Kankia, Besik I; Soto, Ana Maria; Burns, Nicole; Shikiya, Ronald; Tung, Chang-Shung; Marky, Luis A
2002-11-05
The anticancer activity of cisplatin arises from its ability to bind covalently to DNA, forming primarily intrastrand cross-links to adjacent purine residues; the most common adducts involve d(GpG) (65%) and d(ApG) (25%) intrastrand cross-links. The incorporation of these platinum adducts in a B-DNA helix induces local distortions, causing bending and unwinding of the DNA. In this work, we used temperature-dependent UV spectroscopy to investigate the unfolding thermodynamics, and associated ionic effects, of two sets of DNA decamer duplexes containing either cis-[Pt(NH(3))(2)[d(GpG
Lee, Joon-Hwa; Bae, Sung-Hun; Choi, Byong-Seok
2000-01-01
In contrast to the highly mutagenic pyrimidine(6–4)pyrimidone photoproduct, its Dewar valence isomer (Dewar product) has low mutagenic potential and produces a broad range of mutations [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the mutagenic property of the Dewar product, we used experimental NMR restraints and molecular dynamics to determine the solution structure of a Dewar-lesion DNA decamer duplex. This DNA decamer duplex (DW/GA duplex) contains a mismatched base pair between the 3′ T residue of the Dewar lesion (T6) and an opposed G residue (G15). The 3′ T (T6) of the Dewar lesion formed stable hydrogen bonds with the opposing G15 residue. However, the helical bending and unwinding angles of the DW/GA duplex were much larger than those of a second duplex that contains the Dewar lesion and opposing A15 and A16 residues (DW/AA duplex). The DW/GA duplex showed poorer stacking interactions at the two bases of the Dewar product and at the adjacent A7⋅T14 base pair than did the DW/AA duplex. These structural features imply that no thermal stability or conformational benefit is obtained by incorporating a G instead of an A opposite the 3′ T of the Dewar lesion. These properties may thus facilitate the preferential incorporation of an A in accordance with the A rule during translesion replication and lead to the low frequency of 3′ T→C mutations observed at this site. PMID:10758155
Chazin, W J; Rance, M; Chollet, A; Leupin, W
1991-01-01
The dodecadeoxynucleotide duplex d-(GCATTAATGC)2 has been prepared with all adenine bases replaced by 2-NH2-adenine. This modified duplex has been characterized by nuclear magnetic resonance (NMR) spectroscopy. Complete sequence-specific 1H resonance assignments have been obtained by using a variety of 2D NMR methods. Multiple quantum-filtered and multiple quantum experiments have been used to completely assign all sugar ring protons, including 5'H and 5'H resonances. The assignments form the basis for a detailed comparative analysis of the 1H NMR parameters of the modified and parent duplex. The structural features of both decamer duplexes in solution are characteristic of the B-DNA family. The spin-spin coupling constants in the sugar rings and the relative spatial proximities of protons in the bases and sugars (as determined from the comparison of corresponding nuclear Overhauser effects) are virtually identical in the parent and modified duplexes. Thus, substitution by this adenine analogue in oligonucleotides appears not to disturb the global or local conformation of the DNA duplex. PMID:1945828
NASA Astrophysics Data System (ADS)
Smith, Jarrod Anson
2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.
NASA Technical Reports Server (NTRS)
Egli, M.; Usman, N.; Rich, A.
1993-01-01
We have crystallized three double-helical DNA-RNA chimeric duplexes and determined their structures by X-ray crystallography at resolutions between 2 and 2.25 A. The two self-complementary duplexes [r(G)d(CGTATACGC)]2 and [d(GCGT)r(A)d(TACGC)]2, as well as the Okazaki fragment d(GGGTATACGC).r(GCG)d(TATACCC), were found to adopt A-type conformations. The crystal structures are non-isomorphous, and the crystallographic environments for the three chimeras are different. A number of intramolecular interactions of the ribose 2'-hydroxyl groups contribute to the stabilization of the A-conformation. Hydrogen bonds between 2'-hydroxyls and 5'-oxygens or phosphate oxygens, in addition to the previously observed hydrogen bonds to 1'-oxygens of adjacent riboses and deoxyriboses, are observed in the DNA-RNA chimeric duplexes. The crystalline chimeric duplexes do not show a transition between the DNA A- and B-conformations. CD spectra suggest that the Okazaki fragment assumes an A-conformation in solution as well. In this molecule the three RNA residues may therefore lock the complete decamer in the A-conformation. Crystals of an all-DNA strand with the same sequence as the self-complementary chimeras show a morphology which is different from those of the chimera crystals. Moreover, the oligonucleotide does not match any of the sequence characteristics of DNAs usually adopting the A-conformation in the crystalline state (e.g., octamers with short alternating stretches of purines and pyrimidines). In DNA-RNA chimeric duplexes, it is therefore possible that a single RNA residue can drive the conformational equilibrium toward the A-conformation.
Lee, Joon-Hwa; Park, Chin-Ju; Shin, Jae-Sun; Ikegami, Takahisa; Akutsu, Hideo; Choi, Byong-Seok
2004-01-01
The cis-syn cyclobutane pyrimidine dimer (CPD) is a cytotoxic, mutagenic and carcinogenic DNA photoproduct and is repaired by the nucleotide excision repair (NER) pathway in mammalian cells. The XPC-hHR23B complex as the initiator of global genomic NER binds to sites of certain kinds of DNA damage. Although CPDs are rarely recognized by the XPC-hHR23B complex, the presence of mismatched bases opposite a CPD significantly increased the binding affinity of the XPC-hHR23B complex to the CPD. In order to decipher the properties of the DNA structures that determine the binding affinity for XPC-hHR23B to DNA, we carried out structural analyses of the various types of CPDs by NMR spectroscopy. The DNA duplex which contains a single 3' T*G wobble pair in a CPD (CPD/GA duplex) induces little conformational distortion. However, severe distortion of the helical conformation occurs when a CPD contains double T*G wobble pairs (CPD/GG duplex) even though the T residues of the CPD form stable hydrogen bonds with the opposite G residues. The helical bending angle of the CPD/GG duplex was larger than those of the CPD/GA duplex and properly matched CPD/AA duplex. The fluctuation of the backbone conformation and significant changes in the widths of the major and minor grooves at the double T*G wobble paired site were also observed in the CPD/GG duplex. These structural features were also found in a duplex that contains the (6-4) adduct, which is efficiently recognized by the XPC-hHR23B complex. Thus, we suggest that the unique structural features of the DNA double helix (that is, helical bending, flexible backbone conformation, and significant changes of the major and/or minor grooves) might be important factors in determining the binding affinity of the XPC-hHR23B complex to DNA.
A molecular model for proflavine-DNA intercalation.
Neidle, S; Pearl, L H; Herzyk, P; Berman, H M
1988-01-01
A molecular model has been derived for the intercalation of proflavine into the CpG site of the decamer duplex of d(GATACGATAC). The starting geometry of the intercalation site was taken from previous crystallographic studies on the d(CpG)-proflavine complex, and molecular mechanics used to obtain a stereochemically acceptable structure. This has widened grooves compared to standard A- or B- double helices, as well as distinct conformational, roll, twist and tilt features. PMID:3174439
Foti, M; Marshalko, S; Schurter, E; Kumar, S; Beardsley, G P; Schweitzer, B I
1997-05-06
The nucleoside analog 9-[(1,3-dihydroxy-2-propoxy)methyl]guanine (ganciclovir, DHPG) is an antiviral drug that is used in the treatment of a variety of herpes viruses in immunocompromised patients and in a gene therapy protocol that has shown promising activity for the treatment of cancer. To probe the structural effects of ganciclovir when incorporated into DNA, we determined and compared the solution structure of a modified ganciclovir-containing decamer duplex [d(CTG)(ganciclovir)d(ATCCAG)]2 and a control duplex d[(CTGGATCCAG)]2 using nuclear magnetic resonance techniques. 1H and 31P resonances in both duplexes were assigned using a combination of 2-D 1H and 31P NMR experiments. Proton-proton distances determined from NOESY data and dihedral angles determined from DQF-COSY data were used in restrained molecular dynamics simulations starting from canonical A- and B-form DNA models. Both the control and ganciclovir sets of simulations converged to B-type structures. These structures were subjected to full relaxation matrix refinement to produce final structures that were in excellent agreement with the observed NOE intensities. Examination of the final ganciclovir-containing structures reveals that the base of the ganciclovir residue is hydrogen bonded to its complementary dC and is stacked in the helix; in fact, the base of ganciclovir exhibits increased stacking with the 5' base relative to the control. Interestingly, some of the most significant distortions in the structures occur 3' to the lesion site, including a noticeable kink in the sugar-phosphate backbone at this position. Further examination reveals that the backbone conformation, sugar pucker, and glycosidic torsion angle of the residue 3' to the lesion site all indicate an A-type conformation at this position. A possible correlation of these structural findings with results obtained from earlier biochemical studies will be discussed.
Lee, Joon-Hwa; Hwang, Geum-Sook; Choi, Byong-Seok
1999-01-01
The pyrimidine(6–4)pyrimidone photoproduct [(6–4) adduct] is one of the major photoproducts induced by UV irradiation of DNA and occurs at TpT sites. The (6–4) adduct is highly mutagenic and leads most often to a 3′ T → C transition with 85% replicating error frequency [LeClerc, J. E., Borden, A. & Lawrence, C. W. (1991) Proc. Natl. Acad. Sci. USA 88, 9685–9689]. To determine the origin of the specific 3′ T → C transition of the (6–4) adduct, we have used experimental NMR restraints and molecular dynamics to determine the solution structure of a (6–4)-lesion DNA decamer duplex that contains a mismatched base pair between the 3′ T residue and an opposed G residue. Normal Watson–Crick-type hydrogen bonding is retained at the 5′ T of the lesion site. The O2 carbonyl of the 3′ T residue forms hydrogen bonds with the imino and amino protons of the opposed G residue. This potential hydrogen bonding stabilizes the overall helix and restores the highly distorted conformation of the (6–4) adduct to the typical B-form-like DNA structure. This structural feature can explain the marked preference for the insertion of an A residue opposite the 5′ T and a G residue opposite the 3′ T of the (6–4) lesion during trans-lesion synthesis. Thus these insertions yield the predominant 3′ T → C transition. PMID:10359763
Application of a coarse-grained model for DNA to homo- and heterogeneous melting equilibria
NASA Astrophysics Data System (ADS)
Tito, Nicholas B.; Stubbs, John M.
2010-01-01
Configurational-bias Monte Carlo simulations were carried out on deoxyribonucleic acid (DNA) decamers using a coarse-grained molecular model. The effects of single mutations on the melting transition were investigated as were heterogeneous systems with immobilization of one strand on a surface, both with and without a spacer. The destabilizing effect of an internal mutation is attributed to a lack of cooperativity, which acts through a hydrogen bonding nucleotide's restriction of the conformational freedom of neighboring bases. A surface-oligomer spacer is necessary for duplex stability with the destabilizing effect of the surface coinciding with the volume it excludes.
Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A
2016-05-01
The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.
Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E
2012-06-01
We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F-CeNA gapmer ASO showed similar RNA affinity but significantly improved activity compared to that of a sequence matched MOE ASO, thus establishing F-CeNA as a useful modification for antisense applications.
Structure and stability of the consecutive stereoregulated chiral phosphorothioate DNA duplex.
Kanaori, K; Tamura, Y; Wada, T; Nishi, M; Kanehara, H; Morii, T; Tajima, K; Makino, K
1999-12-07
The duplex structures of the stereoregulated phosphorothioate DNAs, [R(p),R(p)]- and [S(p),S(p)]-[d(GC(ps)T(ps)ACG)] (ps, phosphorothioate; PS-DNA), with their complementary RNA have been investigated by combined use of (1)H NMR and restrained molecular dynamics calculation. Compared to those obtained for the unmodified duplex structures (PO-DNA.RNA), the NOE cross-peak intensities are virtually identical for the PS-DNA.RNA hybrid duplexes. The structural analysis on the basis of the NOE restraints reveals that all of the three DNA.RNA duplexes take a A-form conformation and that there is no significant difference in the base stacking for the DNA.RNA hybrid duplexes. On the other hand, the NOE cross-peak intensities of the protons around the central T(ps)A step of the PS-DNA.DNA duplexes are apparently different from those of PO-DNA. DNA. The chemical shifts of H8/6 and H1' at the T(ps)A step are also largely different among PS-DNA.DNAs and PO-DNA.DNA, suggesting that the DNA.DNA structure is readily changed by the introduction of the phosphorothioate groups to the central T(p)A step. The structure calculations indicate that all of these DNA.DNA duplexes are B-form although there exist some small differences in helical parameters between the [R(p),R(p)]- and [S(p),S(p)]PS-DNA.DNA duplexes. The melting temperatures (T(m)) were determined for all of the duplexes by plotting the chemical shift change of isolated peaks as a function of temperature. For the PS-DNA.RNA hybrid duplexes, the [S(p),S(p)] isomer is less stable than the [R(p),R(p)] isomer while this trend is reversed for the PS-DNA.DNA duplexes. Consequently, although the PS-DNA.RNA duplexes take the similar A-form structure, the duplex stability is different between PS-DNA.RNA duplexes. The stability of the DNA.RNA duplexes may not be governed by the A-form structure itself but by some other factors such as the hydration around the phosphorothioate backbone, although the T(m) difference of the DNA.DNA duplexes could be explained by the structural factor.
Menchise, Valeria; De Simone, Giuseppina; Tedeschi, Tullia; Corradini, Roberto; Sforza, Stefano; Marchelli, Rosangela; Capasso, Domenica; Saviano, Michele; Pedone, Carlo
2003-01-01
Peptide nucleic acids (PNAs) are oligonucleotide analogues in which the sugar-phosphate backbone has been replaced by a pseudopeptide skeleton. They bind DNA and RNA with high specificity and selectivity, leading to PNA–RNA and PNA–DNA hybrids more stable than the corresponding nucleic acid complexes. The binding affinity and selectivity of PNAs for nucleic acids can be modified by the introduction of stereogenic centers (such as d-Lys-based units) into the PNA backbone. To investigate the structural features of chiral PNAs, the structure of a PNA decamer containing three d-Lys-based monomers (namely H-GpnTpnApnGpnAdlTdlCdlApnCpnTpn-NH2, in which pn represents a pseudopeptide link and dl represents a d-Lys analogue) hybridized with its complementary antiparallel DNA has been solved at a 1.66-Å resolution by means of a single-wavelength anomalous diffraction experiment on a brominated derivative. Thed-Lys-based chiral PNA–DNA (LPD) heteroduplex adopts the so-called P-helix conformation. From the substantial similarity between the PNA conformation in LPD and the conformations observed in other PNA structures, it can be concluded that PNAs possess intrinsic conformational preferences for the P-helix, and that their flexibility is rather restricted. The conformational rigidity of PNAs is enhanced by the presence of the chiral centers, limiting the ability of PNA strands to adopt other conformations and, ultimately, increasing the selectivity in molecular recognition. PMID:14512516
NASA Astrophysics Data System (ADS)
Takenaka, Shigeori
2017-07-01
It is known that naphthalene diimide carrying two substituents binds to DNA duplex with threading intercalation. Naphthalene diimide carrying ferrocene moieties, ferrocenylnaphthalene diimide (FND), formed a stable complex with DNA duplex and an electrochemical gene detection was achieved with current signal generated from FND bound to the DNA duplex between target DNA and DNA probe immobilized electrode. FND couldn't bind to the mismatched and its surrounding region of DNA duplex and thus FND was applied to the precision detection of single nucleotide polymorphisms (SNPs) using the improved discrimination ability between fully matched and mismatched DNA hybrids and multi-electrode chip. Some of FND derivatives bound to telomere DNA tetraplex stronger than to DNA duplex and was applied to cancer diagnosis as a measure of the elongated telomere DNA with telomerase as a suitable maker of cancer. Furthermore, cyclic naphthalene diimides realized the extremely high preference for DNA tetraplex over DNA duplex. Such molecules will open an effective anti-cancer drug based on telomerase specific inhibitor.
Ahn, Junho; Choi, Yeonweon; Lee, Ae-Ree; Lee, Joon-Hwa; Jung, Jong Hwa
2016-03-21
Using duplex DNA-AuNP aggregates, a sequence-specific DNA-binding protein, SQUAMOSA Promoter-binding-Like protein 12 (SPL-12), was directly determined by SPL-12-duplex DNA interaction-based colorimetric actions of DNA-Au assemblies. In order to prepare duplex DNA-Au aggregates, thiol-modified DNA 1 and DNA 2 were attached onto the surface of AuNPs, respectively, by the salt-aging method and then the DNA-attached AuNPs were mixed. Duplex-DNA-Au aggregates having the average size of 160 nm diameter and the maximum absorption at 529 nm were able to recognize SPL-12 and reached the equivalent state by the addition of ∼30 equivalents of SPL-12 accompanying a color change from red to blue with a red shift of the maximum absorption at 570 nm. As a result, the aggregation size grew to about 247 nm. Also, at higher temperatures of the mixture of duplex-DNA-Au aggregate solution and SPL-12, the equivalent state was reached rapidly. On the contrary, in the control experiment using Bovine Serum Albumin (BSA), no absorption band shift of duplex-DNA-Au aggregates was observed.
Hole Transport in A-form DNA/RNA Hybrid Duplexes
NASA Astrophysics Data System (ADS)
Wong, Jiun Ru; Shao, Fangwei
2017-01-01
DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations.
Hole Transport in A-form DNA/RNA Hybrid Duplexes
Wong, Jiun Ru; Shao, Fangwei
2017-01-01
DNA/RNA hybrid duplexes are prevalent in many cellular functions and are an attractive target form for electrochemical biosensing and electric nanodevice. However the electronic conductivities of DNA/RNA hybrid duplex remain relatively unexplored and limited further technological applications. Here cyclopropyl-modified deoxyribose- and ribose-adenosines were developed to explore hole transport (HT) in both DNA duplex and DNA/RNA hybrids by probing the transient hole occupancies on adenine tracts. HT yields through both B-form and A-form double helixes displayed similar shallow distance dependence, although the HT yields of DNA/RNA hybrid duplexes were lower than those of DNA duplexes. The lack of oscillatory periods and direction dependence in HT through both helixes implied efficient hole propagation can be achieved via the hole delocalization and coherent HT over adenine tracts, regardless of the structural variations. PMID:28084308
Nanopore Analysis of the 5-Guanidinohydantoin to Iminoallantoin Isomerization in Duplex DNA.
Zeng, Tao; Fleming, Aaron M; Ding, Yun; Ren, Hang; White, Henry S; Burrows, Cynthia J
2018-04-06
In DNA, guanine oxidation yields diastereomers of 5-guanidinohydantoin (Gh) as one of the major products. In nucleosides and single-stranded DNA, Gh is in a pH-dependent equilibrium with its constitutional isomer iminoallantoin (Ia). Herein, the isomerization reaction between Gh and Ia was monitored in duplex DNA using a protein nanopore by measuring the ionic current when duplex DNA interacts with the pore under an electrophoretic force. Monitoring current levels in this single-molecule method proved to be superior for analysis of population distributions in an equilibrating mixture of four isomers in duplex DNA as a function of pH. The results identified Gh as a major isomer observed when base paired with A, C, or G at pH 6.4-8.4, and Ia was a minor isomer of the reaction mixture that was only observed when the pH was >7.4 in the duplex DNA context. The present results suggest that Gh will be the dominant isomer in duplex DNA under physiological conditions regardless of the base-pairing partner in the duplex.
Probing of miniPEGγ-PNA-DNA Hybrid Duplex Stability with AFM Force Spectroscopy.
Dutta, Samrat; Armitage, Bruce A; Lyubchenko, Yuri L
2016-03-15
Peptide nucleic acids (PNA) are synthetic polymers, the neutral peptide backbone of which provides elevated stability to PNA-PNA and PNA-DNA hybrid duplexes. It was demonstrated that incorporation of diethylene glycol (miniPEG) at the γ position of the peptide backbone increased the thermal stability of the hybrid duplexes (Sahu, B. et al. J. Org. Chem. 2011, 76, 5614-5627). Here, we applied atomic force microscopy (AFM) based single molecule force spectroscopy and dynamic force spectroscopy (DFS) to test the strength and stability of the hybrid 10 bp duplex. This hybrid duplex consisted of miniPEGγ-PNA and DNA of the same length (γ(MP)PNA-DNA), which we compared to a DNA duplex with a homologous sequence. AFM force spectroscopy data obtained at the same conditions showed that the γ(MP)PNA-DNA hybrid is more stable than the DNA counterpart, 65 ± 15 pN vs 47 ± 15 pN, respectively. The DFS measurements performed in a range of pulling speeds analyzed in the framework of the Bell-Evans approach yielded a dissociation constant, koff ≈ 0.030 ± 0.01 s⁻¹ for γ(MP)PNA-DNA hybrid duplex vs 0.375 ± 0.18 s⁻¹ for the DNA-DNA duplex suggesting that the hybrid duplex is much more stable. Correlating the high affinity of γ(MP)PNA-DNA to slow dissociation kinetics is consistent with prior bulk characterization by surface plasmon resonance. Given the growing interest in γ(MP)PNA as well as other synthetic DNA analogues, the use of single molecule experiments along with computational analysis of force spectroscopy data will provide direct characterization of various modifications as well as higher order structures such as triplexes and quadruplexes.
Wysoczynski, Christina L.; Roemer, Sarah C.; Dostal, Vishantie; Barkley, Robert M.; Churchill, Mair E. A.; Malarkey, Christopher S.
2013-01-01
Obtaining quantities of highly pure duplex DNA is a bottleneck in the biophysical analysis of protein–DNA complexes. In traditional DNA purification methods, the individual cognate DNA strands are purified separately before annealing to form DNA duplexes. This approach works well for palindromic sequences, in which top and bottom strands are identical and duplex formation is typically complete. However, in cases where the DNA is non-palindromic, excess of single-stranded DNA must be removed through additional purification steps to prevent it from interfering in further experiments. Here we describe and apply a novel reversed-phase ion-pair liquid chromatography purification method for double-stranded DNA ranging in lengths from 17 to 51 bp. Both palindromic and non-palindromic DNA can be readily purified. This method has the unique ability to separate blunt double-stranded DNA from pre-attenuated (n-1, n-2, etc) synthesis products, and from DNA duplexes with single base pair overhangs. Additionally, palindromic DNA sequences with only minor differences in the central spacer sequence of the DNA can be separated, and the purified DNA is suitable for co-crystallization of protein–DNA complexes. Thus, double-stranded ion-pair liquid chromatography is a useful approach for duplex DNA purification for many applications. PMID:24013567
Capturing a DNA duplex under near-physiological conditions
NASA Astrophysics Data System (ADS)
Zhang, Huijuan; Xu, Wei; Liu, Xiaogang; Stellacci, Francesco; Thong, John T. L.
2010-10-01
We report in situ trapping of a thiolated DNA duplex with eight base pairs into a polymer-protected gold nanogap device under near-physiological conditions. The double-stranded DNA was captured by electrophoresis and covalently attached to the nanogap electrodes through sulfur-gold bonding interaction. The immobilization of the DNA duplex was confirmed by direct electrical measurements under near-physiological conditions. The conductance of the DNA duplex was estimated to be 0.09 μS. We also demonstrate the control of DNA dehybridization by heating the device to temperatures above the melting point of the DNA.
NASA Astrophysics Data System (ADS)
Ramaiah, Danaboyina; Kan, Yongzhi; Koch, Troels; Orum, Henrik; Schuster, Gary B.
1998-10-01
Peptide nucleic acids (PNA) are mimics with normal bases connected to a pseudopeptide chain that obey Watson--Crick rules to form stable duplexes with itself and natural nucleic acids. This has focused attention on PNA as therapeutic or diagnostic reagents. Duplexes formed with PNA mirror some but not all properties of DNA. One fascinating aspect of PNA biochemistry is their reaction with enzymes. Here we show an enzyme reaction that operates effectively on a PNA/DNA hybrid duplex. A DNA oligonucleotide containing a cis, syn-thymine [2+2] dimer forms a stable duplex with PNA. The hybrid duplex is recognized by photolyase, and irradiation of the complex leads to the repair of the thymine dimer. This finding provides insight into the enzyme mechanism and provides a means for the selective repair of thymine photodimers.
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay
Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710
Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.
Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen
2015-01-01
Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.
Zhang, Bo; Wu, Wen-Qiang; Liu, Na-Nv; Duan, Xiao-Lei; Li, Ming; Dou, Shuo-Xing; Hou, Xi-Miao; Xi, Xu-Guang
2016-01-01
Alternative DNA structures that deviate from B-form double-stranded DNA such as G-quadruplex (G4) DNA can be formed by G-rich sequences that are widely distributed throughout the human genome. We have previously shown that Pif1p not only unfolds G4, but also unwinds the downstream duplex DNA in a G4-stimulated manner. In the present study, we further characterized the G4-stimulated duplex DNA unwinding phenomenon by means of single-molecule fluorescence resonance energy transfer. It was found that Pif1p did not unwind the partial duplex DNA immediately after unfolding the upstream G4 structure, but rather, it would dwell at the ss/dsDNA junction with a ‘waiting time’. Further studies revealed that the waiting time was in fact related to a protein dimerization process that was sensitive to ssDNA sequence and would become rapid if the sequence is G-rich. Furthermore, we identified that the G-rich sequence, as the G4 structure, equally stimulates duplex DNA unwinding. The present work sheds new light on the molecular mechanism by which G4-unwinding helicase Pif1p resolves physiological G4/duplex DNA structures in cells. PMID:27471032
Ding, Yuan; Zhang, Xiaojun; Tham, Kenneth W.; Qin, Peter Z.
2014-01-01
Sequence-dependent variation in structure and dynamics of a DNA duplex, collectively referred to as ‘DNA shape’, critically impacts interactions between DNA and proteins. Here, a method based on the technique of site-directed spin labeling was developed to experimentally map shapes of two DNA duplexes that contain response elements of the p53 tumor suppressor. An R5a nitroxide spin label, which was covalently attached at a specific phosphate group, was scanned consecutively through the DNA duplex. X-band continuous-wave electron paramagnetic resonance spectroscopy was used to monitor rotational motions of R5a, which report on DNA structure and dynamics at the labeling site. An approach based on Pearson's coefficient analysis was developed to collectively examine the degree of similarity among the ensemble of R5a spectra. The resulting Pearson's coefficients were used to generate maps representing variation of R5a mobility along the DNA duplex. The R5a mobility maps were found to correlate with maps of certain DNA helical parameters, and were capable of revealing similarity and deviation in the shape of the two closely related DNA duplexes. Collectively, the R5a probe and the Pearson's coefficient-based lineshape analysis scheme yielded a generalizable method for examining sequence-dependent DNA shapes. PMID:25092920
NASA Astrophysics Data System (ADS)
Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan
2016-07-01
Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex.
Ueda, Yu-Mi; Zouzumi, Yu-Ki; Maruyama, Atsushi; Nakano, Shu-Ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
We systematically investigated effects of molecular crowding with trimethylamine N -oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences.
Effects of trimethylamine N-oxide and urea on DNA duplex and G-quadruplex
Ueda, Yu-mi; Zouzumi, Yu-ki; Maruyama, Atsushi; Nakano, Shu-ichi; Sugimoto, Naoki; Miyoshi, Daisuke
2016-01-01
Abstract We systematically investigated effects of molecular crowding with trimethylamine N-oxide (TMAO) as a zwitterionic and protective osmolyte and urea as a nonionic denaturing osmolyte on conformation and thermodynamics of the canonical DNA duplex and the non-canonical DNA G-quadruplex. It was found that TMAO and urea stabilized and destabilized, respectively, the G-quadruplex. On the other hand, these osmolytes generally destabilize the duplex; however, it was observed that osmolytes having the trimethylamine group stabilized the duplex at the lower concentrations because of a direct binding to a groove of the duplex. These results are useful not only to predict DNA structures and their thermodynamics under physiological environments in living cells, but also design of polymers and materials to regulate structure and stability of DNA sequences. PMID:27933115
Mulholland, Kelly; Siddiquei, Farzana; Wu, Chun
2017-07-19
RHPS4, a potent binder to human telomeric DNA G-quadruplex, shows high efficacy in tumor cell growth inhibition. However, it's preferential binding to DNA G-quadruplex over DNA duplex (about 10 fold) remains to be improved toward its clinical application. A high resolution structure of the single-stranded telomeric DNA G-quadruplexes, or B-DNA duplex, in complex with RHPS4 is not available yet, and the binding nature of this ligand to these DNA forms remains to be elusive. In this study, we carried out 40 μs molecular dynamics binding simulations with a free ligand to decipher the binding pathway of RHPS4 to a DNA duplex and three G-quadruplex folders (parallel, antiparallel and hybrid) of the human telomeric DNA sequence. The most stable binding mode identified for the duplex, parallel, antiparallel and hybrid G-quadruplexes is an intercalation, bottom stacking, top intercalation and bottom intercalation mode, respectively. The intercalation mode with similar binding strength to both the duplex and the G-quadruplexes, explains the lack of binding selectivity of RHPS4 to the G-quadruplex form. Therefore, a ligand modification that destabilizes the duplex intercalation mode but stabilizes the G-quadruplex intercalation mode will improve the binding selectivity toward G-quadruplex. The intercalation mode of RHPS4 to both the duplex and the antiparallel and the hybrid G-quadruplex follows a base flipping-insertion mechanism rather than an open-insertion mechanism. The groove binding, the side binding and the intercalation with flipping out of base were observed to be intermediate states before the full intercalation state with paired bases.
Base opening in RNA and DNA duplexes: implication for RNA stability.
Chen, Y Z; Mohan, V; Griffey, R H
2000-05-01
The energetics of a low-energy single base opening in several RNA duplex crystal structures has been calculated and compared to DNA duplexes. Base opening in RNA appears to have an overall preference towards the major groove, similar to results previously reported for B-DNA. Movement of each of the adenine, uracil, and cytosine bases into the minor groove is blocked by a high-energy barrier due to severe close contact with neighboring bases. Guanine bases are able to open towards both grooves because of the unique orientation of the base that avoids steric clash along the opening pathway. RNA bases are found to have a substantially smaller major groove opening extent than that of their B-DNA counterparts. A comparison with base opening behavior of A-DNA duplexes suggests that this difference results from helix constraint associated with A-form backbone conformation. The reduced opening extent correlates with the RNA duplex stability and is consistent with observed slower imino proton exchange rates in RNA duplexes.
NDI and DAN DNA: nucleic acid-directed assembly of NDI and DAN.
Ikkanda, Brian A; Samuel, Stevan A; Iverson, Brent L
2014-03-07
Two novel DNA base surrogate phosphoramidites 1 and 2, based upon relatively electron-rich 1,5-dialkoxynaphthalene (DAN) and relatively electron-deficient 1,4,5,8-naphthalenetetracarboxylic diimide (NDI), respectively, were designed, synthesized, and incorporated into DNA oligonucleotide strands. The DAN and NDI artificial DNA bases were inserted within a three-base-pair region within the interior of a 12-mer oligonucleotide duplex in various sequential arrangements and investigated with CD spectroscopy and UV melting curve analysis. The CD spectra of the modified duplexes indicated B-form DNA topology. Melting curve analyses revealed trends in DNA duplex stability that correlate with the known association of DAN and NDI moieties in aqueous solution as well as the known favorable interactions between NDI and natural DNA base pairs. This demonstrates that DNA duplex stability and specificity can be driven by the electrostatic complementarity between DAN and NDI. In the most favorable case, an NDI-DAN-NDI arrangement in the middle of the DNA duplex was found to be approximately as stabilizing as three A-T base pairs.
Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles
Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.
2008-01-01
We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366
Structural mechanisms of DNA binding and unwinding in bacterial RecQ helicases
Manthei, Kelly A.; Hill, Morgan C.; Burke, Jordan E.; ...
2015-03-23
RecQ helicases unwind remarkably diverse DNA structures as key components of many cellular processes. How RecQ enzymes accommodate different substrates in a unified mechanism that couples ATP hydrolysis to DNA unwinding is unknown. In this paper, the X-ray crystal structure of the Cronobacter sakazakii RecQ catalytic core domain bound to duplex DNA with a 3' single-stranded extension identifies two DNA-dependent conformational rearrangements: a winged-helix domain pivots ~90° to close onto duplex DNA, and a conserved aromatic-rich loop is remodeled to bind ssDNA. These changes coincide with a restructuring of the RecQ ATPase active site that positions catalytic residues for ATPmore » hydrolysis. Complex formation also induces a tight bend in the DNA and melts a portion of the duplex. Finally, this bending, coupled with translocation, could provide RecQ with a mechanism for unwinding duplex and other DNA structures.« less
Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip
2016-03-22
Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.
NASA Astrophysics Data System (ADS)
Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip
2016-03-01
Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luo, Zhipu; Dauter, Zbigniew; Gilski, Miroslaw
DNA oligomer duplexes containing alternating cytosines and guanines in their sequences tend to form left-handed helices of the Z-DNA type, with the sugar and phosphate backbone in a zigzag conformation and a helical repeat of two successive nucleotides. Z-DNA duplexes usually crystallize as hexagonally arranged parallel helical tubes, with various relative orientations and translation of neighboring duplexes. Four novel high-resolution crystal structures of d(CGCGCG) 2duplexes are described here. They are characterized by a high degree of pseudosymmetry and/or twinning, with three or four independent duplexes differently oriented in a monoclinicP2 1lattice of hexagonal metric. The various twinning criteria give somewhatmore » conflicting indications in these complicated cases of crystal pathology. The details of molecular packing in these crystal structures are compared with other known crystal forms of Z-DNA.« less
Force-Induced Rupture of a DNA Duplex: From Fundamentals to Force Sensors.
Mosayebi, Majid; Louis, Ard A; Doye, Jonathan P K; Ouldridge, Thomas E
2015-12-22
The rupture of double-stranded DNA under stress is a key process in biophysics and nanotechnology. In this article, we consider the shear-induced rupture of short DNA duplexes, a system that has been given new importance by recently designed force sensors and nanotechnological devices. We argue that rupture must be understood as an activated process, where the duplex state is metastable and the strands will separate in a finite time that depends on the duplex length and the force applied. Thus, the critical shearing force required to rupture a duplex depends strongly on the time scale of observation. We use simple models of DNA to show that this approach naturally captures the observed dependence of the force required to rupture a duplex within a given time on duplex length. In particular, this critical force is zero for the shortest duplexes, before rising sharply and then plateauing in the long length limit. The prevailing approach, based on identifying when the presence of each additional base pair within the duplex is thermodynamically unfavorable rather than allowing for metastability, does not predict a time-scale-dependent critical force and does not naturally incorporate a critical force of zero for the shortest duplexes. We demonstrate that our findings have important consequences for the behavior of a new force-sensing nanodevice, which operates in a mixed mode that interpolates between shearing and unzipping. At a fixed time scale and duplex length, the critical force exhibits a sigmoidal dependence on the fraction of the duplex that is subject to shearing.
Analysis of Structural Flexibility of Damaged DNA Using Thiol-Tethered Oligonucleotide Duplexes
Fujita, Masashi; Watanabe, Shun; Yoshizawa, Mariko; Yamamoto, Junpei; Iwai, Shigenori
2015-01-01
Bent structures are formed in DNA by the binding of small molecules or proteins. We developed a chemical method to detect bent DNA structures. Oligonucleotide duplexes in which two mercaptoalkyl groups were attached to the positions facing each other across the major groove were prepared. When the duplex contained the cisplatin adduct, which was proved to induce static helix bending, interstrand disulfide bond formation under an oxygen atmosphere was detected by HPLC analyses, but not in the non-adducted duplex, when the two thiol-tethered nucleosides were separated by six base pairs. When the insert was five and seven base pairs, the disulfide bond was formed and was not formed, respectively, regardless of the cisplatin adduct formation. The same reaction was observed in the duplexes containing an abasic site analog and the (6–4) photoproduct. Compared with the cisplatin case, the disulfide bond formation was slower in these duplexes, but the reaction rate was nearly independent of the linker length. These results indicate that dynamic structural changes of the abasic site- and (6–4) photoproduct-containing duplexes could be detected by our method. It is strongly suggested that the UV-damaged DNA-binding protein, which specifically binds these duplexes and functions at the first step of global-genome nucleotide excision repair, recognizes the easily bendable nature of damaged DNA. PMID:25679955
Unique Dynamic Properties of DNA Duplexes Containing Interstrand Crosslinks†
Friedman, Joshua I.; Jiang, Yu Lin; Miller, Paul S.; Stivers, James T.
2010-01-01
Bifunctional DNA alkylating agents form a diverse assortment of covalent DNA interstrand crosslinked (ICL) structures that are potent cytotoxins. Since it is implausible that cells could possess distinct DNA repair systems for each individual ICL, it is believed that common structural and dynamic features of ICL damage are recognized, rather than specific structural characteristics of each cross-linking agent. Investigation of the structural and dynamic properties of ICLs that might be important for recognition has been complicated by heterogeneous incorporation of these lesions into DNA. To address this problem we have synthesized and characterized several homogenous ICL-DNAs containing site–specific staggered N4-cytosine-ethyl-N4-cytosine crosslinks. Staggered crosslinks were introduced in two ways: in a manner that preserves the overall structure of B-form duplex DNA, and in a manner that highly distorts the DNA structure, with the goal of understanding how structural and dynamic properties of diverse ICL duplexes might flag these sites for repair. Measurements of base pair opening dynamics in the B-form ICL duplex by 1H NMR linewidth or imino proton solvent exchange showed that the guanine base opposite to the crosslinked cytosine opened at least an order of magnitude more slowly than when in a control matched normal duplex. To a lesser degree, the B-form ICL also induced a decrease in base pair opening dynamics that extended from the site of the crosslink to adjacent base pairs. In contrast, the non-B-form ICL showed extensive conformational dynamics at the site of the cross link, which extended over the entire DNA sequence. Since DNA duplexes containing the B-form and non-B-form ICL crosslinks have both been shown to be incised when incubated in mammalian whole cell extracts, while a matched normal duplex is not, we conclude that intrinsic DNA dynamics is not a requirement for specific damage incision of these ICLs. Instead, we propose a general model where destabilized ICL-duplexes serve to energetically facilitate binding of DNA repair factors that must induce bubbles or other distortions in the duplex. However, the essential requirement for incision is an immobile Y-junction where the repair factors are stably bound at the site of the ICL, and the two DNA strands are unpaired. PMID:21174443
Shen, Zhanhang; Mulholland, Kelly A; Zheng, Yujun; Wu, Chun
2017-09-01
DNA G-quadruplex structures are emerging cancer-specific targets for chemotherapeutics. Ligands that bind to and stabilize DNA G-quadruplexes have the potential to be anti-cancer drugs. Lack of binding selectivity to DNA G-quadruplex over DNA duplex remains a major challenge when attempting to develop G-quadruplex ligands into successful anti-cancer drugs. Thorough understanding of the binding nature of existing non-selective ligands that bind to both DNA quadruplex and DNA duplex will help to address this challenge. Daunomycin and doxorubicin, two commonly used anticancer drugs, are examples of non-selective DNA ligands. In this study, we extended our early all-atom binding simulation studies between doxorubicin and a DNA duplex (d(CGATCG) 2 ) to probe the binding between daunomycin and a parallel DNA quadruplex (d(TGGGGT) 4 ) and DNA duplex. In addition to the end stacking mode, which mimics the mode in the crystal structure, a pure groove binding mode was observed in our free binding simulations. The dynamic and energetic properties of these two binding modes are thoroughly examined, and a detailed comparison is made between DNA quadruplex binding modes and DNA duplex binding modes. Implications on the design of more selective DNA quadruplex ligands are also discussed. Graphical abstract Top stacking and groov binding modes from the MD simulations.
Effect of C(60) fullerene on the duplex formation of i-motif DNA with complementary DNA in solution.
Jin, Kyeong Sik; Shin, Su Ryon; Ahn, Byungcheol; Jin, Sangwoo; Rho, Yecheol; Kim, Heesoo; Kim, Seon Jeong; Ree, Moonhor
2010-04-15
The structural effects of fullerene on i-motif DNA were investigated by characterizing the structures of fullerene-free and fullerene-bound i-motif DNA, in the presence of cDNA and in solutions of varying pH, using circular dichroism and synchrotron small-angle X-ray scattering. To facilitate a direct structural comparison between the i-motif and duplex structures in response to pH stimulus, we developed atomic scale structural models for the duplex and i-motif DNA structures, and for the C(60)/i-motif DNA hybrid associated with the cDNA strand, assuming that the DNA strands are present in an ideal right-handed helical conformation. We found that fullerene shifted the pH-induced conformational transition between the i-motif and the duplex structure, possibly due to the hydrophobic interactions between the terminal fullerenes and between the terminal fullerenes and an internal TAA loop in the DNA strand. The hybrid structure showed a dramatic reduction in cyclic hysteresis.
Effect of Cavity Size of Mesoporous Silica on Short DNA Duplex Stability.
Masuda, Tsubasa; Shibuya, Yuuta; Arai, Shota; Kobayashi, Sayaka; Suzuki, Sotaro; Kijima, Jun; Itoh, Tetsuji; Sato, Yusuke; Nishizawa, Seiichi; Yamaguchi, Akira
2018-05-15
We studied the stabilities of short (4- and 3-bp) DNA duplexes within silica mesopores modified with a positively charged trimethyl aminopropyl (TMAP) monolayer (BJH pore diameter 1.6-7.4 nm). The DNA fragments with fluorescent dye were introduced into the pores, and their fluorescence resonance energy transfer (FRET) response was measured to estimate the structuring energies of the short DNA duplexes under cryogenic conditions (temperature 233-323 K). The results confirmed the enthalpic stability gain of the duplex within size-matched pores (1.6 and 2.3 nm). The hybridization equilibrium constants found for the size-matched pores were 2 orders of magnitude larger than those for large pores (≥3.5 nm), and this size-matching effect for the enhanced duplex stability was explained by a tight electrostatic interaction between the duplex and the surface TMAP groups. These results indicate the requirement of the precise regulation of mesopore size to ensure the stabilization of hydrogen-bonded supramolecular assemblies.
Pang, Jie; Zhang, Ziping; Jin, Haizhu
2016-03-15
Electrochemical aptamer-based (E-AB) sensors employing electrode-immobilized, redox-tagged aptamer probes have emerged as a promising platform for the sensitive and quick detection of target analytes ranging from small molecules to proteins. Signal generation in this class of sensor is linked to change in electron transfer efficiency upon binding-induced change in flexibility/conformation of the aptamer probe. Because of this signaling mechanism, signal gains of these sensors can be improved by employing a displacement-based recognition system, which links target binding with a large-scale flexibility/conformation shift from the aptamer-DNA duplex to the single-stranded DNA or the native aptamer. Despite the relatively large number of displacement-based E-AB sensor samples, little attention has been paid to the structure variation of the aptamer-DNA duplex probe. Here we detail the effects of complementary length and position of the aptamer-DNA duplex probe on the performance of a model displacement-based E-AB sensor for ATP. We find that, greater background suppression and signal gain are observed with longer complementary length of the aptamer-DNA duplex probe. However, sensor equilibration time slows monotonically with increasing complementary length; and with too many target binding sites in aptamer sequence being occupied by the complementary DNA, the aptamer-target binding does not occur and no signal gain observed. We also demonstrate that signal gain of the displacement-based E-AB sensor is strongly dependent on the complementary position of the aptamer-DNA duplex probe, with complementary position located at the electrode-attached or redox-tagged end of the duplex probe, larger background suppression and signal increase than that of the middle position are observed. These results highlight the importance of rational structure design of the aptamer-DNA duplex probe and provide new insights into the optimization of displacement-based E-AB sensors. Copyright © 2015 Elsevier B.V. All rights reserved.
Aarattuthodiyil, Suja; Byrd, Alicia K.; Raney, Kevin D.
2014-01-01
Interactions between helicases and the tracking strand of a DNA substrate are well-characterized; however, the role of the displaced strand is a less understood characteristic of DNA unwinding. Dda helicase exhibited greater processivity when unwinding a DNA fork compared to a ss/ds DNA junction substrate. The lag phase in the unwinding progress curve was reduced for the forked DNA compared to the ss/ds junction. Fewer kinetic steps were required to unwind the fork compared to the ss/ds junction, suggesting that binding to the fork leads to disruption of the duplex. DNA footprinting confirmed that interaction of Dda with a fork leads to two base pairs being disrupted whereas no disruption of base pairing was observed with the ss/ds junction. Neutralization of the phosphodiester backbone resulted in a DNA-footprinting pattern similar to that observed with the ss/ds junction, consistent with disruption of the interaction between Dda and the displaced strand. Several basic residues in the 1A domain which were previously proposed to bind to the incoming duplex DNA were replaced with alanines, resulting in apparent loss of interaction with the duplex. Taken together, these results suggest that Dda interaction with the tracking strand, displaced strand and duplex coordinates DNA unwinding. PMID:25249618
An intercalation-locked parallel-stranded DNA tetraplex
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
2015-01-27
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
M-DNA: a self-assembling molecular wire for nanoelectronics and biosensing.
Wettig, Shawn D; Li, Chen-Zhong; Long, Yi-Tao; Kraatz, Heinz-Bernhard; Lee, Jeremy S
2003-01-01
M-DNA is a complex between divalent metal ions such as Zn2+ and duplex DNA which forms at pH 8.5. Unlike B-DNA, M-DNA does not bind ethidium so that M-DNA formation can be monitored conveniently by an ethidium fluorescence assay. M-DNA was shown to be a better conductor than B-DNA by fluorometric measurements of electron transport in donor-acceptor labelled duplexes; by direct conductivity measurements of M-DNA bound between gold electrodes and by cyclic voltammetric studies on ferrocene labelled duplexes attached to gold microelectrodes. As is the case with B-DNA, M-DNA can self-assemble into a variety of structures and is anticipated to find widespread use in nanoelectronics and biosensing.
Gupta, Sharad K; Sur, Souvik; Prasad Ojha, Rajendra; Tandon, Vibha
2013-07-01
This paper describes the synthesis of a novel 8-aza-7-deazapurin-2,6-diamine (DPP)-containing peptide nucleic acid (PNA) monomer and Boc protecting group-based oligomerization of PNA, replacing adenine (A) with DPP monomers in the PNA strand. The PNA oligomers were synthesized against the biologically relevant SV40 promoter region (2494-AATTTTTTTTATTTA-2508) of pEGFP-N3 plasmid. The DPP-PNA·DNA duplex showed enhanced stability as compared to normal duplex (A-PNA·DNA). The electronic distribution of DPP monomer suggested that DPP had better electron donor properties over 2,6-diamino purine. UV melting and thermodynamic analysis revealed that the PNA oligomer containing a diaminopyrazolo(3,4-d)pyrimidine moiety (DPP) stabilized the PNA·DNA hybrids compared to A-PNA·DNA. DPP-PNA·DNA duplex showed higher water activity (Δnw = 38.5) in comparison to A-PNA·DNA duplex (Δnw = 14.5). The 50 ns molecular dynamics simulations of PNA·DNA duplex containing DPP or unmodified nucleobase-A showed average H-bond distances in the DPP-dT base pair of 2.90 Å (OH-N bond) and 2.91 Å (NH-N bond), which were comparably shorter than in the A-dT base pair, in which the average distances were 3.18 Å (OH-N bond) and 2.97 Å (NH-N bond), and there was one additional H-bond in the DPP-dT base pair of around 2.98 Å (O2H-N2 bond), supporting the higher stability of DPP-PNA·DNA. The analysis of molecular dynamics simulation data showed that the system binding free energy increased at a rate of approximately -4.5 kcal mol(-1) per DPP base of the PNA·DNA duplex. In summary, increased thermal stability, stronger hydrogen bonding and more stable conformation in the DPP-PNA·DNA duplex make it a better candidate as antisense/antigene therapeutic agents.
Soares, Marcelo B.; Efstratiadis, Argiris
1997-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Soares, M.B.; Efstratiadis, A.
1997-06-10
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Nikzad, Jafar; Shahhosseini, Soraya; Tabarzad, Maryam; Nafissi-Varcheh, Nastaran; Torshabi, Maryam
2017-02-14
In the pharmaceutical industry, hard- and soft-shelled capsules are typically made from gelatin, commonly derived from bovine and porcine sources. To ensure that pharmaceutical products comply with halal regulations in Muslim countries (no porcine products allowed), development of a valid, reliable, quick, and most importantly, cost-effective tests are of utmost importance. We developed a species-specific duplex polymerase chain reaction (PCR) assay targeting 149 bp porcine and 271 bp bovine mitochondrial DNA (mtDNA) to simultaneously detect both porcine and bovine DNA (in one reaction at the same time) in gelatin. Some additional simplex PCR tests (targeting 126 bp bovine and 212 bp porcine mtDNA) and real-time PCR using a commercially available kit (for identification of porcine DNA) were used to verify the selectivity and sensitivity of our duplex PCR. After optimization of DNA extraction and PCR methods, hard/soft pharmaceutical gelatin capsules (containing drug) were tested for the presence of porcine and/or bovine DNA. Duplex PCR detected the presence of as little as 0.1% porcine DNA, which was more accurate than the commercially available kit. Of all gelatin capsules tested (n = 24), 50% contained porcine DNA (pure porcine gelatin alone or in combination with bovine gelatin). Duplex PCR presents an easy-to-follow, quick, low-cost and reliable method to simultaneously detect porcine and bovine DNAs (>100 bp) in minute amounts in highly processed gelatin-containing pharmaceutical products (with a 0.1% sensitivity for porcine DNA) which may be used for halal authentication. Simultaneous detection of porcine and bovine DNA in gelatin capsules by duplex PCR.
Methods And Devices For Characterizing Duplex Nucleic Acid Molecules
Akeson, Mark; Vercoutere, Wenonah; Haussler, David; Winters-Hilt, Stephen
2005-08-30
Methods and devices are provided for characterizing a duplex nucleic acid, e.g., a duplex DNA molecule. In the subject methods, a fluid conducting medium that includes a duplex nucleic acid molecule is contacted with a nanopore under the influence of an applied electric field and the resulting changes in current through the nanopore caused by the duplex nucleic acid molecule are monitored. The observed changes in current through the nanopore are then employed as a set of data values to characterize the duplex nucleic acid, where the set of data values may be employed in raw form or manipulated, e.g., into a current blockade profile. Also provided are nanopore devices for practicing the subject methods, where the subject nanopore devices are characterized by the presence of an algorithm which directs a processing means to employ monitored changes in current through a nanopore to characterize a duplex nucleic acid molecule responsible for the current changes. The subject methods and devices find use in a variety of applications, including, among other applications, the identification of an analyte duplex DNA molecule in a sample, the specific base sequence at a single nulceotide polymorphism (SNP), and the sequencing of duplex DNA molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tripathi, S.; Zhang, D.; Paukstelis, P. J.
DNA has proved to be an excellent material for nanoscale construction because complementary DNA duplexes are programmable and structurally predictable. However, in the absence of Watson–Crick pairings, DNA can be structurally more diverse. Here, we describe the crystal structures of d(ACTCGGATGAT) and the brominated derivative, d(AC BrUCGGA BrUGAT). These oligonucleotides form parallel-stranded duplexes with a crystallographically equivalent strand, resulting in the first examples of DNA crystal structures that contains four different symmetric homo base pairs. Two of the parallel-stranded duplexes are coaxially stacked in opposite directions and locked together to form a tetraplex through intercalation of the 5'-most A–A basemore » pairs between adjacent G–G pairs in the partner duplex. The intercalation region is a new type of DNA tertiary structural motif with similarities to the i-motif. 1H– 1H nuclear magnetic resonance and native gel electrophoresis confirmed the formation of a parallel-stranded duplex in solution. Finally, we modified specific nucleotide positions and added d(GAY) motifs to oligonucleotides and were readily able to obtain similar crystals. This suggests that this parallel-stranded DNA structure may be useful in the rational design of DNA crystals and nanostructures.« less
Sheng, Jia; Hassan, Abdalla E A; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S; Huang, Zhen
2011-05-01
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. © The Author(s) 2011. Published by Oxford University Press.
Sheng, Jia; Hassan, Abdalla E. A.; Zhang, Wen; Zhou, Jianfeng; Xu, Bingqian; Soares, Alexei S.; Huang, Zhen
2011-01-01
We report here the first synthesis of 5-phenyl–telluride–thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNA duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation. PMID:21245037
Kaushik, Mahima; Kukreti, Shrikant
2006-01-01
Structural polymorphism of DNA is a widely accepted property. A simple addition to this perception has been our recent finding, where a single nucleotide polymorphism (SNP) site present in a quasipalindromic sequence of beta-globin LCR exhibited a hairpin-duplex equilibrium. Our current studies explore that secondary structures adopted by individual complementary strands compete with formation of a perfect duplex. Using gel-electrophoresis, ultraviolet (UV)-thermal denaturation, circular dichroism (CD) techniques, we have demonstrated the structural transitions within a perfect duplex containing 11 bp quasipalindromic stretch (TGGGG(G/C)CCCCA), to hairpins and bulge duplex forms. The extended version of the 11 bp duplex, flanked by 5 bp on both sides also demonstrated conformational equilibrium between duplex and hairpin species. Gel-electrophoresis confirms that the duplex coexists with hairpin and bulge duplex/cruciform species. Further, in CD spectra of duplexes, presence of two overlapping positive peaks at 265 and 285 nm suggest the features of A- as well as B-type DNA conformation and show oligomer concentration dependence, manifested in A --> B transition. This indicates the possibility of an architectural switching at quasipalindromic region between linear duplex to a cruciform structure. Such DNA structural variations are likely to be found in the mechanics of molecular recognition and manipulation by proteins.
