; Iwamura, Takeshi; Seiki, Motoharu; Nabeshima, Kazuki; Koono, Masashi

1999-01-01

Matrix metalloproteinases (MMPs) are believed to contribute to the complex process of cancer progression. They also exhibit an α1-proteinase inhibitor (αPI)-degrading activity generating a carboxyl-terminal fragment of ∼5 kd (αPI-C). This study reports that overexpression of αPI-C in S2–020, a cloned subline derived from the human pancreas adenocarcinoma cell line SUIT-2, potentiates the growth capability of the cells in nude mice. After stable transfection of a vector containing a chimeric cDNA encoding a signal peptide sequence of tissue inhibitor of metalloproteinase-1 followed by cDNA for αPI-C into S2–020 cells, three clones that stably secrete αPI-C were obtained. The ectopic expression of αPI-C did not alter in vitro cellular growth. However, subcutaneous injection of the αPI-C-secreting clones resulted in tumors that were 1.5 to 3-fold larger than those of control clones with an increased tendency to invasiveness and lymph node metastasis. These effects could be a result of modulation of natural killer (NK) cell-mediated control of tumor growth in nude mice, as the growth advantage of αPI-C-secreting clones was not observed in NK-depleted mice, and αPI-C-secreting clones showed decreased NK sensitivity in vitro. In addition, production of αPI and generation of the cleaved form of αPI by MMP were observed in various human tumor cell lines and in a highly metastatic subline of SUIT-2 in vitro. These results provide experimental evidence that the αPI-degrading activity of MMPs may play a role in tumor progression not only via the inactivation of αPI but also via the generation of αPI-C. PMID:10027404

Physical mapping of complex genomes

DOEpatents

Evans, Glen A.

1993-01-01

Method for simultaneous identification of overlapping cosmid clones among multiple cosmid clones and the use of the method for mapping complex genomes are provided. A library of cosmid clones that contains the DNA to be mapped is constructed and arranged in a manner such that individual clones can be identified and replicas of the arranged clones prepared. In preferred embodiments, the clones are arranged in a two dimensional matrix. In such embodiments, the cosmid clones in a row are pooled, mixed probes complementary to the ends of the DNA inserts int he pooled clones are synthesized, hybridized to a first replica of the library. Hybridizing clones, which include the pooled row, are identified. A second portion of clones is prepared by pooling cosmid clones that correspond to a column in the matrix. The second pool thereby includes one clone from the first portion pooled clones. This common clone is located on the replica at the intersection of the column and row. Mixed probes complementary to the ends of the DNA inserts in the second pooled portion of clones are prepared and hybridized to a second replica of the library. The hybridization pattern on the first and second replicas of the library are compared and cross-hybridizing clones, other than the clones in the pooled column and row, that hybridize to identical clones in the first and second replicas are identified. These clones necessarily include DNA inserts that overlap with the DNA insert int he common clone located at the intersection of the pooled row and pooled column. The DNA in the entire library may be mapped by pooling the clones in each of the rows and columns of the matrix, preparing mixed end-specific probes and hybridizing the probes from each row or column to a replica of the library. Since all clones in the library are located at the intersection of a column and a row, the overlapping clones for all clones in the library may be identified and a physical map constructed. In other preferred embodiments, the cosmid clones are arranged in a three dimensional matrix, pooled and compared in threes according to intersecting planes of the three dimensional matrix. Arrangements corresponding to geometries of higher dimensions may also be prepared and used to simultaneously identify overlapping clones in highly complex libraries with relatively few hybridization reactions.

Influenza virus-specific TCR-transduced T cells as a model for adoptive immunotherapy

PubMed Central

Berdien, Belinda; Reinhard, Henrike; Meyer, Sabrina; Spöck, Stefanie; Kröger, Nicolaus; Atanackovic, Djordje; Fehse, Boris

2013-01-01

Adoptive transfer of T lymphocytes equipped with tumor-antigen specific T-cell receptors (TCRs) represents a promising strategy in cancer immunotherapy, but the approach remains technically demanding. Using influenza virus (Flu)-specific T-cell responses as a model system we compared different methods for the generation of T-cell clones and isolation of antigen-specific TCRs. Altogether, we generated 12 CD8+ T-cell clones reacting to the Flu matrix protein (Flu-M) and 6 CD4+ T-cell clones reacting to the Flu nucleoprotein (Flu-NP) from 4 healthy donors. IFN-γ-secretion-based enrichment of antigen-specific cells, optionally combined with tetramer staining, was the most efficient way for generating T-cell clones. In contrast, the commonly used limiting dilution approach was least efficient. TCR genes were isolated from T-cell clones and cloned into both a previously used gammaretroviral LTR-vector, MP91 and the novel lentiviral self-inactivating vector LeGO-MP that contains MP91-derived promotor and regulatory elements. To directly compare their functional efficiencies, we in parallel transduced T-cell lines and primary T cells with the two vectors encoding identical TCRs. Transduction efficiencies were approximately twice higher with the gammaretroviral vector. Secretion of high amounts of IFN-γ, IL-2 and TNF-α by transduced cells after exposure to the respective influenza target epitope proved efficient specificity transfer of the isolated TCRs to primary T-cells for both vectors, at the same time indicating superior functionality of MP91-transduced cells. In conclusion, we have developed optimized strategies to obtain and transfer antigen-specific TCRs as well as designed a novel lentiviral vector for TCR-gene transfer. Our data may help to improve adoptive T-cell therapies. PMID:23428899

Screening a wide host-range, waste-water metagenomic library in tryptophan auxotrophs of Rhizobium leguminosarum and of Escherichia coli reveals different classes of cloned trp genes.

PubMed

Li, Youguo; Wexler, Margaret; Richardson, David J; Bond, Philip L; Johnston, Andrew W B

2005-12-01

A metagenomic cosmid library was constructed, in which the insert DNA was derived from bacteria in a waste-water treatment plant and the vector was the wide host-range cosmid pLAFR3. The library was screened for clones that could correct defined tryptophan auxotrophs of the alpha-proteobacterium Rhizobium leguminosarum and of Escherichia coli. A total of 26 different cosmids that corrected at least one trp mutant in one or both of these species were obtained. Several cosmids corrected the auxotrophy of one or more R. leguminosarum trp mutants, but not the corresponding mutants in E. coli. Conversely, one cosmid corrected trpA, B, C, D and E mutants of E. coli but none of the trp mutants of R. leguminosarum. Two of the Trp+ cosmids were examined in more detail. One contained a trp operon that resembled that of the pathogen Chlamydophila caviae, containing the unusual kynU gene, which specifies kynureninase. The other, whose trp genes functioned in R. leguminosarum but not in E. coli, contained trpDCFBA in an operon that is likely co-transcribed with five other genes, most of which had no known link with tryptophan synthesis. The sequences of these TRP proteins, and the products of nine other genes encoded by this cosmid, failed to affiliate them with any known bacterial lineage. For one metagenomic cosmid, lac reporter fusions confirmed that its cloned trp genes were transcribed in R. leguminosarum, but not in E. coli. Thus, rhizobia, with their many sigma-factors, may be well-suited hosts for metagenomic libraries, cloned in wide host-range vectors.

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

PubMed

Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

2017-06-19

Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

PubMed

Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

2001-01-01

Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

MacroBac: New Technologies for Robust and Efficient Large-Scale Production of Recombinant Multiprotein Complexes.

PubMed

Gradia, Scott D; Ishida, Justin P; Tsai, Miaw-Sheue; Jeans, Chris; Tainer, John A; Fuss, Jill O

2017-01-01

Recombinant expression of large, multiprotein complexes is essential and often rate limiting for determining structural, biophysical, and biochemical properties of DNA repair, replication, transcription, and other key cellular processes. Baculovirus-infected insect cell expression systems are especially well suited for producing large, human proteins recombinantly, and multigene baculovirus systems have facilitated studies of multiprotein complexes. In this chapter, we describe a multigene baculovirus system called MacroBac that uses a Biobricks-type assembly method based on restriction and ligation (Series 11) or ligation-independent cloning (Series 438). MacroBac cloning and assembly is efficient and equally well suited for either single subcloning reactions or high-throughput cloning using 96-well plates and liquid handling robotics. MacroBac vectors are polypromoter with each gene flanked by a strong polyhedrin promoter and an SV40 poly(A) termination signal that minimize gene order expression level effects seen in many polycistronic assemblies. Large assemblies are robustly achievable, and we have successfully assembled as many as 10 genes into a single MacroBac vector. Importantly, we have observed significant increases in expression levels and quality of large, multiprotein complexes using a single, multigene, polypromoter virus rather than coinfection with multiple, single-gene viruses. Given the importance of characterizing functional complexes, we believe that MacroBac provides a critical enabling technology that may change the way that structural, biophysical, and biochemical research is done. © 2017 Elsevier Inc. All rights reserved.

MIDAS: A Modular DNA Assembly System for Synthetic Biology.