Suresh, Gorle; Priyakumar, U Deva
2015-09-01
Modified nucleic acids have found profound applications in nucleic acid based technologies such as antisense and antiviral therapies. Previous studies on chemically modified nucleic acids have suggested that modifications incorporated in furanose sugar especially at 2'-position attribute special properties to nucleic acids when compared to other modifications. 2'-O-methyl modification to deoxyribose sugars of DNA-RNA hybrids is one such modification that increases nucleic acid stability and has become an attractive class of compounds for potential antisense applications. It has been reported that modification of DNA strands with 2'-O-methyl group reverses the thermodynamic stability of DNA-RNA hybrid duplexes. Molecular dynamics simulations have been performed on two hybrid duplexes (DR and RD) which differ from each other and 2'-O-methyl modified counterparts to investigate the effect of 2'-O-methyl modification on their duplex stability. The results obtained suggest that the modification drives the conformations of both the hybrid duplexes towards A-RNA like conformation. The modified hybrid duplexes exhibit significantly contrasting dynamics and hydration patterns compared to respective parent duplexes. In line with the experimental results, the relative binding free energies suggest that the introduced modifications stabilize the less stable DR hybrid, but destabilize the more stable RD duplex. Binding free energy calculations suggest that the increased hydrophobicity is primarily responsible for the reversal of thermodynamic stability of hybrid duplexes. Free energy component analysis further provides insights into the stability of modified duplexes. Copyright © 2015 Elsevier Inc. All rights reserved.
Circularly polarized luminescence of helically assembled pyrene π-stacks on RNA and DNA duplexes.
Nakamura, Mitsunobu; Ota, Fuyuki; Takada, Tadao; Akagi, Kazuo; Yamana, Kazushige
2018-05-01
In this report, we describe the circularly polarized luminescence (CPL) of the RNA duplexes having one to four 2'-O-pyrene modified uridines (Upy) and the DNA duplexes having two, four, and six pyrene modified non-nucleosidic linkers (Py). Both the pyrene π-stack arrays formed on the RNA and DNA double helical structures exhibited pyrene excimer fluorescence. In the pyrene-modified RNA systems, the RNA duplex having four Upys gives CPL emission with g lum value of <0.01 at 480 nm. The structure of pyrene stacks on the RNA duplex may be rigidly regulated with increase in the Upy domains, which resulted in the CPL emission. In the DNA systems, the pyrene-modified duplexes containing two and four Pys exhibited CPL emission with g lum values of <0.001 at 505 nm. The pyrene π-stack arrays presented here show CPL emission. However, the g lum values are relatively small when compared with our previous system consisting of the pyrene-zipper arrays on RNA. © 2018 Wiley Periodicals, Inc.
Ho, Dominik; Dose, Christian; Albrecht, Christian H.; Severin, Philip; Falter, Katja; Dervan, Peter B.; Gaub, Hermann E.
2009-01-01
Force-based ligand detection is a promising method to characterize molecular complexes label-free at physiological conditions. Because conventional implementations of this technique, e.g., based on atomic force microscopy or optical traps, are low-throughput and require extremely sensitive and sophisticated equipment, this approach has to date found only limited application. We present a low-cost, chip-based assay, which combines high-throughput force-based detection of dsDNA·ligand interactions with the ease of fluorescence detection. Within the comparative unbinding force assay, many duplicates of a target DNA duplex are probed against a defined reference DNA duplex each. The fractions of broken target and reference DNA duplexes are determined via fluorescence. With this assay, we investigated the DNA binding behavior of artificial pyrrole-imidazole polyamides. These small compounds can be programmed to target specific dsDNA sequences and distinguish between D- and L-DNA. We found that titration with polyamides specific for a binding motif, which is present in the target DNA duplex and not in the reference DNA duplex, reliably resulted in a shift toward larger fractions of broken reference bonds. From the concentration dependence nanomolar to picomolar dissociation constants of dsDNA·ligand complexes were determined, agreeing well with prior quantitative DNAase footprinting experiments. This finding corroborates that the forced unbinding of dsDNA in presence of a ligand is a nonequilibrium process that produces a snapshot of the equilibrium distribution between dsDNA and dsDNA·ligand complexes. PMID:19486688
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1996-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1996-01-09
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form. The method comprises: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.
Recombinant DHX33 Protein Possesses Dual DNA/RNA Helicase Activity.
Wang, Xingshun; Ge, Wei; Zhang, Yandong
2018-06-13
RNA helicase DHX33 has been shown to participate in a variety of cellular activities, including ribosome biogenesis, protein translation, and gene transcription. We and others further discovered that DHX33 is strongly expressed in several types of human cancers and plays important roles in promoting cancer cell proliferation. To better understand the molecular mechanism for DHX33 in exerting its biological functions, we purified recombinant DHX33 and performed biochemical studies in vitro. DHX33 protein was found to have ATPase activity that is dependent on DNA or RNA duplexes. The ATPase activity of DHX33 is coupled with its RNA/DNA unwinding activity. If a key residue in the ATP binding site were mutated, the mutant DHX33 could not unwind DNA/RNA duplexes. Furthermore, a deletion mutant of a RKK motif previously identified to be involved in ribosome DNA binding could still unwind DNA duplexes, albeit with reduced efficiency. In summary, our study reveals that purified DHX33 protein possesses unwinding activity toward DNA and RNA duplexes.
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes
2007-10-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
Free Energy Gap and Statistical Thermodynamic Fidelity of DNA Codes (Postprint)
2007-01-01
reverse-complement unless otherwise stated. For strand x, let Nx denote its complement. A (perfect) Watson - Crick duplex is the joining of complement...is possible for complementary sequences to form a non-perfectly aligned duplex, we will call any x W Nx duplex a Watson - Crick (WC) duplex. Two...DATES COVERED (From - To) 4. TITLE AND SUBTITLE FREE ENERGY GAP AND STATISTICAL THERMODYNAMIC FIDELITY OF DNA CODES 5a. CONTRACT NUMBER FA8750-07
[A Duplex PCR Method for Detection of Babesia caballi and Theileria equi].
Zhang, Yang; Zhang, Yu-ting; Wang, Zhen-bao; Bolati; Li, Hai; Bayinchahan
2015-04-01
To develop a duplex PCR assay for detection of Babesia caballi and Theileria equi. Two pairs of primers were designed according to the BC48 gene of B. caballi and 18 s rRNA gene of T. equi, and a duplex PCR assay was developed by the optimization of reaction conditions. The specificity, sensitivity and reliability of the method were tested. The horse blood samples of suspected cases were collected from Yili region, and detected by the duplex PCR, microspopy, conventional PCR, and fluorescence quantitative PCR, and the results were compared. Using the duplex PCR assay, the specific fragments of 155 bp and 280 bp were amplified from DNA samples of B. caballi and T. equi, respectively. No specific fragment was amplified from DNA samples of B. bigemina, Theilerdia annulata, Theilerdia sergenti, Toxoplasma gondii, Neospora caninum, and Trypanosoma evansi. The limit of detection was 4.85 x 10(5) copies/L for B. caballi DNA and 4.85 x 10(4) copies/µl for T. equi DNA, respectively. Among the 24 blood samples, 11 were found B. caballi-positive by the duplex PCR assay, and 18 were T. equi-positive. The coincidence rate of microscopy, conventional PCR, and fluorescence quantitative PCR with duplex PCR was 91.7% (22/24), 95.8% (23/24), and 95.8% (23/24), respectively. A duplex PCR assay for simultaneous detection of B. caballi and T. equi is established.
Kondo, Jiro; Yamada, Tom; Hirose, Chika; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2014-02-24
The metallo DNA duplex containing mercury-mediated T-T base pairs is an attractive biomacromolecular nanomaterial which can be applied to nanodevices such as ion sensors. Reported herein is the first crystal structure of a B-form DNA duplex containing two consecutive T-Hg(II)-T base pairs. The Hg(II) ion occupies the center between two T residues. The N3-Hg(II) bond distance is 2.0 Å. The relatively short Hg(II)-Hg(II) distance (3.3 Å) observed in consecutive T-Hg(II)-T base pairs suggests that the metallophilic attraction could exist between them and may stabilize the B-form double helix. To support this, the DNA duplex is largely distorted and adopts an unusual nonhelical conformation in the absence of Hg(II). The structure of the metallo DNA duplex itself and the Hg(II)-induced structural switching from the nonhelical form to the B-form provide the basis for structure-based design of metal-conjugated nucleic acid nanomaterials. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-01-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions. PMID:9443977
Solution structure of a highly stable DNA duplex conjugated to a minor groove binder.
Kumar, S; Reed, M W; Gamper, H B; Gorn, V V; Lukhtanov, E A; Foti, M; West, J; Meyer, R B; Schweitzer, B I
1998-02-01
The tripeptide 1,2-dihydro-(3 H )-pyrrolo[3,2- e ]indole-7-carboxylate (CDPI3) binds to the minor groove of DNA with high affinity. When this minor groove binder is conjugated to the 5'-end of short oligonucleotides the conjugates form unusually stable hybrids with complementary DNA and thus may have useful diagnostic and/or therapeutic applications. In order to gain an understanding of the structural interactions between the CDPI3minor groove binding moiety and the DNA, we have determined and compared the solution structure of a duplex consisting of oligodeoxyribonucleotide 5'-TGATTATCTG-3' conjugated at the 5'-end to CDPI3 and its complementary strand to an unmodified control duplex of the same sequence using nuclear magnetic resonance techniques. Thermal denaturation studies indicated that the hybrid of this conjugate with its complementary strand had a melting temperature that was 30 degrees C higher compared with the unmodified control duplex. Following restrained molecular dynamics and relaxation matrix refinement, the solution structure of the CDPI3-conjugated DNA duplex demonstrated that the overall shape of the duplex was that of a straight B-type helix and that the CDPI3moiety was bound snugly in the minor groove, where it was stabilized by extensive van der Waal's interactions.
Method for construction of normalized cDNA libraries
Soares, Marcelo B.; Efstratiadis, Argiris
1998-01-01
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.
Method for construction of normalized cDNA libraries
Soares, M.B.; Efstratiadis, A.
1998-11-03
This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Noy, A
2004-05-04
Modern force microscopy techniques allow researchers to use mechanical forces to probe interactions between biomolecules. However, such measurements often happen in non-equilibrium regime, which precludes straightforward extraction of the equilibrium energy information. Here we use the work averaging method based on Jarzynski equality to reconstruct the equilibrium interaction potential from the unbinding of a complementary 14-mer DNA duplex from the results of non-equilibrium single-molecule measurements. The reconstructed potential reproduces most of the features of the DNA stretching transition, previously observed only in equilibrium stretching of long DNA sequences. We also compare the reconstructed potential with the thermodynamic parameters of DNAmore » duplex unbinding and show that the reconstruction accurately predicts duplex melting enthalpy.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
J Sheng; A Hassan; W Zhang
2011-12-31
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheng, J.; Soares, A.; Hassan, A. E. A.
2011-05-01
We report here the first synthesis of 5-phenyl-telluride-thymidine derivatives and the Te-phosphoramidite. We also report here the synthesis, structure and STM current-imaging studies of DNA oligonucleotides containing the nucleobases (thymine) derivatized with 5-phenyl-telluride functionality (5-Te). Our results show that the 5-Te-DNA is stable, and that the Te-DNA duplex has the thermo-stability similar to the corresponding native duplex. The crystal structure indicates that the 5-Te-DNA duplex structure is virtually identical to the native one, and that the Te-modified T and native A interact similarly to the native T and A pair. Furthermore, while the corresponding native showed weak signals, the DNAmore » duplex modified with electron-rich tellurium functionality showed strong topographic and current peaks by STM imaging, suggesting a potential strategy to directly image DNA without structural perturbation.« less
Poomsuk, Nattawee; Vilaivan, Tirayut; Siriwong, Khatcharin
2018-06-12
Peptide nucleic acid (PNA) is a powerful biomolecule with a wide variety of important applications. In this work, the molecular structures and binding affinity of PNA with a D-prolyl-2-aminocyclopentane carboxylic acid backbone (acpcPNA) that binds to both DNA and RNA were studied using molecular dynamics simulations. The simulated structures of acpcPNA-DNA and acpcPNA-RNA duplexes more closely resembled the typical structures of B-DNA and A-RNA than the corresponding duplexes of aegPNA. The calculated binding free energies are in good agreement with the experimental results that the acpcPNA-DNA duplex is more stable than the acpcPNA-RNA duplex regardless of the base sequences. The results provide further insights in the relationship between structure and stability of this unique PNA system. Copyright © 2018 Elsevier Inc. All rights reserved.
Kocalka, Petr; Andersen, Nicolai K; Jensen, Frank; Nielsen, Poul
2007-11-23
A general protocol for converting alkyl and aryl halides into azides and for converting these in situ into 1,4-disubstituted triazoles was applied with 5-ethynyl-2'-deoxyuridine. This afforded three modified 2'-deoxyuridine analogues with either unsubstituted or 1-phenyl-/1-benzyl-substituted triazoles in their 5-positions. Modelling demonstrates coplanarity of the two heteroaromatic rings, and UV spectroscopy showed the uracil pK(a) values to be almost unchanged. The three nucleosides were introduced into nonamer oligonucleotides by phosphoramidite chemistry. The heteroaromatic triazoles became positioned in the major grooves of the short dsDNA and DNA-RNA duplexes. While single modifications led to decreased duplex stability, the stacking of four consecutive modifications led to enhanced duplex stability, especially for DNA-RNA duplexes. The duplex structures were studied by CD spectroscopy and molecular dynamics simulations, which supported the conjecture that the duplex stabilizing effect is due to efficient stacking of the heteroaromatic triazoles.
Bhattacharjee, Snehasish; Chakraborty, Sandipan; Sengupta, Pradeep K; Bhowmik, Sudipta
2016-09-01
Guanine-rich sequences have the propensity to fold into a four-stranded DNA structure known as a G-quadruplex (G4). G4 forming sequences are abundant in the promoter region of several oncogenes and become a key target for anticancer drug binding. Here we have studied the interactions of two structurally similar dietary plant flavonoids fisetin and naringenin with G4 as well as double stranded (duplex) DNA by using different spectroscopic and modeling techniques. Our study demonstrates the differential binding ability of the two flavonoids with G4 and duplex DNA. Fisetin more strongly interacts with parallel G4 structure than duplex DNA, whereas naringenin shows stronger binding affinity to duplex rather than G4 DNA. Molecular docking results also corroborate our spectroscopic results, and it was found that both of the ligands are stacked externally in the G4 DNA structure. C-ring planarity of the flavonoid structure appears to be a crucial factor for preferential G4 DNA recognition of flavonoids. The goal of this study is to explore the critical effects of small differences in the structure of closely similar chemical classes of such small molecules (flavonoids) which lead to the contrasting binding properties with the two different forms of DNA. The resulting insights may be expected to facilitate the designing of the highly selective G4 DNA binders based on flavonoid scaffolds.
Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction
Chen, Xian; Gupta, Goutam; Bradbury, E. Morton
2001-01-01
Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.
Atomistic Simulations of Complex DNA DSBs and the Interactions with Ku70/80 Heterodimer
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2011-01-01
Compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex. Binding of Ku drastically reduces the structural disruption and flexibility caused by the complex lesions. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. Binding of Ku promotes the rigidity of DNA duplexes, due to the clamp structure of the inner surface of the rings of Ku70/80.
Synthesis and structures of a pincer-type rhodium(iii) complex: reactivity toward biomolecules.
Milutinović, Milan M; Bogojeski, Jovana V; Klisurić, Olivera; Scheurer, Andreas; Elmroth, Sofi K C; Bugarčić, Živadin D
2016-10-04
A novel rhodium(iii) complex [Rh III (H 2 L tBu )Cl 3 ] (1) (H 2 L tBu = 2,6-bis(5-tert-butyl-1H-pyrazol-3-yl)pyridine) containing a pincer type, tridentate nitrogen-donor chelate system was synthesized. Single crystal X-ray structure analysis revealed that 1 crystallizes in the orthorhombic space group Pbcn with a = 20.7982(6), b = 10.8952(4), c = 10.9832(4) Å, V = 2488.80(15) Å 3 , and eight molecules in the unit cell. The rhodium center in the complex [Rh III (H 2 L tBu )Cl 3 ] (1) is coordinated in a slightly distorted octahedral geometry by the tridentate N,N,N-donor and three chloro ligands, adopting a mer arrangement with an essentially planar ligand skeleton. Due to the tridentate coordination of the N,N,N-donor, the central nitrogen atom N1 is located closer to the Rh III center. The reactivity of the synthesized complex toward small biomolecules (l-methionine (l-Met), guanosine-5'-monophosphate (5'-GMP), l-histidine (l-His) and glutathione (GSH)) and to a series of duplex DNAs and RNA was investigated. The order of reactivity of the studied small biomolecules is: 5'-GMP > GSH > l-Met > l-His. Duplex RNA reacts faster with the [Rh III (H 2 L tBu )Cl 3 ] complex than duplex DNA, while shorter duplex DNA (15mer GG) reacts faster compared with 22mer GG duplex DNA. In addition, a higher reactivity is achieved with a DNA duplex with a centrally located GG-sequence than with a 22GTG duplex DNA, in which the GG-sequence is separated by a T base. Furthermore, the interaction of this metal complex 1 with calf thymus DNA (CT-DNA) and bovine serum albumin (BSA) was examined by absorption (UV-Vis) and emission spectral studies (EthBr displacement studies). Overall, the studied complex exhibited good DNA and BSA interaction ability.
Noronha, Anne M; Noll, David M; Wilds, Christopher J; Miller, Paul S
2002-01-22
The preparation and physical properties of short DNA duplexes that contain a N(4)C-ethyl-N(4)C interstrand cross-link are described. Duplexes that contain an interstrand cross-link between mismatched C-C residues and duplexes in which the C residues of a -CG- or -GC- step are linked to give "staggered" interstrand cross-links were prepared using a novel N(4)C-ethyl-N(4)C phosphoramidite reagent. Duplexes with the C-C mismatch cross-link have UV thermal transition temperatures that are 25 degrees C higher than the melting temperatures of control duplexes in which the cross-link is replaced with a G-C base pair. It appears that this cross-link stabilizes adjacent base pairs and does not perturb the structure of the helix, a conclusion that is supported by the CD spectrum of this duplex and by molecular models. An even higher level of stabilization, 49 degrees C, is seen with the duplex that contains a -CG- staggered cross-link. Molecular models suggest that this cross-link may induce propeller twisting in the cross-linked base pairs, and the CD spectrum of this duplex exhibits an unusual negative band at 298 nm, although the remainder of the spectrum is similar to that of B-form DNA. Mismatched C-C or -CG- staggered cross-linked duplexes that have complementary overhanging ends can undergo self-ligation catalyzed by T4 DNA ligase. Analysis of the ligated oligomers by nondenaturing polyacrylamide gel electrophoresis shows that the resulting oligomers migrate in a manner similar to that of a mixture of non-cross-linked control oligomers and suggests that these cross-links do not result in significant bending of the helix. However, the orientation of the staggered cross-link can have a significant effect on the structure and stability of the cross-linked duplex. Thus, the thermal stability of the duplex that contains a -GC- staggered cross-link is 10 degrees C lower than the melting temperature of the control, non-cross-linked duplex. Unlike the -CG- staggered cross-link, in which the cross-linked base pairs can still maintain hydrogen bond contacts, molecular models suggest that formation of the -GC- staggered cross-link disrupts hydrogen bonding and may also perturb adjacent base pairs leading to an overall reduction in helix stability. Duplexes with specifically positioned and oriented cross-links can be used as substrates to study DNA repair mechanisms.
Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-01-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744
Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-08-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.
Zeng, Yan; Wan, Yi; Zhang, Dun; Qi, Peng
2015-01-01
A novel magneto-DNA duplex probe for bacterial DNA detection based on exonuclease III (Exo-III) aided cycling amplification has been developed. This magneto-DNA duplex probe contains a partly hybrid fluorophore-modified capture probe and a fluorophore-modified signal probe with magnetic microparticle as carrier. In the presence of a perfectly matched target bacterial DNA, blunt 3'-terminus of the capture probe is formed, activating the Exo-III aided cycling amplification. Thus, Exo-III catalyzes the stepwise removal of mononucleotides from this terminus, releasing both fluorophore-modified signal probe, fluorescent dyes of the capture probe and target DNA. The released target DNA then starts a new cycle, while released fluorescent fragments are recovered with magnetic separation for fluorescence signal collection. This system exhibited sensitive detection of bacterial DNA, with a detection limit of 14 pM because of the unique cleavage function of Exo-III, high fluorescence intensity, and separating function of magneto-DNA duplex probes. Besides this sensitivity, this strategy exhibited excellent selectivity with mismatched bacterial DNA targets and other bacterial species targets and good applicability in real seawater samples, hence, this strategy could be potentially used for qualitative and quantitative analysis of bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.
Su'etsugu, Masayuki; Takata, Makoto; Kubota, Toshio; Matsuda, Yusaku; Katayama, Tsutomu
2004-06-01
In Escherichia coli, the ATP-DnaA protein initiates chromosomal replication. After the DNA polymerase III holoenzyme is loaded on to DNA, DnaA-bound ATP is hydrolysed in a manner depending on Hda protein and the DNA-loaded form of the DNA polymerase III sliding clamp subunit, which yields ADP-DnaA, an inactivated form for initiation. This regulatory DnaA-inactivation represses extra initiation events. In this study, in vitro replication intermediates and structured DNA mimicking replicational intermediates were first used to identify structural prerequisites in the process of DnaA-ATP hydrolysis. Unlike duplex DNA loaded with sliding clamps, primer RNA-DNA heteroduplexes loaded with clamps were not associated with DnaA-ATP hydrolysis, and duplex DNA provided in trans did not rescue this defect. At least 40-bp duplex DNA is competent for the DnaA-ATP hydrolysis when a single clamp was loaded. The DnaA-ATP hydrolysis was inhibited when ATP-DnaA was tightly bound to a DnaA box-bearing oligonucleotide. These results imply that the DnaA-ATP hydrolysis involves the direct interaction of ATP-DnaA with duplex DNA flanking the sliding clamp. Furthermore, Hda protein formed a stable complex with the sliding clamp. Based on these, we suggest a mechanical basis in the DnaA-inactivation that ATP-DnaA interacts with the Hda-clamp complex with the aid of DNA binding. Copyright Blackwell Publishing Limited
Photophysical Characterization of Enhanced 6-Methylisoxanthopterin Fluorescence in Duplex DNA.
Moreno, Andrew; Knee, J L; Mukerji, Ishita
2016-12-08
The structure and dynamic motions of bases in DNA duplexes and other constructs are important for understanding mechanisms of selectivity and recognition of DNA-binding proteins. The fluorescent guanine analogue, 6-methylisoxanthopterin 6-MI, is well suited to this purpose as it exhibits an unexpected 3- to 4-fold increase in relative quantum yield upon duplex formation when incorporated into the following sequences: ATFAA, AAFTA, or ATFTA (where F represents 6-MI). To better understand some of the factors leading to the 6-MI fluorescence increase upon duplex formation, we characterized the effect of local sequence and structural perturbations on 6-MI photophysics through temperature melts, quantum yield measurements, fluorescence quenching assays, and fluorescence lifetime measurements. By examining 21 sequences we have determined that the duplex-enhanced fluorescence (DEF) depends on the composition of bases adjacent to 6-MI and the presence of adenines at locations n ± 2 from the probe. Investigation of duplex stability and local solvent accessibility measurements support a model in which the DEF arises from a constrained geometry of 6-MI in the duplex, which remains H-bonded to cytosine, stacked with adjacent bases and inaccessible to quenchers. Perturbation of DNA structure through the introduction of an unpaired base 3' to 6-MI or a mismatched basepair increases 6-MI dynamic motion leading to fluorescence quenching and a reduction in quantum yield. Molecular dynamics simulations suggest the enhanced fluorescence results from a greater degree of twist at the X-F step relative to the quenched duplexes examined. These results point to a model where adenine residues located at n ± 2 from 6-MI induce a structural geometry with greater twist in the duplex that hinders local motion reducing dynamic quenching and producing an increase in 6-MI fluorescence.
Bypass of a Nick by the Replisome of Bacteriophage T7*
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C.
2011-01-01
DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase·polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick. PMID:21701044
Bypass of a nick by the replisome of bacteriophage T7.
Zhu, Bin; Lee, Seung-Joo; Richardson, Charles C
2011-08-12
DNA polymerase and DNA helicase are essential components of DNA replication. The helicase unwinds duplex DNA to provide single-stranded templates for DNA synthesis by the DNA polymerase. In bacteriophage T7, movement of either the DNA helicase or the DNA polymerase alone terminates upon encountering a nick in duplex DNA. Using a minicircular DNA, we show that the helicase · polymerase complex can bypass a nick, albeit at reduced efficiency of 7%, on the non-template strand to continue rolling circle DNA synthesis. A gap in the non-template strand cannot be bypassed. The efficiency of bypass synthesis depends on the DNA sequence downstream of the nick. A nick on the template strand cannot be bypassed. Addition of T7 single-stranded DNA-binding protein to the complex stimulates nick bypass 2-fold. We propose that the association of helicase with the polymerase prevents dissociation of the helicase upon encountering a nick, allowing the helicase to continue unwinding of the duplex downstream of the nick.
Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut
2012-02-01
A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.
Lee, Chang Yeol; Park, Ki Soo; Park, Hyun Gyu
2017-12-15
We develop a novel approach to determine formamidopyrimidine DNA glycosylase (Fpg) activity by taking advantage of the unique fluorescence property of pyrrolo-dC (PdC) positioned opposite to 8-oxoguanine (8-oxoG) in duplex DNA. In its initial state, PdC in duplex DNA undergoes the efficient stacking and collisional quenching interactions, showing the low fluorescence signal. In contrast, the presence of Fpg, which specifically removes 8-oxoG and incises resulting apurinic (AP) site, transforms duplex DNA into single-stranded (ss) DNAs. As a result, the intrinsic fluorescence signal of PdC in ssDNA is recovered to exhibit the significantly enhanced fluorescence signal. Based on this Fpg-dependent fluorescence response of PdC, we could reliably determine Fpg activity down to 1.25U/ml with a linear response from 0 to 50U/ml. In addition, the diagnostic capability of this strategy was successfully demonstrated by reliably assaying Fpg activity in human blood serum, showing its great potential in the practical applications. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Frank, Natia L.; Meade, Thomas J.
2003-01-01
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.
Superimposed Code Theoretic Analysis of DNA Codes and DNA Computing
2008-01-01
complements of one another and the DNA duplex formed is a Watson - Crick (WC) duplex. However, there are many instances when the formation of non-WC...that the user’s requirements for probe selection are met based on the Watson - Crick probe locality within a target. The second type, called...AFRL-RI-RS-TR-2007-288 Final Technical Report January 2008 SUPERIMPOSED CODE THEORETIC ANALYSIS OF DNA CODES AND DNA COMPUTING
NASA Astrophysics Data System (ADS)
Novianty, E.; Kartikasari, L. R.; Lee, J. H.; Cahyadi, M.
2017-04-01
Meat based food products have a big opportunity to mix and adulterated with other meats. Muslim communities are prohibited to consume pork-containing product or other pig derivatives in food. Therefore, the high sensitivity, fast, cheap and accurate approach is needed to detect pig contamination in raw meat and meat-processed product such as meatball. The aim of this study was to identify pork contamination in meatball using genetic marker of mitochondrial DNA cytochrome b gene by duplex-PCR. Samples were prepared and designed by following the proportions 0, 1, 5, 10, 25% of pork in meatballs, respectively. The DNA genome was extracted from meatballs and polymerase chain reaction (PCR) was performed using species specific primer to isolate mt-DNA cytochrome b gene. The results showed that the DNA genome was successfully isolated from pork, beef, and contaminated meatballs. Furthermore, 2% agarose gels was able to visualize of duplex-PCR to identify pork contamination in meatballs up to very small proportion (1%). It can be concluded that duplex-PCR of mt-DNA cytochrome b gene was very sensitive to identify pork contamination in meatball with the presence of specific 398 bp DNA band.
Translational Entropy and DNA Duplex Stability.
Privalov, Peter L; Crane-Robinson, Colyn
2018-01-09
Investigation of folding/unfolding DNA duplexes of various size and composition by superprecise calorimetry has revised several long-held beliefs concerning the forces responsible for the formation of the double helix. It was established that: 1) the enthalpy and the entropy of duplex unfolding are temperature dependent, increasing with temperature rise and having the same heat capacity increment for CG and AT pairs; 2) the enthalpy of AT melting is greater than that of the CG pair, so the stabilizing effect of the CG pair in comparison with AT results not from its larger enthalpic contribution (as expected from its extra hydrogen bond), but from the larger entropic contribution of the AT pair that results from its ability to fix ordered water in the minor groove and release it upon duplex unfolding; 3) the translation entropy, resulting from the appearance of a new kinetic unit on duplex dissociation, determines the dependence of duplex stability on its length and its concentration (it is an order-of-magnitude smaller than predicted from the statistical mechanics of gases and is fully expressed by the stoichiometric correction term); 4) changes in duplex stability on reshuffling the sequence (the "nearest-neighbor effect") result from the immobilized water molecules fixed by AT pairs in the minor groove; and 5) the evaluated thermodynamic components permit a quantitative expression of DNA duplex stability. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Yeast Pif1 Accelerates Annealing of Complementary DNA Strands
2015-01-01
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg2+. Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3′-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1. PMID:25393406
Yeast Pif1 accelerates annealing of complementary DNA strands.
Ramanagoudr-Bhojappa, Ramanagouda; Byrd, Alicia K; Dahl, Christopher; Raney, Kevin D
2014-12-09
Pif1 is a helicase involved in the maintenance of nuclear and mitochondrial genomes in eukaryotes. Here we report a new activity of Saccharomyces cerevisiae Pif1, annealing of complementary DNA strands. We identified preferred substrates for annealing as those that generate a duplex product with a single-stranded overhang relative to a blunt end duplex. Importantly, we show that Pif1 can anneal DNA in the presence of ATP and Mg(2+). Pif1-mediated annealing also occurs in the presence of single-stranded DNA binding proteins. Additionally, we show that partial duplex substrates with 3'-single-stranded overhangs such as those generated during double-strand break repair can be annealed by Pif1.
Influence of 5-N-carboxamide modifications on the thermodynamic stability of oligonucleotides
Wolk, Steven K.; Shoemaker, Richard K.; Mayfield, Wes S.; Mestdagh, Andrew L.; Janjic, Nebojsa
2015-01-01
We have recently shown that the incorporation of modified nucleotides such as 5-N-carboxamide-deoxyuridines into random nucleic acid libraries improves success rates in SELEX experiments and facilitates the identification of ligands with slow off-rates. Here we report the impact of these modifications on the thermodynamic stability of both duplexes and intramolecular ‘single-stranded’ structures. Within duplexes, large, hydrophobic naphthyl groups were destabilizing relative to the all natural DNA duplex, while the hydrophilic groups exhibited somewhat improved duplex stability. All of the significant changes in stability were driven by opposing contributions from the enthalpic and entropic terms. In contrast, both benzyl and naphthyl modifications stabilized intramolecular single-stranded structures relative to their natural DNA analogs, consistent with the notion that intramolecular folding allows formation of novel, stabilizing hydrophobic interactions. Imino proton NMR data provided evidence that elements of the folded structure form at temperatures well below the Tm, with a melting transition that is distinctly less cooperative when compared to duplex DNA. Although there are no data to suggest that the unmodified DNA sequences fold into structures similar to their modified analogs, this still represents clear evidence that these modifications impart thermodynamic stability to the folded structure not achievable with unmodified DNA. PMID:26438535
Programming a topologically constrained DNA nanostructure into a sensor
NASA Astrophysics Data System (ADS)
Liu, Meng; Zhang, Qiang; Li, Zhongping; Gu, Jimmy; Brennan, John D.; Li, Yingfu
2016-06-01
Many rationally engineered DNA nanostructures use mechanically interlocked topologies to connect individual DNA components, and their physical connectivity is achieved through the formation of a strong linking duplex. The existence of such a structural element also poses a significant topological constraint on functions of component rings. Herein, we hypothesize and confirm that DNA catenanes with a strong linking duplex prevent component rings from acting as the template for rolling circle amplification (RCA). However, by using an RNA-containing DNA [2] catenane with a strong linking duplex, we show that a stimuli-responsive RNA-cleaving DNAzyme can linearize one component ring, and thus enable RCA, producing an ultra-sensitive biosensing system. As an example, a DNA catenane biosensor is engineered to detect the model bacterial pathogen Escherichia coli through binding of a secreted protein, with a detection limit of 10 cells ml-1, thus establishing a new platform for further applications of mechanically interlocked DNA nanostructures.
Programming a topologically constrained DNA nanostructure into a sensor
Liu, Meng; Zhang, Qiang; Li, Zhongping; Gu, Jimmy; Brennan, John D.; Li, Yingfu
2016-01-01
Many rationally engineered DNA nanostructures use mechanically interlocked topologies to connect individual DNA components, and their physical connectivity is achieved through the formation of a strong linking duplex. The existence of such a structural element also poses a significant topological constraint on functions of component rings. Herein, we hypothesize and confirm that DNA catenanes with a strong linking duplex prevent component rings from acting as the template for rolling circle amplification (RCA). However, by using an RNA-containing DNA [2] catenane with a strong linking duplex, we show that a stimuli-responsive RNA-cleaving DNAzyme can linearize one component ring, and thus enable RCA, producing an ultra-sensitive biosensing system. As an example, a DNA catenane biosensor is engineered to detect the model bacterial pathogen Escherichia coli through binding of a secreted protein, with a detection limit of 10 cells ml−1, thus establishing a new platform for further applications of mechanically interlocked DNA nanostructures. PMID:27337657
Genetic Heterogeneity in Streptococcus mutans1
Coykendall, Alan L.
1971-01-01
The genetic homogeneity among eight cariogenic strains of Streptococcus mutans was assessed by deoxyribonucleic acid (DNA)-DNA reassociation experiments. DNA species were extracted from strains GS5, Ingbritt, 10449, FAl, BHT, E49, SLl, and KlR. Labeled DNA (14C-DNA) was extracted from strains 10449, FAl, and SLl. Denatured 14C-DNA fragments were allowed to reassociate, i.e., form hybrid duplexes, with denatured DNA immobilized on membrane filters incubated in 0.45 m NaCl-0.045 m sodium citrate at 67 or 75 C. At 67 C, 10449 14C-DNA reassociated extensively only with GS5 and Ingbritt DNA. FAl 14C-DNA hybridized extensively only with BHT DNA, and SLl 14C-DNA reassociated with KlR and E49 DNA. DNA which hybridized extensively at 67 C also reassociated to a high degree at 75 C. Thermal elution of 14C-FAl-BHT duplexes showed that the hybrid duplexes were thermostable. The results indicate that S. mutans is a genetically heterogeneous species. The strains studied can be divided into three (possibly four) genetic groups, and these groups closely parallel antigenic groups. PMID:5551636
Thermodynamic and hydration effects for the incorporation of a cationic 3-aminopropyl chain into DNA
Soto, Ana Maria; Kankia, Besik I.; Dande, Prasad; Gold, Barry; Marky, Luis A.
2002-01-01
The introduction of cationic 5-(ω-aminoalkyl)-2′-deoxypyrimidines into duplex DNA has been shown to induce DNA bending. In order to understand the energetic and hydration contributions for the incorporation of a cationic side chain in DNA a combination of spectroscopy, calorimetry and density techniques were used. Specifically, the temperature unfolding and isothermal formation was studied for a pair of duplexes with sequence d(CGTAGUCG TGC)/d(GCACGACTACG), where U represents 2′-deoxyuridine (‘control’) or 5-(3-aminopropyl)-2′-deoxyuridine (‘modified’). Continuous variation experiments confirmed 1:1 stoichiometries for each duplex and the circular dichroism spectra show that both duplexes adopted the B conformation. UV and differential scanning calorimetry melting experiments reveal that each duplex unfolds in two-state transitions. In low salt buffer, the ‘modified’ duplex is more stable and unfolds with a lower endothermic heat and lower release of counterion and water. This electrostatic stabilization is entropy driven and disappears at higher salt concentrations. Complete thermodynamic profiles at 15°C show that the favorable formation of each duplex results from the compensation of a favorable exothermic heat with an unfavorable entropy contribution. However, the isothermal profiles yielded a differential enthalpy of 8.8 kcal/mol, which is 4.3 kcal/mol higher than the differential enthalpy observed in the unfolding profiles. This indicates that the presence of the aminopropyl chain induces an increase in base stacking interactions in the modified single strand and a decrease in base stacking interactions in the modified duplex. Furthermore, the formation of the ‘control’ duplex releases water while the ‘modified’ duplex takes up water. Relative to the control duplex, formation of the modified duplex at 15°C yielded a marginal differential ΔG° term, positive ΔΔHITC–Δ(TΔS) compensation, negative ΔΔV and a net release of counterions. The opposite signs of the differential enthalpy–entropy compensation and differential volume change terms show a net uptake of structural water around polar and non-polar groups. This indicates that incorporation of the aminopropyl chain induces a higher exposure of aromatic bases to the solvent, which may be consistent with a small and local bend in the ‘modified’ duplex. PMID:12136099
Repair of Clustered Damage and DNA Polymerase Iota.
Belousova, E A; Lavrik, O I
2015-08-01
Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.
Deleavey, Glen F.; Watts, Jonathan K.; Alain, Tommy; Robert, Francis; Kalota, Anna; Aishwarya, Veenu; Pelletier, Jerry; Gewirtz, Alan M.; Sonenberg, Nahum; Damha, Masad J.
2010-01-01
We report that combining a DNA analog (2′F-ANA) with rigid RNA analogs [2′F-RNA and/or locked nucleic acid (LNA)] in siRNA duplexes can produce gene silencing agents with enhanced potency. The favored conformations of these two analogs are different, and combining them in a 1–1 pattern led to reduced affinity, whereas alternating short continuous regions of individual modifications increased affinity relative to an RNA:RNA duplex. Thus, the binding affinity at key regions of the siRNA duplex could be tuned by changing the pattern of incorporation of DNA-like and RNA-like nucleotides. These heavily or fully modified duplexes are active against a range of mRNA targets. Effective patterns of modification were chosen based on screens using two sequences targeting firefly luciferase. We then applied the most effective duplex designs to the knockdown of the eIF4E binding proteins 4E-BP1 and 4E-BP2. We identified modified duplexes with potency comparable to native siRNA. Modified duplexes showed dramatically enhanced stability to serum nucleases, and were characterized by circular dichroism and thermal denaturation studies. Chemical modification significantly reduced the immunostimulatory properties of these siRNAs in human peripheral blood mononuclear cells. PMID:20413581
DNA binding and unwinding by Hel308 helicase requires dual functions of a winged helix domain.
Northall, Sarah J; Buckley, Ryan; Jones, Nathan; Penedo, J Carlos; Soultanas, Panos; Bolt, Edward L
2017-09-01
Hel308 helicases promote genome stability linked to DNA replication in archaea, and have homologues in metazoans. In the crystal structure of archaeal Hel308 bound to a tailed DNA duplex, core helicase domains encircle single-stranded DNA (ssDNA) in a "ratchet" for directional translocation. A winged helix domain (WHD) is also present, but its function is mysterious. We investigated the WHD in full-length Hel308, identifying that mutations in a solvent exposed α-helix resulted in reduced DNA binding and unwinding activities. When isolated from the rest of Hel308, the WHD protein alone bound to duplex DNA but not ssDNA, and DNA binding by WHD protein was abolished by the same mutations as were analyzed in full-length Hel308. Isolated WHD from a human Hel308 homologue (HelQ) also bound to duplex DNA. By disrupting the interface between the Hel308 WHD and a RecA-like domain, a topology typical of Ski2 helicases, we show that this is crucial for ATPase and helicase activities. The data suggest a model in which the WHD promotes activity of Hel308 directly, through binding to duplex DNA that is distinct from ssDNA binding by core helicase, and indirectly through interaction with the RecA-like domain. We propose how the WHD may contribute to ssDNA translocation, resulting in DNA helicase activity or in removal of other DNA bound proteins by "reeling" ssDNA. Copyright © 2017 Elsevier B.V. All rights reserved.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E
2010-06-01
A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.
Liu, Zhi; Ding, Shuang; Kropachev, Konstantin; Lei, Jia; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2015-01-01
The nucleotide excision repair of certain bulky DNA lesions is abrogated in some specific non-canonical DNA base sequence contexts, while the removal of the same lesions by the nucleotide excision repair mechanism is efficient in duplexes in which all base pairs are complementary. Here we show that the nucleotide excision repair activity in human cell extracts is moderate-to-high in the case of two stereoisomeric DNA lesions derived from the pro-carcinogen benzo[a]pyrene (cis- and trans-B[a]P-N 2-dG adducts) in a normal DNA duplex. By contrast, the nucleotide excision repair activity is completely abrogated when the canonical cytosine base opposite the B[a]P-dG adducts is replaced by an abasic site in duplex DNA. However, base excision repair of the abasic site persists. In order to understand the structural origins of these striking phenomena, we used NMR and molecular spectroscopy techniques to evaluate the conformational features of 11mer DNA duplexes containing these B[a]P-dG lesions opposite abasic sites. Our results show that in these duplexes containing the clustered lesions, both B[a]P-dG adducts adopt base-displaced intercalated conformations, with the B[a]P aromatic rings intercalated into the DNA helix. To explain the persistence of base excision repair in the face of the opposed bulky B[a]P ring system, molecular modeling results suggest how the APE1 base excision repair endonuclease, that excises abasic lesions, can bind productively even with the trans-B[a]P-dG positioned opposite the abasic site. We hypothesize that the nucleotide excision repair resistance is fostered by local B[a]P residue—DNA base stacking interactions at the abasic sites, that are facilitated by the absence of the cytosine partner base in the complementary strand. More broadly, this study sets the stage for elucidating the interplay between base excision and nucleotide excision repair in processing different types of clustered DNA lesions that are substrates of nucleotide excision repair or base excision repair mechanisms. PMID:26340000
Kusano, Shuhei; Ishiyama, Shogo; Lam, Sik Lok; Mashima, Tsukasa; Katahira, Masato; Miyamoto, Kengo; Aida, Misako; Nagatsugi, Fumi
2015-01-01
DNA interstrand crosslinks (ICLs) are the primary mechanism for the cytotoxic activity of many clinical anticancer drugs, and numerous strategies for forming ICLs have been developed. One such method is using crosslink-forming oligonucleotides (CFOs). In this study, we designed a 4-amino-6-oxo-2-vinylpyrimidine (AOVP) derivative with an acyclic spacer to react selectively with guanine. The AOVP CFO exhibited selective crosslinking reactivity with guanine and thymine in DNA, and with guanine in RNA. These crosslinking reactions with guanine were accelerated in the presence of CoCl2, NiCl2, ZnCl2 and MnCl2. In addition, we demonstrated that the AOVP CFO was reactive toward 8-oxoguanine opposite AOVP in the duplex DNA. The structural analysis of each guanine and 8-oxoguanine adduct in the duplex DNA was investigated by high-resolution NMR. The results suggested that AOVP reacts at the N2 amine in guanine and at the N1 or N2 amines in 8-oxoguanine in the duplex DNA. This study demonstrated the first direct determination of the adduct structure in duplex DNA without enzyme digestion. PMID:26245348
NASA Technical Reports Server (NTRS)
Karpova, E. A.; Kubareva, E. A.; Shabarova, Z. A.
1999-01-01
To elucidate the mechanism of interaction of restriction endonuclease EcoRII with DNA, we studied by native gel electrophoresis the binding of this endonuclease to a set of synthetic DNA-duplexes containing the modified or canonical recognition sequence 5'-d(CCA/TGG)-3'. All binding substrate or substrate analogues tested could be divided into two major groups: (i) duplexes that, at the interaction with endonuclease EcoRII, form two types of stable complexes on native gel in the absence of Mg2+ cofactor; (ii) duplexes that form only one type of complex, observed both in the presence and absence of Mg2+. Unlike the latter, duplexes under the first group can be hydrolyzed by endonuclease. Data obtained suggest that the active complex is most likely formed by one protein subunit and one DNA recognition sequence. A model of EcoRII endonuclease action is presented.
2017-01-01
The effect of S-substitution on the O6 guanine site of a 13-mer DNA duplex containing a G:T mismatch is studied using molecular dynamics. The structure, dynamic evolution and hydration of the S-substituted duplex are compared with those of a normal duplex, a duplex with S-substitution on guanine, but no mismatch and a duplex with just a G:T mismatch. The S-substituted mismatch leads to cell death rather than repair. One suggestion is that the G:T mismatch recognition protein recognises the S-substituted mismatch (GS:T) as G:T. This leads to a cycle of futile repair ending in DNA breakage and cell death. We find that some structural features of the helix are similar for the duplex with the G:T mismatch and that with the S-substituted mismatch, but differ from the normal duplex, notably the helical twist. These differences arise from the change in the hydrogen-bonding pattern of the base pair. However a marked feature of the S-substituted G:T mismatch duplex is a very large opening. This showed considerable variability. It is suggested that this enlarged opening would lend support to an alternative model of cell death in which the mismatch protein attaches to thioguanine and activates downstream damage-response pathways. Attack on the sulphur by reactive oxygen species, also leading to cell death, would also be aided by the large, variable opening. PMID:28910418
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Paiva, Anthony M; Sheardy, Richard D
2005-04-20
The formation of unusual structures during DNA replication has been invoked for gene expansion in genomes possessing triplet repeat sequences, CNG, where N = A, C, G, or T. In particular, it has been suggested that the daughter strand of the leading strand partially dissociates from the parent strand and forms a hairpin. The equilibrium between the fully duplexed parent:daugter species and the parent:hairpin species is dependent upon their relative stabilities and the rates of reannealing of the daughter strand back to the parent. These stabilities and rates are ultimately influenced by the sequence context of the DNA and its length. Previous work has demonstrated that longer strands are more stable than shorter strands and that the identity of N also influences the thermal stability [Paiva, A. M.; Sheardy, R. D. Biochemistry 2004, 43, 14218-14227]. Here, we show that the rate of duplex formation from complementary hairpins is also sequence context and length dependent. In particular, longer duplexes have higher activation energies than shorter duplexes of the same sequence context. Further, [(CCG):(GGC)] duplexes have lower activation energies than corresponding [(CAG):(GTC)] duplexes of the same length. Hence, hairpins formed from long CNG sequences are more thermodynamically stable and have slower kinetics for reannealing to their complement than shorter analogues. Gene expansion can now be explained in terms of thermodynamics and kinetics.
Defined presentation of carbohydrates on a duplex DNA scaffold.
Schlegel, Mark K; Hütter, Julia; Eriksson, Magdalena; Lepenies, Bernd; Seeberger, Peter H
2011-12-16
A new method for the spatially defined alignment of carbohydrates on a duplex DNA scaffold is presented. The use of an N-hydroxysuccinimide (NHS)-ester phosphoramidite along with carbohydrates containing an alkylamine linker allows for on-column labeling during solid-phase oligonucleotide synthesis. This modification method during solid-phase synthesis only requires the use of minimal amounts of complex carbohydrates. The covalently attached carbohydrates are presented in the major groove of the B-form duplex DNA as potential substrates for murine type II C-type lectin receptors mMGL1 and mMGL2. CD spectroscopy and thermal melting revealed only minimal disturbance of the overall helical structure. Surface plasmon resonance and cellular uptake studies with bone-marrow-derived dendritic cells were used to assess the capability of these carbohydrate-modified duplexes to bind to mMGL receptors. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-01-01
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA–DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA–DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs. PMID:28484024
Mechanism of duplex DNA destabilization by RNA-guided Cas9 nuclease during target interrogation.
Mekler, Vladimir; Minakhin, Leonid; Severinov, Konstantin
2017-05-23
The prokaryotic clustered regularly interspaced short palindromic repeats (CRISPR)-associated 9 (Cas9) endonuclease cleaves double-stranded DNA sequences specified by guide RNA molecules and flanked by a protospacer adjacent motif (PAM) and is widely used for genome editing in various organisms. The RNA-programmed Cas9 locates the target site by scanning genomic DNA. We sought to elucidate the mechanism of initial DNA interrogation steps that precede the pairing of target DNA with guide RNA. Using fluorometric and biochemical assays, we studied Cas9/guide RNA complexes with model DNA substrates that mimicked early intermediates on the pathway to the final Cas9/guide RNA-DNA complex. The results show that Cas9/guide RNA binding to PAM favors separation of a few PAM-proximal protospacer base pairs allowing initial target interrogation by guide RNA. The duplex destabilization is mediated, in part, by Cas9/guide RNA affinity for unpaired segments of nontarget strand DNA close to PAM. Furthermore, our data indicate that the entry of double-stranded DNA beyond a short threshold distance from PAM into the Cas9/single-guide RNA (sgRNA) interior is hindered. We suggest that the interactions unfavorable for duplex DNA binding promote DNA bending in the PAM-proximal region during early steps of Cas9/guide RNA-DNA complex formation, thus additionally destabilizing the protospacer duplex. The mechanism that emerges from our analysis explains how the Cas9/sgRNA complex is able to locate the correct target sequence efficiently while interrogating numerous nontarget sequences associated with correct PAMs.
Reducing the background fluorescence in mice receiving fluorophore/inhibitor DNA duplexes.
Liang, Minmin; Liu, Xinrong; Liu, Guozheng; Dou, Shuping; Cheng, Dengfeng; Liu, Yuxia; Rusckowski, Mary; Hnatowich, Donald J
2011-02-07
In principle, a DNA duplex consisting of an antisense fluorophore-conjugated major strand hybridized to a shorter complementary inhibitor-conjugated minor strand should provide fluorescence only in the tumor after intravenous administration if designed to remain intact except in the presence in tumor of its mRNA target. While we have obtained impressive tumor images in mice using this approach, there remains some background fluorescence. In this study, tissue homogenates of selected mouse organs were incubated with a test duplex and the kinetics of duplex dissociation in normal tissues were measured. In this manner we were able to identify the liver as the likely major source responsible for the duplex dissociation providing this fluorescence background. Thereafter liver homogenates were used to screen a series of duplex candidates with variable-length minor strands, and dissociation was measured by gel electrophoresis. The selected fluorophore/inhibitor duplex with improved stability displayed an insignificant (P > 0.05) background fluorescence after administration to SKH-1 normal mice and apparently without affecting target mRNA binding in vitro in cell culture or in vivo in tumor bearing mice.
Molecular dynamics study of some non-hydrogen-bonding base pair DNA strands
NASA Astrophysics Data System (ADS)
Tiwari, Rakesh K.; Ojha, Rajendra P.; Tiwari, Gargi; Pandey, Vishnudatt; Mall, Vijaysree
2018-05-01
In order to elucidate the structural activity of hydrophobic modified DNA, the DMMO2-D5SICS, base pair is introduced as a constituent in different set of 12-mer and 14-mer DNA sequences for the molecular dynamics (MD) simulation in explicit water solvent. AMBER 14 force field was employed for each set of duplex during the 200ns production-dynamics simulation in orthogonal-box-water solvent by the Particle-Mesh-Ewald (PME) method in infinite periodic boundary conditions (PBC) to determine conformational parameters of the complex. The force-field parameters of modified base-pair were calculated by Gaussian-code using Hartree-Fock /ab-initio methodology. RMSD Results reveal that the conformation of the duplex is sequence dependent and the binding energy of the complex depends on the position of the modified base-pair in the nucleic acid strand. We found that non-bonding energy had a significant contribution to stabilising such type of duplex in comparison to electrostatic energy. The distortion produced within strands by such type of base-pair was local and destabilised the duplex integrity near to substitution, moreover the binding energy of duplex depends on the position of substitution of hydrophobic base-pair and the DNA sequence and strongly supports the corresponding experimental study.
Thermal stability of DNA quadruplex-duplex hybrids.
Lim, Kah Wai; Khong, Zi Jian; Phan, Anh Tuân
2014-01-14
DNA has the capacity to adopt several distinct structural forms, such as duplex and quadruplex helices, which have been implicated in cellular processes and shown to exhibit important functional properties. Quadruplex-duplex hybrids, generated from the juxtaposition of these two structural elements, could find applications in therapeutics and nanotechnology. Here we used NMR and CD spectroscopy to investigate the thermal stability of two classes of quadruplex-duplex hybrids comprising fundamentally distinct modes of duplex and quadruplex connectivity: Construct I involves the coaxial orientation of the duplex and quadruplex helices with continual base stacking across the two components; Construct II involves the orthogonal orientation of the duplex and quadruplex helices with no base stacking between the two components. We have found that for both constructs, the stability of the quadruplex generally increases with the length of the stem-loop incorporated, with respect to quadruplexes comprising nonstructured loops of the same length, which showed a continuous drop in stability with increasing loop length. The stability of these complexes, particularly Construct I, can be substantially influenced by the base-pair steps proximal to the quadruplex-duplex junction. Bulges at the junction are largely detrimental to the adoption of the desired G-quadruplex topology for Construct I but not for Construct II. These findings should facilitate future design and prediction of quadruplex-duplex hybrids.