PubMed

van Dolleweerd, Craig J; Kessans, Sarah A; Van de Bittner, Kyle C; Bustamante, Leyla Y; Bundela, Rudranuj; Scott, Barry; Nicholson, Matthew J; Parker, Emily J

2018-04-20

A modular and hierarchical DNA assembly platform for synthetic biology based on Golden Gate (Type IIS restriction enzyme) cloning is described. This enabling technology, termed MIDAS (for Modular Idempotent DNA Assembly System), can be used to precisely assemble multiple DNA fragments in a single reaction using a standardized assembly design. It can be used to build genes from libraries of sequence-verified, reusable parts and to assemble multiple genes in a single vector, with full user control over gene order and orientation, as well as control of the direction of growth (polarity) of the multigene assembly, a feature that allows genes to be nested between other genes or genetic elements. We describe the detailed design and use of MIDAS, exemplified by the reconstruction, in the filamentous fungus Penicillium paxilli, of the metabolic pathway for production of paspaline and paxilline, key intermediates in the biosynthesis of a range of indole diterpenes-a class of secondary metabolites produced by several species of filamentous fungi. MIDAS was used to efficiently assemble a 25.2 kb plasmid from 21 different modules (seven genes, each composed of three basic parts). By using a parts library-based system for construction of complex assemblies, and a unique set of vectors, MIDAS can provide a flexible route to assembling tailored combinations of genes and other genetic elements, thereby supporting synthetic biology applications in a wide range of expression hosts.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Nucleic acid probes as a diagnostic method for tick-borne hemoparasites of veterinary importance.

PubMed

Figueroa, J V; Buening, G M

1995-03-01

An increased number of articles on the use of nucleic acid-based hybridization techniques for diagnostic purposes have been recently published. This article reviews nucleic acid-based hybridization as an assay to detect hemoparasite infections of economic relevance in veterinary medicine. By using recombinant DNA techniques, selected clones containing inserts of Anaplasma, Babesia, Cowdria or Theileria genomic DNA sequences have been obtained, and they are now available to be utilized as specific, highly sensitive DNA or RNA probes to detect the presence of the hemoparasite DNA in an infected animal. Either in an isotopic or non-isotopic detection system, probes have allowed scientists to test for--originally in samples collected from experimentally infected animals and later in samples collected in the field--the presence of hemoparasites during the prepatent, patent, convalescent, and chronic periods of the infection in the host. Nucleic acid probes have given researchers the opportunity to carry out genomic analysis of parasite DNA to differentiate hemoparasite species and to identify genetically distinct populations among and within isolates, strains and clonal populations. Prevalence of parasite infection in the tick vector can now be accomplished more specifically with the nucleic acid probes. Lately, with the advent of the polymerase chain reaction technique, small numbers of hemoparasites can be positively identified in the vertebrate host and tick vector. These techniques can be used to assess the veterinary epidemiological situation in a particular geographical region for the planning of control measures.

Use of lambdagt11 to isolate genes for two pseudorabies virus glycoproteins with homology to herpes simplex virus and varicella-zoster virus glycoproteins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrovskis, E.A.; Timmins, J.G.; Post, L.E.

1986-10-01

A library of pseudorabies virus (PRV) DNA fragments was constructed in the expression cloning vector lambdagt11. The library was screened with antisera which reacted with mixtures of PRV proteins to isolate recombinant bacteriophages expressing PRV proteins. By the nature of the lambdagt11 vector, the cloned proteins were expressed in Escherichia coli as ..beta..-galactosidase fusion proteins. The fusion proteins from 35 of these phages were purified and injected into mice to raise antisera. The antisera were screened by several different assays, including immunoprecipitation of (/sup 14/C)glucosamine-labeled PRV proteins. This method identified phages expressing three different PRV glycoproteins: the secreted glycoprotein, gX;more » gI; and a glycoprotein that had not been previously identified, which we designate gp63. The gp63 and gI genes map adjacent to each other in the small unique region of the PRV genome. The DNA sequence was determined for the region of the genome encoding gp63 and gI. It was found that gp63 has a region of homology with a herpes simplex virus type 1 (HSV-1) protein, encoded by US7, and also with varicella-zoster virus (VZV) gpIV. The gI protein sequence has a region of homology with HSV-1 gE and VZV gpI. It is concluded that PRV, HSV, and VZV all have a cluster of homologous glycoprotein genes in the small unique components of their genomes and that the organization of these genes is conserved.« less

Anti-tumor function of double-promoter regulated adenovirus carrying SEA gene, in the treatment of bladder cancer.

PubMed

Hu, Jianpeng; Xuan, Xujun; Han, Conghui; Hao, Lin; Zhang, Peiying; Chen, Meng; He, Houguang; Fan, Tao; Dong, Binzheng

2012-03-01

To construct an adenovirus carrying SEA gene and regulated by telomerase reverse transcriptase (hTERT) and hypoxia-inducible factor (HIF) promoters and investigate its anti-tumor function in vitro, as well as its role in lymphocyte production. hTERT and HIF genes were cloned into adenovirus E1A and E1B shuttle plasmids. The control vector for SEA gene expression is under the regulation of CMV and SV40 promoters. Double regulation was obtained through homologous recombination. The positive clones of replicable adenovirus H2-SEA-Ad were selected by plaque assay. The adenovirus was purified, titrated, and DNA was verified by PCR. The obtained virus was used to infect EJ bladder tumor cells and the SEA Mrna, and protein expression was measured by RT-PCR, western blot, and immunofluorescence microscopy, respectively. Co-culture of lymphocytes and tumor cells was observed dynamically under microscope. The construction of shuttle plasmid p315-CSS-SEA was confirmed by PCR and DNA sequencing. Insertion of superantigen SEA gene in adenovirus (H2-SEA-Ad.SEA) was obtained by homologous recombination. In lymphocytes and tumor cell co-culture, the number of viable tumor cells in test groups was significantly lower than that in control group after 12, 24, and 48 h of treatment. Production of interleukin-2, interleukin-4, and tumor necrosis factor were higher in test groups than in control group. Expression of SEA gene in bladder tumor cells by adenoviral vector caused reduced tumor cell proliferation, as well as stimulation of inflammatory cytokine productions in co-cultures with lymphocytes.

Development of DNA probes for Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheung, L.L.; Hudson, J.B.

1988-07-01

An attempt was made to produce DNA probes that could be used as a rapid and efficient means of detecting candidiasis (invasive Candida infection) in immunocompromised patients. Whole DNA from Candida albicans was digested with restriction endonuclease, and the resulting fragments were randomly cloned into a plasmid vector. Several recombinant plasmids were evaluated for cross-hybridization to various other Candida species, other fungal DNAs, and to nonfungal DNAs. Cross reactions were observed between the probes and different yeasts, but none with unrelated DNAs. Some recombinants were genus-specific, and two of these were applied to the analysis of C. albicans growth curves.more » It became evident that, although both /sup 32/P- and biotin-labelled probes could be made quite sensitive, a possible limitation in their diagnostic potential was the poor liberation of Candida DNA from cells. Thus, better methods of treatment of clinical specimens will be required before such probes will be useful in routine diagnosis.« less

Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

PubMed

Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

2013-10-01

Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

A phytoplasma closely related to the pigeon pea witches'-broom phytoplasma (16Sr IX) is associated with citrus huanglongbing symptoms in the state of São Paulo, Brazil.

PubMed

Teixeira, D C; Wulff, N A; Martins, E C; Kitajima, E W; Bassanezi, R; Ayres, A J; Eveillard, S; Saillard, C; Bové, J M

2008-09-01

In February 2007, sweet orange trees with characteristic symptoms of huanglongbing (HLB) were encountered in a region of São Paulo state (SPs) hitherto free of HLB. These trees tested negative for the three liberibacter species associated with HLB. A polymerase chain reaction (PCR) product from symptomatic fruit columella DNA amplifications with universal primers fD1/rP1 was cloned and sequenced. The corresponding agent was found to have highest 16S rDNA sequence identity (99%) with the pigeon pea witches'-broom phytoplasma of group 16Sr IX. Sequences of PCR products obtained with phytoplasma 16S rDNA primer pairs fU5/rU3, fU5/P7 confirm these results. With two primers D7f2/D7r2 designed based on the 16S rDNA sequence of the cloned DNA fragment, positive amplifications were obtained from more than one hundred samples including symptomatic fruits and blotchy mottle leaves. Samples positive for phytoplasmas were negative for liberibacters, except for four samples, which were positive for both the phytoplasma and 'Candidatus Liberibacter asiaticus'. The phytoplasma was detected by electron microscopy in the sieve tubes of midribs from symptomatic leaves. These results show that a phytoplasma of group IX is associated with citrus HLB symptoms in northern, central, and southern SPs. This phytoplasma has very probably been transmitted to citrus from an external source of inoculum, but the putative insect vector is not yet known.

DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

PubMed

Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

2005-09-01

Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

PubMed Central

Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

1985-01-01

The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

PubMed

Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

1991-08-01

Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

Identification of human antibody fragment clones specific for tetanus toxoid in a bacteriophage. lambda. immunoexpression library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mullinax, R.L.; Gross, E.A.; Amberg, J.R.

1990-10-01

The authors have applied a molecular biology approach to the identification of human monoclonal antibodies. Human peripheral blood lymphocyte mRNA was converted to cDNA and a select subset was amplified by the polymerase chain reaction. These products, containing coding sequences for numerous immunoglobulin heavy- and {kappa} light-chain variable and constant region domains, were inserted into modified bacteriophase {lambda} expression vectors and introduced into Escherichia coli by infection to yield a combinatorial immunoexpression library. Clones with binding activity to tetanus toxoid were identified by filter hybridization with radiolabeled antigen and appeared at a frequency of 0.2{percent} in the library. These humanmore » antigen binding fragments, consisting of a heavy-chain fragment covalently linked to a light chain, displayed high affinity of binding to tetanus toxoid with equilibrium constants in the nanomolar range but did not cross-react with other proteins tested. They estimate that this human immunoexpression library contains 20,000 clones with high affinity and specificity to our chosen antigen.« less

Identification, cloning and sequencing of Escherichia coli strain chi1378 (O78:K80) iss gene isolated from poultry colibacillosis in Iran.

PubMed

Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V

2009-09-01

To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.

The cell wall and cell division gene cluster in the Mra operon of Pseudomonas aeruginosa: cloning, production, and purification of active enzymes.

PubMed

Azzolina, B A; Yuan, X; Anderson, M S; El-Sherbeini, M

2001-04-01

We have cloned the Pseudomonas aeruginosa cell wall biosynthesis and cell division gene cluster that corresponds to the mra operon in the 2-min region of the Escherichia coli chromosome. The organization of the two chromosomal regions in P. aeruginosa and E. coli is remarkably similar with the following gene order: pbp3/pbpB, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, and envA/LpxC. All of the above P. aeruginosa genes are transcribed from the same strand of DNA with very small, if any, intragenic regions, indicating that these genes may constitute a single operon. All five amino acid ligases, MurC, MurD, MurE, MurF, and DdlB, in addition to MurG and MraY were cloned in expression vectors. The four recombinant P. aeruginosa Mur ligases, MurC, MurD, MurE, and MurF were overproduced in E. coli and purified as active enzymes. Copyright 2001 Academic Press.

DNA book.

PubMed

Kawai, Jun; Hayashizaki, Yoshihide

2003-06-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%-100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Fidelity of DNA Replication in Normal and Malignant Human Breast Cells.

DTIC Science & Technology

1997-08-01

enzyme) into the multiple cloning site (MCS). This template will not only replicate inside a mammalian cell (utilizing the E-B virus origin), and...Maniatis, T. Commonly used techniques in molecular cloning . In: Molecular cloning : REFERENCES a laboratory manual, 2nd edition. Cold Spring Harbor...A vatit"Y Of DNA synthesis and the typt of DNA replica~tion Products " celular prca including DNA rsplicatlon. DNA repsair. R~NA formed in experiments

An integrated vector system for cellular studies of phage display-derived peptides.

PubMed

Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

2002-09-15

Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

[Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

PubMed

Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

2016-06-01

Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

Improving a Synechocystis-based photoautotrophic chassis through systematic genome mapping and validation of neutral sites

PubMed Central

Pinto, Filipe; Pacheco, Catarina C.; Oliveira, Paulo; Montagud, Arnau; Landels, Andrew; Couto, Narciso; Wright, Phillip C.; Urchueguía, Javier F.; Tamagnini, Paula

2015-01-01

The use of microorganisms as cell factories frequently requires extensive molecular manipulation. Therefore, the identification of genomic neutral sites for the stable integration of ectopic DNA is required to ensure a successful outcome. Here we describe the genome mapping and validation of five neutral sites in the chromosome of Synechocystis sp. PCC 6803, foreseeing the use of this cyanobacterium as a photoautotrophic chassis. To evaluate the neutrality of these loci, insertion/deletion mutants were produced, and to assess their functionality, a synthetic green fluorescent reporter module was introduced. The constructed integrative vectors include a BioBrick-compatible multiple cloning site insulated by transcription terminators, constituting robust cloning interfaces for synthetic biology approaches. Moreover, Synechocystis mutants (chassis) ready to receive purpose-built synthetic modules/circuits are also available. This work presents a systematic approach to map and validate chromosomal neutral sites in cyanobacteria, and that can be extended to other organisms. PMID:26490728

Molecular cloning, recombinant expression, and antifungal functional characterization of the lipid transfer protein from Panax ginseng.

PubMed

Cai, Kexin; Wang, Jiawen; Wang, Min; Zhang, Hui; Wang, Siming; Zhao, Yu

2016-07-01

To establish an efficient expression system for a fusion protein GST-pgLTP (Lipid Transfer Protein) and to test its antifungal activity. The nucleotide sequence of LTP gene was obtained from Panax ginseng using RT-PCR. The ORF of the cDNA is 363 bp, codING for a protein OF 120 amino acids with a calculated MW of 12.09 kDa. The pgLTP gene with a His6-tag at the C-terminus was cloned into the pGEX-6p1 vector to generate a GST-fusion pgLTP protein construct that was expressed in Escherichia coli Rosetta. Following purification by Ni-NTA, the fusion protein exhibited antifungal activity against five fungi found in ginseng. The fusion protein GST-pgLTP has activity against a broad spectrum of phytopathogenic fungi, and can potentially be adapted for production to combat fungal diseases that affect P. ginseng.

Gene trap and gene inversion methods for conditional gene inactivation in the mouse

PubMed Central

Xin, Hong-Bo; Deng, Ke-Yu; Shui, Bo; Qu, Shimian; Sun, Qi; Lee, Jane; Greene, Kai Su; Wilson, Jason; Yu, Ying; Feldman, Morris; Kotlikoff, Michael I.

2005-01-01

Conditional inactivation of individual genes in mice using site-specific recombinases is an extremely powerful method for determining the complex roles of mammalian genes in developmental and tissue-specific contexts, a major goal of post-genomic research. However, the process of generating mice with recombinase recognition sequences placed at specific locations within a gene, while maintaining a functional allele, is time consuming, expensive and technically challenging. We describe a system that combines gene trap and site-specific DNA inversion to generate mouse embryonic stem (ES) cell clones for the rapid production of conditional knockout mice, and the use of this system in an initial gene trap screen. Gene trapping should allow the selection of thousands of ES cell clones with defined insertions that can be used to generate conditional knockout mice, thereby providing extensive parallelism that eliminates the time-consuming steps of targeting vector construction and homologous recombination for each gene. PMID:15659575

Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lima, Cassia A.; Sasaki, Sergio D.; Tanaka, Aparecida S.

2006-08-18

The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. DQ066227). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M{sub r} of 11kDa. Bmcystatin gene was cloned in pET 26b vector andmore » the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K{sub i} value of 0.1 and 0.6nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.« less

Bmcystatin, a cysteine proteinase inhibitor characterized from the tick Boophilus microplus.

PubMed

Lima, Cassia A; Sasaki, Sergio D; Tanaka, Aparecida S

2006-08-18

The bovine tick Rhipicephalus (Boophilus) microplus is a blood-sucking animal, which is responsible for Babesia spp and Anaplasma marginale transmission for cattle. From a B. microplus fat body cDNA library, 465 selected clones were sequenced randomly and resulted in 60 Contigs. An open reading frame (ORF) contains 98 amino acids named Bmcystatin, due to 70% amino acid identity to a classical type 1 cystatin from Ixodes scapularis tick (GenBank Accession No. ). The Bmcystatin amino acid sequence analysis showed two cysteine residues, theoretical pI of 5.92 and M(r) of 11 kDa. Bmcystatin gene was cloned in pET 26b vector and the protein expressed using bacteria Escherichia coli BL21 SI. Recombinant Bmcystatin (rBmcystatin) purified by affinity chromatography on Ni-NTA-agarose column and ionic exchange chromatography on HiTrap Q column presented molecular mass of 11 kDa, by SDS-PAGE and the N-terminal amino acid sequenced revealed unprocessed N-terminal containing part of pelB signal sequence. Purified rBmcystatin showed to be a C1 cysteine peptidase inhibitor with K(i) value of 0.1 and 0.6 nM for human cathepsin L and VTDCE (vitellin degrading cysteine endopeptidase), respectively. The rBmcystatin expression analyzed by semi-quantitative RT-PCR confirmed the amplification of a specific DNA sequence (294 bp) in the fat body and ovary cDNA preparation. On the other hand, a protein band was detected in the fat body, ovary, and the salivary gland extracts using anti-Bmcystatin antibody by Western blot. The present results suggest a possible role of Bmcystatin in the ovary, even though the gene was cloned from the fat body, which could be another site of this protein synthesis.

The LE1 Bacteriophage Replicates as a Plasmid within Leptospira biflexa: Construction of an L. biflexa-Escherichia coli Shuttle Vector

PubMed Central

Girons, Isabelle Saint; Bourhy, Pascale; Ottone, Catherine; Picardeau, Mathieu; Yelton, David; Hendrix, Roger W.; Glaser, Philippe; Charon, Nyles

2000-01-01

We have discovered that LE1, one of the plaque-forming phages previously described as lytic for the Leptospira biflexa saprophytic spirochete (I. Saint Girons, D. Margarita, P. Amouriaux, and G. Baranton, Res. Microbiol. 141:1131–1138, 1990), was indeed temperate. LE1 was found to be unusual, as Southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. The unavailability of such small endogenous replicons has hindered genetic experimentation in Leptospira. We have developed a shuttle vector with DNA derived from LE1. Random LE1 DNA fragments were cloned into a pGEM 7Zf(+) derivative devoid of most of the bla gene but carrying a kanamycin resistance marker from the gram-positive bacterium Enterococcus (Streptococcus) faecalis. These constructs were transformed into L. biflexa strain Patoc 1 by electroporation, giving rise to kanamycin-resistant transformants. A 2.2-kb fragment from LE1 was responsible for replication of the vector in L. biflexa. However, a larger region including an intact parA gene homologue was necessary for the stability of the shuttle vector. Direct repeats and AT-rich regions characterized the LE1 origin of replication. Our data indicate that the replicon derived from the LE1 leptophage, together with the kanamycin resistance gene, is a promising tool with which to develop the genetics of Leptospira species. PMID:11004167

Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.