Zhang, Hui; Yang, Yin; Dong, Huilei; Cai, Chenxin
2016-12-15
DNA methyltransferase (MTase) activity is highly correlated with the occurrence and development of cancer. This work reports a superstructure-based electrochemical assay for signal-amplified detection of DNA MTase activity using M.SssI as an example. First, low-density coverage of DNA duplexes on the surface of the gold electrode was achieved by immobilized mercaptohexanol, followed by immobilization of DNA duplexes. The duplex can be cleaved by BstUI endonuclease in the absence of DNA superstructures. However, the cleavage is blocked after the DNA is methylated by M.SssI. The DNA superstructures are formed with the addition of helper DNA. By using an electroactive complex, RuHex, which can bind to DNA double strands, the activity of M.SssI can be quantitatively detected by differential pulse voltammetry. Due to the high site-specific cleavage by BstUI and signal amplification by the DNA superstructure, the biosensor can achieve ultrasensitive detection of DNA MTase activity down to 0.025U/mL. The method can be used for evaluation and screening of the inhibitors of MTase, and thus has potential in the discovery of methylation-related anticancer drugs. Copyright © 2016 Elsevier B.V. All rights reserved.
Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.
Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V
2016-04-07
Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.
Smectic phase in suspensions of gapped DNA duplexes
Salamonczyk, Miroslaw; Zhang, Jing; Portale, Giuseppe; ...
2016-11-15
Smectic ordering in aqueous solutions of monodisperse stiff double-stranded DNA fragments is known not to occur, in spite of the fact that these systems exhibit both chiral nematic and columnar mesophases. Here, we show, unambiguously, that a smectic-A type of phase is formed by increasing the DNA's flexibility through the introduction of an unpaired single-stranded DNA spacer in the middle of each duplex. This is unusual for a lyotropic system, where flexibility typically destabilizes the smectic phase. We also report on simulations suggesting that the gapped duplexes (resembling chain-sticks) attain a folded conformation in the smectic layers, and argue thatmore » this layer structure, which we designate as smectic-fA phase, is thermodynamically stabilized by both entropic and energetic contributions to the system's free energy. These results demonstrate that DNA as a building block offers an exquisitely tunable means to engineer a potentially rich assortment of lyotropic liquid crystals.« less
The Role of Structural Enthalpy in Spherical Nucleic Acid Hybridization.
Fong, Lam-Kiu; Wang, Ziwei; Schatz, George C; Luijten, Erik; Mirkin, Chad A
2018-05-23
DNA hybridization onto DNA-functionalized nanoparticle surfaces (e.g., in the form of a spherical nucleic acid (SNA)) is known to be enhanced relative to hybridization free in solution. Surprisingly, via isothermal titration calorimetry, we reveal that this enhancement is enthalpically, as opposed to entropically, dominated by ∼20 kcal/mol. Coarse-grained molecular dynamics simulations suggest that the observed enthalpic enhancement results from structurally confining the DNA on the nanoparticle surface and preventing it from adopting enthalpically unfavorable conformations like those observed in the solution case. The idea that structural confinement leads to the formation of energetically more stable duplexes is evaluated by decreasing the degree of confinement a duplex experiences on the nanoparticle surface. Both experiment and simulation confirm that when the surface-bound duplex is less confined, i.e., at lower DNA surface density or at greater distance from the nanoparticle surface, its enthalpy of formation approaches the less favorable enthalpy of duplex formation for the linear strand in solution. This work provides insight into one of the most important and enabling properties of SNAs and will inform the design of materials that rely on the thermodynamics of hybridization onto DNA-functionalized surfaces, including diagnostic probes and therapeutic agents.
Moriguchi, Tomohisa; Sakai, Hideaki; Suzuki, Hideo; Shinozuka, Kazuo
2008-09-01
Novel phosphorothioate-modified oligodeoxynucleotides (S-ODNs) containing a deoxyuridine derivative bearing a spermine moiety at the C-5 position were synthesized. The study of the thermal stability and the thermodynamic stability showed that the modified S-ODNs have been able to form the stable duplexes with the complementary DNA. It was also found that the duplex composed of the modified S-ODN and its complementary RNA strand is the substrate for Escherichia coli RNase H, and the cleavage of the RNA strand by the enzyme was almost similar as in the case of the unmodified one.
Kimura, Tsuyoshi; Nakamura, Naoko; Umeda, Kanji; Hashimoto, Yoshihide; Kishida, Akio
We synthesized a temperature-responsive surface that immobilized an antibody via DNA duplex formation for selective capture and release of target cells. Polyethylene films were modified by grafting poly(N-isopropylacrylamide-co-acrylic acid) (P(NIPAAm-co-AAc)), which were prepared at various ratios of NIPAAm/AAc. The increased hydrophilicity of P(NIPAAm-co-PAA) film with decreased temperature was confirmed by water contact angle measurement. Single strand DNA (20mer) was chemically immobilized on the surface and then antibody (anti-mouse CD45, mCD45) modified with the complementary single strand DNA was immobilized on the surface through DNA duplex formation. The mCD45 antibody immobilization was confirmed by immunostaining. HeLa cells (mCD45 negative) and mouse bone marrow (BM) cells (mCD45 positive) were adhered on the surfaces at 37 °C. Although HeLa cells were detached by 4 °C incubation, BM cells were still adhered on the surface and then the adhered cells were released by DNase treatment. From these results, it was suggested that cells could be selectively captured and collected by using a film having surface that immobilizes an antibody via DNA duplex formation.
Russo Krauss, Irene; Ramaswamy, Sneha; Neidle, Stephen; Haider, Shozeb; Parkinson, Gary N
2016-02-03
We report here on an X-ray crystallographic and molecular modeling investigation into the complex 3' interface formed between putative parallel stranded G-quadruplexes and a duplex DNA sequence constructed from the human telomeric repeat sequence TTAGGG. Our crystallographic approach provides a detailed snapshot of a telomeric 3' quadruplex-duplex junction: a junction that appears to have the potential to form a unique molecular target for small molecule binding and interference with telomere-related functions. This unique target is particularly relevant as current high-affinity compounds that bind putative G-quadruplex forming sequences only rarely have a high degree of selectivity for a particular quadruplex. Here DNA junctions were assembled using different putative quadruplex-forming scaffolds linked at the 3' end to a telomeric duplex sequence and annealed to a complementary strand. We successfully generated a series of G-quadruplex-duplex containing crystals, both alone and in the presence of ligands. The structures demonstrate the formation of a parallel folded G-quadruplex and a B-form duplex DNA stacked coaxially. Most strikingly, structural data reveals the consistent formation of a TAT triad platform between the two motifs. This triad allows for a continuous stack of bases to link the quadruplex motif with the duplex region. For these crystal structures formed in the absence of ligands, the TAT triad interface occludes ligand binding at the 3' quadruplex-duplex interface, in agreement with in silico docking predictions. However, with the rearrangement of a single nucleotide, a stable pocket can be produced, thus providing an opportunity for the binding of selective molecules at the interface.
Effects of Polymer Conjugation on Hybridization Thermodynamics of Oligonucleic Acids.
Ghobadi, Ahmadreza F; Jayaraman, Arthi
2016-09-15
In this work, we perform coarse-grained (CG) and atomistic simulations to study the effects of polymer conjugation on hybridization/melting thermodynamics of oligonucleic acids (ONAs). We present coarse-grained Langevin molecular dynamics simulations (CG-NVT) to assess the effects of the polymer flexibility, length, and architecture on hybridization/melting of ONAs with different ONA duplex sequences, backbone chemistry, and duplex concentration. In these CG-NVT simulations, we use our recently developed CG model of ONAs in implicit solvent, and treat the conjugated polymer as a CG chain with purely repulsive Weeks-Chandler-Andersen interactions with all other species in the system. We find that 8-100-mer linear polymer conjugation destabilizes 8-mer ONA duplexes with weaker Watson-Crick hydrogen bonding (WC H-bonding) interactions at low duplex concentrations, while the same polymer conjugation has an insignificant impact on 8-mer ONA duplexes with stronger WC H-bonding. To ensure the configurational space is sampled properly in the CG-NVT simulations, we also perform CG well-tempered metadynamics simulations (CG-NVT-MetaD) and analyze the free energy landscape of ONA hybridization for a select few systems. We demonstrate that CG-NVT-MetaD simulation results are consistent with the CG-NVT simulations for the studied systems. To examine the limitations of coarse-graining in capturing ONA-polymer interactions, we perform atomistic parallel tempering metadynamics simulations at well-tempered ensemble (AA-MetaD) for a 4-mer DNA in explicit water with and without conjugation to 8-mer poly(ethylene glycol) (PEG). AA-MetaD simulations also show that, for a short DNA duplex at T = 300 K, a condition where the DNA duplex is unstable, conjugation with PEG further destabilizes DNA duplex. We conclude with a comparison of results from these three different types of simulations and discuss their limitations and strengths.
Sequence-dependent base pair stepping dynamics in XPD helicase unwinding
Qi, Zhi; Pugh, Robert A; Spies, Maria; Chemla, Yann R
2013-01-01
Helicases couple the chemical energy of ATP hydrolysis to directional translocation along nucleic acids and transient duplex separation. Understanding helicase mechanism requires that the basic physicochemical process of base pair separation be understood. This necessitates monitoring helicase activity directly, at high spatio-temporal resolution. Using optical tweezers with single base pair (bp) resolution, we analyzed DNA unwinding by XPD helicase, a Superfamily 2 (SF2) DNA helicase involved in DNA repair and transcription initiation. We show that monomeric XPD unwinds duplex DNA in 1-bp steps, yet exhibits frequent backsteps and undergoes conformational transitions manifested in 5-bp backward and forward steps. Quantifying the sequence dependence of XPD stepping dynamics with near base pair resolution, we provide the strongest and most direct evidence thus far that forward, single-base pair stepping of a helicase utilizes the spontaneous opening of the duplex. The proposed unwinding mechanism may be a universal feature of DNA helicases that move along DNA phosphodiester backbones. DOI: http://dx.doi.org/10.7554/eLife.00334.001 PMID:23741615
Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.
2014-01-01
We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239
G-quadruplexes Significantly Stimulate Pif1 Helicase-catalyzed Duplex DNA Unwinding*
Duan, Xiao-Lei; Liu, Na-Nv; Yang, Yan-Tao; Li, Hai-Hong; Li, Ming; Dou, Shuo-Xing; Xi, Xu-Guang
2015-01-01
The evolutionarily conserved G-quadruplexes (G4s) are faithfully inherited and serve a variety of cellular functions such as telomere maintenance, gene regulation, DNA replication initiation, and epigenetic regulation. Different from the Watson-Crick base-pairing found in duplex DNA, G4s are formed via Hoogsteen base pairing and are very stable and compact DNA structures. Failure of untangling them in the cell impedes DNA-based transactions and leads to genome instability. Cells have evolved highly specific helicases to resolve G4 structures. We used a recombinant nuclear form of Saccharomyces cerevisiae Pif1 to characterize Pif1-mediated DNA unwinding with a substrate mimicking an ongoing lagging strand synthesis stalled by G4s, which resembles a replication origin and a G4-structured flap in Okazaki fragment maturation. We find that the presence of G4 may greatly stimulate the Pif1 helicase to unwind duplex DNA. Further studies reveal that this stimulation results from G4-enhanced Pif1 dimerization, which is required for duplex DNA unwinding. This finding provides new insights into the properties and functions of G4s. We discuss the observed activation phenomenon in relation to the possible regulatory role of G4s in the rapid rescue of the stalled lagging strand synthesis by helping the replicator recognize and activate the replication origin as well as by quickly removing the G4-structured flap during Okazaki fragment maturation. PMID:25627683
Multi-shell model of ion-induced nucleic acid condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois
2016-04-21
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes in- duced by tri-valent cobalt hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. The duplex aggregation free energy is de- composed into attraction and repulsion components represented by simple analytic expressions. The source of the short-range attraction between NA duplexes in the aggregated phase is the in- teraction of CoHex ions in the overlapping regions of the “external” shells with the oppositely chargedmore » duplexes. The attraction depends on CoHex binding affinity to the “external” shell of nearly neutralized duplex and the number of ions in the shell overlapping volume. For a given NA duplex sequence and structure, these parameters are estimated from molecular dynamics simula- tion. The attraction is opposed by the residual repulsion of nearly neutralized duplexes as well as duplex configurational entropy loss upon aggregation. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA conden- sation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. The model also predicts that longer NA fragments will condense easier than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation, lends support to proposed NA condensation picture based on the multivalent “ion binding shells”.« less
Tsuruoka, H; Shohda, K; Wada, T; Sekine, M
2000-11-03
To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.
Moreira, Bernardo G; You, Yong; Owczarzy, Richard
2015-03-01
Cyanine dyes are important chemical modifications of oligonucleotides exhibiting intensive and stable fluorescence at visible light wavelengths. When Cy3 or Cy5 dye is attached to 5' end of a DNA duplex, the dye stacks on the terminal base pair and stabilizes the duplex. Using optical melting experiments, we have determined thermodynamic parameters that can predict the effects of the dyes on duplex stability quantitatively (ΔG°, Tm). Both Cy dyes enhance duplex formation by 1.2 kcal/mol on average, however, this Gibbs energy contribution is sequence-dependent. If the Cy5 is attached to a pyrimidine nucleotide of pyrimidine-purine base pair, the stabilization is larger compared to the attachment to a purine nucleotide. This is likely due to increased stacking interactions of the dye to the purine of the complementary strand. Dangling (unpaired) nucleotides at duplex terminus are also known to enhance duplex stability. Stabilization originated from the Cy dyes is significantly larger than the stabilization due to the presence of dangling nucleotides. If both the dangling base and Cy3 are present, their thermodynamic contributions are approximately additive. New thermodynamic parameters improve predictions of duplex folding, which will help design oligonucleotide sequences for biophysical, biological, engineering, and nanotechnology applications. Copyright © 2015. Published by Elsevier B.V.
AgI -Induced Switching of DNA Binding Modes via Formation of a Supramolecular Metallacycle.
Basak, Shibaji; Léon, J Christian; Ferranco, Annaleizle; Sharma, Renu; Hebenbrock, Marian; Lough, Alan; Müller, Jens; Kraatz, Heinz-Bernhard
2018-03-12
The histidine derivative L1 of the DNA intercalator naphthalenediimide (NDI) forms a triangular Ag I complex (C2). The interactions of L1 and of C2 with DNA were studied by circular dichroism (CD) and UV/Vis spectroscopy and by viscosity studies. Different binding modes were observed for L1 and for C2, as the Ag I complex C2 is too large in size to act as an intercalator. If Ag I is added to the NDI molecule that is already intercalated into a duplex, higher order complexes are formed within the DNA duplex and cause disruptions in the helical duplex structure, which leads to a significant decrease in the characteristic CD features of B-DNA. Thus, via addition of a metal we show how a classic and well-known organic intercalator unit can be turned into a partial metallo insertor. We also show how electrochemical impedance spectroscopy (EIS) can be used to probe DNA binding modes on DNA films that are immobilized on gold surfaces. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Triple helical DNA in a duplex context and base pair opening
Esguerra, Mauricio; Nilsson, Lennart; Villa, Alessandra
2014-01-01
It is fundamental to explore in atomic detail the behavior of DNA triple helices as a means to understand the role they might play in vivo and to better engineer their use in genetic technologies, such as antigene therapy. To this aim we have performed atomistic simulations of a purine-rich antiparallel triple helix stretch of 10 base triplets flanked by canonical Watson–Crick double helices. At the same time we have explored the thermodynamic behavior of a flipping Watson–Crick base pair in the context of the triple and double helix. The third strand can be accommodated in a B-like duplex conformation. Upon binding, the double helix changes shape, and becomes more rigid. The triple-helical region increases its major groove width mainly by oversliding in the negative direction. The resulting conformations are somewhere between the A and B conformations with base pairs remaining almost perpendicular to the helical axis. The neighboring duplex regions maintain a B DNA conformation. Base pair opening in the duplex regions is more probable than in the triplex and binding of the Hoogsteen strand does not influence base pair breathing in the neighboring duplex region. PMID:25228466
Huang, Ke-Jing; Shuai, Hong-Lei; Zhang, Ji-Zong
2016-03-15
A highly sensitive and ultrasensitive electrochemical aptasensor for platelet-derived growth factor BB (PDGF-BB) detection is fabricated based on layered molybdenum selenide-graphene (MoSe2-Gr) composites and Exonuclease III (Exo III)-aided signal amplification. MoSe2-Gr is prepared by a simple hydrothermal method and used as a promising sensing platform. Exo III has a specifical exo-deoxyribonuclease activity for duplex DNAs in the direction from 3' to 5' terminus, however its activity is limited on the duplex DNAs with more than 4 mismatched terminal bases at 3' ends. Herein, aptamer and complementary DNA (cDNA) sequences are designed with four thymine bases on 3' ends. In the presence of target protein, the aptamer associates with it and facilitates the formation of duplex DNA between cDNA and signal DNA. The duplex DNA then is digested by Exo III and releases cDNA, which hybridizes with signal DNA to perform a new cleavage process. Nevertheless, in the absence of target protein, the aptamer hybridizes with cDNA will inhibit the Exo III-assisted nucleotides cleavage. The signal DNA then hybridizes with capture DNA on the electrode. Subsequently, horse radish peroxidase is fixed on electrode by avidin-biotin reaction and then catalyzes hydrogen peroxide and hydroquinone to produce electrochemical response. Therefore, a bridge can be established between the concentration of target protein and the degree of the attenuation of the obtained signal, providing a quantitative measure of target protein with a broad detection range of 0.0001-1 nM and a detection limit of 20 fM. Copyright © 2015 Elsevier B.V. All rights reserved.
Sharaf-Eldin, M A; Al-Tamimi, A; Alam, P; Elkholy, S F; Jordan, J R
2015-12-28
The artichoke (Cynara scolymus L.) is an important food and medicinal crop that is cultivated in Mediterranean countries. Morphological characteristics, such as head shape and diameter, leaf shape, and bract shape, are mainly affected by environmental conditions. A molecular marker approach was used to analyze the degree of polymorphism between artichoke hybrid lines. The degree of genetic difference among three artichoke hybrids was evaluated using random amplified polymorphic DNA-PCR (RAPD-PCR). In this study, the DNA fingerprints of three artichoke lines (A13-010, A11-018, and A12-179) were generated, and a total of 10 decamer primers were applied for RAPD-PCR analyses. Polymorphism (16.66 to 62.50%) was identified using eight arbitrary decamers and total genomic DNA extracted from the hybrids. Of the 59 loci detected, there were 25 polymorphic and 34 monomorphic loci. Jaccard's similarity index (JSI) ranged between 1.0 and 0.84. Based on the unweighted pair group method with arithmetic mean (UPGMA) similarity matrix and dendrogram, the results indicated that two hybrids (A13-010 and A11-018) were closely related to each other, and the A12-179 line showed more divergence. When identifying correct accessions, consideration of the genetic variation and genetic relationships among the genotypes are required. The RAPD-PCR fingerprinting of artichoke lines clearly showed that it is possible to analyze the RAPD patterns for correlation between genetic means and differences or resemblance between close accessions (A13-010 and A11- 018) at the genomic level.
Naiser, Thomas; Ehler, Oliver; Kayser, Jona; Mai, Timo; Michel, Wolfgang; Ott, Albrecht
2008-01-01
Background The high binding specificity of short 10 to 30 mer oligonucleotide probes enables single base mismatch (MM) discrimination and thus provides the basis for genotyping and resequencing microarray applications. Recent experiments indicate that the underlying principles governing DNA microarray hybridization – and in particular MM discrimination – are not completely understood. Microarrays usually address complex mixtures of DNA targets. In order to reduce the level of complexity and to study the problem of surface-based hybridization with point defects in more detail, we performed array based hybridization experiments in well controlled and simple situations. Results We performed microarray hybridization experiments with short 16 to 40 mer target and probe lengths (in situations without competitive hybridization) in order to systematically investigate the impact of point-mutations – varying defect type and position – on the oligonucleotide duplex binding affinity. The influence of single base bulges and single base MMs depends predominantly on position – it is largest in the middle of the strand. The position-dependent influence of base bulges is very similar to that of single base MMs, however certain bulges give rise to an unexpectedly high binding affinity. Besides the defect (MM or bulge) type, which is the second contribution in importance to hybridization affinity, there is also a sequence dependence, which extends beyond the defect next-neighbor and which is difficult to quantify. Direct comparison between binding affinities of DNA/DNA and RNA/DNA duplexes shows, that RNA/DNA purine-purine MMs are more discriminating than corresponding DNA/DNA MMs. In DNA/DNA MM discrimination the affected base pair (C·G vs. A·T) is the pertinent parameter. We attribute these differences to the different structures of the duplexes (A vs. B form). Conclusion We have shown that DNA microarrays can resolve even subtle changes in hybridization affinity for simple target mixtures. We have further shown that the impact of point defects on oligonucleotide stability can be broken down to a hierarchy of effects. In order to explain our observations we propose DNA molecular dynamics – in form of zipping of the oligonucleotide duplex – to play an important role. PMID:18477387
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Algasaier, Sana I.; Exell, Jack C.; Bennet, Ian A.; Thompson, Mark J.; Gotham, Victoria J. B.; Shaw, Steven J.; Craggs, Timothy D.; Finger, L. David; Grasby, Jane A.
2016-01-01
Human flap endonuclease-1 (hFEN1) catalyzes the essential removal of single-stranded flaps arising at DNA junctions during replication and repair processes. hFEN1 biological function must be precisely controlled, and consequently, the protein relies on a combination of protein and substrate conformational changes as a prerequisite for reaction. These include substrate bending at the duplex-duplex junction and transfer of unpaired reacting duplex end into the active site. When present, 5′-flaps are thought to thread under the helical cap, limiting reaction to flaps with free 5′-termini in vivo. Here we monitored DNA bending by FRET and DNA unpairing using 2-aminopurine exciton pair CD to determine the DNA and protein requirements for these substrate conformational changes. Binding of DNA to hFEN1 in a bent conformation occurred independently of 5′-flap accommodation and did not require active site metal ions or the presence of conserved active site residues. More stringent requirements exist for transfer of the substrate to the active site. Placement of the scissile phosphate diester in the active site required the presence of divalent metal ions, a free 5′-flap (if present), a Watson-Crick base pair at the terminus of the reacting duplex, and the intact secondary structure of the enzyme helical cap. Optimal positioning of the scissile phosphate additionally required active site conserved residues Tyr40, Asp181, and Arg100 and a reacting duplex 5′-phosphate. These studies suggest a FEN1 reaction mechanism where junctions are bound and 5′-flaps are threaded (when present), and finally the substrate is transferred onto active site metals initiating cleavage. PMID:26884332
Predicting stability of DNA duplexes in solutions containing magnesium and monovalent cations.
Owczarzy, Richard; Moreira, Bernardo G; You, Yong; Behlke, Mark A; Walder, Joseph A
2008-05-13
Accurate predictions of DNA stability in physiological and enzyme buffers are important for the design of many biological and biochemical assays. We therefore investigated the effects of magnesium, potassium, sodium, Tris ions, and deoxynucleoside triphosphates on melting profiles of duplex DNA oligomers and collected large melting data sets. An empirical correction function was developed that predicts melting temperatures, transition enthalpies, entropies, and free energies in buffers containing magnesium and monovalent cations. The new correction function significantly improves the accuracy of predictions and accounts for ion concentration, G-C base pair content, and length of the oligonucleotides. The competitive effects of potassium and magnesium ions were characterized. If the concentration ratio of [Mg (2+)] (0.5)/[Mon (+)] is less than 0.22 M (-1/2), monovalent ions (K (+), Na (+)) are dominant. Effects of magnesium ions dominate and determine duplex stability at higher ratios. Typical reaction conditions for PCR and DNA sequencing (1.5-5 mM magnesium and 20-100 mM monovalent cations) fall within this range. Conditions were identified where monovalent and divalent cations compete and their stability effects are more complex. When duplexes denature, some of the Mg (2+) ions associated with the DNA are released. The number of released magnesium ions per phosphate charge is sequence dependent and decreases surprisingly with increasing oligonucleotide length.
Multi-shell model of ion-induced nucleic acid condensation
NASA Astrophysics Data System (ADS)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Baker, Nathan A.; Onufriev, Alexey V.
2016-04-01
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into "external" and "internal" ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the "external" shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the "internal" shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent "ion binding shells."
Crystal structure of a four-stranded intercalated DNA: d(C4)
NASA Technical Reports Server (NTRS)
Chen, L.; Cai, L.; Zhang, X.; Rich, A.
1994-01-01
The crystal structure of d(C4) solved at 2.3-A resolution reveals a four-stranded molecule composed of two interdigitated or intercalated duplexes. The duplexes are held together by hemiprotonated cytosine-cytosine base pairs and are parallel stranded, but the two duplexes point in opposite directions. The molecule has a slow right-handed twist of 12.4 degrees between covalently linked cytosine base pairs, and the base stacking distance is 3.1 A. This is in general agreement with the NMR studies. A biological role for DNA in this conformation is suggested.
A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.
Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares
2017-11-15
Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format has many advantages. By joining two qPCR protocols into one, more results can be obtained in the same amount of time with reduced costs and embedded quality control. Reagents are preloaded and stored on the plate, reducing the operator's hands-on time to set up a reaction, as well as decreasing manipulation steps, which reduces the risk of mistakes or contamination. Thus, the ready-to-use duplex format turns qPCR into a robust, easy-to-use tool, which could help increase the availability of qPCR for CVL diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
Jain, Deepak R; Anandi V, Libi; Lahiri, Mayurika; Ganesh, Krishna N
2014-10-17
Intrinsically cationic and chiral C(γ)-substituted peptide nucleic acid (PNA) analogues have been synthesized in the form of γ(S)-ethyleneamino (eam)- and γ(S)-ethyleneguanidino (egd)-PNA with two carbon spacers from the backbone. The relative stabilization (ΔTm) of duplexes from modified cationic PNAs as compared to 2-aminoethylglycyl (aeg)-PNA is better with complementary DNA (PNA:DNA) than with complementary RNA (PNA:RNA). Inherently, PNA:RNA duplexes have higher stability than PNA:DNA duplexes, and the guanidino PNAs are superior to amino PNAs. The cationic PNAs were found to be specific toward their complementary DNA target as seen from their significantly lower binding with DNA having single base mismatch. The differential binding avidity of cationic PNAs was assessed by the displacement of DNA duplex intercalated ethidium bromide and gel electrophoresis. The live cell imaging of amino/guanidino PNAs demonstrated their ability to penetrate the cell membrane in 3T3 and MCF-7 cells, and cationic PNAs were found to be accumulated in the vicinity of the nuclear membrane in the cytoplasm. Fluorescence-activated cell sorter (FACS) analysis of cell permeability showed the efficiency to be dependent upon the nature of cationic functional group, with guanidino PNAs being better than the amino PNAs in both cell lines. The results are useful to design new biofunctional cationic PNA analogues that not only bind RNA better but also show improved cell permeability.
Mechanism-based inhibition of C5-cytosine DNA methyltransferases by 2-H pyrimidinone.
Hurd, P J; Whitmarsh, A J; Baldwin, G S; Kelly, S M; Waltho, J P; Price, N C; Connolly, B A; Hornby, D P
1999-02-19
DNA duplexes in which the target cytosine base is replaced by 2-H pyrimidinone have previously been shown to bind with a significantly greater affinity to C5-cytosine DNA methyltransferases than unmodified DNA. Here, it is shown that 2-H pyrimidinone, when incorporated into DNA duplexes containing the recognition sites for M.HgaI-2 and M.MspI, elicits the formation of inhibitory covalent nucleoprotein complexes. We have found that although covalent complexes are formed between 2-H pyrimidinone-modified DNA and both M.HgaI-2 and M.MspI, the kinetics of complex formation are quite distinct in each case. Moreover, the formation of a covalent complex is still observed between 2-H pyrimidinone DNA and M.MspI in which the active-site cysteine residue is replaced by serine or threonine. Covalent complex formation between M.MspI and 2-H pyrimidinone occurs as a direct result of nucleophilic attack by the residue at the catalytic position, which is enhanced by the absence of the 4-amino function in the base. The substitution of the catalytic cysteine residue by tyrosine or chemical modification of the wild-type enzyme with N-ethylmaleimide, abolishes covalent interaction. Nevertheless the 2-H pyrimidinone-substituted duplex still binds to M.MspI with a greater affinity than a standard cognate duplex, since the 2-H pyrimidinone base is mis-paired with guanine. Copyright 1999 Academic Press.
Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU
1996-09-03
A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.
Takezawa, Yusuke; Nishiyama, Kotaro; Mashima, Tsukasa; Katahira, Masato; Shionoya, Mitsuhiko
2015-10-12
A novel bifacial ligand-bearing nucleobase, 5-hydroxyuracil (U(OH) ), which forms both a hydrogen-bonded base pair (U(OH) -A) and a metal-mediated base pair (U(OH) -M-U(OH) ) has been developed. The U(OH) -M-U(OH) base pairs were quantitatively formed in the presence of lanthanide ions such as Gd(III) when U(OH) -U(OH) pairs were consecutively incorporated into DNA duplexes. This result established metal-assisted duplex stabilization as well as DNA-templated assembly of lanthanide ions. Notably, a duplex possessing U(OH) -A base pairs was destabilized by addition of Gd(III) ions. This observation suggests that the hybridization behaviors of the U(OH) -containing DNA strands are altered by metal complexation. Thus, the U(OH) nucleobase with a bifacial base-pairing property holds great promise as a component for metal-responsive DNA materials. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bag, Subhendu Sekhar; Talukdar, Sangita; Kundu, Rajen; Saito, Isao; Jana, Subhashis
2014-01-25
Dual door entry to exciplex formation was established in a chimeric DNA duplex wherein a fluorescent non-nucleosidic base surrogate () is paired against a fluorescent nucleosidic base surrogate (). Packing of the nucleobases via intercalative stacking interactions led to an exciplex emission either via FRET from the donor or direct excitation of the FRET acceptor .
Stacked-unstacked equilibrium at the nick site of DNA.
Protozanova, Ekaterina; Yakovchuk, Peter; Frank-Kamenetskii, Maxim D
2004-09-17
Stability of duplex DNA with respect to separation of complementary strands is crucial for DNA executing its major functions in the cell and it also plays a central role in major biotechnology applications of DNA: DNA sequencing, polymerase chain reaction, and DNA microarrays. Two types of interaction are well known to contribute to DNA stability: stacking between adjacent base-pairs and pairing between complementary bases. However, their contribution into the duplex stability is yet to be determined. Now we fill this fundamental gap in our knowledge of the DNA double helix. We have prepared a series of 32, 300 bp-long DNA fragments with solitary nicks in the same position differing only in base-pairs flanking the nick. Electrophoretic mobility of these fragments in the gel has been studied. Assuming the equilibrium between stacked and unstacked conformations at the nick site, all 32 stacking free energy parameters have been obtained. Only ten of them are essential and they govern the stacking interactions between adjacent base-pairs in intact DNA double helix. A full set of DNA stacking parameters has been determined for the first time. From these data and from a well-known dependence of DNA melting temperature on G.C content, the contribution of base-pairing into duplex stability has been estimated. The obtained energy parameters of the DNA double helix are of paramount importance for understanding sequence-dependent DNA flexibility and for numerous biotechnology applications.
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
Solution structure and stability of the DNA undecamer duplexes containing oxanine mismatch
Pack, Seung Pil; Morimoto, Hirohisa; Makino, Keisuke; Tajima, Kunihiko; Kanaori, Kenji
2012-01-01
Solution structures of DNA duplexes containing oxanine (Oxa, O) opposite a cytosine (O:C duplex) and opposite a thymine (O:T duplex) have been solved by the combined use of 1H NMR and restrained molecular dynamics calculation. One mismatch pair was introduced into the center of the 11-mer duplex of [d(GTGACO6CACTG)/d(CAGTGX17GTCAC), X = C or T]. 1H NMR chemical shifts and nuclear Overhauser enhancement (NOE) intensities indicate that both the duplexes adopt an overall right-handed B-type conformation. Exchangeable resonances of C17 4-amino proton of the O:C duplex and of T17 imino proton of O:T duplex showed unusual chemical shifts, and disappeared with temperature increasing up to 30°C, although the melting temperatures were >50°C. The O:C mismatch takes a wobble geometry with positive shear parameter where the Oxa ring shifted toward the major groove and the paired C17 toward the minor groove, while, in the O:T mismatch pair with the negative shear, the Oxa ring slightly shifted toward the minor groove and the paired T17 toward the major groove. The Oxa mismatch pairs can be wobbled largely because of no hydrogen bond to the O1 position of the Oxa base, and may occupy positions in the strands that optimize the stacking with adjacent bases. PMID:22039100
Yeast Helicase Pif1 Unwinds RNA:DNA Hybrids with Higher Processivity than DNA:DNA Duplexes*
Chib, Shubeena; Byrd, Alicia K.; Raney, Kevin D.
2016-01-01
Saccharomyces cerevisiae Pif1, an SF1B helicase, has been implicated in both mitochondrial and nuclear functions. Here we have characterized the preference of Pif1 for RNA:DNA heteroduplexes in vitro by investigating several kinetic parameters associated with unwinding. We show that the preferential unwinding of RNA:DNA hybrids is due to neither specific binding nor differences in the rate of strand separation. Instead, Pif1 is capable of unwinding RNA:DNA heteroduplexes with moderately greater processivity compared with its duplex DNA:DNA counterparts. This higher processivity of Pif1 is attributed to slower dissociation from RNA:DNA hybrids. Biologically, this preferential role of the helicase may contribute to its functions at both telomeric and nontelomeric sites. PMID:26733194
Recognition of DNA/RNA bulges by antimicrobial and antitumor metallohelices.
Malina, Jaroslav; Scott, Peter; Brabec, Viktor
2015-09-07
Bulged structures have been identified in nucleic acids and have been shown to be linked to biomolecular processes involved in numerous diseases. Thus, chemical agents with affinity for bulged nucleic acids are of general biological significance. Herein, the mechanism of specific recognition and stabilization of bulged DNA and RNA by helical bimetallic species was established through detailed molecular biophysics and biochemistry assays. These agents, known as 'flexicates', are potential mimetics of α-helical peptides in cancer treatment, exhibiting antimicrobial and antitumor effects. The flexicates have positive impacts on the thermal stability of DNA duplexes containing bulges, which means that the flexicates interact with the duplexes containing bulges, and that these interactions stabilize the secondary structures of these duplexes. Notably, the stabilising effect of the flexicates increases with the size of the bulge, the maximal stabilization is observed for the duplexes containing a bulge composed of at least three bases. The flexicates bind most preferentially to the bulges composed of pyrimidines flanked on both sides also by pyrimidines. It is suggested that it is so because these bulges exhibit greatest conformational variability in comparison with other combinations of bases in the bulge loop and bases flanking the bulge. Finally, the results indicate that there is only one dominant binding site for the flexicates on the DNA and RNA bulges and that the flexicates bind directly to the bulge or in its close proximity. It is also shown that the flexicates effectively bind to RNA duplexes containing the bulged region of HIV-1 TAR RNA.
Hughesman, Curtis; Fakhfakh, Kareem; Bidshahri, Roza; Lund, H Louise; Haynes, Charles
2015-02-17
Advances in real-time polymerase chain reaction (PCR), as well as the emergence of digital PCR (dPCR) and useful modified nucleotide chemistries, including locked nucleic acids (LNAs), have created the potential to improve and expand clinical applications of PCR through their ability to better quantify and differentiate amplification products, but fully realizing this potential will require robust methods for designing dual-labeled hydrolysis probes and predicting their hybridization thermodynamics as a function of their sequence, chemistry, and template complementarity. We present here a nearest-neighbor thermodynamic model that accurately predicts the melting thermodynamics of a short oligonucleotide duplexed either to its perfect complement or to a template containing mismatched base pairs. The model may be applied to pure-DNA duplexes or to duplexes for which one strand contains any number and pattern of LNA substitutions. Perturbations to duplex stability arising from mismatched DNA:DNA or LNA:DNA base pairs are treated at the Gibbs energy level to maintain statistical significance in the regressed model parameters. This approach, when combined with the model's accounting of the temperature dependencies of the melting enthalpy and entropy, permits accurate prediction of T(m) values for pure-DNA homoduplexes or LNA-substituted heteroduplexes containing one or two independent mismatched base pairs. Terms accounting for changes in solution conditions and terminal addition of fluorescent dyes and quenchers are then introduced so that the model may be used to accurately predict and thereby tailor the T(m) of a pure-DNA or LNA-substituted hydrolysis probe when duplexed either to its perfect-match template or to a template harboring a noncomplementary base. The model, which builds on classic nearest-neighbor thermodynamics, should therefore be of use to clinicians and biologists who require probes that distinguish and quantify two closely related alleles in either a quantitative PCR or dPCR assay. This potential is demonstrated by using the model to design allele-specific probes that completely discriminate and quantify clinically relevant mutant alleles (BRAF V600E and KIT D816V) in a dPCR assay.
Sampath, Asanga; Weerasekera, Manjula; Dilhari, Ayomi; Gunasekara, Chinthika; Bulugahapitiya, Uditha; Fernando, Neluka; Samaranayake, Lakshman
2017-12-01
Candida dubliniensis shares a wide range of phenotypic characteristics with Candida albicans including a common trait called germ tube positivity. Hence, laboratory differentiation of these two species is cumbersome. Duplex PCR analyses for C. albicans and C. dubliniensis was performed directly on DNA extracted from a total of 122 germ tube positive isolates derived from 100 concentrated oral rinse samples from a random cohort of diabetics attending a clinic in Sri Lanka. These results were confirmed by DNA sequencing of internal transcribed spacer (ITS) region of rDNA of the yeasts. Performance efficacy of duplex PCR was then compared with phenotypic identification using a standard battery of phenotypic tests. Of the 122 germ tube positive isolates three were identified by duplex PCR as C. dubliniensis and the remainder as C. albicans. On the contrary, when the standard phenotypic tests, sugar assimilation and chlamydospore formation, were used to differentiate the two species 13 germ tube positive isolates were erroneously identified as C. dubliniensis. Duplex PCR was found to be rapid, sensitive and more specific than phenotypic identification methods in discriminating C. dubliniensis from C. albicans. This is also the first report on the oral carriage of C. dubliniensis in a Sri Lankan population.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
Functional Architecture of T7 RNA Polymerase Transcription Complexes
Nayak, Dhananjaya; Guo, Qing; Sousa, Rui
2007-01-01
Summary T7 RNA polymerase is the best-characterized member of a widespread family of single-subunit RNA polymerases. Crystal structures of T7 RNA polymerase initiation and elongation complexes have provided a wealth of detailed information on RNA polymerase interactions with the promoter and transcription bubble, but the absence of DNA downstream of the melted region of the template in the initiation complex structure, and the absence of DNA upstream of the transcription bubble in the elongation complex structure means that our picture of the functional architecture of T7 RNA polymerase transcription complexes remains incomplete. Here we use the site-specifically tethered chemical nucleases and functional characterization of directed T7 RNAP mutants to both reveal the architecture of the duplex DNA that flanks the transcription bubble in the T7 RNAP initiation and elongation complexes, and to define the function of the interactions made by these duplex elements. We find that downstream duplex interactions made with a cluster of lysines (K711/K713/K714) are present during both elongation and initiation where they contribute to stabilizing a bend in the downstream DNA that is important for promoter opening. The upstream DNA in the elongation complex is also found to be sharply bent at the upstream edge of the transcription bubble, thereby allowing formation of upstream duplex:polymerase interactions that contribute to elongation complex stability. PMID:17580086
Rajendran, Arivazhagan; Endo, Masayuki; Hidaka, Kumi; Lan Thao Tran, Phong; Mergny, Jean-Louis; Sugiyama, Hiroshi
2013-01-01
Guanine-rich oligonucleotides often show a strong tendency to form supramolecular architecture, the so-called G-quadruplex structure. Because of the biological significance, it is now considered to be one of the most important conformations of DNA. Here, we describe the direct visualization and single-molecule analysis of the formation of a tetramolecular G-quadruplex in KCl solution. The conformational changes were carried out by incorporating two duplex DNAs, with G–G mismatch repeats in the middle, inside a DNA origami frame and monitoring the topology change of the strands. In the absence of KCl, incorporated duplexes had no interaction and laid parallel to each other. Addition of KCl induced the formation of a G-quadruplex structure by stably binding the duplexes to each other in the middle. Such a quadruplex formation allowed the DNA synapsis without disturbing the duplex regions of the participating sequences, and resulted in an X-shaped structure that was monitored by atomic force microscopy. Further, the G-quadruplex formation in KCl solution and its disruption in KCl-free buffer were analyzed in real-time. The orientation of the G-quadruplex is often difficult to control and investigate using traditional biochemical methods. However, our method using DNA origami could successfully control the strand orientations, topology and stoichiometry of the G-quadruplex. PMID:23863846
Vengut-Climent, Empar; Peñalver, Pablo; Lucas, Ricardo; Gómez-Pinto, Irene; Aviñó, Anna; Muro-Pastor, Alicia M.; Galbis, Elsa; de Paz, M. Violante; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias; Eritja, Ramón; González, Carlos
2018-01-01
Recently, we studied glucose-nucleobase pairs, a binding motif found in aminoglycoside–RNA recognition. DNA duplexes with glucose as a nucleobase were able to hybridize and were selective for purines. They were less stable than natural DNA but still fit well on regular B-DNA. These results opened up the possible use of glucose as a non-aromatic DNA base mimic. Here, we have studied the incorporation and thermal stability of glucose with different types of anchoring units and alternative apolar sugar-nucleobase pairs. When we explored butanetriol instead of glycerol as a wider anchoring unit, we did not gain duplex thermal stability. This result confirmed the necessity of a more conformationally restricted linker to increase the overall duplex stability. Permethylated glucose-nucleobase pairs showed similar stability to glucoside-nucleobase pairs but no selectivity for a specific nucleobase, possibly due to the absence of hydrogen bonds between them. The three-dimensional structure of the duplex solved by NMR located both, the hydrophobic permethylated glucose and the nucleobase, inside the DNA helix as in the case of glucose-nucleobase pairs. Quantum chemical calculations on glucose-nucleobase pairs indicate that the attachment of the sugar to the DNA skeleton through the OH1 or OH4 positions yields the highest binding energies. Moreover, glucose was very selective for guanine when attached through OH1 or OH4 to the DNA. Finally, we examined DNA polymerase insertion of nucleotides in front of the saccharide unit. KF– polymerase from E. coli inserted A and G opposite glc and 6dglc with low efficiency but notable selectivity. It is even capable of extending the new pair although its efficiency depended on the DNA sequence. In contrast, Bst 2.0, SIII and BIOTAQ™ DNA polymerases seem to display a loop-out mechanism possibly due to the flexible glycerol linker used instead of deoxyribose. PMID:29780486
Maltseva, T; Sandström, A; Ivanova, I M; Sergeyev, D S; Zarytova, V F; Chattopadhyaya, J
1993-05-01
The mechanism through which modified oligo-DNA analogues act as antisense repressors at the transcriptional and translational level of gene expression is based on the information content in the nucleotide sequence which is determined by the specific base pairing. The efficiency of such action is largely determined by the stability of the duplex formed between the oligonucleotide reagent and the target sequence and also by the mismatched base pairing, such as G-A, that occurs during replication or recombination. We herein report that the phenazinium (Pzn)-tethered matched duplex p(d(TGTTTGGC)):(Pzn)-p(d(CCAAACA)) (III) (Tm = 50 degrees C) has a much larger stability than the parent matched duplex p(d(TGTTTGGC)):p(d(CCAAACA)) (I) (Tm = 30 degrees C). On the other hand, the Pzn-tethered G-A-mismatched duplex p(d(TGTTTGGC)):(Pzn)-p(d(ACAAACA)) (IV) (Tm = 34 degrees C) is only slightly more stable than its parent mismatched duplex p(d(TGTTTGGC)):p(d(ACAAACA)) (Tm = 25 degrees C). A detailed 500 MHz NMR study and constrained MD refinements of NMR-derived structures have been undertaken for the DNA duplexes (I), (II), (III) and (IV) in order to understand the structural basis of stabilization of Pzn-tethered matched DNA duplex (delta Tm = 20 degrees C) compared to mismatched duplex (delta Tm = 9 degrees C). Assignment of the 1H-NMR (500 MHz) spectra of the duplexes has been carried out by 2D NOESY, HOHAHA and DQF-COSY experiments. The torsion angles have been extracted from the J-coupling constants obtained by simulation of most of the DQF-COSY cross-peaks using program SMART. The solution structure of the duplexes were assessed by an iterative hybride relaxation matrix method (MORASS) combined with NOESY distances and torsion angles restrained molecular dynamics (MD) using program Amber 4.0. The standard Amber 4.0 force-field parameters were used for the oligonucleotide in conjunction with the new parameters for Pzn residue which was obtained by full geometry optimization using ab initio program (3-21G basis set). It has been shown that mismatched G-A bases are in the anti-anti conformation. The mismatched 7G-1A form stable base pairs through inter-strand hydrogen bonds (N7(A)...HN2(G) (1.92 A) with a subtended angle of 176 degrees and N3(G)...HN6(A) (2.01 A) with a subtended angle of 153 degrees (the 'amino-type' hydrogen bond)) and a propeller twist of 36 degrees for 7G-1A residues.(ABSTRACT TRUNCATED AT 400 WORDS)
Interstrand cross-links arising from strand breaks at true abasic sites in duplex DNA
Yang, Zhiyu; Price, Nathan E.; Johnson, Kevin M.
2017-01-01
Abstract Interstrand cross-links are exceptionally bioactive DNA lesions. Endogenous generation of interstrand cross-links in genomic DNA may contribute to aging, neurodegeneration, and cancer. Abasic (Ap) sites are common lesions in genomic DNA that readily undergo spontaneous and amine-catalyzed strand cleavage reactions that generate a 2,3-didehydro-2,3-dideoxyribose sugar remnant (3’ddR5p) at the 3’-terminus of the strand break. Interestingly, this strand scission process leaves an electrophilic α,β-unsaturated aldehyde residue embedded within the resulting nicked duplex. Here we present evidence that 3’ddR5p derivatives generated by spermine-catalyzed strand cleavage at Ap sites in duplex DNA can react with adenine residues on the opposing strand to generate a complex lesion consisting of an interstrand cross-link adjacent to a strand break. The cross-link blocks DNA replication by ϕ29 DNA polymerase, a highly processive polymerase enzyme that couples synthesis with strand displacement. This suggests that 3’ddR5p-derived cross-links have the potential to block critical cellular DNA transactions that require strand separation. LC-MS/MS methods developed herein provide powerful tools for studying the occurrence and properties of these cross-links in biochemical and biological systems. PMID:28531327
Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics
Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.
2014-01-01
Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254
Zhang, Haibo; Yang, Litao; Guo, Jinchao; Li, Xiang; Jiang, Lingxi; Zhang, Dabing
2008-07-23
To enforce the labeling regulations of genetically modified organisms (GMOs), the application of reference molecules as calibrators is becoming essential for practical quantification of GMOs. However, the reported reference molecules with tandem marker multiple targets have been proved not suitable for duplex PCR analysis. In this study, we developed one unique plasmid molecule based on one pMD-18T vector with three exogenous target DNA fragments of Roundup Ready soybean GTS 40-3-2 (RRS), that is, CaMV35S, NOS, and RRS event fragments, plus one fragment of soybean endogenous Lectin gene. This Lectin gene fragment was separated from the three exogenous target DNA fragments of RRS by inserting one 2.6 kb DNA fragment with no relatedness to RRS detection targets in this resultant plasmid. Then, we proved that this design allows the quantification of RRS using the three duplex real-time PCR assays targeting CaMV35S, NOS, and RRS events employing this reference molecule as the calibrator. In these duplex PCR assays, the limits of detection (LOD) and quantification (LOQ) were 10 and 50 copies, respectively. For the quantitative analysis of practical RRS samples, the results of accuracy and precision were similar to those of simplex PCR assays, for instance, the quantitative results were at the 1% level, the mean bias of the simplex and duplex PCR were 4.0% and 4.6%, respectively, and the statistic analysis ( t-test) showed that the quantitative data from duplex and simplex PCR had no significant discrepancy for each soybean sample. Obviously, duplex PCR analysis has the advantages of saving the costs of PCR reaction and reducing the experimental errors in simplex PCR testing. The strategy reported in the present study will be helpful for the development of new reference molecules suitable for duplex PCR quantitative assays of GMOs.
Marathias, V M; Sawicki, M J; Bolton, P H
1999-07-15
The ability to chemically synthesize biomolecules has opened up the opportunity to observe changes in structure and activity that occur upon single atom substitution. In favorable cases this can provide information about the roles of individual atoms. The substitution of 6-thioguanine (6SG) for guanine is a potentially very useful single atom substitution as 6SG has optical, photocrosslinking, metal ion binding and other properties of potential utility. In addition, 6-mercaptopurine is a clinically important pro-drug that is activated by conversion into 6SG by cells. The results presented here indicate that the presence of 6SG blocks the formation of quadruplex DNA. The presence of 6SG alters the structure and lowers the thermal stability of duplex DNA, but duplex DNA can be formed in the presence of 6SG. These results indicate that some of the cytotoxic activity of 6SG may be due to disruption of the quadruplex structures formed by telomere and other DNAs. This additional mode of action is consistent with the delayed onset of cytotoxicity.
Langston, Lance; O’Donnell, Mike
2017-01-01
Replicative helicases are ring-shaped hexamers that encircle DNA for duplex unwinding. The currently accepted view of hexameric helicase function is by steric exclusion, where the helicase encircles one DNA strand and excludes the other, acting as a wedge with an external DNA unwinding point during translocation. Accordingly, strand-specific blocks only affect these helicases when placed on the tracking strand, not the excluded strand. We examined the effect of blocks on the eukaryotic CMG and, contrary to expectations, blocks on either strand inhibit CMG unwinding. A recent cryoEM structure of yeast CMG shows that duplex DNA enters the helicase and unwinding occurs in the central channel. The results of this report inform important aspects of the structure, and we propose that CMG functions by a modified steric exclusion process in which both strands enter the helicase and the duplex unwinding point is internal, followed by exclusion of the non-tracking strand. DOI: http://dx.doi.org/10.7554/eLife.23449.001 PMID:28346143
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-01-01
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson–Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine–thymine (A–T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. PMID:26250116
NASA Astrophysics Data System (ADS)
Ghobadi, Ahmadreza F.; Jayaraman, Arthi
DNA hybridization is the basis of various bio-nano technologies, such as DNA origami and assembly of DNA-functionalized nanoparticles. A hybridized double stranded (ds) DNA is formed when complementary nucleobases on hybridizing strands exhibit specific and directional hydrogen bonds through canonical Watson-Crick base-pairing interactions. In recent years, the need for cheaper alternatives and significant synthetic advances have driven design of DNA mimics with new backbone chemistries. However, a fundamental understanding of how these backbone modifications in the oligo-nucleic acids impact the hybridization and melting behavior of the duplex is still lacking. In this talk, we present our recent findings on impact of varying backbone chemistry on hybridization of oligo-nucleic acid duplexes. We use coarse-grained molecular dynamics simulations to isolate the effect of strand flexibility, electrostatic interactions and nucleobase spacing on the melting curves for duplexes with various strand sequences and concentrations. Since conjugation of oligo-nucleic acids with polymers serve as building blocks for thermo-responsive polymer networks and gels, we also present the effect of such conjugation on hybridization thermodynamics and polymer conformation.
Multi-shell model of ion-induced nucleic acid condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(III) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derivedmore » from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.”.« less
Multi-shell model of ion-induced nucleic acid condensation
Tolokh, Igor S.; Drozdetski, Aleksander V.; Pollack, Lois; Onufriev, Alexey V.
2016-01-01
We present a semi-quantitative model of condensation of short nucleic acid (NA) duplexes induced by trivalent cobalt(iii) hexammine (CoHex) ions. The model is based on partitioning of bound counterion distribution around single NA duplex into “external” and “internal” ion binding shells distinguished by the proximity to duplex helical axis. In the aggregated phase the shells overlap, which leads to significantly increased attraction of CoHex ions in these overlaps with the neighboring duplexes. The duplex aggregation free energy is decomposed into attractive and repulsive components in such a way that they can be represented by simple analytical expressions with parameters derived from molecular dynamic simulations and numerical solutions of Poisson equation. The attractive term depends on the fractions of bound ions in the overlapping shells and affinity of CoHex to the “external” shell of nearly neutralized duplex. The repulsive components of the free energy are duplex configurational entropy loss upon the aggregation and the electrostatic repulsion of the duplexes that remains after neutralization by bound CoHex ions. The estimates of the aggregation free energy are consistent with the experimental range of NA duplex condensation propensities, including the unusually poor condensation of RNA structures and subtle sequence effects upon DNA condensation. The model predicts that, in contrast to DNA, RNA duplexes may condense into tighter packed aggregates with a higher degree of duplex neutralization. An appreciable CoHex mediated RNA-RNA attraction requires closer inter-duplex separation to engage CoHex ions (bound mostly in the “internal” shell of RNA) into short-range attractive interactions. The model also predicts that longer NA fragments will condense more readily than shorter ones. The ability of this model to explain experimentally observed trends in NA condensation lends support to proposed NA condensation picture based on the multivalent “ion binding shells.” PMID:27389241
NASA Astrophysics Data System (ADS)
Birrento, Monica L.; Bryan, Tracy M.; Samosorn, Siritron; Beck, Jennifer L.