PubMed

Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

2013-07-01

Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

Vaccination with Lentiviral Vector Expressing the nfa1 Gene Confers a Protective Immune Response to Mice Infected with Naegleria fowleri

PubMed Central

Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun

2013-01-01

Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321

Amplification of the groESL operon in Pseudomonas putida increases siderophore gene promoter activity.

PubMed

Venturi, V; Wolfs, K; Leong, J; Weisbeek, P J

1994-10-17

Pseudobactin 358 is the yellow-green fluorescent siderophore [microbial iron(III) transport agent] produced by Pseudomonas putida WCS358 under iron-limiting conditions. The genes encoding pseudobactin 358 biosynthesis are iron-regulated at the level of transcription. In this study, the molecular characterization is reported of a cosmid clone of WCS358 DNA that can stimulate, in an iron-dependent manner, the activity of a WCS358 siderophore gene promoter in the heterologous Pseudomonas strain A225. The functional region in the clone was identified by subcloning, transposon mutagenesis and DNA sequencing as the groESL operon of strain WCS358. This increase in promoter activity was not observed when the groESL genes of strain WCS358 were integrated via a transposon vector into the genome of Pseudomonas A225, indicating that multiple copies of the operon are necessary for the increase in siderophore gene promoter activity. Amplification of the Escherichia coli and WCS358 groESL genes also increased iron-regulated promoter activity in the parent strain WCS358. The groESL operon codes for the chaperone proteins GroES and GroEL, which are responsible for mediating the folding and assembly of many proteins.

Enhanced immune response to a dual-promoter anti-caries DNA vaccine orally delivered by attenuated Salmonella typhimurium.

PubMed

Jiang, Hao; Hu, Yijun; Yang, Mei; Liu, Hao; Jiang, Guangshui

2017-05-01

The strength of immune responses induced by DNA vaccine is closely associated with the expression level of cloned antigens available to the antigen presenting cells (APCs). To acquire a larger and more persistent amount of antigen, a dual-promoter, which could double the target antigen output through its expression both in prokaryotic and eukaryotic cells, was employed in the constructed anti-caries DNA vaccine with attenuated Salmonella as mucosal delivery vector in this study. Here, both CMV and nirB promoters were included in the plasmid that harbors the genes encoding the functional epitopes of two virulence factors of S. mutans, i.e. the saliva-binding region (SBR) of PAc and the glucan-binding region (GBR) of glucosyltransferase-I (GTF-I). Delivered by attenuated Salmonella Typhimurium strain SL3261, the anti-caries vaccine was administered intragastrointestinally to BALB/c mice for evaluation of the effectiveness of this immune regime. Specific anti-SBR and anti-GBR antibodies were detected in the serum and saliva of experimental animals by week 3 after immunization. These immune responses were further enhanced after a booster vaccination at week 16. However, in mice receiving Salmonella expressing SBR and GBR under the control of nirB alone these antibody responses were significantly (P<0.01) lower. The serum IgG subclass profiles suggested a Th1/Th2-mixed but Th2 biased immune response to the cloned antigens, which was further confirmed by a significant increase in the Th1 (IFN-γ, IL-2) and Th2 (IL-4, IL-10) cytokines in splenocytes of immunized mice upon stimulation with SBR or GBR. To further determine the protective efficacy of these responses, a challenge test with S. mutans strain UA159 was performed in mice after the second immunization. Following challenge, mice immunized with Salmonella expressing SBR and GBR under the control of the CMV-nirB promoter showed a significant (P<0.01) reduction in the number of S. mutans in the dental plaque compared to the empty vector-immunized or unimmunized mice, and the reduction was also significant at weeks 3-8 (P<0.05) post-challenge when compared with those receiving Salmonella clones with nirB promoter alone. These results provide evidence for the effectiveness of a dual-promoter strategy in the anti-caries DNA vaccine when employing attenuated Salmonella as delivering vehicle for mucosal immunization. Copyright © 2017 Elsevier GmbH. All rights reserved.

Infectious Maize rayado fino virus from cloned cDNA

USDA-ARS?s Scientific Manuscript database

Maize rayado fino virus (MRFV) is the type member of the marafiviruses within the family Tymoviridae. A cDNA clone from which infectious RNA can be transcribed was produced from a US isolate of MRFV (MRFV-US). Infectivity of transcripts derived from cDNA clones was demonstrated by infection of mai...

A cell clone strain from Mythimna separata (Lepidoptera: Noctuidae) highly susceptible to Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata NPV (MsNPV).

PubMed

Meng, Xiang-Qian; Zheng, Gui-Ling; Zhao, Chuan-De; Wan, Fang-Hao; Li, Chang-You

2017-08-01

In this study, we describe a cell line, Ms-10C, cloned from the line QAU-Ms-E-10 (simplified Ms-10), an embryonic line from Mythimna separata. The cloned cell line was significantly more sensitive to nucleopolyhedrovirus (NPV). Ms-10C cells were mainly spherical with a diameter of 14.42 ± 2.23 μm. DNA amplification fingerprinting (DAF) confirmed the profile of PCR-amplified bands of the cloned cell line was consistent with those of the parental cell line, Ms-10. The sequencing result of the mitochondrial cytochrome c oxidase I (mtCO I) fragment confirmed that the amplified 636-bps mtCOI fragment was 100% identical to that of M. separata. Its chromosomes exhibited the typical characters of lepidopteran cell lines. Its population doubling time was 42.2 h at 27°C. Ms-10C was more sensitive than Ms-10 to both Autographa californica multiple nucleopolyhedrovirus (AcMNPV) and M. separata nucleopolyhedrovirus (MsNPV). At 4 d post infection, the infection rates of two viruses reached 94.2 and 92.3%, respectively. The availability of this cell clone strain will provide a useful tool for the basic research on nucleopolyhedrovirus and for potential application in expression of recombinant proteins with baculovirus expression vector system.

[Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

PubMed

Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

2015-07-01

To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Hunting, Swimming, and Worshiping: Human Cultural Practices Illuminate the Blood Meal Sources of Cave Dwelling Chagas Vectors (Triatoma dimidiata) in Guatemala and Belize

PubMed Central

Stevens, Lori; Monroy, M. Carlota; Rodas, Antonieta Guadalupe; Dorn, Patricia L.

2014-01-01

Background Triatoma dimidiata, currently the major Central American vector of Trypanosoma cruzi, the parasite that causes Chagas disease, inhabits caves throughout the region. This research investigates the possibility that cave dwelling T. dimidiata might transmit the parasite to humans and links the blood meal sources of cave vectors to cultural practices that differ among locations. Methodology/Principal Findings We determined the blood meal sources of twenty-four T. dimidiata collected from two locations in Guatemala and one in Belize where human interactions with the caves differ. Blood meal sources were determined by cloning and sequencing PCR products amplified from DNA extracted from the vector abdomen using primers specific for the vertebrate 12S mitochondrial gene. The blood meal sources were inferred by ≥99% identity with published sequences. We found 70% of cave-collected T. dimidiata positive for human DNA. The vectors had fed on 10 additional vertebrates with a variety of relationships to humans, including companion animal (dog), food animals (pig, sheep/goat), wild animals (duck, two bat, two opossum species) and commensal animals (mouse, rat). Vectors from all locations fed on humans and commensal animals. The blood meal sources differ among locations, as well as the likelihood of feeding on dog and food animals. Vectors from one location were tested for T. cruzi infection, and 30% (3/10) tested positive, including two positive for human blood meals. Conclusions/Significance Cave dwelling Chagas disease vectors feed on humans and commensal animals as well as dog, food animals and wild animals. Blood meal sources were related to human uses of the caves. We caution that just as T. dimidiata in caves may pose an epidemiological risk, there may be other situations where risk is thought to be minimal, but is not. PMID:25211347

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

Molecular cloning, expression and immunological properties of LiD1, a protein from the dermonecrotic family of Loxosceles intermedia spider venom.

PubMed

Kalapothakis, Evanguedes; Araujo, Simone Costa; de Castro, Cibele Soares; Mendes, Thais Melo; Gomez, Marcus Vinícius; Mangili, Oldemir C; Gubert, Ida C; Chávez-Olórtegui, Carlos

2002-12-01

The present report describes the identification and molecular characterization of LiD1, a protein expressed in the venom gland of the brown spider Loxosceles intermedia. LiD1 belongs to a family of proteins with dermonecrotic activity and members of this family have been found in spiders from the genus Loxosceles. The necrotic lesions caused by this group of proteins may lead to serious socio-economic problems such as surgical tissue reconstitution and even patient death. LiD1 was cloned using a cDNA library constructed from the venom gland of L. intermedia and antibodies against proteins with dermonecrotic activity isolated from the crude venom of this spider. The amino acid sequence deduced from the cDNA revealed a mature protein of approximately 31 kDa, with a pI of 7.37. The cDNA also revealed the existence of a signal peptide, a propeptide and also an untranslated 3' region with 218 nucleotides. LiD1 was expressed as a protein fused with beta-galactoside protein using the vector pBK-CMV, resulting in the recombinant protein recLiD1 with important immunological properties. recLiD1 was strongly recognised by anti-dermonecrotic antibodies and was also able to generate reactive antibodies against native dermonecrotic proteins isolated from the venom of L. intermedia.

Methylotroph cloning vehicle

DOEpatents

Hanson, Richard S.; Allen, Larry N.

1989-04-25

A cloning vehicle comprising: a replication determinant effective for replicating the vehicle in a non-C.sub.1 -utilizing host and in a C.sub.1 -utilizing host; DNA effective to allow the vehicle to be mobilized from the non-C.sub.1 -utilizing host to the C.sub.1 -utilizing host; DNA providing resistance to two antibiotics to which the wild-type C.sub.1 -utilizing host is susceptible, each of the antibiotic resistance markers having a recognition site for a restriction endonuclease; a cos site; and a means for preventing replication in the C.sub.1 -utilizing host. The vehicle is used for complementation mapping as follows. DNA comprising a gene from the C.sub.1 -utilizing organism is inserted at the restriction nuclease recognition site, inactivating the antibiotic resistance marker at that site. The vehicle can then be used to form a cosmid structure to infect the non-C.sub.1 -utilizing (e.g., E. coli) host, and then conjugated with a selected C.sub.1 -utilizing mutant. Resistance to the other antibiotic by the mutant is a marker of the conjugation. Other phenotypical changes in the mutant, e.g., loss of an auxotrophic trait, is attributed to the C.sub.1 gene. The vector is also used to inactivate genes whose protein products catalyze side reactions that divert compounds from a biosynthetic pathway to a desired product, thereby producing an organism that makes the desired product in higher yields.

Studies of the effects of Vilon and Epithalon on gene expression in mouse heart using DNA-microarray technology.

PubMed

Anisimov, S V; Bokheler, K R; Khavinson, V Kh; Anisimov, V N

2002-03-01

Expression of 15,247 clones from a cDNA library in the heart of mice receiving Vilon and Epithalon was studied by DNA-microarray technology. We revealed 300 clones (1.94% of the total count), whose expression changed more than by 2 times. Vilon changed expression of 36 clones, while Epithalon modulated expression of 98 clones. Combined treatment with Vilon and Epithalon changed expression of 144 clones. Vilon alone or in combination with Epithalon activated expression of 157 clones (maximally by 6.13 times) and inhibited expression of 23 clones (maximally by 2.79 times). Epithalon alone or in combination with Vilon activated expression of 194 clones (maximally by 6.61 times) and inhibited expression of 48 clones (maximally by 2.71 times). Our results demonstrate the specific effects of Epithalon and Vilon on gene expression.

Transformation of apple (Malus × domestica) using mutants of apple acetolactate synthase as a selectable marker and analysis of the T-DNA integration sites.

PubMed

Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P

2013-05-01

Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-11-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.

Exon trapping: a genetic screen to identify candidate transcribed sequences in cloned mammalian genomic DNA.

PubMed Central

Duyk, G M; Kim, S W; Myers, R M; Cox, D R

1990-01-01

Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475

DNA cloning: A personal view after 40 years

PubMed Central

Cohen, Stanley N.

2013-01-01

In November 1973, my colleagues A. C. Y. Chang, H. W. Boyer, R. B. Helling, and I reported in PNAS that individual genes can be cloned and isolated by enzymatically cleaving DNA molecules into fragments, linking the fragments to an autonomously replicating plasmid, and introducing the resulting recombinant DNA molecules into bacteria. A few months later, Chang and I reported that genes from unrelated bacterial species can be combined and propagated using the same approach and that interspecies recombinant DNA molecules can produce a biologically functional protein in a foreign host. Soon afterward, Boyer’s laboratory and mine published our collaborative discovery that even genes from animal cells can be cloned in bacteria. These three PNAS papers quickly led to the use of DNA cloning methods in multiple areas of the biological and chemical sciences. They also resulted in a highly public controversy about the potential hazards of laboratory manipulation of genetic material, a decision by Stanford University and the University of California to seek patents on the technology that Boyer and I had invented, and the application of DNA cloning methods for commercial purposes. In the 40 years that have passed since publication of our findings, use of DNA cloning has produced insights about the workings of genes and cells in health and disease and has altered the nature of the biotechnology and biopharmaceutical industries. Here, I provide a personal perspective of the events that led to, and followed, our report of DNA cloning. PMID:24043817

Generation of selectable marker-free transgenic eggplant resistant to Alternaria solani using the R/RS site-specific recombination system.

PubMed

Darwish, Nader Ahmed; Khan, Raham Sher; Ntui, Valentine Otang; Nakamura, Ikuo; Mii, Masahiro

2014-03-01

Marker-free transgenic eggplants, exhibiting enhanced resistance to Alternaria solani , can be generated on plant growth regulators (PGRs)- and antibiotic-free MS medium employing the multi-auto-transformation (MAT) vector, pMAT21 - wasabi defensin , wherein isopentenyl transferase ( ipt ) gene is used as a positive selection marker. Use of the selection marker genes conferring antibiotic or herbicide resistance in transgenic plants has been considered a serious problem for environment and the public. Multi-auto-transformation (MAT) vector system has been one of the tools to excise the selection marker gene and produce marker-free transgenic plants. Ipt gene was used as a selection marker gene. Wasabi defensin gene, isolated from Wasabia japonica (a Japanese horseradish which has been a potential source of antimicrobial proteins), was used as a gene of interest. Wasabi defensin gene was cloned from the binary vector, pEKH-WD, to an ipt-type MAT vector, pMAT21, by gateway cloning technology and transferred to Agrobacterium tumefaciens strain EHA105. Infected cotyledon explants of eggplant were cultured on PGRs- and antibiotic-free MS medium. Extreme shooty phenotype/ipt shoots were produced by the explants infected with the pMAT21-wasabi defensin (WD). The same PGRs- and antibiotic-free MS medium was used in subcultures of the ipt shoots. Subsequently, morphologically normal shoots emerged from the Ipt shoots. Molecular analyses of genomic DNA from transgenic plants confirmed the integration of the WD gene and excision of the selection marker (ipt gene). Expression of the WD gene was confirmed by RT-PCR and Northern blot analyses. In vitro whole plant and detached leaf assay of the marker-free transgenic plants exhibited enhanced resistance against Alternaria solani.

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

EPA Science Inventory

The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

Survival of Skin Graft between Transgenic Cloned Dogs and Non-Transgenic Cloned Dogs

PubMed Central

Kim, Geon A; Oh, Hyun Ju; Kim, Min Jung; Jo, Young Kwang; Choi, Jin; Park, Jung Eun; Park, Eun Jung; Lim, Sang Hyun; Yoon, Byung Il; Kang, Sung Keun; Jang, Goo; Lee, Byeong Chun

2014-01-01

Whereas it has been assumed that genetically modified tissues or cells derived from somatic cell nuclear transfer (SCNT) should be accepted by a host of the same species, their immune compatibility has not been extensively explored. To identify acceptance of SCNT-derived cells or tissues, skin grafts were performed between cloned dogs that were identical except for their mitochondrial DNA (mtDNA) haplotypes and foreign gene. We showed here that differences in mtDNA haplotypes and genetic modification did not elicit immune responses in these dogs: 1) skin tissues from genetically-modified cloned dogs were successfully transplanted into genetically-modified cloned dogs with different mtDNA haplotype under three successive grafts over 63 days; and 2) non-transgenic cloned tissues were accepted into transgenic cloned syngeneic recipients with different mtDNA haplotypes and vice versa under two successive grafts over 63 days. In addition, expression of the inserted gene was maintained, being functional without eliciting graft rejection. In conclusion, these results show that transplanting genetically-modified tissues into normal, syngeneic or genetically-modified recipient dogs with different mtDNA haplotypes do not elicit skin graft rejection or affect expression of the inserted gene. Therefore, therapeutically valuable tissue derived from SCNT with genetic modification might be used safely in clinical applications for patients with diseased tissues. PMID:25372489

Nuclear transfer to prevent mitochondrial DNA disorders: revisiting the debate on reproductive cloning.

PubMed

Bredenoord, A L; Dondorp, W; Pennings, G; De Wert, G

2011-02-01

Preclinical experiments are currently performed to examine the feasibility of several types of nuclear transfer to prevent mitochondrial DNA (mtDNA) disorders. Whereas the two most promising types of nuclear transfer to prevent mtDNA disorders, spindle transfer and pronuclear transfer, do not amount to reproductive cloning, one theoretical variant, blastomere transfer does. This seems the most challenging both technically and ethically. It is prohibited by many jurisdictions and also the scientific community seems to avoid it. Nevertheless, this paper examines the moral acceptability of blastomere transfer as a method to prevent mtDNA disorders. The reason for doing so is that most objections against reproductive cloning refer to reproductive adult cloning, while blastomere transfer would amount to reproductive embryo cloning. After clarifying this conceptual difference, this paper examines whether the main non-safety objections brought forward against reproductive cloning also apply in the context of blastomere transfer. The conclusion is that if this variant were to become safe and effective, dismissing it because it would involve reproductive cloning is unjustified. Nevertheless, as it may lead to more complex ethical appraisals than the other variants, researchers should initially focus on the development of the other types of nuclear transfer to prevent mtDNA disorders. Copyright © 2010 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

Automated solid-phase subcloning based on beads brought into proximity by magnetic force.