2015-07-01
Electrospray ionization mass spectrometry (ESI-MS) conditions were optimized for simultaneous observation of a bimolecular qDNA and a Watson-Crick base-paired duplex DNA/RNA hybrid. The DNA sequence used was telomeric DNA, and the RNA contained the template for telomerase-mediated telomeric DNA synthesis. Addition of RNA to the quadruplex DNA (qDNA) resulted in formation of the duplex DNA/RNA hybrid. Melting profiles obtained using circular dichroism spectroscopy confirmed that the DNA/RNA hybrid exhibited greater thermal stability than the bimolecular qDNA in solution. Binding of a 13-substituted berberine ( 1) derivative to the bimolecular qDNA stabilized its structure as evidenced by an increase in its stability in the mass spectrometer, and an increase in its circular dichroism (CD) melting temperature of 10°C. The DNA/RNA hybrid did not bind the ligand extensively and its thermal stability was unchanged in the presence of ( 1). The qDNA-ligand complex resisted unfolding in the presence of excess RNA, limiting the formation of the DNA/RNA hybrid. Previously, it has been proposed that DNA secondary structures, such as qDNA, may be involved in the telomerase mechanism. DNA/RNA hybrid structures occur at the active site of telomerase. The results presented in the current work show that if telomeric DNA was folded into a qDNA structure, it is possible for a DNA/RNA hybrid to form as is required during template alignment. The discrimination of ligand ( 1) for binding to the bimolecular qDNA over the DNA/RNA hybrid positions it as a useful compound for probing the role(s), if any, of antiparallel qDNA in the telomerase mechanism.
Development of dansyl-modified oligonucleotide probes responding to structural changes in a duplex.
Suzuki, Yoshio; Kowata, Keiko; Komatsu, Yasuo
2013-11-15
We have synthesized a nonnucleoside amidite block of dansyl fluorophore to prepare dansyl-modified oligonucleotides (ONTs). The fluorescence intensities of dansyl-ONT specifically increased by the presence of adjacent guanosine residues but, significantly reduced in a dansyl-flipping duplex. These changes were caused by solvatochromism effect due to the number of guanine which is hydrophobic functional group and the external environment of dansyl group. The fluorescence intensities could be plotted as a function of the ONTs concentrations and the increase in the fluorescence was observed to equimolar concentrations of target DNA. This duplex exhibited higher melting temperature relative to the corresponding duplexes containing other base pairs. Similar changes in fluorescence could be detected upon hybridization with complementary RNAs. Thus, the dansyl-modified ONTs provide sequence specific fluorescent probe of DNA and RNA. Copyright © 2013 Elsevier Ltd. All rights reserved.
Monti, Susanna; Cacelli, Ivo; Ferretti, Alessandro; Prampolini, Giacomo; Barone, Vincenzo
2011-07-21
Molecular dynamics simulations (90 ns) of different DNA complexes attached to a functionalized substrate in solution were performed in order to clarify the behavior of mismatched DNA sequences captured by a tethered DNA probe (biochip). Examination of the trajectories revealed that the substrate influence and a series of cooperative events, including recognition, reorientation and reorganization of the bases, could induce the formation of stable duplexes having non-canonical arrangements. Major adjustment of the structures was observed when the mutated base was located in the end region of the chain close to the surface. This journal is © the Owner Societies 2011
Toehold-Mediated Displacement of an Adenosine-Binding Aptamer from a DNA Duplex by its Ligand.
Monserud, Jon H; Macri, Katherine M; Schwartz, Daniel K
2016-10-24
DNA is increasingly used to engineer dynamic nanoscale circuits, structures, and motors, many of which rely on DNA strand-displacement reactions. The use of functional DNA sequences (e.g., aptamers, which bind to a wide range of ligands) in these reactions would potentially confer responsiveness on such devices, and integrate DNA computation with highly varied molecular stimuli. By using high-throughput single-molecule FRET methods, we compared the kinetics of a putative aptamer-ligand and aptamer-complement strand-displacement reaction. We found that the ligands actively disrupted the DNA duplex in the presence of a DNA toehold in a similar manner to complementary DNA, with kinetic details specific to the aptamer structure, thus suggesting that the DNA strand-displacement concept can be extended to functional DNA-ligand systems. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Maltseva, E A; Krasikova, Y S; Naegeli, H; Lavrik, O I; Rechkunova, N I
2014-06-01
Xeroderma pigmentosum factor A (XPA) is one of the key proteins in the nucleotide excision repair (NER) process. The effects of point substitutions in the DNA-binding domain of XPA (positively charged lysine residues replaced by negatively charged glutamate residues: XPA K204E, K179E, K141E, and tandem mutant K141E/K179E) on the interaction of the protein with DNA structures modeling intermediates of the damage recognition and pre-incision stages in NER were analyzed. All these mutations decreased the affinity of the protein to DNA, the effect depending on the substitution and the DNA structure. The mutant as well as wild-type proteins bind with highest efficiency partly open damaged DNA duplex, and the affinity of the mutants to this DNA is reduced in the order: K204E > K179E > K141E = K141/179E. For all the mutants, decrease in DNA binding efficiency was more pronounced in the case of full duplex and single-stranded DNA than with bubble-DNA structure, the difference between protein affinities to different DNA structures increasing as DNA binding activity of the mutant decreased. No effect of the studied XPA mutations on the location of the protein on the partially open DNA duplex was observed using photoinduced crosslinking with 5-I-dUMP in different positions of the damaged DNA strand. These results combined with earlier published data suggest no direct correlation between DNA binding and activity in NER for these XPA mutants.
C-5 Propynyl Modifications Enhance the Mechanical Stability of DNA.
Aschenbrenner, Daniela; Baumann, Fabian; Milles, Lukas F; Pippig, Diana A; Gaub, Hermann E
2015-07-20
Increased thermal or mechanical stability of DNA duplexes is desired for many applications in nanotechnology or -medicine where DNA is used as a programmable building block. Modifications of pyrimidine bases are known to enhance thermal stability and have the advantage of standard base-pairing and easy integration during chemical DNA synthesis. Through single-molecule force spectroscopy experiments with atomic force microscopy and the molecular force assay we investigated the effect of pyrimidines harboring C-5 propynyl modifications on the mechanical stability of double-stranded DNA. Utilizing these complementary techniques, we show that propynyl bases significantly increase the mechanical stability if the DNA is annealed at high temperature. In contrast, modified DNA complexes formed at room temperature and short incubation times display the same stability as non-modified DNA duplexes. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Otto, C., Thomas, G.A.; Peticolas, W.L.; Rippe, K.
Raman spectra of the parallel-stranded duplex formed from the deoxyoligonucleotides 5{prime}-d-((A){sub 10}TAATTTTAAATATTT)-3{prime} (D1) and 5{prime}-d((T){sub 10}ATTAAAATTTATAAA)-3{prime} (D2) in H{sub 2}O and D{sub 2}O have been acquired. The spectra of the parallel-stranded DNA are then compared to the spectra of the antiparallel double helix formed from the deoxyoligonucleotides D1 and 5{prime}-d(AAATATTTAAAATTA-(T){sub 10})-3{prime} (D3). The Raman spectra of the antiparallel-stranded (aps) duplex are reminiscent of the spectra of poly(d(A)){center dot}poly(d(T)) and a B-form structure similar to that adopted by the homopolymer duplex is assigned to the antiparallel double helix. The spectra of the parallel-stranded (ps) and antiparallel-stranded duplexes differ significantly due tomore » changes in helical organization, i.e., base pairing, base stacking, and backbone conformation. Large changes observed in the carbonyl stretching region implicate the involvement of the C(2) carbonyl of thymine in base pairing. The interaction of adenine with the C(2) carbonyl of thymine is consistent with formation of reverse Watson-Crick base pairing in parallel-stranded DNA. Phosphate-furanose vibrations similar to those observed for B-form DNA of heterogeneous sequence and high A,T content are observed at 843 and 1,092 cm{sup {minus}1} in the spectra of the parallel-stranded duplex.« less
NASA Technical Reports Server (NTRS)
Smith, G. K.; Jie, J.; Fox, G. E.; Gao, X.
1995-01-01
DNA triplet repeats, 5'-d(CTG)n and 5'-d(CAG)n, are present in genes which have been implicated in several neurodegenerative disorders. To investigate possible stable structures formed by these repeating sequences, we have examined d(CTG)n, d(CAG)n and d(CTG).d(CAG)n (n = 2 and 3) using NMR and UV optical spectroscopy. These studies reveal that single stranded (CTG)n (n > 2) forms stable, antiparallel helical duplexes, while the single stranded (CAG)n requires at least three repeating units to form a duplex. NMR and UV melting experiments show that the Tm increases in the order of [(CAG)3]2 < [(CTG)3]2 << (CAG)3.(CTG)3. The (CTG)3 duplex is stable and exhibits similar NMR spectra in solutions containing 0.1-4 M NaCl and at a pH range from 4.6 to 8.8. The (CTG)3 duplex, which contains multiple-T.T mismatches, displays many NMR spectral characteristics similar to those of B-form DNA. However, unique NOE and 1H-31P coupling patterns associated with the repetitive T.T mismatches in the CTG repeats are discerned. These results, in conjunction with recent in vitro studies suggest that longer CTG repeats may form hairpin structures, which can potentially cause interruption in replication, leading to dynamic expansion or deletion of triplet repeats.
Recognition of DNA bulges by dinuclear iron(II) metallosupramolecular helicates.
Malina, Jaroslav; Hannon, Michael J; Brabec, Viktor
2014-02-01
Bulged DNA structures are of general biological significance because of their important roles in a number of biochemical processes. Compounds capable of targeting bulged DNA sequences can be used as probes for studying their role in nucleic acid function, or could even have significant therapeutic potential. The interaction of [Fe(2)L(3)](4+) metallosupramolecular helicates (L = C(25)H(20)N(4)) with DNA duplexes containing bulges has been studied by measurement of the DNA melting temperature and gel electrophoresis. This study was aimed at exploring binding affinities of the helicates for DNA bulges of various sizes and nucleotide sequences. The studies reported herein reveal that both enantiomers of [Fe(2)L(3)](4+) bind to DNA bulges containing at least two unpaired nucleotides. In addition, these helicates show considerably enhanced affinity for duplexes containing unpaired pyrimidines in the bulge and/or pyrimidines flanking the bulge on both sides. We suggest that the bulge creates the structural motif, such as the triangular prismatic pocket formed by the unpaired bulge bases, to accommodate the [Fe(2)L(3)](4+) helicate molecule, and is probably responsible for the affinity for duplexes with a varying number of bulge bases. Our results reveal that DNA bulges represent another example of unusual DNA structures recognized by dinuclear iron(II) ([Fe(2)L(3)](4+)) supramolecular helicates. © 2013 FEBS.
Structural energetics of the adenine tract from an intrinsic transcription terminator.
Huang, Yuegao; Weng, Xiaoli; Russu, Irina M
2010-04-02
Intrinsic transcription termination sites generally contain a tract of adenines in the DNA template that yields a tract of uracils at the 3' end of the nascent RNA. To understand how this base sequence contributes to termination of transcription, we have investigated two nucleic acid structures. The first is the RNA-DNA hybrid that contains the uracil tract 5'-rUUUUUAU-3' from the tR2 intrinsic terminator of bacteriophage lambda. The second is the homologous DNA-DNA duplex that contains the adenine tract 5'-dATAAAAA-3'. This duplex is present at the tR2 site when the DNA is not transcribed. The opening and the stability of each rU-dA/dT-dA base pair in the two structures are characterized by imino proton exchange and nuclear magnetic resonance spectroscopy. The results reveal concerted opening of the central rU-dA base pairs in the RNA-DNA hybrid. Furthermore, the stability profile of the adenine tract in the RNA-DNA hybrid is very different from that of the tract in the template DNA-DNA duplex. In the RNA-DNA hybrid, the stabilities of rU-dA base pairs range from 4.3 to 6.5 kcal/mol (at 10 degrees C). The sites of lowest stability are identified at the central positions of the tract. In the template DNA-DNA duplex, the dT-dA base pairs are more stable than the corresponding rU-dA base pairs in the hybrid by 0.9 to 4.6 kcal/mol and, in contrast to the RNA-DNA hybrid, the central base pairs have the highest stability. These results suggest that the central rU-dA/dT-dA base pairs in the adenine tract make the largest energetic contributions to transcription termination by promoting both the dissociation of the RNA transcript and the closing of the transcription bubble. The results also suggest that the high stability of dT-dA base pairs in the DNA provides a signal for the pausing of RNA polymerase at the termination site. Copyright 2010 Elsevier Ltd. All rights reserved.
Improved Force Fields for Peptide Nucleic Acids with Optimized Backbone Torsion Parameters.
Jasiński, Maciej; Feig, Michael; Trylska, Joanna
2018-06-06
Peptide nucleic acids are promising nucleic acid analogs for antisense therapies as they can form stable duplex and triplex structures with DNA and RNA. Computational studies of PNA-containing duplexes and triplexes are an important component for guiding their design, yet existing force fields have not been well validated and parametrized with modern computational capabilities. We present updated CHARMM and Amber force fields for PNA that greatly improve the stability of simulated PNA-containing duplexes and triplexes in comparison with experimental structures and allow such systems to be studied on microsecond time scales. The force field modifications focus on reparametrized PNA backbone torsion angles to match high-level quantum mechanics reference energies for a model compound. The microsecond simulations of PNA-PNA, PNA-DNA, PNA-RNA, and PNA-DNA-PNA complexes also allowed a comprehensive analysis of hydration and ion interactions with such systems.
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-04-01
To clarify the biochemical behavior of 2'-deoxyribonucleoside 5'-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (C(o)) and adenine N-oxide (A(o)), we examined their base recognition ability in DNA duplex formation using melting temperature (T(m)) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the T(m) values of modified DNA-DNA duplexes incorporating 2'-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo(-)) and Vent (exo(-)) suggested that C(o) and A(o) selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo(-)) toward A(o) on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator.
Why double-stranded RNA resists condensation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Pabit, Suzette; Katz, Andrea M.
2014-09-15
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to attraction between the negatively charged helices and eventually to condensation. Surprisingly, this effect is suppressed in double-stranded RNA, which carries the same charge as the DNA, but assumes a different double helical form. However, additional characterization of short (25 base-pairs) nucleic acid (NA) duplex structures by circular dichroism shows that measured differences in condensation are not solely determined by duplex helical geometry. Here we combine experiment, theory, and atomistic simulations to propose a mechanism that connects the observed variations in condensation of short NA duplexesmore » with the spatial variation of cobalt hexammine (CoHex) binding at the NA duplex surface. The atomistic picture that emerged showed that CoHex distributions around the NA reveals two major NA-CoHex binding modes -- internal and external -- distinguished by the proximity of bound CoHex to the helical axis. Decreasing trends in experimentally observed condensation propensity of the four studied NA duplexes (from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA) are explained by the progressive decrease of a single quantity: the fraction of CoHex ions in the external binding mode. Thus, while NA condensation depends on a complex interplay between various structural and sequence features, our coupled experimental and theoretical results suggest a new model in which a single parameter connects the NA condensation propensity with geometry and sequence dependence of CoHex binding.« less
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)<==>(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)<==>(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition, 55 NMR-derived backbone dihedral constraints per strand were used for both structures. The main effect of the Hoogsteen basepairs in (1B) on the overall structure is a narrowing of the minor groove and a corresponding widening of the major groove. The Hoogsteen basepairing at the central A6:T7 basepairs in (1B) has enforced a syn conformation on the glycosyl torsion of the 2'-deoxyaristeromycin moiety, A6, as a result of substitution of the endocyclic 4'-oxygen in the natural sugar with a methylene group in A6. A comparison of the Watson-Crick basepaired duplex (1A) to the Hoogsteen basepaired duplex (1B) shows that only a few changes, mainly in alpha, sigma and gamma torsions, in the sugar-phosphate backbone seem to be necessary to accommodate the Hoogsteen basepair.
Sentürker, S; Auffret van der Kemp, P; You, H J; Doetsch, P W; Dizdaroglu, M; Boiteux, S
1998-01-01
Two genes of Saccharomyces cerevisiae, NTG1 and NTG2, encode proteins with a significant sequence homology to the endonuclease III of Escherichia coli. The Ntg1 and Ntg2 proteins were overexpressed in E.coli and purified to apparent homogeneity. The substrate specificity of Ntg1 and Ntg2 proteins for modified bases in oxidatively damaged DNA was investigated using gas chromatography/isotope-dilution mass spectrometry. The substrate used was calf-thymus DNA exposed to gamma-radiation in N2O-saturated aqueous solution. The results reveal excision by Ntg1 and Ntg2 proteins of six pyrimidine-derived lesions, 5-hydroxy-6-hydrothymine, 5-hydroxy-6-hydrouracil, 5-hydroxy-5-methylhydantoin, 5-hydroxyuracil, 5-hydroxycytosine and thymine glycol, and two purine-derived lesions, 2,6-diamino-4-hydroxy-5-formamidopyrimidine and 4,6-diamino-5-formamidopyrimidine from gamma-irradiated DNA. In contrast, Ntg1 and Ntg2 proteins do not release 8-hydroxyguanine or 8-hydroxyadenine from gamma-irradiated DNA. The Ntg1 and Ntg2 proteins also release 2, 6-diamino-4-hydroxy-5-N-methylformamido-pyrimidine from damaged poly(dG-dC).poly(dG-dC). Excision was measured as a function of enzyme concentration and time. Furthermore, kinetic parameters were determined for each lesion. The results show that kinetic constants varied among the different lesions for the same enzyme. We also investigated the capacity of the Ntg1 and Ntg2 proteins to cleave 34mer DNA duplexes containing a single 8-OH-Gua residue mispaired with each of the four DNA bases. The results show that the Ntg1 protein preferentially cleaves a DNA duplex containing 8-OH-Gua mispaired with a guanine. Moreover, the Ntg1 protein releases free 8-OH-Gua from 8-OH-Gua/Gua duplex but not from duplexes containing 8-OH-Gua mispaired with adenine, thymine or cytosine. In contrast, the Ntg2 protein does not incise duplexes containing 8-OH-Gua mispaired with any of the four DNA bases. These results demonstrate that substrate specificities of the Ntg1 and Ntg2 proteins are similar but not identical and clearly different from that of the endonuclease III of E.coli and its homologues in Schizosaccharomyces pombe or human cells. PMID:9826748
The energetic basis of the DNA double helix: a combined microcalorimetric approach
Vaitiekunas, Paulius; Crane-Robinson, Colyn; Privalov, Peter L.
2015-01-01
Microcalorimetric studies of DNA duplexes and their component single strands showed that association enthalpies of unfolded complementary strands into completely folded duplexes increase linearly with temperature and do not depend on salt concentration, i.e. duplex formation results in a constant heat capacity decrement, identical for CG and AT pairs. Although duplex thermostability increases with CG content, the enthalpic and entropic contributions of an AT pair to duplex formation exceed that of a CG pair when compared at the same temperature. The reduced contribution of AT pairs to duplex stabilization comes not from their lower enthalpy, as previously supposed, but from their larger entropy contribution. This larger enthalpy and particularly the greater entropy results from water fixed by the AT pair in the minor groove. As the increased entropy of an AT pair exceeds that of melting ice, the water molecule fixed by this pair must affect those of its neighbors. Water in the minor groove is, thus, orchestrated by the arrangement of AT groups, i.e. is context dependent. In contrast, water hydrating exposed nonpolar surfaces of bases is responsible for the heat capacity increment on dissociation and, therefore, for the temperature dependence of all thermodynamic characteristics of the double helix. PMID:26304541
Saba Shirvan, Aylar; Mardani, Karim
2014-01-01
Infectious bronchitis (IB) and Newcastle disease (ND) are highly contagious and the most economically important diseases of the poultry affecting respiratory tract and causing economic losses in poultry industry throughout the world. In the present study, the simultaneous detection and differentiation of causative agents of these diseases were investigated using duplex-RT-PCR. RNA was extracted from vaccinal and reference strains of infectious bronchitis virus (IBV) and Newcastle disease virus (NDV) and then cDNA was synthesized. Using two universal primer sets for detection of IBV and NDV, the duplex-RT-PCR was developed. In order to assess the efficiency of the developed duplex RT-PCR, a number of 12 broiler farms with the symptoms of respiratory tract infection was sampled (trachea, lung and kidney were sampled from affected birds suspicious for IBV and NDV infections). After RNA extraction from tissues and cDNA synthesis, the presence of IBV and NDV genome were investigated using duplex-PCR. The results showed that three of twelve examined broiler farms were positive for IBV and two farms were positive for NDV and IBV. The results revealed that the duplex-RT-PCR is a quick and sensitive procedure for simultaneously detecting IBV and NDV in birds with respiratory infections.
Explicit ions/implicit water generalized Born model for nucleic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.
Ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model, and utilizes a non-standard approach to defining the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes – disconnected dielectric boundary around the solute-ion or ion-ion pairs. Fully analytical description of all energymore » components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force (PMF) for Na+-Cl− ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of DNA duplex; these differences in the counterion binding patters were shown earlier to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with homopolymeric poly(dA·dT) DNA duplex with modified (de-methylated) and native Thymine bases are used to explore the physics behind CoHex-Thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-Thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range, and may be important to consider in the context of methylation effects on DNA condensation.« less
Explicit ions/implicit water generalized Born model for nucleic acids
NASA Astrophysics Data System (ADS)
Tolokh, Igor S.; Thomas, Dennis G.; Onufriev, Alexey V.
2018-05-01
The ion atmosphere around highly charged nucleic acid molecules plays a significant role in their dynamics, structure, and interactions. Here we utilized the implicit solvent framework to develop a model for the explicit treatment of ions interacting with nucleic acid molecules. The proposed explicit ions/implicit water model is based on a significantly modified generalized Born (GB) model and utilizes a non-standard approach to define the solute/solvent dielectric boundary. Specifically, the model includes modifications to the GB interaction terms for the case of multiple interacting solutes—disconnected dielectric boundary around the solute-ion or ion-ion pairs. A fully analytical description of all energy components for charge-charge interactions is provided. The effectiveness of the approach is demonstrated by calculating the potential of mean force for Na+-Cl- ion pair and by carrying out a set of Monte Carlo (MC) simulations of mono- and trivalent ions interacting with DNA and RNA duplexes. The monovalent (Na+) and trivalent (CoHex3+) counterion distributions predicted by the model are in close quantitative agreement with all-atom explicit water molecular dynamics simulations used as reference. Expressed in the units of energy, the maximum deviations of local ion concentrations from the reference are within kBT. The proposed explicit ions/implicit water GB model is able to resolve subtle features and differences of CoHex distributions around DNA and RNA duplexes. These features include preferential CoHex binding inside the major groove of the RNA duplex, in contrast to CoHex biding at the "external" surface of the sugar-phosphate backbone of the DNA duplex; these differences in the counterion binding patters were earlier shown to be responsible for the observed drastic differences in condensation propensities between short DNA and RNA duplexes. MC simulations of CoHex ions interacting with the homopolymeric poly(dA.dT) DNA duplex with modified (de-methylated) and native thymine bases are used to explore the physics behind CoHex-thymine interactions. The simulations suggest that the ion desolvation penalty due to proximity to the low dielectric volume of the methyl group can contribute significantly to CoHex-thymine interactions. Compared to the steric repulsion between the ion and the methyl group, the desolvation penalty interaction has a longer range and may be important to consider in the context of methylation effects on DNA condensation.
Tanaka, Makiko; Oguma, Kazuhiro; Saito, Yoshio; Saito, Isao
2012-06-15
5-(1-Naphthalenylethynyl)-2'-deoxyuridine ((N)U) and 5-[(4-cyano-1-naphthalenyl)ethynyl]-2'-deoxyuridine ((CN)U) were synthesized and incorporated into oligodeoxynucleotides. Fluorescence emissions of modified duplexes containing double (N)U were efficiently quenched depending upon the sequence pattern of the naphthalenes in DNA major groove, as compared to the duplex possessing single (N)U. When one of the naphthalene moieties has a cyano substituent, the exciplex emission from the chromophores in DNA major groove was observed at longer wavelength. Copyright © 2012 Elsevier Ltd. All rights reserved.
Mattagajasingh, Ilwola; Mukherjee, Arup Kumar; Das, Premananda
2006-01-01
Thirty-one species of Mammillaria were selected to study the molecular phylogeny using random amplified polymorphic DNA (RAPD) markers. High amount of mucilage (gelling polysaccharides) present in Mammillaria was a major obstacle in isolating good quality genomic DNA. The CTAB (cetyl trimethyl ammonium bromide) method was modified to obtain good quality genomic DNA. Twenty-two random decamer primers resulted in 621 bands, all of which were polymorphic. The similarity matrix value varied from 0.109 to 0.622 indicating wide variability among the studied species. The dendrogram obtained from the unweighted pair group method using arithmetic averages (UPGMA) analysis revealed that some of the species did not follow the conventional classification. The present work shows the usefulness of RAPD markers for genetic characterization to establish phylogenetic relations among Mammillaria species.
Interstrand cross-links arising from strand breaks at true abasic sites in duplex DNA.
Yang, Zhiyu; Price, Nathan E; Johnson, Kevin M; Wang, Yinsheng; Gates, Kent S
2017-06-20
Interstrand cross-links are exceptionally bioactive DNA lesions. Endogenous generation of interstrand cross-links in genomic DNA may contribute to aging, neurodegeneration, and cancer. Abasic (Ap) sites are common lesions in genomic DNA that readily undergo spontaneous and amine-catalyzed strand cleavage reactions that generate a 2,3-didehydro-2,3-dideoxyribose sugar remnant (3'ddR5p) at the 3'-terminus of the strand break. Interestingly, this strand scission process leaves an electrophilic α,β-unsaturated aldehyde residue embedded within the resulting nicked duplex. Here we present evidence that 3'ddR5p derivatives generated by spermine-catalyzed strand cleavage at Ap sites in duplex DNA can react with adenine residues on the opposing strand to generate a complex lesion consisting of an interstrand cross-link adjacent to a strand break. The cross-link blocks DNA replication by ϕ29 DNA polymerase, a highly processive polymerase enzyme that couples synthesis with strand displacement. This suggests that 3'ddR5p-derived cross-links have the potential to block critical cellular DNA transactions that require strand separation. LC-MS/MS methods developed herein provide powerful tools for studying the occurrence and properties of these cross-links in biochemical and biological systems. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Copp, William; Denisov, Alexey Y.; Xie, Jingwei; Noronha, Anne M.; Liczner, Christopher; Safaee, Nozhat
2017-01-01
Abstract Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2′-deoxyribose, 2′-O-methyl-ribose, 2′-deoxy-2′-fluoro-ribose, arabinose and 2′-deoxy-2′-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2’ modifications gave a variety of effects. Arabinose and 2′-deoxy-2′-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2′-O-methyl and 2′-deoxy-2′-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. PMID:28973475
Copp, William; Denisov, Alexey Y; Xie, Jingwei; Noronha, Anne M; Liczner, Christopher; Safaee, Nozhat; Wilds, Christopher J; Gehring, Kalle
2017-09-29
Polyadenylate (poly(A)) has the ability to form a parallel duplex with Hoogsteen adenine:adenine base pairs at low pH or in the presence of ammonium ions. In order to evaluate the potential of this structural motif for nucleic acid-based nanodevices, we characterized the effects on duplex stability of substitutions of the ribose sugar with 2'-deoxyribose, 2'-O-methyl-ribose, 2'-deoxy-2'-fluoro-ribose, arabinose and 2'-deoxy-2'-fluoro-arabinose. Deoxyribose substitutions destabilized the poly(A) duplex both at low pH and in the presence of ammonium ions: no duplex formation could be detected with poly(A) DNA oligomers. Other sugar C2' modifications gave a variety of effects. Arabinose and 2'-deoxy-2'-fluoro-arabinose nucleotides strongly destabilized poly(A) duplex formation. In contrast, 2'-O-methyl and 2'-deoxy-2'-fluoro-ribo modifications were stabilizing either at pH 4 or in the presence of ammonium ions. The differential effect suggests they could be used to design molecules selectively responsive to pH or ammonium ions. To understand the destabilization by deoxyribose, we determined the structures of poly(A) duplexes with a single DNA residue by nuclear magnetic resonance spectroscopy and X-ray crystallography. The structures revealed minor structural perturbations suggesting that the combination of sugar pucker propensity, hydrogen bonding, pKa shifts and changes in hydration determine duplex stability. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Yokoyama, Katsushi; Nogami, Hideki; Kabasawa, Mamiko; Ebihara, Sonomi; Shimowasa, Ai; Hashimoto, Keiko; Kawashima, Tsuyoshi; Ishijima, Sanae A.; Suzuki, Masashi
2009-01-01
The DNA-binding mode of archaeal feast/famine-regulatory proteins (FFRPs), i.e. paralogs of the Esherichia coli leucine-responsive regulatory protein (Lrp), was studied. Using the method of systematic evolution of ligands by exponential enrichment (SELEX), optimal DNA duplexes for interacting with TvFL3, FL10, FL11 and Ss-LrpB were identified as TACGA[AAT/ATT]TCGTA, GTTCGA[AAT/ATT]TCGAAC, CCGAAA[AAT/ATT]TTTCGG and TTGCAA[AAT/ATT]TTGCAA, respectively, all fitting into the form abcdeWWWedcba. Here W is A or T, and e.g. a and a are bases complementary to each other. Apparent equilibrium binding constants of the FFRPs and various DNA duplexes were determined, thereby confirming the DNA-binding specificities of the FFRPs. It is likely that these FFRPs recognize DNA in essentially the same way, since their DNA-binding specificities were all explained by the same pattern of relationship between amino-acid positions and base positions to form chemical interactions. As predicted from this relationship, when Gly36 of TvFL3 was replaced by Thr, the b base in the optimal DNA duplex changed from A to T, and, when Thr36 of FL10 was replaced by Ser, the b base changed from T to G/A. DNA-binding characteristics of other archaeal FFRPs, Ptr1, Ptr2, Ss-Lrp and LysM, are also consistent with the relationship. PMID:19468044
Spring-Connell, Alexander M.; Evich, Marina G.; Debelak, Harald; Seela, Frank; Germann, Markus W.
2016-01-01
A truly universal nucleobase enables a host of novel applications such as simplified templates for PCR primers, randomized sequencing and DNA based devices. A universal base must pair indiscriminately to each of the canonical bases with little or preferably no destabilization of the overall duplex. In reality, many candidates either destabilize the duplex or do not base pair indiscriminatingly. The novel base 8-aza-7-deazaadenine (pyrazolo[3,4-d]pyrimidin- 4-amine) N8-(2′deoxyribonucleoside), a deoxyadenosine analog (UB), pairs with each of the natural DNA bases with little sequence preference. We have utilized NMR complemented with molecular dynamic calculations to characterize the structure and dynamics of a UB incorporated into a DNA duplex. The UB participates in base stacking with little to no perturbation of the local structure yet forms an unusual base pair that samples multiple conformations. These local dynamics result in the complete disappearance of a single UB proton resonance under native conditions. Accommodation of the UB is additionally stabilized via heightened backbone conformational sampling. NMR combined with various computational techniques has allowed for a comprehensive characterization of both structural and dynamic effects of the UB in a DNA duplex and underlines that the UB as a strong candidate for universal base applications. PMID:27566150
Sato, Yoshiteru; Mitomi, Kenta; Sunami, Tomoko; Kondo, Jiro; Takénaka, Akio
2006-12-01
The crystal structure of the tetragonal form of d(gcGAAAgc) has been revised and reasonably refined including the disordered residues. The two DNA strands form a base-intercalated duplex, and the four duplexes are assembled according to the crystallographic 222 symmetry to form an octaplex. In the central region, the eight strands are associated by I-motif of double A-quartets. Furthermore, eight hydrated-magnesium cations link the four duplexes to support the octaplex formation. Based on these structural features, a proposal that folding of d(GAAA)n, found in the non-coding region of genomes, into an octaplex can induce slippage during replication to facilitate length polymorphism is presented.
Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi
2018-03-20
A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Comparing Charge Transport in Oligonucleotides: RNA:DNA Hybrids and DNA Duplexes.
Li, Yuanhui; Artés, Juan M; Qi, Jianqing; Morelan, Ian A; Feldstein, Paul; Anantram, M P; Hihath, Joshua
2016-05-19
Understanding the electronic properties of oligonucleotide systems is important for applications in nanotechnology, biology, and sensing systems. Here the charge-transport properties of guanine-rich RNA:DNA hybrids are compared to double-stranded DNA (dsDNA) duplexes with identical sequences. The conductance of the RNA:DNA hybrids is ∼10 times higher than the equivalent dsDNA, and conformational differences are determined to be the primary reason for this difference. The conductance of the RNA:DNA hybrids is also found to decrease more rapidly than dsDNA when the length is increased. Ab initio electronic structure and Green's function-based density of states calculations demonstrate that these differences arise because the energy levels are more spatially distributed in the RNA:DNA hybrid but that the number of accessible hopping sites is smaller. These combination results indicate that a simple hopping model that treats each individual guanine as a hopping site is insufficient to explain both a higher conductance and β value for RNA:DNA hybrids, and larger delocalization lengths must be considered.
Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.
Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016
Willwand, K; Baldauf, A Q; Deleu, L; Mumtsidu, E; Costello, E; Beard, P; Rommelaere, J
1997-10-01
The right-end telomere of replicative form (RF) DNA of the autonomous parvovirus minute virus of mice (MVM) consists of a sequence that is self-complementary except for a three nucleotide loop around the axis of symmetry and an interior bulge of three unpaired nucleotides on one strand (designated the right-end 'bubble'). This right-end inverted repeat can exist in the form of a folded-back strand (hairpin conformation) or in an extended form, base-paired to a copy strand (duplex conformation). We recently reported that the right-end telomere is processed in an A9 cell extract supplemented with the MVM nonstructural protein NS1. This processing is shown here to result from the NS1-dependent nicking of the complementary strand at a unique position 21 nt inboard of the folded-back genomic 5' end. DNA species terminating in duplex or hairpin configurations, or in a mutated structure that has lost the right-end bulge, are all cleaved in the presence of NS1, indicating that features distinguishing these structures are not prerequisites for nicking under the in vitro conditions tested. Cleavage of the hairpin structure is followed by strand-displacement synthesis, generating the right-end duplex conformation, while processing of the duplex structure leads to the release of free right-end telomeres. In the majority of molecules, displacement synthesis at the right terminus stops a few nucleotides before reaching the end of the template strand, possibly due to NS1 which is covalently bound to this end. A fraction of the right-end duplex product undergoes melting and re-folding into hairpin structures (formation of a 'rabbit-ear' structure).
Triplex-forming oligonucleotides: a third strand for DNA nanotechnology
2018-01-01
Abstract DNA self-assembly has proved to be a useful bottom-up strategy for the construction of user-defined nanoscale objects, lattices and devices. The design of these structures has largely relied on exploiting simple base pairing rules and the formation of double-helical domains as secondary structural elements. However, other helical forms involving specific non-canonical base-base interactions have introduced a novel paradigm into the process of engineering with DNA. The most notable of these is a three-stranded complex generated by the binding of a third strand within the duplex major groove, generating a triple-helical (‘triplex’) structure. The sequence, structural and assembly requirements that differentiate triplexes from their duplex counterparts has allowed the design of nanostructures for both dynamic and/or structural purposes, as well as a means to target non-nucleic acid components to precise locations within a nanostructure scaffold. Here, we review the properties of triplexes that have proved useful in the engineering of DNA nanostructures, with an emphasis on applications that hitherto have not been possible by duplex formation alone. PMID:29228337
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tsunoda, Hirosuke; Kudo, Tomomi; Masaki, Yoshiaki; Ohkubo, Akihiro; Seio, Kohji; Sekine, Mitsuo
2011-01-01
To clarify the biochemical behavior of 2′-deoxyribonucleoside 5′-triphosphates and oligodeoxyribonucleotides (ODNs) containing cytosine N-oxide (Co) and adenine N-oxide (Ao), we examined their base recognition ability in DNA duplex formation using melting temperature (Tm) experiments and their substrate specificity in DNA polymerase-mediated replication. As the result, it was found that the Tm values of modified DNA–DNA duplexes incorporating 2′-deoxyribonucleoside N-oxide derivatives significantly decreased compared with those of the unmodified duplexes. However, single insertion reactions by DNA polymerases of Klenow fragment (KF) (exo−) and Vent (exo−) suggested that Co and Ao selectively recognized G and T, respectively. Meanwhile, the kinetic study showed that the incorporation efficiencies of the modified bases were lower than those of natural bases. Ab initio calculations suggest that these modified bases can form the stable base pairs with the original complementary bases. These results indicate that the modified bases usually recognize the original bases as partners for base pairing, except for misrecognition of dATP by the action of KF (exo−) toward Ao on the template, and the primers could be extended on the template DNA. When they misrecognized wrong bases, the chain could not be elongated so that the modified base served as the chain terminator. PMID:21300642
Spermine Condenses DNA, but Not RNA Duplexes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Katz, Andrea M.; Tolokh, Igor S.; Pabit, Suzette A.
Interactions between the polyamine spermine and nucleic acids drive important cellular processes. Spermine condenses DNA, and some RNAs such as poly(rA):poly(rU). A large fraction of the spermine present in cells is bound to RNA, but apparently does not condense it. Here, we study the effect of spermine binding to short duplex RNA and DNA and compare our findings with predictions of molecular dynamics simulations. When small numbers of spermine are introduced, RNA with a designed sequence, containing a mixture of 14 GC pairs and 11 AU pairs, resists condensation relative to DNA of an equivalent sequence or to 25 basemore » pair poly(rA):poly(rU) RNA. Comparison of wide-angle x-ray scattering profiles with simulation suggests that spermine is sequestered deep within the major groove of mixed sequence RNA, preventing condensation by limiting opportunities to bridge to other molecules as well as stabilizing the RNA by locking it into a particular conformation. In contrast, for DNA, simulations suggest that spermine binds external to the duplex, offering opportunities for intermolecular interaction. The goal of this study is to explain how RNA can remain soluble, and available for interaction with other molecules in the cell, despite the presence of spermine at concentrations high enough to precipitate DNA.« less
Nucleic acid nanomaterials: Silver-wired DNA
NASA Astrophysics Data System (ADS)
Auffinger, Pascal; Ennifar, Eric
2017-10-01
DNA double helical structures are supramolecular assemblies that are typically held together by classical Watson-Crick pairing. Now, nucleotide chelation of silver ions supports an extended silver-DNA hybrid duplex featuring an uninterrupted silver array.
The Crystal Structure of Non-Modified and Bipyridine-Modified PNA Duplexes
Yeh, Joanne I.; Pohl, Ehmke; Truan, Daphne; He, Wei; Sheldrick, George M.; Du, Shoucheng; Achim, Catalina
2011-01-01
Peptide nucleic acid (PNA) is a synthetic analogue of DNA that commonly has an N-aminoethlyl-glycine backbone. The crystal structure of two PNA duplexes, one containing eight standard nucleobase pairs (GGCATCGG)2 (pdb: 3MBS), and the other containing the same nucleobase pairs and a central pair of bipyridine ligands (pdb: 3MBU), has been solved with a resolution of 1.2 Å and 1.05 Å, respectively. The non-modified PNA duplex adopts a P-type helical structure s i m i l a r t o that of previously characterized PNAs. The atomic-level resolution of the structures allowed us to observe for the first time specific modes of interaction between the terminal lysines of the PNA and the backbone and nucleobases situated in the vicinity of the lysines, which are considered an important factor in the induction of a preferred handedness in PNA duplexes. These results support the notion that while PNA typically adopts a P-type helical structure, its flexibility is relatively high. For example, the base pair rise in the bipyridine-containing PNA is the largest measured to date in a PNA homoduplex. The two bipyridines are bulged out of the duplex and are aligned parallel to the minor groove of the PNA. In the case of the bipyridine-containing PNA, two bipyridines from adjacent PNA duplexes form a π-stacked pair that relates the duplexes within the crystal. The bulging out of the bipyridines causes bending of the PNA duplex, which is in contrast to the structure previously reported for biphenyl-modified DNA duplexes in solution, where the biphenyls are π-stacking with adjacent nucleobase pairs and adopt an intrahelical geometry [Johar et al., Chem. Eur. J., 2008, 14, 2080]. This difference shows that relatively small perturbations can significantly impact the relative position of nucleobase analogues in nucleic acid duplexes. PMID:20859960
Poltev, V; Anisimov, V M; Dominguez, V; Gonzalez, E; Deriabina, A; Garcia, D; Rivas, F; Polteva, N A
2018-02-01
Deciphering the mechanism of functioning of DNA as the carrier of genetic information requires identifying inherent factors determining its structure and function. Following this path, our previous DFT studies attributed the origin of unique conformational characteristics of right-handed Watson-Crick duplexes (WCDs) to the conformational profile of deoxydinucleoside monophosphates (dDMPs) serving as the minimal repeating units of DNA strand. According to those findings, the directionality of the sugar-phosphate chain and the characteristic ranges of dihedral angles of energy minima combined with the geometric differences between purines and pyrimidines determine the dependence on base sequence of the three-dimensional (3D) structure of WCDs. This work extends our computational study to complementary deoxydinucleotide-monophosphates (cdDMPs) of non-standard conformation, including those of Z-family, Hoogsteen duplexes, parallel-stranded structures, and duplexes with mispaired bases. For most of these systems, except Z-conformation, computations closely reproduce experimental data within the tolerance of characteristic limits of dihedral parameters for each conformation family. Computation of cdDMPs with Z-conformation reveals that their experimental structures do not correspond to the internal energy minimum. This finding establishes the leading role of external factors in formation of the Z-conformation. Energy minima of cdDMPs of non-Watson-Crick duplexes demonstrate different sequence-dependence features than those known for WCDs. The obtained results provide evidence that the biologically important regularities of 3D structure distinguish WCDs from duplexes having non-Watson-Crick nucleotide pairing.
Equilibrious Strand Exchange Promoted by DNA Conformational Switching
NASA Astrophysics Data System (ADS)
Wu, Zhiguo; Xie, Xiao; Li, Puzhen; Zhao, Jiayi; Huang, Lili; Zhou, Xiang
2013-01-01
Most of DNA strand exchange reactions in vitro are based on toehold strategy which is generally nonequilibrium, and intracellular strand exchange mediated by proteins shows little sequence specificity. Herein, a new strand exchange promoted by equilibrious DNA conformational switching is verified. Duplexes containing c-myc sequence which is potentially converted into G-quadruplex are designed in this strategy. The dynamic equilibrium between duplex and G4-DNA is response to the specific exchange of homologous single-stranded DNA (ssDNA). The SER is enzyme free and sequence specific. No ATP is needed and the displaced ssDNAs are identical to the homologous ssDNAs. The SER products and exchange kenetics are analyzed by PAGE and the RecA mediated SER is performed as the contrast. This SER is a new feature of G4-DNAs and a novel strategy to utilize the dynamic equilibrium of DNA conformations.
An Enzyme-Catalyzed Multistep DNA Refolding Mechanism in Hairpin Telomere Formation
Shi, Ke; Huang, Wai Mun; Aihara, Hideki
2013-01-01
Hairpin telomeres of bacterial linear chromosomes are generated by a DNA cutting–rejoining enzyme protelomerase. Protelomerase resolves a concatenated dimer of chromosomes as the last step of chromosome replication, converting a palindromic DNA sequence at the junctions between chromosomes into covalently closed hairpins. The mechanism by which protelomerase transforms a duplex DNA substrate into the hairpin telomeres remains largely unknown. We report here a series of crystal structures of the protelomerase TelA bound to DNA that represent distinct stages along the reaction pathway. The structures suggest that TelA converts a linear duplex substrate into hairpin turns via a transient strand-refolding intermediate that involves DNA-base flipping and wobble base-pairs. The extremely compact di-nucleotide hairpin structure of the product is fully stabilized by TelA prior to strand ligation, which drives the reaction to completion. The enzyme-catalyzed, multistep strand refolding is a novel mechanism in DNA rearrangement reactions. PMID:23382649
NASA Astrophysics Data System (ADS)
Rivard, Brea R.; Cooper, Sarah J.; Stubbs, John M.
2018-02-01
DNA duplexes consisting of a 25mer together with shorter complementary sequences were studied over a range of temperature and surface binding motifs using a coarse-grained two-site nucleotide model. Results were analyzed in terms of hydrogen bonding interactions and structural characteristics and indicate that hybridization is most stable when furthest from the surface binding site. Strand elongation and straightening near the bound end are found to be correlated to duplex destabilization.
Mariappan, S V Santhana; Cheng, Xun; van Breemen, Richard B; Silks, Louis A; Gupta, Goutam
2004-11-15
The formation of a GAA/TTC DNA triplex has been implicated in Friedreich's ataxia. The destabilization of GAA/TTC DNA triplexes either by pH or by binding to appropriate ligands was analyzed by nuclear magnetic resonance (NMR) and positive-ion electrospray mass spectrometry. The triplexes and duplexes were identified by changes in the NMR chemical shifts of H8, H1, H4, 15N7, and 15N4. The lowest pH at which the duplex is detectable depends upon the overall stability and the relative number of Hoogsteen C composite function G to T composite function A basepairs. A melting pH (pHm) of 7.6 was observed for the destabilization of the (GAA)2T4(TTC)2T4(CTT)2 triplex to the corresponding Watson-Crick duplex and the T4(CTT)2 overhang. The mass spectrometric analyses of (TTC)6.(GAA)6 composite function(TTC)6 triplex detected ions due to both triplex and single-stranded oligonucleotides under acidic conditions. The triplex ions disappeared completely at alkaline pH. Duplex and single strands were detectable only at neutral and alkaline pH values. Mass spectrometric analyses also showed that minor groove-binding ligands berenil, netropsin, and distamycin and the intercalating ligand acridine orange destabilize the (TTC)6.(GAA)6 composite function (TTC)6 triplex. These NMR and mass spectrometric methods may function as screening assays for the discovery of agents that destabilize GAA/TTC triplexes and as general methods for the characterization of structure, dynamics, and stability of DNA and DNA-ligand complexes.
Nguyen, Thi Quynh Ngoc; Lim, Kah Wai; Phan, Anh Tuân
2017-09-20
Small-molecule ligands targeting nucleic acids have been explored as potential therapeutic agents. Duplex groove-binding ligands have been shown to recognize DNA in a sequence-specific manner. On the other hand, quadruplex-binding ligands exhibit high selectivity between quadruplex and duplex, but show limited discrimination between different quadruplex structures. Here we propose a dual-specific approach through the simultaneous application of duplex- and quadruplex-binders. We demonstrated that a quadruplex-specific ligand and a duplex-specific ligand can simultaneously interact at two separate binding sites of a quadruplex-duplex hybrid harbouring both quadruplex and duplex structural elements. Such a dual-specific targeting strategy would combine the sequence specificity of duplex-binders and the strong binding affinity of quadruplex-binders, potentially allowing the specific targeting of unique quadruplex structures. Future research can be directed towards the development of conjugated compounds targeting specific genomic quadruplex-duplex sites, for which the linker would be highly context-dependent in terms of length and flexibility, as well as the attachment points onto both ligands.
Usdin, K; Furano, A V
1988-01-01
The L family (long interspersed repeated DNA) of mobile genetic elements is a persistent feature of the mammalian genome. In rats, this family contains approximately equal to 40,000 members and accounts for approximately equal to 10% of the haploid genome. We demonstrate here that the guanine-rich homopurine stretches located at the right end of L-DNA induce oligonucleotide uptake by contiguous duplex DNA. The uptake is dependent on negative supercoiling and the length of the homopurine stretch and occurs even when the L-DNA homopurine stretches are introduced into a different DNA environment. The bound oligomer primes DNA synthesis when DNA polymerase and deoxyribonucleoside triphosphates are added, resulting in a faithful copy of the template to which the oligonucleotide had bound. The implications of this property of the L-DNA guanine-rich homopurine stretches in the amplification, recombination, and dispersal of L elements is discussed. Images PMID:2837766
Sommers, Joshua A.; Banerjee, Taraswi; Hinds, Twila; Wan, Bingbing; Wold, Marc S.; Lei, Ming; Brosh, Robert M.
2014-01-01
Understanding how cellular machinery deals with chromosomal genome complexity is an important question because protein bound to DNA may affect various cellular processes of nucleic acid metabolism. DNA helicases are at the forefront of such processes, yet there is only limited knowledge how they remodel protein-DNA complexes and how these mechanisms are regulated. We have determined that representative human RecQ and Fe-S cluster DNA helicases are potently blocked by a protein-DNA interaction. The Fanconi anemia group J (FANCJ) helicase partners with the single-stranded DNA-binding protein replication protein A (RPA) to displace BamHI-E111A bound to duplex DNA in a specific manner. Protein displacement was dependent on the ATPase-driven function of the helicase and unique properties of RPA. Further biochemical studies demonstrated that the shelterin proteins TRF1 and TRF2, which preferentially bind the telomeric repeat found at chromosome ends, effectively block FANCJ from unwinding the forked duplex telomeric substrate. RPA, but not the Escherichia coli single-stranded DNA-binding protein or shelterin factor Pot1, stimulated FANCJ ejection of TRF1 from the telomeric DNA substrate. FANCJ was also able to displace TRF2 from the telomeric substrate in an RPA-dependent manner. The stimulation of helicase-catalyzed protein displacement is also observed with the DNA helicase RECQ1, suggesting a conserved functional interaction of RPA-interacting helicases. These findings suggest that partnerships between RPA and interacting human DNA helicases may greatly enhance their ability to dislodge proteins bound to duplex DNA, an activity that is likely to be highly relevant to their biological roles in DNA metabolism. PMID:24895130
50 years of DNA ‘Breathing’: Reflections on Old and New Approaches
von Hippel, Peter H.; Johnson, Neil P.; Marcus, Andrew H.
2015-01-01
Summary The coding sequences for genes, and much other regulatory information involved in genome expression, are located ‘inside’ the DNA duplex. Thus the ‘macromolecular machines’ that read-out this information from the base sequence of the DNA must somehow access the DNA ‘interior’. Double-stranded (ds) DNA is a highly structured and cooperatively stabilized system at physiological temperatures, but is also only marginally stable and undergoes a cooperative ‘melting phase transition’ at temperatures not far above physiological. Furthermore, due to its length and heterogeneous sequence, with AT-rich segments being less stable than GC-rich segments, the DNA genome ‘melts’ in a multistate fashion. Therefore the DNA genome must also manifest thermally driven structural (‘breathing’) fluctuations at physiological temperatures that should reflect the heterogeneity of the dsDNA stability near the melting temperature. Thus many of the breathing fluctuations of dsDNA are likely also to be sequence dependent, and could well contain information that should be ‘readable’ and useable by regulatory proteins and protein complexes in site-specific binding reactions involving dsDNA ‘opening’. Our laboratory has been involved in studying the breathing fluctuations of duplex DNA for about 50 years. In this ‘Reflections’ article we present a relatively chronological overview of these studies, starting with the use of simple chemical probes (such as hydrogen exchange, formaldehyde and simple DNA ‘melting’ proteins) to examine the local stability of the dsDNA structure, and culminating in sophisticated spectroscopic approaches that can be used to monitor the breathing-dependent interactions of regulatory complexes with their duplex DNA targets in ‘real time’. PMID:23840028
Molluscan mega-hemocyanin: an ancient oxygen carrier tuned by a ~550 kDa polypeptide
2010-01-01
Background The allosteric respiratory protein hemocyanin occurs in gastropods as tubular di-, tri- and multimers of a 35 × 18 nm, ring-like decamer with a collar complex at one opening. The decamer comprises five subunit dimers. The subunit, a 400 kDa polypeptide, is a concatenation of eight paralogous functional units. Their exact topology within the quaternary structure has recently been solved by 3D electron microscopy, providing a molecular model of an entire didecamer (two conjoined decamers). Here we study keyhole limpet hemocyanin (KLH2) tridecamers to unravel the exact association mode of the third decamer. Moreover, we introduce and describe a more complex type of hemocyanin tridecamer discovered in fresh/brackish-water cerithioid snails (Leptoxis, Melanoides, Terebralia). Results The "typical" KLH2 tridecamer is partially hollow, whereas the cerithioid tridecamer is almost completely filled with material; it was therefore termed "mega-hemocyanin". In both types, the staggering angle between adjoining decamers is 36°. The cerithioid tridecamer comprises two typical decamers based on the canonical 400 kDa subunit, flanking a central "mega-decamer" composed of ten unique ~550 kDa subunits. The additional ~150 kDa per subunit substantially enlarge the internal collar complex. Preliminary oxygen binding measurements indicate a moderate hemocyanin oxygen affinity in Leptoxis (p50 ~9 mmHg), and a very high affinity in Melanoides (~3 mmHg) and Terebralia (~2 mmHg). Species-specific and individual variation in the proportions of the two subunit types was also observed, leading to differences in the oligomeric states found in the hemolymph. Conclusions In cerithioid hemocyanin tridecamers ("mega-hemocyanin") the collar complex of the central decamer is substantially enlarged and modified. The preliminary O2 binding curves indicate that there are species-specific functional differences in the cerithioid mega-hemocyanins which might reflect different physiological tolerances of these gill-breathing animals. The observed differential expression of the two subunit types of mega-hemocyanin might allow individual respiratory acclimatization. We hypothesize that mega-hemocyanin is a key character supporting the adaptive radiation and invasive capacity of cerithioid snails. PMID:20465844
Prokaryotic and eukaryotic DNA helicases. Essential molecular motor proteins for cellular machinery.