PubMed

Hudson, Elton P; Nikoshkov, Andrej; Uhlen, Mathias; Rockberg, Johan

2012-01-01

In the fields of proteomics, metabolic engineering and synthetic biology there is a need for high-throughput and reliable cloning methods to facilitate construction of expression vectors and genetic pathways. Here, we describe a new approach for solid-phase cloning in which both the vector and the gene are immobilized to separate paramagnetic beads and brought into proximity by magnetic force. Ligation events were directly evaluated using fluorescent-based microscopy and flow cytometry. The highest ligation efficiencies were obtained when gene- and vector-coated beads were brought into close contact by application of a magnet during the ligation step. An automated procedure was developed using a laboratory workstation to transfer genes into various expression vectors and more than 95% correct clones were obtained in a number of various applications. The method presented here is suitable for efficient subcloning in an automated manner to rapidly generate a large number of gene constructs in various vectors intended for high throughput applications.

Automated Solid-Phase Subcloning Based on Beads Brought into Proximity by Magnetic Force

PubMed Central

Hudson, Elton P.; Nikoshkov, Andrej; Uhlen, Mathias; Rockberg, Johan

2012-01-01

In the fields of proteomics, metabolic engineering and synthetic biology there is a need for high-throughput and reliable cloning methods to facilitate construction of expression vectors and genetic pathways. Here, we describe a new approach for solid-phase cloning in which both the vector and the gene are immobilized to separate paramagnetic beads and brought into proximity by magnetic force. Ligation events were directly evaluated using fluorescent-based microscopy and flow cytometry. The highest ligation efficiencies were obtained when gene- and vector-coated beads were brought into close contact by application of a magnet during the ligation step. An automated procedure was developed using a laboratory workstation to transfer genes into various expression vectors and more than 95% correct clones were obtained in a number of various applications. The method presented here is suitable for efficient subcloning in an automated manner to rapidly generate a large number of gene constructs in various vectors intended for high throughput applications. PMID:22624028

Cloning of genes required for hypersensitivity and pathogenicity in Pseudomonas syringae pv. aptata.

PubMed

Minardi, P

1995-01-01

A genomic library of Pseudomonas syringae pv. aptata strain NCPPB 2664, which causes bacterial blight of sugar beet, lettuce and other plants, was constructed in the cosmid vector pCPP31. The 13.4 kb EcoRI fragment of the cosmid pHIR11, containing the hrp (hypersensitive response and pathogenicity) gene cluster of the closely related bacterium Pseudomonas syringae pv. syringae strain 61, was used as a probe to identify a homologous hrp gene cluster in P. syringae pv. aptata. Thirty of 2500 cosmid clones, screened by colony hybridization, gave a strong hybridization signal with the probe, but none of these conferred to the non-pathogenic bacterium, Pseudomonas fluorescens, the ability to elicit the hypersensitive response (HR) in tobacco. Southern blot analysis of EcoRI-digested genomic DNA of P. syringae pv. aptata showed hybridizing bands of 12 kb and 4.4 kb. Only a 12 kb fragment hybridized in digests of the cosmids. Cosmid clone pCPP1069 was mutagenized with Tn10-minitet and marker-exchanged into the genome of P. syringae pv. aptata. Three resulting prototrophic mutant strains failed to elicit the HR in tobacco and to cause disease in lettuce. The DNA flanking the Tn10-minitet insertions from mutated derivatives of pCPP1069 hybridized with the 10.6 kb Bg/II fragment of pHIR11. These results indicate that P. syringae pv. aptata harbours hrp genes that are similar to, but arranged differently from, homologous hrp genes of P. syringae pv. syringae.

DNA Book

PubMed Central

Kawai, Jun; Hayashizaki, Yoshihide

2003-01-01

We propose herein a new method of DNA distribution, whereby DNA clones or PCR products are printed directly onto the pages of books and delivered to users along with relevant scientific information. DNA sheets, comprising water-soluble paper onto which DNA is spotted, can be bound into books. Readers can easily extract the DNA fragments from DNA sheets and amplify them using PCR. We show that DNA sheets can withstand various conditions that may be experienced during bookbinding and delivery, such as high temperatures and humidity. Almost all genes (95%–100% of randomly selected RIKEN mouse cDNA clones) were recovered successfully by use of PCR. Readers can start their experiments after a 2-h PCR amplification without waiting for the delivery of DNA clones. The DNA Book thus provides a novel method for delivering DNA in a timely and cost-effective manner. A sample DNA sheet (carrying RIKEN mouse cDNA clones encoding genes of enzymes for the TCA cycle) is included in this issue for field-testing. We would greatly appreciate it if readers could attempt to extract DNA and report the results and whether the DNA sheet was shipped to readers in good condition. PMID:12819147

Ars insulator identified in sea urchin possesses an activity to ensure the transgene expression in mouse cells.

PubMed

Tajima, Shoji; Shinohara, Keiko; Fukumoto, Maiko; Zaitsu, Reiko; Miyagawa, Junichi; Hino, Shinjiro; Fan, Jun; Akasaka, Koji; Matsuoka, Masao

2006-04-01

Sea urchin arylsulfatase (Ars) gene locus has features of an insulator, i.e., blocking of enhancer and promoter interaction, and protection of a transgene against positional effects [Akasaka et al. (1999) Cell. Mol. Biol. 45, 555-565]. To examine the effect of Ars insulator on long-term expression of a transgene, the insulator was inserted into LTR of retrovirus vector harboring hrGFP gene as a reporter, and then introduced into mouse myoblast cells. The isolated clones transduced with the reporter gene with or without Ars insulator were cultured for more than 20 wk in the absence of a selection reagent, and the expression of hrGFP was periodically determined. Expression of hrGFP in four clones transduced with the reporter gene without Ars insulator was completely silenced after 20 wk of culture. On the other hand, hrGFP was expressed in all clones with Ars insulator inserted in one of the two different orientations. Histone H3 deacetylation and DNA methylation of the 5'LTR promoter region, signs for heterochromatin and silencing, were suppressed in the clones that were expressing hrGFP. Ars insulator is effective in maintaining a transgene in mouse cells in an orientation-dependent manner, and will be a useful tool to ensure stable expression of a transgene.

Isolation and characterization of novel lipases/esterases from a bovine rumen metagenome.

PubMed

Privé, Florence; Newbold, C Jamie; Kaderbhai, Naheed N; Girdwood, Susan G; Golyshina, Olga V; Golyshin, Peter N; Scollan, Nigel D; Huws, Sharon A

2015-07-01

Improving the health beneficial fatty acid content of meat and milk is a major challenge requiring an increased understanding of rumen lipid metabolism. In this study, we isolated and characterized rumen bacterial lipases/esterases using functional metagenomics. Metagenomic libraries were constructed from DNA extracted from strained rumen fluid (SRF), solid-attached bacteria (SAB) and liquid-associated rumen bacteria (LAB), ligated into a fosmid vector and subsequently transformed into an Escherichia coli host. Fosmid libraries consisted of 7,744; 8,448; and 7,680 clones with an average insert size of 30 to 35 kbp for SRF, SAB and LAB, respectively. Transformants were screened on spirit blue agar plates containing tributyrin for lipase/esterase activity. Five SAB and four LAB clones exhibited lipolytic activity, and no positive clones were found in the SRF library. Fosmids from positive clones were pyrosequenced and twelve putative lipase/esterase genes and two phospholipase genes retrieved. Although the derived proteins clustered into diverse esterase and lipase families, a degree of novelty was seen, with homology ranging from 40 to 78% following BlastP searches. Isolated lipases/esterases exhibited activity against mostly short- to medium-chain substrates across a range of temperatures and pH. The function of these novel enzymes recovered in ruminal metabolism needs further investigation, alongside their potential industrial uses.

Cloning and expression of a conjugated bile acid hydrolase gene from Lactobacillus plantarum by using a direct plate assay.

PubMed

Christiaens, H; Leer, R J; Pouwels, P H; Verstraete, W

1992-12-01

The conjugated bile acid hydrolase gene from the silage isolate Lactobacillus plantarum 80 was cloned and expressed in Escherichia coli MC1061. For the screening of this hydrolase gene within the gene bank, a direct plate assay developed by Dashkevicz and Feighner (M. P. Dashkevicz and S. D. Feighner, Appl. Environ. Microbiol. 53:331-336, 1989) was adapted to the growth requirements of E. coli. Because of hydrolysis and medium acidification, hydrolase-active colonies were surrounded with big halos of precipitated, free bile acids. This phenomenon was also obtained when the gene was cloned into a multicopy shuttle vector and subsequently reintroduced into the parental Lactobacillus strain. The cbh gene and surrounding regions were characterized by nucleotide sequence analysis. The deduced amino acid sequence was shown to have 52% similarity with a penicillin V amidase from Bacillus sphaericus. Preliminary characterization of the gene product showed that it is a cholylglycine hydrolase (EC 3.5.1.24) with only slight activity against taurine conjugates. The optimum pH was between 4.7 and 5.5. Optimum temperature ranged from 30 to 45 degrees C. Southern blot analysis indicated that the cloned gene has similarity with genomic DNA of bile acid hydrolase-active Lactobacillus spp. of intestinal origin.

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

PubMed

Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

2016-05-01

Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Synthesis and cell-free cloning of DNA libraries using programmable microfluidics

PubMed Central

Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud

2016-01-01

Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354

Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

PubMed

Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

1997-02-01

Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

Genomic clones for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kott, M.; Venta, P.J.; Larsen, J.