Tuteja, Narendra; Tuteja, Renu
2004-05-01
DNA helicases are ubiquitous molecular motor proteins which harness the chemical free energy of ATP hydrolysis to catalyze the unwinding of energetically stable duplex DNA, and thus play important roles in nearly all aspects of nucleic acid metabolism, including replication, repair, recombination, and transcription. They break the hydrogen bonds between the duplex helix and move unidirectionally along the bound strand. All helicases are also translocases and DNA-dependent ATPases. Most contain conserved helicase motifs that act as an engine to power DNA unwinding. All DNA helicases share some common properties, including nucleic acid binding, NTP binding and hydrolysis, and unwinding of duplex DNA in the 3' to 5' or 5' to 3' direction. The minichromosome maintenance (Mcm) protein complex (Mcm4/6/7) provides a DNA-unwinding function at the origin of replication in all eukaryotes and may act as a licensing factor for DNA replication. The RecQ family of helicases is highly conserved from bacteria to humans and is required for the maintenance of genome integrity. They have also been implicated in a variety of human genetic disorders. Since the discovery of the first DNA helicase in Escherichia coli in 1976, and the first eukaryotic one in the lily in 1978, a large number of these enzymes have been isolated from both prokaryotic and eukaryotic systems, and the number is still growing. In this review we cover the historical background of DNA helicases, helicase assays, biochemical properties, prokaryotic and eukaryotic DNA helicases including Mcm proteins and the RecQ family of helicases. The properties of most of the known DNA helicases from prokaryotic and eukaryotic systems, including viruses and bacteriophages, are summarized in tables.
Efficient Long-Range Hole Transport Through G-Quadruplexes.
Wu, Jingyuan; Meng, Zhenyu; Lu, Yunpeng; Shao, Fangwei
2017-10-09
DNA offers a means of long-range charge transport for biology and electric nanodevices. Here, a series of tetra-stranded G-quadruplexes were assembled within a dendritic DNA architecture to explore oxidative charge transport (hole transport) through the G-quadruplex. Efficient charge transport was achieved over 28 Å upon UV irradiation. Over a longer G-quadruplex bridge, hole transport was escalated to a higher efficiency, which resulted in a higher yield than that of the optimal duplex DNA for charge transport, that is, the adenine tract. Efficient long-range hole transport suggests tetra-stranded G-quadruplexes, instead of an oxidation hotspot, hold better potential as an electron conduit than duplex DNA. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Duplex Interrogation by a Direct DNA Repair Protein in Search of Base Damage
Yi, Chengqi; Chen, Baoen; Qi, Bo; Zhang, Wen; Jia, Guifang; Zhang, Liang; Li, Charles J.; Dinner, Aaron R.; Yang, Cai-Guang; He, Chuan
2012-01-01
ALKBH2 is a direct DNA repair dioxygenase guarding mammalian genome against N1-methyladenine, N3-methylcytosine, and 1,N6-ethenoadenine damage. A prerequisite for repair is to identify these lesions in the genome. Here we present crystal structures of ALKBH2 bound to different duplex DNAs. Together with computational and biochemical analyses, our results suggest that DNA interrogation by ALKBH2 displays two novel features: i) ALKBH2 probes base-pair stability and detects base pairs with reduced stability; ii) ALKBH2 does not have nor need a “damage-checking site”, which is critical for preventing spurious base-cleavage for several glycosylases. The demethylation mechanism of ALKBH2 insures that only cognate lesions are oxidized and reversed to normal bases, and that a flipped, non-substrate base remains intact in the active site. Overall, the combination of duplex interrogation and oxidation chemistry allows ALKBH2 to detect and process diverse lesions efficiently and correctly. PMID:22659876
Plchova, Helena; Hartung, Frank; Puchta, Holger
2003-11-07
The human Werner syndrome protein (hWRN-p) possessing DNA helicase and exonuclease activities is essential for genome stability. Plants have no homologue of this bifunctional protein, but surprisingly the Arabidopsis genome contains a small open reading frame (ORF) (AtWRNexo) with homology to the exonuclease domain of hWRN-p. Expression of this ORF in Escherichia coli revealed an exonuclease activity for AtWRN-exo-p with similarities but also some significant differences to hWRN-p. The protein digests recessed strands of DNA duplexes in the 3' --> 5' direction but hardly single-stranded DNA or blunt-ended duplexes. In contrast to the Werner exonuclease, AtWRNexo-p is also able to digest 3'-protruding strands. DNA with recessed 3'-PO4 and 3'-OH termini is degraded to a similar extent. AtWRNexo-p hydrolyzes the 3'-recessed strand termini of duplexes containing mismatched bases. AtWRNexo-p needs the divalent cation Mg2+ for activity, which can be replaced by Mn2+. Apurinic sites, cholesterol adducts, and oxidative DNA damage (such as 8-oxoadenine and 8-oxoguanine) inhibit or block the enzyme. Other DNA modifications, including uracil, hypoxanthine and ethenoadenine, did not inhibit AtWRNexo-p. A mutation of a conserved residue within the exonuclease domain (E135A) completely abolished the exonucleolytic activity. Our results indicate that a type of WRN-like exonuclease activity seems to be a common feature of the DNA metabolism of animals and plants.
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M
2017-05-19
In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K.
2017-01-01
Abstract In the canonical DNA double helix, Watson–Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02–0.4%) and short-lived (lifetimes ∼0.2–2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. PMID:28369571
Poltev, Valeri; Anisimov, Victor M; Danilov, Victor I; Garcia, Dolores; Sanchez, Carolina; Deriabina, Alexandra; Gonzalez, Eduardo; Rivas, Francisco; Polteva, Nina
2014-06-01
Our previous DFT computations of deoxydinucleoside monophosphate complexes with Na(+)-ions (dDMPs) have demonstrated that the main characteristics of Watson-Crick (WC) right-handed duplex families are predefined in the local energy minima of dDMPs. In this work, we study the mechanisms of contribution of chemically monotonous sugar-phosphate backbone and the bases into the double helix irregularity. Geometry optimization of sugar-phosphate backbone produces energy minima matching the WC DNA conformations. Studying the conformational variability of dDMPs in response to sequence permutation, we found that simple replacement of bases in the previously fully optimized dDMPs, e.g. by constructing Pyr-Pur from Pur-Pyr, and Pur-Pyr from Pyr-Pur sequences, while retaining the backbone geometry, automatically produces the mutual base position characteristic of the target sequence. Based on that, we infer that the directionality and the preferable regions of the sugar-phosphate torsions, combined with the difference of purines from pyrimidines in ring shape, determines the sequence dependence of the structure of WC DNA. No such sequence dependence exists in dDMPs corresponding to other DNA conformations (e.g., Z-family and Hoogsteen duplexes). Unlike other duplexes, WC helix is unique by its ability to match the local energy minima of the free single strand to the preferable conformations of the duplex. Copyright © 2013 Wiley Periodicals, Inc.
Johnson, Robert P; Fleming, Aaron M; Jin, Qian; Burrows, Cynthia J; White, Henry S
2014-08-19
The latch region of the wild-type protein pore α-hemolysin (α-HL) constitutes a sensing zone for individual abasic sites (and furan analogs) in double-stranded DNA (dsDNA). The presence of an abasic site or furan within a DNA duplex, electrophoretically captured in the α-HL vestibule and positioned at the latch region, can be detected based on the current blockage prior to duplex unzipping. We investigated variations in blockage current as a function of temperature (12-35°C) and KCl concentration (0.15-1.0 M) to understand the origin of the current signature and to optimize conditions for identifying the base modification. In 1 M KCl solution, substitution of a furan for a cytosine base in the latch region results in an ∼ 8 kJ mol(-1) decrease in the activation energy for ion transport through the protein pore. This corresponds to a readily measured ∼ 2 pA increase in current at room temperature. Optimal resolution for detecting the presence of a furan in the latch region is achieved at lower KCl concentrations, where the noise in the measured blockage current is significantly lower. The noise associated with the blockage current also depends on the stability of the duplex (as measured from the melting temperature), where a greater noise in the measured blockage current is observed for less stable duplexes. Copyright © 2014 Biophysical Society. Published by Elsevier Inc. All rights reserved.
Interactions of Escherichia coli σ70 within the transcription elongation complex
Daube, Shirley S.; von Hippel, Peter H.
1999-01-01
A functional transcription elongation complex can be formed without passing through a promoter by adding a complementary RNA primer and core Escherichia coli RNA polymerase in trans to an RNA-primed synthetic bubble-duplex DNA framework. This framework consists of a double-stranded DNA sequence with an internal noncomplementary DNA “bubble” containing a hybridized RNA primer. On addition of core polymerase and the requisite NTPs, the RNA primer is extended in a process that manifests most of the properties of in vitro transcription elongation. This synthetic elongation complex can also be assembled by using holo rather than core RNA polymerase, and in this study we examine the interactions and fate of the σ70 specificity subunit of the holopolymerase in the assembly process. We show that the addition of holopolymerase to the bubble-duplex construct triggers the dissociation of the sigma factor from some complexes, whereas in others the RNA oligomer is released into solution instead. These results are consistent with an allosteric competition between σ70 and the nascent RNA strand within the elongation complex and suggest that both cannot be bound to the core polymerase simultaneously. However, the dissociation of σ70 from the complex can also be stimulated by binding of the holopolymerase to the DNA bubble duplex in the absence of a hybridized RNA primer, suggesting that the binding of the core polymerase to the bubble-duplex construct also triggers a conformational change that additionally weakens the sigma–core interaction. PMID:10411885
Ren, Wang; Gao, Zhong Feng; Li, Nian Bing; Luo, Hong Qun
2015-01-15
This work reported a novel, ultrasensitive, and selective platform for electrochemical detection of DNA, employing an integration of exonuclease III (Exo-III) assisted target recycling and hybridization chain reaction (HCR) for the dual signal amplification strategy. The hairpin capture probe DNA (C-DNA) with an Exo-III 3' overhang end was self-assembled on a gold electrode. In the presence of target DNA (T-DNA), C-DNA hybridized with the T-DNA to form a duplex region, exposing its 5' complementary sequence (initiator). Exo-III was applied to selectively digest duplex region from its 3-hydroxyl termini until the duplex was fully consumed, leaving the remnant initiator. The intact T-DNA spontaneously dissociated from the structure and then initiated the next hybridization process as a result of catalysis of the Exo-III. HCR event was triggered by the initiator and two hairpin helper signal probes labeled with methylene blue, facilitating the polymerization of oligonucleotides into a long nicked dsDNA molecule. The numerous exposed remnant initiators can trigger more HCR events. Because of integration of dual signal amplification and the specific HCR process reaction, the resultant sensor showed a high sensitivity for the detection of the target DNA in a linear range from 1.0 fM to 1.0 nM, and a detection limit as low as 0.2 fM. The proposed dual signal amplification strategy provides a powerful tool for detecting different sequences of target DNA by changing the sequence of capture probe and signal probes, holding a great potential for early diagnosis in gene-related diseases. Copyright © 2014 Elsevier B.V. All rights reserved.
Slama-Schwok, A; Zakrzewska, K; Léger, G; Leroux, Y; Takahashi, M; Käs, E; Debey, P
2000-01-01
Using spectroscopic methods, we have studied the structural changes induced in both protein and DNA upon binding of the High-Mobility Group I (HMG-I) protein to a 21-bp sequence derived from mouse satellite DNA. We show that these structural changes depend on the stoichiometry of the protein/DNA complexes formed, as determined by Job plots derived from experiments using pyrene-labeled duplexes. Circular dichroism and melting temperature experiments extended in the far ultraviolet range show that while native HMG-I is mainly random coiled in solution, it adopts a beta-turn conformation upon forming a 1:1 complex in which the protein first binds to one of two dA.dT stretches present in the duplex. HMG-I structure in the 1:1 complex is dependent on the sequence of its DNA target. A 3:1 HMG-I/DNA complex can also form and is characterized by a small increase in the DNA natural bend and/or compaction coupled to a change in the protein conformation, as determined from fluorescence resonance energy transfer (FRET) experiments. In addition, a peptide corresponding to an extended DNA-binding domain of HMG-I induces an ordered condensation of DNA duplexes. Based on the constraints derived from pyrene excimer measurements, we present a model of these nucleated structures. Our results illustrate an extreme case of protein structure induced by DNA conformation that may bear on the evolutionary conservation of the DNA-binding motifs of HMG-I. We discuss the functional relevance of the structural flexibility of HMG-I associated with the nature of its DNA targets and the implications of the binding stoichiometry for several aspects of chromatin structure and gene regulation. PMID:10777751
Cai, Yuqin; Kropachev, Konstantin; Xu, Rong; Tang, Yijin; Kolbanovskii, Marina; Kolbanovskii, Alexander; Amin, Shantu; Patel, Dinshaw J.; Broyde, Suse; Geacintov, Nicholas E.
2010-01-01
Summary The effects of non-nearest base sequences, beyond the nucleotides flanking a DNA lesion on either side, on nucleotide excision repair (NER) in extracts from human cells were investigated. We constructed two duplexes containing the same minor groove-aligned 10S (+)-trans-anti-B[a]P-N2-dG (G*) DNA adduct, derived from the environmental carcinogen benzo[a]pyrene (B[a]P): 5′-C-C-A-T-C-G*-C-T-A-C-C-3′ (CG*C-I), and 5′-C-A-C3-A4-C5-G*-C-A-C-A-C-3′ (CG*C-II). We utilized gel electrophoresis to compare the extent of DNA bending, and molecular dynamics (MD) simulations to analyze the structural characteristics of these two DNA duplexes. The NER efficiencies are 1.6 ± 0.2 times greater in the case of the CG*C-II than the CG*C-I sequence context in 135-mer duplexes. Gel electrophoresis and self-ligation circularization experiments revealed that the CG*C-II duplex is more bent than the CG*C-I duplex, while MD simulations showed that the unique -C3-A4-C5- segment in the CG*C-II duplex plays a key role. The presence of a minor groove-positioned guanine amino group, namely, the Watson-Crick partner to C3, acts as a wedge; facilitated by a highly deformable local -C3-A4- base step, this amino group allows the B[a]P ring system to produce a more enlarged minor groove in CG*C-II than in CG*C-I, as well as a local untwisting and enlarged and flexible Roll only in the CG*C-II sequence. These structural properties fit well with our prior findings that in the case of the family of minor groove 10S (+)-trans-anti-B[a]P-N2-dG lesions, flexible bends and enlarged minor groove widths (Cai et al. (2009) J. Mol. Biol., 385: 30–44) constitute NER recognition signals, and extend our understanding of sequence context effects on NER to the neighbors that are distant to the lesion. PMID:20399214
NASA Technical Reports Server (NTRS)
Wu, Xiaolin; Delgado, Guillermo; Krishnamurthy, Ramanarayanan; Eschenmoser, Albert
2003-01-01
Replacement of adenine by 2,6-diaminopurine-two nucleobases to be considered equivalent from an etlological point of view-strongly enhances the stability of TNA/TNA, TNA/RNA, or TNA/DNA duplexes and efficiently accelerates template-directed ligation of TNA ligands.
Taverniers, Isabel; Van Bockstaele, Erik; De Loose, Marc
2004-03-01
Analytical real-time PCR technology is a powerful tool for implementation of the GMO labeling regulations enforced in the EU. The quality of analytical measurement data obtained by quantitative real-time PCR depends on the correct use of calibrator and reference materials (RMs). For GMO methods of analysis, the choice of appropriate RMs is currently under debate. So far, genomic DNA solutions from certified reference materials (CRMs) are most often used as calibrators for GMO quantification by means of real-time PCR. However, due to some intrinsic features of these CRMs, errors may be expected in the estimations of DNA sequence quantities. In this paper, two new real-time PCR methods are presented for Roundup Ready soybean, in which two types of plasmid DNA fragments are used as calibrators. Single-target plasmids (STPs) diluted in a background of genomic DNA were used in the first method. Multiple-target plasmids (MTPs) containing both sequences in one molecule were used as calibrators for the second method. Both methods simultaneously detect a promoter 35S sequence as GMO-specific target and a lectin gene sequence as endogenous reference target in a duplex PCR. For the estimation of relative GMO percentages both "delta C(T)" and "standard curve" approaches are tested. Delta C(T) methods are based on direct comparison of measured C(T) values of both the GMO-specific target and the endogenous target. Standard curve methods measure absolute amounts of target copies or haploid genome equivalents. A duplex delta C(T) method with STP calibrators performed at least as well as a similar method with genomic DNA calibrators from commercial CRMs. Besides this, high quality results were obtained with a standard curve method using MTP calibrators. This paper demonstrates that plasmid DNA molecules containing either one or multiple target sequences form perfect alternative calibrators for GMO quantification and are especially suitable for duplex PCR reactions.
Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.
Odell, M; Shuman, S
1999-05-14
The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.
2015-01-01
DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2′-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated MeCG dinucleotides and at 5′ Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of MeCG sequences may be caused by a lowered ionization potential of guanine bases paired with MeC and the preferential intercalation of riboflavin photosensitizer adjacent to MeC:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational “hotspots” at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer. PMID:24571128
Malina, Jaroslav; Scott, Peter; Brabec, Viktor
2015-01-01
Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo–helical ‘flexicate’ complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3]4+ incorporating the common NN–NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo–helical complexes for cancer chemotherapy. PMID:25940617
Topoisomerase VI senses and exploits both DNA crossings and bends to facilitate strand passage
Wendorff, Timothy J
2018-01-01
Type II topoisomerases manage DNA supercoiling and aid chromosome segregation using a complex, ATP-dependent duplex strand passage mechanism. Type IIB topoisomerases and their homologs support both archaeal/plant viability and meiotic recombination. Topo VI, a prototypical type IIB topoisomerase, comprises two Top6A and two Top6B protomers; how these subunits cooperate to engage two DNA segments and link ATP turnover to DNA transport is poorly understood. Using multiple biochemical approaches, we show that Top6B, which harbors the ATPase activity of topo VI, recognizes and exploits the DNA crossings present in supercoiled DNA to stimulate subunit dimerization by ATP. Top6B self-association in turn induces extensive DNA bending, which is needed to support duplex cleavage by Top6A. Our observations explain how topo VI tightly coordinates DNA crossover recognition and ATP binding with strand scission, providing useful insights into the operation of type IIB topoisomerases and related meiotic recombination and GHKL ATPase machineries. PMID:29595473
Synthesis and structure of duplex DNA containing the genotoxic nucleobase lesion N7-methylguanine
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.; Bowman, B.R.; Ueno, Y.
2008-11-03
The predominant product of aberrant DNA methylation is the genotoxic lesion N7-methyl-2{prime}-deoxyguanosine (m{sup 7}dG). M{sup 7}dG is recognized and excised by lesion-specific DNA glycosylases, namely AlkA in E. coli and Aag in humans. Structural studies of m{sup 7}dG recognition and catalysis by these enzymes have been hampered due to a lack of efficient means by which to incorporate the chemically labile m{sup 7}dG moiety site-specifically into DNA on a preparative scale. Here we report a solution to this problem. We stabilized the lesion toward acid-catalyzed and glycosylase-catalyzed depurination by 2{prime}-fluorination and toward base-catalyzed degradation using mild, nonaqueous conditions in themore » DNA deprotection reaction. Duplex DNA containing 2{prime}-fluoro-m{sup 7}dG (Fm{sup 7}dG) cocrystallized with AlkA as a host-guest complex in which the lesion-containing segment of DNA was nearly devoid of protein contacts, thus enabling the first direct visualization of the N7-methylguanine lesion nucleobase in DNA. The structure reveals that the base-pairing mode of Fm{sup 7}dG:C is nearly identical to that of G:C, and Fm{sup 7}dG does not induce any apparent structural disturbance of the duplex structure. These observations suggest that AlkA and Aag must perform a structurally invasive interrogation of DNA in order to detect the presence of intrahelical m{sup 7}dG lesions.« less
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.
Wang, S; Kool, E T
1995-04-11
Described is a systematic study of the effects of varied backbone structure on the stabilities of pyr.pur.pyr triple helices. The effects were measured using six circular 34 base oligonucleotides containing DNA (D), RNA (R) and/or 2'-O-methyl-RNA (M) residues designed to bind a complementary single-stranded purine target strand by triple helix formation. Eighteen different backbone combinations were studied at pH 5.5 and 7.0 by optical melting experiments and the results compared with the stabilities of the corresponding Watson-Crick duplexes. When the target purine strand is DNA, all circles form pH-dependent triple helical complexes which are considerably stronger than the duplexes alone. When RNA is the target, five of the nine complexes studied are of the pH-dependent triplex type and the other four complexes are not significantly stronger than the corresponding duplexes. The results are useful in the design of the highest affinity ligands for single- and double-stranded DNAs and RNAs and also point out novel ways to engender DNA- or RNA-selective binding.
VizieR Online Data Catalog: CTIO/DECam photometry of RR Lyrae stars in M5 (Vivas+, 2017)
NASA Astrophysics Data System (ADS)
Vivas, A. K.; Saha, A.; Olsen, K.; Blum, R.; Olszewski, E. W.; Claver, J.; Valdes, F.; Axelrod, T.; Kaleida, C.; Kunder, A.; Narayan, G.; Matheson, T.; Walker, A.
2017-11-01
Observations were obtained during 2013 (2013 Jun 7-9, and 2013 Jun 21) and 2014 (2014 Mar 7-9) with the Dark Energy Camera (DECam) imager on the 4m Blanco Telescope at Cerro Tololo Inter-American Observatory (CTIO), Chile. Repeated DECam images of a field centered on M5 (R.A.=15:18:33.2, decl.=+02:04:51.7, J2000.0) were obtained using the u,g,r,i, and z filters. The large field of view (FOV) of DECam (2.2°) easily covers the whole globular cluster with only the central CCDs of the camera. A total of 66 RR Lyrae stars and 1 SX Phe were recognized in the field of M5. The individual measurements for the periodic variable stars are provided in Table2. In Table3, we present the list of periodic variable stars. (3 data files).
Ganguly, Manjori; Szulik, Marta W.; Donahue, Patrick S.; Clancy, Kate; Stone, Michael P.; Gold, Barry
2012-01-01
Oxidation of DNA due to exposure to reactive oxygen species is a major source of DNA damage. One of the oxidation lesions formed, 5-hydroxy-2'-deoxycytidine, has been shown to miscode by some replicative DNA polymerases but not by error prone polymerases capable of translesion synthesis. The 5-hydroxy-2'-deoxycytidine lesion is repaired by DNA glycosylases that require the 5-hydroxycytidine base to be extrahelical so it can enter into the enzyme's active site where it is excised off the DNA backbone to afford an abasic site. The thermodynamic and NMR results presented herein, describe the effect of a 5-hydroxy-2'-deoxycytidine•2'-deoxyguanosine base pair on the stability of two different DNA duplexes. The results demonstrate that the lesion is highly destabilizing and that the energy barrier for the unstacking of 5-hydroxy-2'-deoxycytidine from the DNA duplex may be low. This could provide a thermodynamic mode of adduct identification by DNA glycosylases that require the lesion to be extrahelical. PMID:22332945
Beddows, Amanda; Patel, Nikesh; Finger, L David; Atack, John M; Williams, David M; Grasby, Jane A
2012-09-14
Flap endonucleases (FENs) are proposed to select their target phosphate diester by unpairing the two terminal nucleotides of duplex. Interstrand disulfide crosslinks, introduced by oxidation of thiouracil and thioguanine bases, abolished the specificity of human FEN1 for hydrolysis one nucleotide into the 5'-duplex.
Effects of fluorescent dyes, quenchers, and dangling ends on DNA duplex stability.
Moreira, Bernardo G; You, Yong; Behlke, Mark A; Owczarzy, Richard
2005-02-11
Single and dual-labeled fluorescent oligodeoxynucleotides are used in many molecular biology applications. We investigated the effects of commonly used fluorescent dyes and quenchers on the thermodynamic stability of a model probe-target DNA duplex. We demonstrate that those effects can be significant. Fluorescent dyes and quenchers were attached to the probe ends. In certain combinations, these groups stabilized the duplex up to 1.8kcal/mol and increased T(m) up to 4.3 degrees C. None of the groups tested significantly destabilized the duplex. Rank order of potency was, starting with the most stabilizing group: Iowa Black RQ approximately Black Hole 2>Cy5 approximately Cy3>Black Hole 1>QSY7 approximately Iowa Black FQ>Texas Red approximately TAMRA>FAM approximately HEX approximately Dabcyl>TET. Longer linkers decreased stabilizing effects. Hybridizations to targets with various dangling ends were also studied and were found to have only minor effects on thermodynamic stability. Depending on the dye/quencher combination employed, it can be important to include thermodynamic contributions from fluorophore and quencher when designing oligonucleotide probe assays.
- Astrophysics - DES - PreCam PreCam Work at ANL The Argonne/HEP Dark Energy Survey (DES) group, working on the Dark Energy Camera (DECam), built a mini-DECam camera called PreCam. This camera has provided valuable
Dynamics of spontaneous flipping of a mismatched base in DNA duplex.
Yin, Yandong; Yang, Lijiang; Zheng, Guanqun; Gu, Chan; Yi, Chengqi; He, Chuan; Gao, Yi Qin; Zhao, Xin Sheng
2014-06-03
DNA base flipping is a fundamental theme in DNA biophysics. The dynamics for a B-DNA base to spontaneously flip out of the double helix has significant implications in various DNA-protein interactions but are still poorly understood. The spontaneous base-flipping rate obtained previously via the imino proton exchange assay is most likely the rate of base wobbling instead of flipping. Using the diffusion-decelerated fluorescence correlation spectroscopy together with molecular dynamics simulations, we show that a base of a single mismatched base pair (T-G, T-T, or T-C) in a double-stranded DNA can spontaneously flip out of the DNA duplex. The extrahelical lifetimes are on the order of 10 ms, whereas the intrahelical lifetimes range from 0.3 to 20 s depending on the stability of the base pairs. These findings provide detailed understanding on the dynamics of DNA base flipping and lay down foundation to fully understand how exactly the repair proteins search and locate the target mismatched base among a vast excess of matched DNA bases.
Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm
2011-01-01
The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988
Xia, Ning; Liu, Ke; Zhou, Yingying; Li, Yuanyuan; Yi, Xinyao
2017-01-01
miRNAs have emerged as new biomarkers for the detection of a wide variety of cancers. By employing duplex-specific nuclease for signal amplification and gold nanoparticles (AuNPs) as the carriers of detection probes, a novel electrochemical assay of miRNAs was performed. The method is based on conversion of the well-known colorimetric assay into electrochemical analysis with enhanced sensitivity. DNA capture probes immobilized on the electrode surface and ferrocene (Fc)-labeled DNA detection probes (denoted “Fc-DNA-Fc”) presented in the solution induced the assembly of positively charged AuNPs on the electrode surface through the electrostatic interaction. As a result, a large number of Fc-DNA-Fc molecules were attached on the electrode surface, thus amplifying the electrochemical signal. When duplex-specific nuclease was added to recycle the process of miRNA-initiated digestion of the immobilized DNA probes, Fc-DNA-Fc-induced assembly of AuNPs on the electrode surface could not occur. This resulted in a significant fall in the oxidation current of Fc. The current was found to be inversely proportional to the concentration of miRNAs in the range of 0–25 fM, and a detection limit of 0.1 fM was achieved. Moreover, this work presents a new method for converting colorimetric assays into sensitive electrochemical analyses, and thus would be valuable for design of novel chemical/biosensors. PMID:28761341
Roles of the amino group of purine bases in the thermodynamic stability of DNA base pairing.
Nakano, Shu-ichi; Sugimoto, Naoki
2014-08-05
The energetic aspects of hydrogen-bonded base-pair interactions are important for the design of functional nucleotide analogs and for practical applications of oligonucleotides. The present study investigated the contribution of the 2-amino group of DNA purine bases to the thermodynamic stability of oligonucleotide duplexes under different salt and solvent conditions, using 2'-deoxyriboinosine (I) and 2'-deoxyribo-2,6-diaminopurine (D) as non-canonical nucleotides. The stability of DNA duplexes was changed by substitution of a single base pair in the following order: G • C > D • T ≈ I • C > A • T > G • T > I • T. The apparent stabilization energy due to the presence of the 2-amino group of G and D varied depending on the salt concentration, and decreased in the water-ethanol mixed solvent. The effects of salt concentration on the thermodynamics of DNA duplexes were found to be partially sequence-dependent, and the 2-amino group of the purine bases might have an influence on the binding of ions to DNA through the formation of a stable base-paired structure. Our results also showed that physiological salt conditions were energetically favorable for complementary base recognition, and conversely, low salt concentration media and ethanol-containing solvents were effective for low stringency oligonucleotide hybridization, in the context of conditions employed in this study.
Malina, Jaroslav; Scott, Peter; Brabec, Viktor
2015-06-23
Loss of a base in DNA leading to creation of an abasic (AP) site leaving a deoxyribose residue in the strand, is a frequent lesion that may occur spontaneously or under the action of various physical and chemical agents. Progress in the understanding of the chemistry and enzymology of abasic DNA largely relies upon the study of AP sites in synthetic duplexes. We report here on interactions of diastereomerically pure metallo-helical 'flexicate' complexes, bimetallic triple-stranded ferro-helicates [Fe2(NN-NN)3](4+) incorporating the common NN-NN bis(bidentate) helicand, with short DNA duplexes containing AP sites in different sequence contexts. The results show that the flexicates bind to AP sites in DNA duplexes in a shape-selective manner. They preferentially bind to AP sites flanked by purines on both sides and their binding is enhanced when a pyrimidine is placed in opposite orientation to the lesion. Notably, the Λ-enantiomer binds to all tested AP sites with higher affinity than the Δ-enantiomer. In addition, the binding of the flexicates to AP sites inhibits the activity of human AP endonuclease 1, which is as a valid anticancer drug target. Hence, this finding indicates the potential of utilizing well-defined metallo-helical complexes for cancer chemotherapy. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
NASA Astrophysics Data System (ADS)
Konforti, Boyana B.; Davis, Ronald W.
1987-02-01
The RecA protein of Escherichia coli is important for genetic recombination in vivo and can promote synapsis and strand exchange in vitro. The DNA pairing and strand exchange reactions have been well characterized in reactions with circular single strands and linear duplexes, but little is known about these two processes using substrates more characteristic of those likely to exist in the cell. Single-stranded linear DNAs were prepared by separating strands of duplex molecules or by cleaving single-stranded circles at a unique restriction site created by annealing a short defined oligonucleotide to the circle. Analysis by gel electrophoresis and electron microscopy revealed that, in the presence of RecA and single-stranded binding proteins, a free 3' homologous end is essential for stable joint molecule formation between linear single-stranded and circular duplex DNA.
Distance-dependent duplex DNA destabilization proximal to G-quadruplex/i-motif sequences
König, Sebastian L. B.; Huppert, Julian L.; Sigel, Roland K. O.; Evans, Amanda C.
2013-01-01
G-quadruplexes and i-motifs are complementary examples of non-canonical nucleic acid substructure conformations. G-quadruplex thermodynamic stability has been extensively studied for a variety of base sequences, but the degree of duplex destabilization that adjacent quadruplex structure formation can cause has yet to be fully addressed. Stable in vivo formation of these alternative nucleic acid structures is likely to be highly dependent on whether sufficient spacing exists between neighbouring duplex- and quadruplex-/i-motif-forming regions to accommodate quadruplexes or i-motifs without disrupting duplex stability. Prediction of putative G-quadruplex-forming regions is likely to be assisted by further understanding of what distance (number of base pairs) is required for duplexes to remain stable as quadruplexes or i-motifs form. Using oligonucleotide constructs derived from precedented G-quadruplexes and i-motif-forming bcl-2 P1 promoter region, initial biophysical stability studies indicate that the formation of G-quadruplex and i-motif conformations do destabilize proximal duplex regions. The undermining effect that quadruplex formation can have on duplex stability is mitigated with increased distance from the duplex region: a spacing of five base pairs or more is sufficient to maintain duplex stability proximal to predicted quadruplex/i-motif-forming regions. PMID:23771141
XPD Helicase: Shifting the Inchworm into Reverse
ERIC Educational Resources Information Center
Pugh, Robert A.
2009-01-01
Directional translocation by helicases results in duplex separation and displacement of bound proteins which allows for the DNA processing events associated with DNA repair, replication, recombination, and transcription. Unresolved questions regarding DNA helicases include: (1) how is directional translocation determined in SF2 helicases; (2) do…
Experimentally Dissecting the Origins of Peroxiredoxin Catalysis.
Nelson, Kimberly J; Perkins, Arden; Van Swearingen, Amanda E D; Hartman, Steven; Brereton, Andrew E; Parsonage, Derek; Salsbury, Freddie R; Karplus, P Andrew; Poole, Leslie B
2018-03-01
Peroxiredoxins (Prxs) are ubiquitous cysteine-based peroxidases involved in oxidant defense and signal transduction. Despite much study, the precise roles of conserved residues remain poorly defined. In this study, we carried out extensive functional and structural characterization of 10 variants of such residues in a model decameric bacterial Prx. Three active site proximal mutations of Salmonella typhimurium AhpC, T43V, R119A, and E49Q, lowered catalytic efficiency with hydrogen peroxide by 4-5 orders of magnitude, but did not affect reactivity toward their reductant, AhpF. pK a values of the peroxidatic cysteine were also shifted up by 1-1.3 pH units for these and a decamer disruption mutant, T77I. Except for the decamer-stabilizing T77V, all mutations destabilized decamers in the reduced form. In the oxidized form, three mutants-T77V, T43A, and T43S-exhibited stabilized decamers and were more efficiently reduced by AhpF than wild-type AhpC. Crystal structures of most mutants were solved and many showed alterations in stability of the fully folded active site loop. This is the first study of Prx mutants to comprehensively assess the effects of mutations on catalytic activities, the active site cysteine pK a , and the protein structure and oligomeric status. The Arg119 side chain must be properly situated for efficient catalysis, but for other debilitating variants, the functional defects could be explained by structural perturbations and/or associated decamer destabilization rather than direct effects. This underscores the importance of our comprehensive approach. A remarkable new finding was the preference of the reductant for decamers. Antioxid. Redox Signal. 28, 521-536.
Formation of (DNA)2-LNA triplet with recombinant base recognition: A quantum mechanical study
NASA Astrophysics Data System (ADS)
Mall, Vijaya Shri; Tiwari, Rakesh Kumar
2018-05-01
The formation of DNA triple helix offers the verity of new possibilities in molecular biology. However its applications are limited to purine and pyrimidine rich sequences recognized by forming Hoogsteen/Reverse Hoogsteen triplets in major groove sites of DNA duplex. To overcome this drawback modification in bases backbone and glucose of nucleotide unit of DNA have been proposed so that the third strand base recognized by both the bases of DNA duplex by forming Recombinant type(R-type) of bonding in mixed sequences. Here we performed Quanrum Mechanical (Hartree-Fock and DFT) methodology on natural DNA and Locked Nucleic Acids(LNA) triplets using 6-31G and some other new advance basis sets. Study suggests energetically stable conformation has been observed for recombinant triplets in order of G-C*G > A-T*A > G-C*C > T-A*T for both type of triplets. Interestingly LNA leads to more stable conformation in all set of triplets, clearly suggests an important biological tool to overcome above mentioned drawbacks.
Crystal structure of RecBCD enzyme reveals a machine for processing DNA breaks
NASA Astrophysics Data System (ADS)
Singleton, Martin R.; Dillingham, Mark S.; Gaudier, Martin; Kowalczykowski, Stephen C.; Wigley, Dale B.
2004-11-01
RecBCD is a multi-functional enzyme complex that processes DNA ends resulting from a double-strand break. RecBCD is a bipolar helicase that splits the duplex into its component strands and digests them until encountering a recombinational hotspot (Chi site). The nuclease activity is then attenuated and RecBCD loads RecA onto the 3' tail of the DNA. Here we present the crystal structure of RecBCD bound to a DNA substrate. In this initiation complex, the DNA duplex has been split across the RecC subunit to create a fork with the separated strands each heading towards different helicase motor subunits. The strands pass along tunnels within the complex, both emerging adjacent to the nuclease domain of RecB. Passage of the 3' tail through one of these tunnels provides a mechanism for the recognition of a Chi sequence by RecC within the context of double-stranded DNA. Gating of this tunnel suggests how nuclease activity might be regulated.
Duplex Healing of Selectively Thiolated Guanosine Mismatches through a Cd2+ Chemical Stimulus.
Lunn, Samantha M L; Hribesh, Samira; Whitfield, Colette J; Hall, Michael J; Houlton, Andrew; Bronowska, Agnieszka K; Tuite, Eimer M; Pike, Andrew R
2018-03-25
The on-column selective conversion of guanosine to thioguanosine (tG) yields modified oligomers that exhibit destabilisation over the fully complementary duplex. Restoration to a stabilised duplex is induced through thio-directed Cd 2+ coordination; a route for healing DNA damage. Short oligomers are G-specifically thiolated through a modified on-column protocol without the need for costly thioguanosine phosphoramidites. Addition of Cd 2+ ions to a duplex containing a highly disrupted tG central mismatch sequence, 3'-A 6 tG 4 T 6 -5', suggests a (tG) 8 Cd 2 central coordination regime, resulting in increased base stacking and duplex stability. Equilibrium molecular dynamic calculations support the hypothesis of metal-induced healing of the thiolated duplex. The 2 nm displacement of the central tG mismatched region is dramatically reduced after the addition of a chemical stimuli, Cd 2+ ions, returning to a minimized fluctuational state comparable to the unmodified fully complementary oligomer. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Inhibition of murine DNA methyltransferase Dnmt3a by DNA duplexes containing pyrimidine-2(1H)-one.
Cherepanova, N A; Zhuze, A L; Gromova, E S
2010-09-01
Here we studied the inhibition of the catalytic domain of Dnmt3a methyltransferase (Dnmt3a-CD) by DNA duplexes containing the mechanism-based inhibitor pyrimidine-2(1H)-one (P) instead of the target cytosine. It has been shown that conjugates of Dnmt3a-CD with P-DNA (DNA containing pyrimidine-2(1H)-one) are not stable to heating at 65°C in 0.1% SDS. The yield of covalent intermediate increases in the presence of the regulatory factor Dnmt3L. The importance of the DNA minor groove for covalent intermediate formation during the methylation reaction catalyzed by Dnmt3a-CD has been revealed. P-DNA was shown to inhibit Dnmt3a-CD; the IC(50) is 830 nM. The competitive mechanism of inhibition of Dnmt3a-CD by P-DNA has been elucidated. It is suggested that therapeutic effect of zebularine could be achieved by inhibition of not only Dnmt1 but also Dnmt3a.
Strand-invading linear probe combined with unmodified PNA.
Asanuma, Hiroyuki; Niwa, Rie; Akahane, Mariko; Murayama, Keiji; Kashida, Hiromu; Kamiya, Yukiko
2016-09-15
Efficient strand invasion by a linear probe to fluorescently label double-stranded DNA has been implemented by employing a probe and unmodified PNA. As a fluorophore, we utilized ethynylperylene. Multiple ethynylperylene residues were incorporated into the DNA probe via a d-threoninol scaffold. The ethynylperylene did not significantly disrupt hybridization with complementary DNA. The linear probe self-quenched in the absence of target DNA and did not hybridize with PNA. A gel-shift assay revealed that linear probe and PNA combination invaded the central region of double-stranded DNA upon heat-shock treatment to form a double duplex. To further suppress the background emission and increase the stability of the probe/DNA duplex, a probe containing anthraquinones as well as ethynylperylene was synthesized. This probe and PNA invader pair detected an internal sequence in a double-stranded DNA with high sensitivity when heat shock treatment was used. The probe and PNA pair was able to invade at the terminus of a long double-stranded DNA at 40°C at 100mM NaCl concentration. Copyright © 2016 Elsevier Ltd. All rights reserved.
New t-gap insertion-deletion-like metrics for DNA hybridization thermodynamic modeling.
D'yachkov, Arkadii G; Macula, Anthony J; Pogozelski, Wendy K; Renz, Thomas E; Rykov, Vyacheslav V; Torney, David C
2006-05-01
We discuss the concept of t-gap block isomorphic subsequences and use it to describe new abstract string metrics that are similar to the Levenshtein insertion-deletion metric. Some of the metrics that we define can be used to model a thermodynamic distance function on single-stranded DNA sequences. Our model captures a key aspect of the nearest neighbor thermodynamic model for hybridized DNA duplexes. One version of our metric gives the maximum number of stacked pairs of hydrogen bonded nucleotide base pairs that can be present in any secondary structure in a hybridized DNA duplex without pseudoknots. Thermodynamic distance functions are important components in the construction of DNA codes, and DNA codes are important components in biomolecular computing, nanotechnology, and other biotechnical applications that employ DNA hybridization assays. We show how our new distances can be calculated by using a dynamic programming method, and we derive a Varshamov-Gilbert-like lower bound on the size of some of codes using these distance functions as constraints. We also discuss software implementation of our DNA code design methods.
Miyoshi, Daisuke; Ueda, Yu-Mi; Shimada, Naohiko; Nakano, Shu-Ichi; Sugimoto, Naoki; Maruyama, Atsushi
2014-09-01
Electrostatic interactions play a major role in protein-DNA interactions. As a model system of a cationic protein, herein we focused on a comb-type copolymer of a polycation backbone and dextran side chains, poly(L-lysine)-graft-dextran (PLL-g-Dex), which has been reported to form soluble interpolyelectrolyte complexes with DNA strands. We investigated the effects of PLL-g-Dex on the conformation and thermodynamics of DNA oligonucleotides forming various secondary structures. Thermodynamic analysis of the DNA structures showed that the parallel conformations involved in both DNA duplexes and triplexes were significantly and specifically stabilized by PLL-g-Dex. On the basis of thermodynamic parameters, it was further possible to design DNA switches that undergo structural transition responding to PLL-g-Dex from an antiparallel duplex to a parallel triplex even with mismatches in the third strand hybridization. These results suggest that polycationic molecules are able to induce structural polymorphism of DNA oligonucleotides, because of the conformation-selective stabilization effects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
NASA Astrophysics Data System (ADS)
Mielke, Steven P.; Grønbech-Jensen, Niels; Krishnan, V. V.; Fink, William H.; Benham, Craig J.
2005-09-01
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Mielke, Steven P; Grønbech-Jensen, Niels; Krishnan, V V; Fink, William H; Benham, Craig J
2005-09-22
The topological state of DNA in vivo is dynamically regulated by a number of processes that involve interactions with bound proteins. In one such process, the tracking of RNA polymerase along the double helix during transcription, restriction of rotational motion of the polymerase and associated structures, generates waves of overtwist downstream and undertwist upstream from the site of transcription. The resulting superhelical stress is often sufficient to drive double-stranded DNA into a denatured state at locations such as promoters and origins of replication, where sequence-specific duplex opening is a prerequisite for biological function. In this way, transcription and other events that actively supercoil the DNA provide a mechanism for dynamically coupling genetic activity with regulatory and other cellular processes. Although computer modeling has provided insight into the equilibrium dynamics of DNA supercoiling, to date no model has appeared for simulating sequence-dependent DNA strand separation under the nonequilibrium conditions imposed by the dynamic introduction of torsional stress. Here, we introduce such a model and present results from an initial set of computer simulations in which the sequences of dynamically superhelical, 147 base pair DNA circles were systematically altered in order to probe the accuracy with which the model can predict location, extent, and time of stress-induced duplex denaturation. The results agree both with well-tested statistical mechanical calculations and with available experimental information. Additionally, we find that sites susceptible to denaturation show a propensity for localizing to supercoil apices, suggesting that base sequence determines locations of strand separation not only through the energetics of interstrand interactions, but also by influencing the geometry of supercoiling.
Detection of chicken contamination in beef meatball using duplex-PCR Cyt b gene
NASA Astrophysics Data System (ADS)
Sari, E. P.; Kartikasari, L. R.; Cahyadi, M.
2017-04-01
Beef is one of expensive animal protein sources compared to other meats, on the other hand, chicken is cheap animal protein source. Mixing of chicken into beef meatball is possibly performed to decrease production cost. The aim of this study was to detect chicken contamination in beef meatball using Cytochrome b (Cyt b) gene by duplex-PCR. Sample was designed and prepared as follows, 100% of chicken meatball, 100% of beef meatball and serial level of chicken contaminations in beef meatball (1, 5, 10 and 25%, respectively). Isolation of DNA genome from meatball was according to the guideline of gSYNCTM DNA Extraction Kit for animal tissue. The PCR reaction was carried out using KAPA2G Fast Multiplex Mix. This study found that the DNA genome was succesfully extracted. Moreover, chicken contamination in beef meatball was indicated by the presence of 227 bp DNA band on 2% of agarose gels. Current study revealed that duplex-PCR using Cyt b gene as a genetic marker was able to detect chicken contamination in beef meatball until 1% of chicken meat in the sample. It can be effectively used to identify contamination and also authenticate species origin in animal products to protect consumer from undesirable contents in the food.
NASA Astrophysics Data System (ADS)
Voityuk, Alexander A.; Jortner, Joshua; Bixon, M.; Rösch, Notker
2001-04-01
Electronic matrix elements for hole transfer between Watson-Crick pairs in desoxyribonucleic acid (DNA) of regular structure, calculated at the Hartree-Fock level, are compared with the corresponding intrastrand and interstrand matrix elements estimated for models comprised of just two nucleobases. The hole transfer matrix element of the GAG trimer duplex is calculated to be larger than that of the GTG duplex. "Through-space" interaction between two guanines in the trimer duplexes is comparable with the coupling through an intervening Watson-Crick pair. The gross features of bridge specificity and directional asymmetry of the electronic matrix elements for hole transfer between purine nucleobases in superstructures of dimer and trimer duplexes have been discussed on the basis of the quantum chemical calculations. These results have also been analyzed with a semiempirical superexchange model for the electronic coupling in DNA duplexes of donor (nuclobases)-acceptor, which incorporates adjacent base-base electronic couplings and empirical energy gaps corrected for solvation effects; this perturbation-theory-based model interpretation allows a theoretical evaluation of experimental observables, i.e., the absolute values of donor-acceptor electronic couplings, their distance dependence, and the reduction factors for the intrastrand hole hopping or trapping rates upon increasing the size of the nucleobases bridge. The quantum chemical results point towards some limitations of the perturbation-theory-based modeling.
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Zn2+ selectively stabilizes FdU-substituted DNA through a unique major groove binding motif
Ghosh, Supratim; Salsbury, Freddie R.; Horita, David A.; Gmeiner, William H.
2011-01-01
We report, based on semi-empirical calculations, that Zn2+ binds duplex DNA containing consecutive FdU–dA base pairs in the major groove with distorted trigonal bipyramidal geometry. In this previously uncharacterized binding motif, O4 and F5 on consecutive FdU are axial ligands while three water molecules complete the coordination sphere. NMR spectroscopy confirmed Zn2+ complexation occurred with maintenance of base pairing while a slight hypsochromic shift in circular dichroism (CD) spectra indicated moderate structural distortion relative to B-form DNA. Zn2+ complexation inhibited ethidium bromide (EtBr) intercalation and stabilized FdU-substituted duplex DNA (ΔTm > 15°C). Mg2+ neither inhibited EtBr complexation nor had as strong of a stabilizing effect. DNA sequences that did not contain consecutive FdU were not stabilized by Zn2+. A lipofectamine preparation of the Zn2+–DNA complex displayed enhanced cytotoxicity toward prostate cancer cells relative to the individual components prepared as lipofectamine complexes indicating the potential utility of Zn2+–DNA complexes for cancer treatment. PMID:21296761
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bellon, S.F.; Coleman, J.H.; Lippard, S.J.
The DNA unwinding produced by specific adducts of the antitumor drug cis-diamminedi-chloroplatinum(II) has been quantitatively determined. Synthetic DNA duplex oligonucleotides of varying lengths with two base pair cohesive ends were synthesized and characterized that contained site-specific intrastrand N7-purine/N7-purine cross-links. Included are cis-(Pt(NH{sub 3}){sub 2}(d(GpG))), cis-(Pt(NH){sub 3}{sub 2}(d(ApG))), and cis-(Pt(NH{sub 3}){sub 2}(d(GpTpG))) adducts, respectively referred to as cis-GG, cis-AG, and cis-GTG. Local DNA distortions at the site of platination were amplified by polymerization of these monomers and quantitatively evaluated by using polyacrylamide gel electrophoresis. The extent of DNA unwinding was determined by systematically varying the interplatinum distance, or phasing, in polymersmore » containing the adducts. The multimer that migrates most slowly gives the optimal phasing for cooperative bending, from which the degree of unwinding can be obtained. The authors find that the cis-GG and cis-AG adducts both unwind DNA by 13{degrees}, while the cis-GTG adduct unwinds DNA by 23{degrees}. In addition, experiments are presented that support previous studies revealing that a hinge joint forms at the sites of platination in DNA molecules containing trans-GTG adducts. On the basis of an analysis of the present and other published studies of site-specifically modified DNA. The authors propose that local duplex unwinding is a major determinant in the recognition of DNA damage by the Escherichia coli (A)BC excinuclease. In addition, local duplex unwinding of 13{degrees} and bending by 35{degrees} are shown to correlate well with the recognition of platinated DNA by a previously identified damage recognition protein (DRP) in human cells.« less
Dutta, Udayan; Cohenford, Menashi A; Dain, Joel A
2007-01-15
Advanced glycation end products (AGEs) play a significant role in the pathophysiology of diabetes leading to such conditions as atherosclerosis, cataract formation, and renal dysfunction. While the formation of nucleoside AGEs was previously demonstrated, no extensive studies have been performed to assess the effect of AGEs on DNA structure and folding. The objective of this study was to investigate the nonenzymatic glycation of two DNA oligonucleotide duplexes with one duplex consisting of deoxy-poly(A)15 and deoxy-poly(T)15 and the other consisting of deoxy-poly(GA)15 and deoxy-poly(CT)15. With D-glucose, D-galactose, D/L-glyceraldehyde, and D-glucosamine serving as the model glycating carbohydrates, D-glucosamine was found to exhibit the greatest effect on the stability and structure of the oligonucleotide duplexes, a finding that was confirmed by circular dichroism. The nonenzymatic glycation of deoxy-poly(AT) by D-glucosamine destabilized the deoxy-poly(AT) structure and changed its conformation from A form to X form. D-glucosamine also altered the conformation of deoxy-poly(GA)15 and deoxy-poly(CT)15 from A form to B form. Capillary electrophoresis and ultraviolet and fluorescence spectroscopy revealed that, of the various purines and pyrimidines, 2'-deoxyguanosine and guanine were most reactive with D-glucosamine. The nonenzymatic modification of nucleic acids warrants further investigation because this phenomenon may occur in vivo, altering DNA structure and/or function.
Molecular dynamics simulations of polarizable DNA in crystal environment
NASA Astrophysics Data System (ADS)
Babin, Volodymyr; Baucom, Jason; Darden, Thomas A.; Sagui, Celeste
We have investigated the role of the electrostatic description and cell environment in molecular dynamics (MD) simulations of DNA. Multiple unrestrained MD simulations of the DNA duplex d(CCAACGTTGG)2 have been carried out using two different force fields: a traditional description based on atomic point charges and a polarizable force field. For the time scales probed, and given the ?right? distribution of divalent ions, the latter performs better than the nonpolarizable force field. In particular, by imposing the experimental unit cell environment, an initial configuration with ideal B-DNA duplexes in the unit cell acquires sequence-dependent features that very closely resemble the crystallographic ones. Simultaneously, the all-atom root-mean-square coordinates deviation (RMSD) with respect to the crystallographic structure is seen to decay. At later times, the polarizable force field is able to maintain this lower RMSD, while the nonpolarizable force field starts to drift away.
KEGS Discovery of 28 Supernova Candidates in the K2 Campaign 17 Field with DECam
NASA Astrophysics Data System (ADS)
Narayan, G.; Rest, A.; Strampelli, G. M.; Zenteno, A.; James, D. J.; Smith, R. C.; Tucker, B. E.; Garnavich, P.; Margheim, S.; Kasen, D.; Olling, R.; Shaya, E.; Buron, F. Forster; Villar, V. A.
2018-05-01
The Kepler Extra-Galactic Survey (KEGS, see http://www.mso.anu.edu.au/kegs/ ) reports the discovery of 28 supernova candidates with the Dark Energy Camera (DECam, NOAO 2017B-0285) on the 4m Blanco Telescope at Cerro Tololo Inter-American Observatory (CTIO).
Izanloo, Cobra
2017-09-02
An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the limits typical for the corresponding family. We observe that popular functionals in density functional theory calculations lead to the overestimated distances between base pairs, while MP2 computations and the newer complex functionals produce the structures that have too close atom-atom contacts. A detailed study of some complementary desoxydinucleoside monophosphate complexes with Na-ions highlights the existence of several energy minima corresponding to BI-conformations, in other words, the complexity of the relief pattern of the potential energy surface of complementary desoxydinucleoside monophosphate complexes. This accounts for variability of conformational parameters of duplex fragments with the same base sequence. Popular molecular mechanics force fields AMBER and CHARMM reproduce most of the conformational characteristics of desoxydinucleoside monophosphates and their complementary complexes with Na-ions but fail to reproduce some details of the dependence of the Watson-Crick duplex conformation on the nucleotide sequence.
Janwan, Penchom; Intapan, Pewpan M; Thanchomnang, Tongjit; Lulitanond, Viraphong; Anamnart, Witthaya; Maleewong, Wanchai
2011-12-01
Human opisthorchiasis caused by the liver fluke Opisthorchis viverrini is an endemic disease in Southeast Asian countries including the Lao People's Democratic Republic, Cambodia, Vietnam, and Thailand. Infection with the soil-transmitted roundworm Strongyloides stercoralis is an important problem worldwide. In some areas, both parasitic infections are reported as co-infections. A duplex real-time fluorescence resonance energy transfer (FRET) PCR merged with melting curve analysis was developed for the rapid detection of O. viverrini and S. stercoralis in human fecal samples. Duplex real-time FRET PCR is based on fluorescence melting curve analysis of a hybrid of amplicons generated from two genera of DNA elements: the 162 bp pOV-A6 DNA sequence specific to O. viverrini and the 244 bp 18S rRNA sequence specific to S. stercoralis, and two pairs of specific fluorophore-labeled probes. Both O. viverrini and S. stercoralis can be differentially detected in infected human fecal samples by this process through their different fluorescence channels and melting temperatures. Detection limit of the method was as little as two O. viverrini eggs and four S. stercoralis larvae in 100 mg of fecal sample. The assay could distinguish the DNA of both parasites from the DNA of negative fecal samples and fecal samples with other parasite materials, as well as from the DNA of human leukocytes and other control parasites. The technique showed 100% sensitivity and specificity. The introduced duplex real-time FRET PCR can reduce labor time and reagent costs and is not prone to carry over contamination. The method is important for simultaneous detection especially in areas where both parasites overlap incidence and is useful as the screening tool in the returning travelers and immigrants to industrialized countries where number of samples in the diagnostic units will become increasing.
Yang, Peng; Peng, Xiaomin; Cui, Shujuan; Shao, Junbin; Zhu, Xuping; Zhang, Daitao; Liang, Huijie; Wang, Quanyi
2013-07-30
Streptococcal superantigens (SAgs) are the major virulence factors of infection in humans for group A Streptococcus (GAS) bacteria. A panel consisting of seven duplex real-time PCR assays was developed to simultaneously detect 13 streptococcal SAgs and one internal control which may be important in the control of GAS-mediated diseases. Primer and probe sequences were selected based on the highly conserved region from an alignment of nucleotide sequences of the 13 streptococcal SAgs. The reaction conditions of the duplex real-time PCR were optimized and the specificity of the duplex assays was evaluated using SAg positive strains. The limit of detection of the duplex assays was determined by using 10-fold serial dilutions of the DNA of 13 streptococcal SAgs and compared to a conventional polymerase chain reaction (PCR) method for evaluating the duplex assays sensitivity. Using the duplex assays, we were able to differentiate between 13 SAgs from Streptococcus strains and other non-Streptococcus bacteria without cross-reaction. On the other hand, the limit of detection of the duplex assays was at least one or two log dilutions lower than that of the conventional PCR. The panel was highly specific (100%) and the limit of detection of these duplex groups was at least ten times lower than that obtained by using a conventional PCR method.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-01-01
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson–Crick base-pairing even in the 3′-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5′ base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region. PMID:27325485
Structural basis for the recognition of guide RNA and target DNA heteroduplex by Argonaute.
Miyoshi, Tomohiro; Ito, Kosuke; Murakami, Ryo; Uchiumi, Toshio
2016-06-21
Argonaute proteins are key players in the gene silencing mechanisms mediated by small nucleic acids in all domains of life from bacteria to eukaryotes. However, little is known about the Argonaute protein that recognizes guide RNA/target DNA. Here, we determine the 2 Å crystal structure of Rhodobacter sphaeroides Argonaute (RsAgo) in a complex with 18-nucleotide guide RNA and its complementary target DNA. The heteroduplex maintains Watson-Crick base-pairing even in the 3'-region of the guide RNA between the N-terminal and PIWI domains, suggesting a recognition mode by RsAgo for stable interaction with the target strand. In addition, the MID/PIWI interface of RsAgo has a system that specifically recognizes the 5' base-U of the guide RNA, and the duplex-recognition loop of the PAZ domain is important for the DNA silencing activity. Furthermore, we show that Argonaute discriminates the nucleic acid type (RNA/DNA) by recognition of the duplex structure of the seed region.
AGT Activity Towards Intrastrand Crosslinked DNA is Modulated by the Alkylene Linker.
O'Flaherty, Derek K; Wilds, Christopher J
2017-12-05
DNA oligomers containing dimethylene and trimethylene intrastrand crosslinks (IaCLs) between the O4 and O6 atoms of neighboring thymidine (T) and 2'-deoxyguanosine (dG) residues were prepared by solid-phase synthesis. UV thermal denaturation (T m ) experiments revealed that these IaCLs had a destabilizing effect on the DNA duplex relative to the control. Circular dichroism spectroscopy suggested these IaCLs induced minimal structural distortions. Susceptibility to dealkylation by reaction with various O 6 -alkylguanine DNA alkyltransferases (AGTs) from human and Escherichia coli was evaluated. It was revealed that only human AGT displayed activity towards the IaCL DNA, with reduced efficiency as the IaCL shortened (from four to two methylene linkages). Changing the site of attachment of the ethylene linkage at the 5'-end of the IaCL to the N3 atom of T had minimal influence on duplex stability and structure, and was refractory to AGT activity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Zanchetta, Giuliano; Giavazzi, Fabio; Nakata, Michi; Buscaglia, Marco; Cerbino, Roberto; Clark, Noel A.; Bellini, Tommaso
2010-01-01
Concentrated solutions of duplex-forming DNA oligomers organize into various mesophases among which is the nematic (N∗), which exhibits a macroscopic chiral helical precession of molecular orientation because of the chirality of the DNA molecule. Using a quantitative analysis of the transmission spectra in polarized optical microscopy, we have determined the handedness and pitch of this chiral nematic helix for a large number of sequences ranging from 8 to 20 bases. The B-DNA molecule exhibits a right-handed molecular double-helix structure that, for long molecules, always yields N∗ phases with left-handed pitch in the μm range. We report here that ultrashort oligomeric duplexes show an extremely diverse behavior, with both left- and right-handed N∗ helices and pitches ranging from macroscopic down to 0.3 μm. The behavior depends on the length and the sequence of the oligomers, and on the nature of the end-to-end interactions between helices. In particular, the N∗ handedness strongly correlates with the oligomer length and concentration. Right-handed phases are found only for oligomers shorter than 14 base pairs, and for the sequences having the transition to the N∗ phase at concentration larger than 620 mg/mL. Our findings indicate that in short DNA, the intermolecular double-helical interactions switch the preferred liquid crystal handedness when the columns of stacked duplexes are forced at high concentrations to separations comparable to the DNA double-helix pitch, a regime still to be theoretically described. PMID:20876125
Istrate, Alena; Katolik, Adam; Istrate, Andrei; Leumann, Christian J
2017-08-01
We describe the synthesis, thermal stability, structural and RNase H activation properties of 2'β-fluoro-tricyclo nucleic acids (2'F-tc-ANA). Three 2'F-tc-ANA nucleosides (T, 5Me C and A) were synthesized starting from a previously described fluorinated tricyclo sugar intermediate. NMR analysis and quantum mechanical calculations indicate that 2'F-tc-ANA nucleosides prefer sugar conformations in the East and South regions of the pseudorotational cycle. UV-melting experiments revealed that non-consecutive insertions of 2'F-tc-ANA units in DNA reduce the affinity to DNA and RNA complements. However, an oligonucleotide with five contiguous 2'F-tc-ANA-T insertions exhibits increased affinity to complementary RNA. Moreover, a fully modified 10-mer 2'F-tc-ANA oligonucleotide paired to both DNA (+1.6 °C/mod) and RNA (+2.5 °C/mod) with significantly higher affinity compared to corresponding unmodified DNA, and similar affinity compared to corresponding tc-DNA. In addition, CD spectroscopy and molecular dynamics simulations indicate that the conformation of the 2'F-tc-ANA/RNA duplex is similar to that of a DNA/RNA duplex. Moreover, in some sequence contexts, 2'F-tc-ANA promotes RNase H-mediated cleavage of a complementary RNA strand. Taken together, 2'F-tc-ANA represents a nucleic acid analogue that offers the advantage of high RNA affinity while maintaining the ability to activate RNase H, and can be considered a prospective candidate for gene silencing applications. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tang, Tingting; Deng, Jingjing; Zhang, Min; Shi, Guoyue; Zhou, Tianshu
2016-01-01
Based on the highly sensitivity and stable-fluorescence of water-soluble CdTe/CdS core-shell quantum dots (QDs) with broad-specificity DNA aptamers, a novel ratiometric detection strategy was proposed for the sensitive detection of organophosphorus pesticides by capillary electrophoresis with laser-induced fluorescence (CE-LIF). The as-prepared QDs were first conjugated with the amino-modified oligonucleotide (AMO) by amidation reaction, which is partial complementary to the DNA aptamer of organophosphorus pesticides. Then QD-labeled AMO (QD-AMO) was incubated with the DNA aptamer to form QD-AMO-aptamer duplex. When the target organophosphorus pesticides were added, they could specifically bind the DNA aptamer, leading to the cleavage of QD-AMO-aptamer duplex, accompany with the release of QD-AMO. As a result, the ratio of peak height between QD-AMO and QD-AMO-aptamer duplex changed in the detection process of CE-LIF. This strategy was subsequently applied for the detection of phorate, profenofos, isocarbophos, and omethoate with the detection limits of 0.20, 0.10, 0.17, and 0.23μM, respectively. This is the first report about using QDs as the signal indicators for organophosphorus pesticides detection based on broad-specificity DNA aptamers by CE-LIF, thus contributing to extend the scope of application of QDs in different fields. The proposed method has great potential to be a universal strategy for rapid detection of aptamer-specific small molecule targets by simply changing the types of aptamer sequences. Copyright © 2015 Elsevier B.V. All rights reserved.
Effective pathway of charge transfer in DNA duplex
NASA Astrophysics Data System (ADS)
Kim, Seongjin; Yi, Juyeon; Hwang, Sun-Yong
2009-03-01
We examine the most efficient route for charge propagation in DNA duplex. We find a direct path along one strand and a detour using the complementary strand compete with each other. Charge tends to take the path along the strand whose energy levels are close to its energy, and yet there exists a crossover length Nc so that for a transfer over a distance shorter than Nc the direct path is always advantageous. We obtain the analytic results for the behavior together with various decay types such as a constant decay, an exponential decay, and a crossover between them, whose validity is confirmed by the numerical calculation.
Kuznetsov, N A; Kiryutin, A S; Kuznetsova, A A; Panov, M S; Barsukova, M O; Yurkovskaya, A V; Fedorova, O S
2017-04-01
Human alkyladenine DNA glycosylase (AAG) protects DNA from alkylated and deaminated purine lesions. AAG flips out the damaged nucleotide from the double helix of DNA and catalyzes the hydrolysis of the N-glycosidic bond to release the damaged base. To understand better, how the step of nucleotide eversion influences the overall catalytic process, we performed a pre-steady-state kinetic analysis of AAG interaction with specific DNA-substrates, 13-base pair duplexes containing in the 7th position 1-N6-ethenoadenine (εA), hypoxanthine (Hx), and the stable product analogue tetrahydrofuran (F). The combination of the fluorescence of tryptophan, 2-aminopurine, and 1-N6-ethenoadenine was used to record conformational changes of the enzyme and DNA during the processes of DNA lesion recognition, damaged base eversion, excision of the N-glycosidic bond, and product release. The thermal stability of the duplexes characterized by the temperature of melting, T m , and the rates of spontaneous opening of individual nucleotide base pairs were determined by NMR spectroscopy. The data show that the relative thermal stability of duplexes containing a particular base pair in position 7, (T m (F/T) < T m (εA/T) < T m (Hx/T) < T m (A/T)) correlates with the rate of reversible spontaneous opening of the base pair. However, in contrast to that, the catalytic lesion excision rate is two orders of magnitude higher for Hx-containing substrates than for substrates containing εA, proving that catalytic activity is not correlated with the stability of the damaged base pair. Our study reveals that the formation of the catalytically competent enzyme-substrate complex is not the bottleneck controlling the catalytic activity of AAG.
Rochester scientist discovers new comet with Dark Energy Camera (DECam) at
Sites Group MASS-DIMM New Projects NOAO Future Instrumentation DECam SAM LSST MONSOON What is MONSOON AURA Sites Group Talks and Meetings Upcoming Colloquia Sky Conditions CTIO Site Conditions TASCA colleagues believe. David Cameron, a visiting scientist in Eric Mamajek's research group in the Department of
Dark Energy Camera (DECam) | CTIO
DECam SAM 0.9-m CCD Goodman SOI Optical Spectrographs CHIRON COSMOS Goodman Filters Telescopes Blanco 4 affecting mainly short exposures taken with bluer filters in dark conditions. 2015 Dec. A new filter, N964 the SDSS filters, has been successfully installed. Images are still being evaluated, but looks good
the slit, then the DECam image is being occluded. The small circle is the field of view of DECam on Meetings Upcoming Colloquia Sky Conditions CTIO Site Conditions TASCA RASICAM Infrared Sky Image CTIO Guidelines Library Facilities Outreach NOAO-S EPO Program team Art of Darkness Image Gallery EPO/CADIAS
d'Ambrosio, E; Furano, A V
1987-01-01
An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148
Psoralen-induced DNA adducts are substrates for the base excision repair pathway in human cells
Couvé-Privat, Sophie; Macé, Gaëtane; Saparbaev, Murat K.
2007-01-01
Interstrand cross-link (ICL) is a covalent modification of both strands of DNA, which prevents DNA strand separation during transcription and replication. Upon photoactivation 8-methoxypsoralen (8-MOP+UVA) alkylates both strands of DNA duplex at the 5,6-double bond of thymidines, generating monoadducts (MAs) and ICLs. It was thought that bulky DNA lesions such as MAs are eliminated only in the nucleotide excision repair pathway. Instead, non-bulky DNA lesions are substrates for DNA glycosylases and AP endonucleases which initiate the base excision repair (BER) pathway. Here we examined whether BER might be involved in the removal of psoralen–DNA photoadducts. The results show that in human cells DNA glycosylase NEIL1 excises the MAs in duplex DNA, subsequently the apurinic/apyrimidinic endonuclease 1, APE1, removes the 3′-phosphate residue at single-strand break generated by NEIL1. The apparent kinetic parameters suggest that NEIL1 excises MAs with high efficiency. Consistent with these results HeLa cells lacking APE1 and/or NEIL1 become hypersensitive to 8-MOP+UVA exposure. Furthermore, we demonstrate that bacterial homologues of NEIL1, the Fpg and Nei proteins, also excise MAs. New substrate specificity of the Fpg/Nei protein family provides an alternative repair pathway for ICLs and bulky DNA damage. PMID:17715144
Mu, Hong; Geacintov, Nicholas E; Min, Jung-Hyun; Zhang, Yingkai; Broyde, Suse
2017-06-19
The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N 2 -dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the "pre-flipped" base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [ Mu , H. , ( 2015 ) Biochemistry , 54 ( 34 ), 5263 - 7 ]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER.
2017-01-01
The xeroderma pigmentosum C protein complex (XPC) recognizes a variety of environmentally induced DNA lesions and is the key in initiating their repair by the nucleotide excision repair (NER) pathway. When bound to a lesion, XPC flips two nucleotide pairs that include the lesion out of the DNA duplex, yielding a productively bound complex that can lead to successful lesion excision. Interestingly, the efficiencies of NER vary greatly among different lesions, influencing their toxicity and mutagenicity in cells. Though differences in XPC binding may influence NER efficiency, it is not understood whether XPC utilizes different mechanisms to achieve productive binding with different lesions. Here, we investigated the well-repaired 10R-(+)-cis-anti-benzo[a]pyrene-N2-dG (cis-B[a]P-dG) DNA adduct in a duplex containing normal partner C opposite the lesion. This adduct is derived from the environmental pro-carcinogen benzo[a]pyrene and is likely to be encountered by NER in the cell. We have extensively investigated its binding to the yeast XPC orthologue, Rad4, using umbrella sampling with restrained molecular dynamics simulations and free energy calculations. The NMR solution structure of this lesion in duplex DNA has shown that the dC complementary to the adducted dG is flipped out of the DNA duplex in the absence of XPC. However, it is not known whether the “pre-flipped” base would play a role in its recognition by XPC. Our results show that Rad4 first captures the displaced dC, which is followed by a tightly coupled lesion-extruding pathway for productive binding. This binding path differs significantly from the one deduced for the small cis-syn cyclobutane pyrimidine dimer lesion opposite mismatched thymines [MuH., (2015) Biochemistry, 54(34), 5263−726270861]. The possibility of multiple paths that lead to productive binding to XPC is consistent with the versatile lesion recognition by XPC that is required for successful NER. PMID:28460163
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DNA-DNA interaction beyond the ground state
NASA Astrophysics Data System (ADS)
Lee, D. J.; Wynveen, A.; Kornyshev, A. A.
2004-11-01
The electrostatic interaction potential between DNA duplexes in solution is a basis for the statistical mechanics of columnar DNA assemblies. It may also play an important role in recombination of homologous genes. We develop a theory of this interaction that includes thermal torsional fluctuations of DNA using field-theoretical methods and Monte Carlo simulations. The theory extends and rationalizes the earlier suggested variational approach which was developed in the context of a ground state theory of interaction of nonhomologous duplexes. It shows that the heuristic variational theory is equivalent to the Hartree self-consistent field approximation. By comparison of the Hartree approximation with an exact solution based on the QM analogy of path integrals, as well as Monte Carlo simulations, we show that this easily analytically-tractable approximation works very well in most cases. Thermal fluctuations do not remove the ability of DNA molecules to attract each other at favorable azimuthal conformations, neither do they wash out the possibility of electrostatic “snap-shot” recognition of homologous sequences, considered earlier on the basis of ground state calculations. At short distances DNA molecules undergo a “torsional alignment transition,” which is first order for nonhomologous DNA and weaker order for homologous sequences.
Evaluation of DNA Force Fields in Implicit Solvation
Gaillard, Thomas; Case, David A.
2011-01-01
DNA structural deformations and dynamics are crucial to its interactions in the cell. Theoretical simulations are essential tools to explore the structure, dynamics, and thermodynamics of biomolecules in a systematic way. Molecular mechanics force fields for DNA have benefited from constant improvements during the last decades. Several studies have evaluated and compared available force fields when the solvent is modeled by explicit molecules. On the other hand, few systematic studies have assessed the quality of duplex DNA models when implicit solvation is employed. The interest of an implicit modeling of the solvent consists in the important gain in the simulation performance and conformational sampling speed. In this study, respective influences of the force field and the implicit solvation model choice on DNA simulation quality are evaluated. To this end, extensive implicit solvent duplex DNA simulations are performed, attempting to reach both conformational and sequence diversity convergence. Structural parameters are extracted from simulations and statistically compared to available experimental and explicit solvation simulation data. Our results quantitatively expose the respective strengths and weaknesses of the different DNA force fields and implicit solvation models studied. This work can lead to the suggestion of improvements to current DNA theoretical models. PMID:22043178
Aiba, Yuichiro; Honda, Yuta; Komiyama, Makoto
2015-03-02
Pseudo-complementary peptide nucleic acid (pcPNA), as one of the most widely used synthetic DNA analogues, invades double-stranded DNA according to Watson-Crick rules to form invasion complexes. This unique mode of DNA recognition induces structural changes at the invasion site and can be used for a range of applications. In this paper, pcPNA is conjugated with a nuclear localization signal (NLS) peptide, and its invading activity is notably promoted both thermodynamically and kinetically. Thus, the double-duplex invasion complex is formed promptly at low pcPNA concentrations under high salt conditions, where the invasion otherwise never occurs. Furthermore, NLS-modified pcPNA is successfully employed for site-selective DNA scission, and the targeted DNA is selectively cleaved under conditions that are not conducive for DNA cutters using unmodified pcPNAs. This strategy of pcPNA modification is expected to be advantageous and promising for a range of in vitro and in vivo applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.
2016-01-01
Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050
Exo-Dye-based assay for rapid, inexpensive, and sensitive detection of DNA-binding proteins.
Chen, Zaozao; Ji, Meiju; Hou, Peng; Lu, Zuhong
2006-07-07
We reported herein a rapid, inexpensive, and sensitive technique for detecting sequence-specific DNA-binding proteins. In this technique, the common exonuclease III (ExoIII) footprinting assay is coupled with simple SYBR Green I staining for monitoring the activities of DNA-binding proteins. We named this technique as ExoIII-Dye-based assay. In this assay, a duplex probe was designed to detect DNA-binding protein. One side of the probe contains one protein-binding site, and another side of it contains five protruding bases at 3' end for protection from ExoIII digestion. If a target protein is present, it will bind to binding sites of probe and produce a physical hindrance to ExoIII, which protects the duplex probe from digestion of ExoIII. SYBR Green I will bind to probe, which results in high fluorescence intensity. On the contrary, in the absence of the target protein, the naked duplex probe will be degraded by ExoIII. SYBR Green I will be released, which results in a low fluorescence intensity. In this study, we employed this technique to successfully detect transcription factor NF-kappaB in crude cell extracts. Moreover, it could also be used to evaluate the binding affinity of NF-kappaB. This technique has therefore wide potential application in research, medical diagnosis, and drug discovery.
DNA nanostructures: Through, rather than across
NASA Astrophysics Data System (ADS)
Bruchez, Marcel P.
2018-02-01
Dye molecules are shown to assemble into J-aggregate arrays by sequence-specific organization in the minor groove of DNA duplex sequences. Energy transfer through these structures displays the hallmarks of coherent coupling over distances that exceed those of conventional dipole-coupling processes.
Sakalar, Ergün; Ergün, Seyma Özçirak; Akar, Emine
2015-01-01
A duplex real-time polymerase chain reaction (PCR) based assay for the detection of porcine and horse meat in sausages was designed by using EvaGreen fluorescent dye. Primers were selected from mitochondrial 12S rRNA and 16S rRNA genes which are powerful regions for identification of horse and porcine meat. DNA from reference samples and industrial products was successfully extracted using the GIDAGEN® Multi-Fast DNA Isolation Kit. Genomes were identified based on their specific melting peaks (Mp) which are 82.5℃ and 78℃ for horse and porcine, respectively. The assay used in this study allowed the detection of as little as 0.0001% level of horse meat and 0.001% level of porcine meat in the experimental admixtures. These findings indicate that EvaGreen based duplex real-time PCR is a potentially sensitive, reliable, rapid and accurate assay for the detection of meat species adulterated with porcine and horse meats.
Top1 May Do More Than Relax DNA | Center for Cancer Research
Topoisomerase 1 (Top1) is an enzyme with a well known role in relaxing DNA supercoils by making reversible nicks in DNA. The ribonuclease (RNase) H class of enzymes is equally well known for removing ribonucleotides from hybrid duplex DNA when they are misincorporated during DNA replication. Recently, Shar-yin Huang, Ph.D., and Yves Pommier, M.D., Ph.D., in CCR’s Laboratory of
Sharma, Amit; Jenkins, Katherine R.; Héroux, Annie; Bowman, Gregory D.
2011-01-01
Chromatin remodelers are ATP-dependent machines that dynamically alter the chromatin packaging of eukaryotic genomes by assembling, sliding, and displacing nucleosomes. The Chd1 chromatin remodeler possesses a C-terminal DNA-binding domain that is required for efficient nucleosome sliding and believed to be essential for sensing the length of DNA flanking the nucleosome core. The structure of the Chd1 DNA-binding domain was recently shown to consist of a SANT and SLIDE domain, analogous to the DNA-binding domain of the ISWI family, yet the details of how Chd1 recognized DNA were not known. Here we present the crystal structure of the Saccharomyces cerevisiae Chd1 DNA-binding domain in complex with a DNA duplex. The bound DNA duplex is straight, consistent with the preference exhibited by the Chd1 DNA-binding domain for extranucleosomal DNA. Comparison of this structure with the recently solved ISW1a DNA-binding domain bound to DNA reveals that DNA lays across each protein at a distinct angle, yet contacts similar surfaces on the SANT and SLIDE domains. In contrast to the minor groove binding seen for Isw1 and predicted for Chd1, the SLIDE domain of the Chd1 DNA-binding domain contacts the DNA major groove. The majority of direct contacts with the phosphate backbone occur only on one DNA strand, suggesting that Chd1 may not strongly discriminate between major and minor grooves. PMID:22033927
de La Harpe, Kimberly; Kohl, Forrest R; Zhang, Yuyuan; Kohler, Bern
2018-03-08
To better understand how the solvent influences excited-state deactivation in DNA strands, femtosecond time-resolved IR (fs-TRIR) pump-probe measurements were performed on a d(AT) 9 ·d(AT) 9 duplex dissolved in a deep eutectic solvent (DES) made from choline chloride and ethylene glycol in a 1:2 mol ratio. This solvent, known as ethaline, is a member of a class of ionic liquids capable of solubilizing DNA with minimal disruption to its secondary structure. UV melting analysis reveals that the duplex studied here melts at 18 °C in ethaline compared to 50 °C in aqueous solution. Ethaline has an excellent transparency window that facilitates TRIR measurements in the double-bond stretching region. Transient spectra recorded in deuterated ethaline at room temperature indicate that photoinduced intrastrand charge transfer occurs from A to T, yielding the same exciplex state previously detected in aqueous solution. This state decays via charge recombination with a lifetime of 380 ± 10 ps compared to the 300 ± 10 ps lifetime measured earlier in D 2 O solution. The TRIR data strongly suggest that the long-lived exciplex forms exclusively in the solvated duplex, and not in the denatured single strands, which appear to have little, if any, base stacking. The longer lifetime of the exciplex state in the DES compared to aqueous solution is suggested to arise from reduced stabilization of the charge transfer state, resulting in slower charge recombination on account of Marcus inverted behavior.
System Architecture of the Dark Energy Survey Camera Readout Electronics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shaw, Theresa; /FERMILAB; Ballester, Otger
2010-05-27
The Dark Energy Survey makes use of a new camera, the Dark Energy Camera (DECam). DECam will be installed in the Blanco 4M telescope at Cerro Tololo Inter-American Observatory (CTIO). DECam is presently under construction and is expected to be ready for observations in the fall of 2011. The focal plane will make use of 62 2Kx4K and 12 2kx2k fully depleted Charge-Coupled Devices (CCDs) for guiding, alignment and focus. This paper will describe design considerations of the system; including, the entire signal path used to read out the CCDs, the development of a custom crate and backplane, the overallmore » grounding scheme and early results of system tests.« less
VizieR Online Data Catalog: White dwarf candidates in DECam first field (Belardi+, 2016)
NASA Astrophysics Data System (ADS)
Belardi, C.; Kilic, M.; Munn, J. A.; Gianninas, A.; Barber, S. D.; Dey, A.; Stetson, P. B.
2018-02-01
We used DECam mounted on the Blanco 4m Telescope on UT 2014 Feb 2-9 to obtain g-band exposures of a three square degree field (corresponding to a single DECam pointing) centred at Right Ascension RA=09:03:02 and Declination DE=-04:35:00. Our observations were performed under the NOAO program 2014A-0073. This field was previously observed by the Canada-France-Hawaii Telescope Legacy Survey (CFHTLS1) between 2003 and 2008, and is part of the CFHTLS Wide 2 field, which is a 25 square degree field with MegaCam ugriz photometry available. The earlier MegaCam data provide the first epoch for our proper motion measurements. (4 data files).
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom
2015-01-01
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining.
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L; Tomkinson, Alan E; Tainer, John A; Ellenberger, Tom
2015-08-18
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Sequence distribution of acetaldehyde-derived N2-ethyl-dG adducts along duplex DNA.
Matter, Brock; Guza, Rebecca; Zhao, Jianwei; Li, Zhong-ze; Jones, Roger; Tretyakova, Natalia
2007-10-01
Acetaldehyde (AA) is the major metabolite of ethanol and may be responsible for an increased gastrointestinal cancer risk associated with alcohol beverage consumption. Furthermore, AA is one of the most abundant carcinogens in tobacco smoke and induces tumors of the respiratory tract in laboratory animals. AA binding to DNA induces Schiff base adducts at the exocyclic amino group of dG, N2-ethylidene-dG, which are reversible on the nucleoside level but can be stabilized by reduction to N2-ethyl-dG. Mutagenesis studies in the HPRT reporter gene and in the p53 tumor suppressor gene have revealed the ability of AA to induce G-->A transitions and A-->T transversions, as well as frameshift and splice mutations. AA-induced point mutations are most prominent at 5'-AGG-3' trinucleotides, possibly a result of sequence specific adduct formation, mispairing, and/or repair. However, DNA sequence preferences for the formation of acetaldehyde adducts have not been previously examined. In the present work, we employed a stable isotope labeling-HPLC-ESI+-MS/MS approach developed in our laboratory to analyze the distribution of acetaldehyde-derived N2-ethyl-dG adducts along double-stranded oligodeoxynucleotides representing two prominent lung cancer mutational "hotspots" and their surrounding DNA sequences. 1,7,NH 2-(15)N-2-(13)C-dG was placed at defined positions within DNA duplexes derived from the K-ras protooncogene and the p53 tumor suppressor gene, followed by AA treatment and NaBH 3CN reduction to convert N2-ethylidene-dG to N2-ethyl-dG. Capillary HPLC-ESI+-MS/MS was used to quantify N2-ethyl-dG adducts originating from the isotopically labeled and unlabeled guanine nucleobases and to map adduct formation along DNA duplexes. We found that the formation of N2-ethyl-dG adducts was only weakly affected by the local sequence context and was slightly increased in the presence of 5-methylcytosine within CG dinucleotides. These results are in contrast with sequence-selective formation of other tobacco carcinogen-DNA adducts along K-ras- and p53-derived duplexes and the preferential modification of endogenously methylated CG dinucleotides by benzo[a]pyrene diol epoxide and acrolein.
Conformational Dynamics of DNA Repair by Escherichia coli Endonuclease III*
Kuznetsov, Nikita A.; Kladova, Olga A.; Kuznetsova, Alexandra A.; Ishchenko, Alexander A.; Saparbaev, Murat K.; Zharkov, Dmitry O.; Fedorova, Olga S.
2015-01-01
Escherichia coli endonuclease III (Endo III or Nth) is a DNA glycosylase with a broad substrate specificity for oxidized or reduced pyrimidine bases. Endo III possesses two types of activities: N-glycosylase (hydrolysis of the N-glycosidic bond) and AP lyase (elimination of the 3′-phosphate of the AP-site). We report a pre-steady-state kinetic analysis of structural rearrangements of the DNA substrates and uncleavable ligands during their interaction with Endo III. Oligonucleotide duplexes containing 5,6-dihydrouracil, a natural abasic site, its tetrahydrofuran analog, and undamaged duplexes carried fluorescent DNA base analogs 2-aminopurine and 1,3-diaza-2-oxophenoxazine as environment-sensitive reporter groups. The results suggest that Endo III induces several fast sequential conformational changes in DNA during binding, lesion recognition, and adjustment to a catalytically competent conformation. A comparison of two fluorophores allowed us to distinguish between the events occurring in the damaged and undamaged DNA strand. Combining our data with the available structures of Endo III, we conclude that this glycosylase uses a multistep mechanism of damage recognition, which likely involves Gln41 and Leu81 as DNA lesion sensors. PMID:25869130
Manalo, Marlon N; Kong, Xiangming; LiWang, Andy
2007-04-01
Hydrogen-bond lengths of nucleic acids are (1) longer in DNA than in RNA, and (2) sequence dependent. The physicochemical basis for these variations in hydrogen-bond lengths is unknown, however. Here, the notion that hydration plays a significant role in nucleic acid hydrogen-bond lengths is tested. Watson-Crick N1...N3 hydrogen-bond lengths of several DNA and RNA duplexes are gauged using imino 1J(NH) measurements, and ethanol is used as a cosolvent to lower water activity. We find that 1J(NH) values of DNA and RNA become less negative with added ethanol, which suggests that mild dehydration reduces hydrogen-bond lengths even as the overall thermal stabilities of these duplexes decrease. The 1J(NH) of DNA are increased in 8 mol% ethanol to those of RNA in water, which suggests that the greater hydration of DNA plays a significant role in its longer hydrogen bonds. The data also suggest that ethanol-induced dehydration is greater for the more hydrated G:C base pairs and thereby results in greater hydrogen-bond shortening than for the less hydrated A:T/U base pairs of DNA and RNA.
Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure
North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.
2014-01-01
Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803
Maruyama, Kohei; Takeyama, Haruko; Nemoto, Etsuo; Tanaka, Tsuyoshi; Yoda, Kiyoshi; Matsunaga, Tadashi
2004-09-20
Single nucleotide polymorphism (SNP) detection for aldehyde dehydrogenase 2 (ALDH2) gene based on DNA thermal dissociation curve analysis was successfully demonstrated using an automated system with bacterial magnetic particles (BMPs) by developing a new method for avoiding light scattering caused by nanometer-size particles when using commercially available fluorescent dyes such as FITC, Cy3, and Cy5 as labeling chromophores. Biotin-labeled PCR products in ALDH2, two allele-specific probes (Cy3-labeled detection probe for ALDH2*1 and Cy5-labeled detection probe for ALDH2*2), streptavidin-immobilized BMPs (SA-BMPs) were simultaneously mixed. The mixture was denatured at 70 degrees C for 3 min, cooled slowly to 25 degrees C, and incubated for 10 min, allowing the DNA duplex to form between Cy3- or Cy5-labeled detection probes and biotin-labeled PCR products on SA-BMPs. Then duplex DNA-BMP complex was heated to 58 degrees C, a temperature determined by dissociation curve analysis and a dissociated single-base mismatched detection probe was removed at the same temperature under precise control. Furthermore, fluorescence signal from the detection probe was liberated into the supernatant from completely matched duplex DNA-BMP complex by heating to 80 degrees C and measured. In the homozygote target DNA (ALDH2*1/*1 and ALDH2*2/*2), the fluorescence signals from single-base mismatched were decreased to background level, indicating that mismatched hybridization was efficiently removed by the washing process. In the heterozygote target DNA (ALDH2*1/*2), each fluorescence signals was at a similar level. Therefore, three genotypes of SNP in ALDH2 gene were detected using the automated detection system with BMPs. Copyright 2004 Wiley Periodicals, Inc.
Zhu, Li-Na; Zhao, Shu-Juan; Wu, Bin; Li, Xiao-Zeng; Kong, De-Ming
2012-01-01
The discovery of uncommon DNA structures and speculation about their potential functions in genes has brought attention to specific DNA structure recognition. G-quadruplexes are four-stranded nucleic acid structures formed by G-rich DNA (or RNA) sequences. G-rich sequences with a high potential to form G-quadruplexes have been found in many important genomic regions. Porphyrin derivatives with cationic side arm substituents are important G-quadruplex-binding ligands. For example, 5,10,15,20-Tetrakis(N-methylpyridinium-4-yl)-21H,23H-porphyrin (TMPyP4), interacts strongly with G-quadruplexes, but has poor selectivity for G-quadruplex versus duplex DNA. To increase the G-quadruplex recognition specificity, a new cationic porphyrin derivative, 5,10,15,20-tetra-{4-[2-(1-methyl-1-piperidinyl)ethoxy]phenyl} porphyrin (TMPipEOPP), with large side arm substituents was synthesized, and the interactions between TMPipEOPP and different DNA structures were compared. The results show that G-quadruplexes cause large changes in the UV-Vis absorption and fluorescence spectra of TMPipEOPP, but duplex and single-stranded DNAs do not, indicating that TMPipEOPP can be developed as a highly specific optical probe for discriminating G-quadruplex from duplex and single-stranded DNA. Visual discrimination is also possible. Job plot and Scatchard analysis suggest that a complicated binding interaction occurs between TMPipEOPP and G-quadruplexes. At a low [G-quadruplex]/[TMPipEOPP] ratio, one G-quadruplex binds two TMPipEOPP molecules by end-stacking and outside binding modes. At a high [G-quadruplex]/[TMPipEOPP] ratio, two G-quadruplexes bind to one TMPipEOPP molecule in a sandwich-like end-stacking mode.
Huang, Yong; Liu, Xiaoqian; Huang, Huakui; Qin, Jian; Zhang, Liangliang; Zhao, Shulin; Chen, Zhen-Feng; Liang, Hong
2015-08-18
Extremely sensitive and accurate measurements of protein markers for early detection and monitoring of diseases pose a formidable challenge. Herein, we develop a new type of amplified fluorescence polarization (FP) aptasensor based on allostery-triggered cascade strand-displacement amplification (CSDA) and polystyrene nanoparticle (PS NP) enhancement for ultrasensitive detection of proteins. The assay system consists of a fluorescent dye-labeled aptamer hairpin probe and a PS NP-modified DNA duplex (assistant DNA/trigger DNA duplex) probe with a single-stranded part and DNA polymerase. Two probes coexist stably in the absence of target, and the dye exhibits relatively low FP background. Upon recognition and binding with a target protein, the stem of the aptamer hairpin probe is opened, after which the opened hairpin probe hybridizes with the single-stranded part in the PS NP-modified DNA duplex probe and triggers the CSDA reaction through the polymerase-catalyzed recycling of both target protein and trigger DNA. Throughout this CSDA process, numerous massive dyes are assembled onto PS NPs, which results in a substantial FP increase that provides a readout signal for the amplified sensing process. Our newly proposed amplified FP aptasensor enables the quantitative measurement of proteins with the detection limit in attomolar range, which is about 6 orders of magnitude lower than that of traditional homogeneous aptasensors. Moreover, this sensing method also exhibits high specificity for target proteins and can be performed in homogeneous solutions. In addition, the suitability of this method for the quantification of target protein in biological samples has also been shown. Considering these distinct advantages, the proposed sensing method can be expected to provide an ultrasensitive platform for the analysis of various types of target molecules.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yeo, Hyun Koo; Lee, Jae Young
2012-04-18
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.
Yeo, Hyun Koo; Lee, Jae Young
2010-05-01
The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .
Triplex-mediated analysis of cytosine methylation at CpA sites in DNA.
Johannsen, Marie W; Gerrard, Simon R; Melvin, Tracy; Brown, Tom
2014-01-18
Modified triplex-forming oligonucleotides distinguish 5-methyl cytosine from unmethylated cytosine in DNA duplexes by differences in triplex melting temperatures. The discrimination is sequence-specific; dramatic differences in stabilisation are seen for CpA methylation, whereas CpG methylation is not detected. This direct detection of DNA methylation constitutes a new approach for epigenetic analysis.
Kanakis, C D; Tarantilis, P A; Polissiou, M G; Diamantoglou, S; Tajmir-Riahi, H A
2005-06-01
Flavonoids are strong antioxidants that prevent DNA damage. The anticancer and antiviral activities of these natural products are implicated in their mechanism of actions. However, there has been no information on the interactions of these antioxidants with individual DNA at molecular level. This study was designed to examine the interaction of quercetin (que), kaempferol (kae), and delphinidin (del) with calf-thymus DNA in aqueous solution at physiological conditions, using constant DNA concentration (6.5 mmol) and various drug/DNA(phosphate) ratios of 1/65 to 1. FTIR and UV-Visible difference spectroscopic methods are used to determine the drug binding sites, the binding constants and the effects of drug complexation on the stability and conformation of DNA duplex. Structural analysis showed quercetin, kaempferol, and delphinidin bind weakly to adenine, guanine (major groove), and thymine (minor groove) bases, as well as to the backbone phosphate group with overall binding constants K(que) = 7.25 x 10(4)M(-1), K(kae) = 3.60 x 10(4)M(-1), and K(del) = 1.66 x 10(4)M(-1). The stability of adduct formation is in the order of que>kae>del. Delphinidin with a positive charge induces more stabilizing effect on DNA duplex than quercetin and kaempferol. A partial B to A-DNA transition occurs at high drug concentrations.
Double stranded nucleic acid biochips
Chernov, Boris; Golova, Julia
2006-05-23
This invention describes a new method of constructing double-stranded DNA (dsDNA) microarrays based on the use of pre-synthesized or natural DNA duplexes without a stem-loop structure. The complementary oligonucleotide chains are bonded together by a novel connector that includes a linker for immobilization on a matrix. A non-enzymatic method for synthesizing double-stranded nucleic acids with this novel connector enables the construction of inexpensive and robust dsDNA/dsRNA microarrays. DNA-DNA and DNA-protein interactions are investigated using the microarrays.
Teuben, J M; Bauer, C; Wang, A H; Reedijk, J
1999-09-21
The platinum 1,3-d(GXG) intrastrand cross-link is one of the adducts formed in the reaction of the antitumor drug cisplatin with DNA, and in fact the major adduct found in cells treated with the cisplatin analogue carboplatin. To determine the 3D structure of this adduct, the duplex d(CTCTGTGTCTC).d(GAGACACAGAG)], where GTG denotes a platinum 1,3-intrastrand cross-link, was prepared and studied with high-resolution (1)H NMR. The solution structure was determined using the SPEDREF protocol, which includes an iterative NOE-restrained refinement procedure. Calculated and recorded NOE spectra were found to be in good agreement (NMR R factor 22%). The studied duplex is more distorted from B-DNA than previously determined structures of the 1,2-d(GG) intrastrand adducts. The base pairing is lost for the 5'G-C and the central T-A base pair in the GTG lesion, and the central thymine is extruded from the minor groove. To accommodate this lesion, the minor groove is widened, and the 5'-guanine ribose adopts an N-type conformation. The helix is unwound locally and is significantly bent toward the major groove. Significant difference between the structural distortion of the 1, 3-d(GTG) cross-link and other Pt-DNA cross-links sheds new light on the observed differences in protein recognition of these lesions, and thus on the possible differences in mechanisms of action of the various Pt-DNA adducts formed in treatment with platinum anticancer complexes.
Controlled assembly of artificial protein-protein complexes via DNA duplex formation.
Płoskoń, Eliza; Wagner, Sara C; Ellington, Andrew D; Jewett, Michael C; O'Reilly, Rachel; Booth, Paula J
2015-03-18
DNA-protein conjugates have found a wide range of applications. This study demonstrates the formation of defined, non-native protein-protein complexes via the site specific labeling of two proteins of interest with complementary strands of single-stranded DNA in vitro. This study demonstrates that the affinity of two DNA-protein conjugates for one another may be tuned by the use of variable lengths of DNA allowing reversible control of complex formation.
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Zhou, Huiqing; Kimsey, Isaac J.; Nikolova, Evgenia N.; Sathyamoorthy, Bharathwaj; Grazioli, Gianmarc; McSally, James; Bai, Tianyu; Wunderlich, Christoph H.; Kreutz, Christoph; Andricioaei, Ioan; Al-Hashimi, Hashim M.
2016-01-01
The B-DNA double helix can dynamically accommodate G–C and A–T base pairs in either Watson-Crick or Hoogsteen configurations. Here, we show that G–C+ and A–U Hoogsteen base pairs are strongly disfavored in A-RNA. As a result, N1-methyl adenosine and N1-methyl guanosine, which occur in DNA as a form of alkylation damage, and in RNA as a posttranscriptional modification, have dramatically different consequences. They create G–C+ and A–U Hoogsteen base pairs in duplex DNA that maintain the structural integrity of the double helix, but block base pairing all together and induce local duplex melting in RNA, providing a mechanism for potently disrupting RNA structure through posttranscriptional modifications. The markedly different propensities to form Hoogsteen base pairs in B-DNA and A-RNA may help meet the opposing requirements of maintaining genome stability on one hand, and dynamically modulating the structure of the epitranscriptome on the other. PMID:27478929
â¹âº You are here CTIO Home » About » News » Record-Breaking Image Quality with DECam Post date : 3 years 3 months ago Lunar Eclipse with the Tololo All-Sky CAmera (TASCA) Post date: 3 years 4 months ago DECam's nearby discoveries Post date: 3 years 4 months ago Smashing Results about our Nearby
A metallo-DNA nanowire with uninterrupted one-dimensional silver array
NASA Astrophysics Data System (ADS)
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Hattori, Yoshikazu; Saneyoshi, Hisao; Ono, Akira; Tanaka, Yoshiyuki
2017-10-01
The double-helix structure of DNA, in which complementary strands reversibly hybridize to each other, not only explains how genetic information is stored and replicated, but also has proved very attractive for the development of nanomaterials. The discovery of metal-mediated base pairs has prompted the generation of short metal-DNA hybrid duplexes by a bottom-up approach. Here we describe a metallo-DNA nanowire—whose structure was solved by high-resolution X-ray crystallography—that consists of dodecamer duplexes held together by four different metal-mediated base pairs (the previously observed C-Ag-C, as well as G-Ag-G, G-Ag-C and T-Ag-T) and linked to each other through G overhangs involved in interduplex G-Ag-G. The resulting hybrid nanowires are 2 nm wide with a length of the order of micrometres to millimetres, and hold the silver ions in uninterrupted one-dimensional arrays along the DNA helical axis. The hybrid nanowires are further assembled into three-dimensional lattices by interactions between adenine residues, fully bulged out of the double helix.
Fleming, Aaron M.; Burrows, Cynthia J.
2013-01-01
Telomere shortening occurs during oxidative and inflammatory stress with guanine (G) as the major site of damage. In this work, a comprehensive profile of the sites of oxidation and structures of products observed from G-quadruplex and duplex structures of the human telomere sequence was studied in the G-quadruplex folds (hybrid (K+), basket (Na+), and propeller (K+ + 50% CH3CN)) resulting from the sequence 5’-(TAGGGT)4T-3’ and in an appropriate duplex containing one telomere repeat. Oxidations with four oxidant systems consisting of riboflavin photosensitization, carbonate radical generation, singlet oxygen, and the copper Fenton-like reaction were analyzed under conditions of low product conversion to determine relative reactivity. The one-electron oxidants damaged the 5’-G in G-quadruplexes leading to spiroiminodihydantoin (Sp) and 2,2,4-triamino-2H-oxazol-5-one (Z) as major products as well as 8-oxo-7,8-dihydroguanine (OG) and 5-guanidinohydantoin (Gh) in low relative yields, while oxidation in the duplex context produced damage at the 5’- and middle-Gs of GGG sequences and resulted in Gh being the major product. Addition of the reductant N-acetylcysteine (NAC) to the reaction did not alter the riboflavin-mediated damage sites, but decreased Z by 2-fold and increased OG by 5-fold, while not altering the hydantoin ratio. However, NAC completely quenched the CO3•− reactions. Singlet oxygen oxidations of the G-quadruplex showed reactivity at all Gs on the exterior faces of G-quartets and furnished the product Sp, while no oxidation was observed in the duplex context under these conditions, and addition of NAC had no effect. Because a long telomere sequence would have higher-order structures of G-quadruplexes, studies were also conducted with 5’-(TAGGGT)8-T-3’, and it provided similar oxidation profiles to the single G-quadruplex. Lastly, CuII/H2O2-mediated oxidations were found to be indiscriminate in the damage patterns, and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) was found to be a major duplex product, while nearly equal yields of 2Ih and Sp were observed in G-quadruplex contexts. These findings indicate that the nature of the secondary structure of folded DNA greatly alters both the reactivity of G toward oxidative stress as well as the product outcome and suggest that recognition of damage in telomeric sequences by repair enzymes may be profoundly different from that of B-form duplex DNA. PMID:23438298
Luo, Yakun; Liang, Lin; Zhou, Ling; Zhao, Kai; Cui, Shangjin
2015-07-01
Nanoparticle-assisted polymerase chain reaction (nanoPCR) is a novel method for the simple, rapid, and specific amplification of DNA and has been used to detect viruses. A duplex nanoPCR molecular detection system was developed to detect pseudorabies virus (PRV) and porcine bocavirus (PBoV). Primers were selected to target conserved regions within the PRV gE gene and the PBoV NS1 gene. Under optimized nanoPCR reaction conditions, two specific fragments of 316 bp (PRV) and 996 bp (PBoV) were amplified by the duplex nanoPCR with a detection limit of 6 copies for PRV and 95 copies for PBoV; no fragments were amplified when other porcine viruses were used as template. When used to test 550 clinical samples, the duplex nanoPRC assay and a conventional duplex PCR assay provided very similar results (98.1% consistency); single PRV infections, single PBoV infections, and concurrent PRV and PBoV infections were detected in 37%, 15%, and 9% of the samples, respectively. The results indicate that the novel duplex nanoPCR assay is useful for the rapid detection of PRV and PBoV in pigs. Copyright © 2015 Elsevier B.V. All rights reserved.
Toh, Desiree-Faye Kaixin; Devi, Gitali; Patil, Kiran M.; Qu, Qiuyu; Maraswami, Manikantha; Xiao, Yunyun; Loh, Teck Peng; Zhao, Yanli; Chen, Gang
2016-01-01
RNA duplex regions are often involved in tertiary interactions and protein binding and thus there is great potential in developing ligands that sequence-specifically bind to RNA duplexes. We have developed a convenient synthesis method for a modified peptide nucleic acid (PNA) monomer with a guanidine-modified 5-methyl cytosine base. We demonstrated by gel electrophoresis, fluorescence and thermal melting experiments that short PNAs incorporating the modified residue show high binding affinity and sequence specificity in the recognition of an RNA duplex containing an internal inverted Watson-Crick C-G base pair. Remarkably, the relatively short PNAs show no appreciable binding to DNA duplexes or single-stranded RNAs. The attached guanidine group stabilizes the base triple through hydrogen bonding with the G base in a C-G pair. Selective binding towards an RNA duplex over a single-stranded RNA can be rationalized by the fact that alkylation of the amine of a 5-methyl C base blocks the Watson–Crick edge. PNAs incorporating multiple guanidine-modified cytosine residues are able to enter HeLa cells without any transfection agent. PMID:27596599
Human telomeric DNA: G-quadruplex, i-motif and Watson–Crick double helix
Phan, Anh Tuân; Mergny, Jean-Louis
2002-01-01
Human telomeric DNA composed of (TTAGGG/CCCTAA)n repeats may form a classical Watson–Crick double helix. Each individual strand is also prone to quadruplex formation: the G-rich strand may adopt a G-quadruplex conformation involving G-quartets whereas the C-rich strand may fold into an i-motif based on intercalated C·C+ base pairs. Using an equimolar mixture of the telomeric oligonucleotides d[AGGG(TTAGGG)3] and d[(CCCTAA)3CCCT], we defined which structures existed and which would be the predominant species under a variety of experimental conditions. Under near-physiological conditions of pH, temperature and salt concentration, telomeric DNA was predominantly in a double-helix form. However, at lower pH values or higher temperatures, the G-quadruplex and/or the i-motif efficiently competed with the duplex. We also present kinetic and thermodynamic data for duplex association and for G-quadruplex/i-motif unfolding. PMID:12409451
Abiotic ligation of DNA oligomers templated by their liquid crystal ordering
NASA Astrophysics Data System (ADS)
Fraccia, Tommaso P.; Smith, Gregory P.; Zanchetta, Giuliano; Paraboschi, Elvezia; Yi, Yougwooo; Walba, David M.; Dieci, Giorgio; Clark, Noel A.; Bellini, Tommaso
2015-03-01
It has been observed that concentrated solutions of short DNA oligomers develop liquid crystal ordering as the result of a hierarchically structured supramolecular self-assembly. In mixtures of oligomers with various degree of complementarity, liquid crystal microdomains are formed via the selective aggregation of those oligomers that have a sufficient degree of duplexing and propensity for physical polymerization. Here we show that such domains act as fluid and permeable microreactors in which the order-stabilized molecular contacts between duplex terminals serve as physical templates for their chemical ligation. In the presence of abiotic condensing agents, liquid crystal ordering markedly enhances ligation efficacy, thereby enhancing its own phase stability. The coupling between order-templated ligation and selectivity provided by supramolecular ordering enables an autocatalytic cycle favouring the growth of DNA chains, up to biologically relevant lengths, from few-base long oligomers. This finding suggests a novel scenario for the abiotic origin of nucleic acids.
NASA Astrophysics Data System (ADS)
Babin, Volodymr; Baucom, Jason; Darden, Thomas; Sagui, Celeste
2006-03-01
We have investigated to what extend molecular dynamics (MD) simulatons can reproduce DNA sequence-specific features, given different electrostatic descriptions and different cell environments. For this purpose, we have carried out multiple unrestrained MD simulations of the duplex d(CCAACGTTGG)2. With respect to the electrostatic descriptions, two different force fields were studied: a traditional description based on atomic point charges and a polarizable force field. With respect to the cell environment, the difference between crystal and solution environments is emphasized, as well as the structural importance of divalent ions. By imposing the correct experimental unit cell environment, an initial configuration with two ideal B-DNA duplexes in the unit cell is shown to converge to the crystallographic structure. To the best of our knowledge, this provides the first example of a multiple nanosecond MD trajectory that shows and ideal structure converging to an experimental one, with a significant decay of the RMSD.