1987-05-01

A human genomic library was prepared from peripheral white blood cells from a single donor by inserting an MboI partial digest into BamHI poly-linker sites of EMBL3. This library was screened using an oligolabeled human cholinesterase cDNA probe over 700 bp long. The latter probe was obtained from a human basal ganglia cDNA library. Of approximately 2 million clones screened with high stringency conditions several positive clones were identified; two have been plaque purified. One of these clones has been partially mapped using restriction enzymes known to cut within the coded region of the cDNA for human serum cholinesterase. Hybridizationmore » of the fragments and their sizes are as expected if the genomic clone is cholinesterase. Sequencing of the DNA fragments in M13 is in progress to verify the identify of the clone and the location of introns.« less

Development and analysis of a tick-borne encephalitis virus infectious clone using a novel and rapid strategy.

PubMed

Gritsun, T S; Gould, E A

1998-12-01

In less than 1 month we have constructed an infectious clone of attenuated tick-borne encephalitis virus (strain Vasilchenko) from 100 microl of unpurified virus suspension using long high fidelity PCR and a modified bacterial cloning system. Optimization of the 3' antisense primer concentration was essential to achieve PCR synthesis of an 11 kb cDNA copy of RNA from infectious virus. A novel system utilising two antisense primers, a 14-mer for reverse transcription and a 35-mer for long PCR, produced high yields of genomic length cDNA. Use of low copy number Able K cells and an incubation temperature of 28 degrees C increased the genetic stability of cloned cDNA. Clones containing 11 kb cDNA inserts produced colonies of reduced size, thus providing a positive selection system for full length clones. Sequencing of the infectious clone emphasised the improved fidelity of the method compared with conventional PCR and cloning methods. A simple and rapid strategy for genetic manipulation of the infectious clone is also described. These developments represent a significant advance in recombinant technology and should be applicable to positive stranded RNA viruses which cannot easily be purified or genetically manipulated.

Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

PubMed

Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

2011-09-01

The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

Construction of a High-Quality Yeast Two-Hybrid Library and Its Application in Identification of Interacting Proteins with Brn1 in Curvularia lunata.

PubMed

Gao, Jin-Xin; Jing, Jing; Yu, Chuan-Jin; Chen, Jie

2015-06-01

Curvularia lunata is an important maize foliar fungal pathogen that distributes widely in maize growing area in China, and several key pathogenic factors have been isolated. An yeast two-hybrid (Y2H) library is a very useful platform to further unravel novel pathogenic factors in C. lunata. To construct a high-quality full length-expression cDNA library from the C. lunata for application to pathogenesis-related protein-protein interaction screening, total RNA was extracted. The SMART (Switching Mechanism At 5' end of the RNA Transcript) technique was used for cDNA synthesis. Double-stranded cDNA was ligated into the pGADT7-Rec vector with Herring Testes Carrier DNA using homologous recombination method. The ligation mixture was transformed into competent yeast AH109 cells to construct the primary cDNA library. Eventually, a high qualitative library was successfully established according to an evaluation on quality. The transformation efficiency was about 6.39 ×10(5) transformants/3 μg pGADT7-Rec. The titer of the primary cDNA library was 2.5×10(8) cfu/mL. The numbers for the cDNA library was 2.46×10(5). Randomly picked clones show that the recombination rate was 88.24%. Gel electrophoresis results indicated that the fragments ranged from 0.4 kb to 3.0 kb. Melanin synthesis protein Brn1 (1,3,8-hydroxynaphthalene reductase) was used as a "bait" to test the sufficiency of the Y2H library. As a result, a cDNA clone encoding VelB protein that was known to be involved in the regulation of diverse cellular processes, including control of secondary metabolism containing melanin and toxin production in many filamentous fungi was identified. Further study on the exact role of the VelB gene is underway.

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

AFEAP cloning: a precise and efficient method for large DNA sequence assembly.

PubMed

Zeng, Fanli; Zang, Jinping; Zhang, Suhua; Hao, Zhimin; Dong, Jingao; Lin, Yibin

2017-11-14

Recent development of DNA assembly technologies has spurred myriad advances in synthetic biology, but new tools are always required for complicated scenarios. Here, we have developed an alternative DNA assembly method named AFEAP cloning (Assembly of Fragment Ends After PCR), which allows scarless, modular, and reliable construction of biological pathways and circuits from basic genetic parts. The AFEAP method requires two-round of PCRs followed by ligation of the sticky ends of DNA fragments. The first PCR yields linear DNA fragments and is followed by a second asymmetric (one primer) PCR and subsequent annealing that inserts overlapping overhangs at both sides of each DNA fragment. The overlapping overhangs of the neighboring DNA fragments annealed and the nick was sealed by T4 DNA ligase, followed by bacterial transformation to yield the desired plasmids. We characterized the capability and limitations of new developed AFEAP cloning and demonstrated its application to assemble DNA with varying scenarios. Under the optimized conditions, AFEAP cloning allows assembly of an 8 kb plasmid from 1-13 fragments with high accuracy (between 80 and 100%), and 8.0, 11.6, 19.6, 28, and 35.6 kb plasmids from five fragments at 91.67, 91.67, 88.33, 86.33, and 81.67% fidelity, respectively. AFEAP cloning also is capable to construct bacterial artificial chromosome (BAC, 200 kb) with a fidelity of 46.7%. AFEAP cloning provides a powerful, efficient, seamless, and sequence-independent DNA assembly tool for multiple fragments up to 13 and large DNA up to 200 kb that expands synthetic biologist's toolbox.

Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences†

PubMed Central

Speksnijder, Arjen G. C. L.; Kowalchuk, George A.; De Jong, Sander; Kline, Elizabeth; Stephen, John R.; Laanbroek, Hendrikus J.

2001-01-01

A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a mutational hot spot, and cloning of heteroduplexes and chimeras. These data may partially explain the high degree of microheterogeneity typical of sequence clusters detected in environmental clone libraries. PMID:11133483

In vitro excision of adeno-associated virus DNA from recombinant plasmids: Isolation of an enzyme fraction from HeLa cells that cleaves DNA at poly(G) sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gottlieb, J.; Muzyczka, N.

1988-06-01

When circular recombinant plasmids containing adeno-associated virus (AAV) DNA sequences are transfected into human cells, the AAV provirus is rescued. Using these circular AAV plasmids as substrates, the authors isolated an enzyme fraction from HeLa cell nuclear extracts that excises intact AAV DNA in vitro from vector DNA and produces linear DNA products. The recognition signal for the enzyme is a polypurine-polypyrimidine sequence which is at least 9 residues long and rich in G . C base pairs. Such sequences are present in AAV recombinant plasmids as part of the first 15 base pairs of the AAV terminal repeat andmore » in some cases as the result of cloning the AAV genome by G . C tailing. The isolated enzyme fraction does not have significant endonucleolytic activity on single-stranded or double-stranded DNA. Plasmid DNA that is transfected into tissue culture cells is cleaved in vivo to produce a pattern of DNA fragments similar to that seen with purified enzyme in vitro. The activity has been called endo R for rescue, and its behavior suggests that it may have a role in recombination of cellular chromosomes.« less

Precise Sequential DNA Ligation on A Solid Substrate: Solid-Based Rapid Sequential Ligation of Multiple DNA Molecules

PubMed Central

Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke

2013-01-01

Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972

Efficient preparation of shuffled DNA libraries through recombination (Gateway) cloning.

PubMed

Lehtonen, Soili I; Taskinen, Barbara; Ojala, Elina; Kukkurainen, Sampo; Rahikainen, Rolle; Riihimäki, Tiina A; Laitinen, Olli H; Kulomaa, Markku S; Hytönen, Vesa P

2015-01-01

Efficient and robust subcloning is essential for the construction of high-diversity DNA libraries in the field of directed evolution. We have developed a more efficient method for the subcloning of DNA-shuffled libraries by employing recombination cloning (Gateway). The Gateway cloning procedure was performed directly after the gene reassembly reaction, without additional purification and amplification steps, thus simplifying the conventional DNA shuffling protocols. Recombination-based cloning, directly from the heterologous reassembly reaction, conserved the high quality of the library and reduced the time required for the library construction. The described method is generally compatible for the construction of DNA-shuffled gene libraries. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

DNA Probe for Lactobacillus delbrueckii

PubMed Central

Delley, Michèle; Mollet, Beat; Hottinger, Herbert

1990-01-01

From a genomic DNA library of Lactobacillus delbrueckii subsp. bulgaricus, a clone was isolated which complements a leucine auxotrophy of an Escherichia coli strain (GE891). Subsequent analysis of the clone indicated that it could serve as a specific DNA probe. Dot-blot hybridizations with over 40 different Lactobacillus strains showed that this clone specifically recognizes L. delbrueckii subsp. delbrueckii, bulgaricus, and lactis. The sensitivity of the method was tested by using an α-32P-labeled DNA probe. Images PMID:16348233

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Optimal quantum cloning based on the maximin principle by using a priori information

NASA Astrophysics Data System (ADS)

Kang, Peng; Dai, Hong-Yi; Wei, Jia-Hua; Zhang, Ming

2016-10-01

We propose an optimal 1 →2 quantum cloning method based on the maximin principle by making full use of a priori information of amplitude and phase about the general cloned qubit input set, which is a simply connected region enclosed by a "longitude-latitude grid" on the Bloch sphere. Theoretically, the fidelity of the optimal quantum cloning machine derived from this method is the largest in terms of the maximin principle compared with that of any other machine. The problem solving is an optimization process that involves six unknown complex variables, six vectors in an uncertain-dimensional complex vector space, and four equality constraints. Moreover, by restricting the structure of the quantum cloning machine, the optimization problem is simplified as a three-real-parameter suboptimization problem with only one equality constraint. We obtain the explicit formula for a suboptimal quantum cloning machine. Additionally, the fidelity of our suboptimal quantum cloning machine is higher than or at least equal to that of universal quantum cloning machines and phase-covariant quantum cloning machines. It is also underlined that the suboptimal cloning machine outperforms the "belt quantum cloning machine" for some cases.