Yu, Yanyan; Chen, Zuanguang; Jian, Wensi; Sun, Duanping; Zhang, Beibei; Li, Xinchun; Yao, Meicun
2015-02-15
In this work, a simple and label-free electrochemical biosensor with duel amplification strategy was developed for DNA detection based on isothermal exponential amplification (EXPAR) coupled with hybridization chain reaction (HCR) of DNAzymes nanowires. Through rational design, neither the primer nor the DNAzymes containing molecular beacons (MBs) could react with the duplex probe which were fixed on the electrode surface. Once challenged with target, the duplex probe cleaved and triggered the EXPAR mediated target recycle and regeneration circles as well as the HCR process. As a result, a greater amount of targets were generated to cleave the duplex probes. Subsequently, the nanowires consisting of the G-quadruplex units were self-assembled through hybridization with the strand fixed on the electrode surface. In the presence of hemin, the resulting catalytic G-quadruplex-hemin HRP-mimicking DNAzymes were formed. Electrochemical signals can be obtained by measuring the increase in reduction current of oxidized 3.3',5.5'-tetramethylbenzidine sulfate (TMB), which was generated by DNAzyme in the presence of H2O2. This method exhibited ultrahigh sensitivity towards avian influenza A (H7N9) virus DNA sequence with detection limits of 9.4 fM and a detection range of 4 orders of magnitude. The biosensor was also capable of discriminating single-nucleotide difference among concomitant DNA sequences and performed well in spiked cell lysates. Copyright © 2014 Elsevier B.V. All rights reserved.
Muraiso, T; Nomoto, S; Yamazaki, H; Mishima, Y; Kominami, R
1992-01-01
A protein that binds to a synthetic oligonucleotide of (CCT)12 has been purified from Ehrlich ascites tumor cells by a (CCT)12 affinity chromatography. The protein (p70) has an apparent molecular mass of 70 kDa, as assayed by Southwestern analysis. A competition experiment revealed that p70 binds to (CCT)12, (CCCT)8 and (CCTCCCT)6, but not to (CTT)12, (CT)16 and (CCTGCCT)6, suggesting that p70 has a sequence-specificity. The complementary (AGG)12 and the double stranded DNA did not show the binding. It is also confirmed by S1 nuclease analysis that the (AGG:CCT)12 duplex takes a single-stranded conformation in the absence of the protein. This raises a possibility that the duplex forms two single-stranded loops in chromosomes, the C-rich strand being bound to p70. Structural analysis of the resulting (AGG)12 strand by non-denaturing polyacrylamide gel electrophoresis demonstrated the presence of slower and faster migrated conformers in a neutral pH buffer containing 50 mM NaCl at 5 degrees C. The ratio was dependent on the DNA concentration. Both conformers disappeared in the absence of NaCl. This suggests that (AGG)12 can form intra- and inter-molecular complexes by non-Watson-Crick, guanine:guanine base-pairing. The possible biological function of the (AGG:CCT)n duplex and the p70 is discussed. Images PMID:1480484
Base Pair Opening in a Deoxynucleotide Duplex Containing a cis-syn Thymine Cyclobutane Dimer Lesion
Wenke, Belinda B.; Huiting, Leah N.; Frankel, Elisa B.; Lane, Benjamin F.; Núñez, Megan E.
2014-01-01
The cis-syn thymine cyclobutane dimer is a DNA photoproduct implicated in skin cancer. We compared the stability of individual base pairs in thymine dimer-containing duplexes to undamaged parent 10-mer duplexes. UV melting thermodynamic measurements, CD spectroscopy, and 2D NOESY NMR spectroscopy confirm that the thymine dimer lesion is locally and moderately destabilizing within an overall B-form duplex conformation. We measured the rates of exchange of individual imino protons by NMR using magnetization transfer from water and determined the equilibrium constant for the opening of each base pair Kop. In the normal duplex Kop decreases from the frayed ends of the duplex toward the center, such that the central TA pair is the most stable with a Kop of 8×10−7. In contrast, base pair opening at the 5’T of the thymine dimer is facile. The 5’T of the dimer has the largest equilibrium constant (Kop =3×10−4) in its duplex, considerably larger than even the frayed penultimate base pairs. Notably, base pairing by the 3’T of the dimer is much more stable than by the 5’T, indicating that the predominant opening mechanism for the thymine dimer lesion is not likely to be flipping out into solution as a single unit. The dimer asymmetrically affects the stability of the duplex in its vicinity, destabilizing base pairing on its 5’ side more than on the 3’ side. The striking differences in base pair opening between parent and dimer duplexes occur independently of the duplex-single strand melting transitions. PMID:24328089
Svinarchuk, F; Monnot, M; Merle, A; Malvy, C; Fermandjian, S
1995-01-01
In our previous works we have shown that the oligonucleotides 5'-GGGGAGGGGGAGG-3' and 5'-GGAGGGGGAGGGG-3' give very stable and specific triplexes with their target double stranded DNAs [Svinarchuk, F., Bertrand, J.-R. and Malvy, C. (1994) Nucleic Acids Res., 22, 3742-3747; Svinarchuk, F., Paoletti, J. and Malvy, C. (1995) J. Biol. Chem., 270, 14 068-14,071]. The target for the invariable part of these oligonucleotides, 5'-GGAGGGGGAGG-3', is found in a highly conserved 20 bp long purine/pyrimidine tract of the vpx gene of the SIV and HIV-2 viruses and could be a target for oligonucleotide directed antivirus therapy. Here were report on the ability of four purine oligonucleotides with different lengths (11-, 14-, 17- and 20-mer) to form triplexes with the purine/pyrimidine stretch of the vpx gene. Triplex formation was tested by joint dimethyl sulfate (DMS) footprint, gel-retardation assay, circular dichroism (CD) and UV-melting studies. Dimethyl sulfate footprint studies revealed the antiparallel orientation of the third strand to the purine strand of the Watson-Crick duplex. However, the protection of the guanines at the ends of the target sequence decreased as the length of the third strand oligonucleotide increased. Melting temperature studies provided profiles with only one transition for all of the triplexes. The melting temperatures of the triplexes were found to be the same as for the targeted duplex in the case of the 11- and 14-mer third strands while for the 17- and 20-mer third strands the melting temperature of the triplexes were correspondingly 4 and 8 degrees C higher than for the duplex. Heating and cooling melting curves were reversible for all of the tested triplexes except one with the 20-mer third strand oligonucleotide. Circular dichroism spectra showed the ability of the target DNA to adopt an A-like DNA conformation. Upon triplex formation the A-DNA form becomes even more pronounced. This effect depends on the length of the third strand oligonucleotide: the CD spectrum shows a 'classical' A-DNA shape with the 20-mer. This is not observed with the purine/pyrimidine stretch of the HIV-1 DNA which keeps a B-like spectrum even after triplex formation. We suggest, that an A-like duplex DNA is required for the formation of a stable DNA purine(purine-pyrimidine) triplex. Images PMID:7479024
Kékedy-Nagy, László; Shipovskov, Stepan; Ferapontova, Elena E
2016-08-16
Charges of redox species can critically affect both the interfacial state of DNA and electrochemistry of DNA-conjugated redox labels and, as a result, the electroanalytical performance of those systems. Here, we show that the kinetics of electron transfer (ET) between the gold electrode and methylene blue (MB) label conjugated to a double-stranded (ds) DNA tethered to gold strongly depend on the charge of the MB molecule, and that affects the performance of genosensors exploiting MB-labeled hairpin DNA beacons. Positively charged MB binds to dsDNA via electrostatic and intercalative/groove binding, and this binding allows the DNA-mediated electrochemistry of MB intercalated into the duplex and, as a result, a complex mode of the electrochemical signal change upon hairpin hybridization to the target DNA, dominated by the "on-off" signal change mode at nanomolar levels of the analyzed DNA. When MB bears an additional carboxylic group, the negative charge provided by this group prevents intimate interactions between MB and DNA, and then the ET in duplexes is limited by the diffusion of the MB-conjugated dsDNA (the phenomenon first shown in Farjami , E. ; Clima , L. ; Gothelf , K. ; Ferapontova , E. E. Anal. Chem. 2011 , 83 , 1594 ) providing the robust "off-on" nanomolar DNA sensing. Those results can be extended to other intercalating redox probes and are of strategic importance for design and development of electrochemical hybridization sensors exploiting DNA nanoswitchable architectures.
DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae
Boiteux, Serge; Jinks-Robertson, Sue
2013-01-01
DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164
Dong, X. Y.; Li, W. H.; Zhu, J. L.; Liu, W. J.; Zhao, M. Q.; Luo, Y. W.; Chen, J. D.
2015-01-01
Canine distemper virus (CDV) is the cause of canine distemper (CD) which is a severe and highly contagious disease in dogs. In the present study, a duplex reverse transcription polymerase chain reaction (RT-PCR) method was developed for the detection and differentiation of wild-type and vaccine strains of CDV. Four primers were designed to detect and discriminate the two viruses by generating 638- and 781-bp cDNA products, respectively. Furthermore, the duplex RT-PCR method was used to detect 67 field samples suspected of CD from Guangdong province in China. Results showed that, 33 samples were to be wild-type-like. The duplex RT-PCR method exhibited high specificity and sensitivity which could be used to effectively detect and differentiate wild-type and vaccine CDV, indicating its use for clinical detection and epidemiological surveillance. PMID:27175171
Bi, Sai; Yue, Shuzhen; Wu, Qiang; Ye, Jiayan
2016-09-15
Here we program an initiator-catalyzed self-assembly of duplex-looped DNA hairpin motif based on strand displacement reaction. Due to the recycling of initiator and performance in a cascade manner, this system is versatilely extended to logic operations, including the construction of concatenated logic circuits with a feedback function and a biocomputing keypad-lock security system. Compared with previously reported molecular security systems, the prominent feature of our keypad lock is that it can be spontaneously reset and recycled with no need of any external stimulus and human intervention. Moreover, through integrating with an isothermal amplification technique of rolling circle amplification (RCA), this programming catalytic DNA self-assembly strategy readily achieves sensitive and selective biosensing of initiator. Importantly, a magnetic graphene oxide (MGO) is introduced to remarkably reduced background, which plays an important role in enhancing the signal-to-noise ratio and improving the detection sensitivity. Therefore, the proposed sophisticated DNA strand displacement-based methodology with engineering dynamic functions may find broad applications in the construction of programming DNA nanostructures, amplification biosensing platform, and large-scale DNA circuits. Copyright © 2016 Elsevier B.V. All rights reserved.
Why double-stranded RNA resists condensation
Tolokh, Igor S.; Pabit, Suzette A.; Katz, Andrea M.; Chen, Yujie; Drozdetski, Aleksander; Baker, Nathan; Pollack, Lois; Onufriev, Alexey V.
2014-01-01
The addition of small amounts of multivalent cations to solutions containing double-stranded DNA leads to inter-DNA attraction and eventual condensation. Surprisingly, the condensation is suppressed in double-stranded RNA, which carries the same negative charge as DNA, but assumes a different double helical form. Here, we combine experiment and atomistic simulations to propose a mechanism that explains the variations in condensation of short (25 base-pairs) nucleic acid (NA) duplexes, from B-like form of homopolymeric DNA, to mixed sequence DNA, to DNA:RNA hybrid, to A-like RNA. Circular dichroism measurements suggest that duplex helical geometry is not the fundamental property that ultimately determines the observed differences in condensation. Instead, these differences are governed by the spatial variation of cobalt hexammine (CoHex) binding to NA. There are two major NA-CoHex binding modes—internal and external—distinguished by the proximity of bound CoHex to the helical axis. We find a significant difference, up to 5-fold, in the fraction of ions bound to the external surfaces of the different NA constructs studied. NA condensation propensity is determined by the fraction of CoHex ions in the external binding mode. PMID:25123663
Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen
2011-01-01
With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996
Yu, Luxin; Wu, Wei; Chen, Junhua; Xiao, Zhuo; Ge, Chenchen; Lie, Puchang; Fang, Zhiyuan; Chen, Lingbo; Zhang, Ya; Zeng, Lingwen
2013-12-07
We demonstrated a new spectrophotometric DNA detection approach based on a circular strand-displacement polymerization reaction for the quantitative detection of sequence specific DNA. In this assay, the hybridization of an immobilized hairpin probe on the microtiter plate, to target DNA, results in a conformational change and leads to a stem separation. A short primer thus anneals with the open stem and triggers a polymerization reaction, allowing a cyclic reaction comprising the release of target DNA and hybridization of the target with the remaining immobilized hairpin probe. Through this cyclical process, a large number of duplex DNA complexes are produced. Finally, the biotin modified duplex DNA products can be detected via the HRP catalyzed substrate 3,3',5,5'-tetramethylbenzidine using a spectrophotometer. As a proof of concept, a short DNA sequence (20-nt) related to the South East Asia (SEA) type deletion of α-thalassemia was chosen as the model target. This proposed assay has a very high sensitivity and selectivity with a dynamic response ranging from 0.1 fM to 10 nM and the detection limit was 8 aM. It can be performed within 2 hours, and it can differentiate target SEA DNA from wild-type DNA. By substituting the hairpin probes used in the present work, this assay can be used to detect other subtypes of genetic disorders.
Hellman, Lance M.; Spear, Tyler J.; Koontz, Colton J.; Melikishvili, Manana; Fried, Michael G.
2014-01-01
O6-alkylguanine-DNA alkyltransferase (AGT) is a single-cycle DNA repair enzyme that removes pro-mutagenic O6-alkylguanine adducts from DNA. Its functions with short single-stranded and duplex substrates have been characterized, but its ability to act on other DNA structures remains poorly understood. Here, we examine the functions of this enzyme on O6-methylguanine (6mG) adducts in the four-stranded structure of the human telomeric G-quadruplex. On a folded 22-nt G-quadruplex substrate, binding saturated at 2 AGT:DNA, significantly less than the ∼5 AGT:DNA found with linear single-stranded DNAs of similar length, and less than the value found with the telomere sequence under conditions that inhibit quadruplex formation (4 AGT:DNA). Despite these differences, AGT repaired 6mG adducts located within folded G-quadruplexes, at rates that were comparable to those found for a duplex DNA substrate under analogous conditions. Repair was kinetically biphasic with the amplitudes of rapid and slow phases dependent on the position of the adduct within the G-quadruplex: in general, adducts located in the top or bottom tetrads of a quadruplex stack exhibited more rapid-phase repair than did adducts located in the inner tetrad. This distinction may reflect differences in the conformational dynamics of 6mG residues in G-quadruplex DNAs. PMID:25080506
Biswas, N; Weller, S K
2001-05-18
Herpes simplex virus type 1 encodes a heterotrimeric helicase-primase complex composed of the products of the UL5, UL52, and UL8 genes. The UL5 protein contains seven motifs found in all members of helicase Superfamily 1 (SF1), and the UL52 protein contains several conserved motifs found in primases; however, the contributions of each subunit to the biochemical activities of the subcomplex are not clear. In this work, the DNA binding properties of wild type and mutant subcomplexes were examined using single-stranded, duplex, and forked substrates. A gel mobility shift assay indicated that the UL5-UL52 subcomplex binds more efficiently to the forked substrate than to either single strand or duplex DNA. Although nucleotides are not absolutely required for DNA binding, ADP stimulated the binding of UL5-UL52 to single strand DNA whereas ATP, ADP, and adenosine 5'-O-(thiotriphosphate) stimulated the binding to a forked substrate. We have previously shown that both subunits contact single-stranded DNA in a photocross-linking assay (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076). In this study, photocross-linking assays with forked substrates indicate that the UL5 and UL52 subunits contact the forked substrates at different positions, UL52 at the single-stranded DNA tail and UL5 near the junction between single-stranded and double-stranded DNA. Neither subunit was able to cross-link a forked substrate when 5-iododeoxyuridine was located within the duplex portion. Photocross-linking experiments with subcomplexes containing mutant versions of UL5 and wild type UL52 indicated that the integrity of the ATP binding region is important for DNA binding of both subunits. These results support our previous proposal that UL5 and UL52 exhibit a complex interdependence for DNA binding (Biswas, N., and Weller, S. K. (1999) J. Biol. Chem. 274, 8068-8076) and indicate that the UL52 subunit may play a more active role in helicase activity than had previously been thought.
NASA Astrophysics Data System (ADS)
Torigoe, Chikako; Nishimura, Yoshifumi; Tsuboi, Masamichi; Matsuzaki, Jun-ichi; Hotoda, Hitoshi; Sekine, Mitsuo; Hata, Tsujiaki
Raman spectra of four self-complementary tetradeoxyribonucleoside triphosphates containing only guanosine and cytidine residues have been examined in aqueous solutions of different ionic strengths and at different temperatures. Both in low salt (0.15 M NaCl) and in high salt (4 M NaCl) solutions (at -2°C) all of the four duplexes have different conformations, distinguishable by Raman spectroscopy from one another. Thus, the duplex conformation is sequence-dependent. On the basis of several rules proposed recently for structure—spectrum correlations, new information was provided on the local conformations of the duplexes of these oligo-DNAs. In the low-salt solution, d(CCGG) 2 is B-DNA like in its overall conformation, but in detail the backbone conformation of the CpC portion is considered to be different from that in the GpG portion. In either one of these two portions, the torsion angle (β) around the O5'C5' bond must be somewhat higher than the usual values for B-DNA (150-170°), so that it causes a 815 cm -1 Raman line instead of the usual B marker 830 cm -1 line. This may be related to the peculiar circular dichroism spectrum of d(CCGG) 2. On going to the high-salt solution, about 5% of the d(CCGG) 2 molecules are converted into the A form. In the high-salt form (Z form) of d(CGCG) 2, the terminal guanosine was concluded to be in a C2' endo-syn conformation, whereas the internal one is in C3' endo-syn.
Programmed self-assembly of DNA/RNA for biomedical applications
NASA Astrophysics Data System (ADS)
Wang, Pengfei
Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.
Characterization of biochemical properties of Bacillus subtilis RecQ helicase.
Qin, Wei; Liu, Na-Nv; Wang, Lijun; Zhou, Min; Ren, Hua; Bugnard, Elisabeth; Liu, Jie-Lin; Zhang, Lin-Hu; Vendôme, Jeremie; Hu, Jin-Shan; Xi, Xu Guang
2014-12-01
RecQ family helicases function as safeguards of the genome. Unlike Escherichia coli, the Gram-positive Bacillus subtilis bacterium possesses two RecQ-like homologues, RecQ[Bs] and RecS, which are required for the repair of DNA double-strand breaks. RecQ[Bs] also binds to the forked DNA to ensure a smooth progression of the cell cycle. Here we present the first biochemical analysis of recombinant RecQ[Bs]. RecQ[Bs] binds weakly to single-stranded DNA (ssDNA) and blunt-ended double-stranded DNA (dsDNA) but strongly to forked dsDNA. The protein exhibits a DNA-stimulated ATPase activity and ATP- and Mg(2+)-dependent DNA helicase activity with a 3' → 5' polarity. Molecular modeling shows that RecQ[Bs] shares high sequence and structure similarity with E. coli RecQ. Surprisingly, RecQ[Bs] resembles the truncated Saccharomyces cerevisiae Sgs1 and human RecQ helicases more than RecQ[Ec] with regard to its enzymatic activities. Specifically, RecQ[Bs] unwinds forked dsDNA and DNA duplexes with a 3'-overhang but is inactive on blunt-ended dsDNA and 5'-overhung duplexes. Interestingly, RecQ[Bs] unwinds blunt-ended DNA with structural features, including nicks, gaps, 5'-flaps, Kappa joints, synthetic replication forks, and Holliday junctions. We discuss these findings in the context of RecQ[Bs]'s possible functions in preserving genomic stability. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Kupriushkin, M S; Pyshnyĭ, D V
2012-01-01
Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.
Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.
Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R
2017-11-01
DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.
Chen, Jia; Huang, Yong; Vdovenko, Marina; Sakharov, Ivan Yu; Su, Guifa; Zhao, Shulin
2015-06-01
An enhanced chemiluminescence resonance energy transfer (CRET) system based on target recycling G-guadruplexes/hemin DNAzyme catalysis was developed for ultrasensitive detection of DNA. CRET system consists of luminol as chemiluminescent donor, and fluorescein isothiocyanate (FITC) as acceptor. The sensitive detection was achieved by using the system consisted of G-riched DNA, blocker DNA, and the Nb.BbvCI biocatalyst. Upon addition of target DNA to the system, target DNA hybridizes with the quasi-circular DNA structure, and forms a DNA duplex. The formation of DNA duplex triggers selective enzymatic cleavage of quasi-circular DNA by Nb.BbvCI, resulting in the release of target DNA and two G-riched DNAzyme segments. Released target DNA then hybridizes with another quasi-circular DNA structure to initiate the cleavage of the quasi-circular DNA structure. Eventually, each target DNA can go through many cycles, resulting in the digestion of many quasi-circular DNA structures, generating many G-riched DNAzyme segments. G-riched DNAzyme segment products assemble with hemin to form stable hemin/G-quadruplexes that exhibit peroxidase-like activity which can catalyze the oxidation of luminol by H2O2 to produce CL signals. In the presence of FITC, CL of luminol can excite FITC molecules, and thus produced CRET between the luminol and FITC. This unique analysis strategy gives a detection limit down to 80 fM, which is at least four orders of magnitude lower than that of unamplified DNA detection methods. Copyright © 2015 Elsevier B.V. All rights reserved.
Palle-Reisch, Monika; Cichna-Markl, Margit; Hochegger, Rupert
2014-06-15
The paper presents a duplex real-time PCR assay for the simultaneous detection of three potentially allergenic mustard species commonly used in food: white mustard (Sinapis alba), black mustard (Brassica nigra) and brown mustard (Brassica juncea). White mustard is detected in the "green" and black/brown mustard in the "yellow" channel. The duplex real-time PCR assay does not show cross-reactivity with other Brassicaceae species including broccoli, cauliflower, radish and rapeseed. Low cross-reactivities (difference in the Ct value ⩾ 11.91 compared with the positive control) were obtained with cumin, fenugreek, ginger, rye and turmeric. When applying 500 ng DNA per PCR tube, the duplex real-time PCR assay allowed the detection of white, black and brown mustard in brewed model sausages down to a concentration of 5mg/kg in 10 out of 10 replicates. The duplex real-time PCR assay was applied to verify correct labelling of commercial foodstuffs. Copyright © 2013 Elsevier Ltd. All rights reserved.
Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.
Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W
2011-02-09
Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.
Basic quantitative polymerase chain reaction using real-time fluorescence measurements.
Ares, Manuel
2014-10-01
This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.
He, Hong-qiu; Ma, Xiao-hui; Liu, Bin; Chen, Wei-zu; Wang, Cun-xin; Cheng, Shao-hui
2008-03-01
To develop a novel high-throughput format assay to monitor the integrase (IN) strand transfer (ST) reaction in vitro and apply it to a reaction character study and the identification of antiviral drugs. The donor DNA duplex, with a sequence identical to the U5 end of HIV-1 long terminal repeats, is labeled at its 5' end with biotin (BIO). The target DNA duplex is labeled at its 3' end with digoxin (DIG). IN mediates the integration of donor DNA into target DNA and results in a 5' BIO and 3' DIG-labeled duplex DNA product. Streptavidin-coated magnetic beads were used to capture the product, and the amount of DIG was measured as the ST reaction product. The assay was optimized in 96-well microplate format for high-throughput screening purpose. Moreover, the assay was applied in a ST reaction character study, and the efficiency of the assay in the identification of antiviral compounds was tested. The end-point values, measured as absorbance at 405 nm was approximately 1.5 for the IN-mediated ST reaction as compared with no more than 0.05 of background readings. The ST reaction character and the half maximal inhibitory concentration (IC50) values of 2 known IN inhibitors obtained in our assay were similar to previously reported results using other assays. The evaluation parameter Z' factor for this assay ranged from 0.6 to 0.9. The assay presented here has been proven to be rapid, sensitive, and specific for the detection of IN ST activity, the reaction character study, as well as for the identification of antiviral drugs targeting IN.
Domain Requirements for DNA Unwinding by Mycobacterial UvrD2, an Essential DNA Helicase†
Sinha, Krishna Murari; Stephanou, Nicolas C.; Unciuleac, Mihaela-Carmen; Glickman, Michael S.; Shuman, Stewart
2008-01-01
Mycobacterial UvrD2 is a DNA-dependent ATPase with 3′ to 5′ helicase activity. UvrD2 is an atypical helicase, insofar as its N-terminal ATPase domain resembles the superfamily I helicases UvrD/PcrA, yet it has a C-terminal HRDC domain, which is a feature of RecQ-type superfamily II helicases. The ATPase and HRDC domains are connected by a CxxC-(14)-CxxC tetracysteine module that defines a new clade of UvrD2-like bacterial helicases found only in Actinomycetales. By characterizing truncated versions of Mycobacterium smegmatis UvrD2, we show that whereas the HRDC domain is not required for ATPase or helicase activities in vitro, deletion of the tetracysteine module abolishes duplex unwinding while preserving ATP hydrolysis. Replacing each of the CxxC motifs with a double-alanine variant AxxA had no effect on duplex unwinding, signifying that the domain module, not the cysteines, is crucial for function. The helicase activity of a truncated UvrD2 lacking the tetracysteine and HRDC domains was restored by the DNA-binding protein Ku, a component of the mycobacterial NHEJ system and a cofactor for DNA unwinding by the paralogous mycobacterial helicase UvrD1. Our findings indicate that coupling of ATP hydrolysis to duplex unwinding can be achieved by protein domains acting in cis or trans. Attempts to disrupt the M. smegmatis uvrD2 gene were unsuccessful unless a second copy of uvrD2 was present elsewhere in the chromosome, indicating that UvrD2 is essential for growth of M. smegmatis. PMID:18702526
New Approaches Towards Recognition of Nucleic Acid Triple Helices
Arya, Dev P.
2012-01-01
We show that groove recognition of nucleic acid triple helices can be achieved with aminosugars. Among these aminosugars, neomycin is the most effective aminoglycoside (groove binder) for stabilizing a DNA triple helix. It stabilizes both the T·A·T triplex and mixed-base DNA triplexes better than known DNA minor groove binders (which usually destabilize the triplex) and polyamines. Neomycin selectively stabilizes the triplex (T·A·T and mixed base) without any effect on the DNA duplex. The selectivity of neomycin likely originates from its potential and shape complementarity to the triplex Watson–Hoogsteen groove, making it the first molecule that selectively recognizes a triplex groove over a duplex groove. The groove recognition of aminoglycosides is not limited to DNA triplexes, but also extends to RNA and hybrid triple helical structures. Intercalator–neomycin conjugates are shown to simultaneously probe the base stacking and groove surface in the DNA triplex. Calorimetric and spectrosocopic studies allow the quantification of the effect of surface area of the intercalating moiety on binding to the triplex. These studies outline a novel approach to the recognition of DNA triplexes that incorporates the use of non-competing binding sites. These principles of dual recognition should be applicable to the design of ligands that can bind any given nucleic acid target with nanomolar affinities and with high selectivity. PMID:21073199
DNA interactions of antitumor cisplatin analogs containing enantiomeric amine ligands.
Malina, J; Hofr, C; Maresca, L; Natile, G; Brabec, V
2000-01-01
Modifications of natural DNA and synthetic oligodeoxyribonucleotide duplexes in a cell-free medium by analogs of antitumor cisplatin containing enantiomeric amine ligands, such as cis-[PtCl(2)(RR-DAB)] and cis-[PtCl(2)(SS-DAB)] (DAB = 2,3-diaminobutane), were studied by various methods of molecular biophysics and biophysical chemistry. These methods include DNA binding studies by pulse polarography and atomic absorption spectrophotometry, mapping of DNA adducts using transcription assay, interstrand cross-linking assay using gel electrophoresis under denaturing conditions, differential scanning calorimetry, chemical probing, and bending and unwinding studies of the duplexes containing single, site-specific cross-link. The major differences resulting from the modification of DNA by the two enantiomers are the thermodynamical destabilization and conformational distortions induced in DNA by the 1,2-d(GpG) intrastrand cross-link. It has been suggested that these differences are associated with a different biological activity of the two enantiomers observed previously. In addition, the results of the present work are also consistent with the view that formation of hydrogen bonds between the carbonyl oxygen of the guanine residues and the "quasi equatorial" hydrogen of the cis amine in the 1, 2-d(GpG) intrastrand cross-link plays an important role in determining the character of the distortion induced in DNA by this lesion. PMID:10733979
von Wurmb-Schwark, Nicole; Mályusz, Victoria; Fremdt, Heike; Koch, Christine; Simeoni, Eva; Schwark, Thorsten
2006-05-01
The forensic scientist often has to cope with problematic samples from the crime scene due to their minute size and thus the low amount of extractable DNA. The retrieval of DNA from swabs taken from the surface of the skin, for example, in cases of strangulation, can be especially difficult. We systematically investigated swabs taken from the skin (to obtain a genetic profile from the victim and also from a possible offender) and from sperm cell containing swabs using two extraction kits: the Invisorb forensic and the Invisorb spin swab kit (both Invitek, Germany). DNA quality and quantity were tested on ethidium bromide containing agarose gels and in a highly sensitive duplex-PCR, which amplifies fragments specific for mitochondrial and nuclear DNA. Absolute quantification was done using real time PCR. Samples, which were positive in the duplex-PCR, were also employed to genetic fingerprinting using the Powerplex ES and the AmpFlSTRIdentifiler(TM) kits. Our study shows that the easy-to-use Invisorb spin swab kit is very suitable for DNA isolation from swabs taken from the skin and also from sperm cells. Retrieval of cells from the skin with swabs moistened in extraction buffer, not in distilled water, led to a significant higher DNA yield.
Meng, Zhenyu; Kubar, Tomas; Mu, Yuguang; Shao, Fangwei
2018-05-08
Charge transport (CT) through biomolecules is of high significance in the research fields of biology, nanotechnology, and molecular devices. Inspired by our previous work that showed the binding of ionic liquid (IL) facilitated charge transport in duplex DNA, in silico simulation is a useful means to understand the microscopic mechanism of the facilitation phenomenon. Here molecular dynamics simulations (MD) of duplex DNA in water and hydrated ionic liquids were employed to explore the helical parameters. Principal component analysis was further applied to capture the subtle conformational changes of helical DNA upon different environmental impacts. Sequentially, CT rates were calculated by a QM/MM simulation of the flickering resonance model based upon MD trajectories. Herein, MD simulation illustrated that the binding of ionic liquids can restrain dynamic conformation and lower the on-site energy of the DNA base. Confined movement among the adjacent base pairs was highly related to the increase of electronic coupling among base pairs, which may lead DNA to a CT facilitated state. Sequentially combining MD and QM/MM analysis, the rational correlations among the binding modes, the conformational changes, and CT rates illustrated the facilitation effects from hydrated IL on DNA CT and supported a conformational-gating mechanism.
Atomic-scale imaging of DNA using scanning tunnelling microscopy.
Driscoll, R J; Youngquist, M G; Baldeschwieler, J D
1990-07-19
The scanning tunnelling microscope (STM) has been used to visualize DNA under water, under oil and in air. Images of single-stranded DNA have shown that submolecular resolution is possible. Here we describe atomic-resolution imaging of duplex DNA. Topographic STM images of uncoated duplex DNA on a graphite substrate obtained in ultra-high vacuum are presented that show double-helical structure, base pairs, and atomic-scale substructure. Experimental STM profiles show excellent correlation with atomic contours of the van der Waals surface of A-form DNA derived from X-ray crystallography. A comparison of variations in the barrier to quantum mechanical tunnelling (barrier-height) with atomic-scale topography shows correlation over the phosphate-sugar backbone but anticorrelation over the base pairs. This relationship may be due to the different chemical characteristics of parts of the molecule. Further investigation of this phenomenon should lead to a better understanding of the physics of imaging adsorbates with the STM and may prove useful in sequencing DNA. The improved resolution compared with previously published STM images of DNA may be attributable to ultra-high vacuum, high data-pixel density, slow scan rate, a fortuitously clean and sharp tip and/or a relatively dilute and extremely clean sample solution. This work demonstrates the potential of the STM for characterization of large biomolecular structures, but additional development will be required to make such high resolution imaging of DNA and other large molecules routine.
Atomic Simulation of Complex DNA DSBs and the Interactions with the Ku70/80 Heterodimer
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2011-01-01
DNA double strand breaks (DSBs) induced by ionizing radiation (IR) usually contain modified bases such as 8-oxo-7,8-dihydroguanine (8-oxoG) and thymine glycol, apurinic/apyrimidinic (AP) sites, 2-deoxyribonolactone, or single-strand breaks (SSBs). The presence of such lesions in close proximity to the DSB terminus makes the DNA nicks more difficult to repair and rejoin than endogenously induced simple DSBs, and as such a major determinant of the biological effects of high linear energy transfer (LET) radiation as encountered in space travel. In this study we conducted molecular dynamics simulations on a series of DNA duplexes with various complex lesions of 8-oxoG and AP sites, in an effort to investigate the effects of such lesions to the structural integrity and stability of DNA after insulted by IR. We also simulated the interaction of such complex DSBs with the Ku70/80 heterodimer, the first protein in mammalian cells to embark the non-homologous end joining (NHEJ) DNA repair pathway. The results indicate, compared to DNA with simple DSBs, the complex lesions can enhance the hydrogen bonds opening rate at the DNA terminus, and increase the mobility of the whole duplex, thus they present more deleterious effects to the genome integrity if not captured and repaired promptly in cells. Simulations also demonstrate the binding of Ku drastically reduces structural disruption and flexibility caused by the complex lesions, and the interactions of Ku with complex DSBs have a different potential energy landscape from the bound structure with simple DSB. In all complex DSBs systems, the binding of DSB terminus with Ku70 is softened while the binding of the middle duplex with Ku80 is tightened. This energy shift may help the Ku protein to secure at the DSB terminus for a longer time, so that other end processing factors or repair pathways can proceed at the lesions before NHEJ repair process starts. These atomic simulations may provide valuable new insight into the selective action of repair proteins on damaged DNA.
Crenshaw, Charisse M.; Wade, Jacqueline E.; Arthanari, Haribabu; Frueh, Dominique; Lane, Benjamin F.; Núñez, Megan E.
2011-01-01
The base lesion 8-oxoguanine is formed readily by oxidation of DNA, potentially leading to G→T transversion mutations. Despite the apparent similarity of 8-oxoguanine-cytosine base pairs to normal guanine-cytosine base pairs, cellular base excision repair systems effectively recognize the lesion base. Here we apply several techniques to examine a single 8-oxoguanine lesion at the center of a nonpalindromic 15-mer duplex oligonucleotide in an effort to determine what, if anything, distinguishes an 8-oxoguanine-cytosine base pair from a normal base pair. The lesion duplex is globally almost indistinguishable from the unmodified parent duplex using CD spectroscopy and UV melting thermodynamics. The DNA mismatch-detecting photocleavage agent Rh(bpy)2chrysi3+ cleaves only weakly and nonspecifically, revealing that the 8oxoG-C pair is locally stable at the level of the individual base pairs. NMR spectra are also consistent with a well-conserved B-form duplex structure. In the 2D NOESY spectra, base-sugar and imino-imino crosspeaks are strikingly similar between parent and lesion duplexes. Changes in chemical shift due to the 8oxoG lesion are localized to its complementary cytosine and to the 2–3 base pairs immediately flanking the lesion on the lesion strand. Residues further removed from the lesion are shown to be unperturbed by its presence. Notably, imino exchange experiments indicate that the 8-oxoguanine-cytosine pair is strong and stable, with an apparent equilibrium constant for opening equal to that of other internal guanine-cytosine base pairs, on the order of 10−6. This collection of experiments shows that the 8-oxoguanine-cytosine base pair is incredibly stable and similar to the native pair. PMID:21902242
Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping; Wei, Hongping
2017-10-01
Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers ( nuc and mecA ) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli , MSSA, and other mecA -positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. Copyright © 2017 American Society for Microbiology.
Luo, Jun; Li, Junhua; Yang, Hang; Yu, Junping
2017-01-01
ABSTRACT Accurate and rapid identification of methicillin-resistant Staphylococcus aureus (MRSA) is needed to screen MRSA carriers and improve treatment. The current widely used duplex PCR methods are not able to differentiate MRSA from coexisting methicillin-susceptible S. aureus (MSSA) or other methicillin-resistant staphylococci. In this study, we aimed to develop a direct method for accurate and rapid detection of MRSA in clinical samples from open environments, such as nasal swabs. The new molecular assay is based on detecting the cooccurrence of nuc and mecA markers in a single bacterial cell by utilizing droplet digital PCR (ddPCR) with the chimeric lysin ClyH for cell lysis. The method consists of (i) dispersion of an intact single bacterium into nanoliter droplets, (ii) temperature-controlled release of genomic DNA (gDNA) by ClyH at 37°C, and (iii) amplification and detection of the markers (nuc and mecA) using standard TaqMan chemistries with ddPCR. Results were analyzed based on MRSA index ratios used for indicating the presence of the duplex-positive markers in droplets. The method was able to achieve an absolute limit of detection (LOD) of 2,900 CFU/ml for MRSA in nasal swabs spiked with excess amounts of Escherichia coli, MSSA, and other mecA-positive bacteria within 4 h. Initial testing of 104 nasal swabs showed that the method had 100% agreement with the standard culture method, while the normal duplex qPCR method had only about 87.5% agreement. The single-bacterium duplex ddPCR assay is rapid and powerful for more accurate detection of MRSA directly from clinical specimens. PMID:28724560
Topologically non-linked circular duplex DNA.
Biegeleisen, Ken
2002-05-01
The discovery of circular DNA, over 30 years ago, introduced an element of uneasiness in what had been, up to that point, the almost picture-perfect story of the elucidation of the molecular biology of heredity. If DNA indeed has the Watson-Crick right-handed helical secondary structure, then in circular DNA, thousands, or perhaps even millions of twists must be removed in each generation, and re-wound in the next generation. Although enzyme systems adequate for this task have long since been found and characterized, there have nevertheless arisen a number of proposals for alternative DNA structures in which the strands are topologically non-linked, so that they might separate during replication without having to be unwound. These structures have generally been put forth as theory only, and have been largely unaccompanied by experimental evidence to support their applicability to native DNA from living systems. Recently, however, a report has emerged suggesting that it might be possible to separate, intact, the individual single-stranded circular half-chromosomes which constitute the double-stranded circular chromosomes of certain plasmids. This would not be possible unless the chromosomes had one of the alternative, topologically non-linked structures. It is widely believed that after a half-century of worldwide DNA research, any significant change to the Watson-Crick structure is unlikely to stand up to scrutiny. Nevertheless, the present author has found that in many instances in which the behavior of circular duplex DNA is considered to be explicable only in terms of the topologically linked helical model, it is also possible to explain that same behavior in terms of a topologically non-linked model. It is necessary, in these instances, to make certain logical assumptions which cannot be conclusively proven at the present time. The author herein offers an example of one such instance, namely an examination of the behavior of circular duplex DNA in an alkaline titration experiment, where conformational changes in DNA are deduced from changes in its buoyant density at pH's between 7 and 14. These data have been explained in terms of topological linkage between the DNA strands, but they can also be explained without invoking any such topological linkage, provided that the above-mentioned logical assumptions can be accepted. The principles which emerge from this are applicable to other settings in which knowledge of the topology of DNA is critical to the understanding of observed phenomena.
DNA triplex structure, thermodynamics, and destabilisation: insight from molecular simulations.
Boehm, Belinda J; Whidborne, Charles; Button, Alexander L; Pukala, Tara L; Huang, David M
2018-05-23
Molecular dynamics simulations are used to elucidate the structure and thermodynamics of DNA triplexes associated with the neurodegenerative disease Friedreich's ataxia (FRDA), as well as complexes of these triplexes with the small molecule netropsin, which is known to destabilise triplexes. The ability of molecular simulations in explicit solvent to accurately capture triplex thermodynamics is verified for the first time, with the free energy to dissociate a 15-base antiparallel purine triplex-forming oligomer (TFO) from the duplex found to be slightly higher than reported experimentally. The presence of netropsin in the minor groove destabilises the triplex as expected, reducing the dissociation free energy by approximately 50%. Netropsin binding is associated with localised narrowing of the minor groove near netropsin, an effect that has previously been under contention. This leads to localised widening of the major groove, weakening hydrogen bonds between the TFO and duplex. Consequently, destabilisation is found to be highly localised, occurring only when netropsin is bound directly opposite the TFO. The simulations also suggest that near saturation of the minor groove with ligand is required for complete triplex dissociation. A structural analysis of the DNA triplexes that can form with the FRDA-related duplex sequence indicates that the triplex with a parallel homopyrimidine TFO is likely to be more stable than the antiparallel homopurine-TFO triplex, which may have implications for disease onset and treatment.
Label-free liquid crystal biosensor based on specific oligonucleotide probes for heavy metal ions.
Yang, Shengyuan; Wu, Chao; Tan, Hui; Wu, Yan; Liao, Shuzhen; Wu, Zhaoyang; Shen, Guoli; Yu, Ruqin
2013-01-02
In this study, to enhance the capability of metal ions disturbing the orientation of liquid crystals (LCs), we designed a new label-free LC biosensor for the highly selective and sensitive detection of heavy metal ions. This strategy makes use of the target-induced DNA conformational change to enhance the disruption of target molecules for the orientation of LC leading to an amplified optical signal. The Hg(2+) ion, which possesses a unique property to bind specifically to two DNA thymine (T) bases, is used as a model heavy metal ion. In the presence of Hg(2+), the specific oligonucleotide probes form a conformational reorganization of the oligonucleotide probes from hairpin structure to duplex-like complexes. The duplex-like complexes are then bound on the triethoxysilylbutyraldehyde/N,N-dimethyl-N-octadecyl (3-aminopropyl) trimethoxysilyl chloride (TEA/DMOAP)-coated substrate modified with capture probes, which can greatly distort the orientational profile of LC, making the optical image of LC cell birefringent as a result. The optical signal of LC sensor has a visible change at the Hg(2+) concentration of low to 0.1 nM, showing good detection sensitivity. The cost-effective LC sensing method can translate the concentration signal of heavy metal ions in solution into the presence of DNA duplexes and is expected to be a sensitive detection platform for heavy metal ions and other small molecule monitors.
Harris, J R; Scheffler, D; Gebauer, W; Lehnert, R; Markl, J
2000-12-01
The multimeric/higher oligomeric states of the two isoforms of Haliotis tuberculata hemocyanin (HtH1 and HtH2) have been assessed by transmission electron microscopy (TEM) of negatively stained specimens, for comparison with previously published structural data from keyhole limpet hemocyanin (KLH1 and KLH2) [see Harris, J.R., Gebauer, W., Guderian, F.U., Markl, J., 1997a. Keyhole limpet hemocyanin (KLH), I: Reassociation from Immucothel followed by separation of KLH1 and KLH2. Micron, 28, 31-41; Harris, J.R., Gebauer, W., Söhngen, S.M., Nermut, M.V., Markl, J., 1997b. Keyhole limpet hemocyanin (KLH). II: Characteristic reassociation properties of purified KLH1 and KLH2. Micron, 28, 43-56; Harris, J.R., Gebauer, W., Adrian, M., Markl, J., 1998. Keyhole limpet hemocyanin (KLH): Slow in vitro reassociation of KLH1 and KLH2 from Immucothel. Micron, 29, 329-339]. In purified samples of both HtH isoforms, the hollow cylindrical ca 8MDa didecamer predominates together with a small number of decamers, but tri- and longer multidecamers are detectable only in the HtH2. The stability of the two HtH isoforms under varying ionic conditions have been monitored, thereby enabling conditions for the production of stable decamers to be established. The ability of these decamers to reform multimers in the presence of 10 and 100mM concentrations of calcium and magnesium ions in Tris-HCl buffer (pH 7.4), and also of individual HtH1 and HtH2 subunits (produced by pH 9.6 dissociation in glycine-NaOH buffer), to reassociate in the presence of calcium and magnesium ions, has been assessed. For the HtH1 decamers, the predominant multimeric product is the didecamer at 10 and 100mM calcium and magnesium concentrations, whereas for the HtH2 decamers, large numbers of multidecamers are produced, with the reaction proceeding more completely at the higher calcium and magnesium concentration. With the HtH1 subunit, reassociation in the presence of 10 and 100mM calcium and magnesium ions yielded an almost 100% conversion into didecamers, whereas the HtH2 subunit produced a mixture containing large numbers of short multidecamers and relatively few didecamers, together with a considerable number of smaller diameter helical/tubular polymers. The association properties of the HtH1 and HtH2 decamers, and the subunit reassociation, firmly indicate the integrity and structural competency of the protein under the experimental conditions used. Data on the association of KLH2 decamers is also presented, which together with previously published data on the association KLH1 decamers and the reassociation of KLH1 and KLH2 subunits, enables a detailed comparison of the two hemocyanin isoforms from both molluscan species to be made. Biochemical manipulation of the oligomer states and the subunit reassociation of molluscan hemocyanins can usefully be assessed by the study of negatively stained TEM specimens.
Pervushin, Konstantin; Ono, Akira; Fernández, César; Szyperski, Thomas; Kainosho, Masatsune; Wüthrich, Kurt
1998-01-01
This paper describes the NMR observation of 15N—15N and 1H—15N scalar couplings across the hydrogen bonds in Watson–Crick base pairs in a DNA duplex, hJNN and hJHN. These couplings represent new parameters of interest for both structural studies of DNA and theoretical investigations into the nature of the hydrogen bonds. Two dimensional [15N,1H]-transverse relaxation-optimized spectroscopy (TROSY) with a 15N-labeled 14-mer DNA duplex was used to measure hJNN, which is in the range 6–7 Hz, and the two-dimensional hJNN-correlation-[15N,1H]-TROSY experiment was used to correlate the chemical shifts of pairs of hydrogen bond-related 15N spins and to observe, for the first time, hJHN scalar couplings, with values in the range 2–3.6 Hz. TROSY-based studies of scalar couplings across hydrogen bonds should be applicable for large molecular sizes, including protein-bound nucleic acids. PMID:9826668
RNA polymerase gate loop guides the nontemplate DNA strand in transcription complexes.
NandyMazumdar, Monali; Nedialkov, Yuri; Svetlov, Dmitri; Sevostyanova, Anastasia; Belogurov, Georgiy A; Artsimovitch, Irina
2016-12-27
Upon RNA polymerase (RNAP) binding to a promoter, the σ factor initiates DNA strand separation and captures the melted nontemplate DNA, whereas the core enzyme establishes interactions with the duplex DNA in front of the active site that stabilize initiation complexes and persist throughout elongation. Among many core RNAP elements that participate in these interactions, the β' clamp domain plays the most prominent role. In this work, we investigate the role of the β gate loop, a conserved and essential structural element that lies across the DNA channel from the clamp, in transcription regulation. The gate loop was proposed to control DNA loading during initiation and to interact with NusG-like proteins to lock RNAP in a closed, processive state during elongation. We show that the removal of the gate loop has large effects on promoter complexes, trapping an unstable intermediate in which the RNAP contacts with the nontemplate strand discriminator region and the downstream duplex DNA are not yet fully established. We find that although RNAP lacking the gate loop displays moderate defects in pausing, transcript cleavage, and termination, it is fully responsive to the transcription elongation factor NusG. Together with the structural data, our results support a model in which the gate loop, acting in concert with initiation or elongation factors, guides the nontemplate DNA in transcription complexes, thereby modulating their regulatory properties.
Kladova, Olga A; Krasnoperov, Lev N; Kuznetsov, Nikita A; Fedorova, Olga S
2018-03-30
Endonuclease III (Endo III or Nth) is one of the key enzymes responsible for initiating the base excision repair of oxidized or reduced pyrimidine bases in DNA. In this study, a thermodynamic analysis of structural rearrangements of the specific and nonspecific DNA-duplexes during their interaction with Endo III is performed based on stopped-flow kinetic data. 1,3-diaza-2-oxophenoxazine (tC O ), a fluorescent analog of the natural nucleobase cytosine, is used to record multistep DNA binding and lesion recognition within a temperature range (5-37 °C). Standard Gibbs energy, enthalpy, and entropy of the specific steps are derived from kinetic data using Van't Hoff plots. The data suggest that enthalpy-driven exothermic 5,6-dihydrouracil (DHU) recognition and desolvation-accompanied entropy-driven adjustment of the enzyme-substrate complex into a catalytically active state play equally important parts in the overall process. The roles of catalytically significant amino acids Lys120 and Asp138 in the DNA lesion recognition and catalysis are identified. Lys120 participates not only in the catalytic steps but also in the processes of local duplex distortion, whereas substitution Asp138Ala leads to a complete loss of the ability of Endo III to distort a DNA double chain during enzyme-DNA complex formation.
The Pathway of Oligomeric DNA Melting Investigated by Molecular Dynamics Simulations
Wong, Ka-Yiu; Pettitt, B. Montgomery
2008-01-01
Details of the reaction coordinate for DNA melting are fundamental to much of biology and biotechnology. Recently, it has been shown experimentally that there are at least three states involved. To clarify the reaction mechanism of the melting transition of DNA, we perform 100-ns molecular dynamics simulations of a homo-oligomeric, 12-basepair DNA duplex, d(A12)·d(T12), with explicit salt water at 400 K. Analysis of the trajectory reveals the various biochemically important processes that occur on different timescales. Peeling (including fraying from the ends), searching for Watson-Crick complements, and dissociation are recognizable processes. However, we find that basepair searching for Watson-Crick complements along a strand is not mechanistically tied to or directly accessible from the dissociation steps of strand melting. A three-step melting mechanism is proposed where the untwisting of the duplex is determined to be the major component of the reaction coordinate at the barrier. Though the observations are limited to the characteristics of the system being studied, they provide important insight into the mechanism of melting of other more biologically relevant forms of DNA, which will certainly differ in details from those here. PMID:18952784
Saccharomyces cerevisiae Hrq1 requires a long 3'-tailed DNA substrate for helicase activity.
Kwon, Sung-Hun; Choi, Do-Hee; Lee, Rina; Bae, Sung-Ho
2012-10-26
RecQ helicases are well conserved proteins from bacteria to human and function in various DNA metabolism for maintenance of genome stability. Five RecQ helicases are found in humans, whereas only one RecQ helicase has been described in lower eukaryotes. However, recent studies predicted the presence of a second RecQ helicase, Hrq1, in fungal genomes and verified it as a functional gene in fission yeast. Here we show that 3'-5' helicase activity is intrinsically associated with Hrq1 of Saccharomyces cerevisiae. We also determined several biochemical properties of Hrq1 helicase distinguishable from those of other RecQ helicase members. Hrq1 is able to unwind relatively long duplex DNA up to 120-bp and is significantly stimulated by a preexisting fork structure. Further, the most striking feature of Hrq1 is its absolute requirement for a long 3'-tail (⩾70-nt) for efficient unwinding of duplex DNA. We also found that Hrq1 has potent DNA strand annealing activity. Our results indicate that Hrq1 has vigorous helicase activity that deserves further characterization to expand our understanding of RecQ helicases. Copyright © 2012 Elsevier Inc. All rights reserved.
Virtual Cross-Linking of the Active Nemorubicin Metabolite PNU-159682 to Double-Stranded DNA.
Scalabrin, Matteo; Quintieri, Luigi; Palumbo, Manlio; Riccardi Sirtori, Federico; Gatto, Barbara
2017-02-20
The DNA alkylating mechanism of PNU-159682 (PNU), a highly potent metabolite of the anthracycline nemorubicin, was investigated by gel-electrophoretic, HPLC-UV, and micro-HPLC/mass spectrometry (MS) measurements. PNU quickly reacted with double-stranded oligonucleotides, but not with single-stranded sequences, to form covalent adducts which were detectable by denaturing polyacrylamide gel electrophoresis (DPAGE). Ion-pair reverse-phase HPLC-UV analysis on CG rich duplex sequences having a 5'-CCCGGG-3' central core showed the formation of two types of adducts with PNU, which were stable and could be characterized by micro-HPLC/MS. The first type contained one alkylated species (and possibly one reversibly bound species), and the second contained two alkylated species per duplex DNA. The covalent adducts were found to produce effective bridging of DNA complementary strands through the formation of virtual cross-links reminiscent of those produced by classical anthracyclines in the presence of formaldehyde. Furthermore, the absence of reactivity of PNU with CG-rich sequence containing a TA core (CGTACG), and the minor reactivity between PNU and CGC sequences (TACGCG·CGCGTA) pointed out the importance of guanine sequence context in modulating DNA alkylation.
Schonhoft, Joseph D; Stivers, James T
2013-04-16
Human uracil DNA glycosylase (hUNG) plays a central role in DNA repair and programmed mutagenesis of Ig genes, requiring it to act on sparsely or densely spaced uracil bases located in a variety of contexts, including U/A and U/G base pairs, and potentially uracils within single-stranded DNA (ssDNA). An interesting question is whether the facilitated search mode of hUNG, which includes both DNA sliding and hopping, changes in these different contexts. Here we find that hUNG uses an enhanced local search mode when it acts on uracils in ssDNA, and also, in a context where uracils are densely clustered in duplex DNA. In the context of ssDNA, hUNG performs an enhanced local search by sliding with a mean sliding length larger than that of double-stranded DNA (dsDNA). In the context of duplex DNA, insertion of high-affinity abasic product sites between two uracil lesions serves to significantly extend the apparent sliding length on dsDNA from 4 to 20 bp and, in some cases, leads to directionally biased 3' → 5' sliding. The presence of intervening abasic product sites mimics the situation where hUNG acts iteratively on densely spaced uracils. The findings suggest that intervening product sites serve to increase the amount of time the enzyme remains associated with DNA as compared to nonspecific DNA, which in turn increases the likelihood of sliding as opposed to falling off the DNA. These findings illustrate how the search mechanism of hUNG is not predetermined but, instead, depends on the context in which the uracils are located.