Archaeal Diversity in Waters from Deep South African Gold Mines

PubMed Central

Takai, Ken; Moser, Duane P.; DeFlaun, Mary; Onstott, Tullis C.; Fredrickson, James K.

2001-01-01

A culture-independent molecular analysis of archaeal communities in waters collected from deep South African gold mines was performed by performing a PCR-mediated terminal restriction fragment length polymorphism (T-RFLP) analysis of rRNA genes (rDNA) in conjunction with a sequencing analysis of archaeal rDNA clone libraries. The water samples used represented various environments, including deep fissure water, mine service water, and water from an overlying dolomite aquifer. T-RFLP analysis revealed that the ribotype distribution of archaea varied with the source of water. The archaeal communities in the deep gold mine environments exhibited great phylogenetic diversity; the majority of the members were most closely related to uncultivated species. Some archaeal rDNA clones obtained from mine service water and dolomite aquifer water samples were most closely related to environmental rDNA clones from surface soil (soil clones) and marine environments (marine group I [MGI]). Other clones exhibited intermediate phylogenetic affiliation between soil clones and MGI in the Crenarchaeota. Fissure water samples, derived from active or dormant geothermal environments, yielded archaeal sequences that exhibited novel phylogeny, including a novel lineage of Euryarchaeota. These results suggest that deep South African gold mines harbor novel archaeal communities distinct from those observed in other environments. Based on the phylogenetic analysis of archaeal strains and rDNA clones, including the newly discovered archaeal rDNA clones, the evolutionary relationship and the phylogenetic organization of the domain Archaea are reevaluated. PMID:11722932

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

A novel dual vector coexpressing PhiX174 lysis E gene and staphylococcal nuclease A gene on the basis of lambda promoter pR and pL, respectively.

PubMed

Fu, Lixia; Lu, Chengping

2013-06-01

Bacterial ghost is a novel vaccine platform, and its safe and efficient production depends largely upon a suitable and functional vector. In this study, a series of temperature-inducible plasmids, carrying Phix174 lysis gene E and/or staphylococcal nuclease A (SNA) gene, were constructed and evaluated in Escherichia coli. The results showed that the direct product of SNA (pBV220-SNA) could degrade the plasmid and genomic DNA of E. coli while the fusion product of gene E and partial Cro gene (pKF396M-2) lost the ability to lyse the host strain. The insertion of enhancer T7g10 elements and Shine-Dalgarno box (ESD) between them (pKF396M-3) could resume the function of gene E. Using plasmid pKF396M-4 with gene E and SNA, respectively, under the immediate control of promoter pR and pL, the remnant plasmids and genomic DNA of E. coli were eliminated, and the rates of inactivation increased by two orders of magnitude over that obtained with the exclusive use of E-mediated lysis plasmid. By substituting these two genes with customized multiple cloning sites sequences, the plasmid could be modified to a dual expression vector (pKF396M-5).

Molecular and Immunogenic Properties of Apyrase SP01B and D7-Related SP04 Recombinant Salivary Proteins of Phlebotomus perniciosus from Madrid, Spain

PubMed Central

Martín-Martín, Inés

2013-01-01

Sand fly salivary proteins are on the spotlight to become vaccine candidates against leishmaniasis and to markers of exposure to sand fly bites due to the host immune responses they elicit. Working with the whole salivary homogenate entails serious drawbacks such as the need for maintaining sand fly colonies and the laborious task of glands dissection. In order to overcome these difficulties, producing recombinant proteins of different vectors has become a major task. In this study, a cDNA library was constructed with the salivary glands of Phlebotomus perniciosus from Madrid, Spain, the most widespread vector of Leishmania infantum in the Mediterranean basin. Analysis of the cDNA sequences showed several polymorphisms among the previously described salivary transcripts. The apyrase SP01B and the D7-related protein SP04 were successfully cloned, expressed in Escherichia coli, and purified. Besides, recombinant proteins were recognized by sera of hamsters and mice previously immunized with saliva through the exposure to uninfected sand fly bites. These results suggest that these two recombinant proteins conserved their immunogenic properties after expression in a prokaryote system. Therefore, this work contributes to expand the knowledge of P. perniciosus saliva that would be eventually used for the development of tools for vector control programs. PMID:24171166

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Tigutcystatin, a cysteine protease inhibitor from Triatoma infestans midgut expressed in response to Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buarque, Diego S.; Spindola, Leticia M.N.; Martins, Rafael M.

2011-09-23

Highlights: {yields} Tigutcystatin inhibits Trypanosoma cruzi cysteine proteases with high specificity. {yields} Tigutcystatin expression is up-regulated in response to T. cruzi infection. {yields} It is the first cysteine proteases inhibitor characterized from a triatomine insect. -- Abstract: The insect Triatoma infestans is a vector of Trypanosoma cruzi, the etiological agent of Chagas disease. A cDNA library was constructed from T. infestans anterior midgut, and 244 clones were sequenced. Among the EST sequences, an open reading frame (ORF) with homology to a cystatin type 2 precursor was identified. Then, a 288-bp cDNA fragment encoding mature cystatin (lacking signal peptide) named Tigutcystatinmore » was cloned fused to a N-terminal His tag in pET-14b vector, and the protein expressed in Escherichia coli strain Rosetta gami. Tigutcystatin purified and cleaved by thrombin to remove His tag presented molecular mass of 11 kDa and 10,137 Da by SDS-PAGE and MALDI-TOF mass spectrometry, respectively. Purified Tigutcystatin was shown to be a tight inhibitor towards cruzain, a T. cruzi cathepsin L-like enzyme (K{sub i} = 3.29 nM) and human cathepsin L (K{sub i} = 3.78 nM). Tissue specific expression analysis showed that Tigutcystatin was mostly expressed in anterior midgut, although amplification in small intestine was also detected by semi quantitative RT-PCR. qReal time PCR confirmed that Tigutcystatin mRNA is significantly up-regulated in anterior midgut when T. infestans is infected with T. cruzi. Together, these results indicate that Tigutcystatin may be involved in modulation of T. cruzi in intestinal tract by inhibiting parasite cysteine proteases, which represent the virulence factors of this protozoan.« less

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Maintenance of mitochondrial DNA copy number and expression are essential for preservation of mitochondrial function and cell growth.

PubMed

Jeng, Jaan-Yeh; Yeh, Tien-Shun; Lee, Jing-Wen; Lin, Shyh-Hsiang; Fong, Tsorng-Han; Hsieh, Rong-Hong

2008-02-01

To examine whether a reduction in the mtDNA level will compromise mitochondrial biogenesis and mitochondrial function, we created a cell model with depleted mtDNA. Stable transfection of small interfering (si)RNA of mitochondrial transcription factor A (Tfam) was used to interfere with Tfam gene expression. Selected stable clones showed 60-95% reduction in Tfam gene expression and 50-90% reduction in cytochrome b (Cyt b) gene expression. Tfam gene knockdown clones also showed decreased mtDNA-encoded cytochrome c oxidase subunit I (COX I) protein expression. However, no significant differences in protein expression were observed in nuclear DNA (nDNA)-encoded mitochondrial respiratory enzyme subunits. The cell morphology changed from a rhombus-like to a spindle-like form as determined in clones with decreased expressions of Tfam, mtRNA, and mitochondrial proteins. The mitochondrial respiratory enzyme activities and ATP production in such clones were significantly lower. The proportions of mtDNA mutations including 8-hydroxy-2'-deoxyguanosine (8-OHdG), a 4,977-bp deletion, and a 3,243-point mutation were also examined in these clones. No obvious increase in mtDNA mutations was observed in mitochondrial dysfunctional cell clones. The mitochondrial respiratory activity and ATP production ability recovered in cells with increased mtDNA levels after removal of the specific siRNA treatment. These experimental results provide direct evidence to substantiate that downregulation of mtDNA copy number and expression may compromise mitochondrial function and subsequent cell growth and morphology. (c) 2007 Wiley-Liss, Inc.

Crispr-mediated Gene Targeting of Human Induced Pluripotent Stem Cells.

PubMed

Byrne, Susan M; Church, George M

2015-01-01

CRISPR/Cas9 nuclease systems can create double-stranded DNA breaks at specific sequences to efficiently and precisely disrupt, excise, mutate, insert, or replace genes. However, human embryonic stem or induced pluripotent stem cells (iPSCs) are more difficult to transfect and less resilient to DNA damage than immortalized tumor cell lines. Here, we describe an optimized protocol for genome engineering of human iPSCs using a simple transient transfection of plasmids and/or single-stranded oligonucleotides. With this protocol, we achieve transfection efficiencies greater than 60%, with gene disruption efficiencies from 1-25% and gene insertion/replacement efficiencies from 0.5-10% without any further selection or enrichment steps. We also describe how to design and assess optimal sgRNA target sites and donor targeting vectors; cloning individual iPSC by single cell FACS sorting, and genotyping successfully edited cells.

Recombinant protein production from stable mammalian cell lines and pools.

PubMed

Hacker, David L; Balasubramanian, Sowmya

2016-06-01

We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

PubMed

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

PubMed Central

Mei, Yu; Kernodle, Bliss M.; Hill, John H.

2016-01-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311