Poly(ADP-ribose) polymerases covalently modify strand break termini in DNA fragments in vitro
Talhaoui, Ibtissam; Lebedeva, Natalia A.; Zarkovic, Gabriella; Saint-Pierre, Christine; Kutuzov, Mikhail M.; Sukhanova, Maria V.; Matkarimov, Bakhyt T.; Gasparutto, Didier; Saparbaev, Murat K.; Lavrik, Olga I.; Ishchenko, Alexander A.
2016-01-01
Poly(ADP-ribose) polymerases (PARPs/ARTDs) use nicotinamide adenine dinucleotide (NAD+) to catalyse the synthesis of a long branched poly(ADP-ribose) polymer (PAR) attached to the acceptor amino acid residues of nuclear proteins. PARPs act on single- and double-stranded DNA breaks by recruiting DNA repair factors. Here, in in vitro biochemical experiments, we found that the mammalian PARP1 and PARP2 proteins can directly ADP-ribosylate the termini of DNA oligonucleotides. PARP1 preferentially catalysed covalent attachment of ADP-ribose units to the ends of recessed DNA duplexes containing 3′-cordycepin, 5′- and 3′-phosphate and also to 5′-phosphate of a single-stranded oligonucleotide. PARP2 preferentially ADP-ribosylated the nicked/gapped DNA duplexes containing 5′-phosphate at the double-stranded termini. PAR glycohydrolase (PARG) restored native DNA structure by hydrolysing PAR-DNA adducts generated by PARP1 and PARP2. Biochemical and mass spectrometry analyses of the adducts suggested that PARPs utilise DNA termini as an alternative to 2′-hydroxyl of ADP-ribose and protein acceptor residues to catalyse PAR chain initiation either via the 2′,1″-O-glycosidic ribose-ribose bond or via phosphodiester bond formation between C1′ of ADP-ribose and the phosphate of a terminal deoxyribonucleotide. This new type of post-replicative modification of DNA provides novel insights into the molecular mechanisms underlying biological phenomena of ADP-ribosylation mediated by PARPs. PMID:27471034
Du, Xin-Jun; Zang, Yu-Xuan; Liu, Hai-Bin; Li, Ping; Wang, Shuo
2018-04-01
Listeria monocytogenes is an important food-borne pathogenic bacterium that causes human disease, resulting in economic losses worldwide. The current detection methods for L. monocytogenes are not well suited for direct field testing because they involve complicated, time-consuming operations. A simple, efficient method is vital for L. monocytogenes detection. In this study, we combined isothermal recombinase polymerase amplification (RPA) with a lateral flow (LF) strip to rapidly and reliably detect L. monocytogenes. In the presence of biotin- and digoxin-modified primers, RPA produced numerous digoxin- and biotin-attached duplex DNA products. These products were detected on an LF strip via dual immunoreactions (digoxin on the duplex DNA reacted with the anti-digoxin antibody on the gold nanoparticle (Au-NP) and the biotin on the duplex DNA captured by the streptavidin on the LF test zone). The accumulation of Au-NPs produced characteristic bands, enabling the visual detection of L. monocytogenes without instrumentation. This assay could be used to detect L. monocytogenes within 15 min, including DNA amplification with RPA for 10 min at 39 °C and visualization of the amplicons by LF strips for 5 min. Experiments confirmed a detection limit as low as 300 fg of DNA and 1.5 × 10 1 CFU in pure cultures. Furthermore, RPA-LF exhibited no cross-reactions with pathogens. Evaluation of the method with food samples indicated that the detection limit was substantially improved to 1.5 × 10° CFU for the original bacterial content in 25 g/mL samples after enrichment for 6 hr. RPA-LF can be used as a sensitive and rapid detection technique for L. monocytogenes. Recombinase polymerase amplification (RPA) can amplify target DNA at 37 to 42 °C without a thermal cycler. Lateral flow (LF) strips are portable, cheap and easy to operate. RPA combined with LF strips to detect Listeria monocytogenes can be widely used in remote areas. © 2018 Institute of Food Technologists®.
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki
2015-01-01
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600
Chalikian, T V; Plum, G E; Sarvazyan, A P; Breslauer, K J
1994-07-26
We use high-precision acoustic and densimetric techniques to determine, at 25 degrees C, the changes in volume, delta V, and adiabatic compressibility, delta Ks, that accompany the binding of netropsin to the poly(dAdT).poly(dAdT) and poly(dA).poly(dT) duplexes, as well as to the poly(dT).poly(dA).poly(dT) triplex. We find that netropsin binding to the heteropolymeric poly(dAdT).poly(dAdT) duplex is accompanied by negative changes in volume, delta V, and small positive changes in compressibility, delta Ks. By contrast, netropsin binding to the homopolymeric poly(dA).poly(dT) duplex is accompanied by large positive changes in both volume, delta V, and compressibility, delta Ks. Furthermore, netropsin binding to the poly(dT).poly(dA).poly(dT) triplex causes changes in both volume and compressibility that are nearly twice as large as those observed when netropsin binds to the poly(dA).poly(dT) duplex. We interpret these macroscopic data in terms of binding-induced microscopic changes in the hydration of the DNA structures and the drug. Specifically, we find that netropsin binding induces the release of approximately 22 waters from the hydration shell of the poly(dAdT).poly(dAdT) heteropolymeric duplex, approximately 40 waters from the hydration shell of the poly(dA).poly(dT) homopolymeric duplex, and about 53 waters from the hydration shell of the poly(dA).poly(dT), induces the release of 18 more water molecules than netropsin binding to the heteropolymeric duplex, poly(dAdT).poly(dAdT). On the basis of apparent molar volume, phi V, and apparent molar adiabatic compressibility, phi Ks, values for the initial drug-free and final drug-bound states of the two all-AT duplexes, we propose that the larger dehydration of the poly(dA).poly(dT) duplex reflects, in part, the formation of a less hydrated poly(dA).poly(dT)-netropsin complex compared with the corresponding poly(dAdT).poly(dAdT)-netropsin complex. In conjunction with our previously published entropy data [Marky, L. A., & Breslauer, K. J. (1987) Proc. Natl. Acad. Sci. U.S.A. 84, 4359-4363], we calculate that each water of hydration released to the bulk solvent by ligand binding contributes 1.6 cal K-1 mol-1 to the entropy of binding. This value corresponds to the average difference between the partial molar entropy of water in the bulk state and water in the hydration shells of the two all-AT duplexes. When netropsin binds to the poly(dT).poly(dA).poly(dT) triplex, the changes in both volume and compressibility suggest that the binding event induces more dehydration of the triplex than of the duplex state. Specifically, we calculate that netropsin binding to the poly(dT).poly(dA).poly(dT) triplex causes the release of 13 more waters than netropsin binding to the poly(dA).poly(dT) duplex.(ABSTRACT TRUNCATED AT 400 WORDS)
Individual Basepair Stability of DNA and RNA Studied by NMR-Detected Solvent Exchange
Steinert, Hannah S.; Rinnenthal, Jörg; Schwalbe, Harald
2012-01-01
In this study, we have optimized NMR methodology to determine the thermodynamic parameters of basepair opening in DNA and RNA duplexes by characterizing the temperature dependence of imino proton exchange rates of individual basepairs. Contributions of the nuclear Overhauser effect to exchange rates measured with inversion recovery experiments are quantified, and the influence of intrinsic and external catalysis exchange mechanisms on the imino proton exchange rates is analyzed. Basepairs in DNA and RNA have an approximately equal stability, and the enthalpy and entropy values of their basepair dissociation are correlated linearly. Furthermore, the compensation temperature, Tc, which is derived from the slope of the correlation, coincides with the melting temperature, and duplex unfolding occurs at that temperature where all basepairs are equally thermodynamically stable. The impact of protium-deuterium exchange of the imino hydrogen on the free energy of RNA basepair opening is investigated, and it is found that two A·U basepairs show distinct fractionation factors. PMID:22713572
Insights from the structure of a smallpox virus topoisomerase-DNA transition state mimic
Perry, Kay; Hwang, Young; Bushman, Frederic D.; Van Duyne, Gregory D.
2010-01-01
Summary Poxviruses encode their own type IB topoisomerases (TopIBs) which release superhelical tension generated by replication and transcription of their genomes. To investigate the reaction catalyzed viral TopIBs, we have determined the structure of a variola virus topoisomerase-DNA complex trapped as a vanadate transition state mimic. The structure reveals how the viral TopIB enzymes are likely to position the DNA duplex for ligation following relaxation of supercoils and identifies the sources of friction observed in single molecule experiments that argue against free rotation. The structure also identifies a conformational change in the leaving group sugar that must occur prior to cleavage and reveals a mechanism for promoting ligation following relaxation of supercoils that involves a novel Asp-minor groove interaction. Overall, the new structural data support a common catalytic mechanism for the TopIB superfamily but indicate distinct methods for controlling duplex rotation in the small vs. large enzyme subfamilies. PMID:20152159
Optimization of single-base-pair mismatch discrimination in oligonucleotide microarrays
NASA Technical Reports Server (NTRS)
Urakawa, Hidetoshi; El Fantroussi, Said; Smidt, Hauke; Smoot, James C.; Tribou, Erik H.; Kelly, John J.; Noble, Peter A.; Stahl, David A.
2003-01-01
The discrimination between perfect-match and single-base-pair-mismatched nucleic acid duplexes was investigated by using oligonucleotide DNA microarrays and nonequilibrium dissociation rates (melting profiles). DNA and RNA versions of two synthetic targets corresponding to the 16S rRNA sequences of Staphylococcus epidermidis (38 nucleotides) and Nitrosomonas eutropha (39 nucleotides) were hybridized to perfect-match probes (18-mer and 19-mer) and to a set of probes having all possible single-base-pair mismatches. The melting profiles of all probe-target duplexes were determined in parallel by using an imposed temperature step gradient. We derived an optimum wash temperature for each probe and target by using a simple formula to calculate a discrimination index for each temperature of the step gradient. This optimum corresponded to the output of an independent analysis using a customized neural network program. These results together provide an experimental and analytical framework for optimizing mismatch discrimination among all probes on a DNA microarray.
Pausing kinetics dominates strand-displacement polymerization by reverse transcriptase
Malik, Omri; Khamis, Hadeel; Rudnizky, Sergei; Marx, Ailie
2017-01-01
Abstract Reverse transcriptase (RT) catalyzes the conversion of the viral RNA into an integration-competent double-stranded DNA, with a variety of enzymatic activities that include the ability to displace a non-template strand concomitantly with polymerization. Here, using high-resolution optical tweezers to follow the activity of the murine leukemia Virus RT, we show that strand-displacement polymerization is frequently interrupted. Abundant pauses are modulated by the strength of the DNA duplex ∼8 bp ahead, indicating the existence of uncharacterized RT/DNA interactions, and correspond to backtracking of the enzyme, whose recovery is also modulated by the duplex strength. Dissociation and reinitiation events, which induce long periods of inactivity and are likely the rate-limiting step in the synthesis of the genome in vivo, are modulated by the template structure and the viral nucleocapsid protein. Our results emphasize the potential regulatory role of conserved structural motifs, and may provide useful information for the development of potent and specific inhibitors. PMID:28973474
Li, Ying; Yu, Chuanfeng; Han, Huixia; Zhao, Caisheng; Zhang, Xiaoru
2016-07-15
A novel and sensitive surface-enhanced Raman scattering (SERS) method is proposed for the assay of DNA methyltransferase (MTase) activity and evaluation of inhibitors by developing a target triggering primer generation-based multiple signal amplification strategy. By using of a duplex substrate for Dam MTase, two hairpin templates and a Raman probe, multiple signal amplification mode is achieved. Once recognized by Dam MTase, the duplex substrate can be cleaved by Dpn I endonuclease and two primers are released for triggering the multiple signal amplification reaction. Consequently, a wide dynamic range and remarkably high sensitivity are obtained under isothermal conditions. The detection limit is 2.57×10(-4)UmL(-1). This assay exhibits an excellent selectivity and is successfully applied in the screening of inhibitors for Dam MTase. In addition, this novel sensing system is potentially universal as the recognition element can be conveniently designed for other target analytes by changing the substrate of DNA MTase. Copyright © 2016 Elsevier B.V. All rights reserved.
Sochacka, Elzbieta; Szczepanowski, Roman H.; Cypryk, Marek; Sobczak, Milena; Janicka, Magdalena; Kraszewska, Karina; Bartos, Paulina; Chwialkowska, Anna; Nawrot, Barbara
2015-01-01
2-Thiouracil-containing nucleosides are essential modified units of natural and synthetic nucleic acids. In particular, the 5-substituted-2-thiouridines (S2Us) present in tRNA play an important role in tuning the translation process through codon–anticodon interactions. The enhanced thermodynamic stability of S2U-containing RNA duplexes and the preferred S2U-A versus S2U-G base pairing are appreciated characteristics of S2U-modified molecular probes. Recently, we have demonstrated that 2-thiouridine (alone or within an RNA chain) is predominantly transformed under oxidative stress conditions to 4-pyrimidinone riboside (H2U) and not to uridine. Due to the important biological functions and various biotechnological applications for sulfur-containing nucleic acids, we compared the thermodynamic stabilities of duplexes containing desulfured products with those of 2-thiouracil-modified RNA and DNA duplexes. Differential scanning calorimetry experiments and theoretical calculations demonstrate that upon 2-thiouracil desulfuration to 4-pyrimidinone, the preferred base pairing of S2U with adenosine is lost, with preferred base pairing with guanosine observed instead. Therefore, biological processes and in vitro assays in which oxidative desulfuration of 2-thiouracil-containing components occurs may be altered. Moreover, we propose that the H2U-G base pair is a suitable model for investigation of the preferred recognition of 3′-G-ending versus A-ending codons by tRNA wobble nucleosides, which may adopt a 4-pyrimidinone-type structural motif. PMID:25690900
Front-End Processing of Cell Lysates for Enhanced Chip-Based Detection
2006-07-28
manipulation used in lab-on-a-chip devices. A small unknown sample is first mixed with the PNA surfactants (“PNAA”) to tag the DNA targets, and then the...unknown sample is first mixed with the PNA surfactants (hereafter referred to as “PNA amphiphiles” or “PNAA”) to tag the DNA targets, and then the...prolate ellipsoid, and mixed PNAA/SDS micelles form spherical micelles. On addition of complementary DNA, the PNAA/DNA duplexes do not participate in
The MCM Helicase Motor of the Eukaryotic Replisome.
Abid Ali, Ferdos; Costa, Alessandro
2016-05-08
The MCM motor of the CMG helicase powers ahead of the eukaryotic replication machinery to unwind DNA, in a process that requires ATP hydrolysis. The reconstitution of DNA replication in vitro has established the succession of events that lead to replication origin activation by the MCM and recent studies have started to elucidate the structural basis of duplex DNA unwinding. Despite the exciting progress, how the MCM translocates on DNA remains a matter of debate. Copyright © 2016. Published by Elsevier Ltd.
Wang, M.; Holmes-Davis, R.; Rafinski, Z.; Jedrzejewska, B.; Choi, K. Y.; Zwick, M.; Bupp, C.; Izmailov, A.; Paczkowski, J.; Warner, B.; Koshinsky, H.
2009-01-01
In many settings, molecular testing is needed but unavailable due to complexity and cost. Simple, rapid, and specific DNA detection technologies would provide important alternatives to existing detection methods. Here we report a novel, rapid nucleic acid detection method based on the accelerated photobleaching of the light-sensitive cyanine dye, 3,3′-diethylthiacarbocyanine iodide (DiSC2(3) I−), in the presence of a target genomic DNA and a complementary peptide nucleic acid (PNA) probe. On the basis of the UV–vis, circular dichroism, and fluorescence spectra of DiSC2(3) with PNA–DNA oligomer duplexes and on characterization of a product of photolysis of DiSC2(3) I−, a possible reaction mechanism is proposed. We propose that (1) a novel complex forms between dye, PNA, and DNA, (2) this complex functions as a photosensitizer producing 1O2, and (3) the 1O2 produced promotes photobleaching of dye molecules in the mixture. Similar cyanine dyes (DiSC3(3), DiSC4(3), DiSC5(3), and DiSCpy(3)) interact with preformed PNA–DNA oligomer duplexes but do not demonstrate an equivalent accelerated photobleaching effect in the presence of PNA and target genomic DNA. The feasibility of developing molecular diagnostic assays based on the accelerated photobleaching (the smartDNA assay) that results from the novel complex formed between DiSC2(3) and PNA–DNA is under way. PMID:19231844
Planck-Benzinger thermal work function: Monoclonal antibody-DNA duplex binding interactions
NASA Astrophysics Data System (ADS)
Chun, Paul W.
We have reexamined the van't Hoff plots and delineation of thermodynamic data of the monoclonal antibodies of Jel 274 and Jel 241 binding to DNA duplex at high ionic strength using fluorescein-labeled oligonucleotide titration with increasing concentrations of the antibody as reported by Tanha and Lee (Nucleic Acid Res, 1997, 25, 1442). To compare the thermodynamic parameters from data over the experimental temperature range of 277-312.5 K, the binding constant from van't Hoff plots is used to evaluate ΔGo(T) from 0 to 400 K using our general linear T3 model, ΔGo(T) = α +βT2+γT3. The limited information provided by the van't Hoff plots and their extensions is not sufficient to describe the variations in the Gibbs free energy change as a function of temperature and other thermodynamic functions observed in these and other biological interactions. Rather, it is necessary to determine a number of thermodynamic parameters, including the heat of reaction, (Th), (Tm), and (TCp), and the thermal set point, (TS), all of which can be precisely assessed using our general linear T3 model. To date, no experimental measurement offers this degree of accuracy. In evaluating the thermodynamic parameters in the binding interaction of monoclonal IgG Jel 241-d[AT]20DNA duplex, it is apparent that at a high NaCl concentration, the range of the compensatory temperatures, (Th) = 155 K and (Tm) = 450 K, is much broader than observed in any other sample, whereas the thermal set points, (TS) = 330 K, is 20-30 K higher. The inherent chemical bond energy ΔHo(T0) is much lower in this sample. The values of thermal agitation energy (heat capacity integrals) are of similar magnitude for all the samples tested. It appears that increasing the NaCl concentration to 130 mM will greatly enhance the binding interaction between the monoclonal antibody and DNA duplex. It is not clear, however, from the limited data available, whether the binding interaction is sequence specific, although logic would suggest it is.
pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.
Parsch, U; Engels, J W
2000-07-03
The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.
Method for detecting point mutations in DNA utilizing fluorescence energy transfer
Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle
2001-01-01
A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.
Effect of Radiofrequency Radiation on DNA Duplex Stability and Replication.
1983-08-01
Ando, T. A nuclease specific for heat-denatured DNA isolated from a product of Aspergillus oryzae . Biochim Biophys Acta 114:158-168 (1966). Blakeley...metabolic acti- vation. Mutation Res 64:315-328 (1979). Vogt,. V.M. Purification and further properties of single-strand-specific nuclease from Aspergillus oryzae . Eur J Biochem 33:192-200 (1973). 42
NASA Astrophysics Data System (ADS)
Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle
2016-11-01
Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.
Interactions of Ku70/80 with Double-Strand DNA: Energetic, Dynamics, and Functional Implications
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2010-01-01
Space radiation is a proficient inducer of DNA damage leading to mutation, aberrant cell signaling, and cancer formation. Ku is among the first responding proteins in nucleus to recognize and bind the DNA double strand breaks (DSBs) whenever they are introduced. Once loaded Ku works as a scaffold to recruit other repair factors of non-homologous end joining and facilitates the following repair processes. The crystallographic study of the Ku70/80 heterodimer indicate the core structure of this protein shows virtually no conformational change after binding with DNA. To investigate the dynamical features as well as the energetic characteristics of Ku-DNA binding, we conduct multi-nanosecond molecular dynamics simulations of a modeled Ku70/80 structure and several complexes with two 24-bp DNA duplexes. Free energy calculations show significant energy differences between the complexes with Ku bound at DSBs and those with Ku associated at an internal site of a chromosome. The results also reveal detailed interactions between different nucleotides and the amino acids along the DNA-binding cradle of Ku, indicating subtle binding preference of Ku at specific DNA sequences. The covariance matrix analyses along the trajectories demonstrate the protein is stimulated to undergo correlated motions of different domains once bound to DNA ends. Additionally, principle component analyses identify these low frequency collective motions suitable for binding with and translocation along duplex DNA. It is proposed that the modification of dynamical properties of Ku upon binding with DSBs may provide a signal for the further recruitment of other repair factors such as DNA-PKcs, XLF, and XRCC4.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mikhailov, Victor S.; N. K. Koltzov Institute of Developmental Biology, Russian Academy of Sciences, Moscow 117808; Vanarsdall, Adam L.
2008-01-20
DNA-binding protein (DBP) of Autographa californica multiple nucleopolyhedrovirus (AcMNPV) was expressed as an N-terminal His{sub 6}-tag fusion using a recombinant baculovirus and purified to near homogeneity. Purified DBP formed oligomers that were crosslinked by redox reagents resulting in predominantly protein dimers and tetramers. In gel retardation assays, DBP showed a high affinity for single-stranded oligonucleotides and was able to compete with another baculovirus SSB protein, LEF-3, for binding sites. DBP binding protected ssDNA against hydrolysis by a baculovirus alkaline nuclease AN/LEF-3 complex. Partial proteolysis by trypsin revealed a domain structure of DBP that is required for interaction with DNA andmore » that can be disrupted by thermal treatment. Binding to ssDNA, but not to dsDNA, changed the pattern of proteolytic fragments of DBP indicating adjustments in protein structure upon interaction with ssDNA. DBP was capable of unwinding short DNA duplexes and also promoted the renaturation of long complementary strands of ssDNA into duplexes. The unwinding and renaturation activities of DBP, as well as the DNA binding activity, were sensitive to sulfhydryl reagents and were inhibited by oxidation of thiol groups with diamide or by alkylation with N-ethylmaleimide. A high affinity of DBP for ssDNA and its unwinding and renaturation activities confirmed identification of DBP as a member of the SSB/recombinase family. These activities and a tight association with subnuclear structures suggests that DBP is a component of the virogenic stroma that is involved in the processing of replicative intermediates.« less
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Genotyping by alkaline dehybridization using graphically encoded particles.
Zhang, Huaibin; DeConinck, Adam J; Slimmer, Scott C; Doyle, Patrick S; Lewis, Jennifer A; Nuzzo, Ralph G
2011-03-01
This work describes a nonenzymatic, isothermal genotyping method based on the kinetic differences exhibited in the dehybridization of perfectly matched (PM) and single-base mismatched (MM) DNA duplexes in an alkaline solution. Multifunctional encoded hydrogel particles incorporating allele-specific oligonucleotide (ASO) probes in two distinct regions were fabricated by using microfluidic-based stop-flow lithography. Each particle contained two distinct ASO probe sequences differing at a single base position, and thus each particle was capable of simultaneously probing two distinct target alleles. Fluorescently labeled target alleles were annealed to both probe regions of a particle, and the rate of duplex dehybridization was monitored by using fluorescence microscopy. Duplex dehybridization was achieved through an alkaline stimulus using either a pH step function or a temporal pH gradient. When a single target probe sequence was used, the rate of mismatch duplex dehybridization could be discriminated from the rate of perfect match duplex dehybridization. In a more demanding application in which two distinct probe sequences were used, we found that the rate profiles provided a means to discriminate probe dehybridizations from both of the two mismatched duplexes as well as to distinguish at high certainty the dehybridization of the two perfectly matched duplexes. These results demonstrate an ability of alkaline dehybridization to correctly discriminate the rank hierarchy of thermodynamic stability among four sets of perfect match and single-base mismatch duplexes. We further demonstrate that these rate profiles are strongly temperature dependent and illustrate how the sensitivity can be compensated beneficially by the use of an actuating gradient pH field. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A
1995-04-11
SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Jiang, Jingjing; Lin, Xinyi; Ding, Dong; Diao, Guowang
2018-04-17
Taking advantages of the toehold-triggered strand displacement reaction (TSDR) and host-guest interaction of β-cyclodextrin (β-CD), a facile enzyme-free and homogeneous electrochemical sensing strategy was designed for the sensitive assay of target DNA using Fe 3 O 4 @SiO 2 @β-CD nanocomposites and ferrocene-labeled hairpin DNA (H-1) as the capture and electrochemical probes, respectively. Upon addition of target molecule, the initiated TSDR process induced the conformational change of H-1, and subsequently stimulated the dynamic assembly of assist probes (A-1 and A-2) to generate H-1:A-1:A-2 duplex along with the release of target sequence. The released target could drive the next TSDR recycling and finally result in the formation of numerous DNA duplex. After the molecular recognition of Fe 3 O 4 @SiO 2 @β-CD nanocomposites, a large number of duplex were easily separated from the supernatant solution under an external magnetic field, which led to a decreased H-1 concentration in residual solution, concomitant with a remarkable reduction of peak current. Under the optimized conditions, wide linear range (1-5000 pM), low detection limit (0.3 pM), desirable reproducibility, good selectivity, and satisfactory practical analysis were obtained by the combination of the superior recognition capability of β-CD, TSDR-induced signal amplification, and homogeneous electroanalytical method. The proposed detection strategy could offer a universal approach for the monitoring of various biological analytes via the rational design of probe sequences. Copyright © 2018 Elsevier B.V. All rights reserved.
Jain, Vipin; Hilton, Benjamin; Lin, Bin; Jain, Anshu; MacKerell, Alexander D.; Zou, Yue; Cho, Bongsup P.
2014-01-01
Cluster DNA damage refers to two or more lesions in a single turn of the DNA helix. Such clustering may occur with bulky DNA lesions, which may be responsible for their sequence dependent repair and mutational outcomes. Here we prepared three 16-mer cluster duplexes in which two fluoroacetylaminofluorene adducts (dG-FAAF) are separated by none, one and two nucleotides in the E. coli NarI mutational hot spot (5'-CTCTCG1G2CG3CCATCAC-3'): i.e. 5'-- CG1*G2*CG3CC--3', 5'--CG1G2*CG3*CC--3', and 5'--CG1*G2CG3*CC--3' [G*=dG-FAAF], respectively. We conducted spectroscopic, thermodynamic, and molecular dynamics studies of these di-FAAF duplexes and the results were compared with those of the corresponding mono- FAAF adducts in the same NarI sequence (Nucleic Acids Res. 2012, 3939–3951). Our nucleotide excision repair results showed greater reparability of the di-adducts in comparison to the corresponding mono-adducts. Moreover, we observed dramatic flanking base sequence effects on their repair efficiency in the order of NarI-G2G3 > -G1G3 > -G1G2. The NMR/CD/UV-melting and MD-simulation results revealed that in contrast to the mono-adducts, di-adducts produced synergistic effect on duplex destabilization. In addition, dG-FAAF at G2G3 and G1G3 destack the neighboring bases with greater destabilization occurring with the former. Overall, the results indicate the importance of base stacking and related thermal/thermodynamic destabilization in the repair of bulky cluster arylamine DNA adducts. PMID:23841451
Matter, Brock; Seiler, Christopher L; Murphy, Kristopher; Ming, Xun; Zhao, Jianwei; Lindgren, Bruce; Jones, Roger; Tretyakova, Natalia
2018-06-01
Reactive oxygen and nitrogen species generated during respiration, inflammation, and immune response can damage cellular DNA, contributing to aging, cancer, and neurodegeneration. The ability of oxidized DNA bases to interfere with DNA replication and transcription is strongly influenced by their chemical structures and locations within the genome. In the present work, we examined the influence of local DNA sequence context, DNA secondary structure, and oxidant identity on the efficiency and the chemistry of guanine oxidation in the context of the Kras protooncogene. A novel isotope labeling strategy developed in our laboratory was used to accurately map the formation of 2,2-diamino-4-[(2-deoxy-β-D-erythropentofuranosyl)amino]- 5(2 H)-oxazolone (Z), 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG), and 8-nitroguanine (8-NO 2 -G) lesions along DNA duplexes following photooxidation in the presence of riboflavin, treatment with nitrosoperoxycarbonate, and oxidation in the presence of hydroxyl radicals. Riboflavin-mediated photooxidation preferentially induced OG lesions at 5' guanines within GG repeats, while treatment with nitrosoperoxycarbonate targeted 3'-guanines within GG and AG dinucleotides. Little sequence selectivity was observed following hydroxyl radical-mediated oxidation. However, Z and 8-NO 2 -G adducts were overproduced at duplex ends, irrespective of oxidant identity. Overall, our results indicate that the patterns of Z, OG, and 8-NO 2 -G adduct formation in the genome are distinct and are influenced by oxidant identity and the secondary structure of DNA. Copyright © 2018 Elsevier Inc. All rights reserved.
"Off-on" electrochemical hairpin-DNA-based genosensor for cancer diagnostics.
Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt; Ferapontova, Elena E
2011-03-01
A simple and robust "off-on" signaling genosensor platform with improved selectivity for single-nucleotide polymorphism (SNP) detection based on the electronic DNA hairpin molecular beacons has been developed. The DNA beacons were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 3'-end, while the 5'-end was labeled with a methylene blue (MB) redox probe. A typical "on-off" change of the electrochemical signal was observed upon hybridization of the 27-33 nucleotide (nt) long hairpin DNA to the target DNA, in agreement with all the hitherto published data. Truncation of the DNA hairpin beacons down to 20 nts provided improved genosensor selectivity for SNP and allowed switching of the electrochemical genosensor response from the on-off to the off-on mode. Switching was consistent with the variation in the mechanism of the electron transfer reaction between the electrode and the MB redox label, for the folded beacon being characteristic of the electrochemistry of adsorbed species, while for the "open" duplex structure being formally controlled by the diffusion of the redox label within the adsorbate layer. The relative current intensities of both processes were governed by the length of the formed DNA duplex, potential scan rate, and apparent diffusion coefficient of the redox species. The off-on genosensor design used for detection of a cancer biomarker TP53 gene sequence favored discrimination between the healthy and SNP-containing DNA sequences, which was particularly pronounced at short hybridization times.
Liu, Zhongyuan; Zhang, Wei; Zhu, Shuyun; Zhang, Ling; Hu, Lianzhe; Parveen, Saima; Xu, Guobao
2011-11-15
Combining the advantages of signal-on strategy and nicking endonuclease assisted electrochemistry signal amplification (NEAESA), a new sensitive and signal-on electrochemical DNA biosensor for the sequence specific DNA detection based on NEAESA has been developed for the first time. A Hairpin-shape probe (HP), containing the target DNA recognition sequence, is thiol-modified at 5' end and immobilized on gold electrode via Au-S bonding. Subsequently, the HP modified electrode is hybridized with target DNA to form a duplex. Then the nicking endonuclease is added and nicks the HP strand in the duplex. After nicking, 3'-ferrocene (Fc)-labeled part complementary probe (Fc-PCP) is introduced on the electrode surface by hybridizing with the thiol-modified HP fragment, which results in the generation of electrochemical signal. Hence, the DNA biosensor is constructed successfully. The present DNA biosensor shows a wide linear range of 5.0×10(-13)-5.0×10(-8)M for detecting target DNA, with a low detection limit of 0.167pM. The proposed strategy does not require any amplifying labels (enzymes, DNAzymes, nanoparticles, etc.) for biorecognition events, which avoids false-positive results to occur frequently. Moreover, the strategy has the benefits of simple preparation, convenient operation, good selectivity, and high sensitivity. With the advantages mentioned above, this simple and sensitive strategy has the potential to be integrated in portable, low cost and simplified devices for diagnostic applications. Copyright © 2011 Elsevier B.V. All rights reserved.
Walking of antitumor bifunctional trinuclear PtII complex on double-helical DNA
Malina, Jaroslav; Kasparkova, Jana; Farrell, Nicholas P.; Brabec, Viktor
2011-01-01
The trinuclear BBR3464 ([{trans-PtCl(NH3)2}2µ-(trans-Pt(NH3)2(H2N(CH2)6NH2)2)]4+) belongs to the polynuclear class of platinum-based anticancer agents. DNA adducts of this complex differ significantly in structure and type from those of clinically used mononuclear platinum complexes, especially, long-range (Pt, Pt) intrastrand and interstrand cross-links are formed in both 5′–5′ and 3′–3′ orientations. We show employing short oligonucleotide duplexes containing single, site-specific cross-links of BBR3464 and gel electrophoresis that in contrast to major DNA adducts of clinically used platinum complexes, under physiological conditions the coordination bonds between platinum and N7 of G residues involved in the cross-links of BBR3464 can be cleaved. This cleavage may lead to the linkage isomerization reactions between this metallodrug and double-helical DNA. Differential scanning calorimetry of duplexes containing single, site-specific cross-links of BBR3464 reveals that one of the driving forces that leads to the lability of DNA cross-links of this metallodrug is a difference between the thermodynamic destabilization induced by the cross-link and by the adduct into which it could isomerize. The rearrangements may proceed in the way that cross-links originally formed in one strand of DNA can spontaneously translocate from one DNA strand to its complementary counterpart, which may evoke walking of the platinum complex on DNA molecule. PMID:20833634
Ensuring an exit strategy: RTEL1 restricts rogue recombination.
Villeneuve, Anne M
2008-10-17
Success of homologous recombination-based DNA repair depends not only on recombinases, which promote invasion of the homologous DNA duplex that serves as a template for repair, but also on antirecombinases, which dismantle recombination intermediates to allow completion of repair. In this issue, Barber et al. (2008) identify a previously elusive antirecombinase activity important for maintaining genome stability in animals.
DNA hybridization kinetics: zippering, internal displacement and sequence dependence.
Ouldridge, Thomas E; Sulc, Petr; Romano, Flavio; Doye, Jonathan P K; Louis, Ard A
2013-10-01
Although the thermodynamics of DNA hybridization is generally well established, the kinetics of this classic transition is less well understood. Providing such understanding has new urgency because DNA nanotechnology often depends critically on binding rates. Here, we explore DNA oligomer hybridization kinetics using a coarse-grained model. Strand association proceeds through a complex set of intermediate states, with successful binding events initiated by a few metastable base-pairing interactions, followed by zippering of the remaining bonds. But despite reasonably strong interstrand interactions, initial contacts frequently dissociate because typical configurations in which they form differ from typical states of similar enthalpy in the double-stranded equilibrium ensemble. Initial contacts must be stabilized by two or three base pairs before full zippering is likely, resulting in negative effective activation enthalpies. Non-Arrhenius behavior arises because the number of base pairs required for nucleation increases with temperature. In addition, we observe two alternative pathways-pseudoknot and inchworm internal displacement-through which misaligned duplexes can rearrange to form duplexes. These pathways accelerate hybridization. Our results explain why experimentally observed association rates of GC-rich oligomers are higher than rates of AT- rich equivalents, and more generally demonstrate how association rates can be modulated by sequence choice.
Yeh, Joanne I; Shivachev, Boris; Rapireddy, Srinivas; Crawford, Matthew J; Gil, Roberto R; Du, Shoucheng; Madrid, Marcela; Ly, Danith H
2010-08-11
We have determined the structure of a PNA-DNA duplex to 1.7 A resolution by multiple-wavelength anomalous diffraction phasing method on a zinc derivative. This structure represents the first high-resolution 3D view of a hybrid duplex containing a contiguous chiral PNA strand with complete gamma-backbone modification ("gammaPNA"). Unlike the achiral counterpart, which adopts a random-fold, this particular gammaPNA is already preorganized into a right-handed helix as a single strand. The new structure illustrates the unique characteristics of this modified PNA, possessing conformational flexibility while maintaining sufficient structural integrity to ultimately adopt the preferred P-helical conformation upon hybridization with DNA. The unusual structural adaptability found in the gammaPNA strand is crucial for enabling the accommodation of backbone modifications while constraining conformational states. In conjunction with NMR analysis characterizing the structures and substructures of the individual building blocks, these results provide unprecedented insights into how this new class of chiral gammaPNA is preorganized and stabilized, before and after hybridization with a cDNA strand. Such knowledge is crucial for the future design and development of PNA for applications in biology, biotechnology, and medicine.
Discovery of fur seal feces-associated circular DNA virus in swine feces in Japan.
Oba, Mami; Katayama, Yukie; Naoi, Yuki; Tsuchiaka, Shinobu; Omatsu, Tsutomu; Okumura, Atsushi; Nagai, Makoto; Mizutani, Tetsuya
2017-10-07
Fur seal feces-associated circular ssDNA virus (FSfaCV) was discovered in a pig for the first time in Japan using a next-generation sequencer with duplex-specific nuclease. Full genome of the virus showed approximately 92% similarity to FSfaCVs from New Zealand fur seals. Furthermore, we investigated the prevalence of the ssDNA virus in 85 piglets in Japan, and 65 piglets were positive (76%) for the virus.
Yazaki, A; Ohno, S
1983-01-01
Within the published 2,168-base-long mouse C mu gene of Ig heavy chain consisting of four coding and four noncoding segments, 2 base decamers, 8 nonomers, and 39 octamers recurred. Recurring base heptamers (about 100) and hexamers (about 350) were simply too numerous to merit individual identification. In spite of extensive overlaps between these recurring base decamers to hexamers, they occupied nearly the entire length of mouse Ig C mu gene. As with other genes of the beta-sheet-forming beta 2-microglobulin family, the Ig C mu gene (flanking and intervening noncoding sequences included) is not a unique sequence but rather it is degenerate repeats of the 45-base-long primordial building-block sequence uniquely its own. This primordial building block must originally have specified the 15-amino-acid-residue-long primordial arm of beta-sheet-forming loops, the characteristics of the beta 2-microglobulin family of polypeptides. PMID:6403948
Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki
2015-12-02
In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
A polymerase chain reaction strategy for the diagnosis of camelpox.
Balamurugan, Vinayagamurthy; Bhanuprakash, Veerakyathappa; Hosamani, Madhusudhan; Jayappa, Kallesh Danappa; Venkatesan, Gnanavel; Chauhan, Bina; Singh, Raj Kumar
2009-03-01
Camelpox is a contagious viral skin disease that is mostly seen in young camels. The disease is caused by the Camelpox virus (CMLV). In the present study, a polymerase chain reaction (PCR) assay based on the C18L gene (encoding ankyrin repeat protein) and a duplex PCR based on the C18L and DNA polymerase (DNA pol) genes were developed. The former assay yields a specific amplicon of 243 bp of the C18L gene, whereas the duplex PCR yields 243- and 96-bp products of the C18L and DNA pol genes, respectively, in CMLV, and only a 96-bp product of the DNA pol gene in other orthopoxviruses. The limit of detection was as low as 0.4 ng of viral DNA. Both PCR assays were employed successfully for the direct detection and differentiation of CMLV from other orthopoxviruses, capripoxviruses, and parapoxviruses in both cell culture samples and clinical material. Furthermore, a highly sensitive SYBR Green dye-based, real-time PCR was optimized for quantitation of CMLV DNA. In the standard curve of the quantitative assay, the melting temperature of the specific amplicon at 77.6 degrees C with peak measured fluorescence in dissociation plot was observed with an efficiency of 102%. To the authors' knowledge, this is the first report to describe a C18L gene-based PCR for specific diagnosis of camelpox infection.
Cui, Yunxi; Kong, Deming; Ghimire, Chiran; Xu, Cuixia; Mao, Hanbin
2016-04-19
G-Quadruplex and i-motif are tetraplex structures that may form in opposite strands at the same location of a duplex DNA. Recent discoveries have indicated that the two tetraplex structures can have conflicting biological activities, which poses a challenge for cells to coordinate. Here, by performing innovative population analysis on mechanical unfolding profiles of tetraplex structures in double-stranded DNA, we found that formations of G-quadruplex and i-motif in the two complementary strands are mutually exclusive in a variety of DNA templates, which include human telomere and promoter fragments of hINS and hTERT genes. To explain this behavior, we placed G-quadruplex- and i-motif-hosting sequences in an offset fashion in the two complementary telomeric DNA strands. We found simultaneous formation of the G-quadruplex and i-motif in opposite strands, suggesting that mutual exclusivity between the two tetraplexes is controlled by steric hindrance. This conclusion was corroborated in the BCL-2 promoter sequence, in which simultaneous formation of two tetraplexes was observed due to possible offset arrangements between G-quadruplex and i-motif in opposite strands. The mutual exclusivity revealed here sets a molecular basis for cells to efficiently coordinate opposite biological activities of G-quadruplex and i-motif at the same dsDNA location.
Ethidium and proflavine binding to a 2',5'-linked RNA duplex.
Horowitz, Eric D; Hud, Nicholas V
2006-12-06
Despite over 40 years of physical investigations, fundamental questions persist regarding the energetics of RNA and DNA intercalation. The dramatic unwinding of a nucleic acid duplex upon intercalation immediately suggests that the nucleic acid backbone should play a significant role in dictating the free energy of intercalation. However, the contribution of the backbone to intercalation free energy is difficult to appreciate given the intertwined energetics associated with intercalation (e.g., pi-pi stacking and solvent effects). Fluorescence titrations were used to determine the association constants of two known intercalators, proflavine and ethidium, for duplex 2',5'-linked RNA. Proflavine was found to bind 2',5' RNA with an association constant 25-fold greater than that measured for standard, 3',5'-linked RNA. In contrast, ethidium binds 2',5' RNA less favorably than standard RNA.
Ruan, Jia; Li, Ming; Liu, Ya-Pan; Li, Yuan-Qian; Li, Yong-Xin
2013-03-15
Cronobacter spp. (Enterobacter sakazakii) is an emerging opportunistic pathogen with a 40-80% mortality rate in infants and immunocompromised crowd resulting from the consumption of contaminated food. A novel method for detecting Cronobacter spp. in food samples by duplex polymerase chain reaction (PCR) in combination with capillary electrophoresis-laser induced fluorescence (CE-LIF) detector has been developed. The specific gene sequences of 16S-23S rDNA internal transcribed spacer (ITS) and the outer membrane protein A (OmpA) of Cronobacter spp. were amplified by duplex PCR. The PCR products were separated and determined sensitively by CE-LIF within 12min. The relative standard deviations of migration time for the detected DNA fragments were 2.01-2.91%. The detection limit was as low as 1.6×10(1)cfu/mL of Cronobacter spp. Besides, the specificity of the method was verified by 24 non-Cronobacter bacterial strains. A total of 120 commercial infant food formula were tested for the presence of Cronobacter spp. by using the proposed method. This current study demonstrates that the combination of CE-LIF method with duplex PCR is rapid, sensitive and environmental friendly, and has the potential to be adapted for the routine detection of Cronobacter spp. in food samples. To the best of our knowledge, this is the first use of CE-LIF for the detection of Cronobacter spp. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.
Development of a one-step duplex RT-qPCR for the quantification of phocine distemper virus.
Bogomolni, Andrea L; Frasca, Salvatore; Matassa, Keith A; Nielsen, Ole; Rogers, Kara; De Guise, Sylvain
2015-04-01
Worldwide, stranded marine mammals and the network personnel who respond to marine mammal mortality have provided much of the information regarding marine morbillivirus infections. An assay to determine the amount of virus present in tissue samples would be useful to assist in routine surveying of animal health and for monitoring large-scale die-off events. False negatives from poor-quality samples prevent determination of the true extent of infection, while only small amounts of tissue samples or archived RNA may be available at the time of collection for future retrospective analysis. We developed a one-step duplex real-time reverse transcriptase-quantitative-PCR assay (RT-qPCR) based on Taqman probe technology to quantify phocine distemper virus (PDV) isolated from an outbreak in harbor (Phoca vitulina concolor) and gray seals (Halichoerus grypus) along the northeast US coast in 2006. The glyceraldehyde-3-phosphate-dehydrogenase (GAPDH) gene was selected to assess RNA quality. This duplex assay is specific for PDV and sensitive through a range of 10(0) to 10(9) copies ds-plasmid DNA. For the GAPDH target, the reaction in duplex amplified 10(0) to 10(9) copies of ds-plasmid DNA and was detectable in multiple seal species. This assay reduced the likelihood of false negative results due to degradation of tissues and well-to-well variability while providing sensitive and specific detection of PDV, which would be applicable in molecular epidemiologic studies and pathogen detection in field and laboratory investigations involving a variety of seal species.
All-Atom Polarizable Force Field for DNA Based on the Classical Drude Oscillator Model
Savelyev, Alexey; MacKerell, Alexander D.
2014-01-01
Presented is a first generation atomistic force field for DNA in which electronic polarization is modeled based on the classical Drude oscillator formalism. The DNA model is based on parameters for small molecules representative of nucleic acids, including alkanes, ethers, dimethylphosphate, and the nucleic acid bases and empirical adjustment of key dihedral parameters associated with the phosphodiester backbone, glycosidic linkages and sugar moiety of DNA. Our optimization strategy is based on achieving a compromise between satisfying the properties of the underlying model compounds in the gas phase targeting QM data and reproducing a number of experimental properties of DNA duplexes in the condensed phase. The resulting Drude force field yields stable DNA duplexes on the 100 ns time scale and satisfactorily reproduces (1) the equilibrium between A and B forms of DNA and (2) transitions between the BI and BII sub-states of B form DNA. Consistency with the gas phase QM data for the model compounds is significantly better for the Drude model as compared to the CHARMM36 additive force field, which is suggested to be due to the improved response of the model to changes in the environment associated with the explicit inclusion of polarizability. Analysis of dipole moments associated with the nucleic acid bases shows the Drude model to have significantly larger values than those present in CHARMM36, with the dipoles of individual bases undergoing significant variations during the MD simulations. Additionally, the dipole moment of water was observed to be perturbed in the grooves of DNA. PMID:24752978
2013-01-01
SUBJECT TERMS DNA nanotechnology, purification, origami , 2d arrays Philip S. Lukeman St. John’s University, New York 8000 Utopia Parkway Queens, NY... origami ; DNA double-crossover (“DX”) tile based arrays5 have been constructed using PNA6 and LNA7 oligonucleotides. RNA/ DNA duplexes have been used8 for...the assembly of multiply armed tiles9 and as a template10 to fold DNA origami ;11 all-RNA systems known as ‘tecto-RNA’ have been used to generate a wide
NASA Astrophysics Data System (ADS)
Yalçın, Ergin; Duyar, Halil; Ihmels, Heiko; Seferoğlu, Zeynel
2018-05-01
An improved microwave-induced synthesis of five ethidium derivatives (Ethidium derivatives, 2a-d) is presented. As the derivatives 2a-d have been proposed previously to be telomerase inhibitors, the binding interactions of these ethidium derivatives with G-quadruplex DNA were evaluated by means of photometric and fluorimetric titration, thermal DNA denaturation, CD and 1H NMR spectroscopy. In particular, the compound bearing 3,8-bis(pyrrolidin-1-yl)propanamido substituent 2a exhibits high selectivity for G-quadruplex DNA relative to duplex DNA.
Hughesman, Curtis B; Turner, Robin F B; Haynes, Charles A
2011-06-14
Melting thermodynamic data obtained by differential scanning calorimetry (DSC) are reported for 43 duplexed oligonucleotides containing one or more locked nucleic acid (LNA) substitutions. The measured heat capacity change (ΔC(p)) for the helix-to-coil transition is used to compute the changes in enthalpy and entropy for melting of an LNA-bearing duplex at the T(m) of its corresponding isosequential unmodified DNA duplex to allow rigorous thermodynamic analysis of the stability enhancements provided by LNA substitutions. Contrary to previous studies, our analysis shows that the origin of the improved stability is almost exclusively a net reduction (ΔΔS° < 0) in the entropy gain accompanying the helix-to-coil transition, with the magnitude of the reduction dependent on the type of nucleobase and its base pairing properties. This knowledge and our average measured value for ΔC(p) of 42 ± 11 cal mol(-1) K(-1) bp(-1) are then used to derive a new model that accurately predicts melting thermodynamics and the increased melting temperature (ΔT(m)) of heteroduplexes formed between an unmodified DNA strand and a complementary strand containing any number and configuration of standard LNA nucleotides A, T, C, and G. This single-base thermodynamic (SBT) model requires only four entropy-related parameters in addition to ΔC(p). Finally, DSC data for 20 duplexes containing the nucleobase-modified LNAs 2-aminoadenine (D) and 2-thiothymine (H) are reported and used to determine SBT model parameters for D and H. The data and model suggest that along with the greater stability enhancement provided by D and H bases relative to their corresponding A and T analogues, the unique pseudocomplementary properties of D-H base pairs may make their use appealing for in vitro and in vivo applications.
M-DNA is stabilised in G•C tracts or by incorporation of 5-fluorouracil
Wood, David O.; Dinsmore, Michael J.; Bare, Grant A.; Lee, Jeremy S.
2002-01-01
M-DNA is a complex between the divalent metal ions Zn2+, Ni2+ and Co2+ and duplex DNA which forms at a pH of ∼8.5. The stability and formation of M-DNA was monitored with an ethidium fluorescence assay in order to assess the relationship between pH, metal ion concentration, DNA concentration and the base composition. The dismutation of calf thymus DNA exhibits hysteresis with the formation of M-DNA occurring at a higher pH than the reconversion of M-DNA back to B-DNA. Hysteresis is most prominent with the Ni form of M-DNA where complete reconversion to B-DNA takes several hours even in the presence of EDTA. Increasing the DNA concentration leads to an increase in the metal ion concentration required for M-DNA formation. Both poly(dG)•poly(dC) and poly(dA)•poly(dT) formed M-DNA more readily than the corresponding mixed sequence DNAs. For poly(dG)•(poly(dC) M-DNA formation was observed at pH 7.4 with 0.5 mM ZnCl2. Modified bases were incorporated into a 500 bp fragment of phage λ DNA by polymerase chain reaction. DNAs in which guanine was replaced with hypoxanthine or thymine with 5-fluorouracil formed M-DNA at pHs below 8 whereas substitutions such as 2-aminoadenine and 5-methylcytosine had little effect. Poly[d(A5FU)] also formed a very stable M-DNA duplex as judged from Tm measurements. It is evident that the lower the pKa of the imino proton of the base, the lower the pH at which M-DNA will form; a finding that is consistent with the replacement of the imino proton with the metal ion. PMID:12000844
NASA Technical Reports Server (NTRS)
Hu, Shaowen; Cucinotta, Francis A.
2009-01-01
The Ku70/80 heterodimer is the first repair protein in the initial binding of double-strand break (DSB) ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. In this study we constructed a full-length human Ku70 structure based on its crystal structure, and performed 20 ns conventional molecular dynamic (CMD) simulations on this protein and several other complexes with short DNA duplexes of different sequences. The trajectories of these simulations indicated that, without the topological support of Ku80, the residues in the bridge and C-terminal arm of Ku70 are more flexible than other experimentally identified domains. We studied the two missing loops in the crystal structure and predicted that they are also very flexible. Simulations revealed that they make an important contribution to the Ku70 interaction with DNA. Dislocation of the previously studied SAP domain was observed in several systems, implying its role in DNA binding. Targeted molecular dynamic (TMD) simulation was also performed for one system with a far-away 14bp DNA duplex. The TMD trajectory and energetic analysis disclosed detailed interactions of the DNA-binding residues during the DNA dislocation, and revealed a possible conformational transition for a DSB end when encountering Ku70 in solution. Compared to experimentally based analysis, this study identified more detailed interactions between DNA and Ku70. Free energy analysis indicated Ku70 alone is able to bind DNA with relatively high affinity, with consistent contributions from various domains of Ku70 in different systems. The functional implications of these domains in the processes of Ku heterodimerization and DNA damage recognition and repair can be characterized in detail based upon this analysis.
Nonin, S; Leroy, J L
1996-08-23
At slightly acidic pH, protonation of C-rich oligomers results in the formation of a four-stranded structure composed of two parallel duplexes in a head to tail orientation with their hemi-protonated C.C+ pairs intercalated in a so-called i-motif. In all cases reported previously the duplexes are identical. The tetramer formed by the d(5mCCTCC) oligomer is different. The structure is computed on the basis of 55 inter-residue distances derived from NOESY cross-peaks measured at short mixing times. It consists of two intercalated non-equivalent symmetrical duplexes. The base stacking order is C5* C1 C4* C2 (T3*) T3 C2* C4 C1* C5, but the thymidine bases (T3*) of one duplex are looped out and lie in the wide grooves of the tetramer. The thymidine bases T3 stack as a symmetrical T.T pair between the sequentially adjacent C2.C2+ pair and the C2*.C2*+ pair of the other duplex. Numerous exchange cross-peaks provide evidence for duplex interconversion. The interconversion rate is 1.4 s-1 at 0 degree C and the activation energy is 94 kJ/mol. The opening of the T3.T3 pair, the closing of the T3*.T3 pair, and the opening of the C2*.C2*+ pair occur simultaneously with the duplex interconversion. This suggests that the concerted opening and closing of the thymidine bases drive the duplex interconversion. Opening of the C4.C4+ and C4*.C4*+ pairs, and dissociation of the tetramer are not part of the interconversion since they occur at much slower rates. Duplex interconversion within the [d(5mCCTCC)]4 tetramer provides the first structural and kinetics characterization of broken symmetry in a biopolymer. The tetramer formed by d(5mCCUCC) adopts a similar structure, but the rate of duplex interconversion is faster: 40 s-1 at 0 degree C. At 32 degrees C, interconversion is fast on the NMR time scale.
Dou, Baoting; Yang, Jianmei; Shi, Kai; Yuan, Ruo; Xiang, Yun
2016-09-15
We describe here the development of a sensitive and convenient electronic sensor for the detection of antibodies in human serums. The sensor is constructed by self-assembly formation of a mixed monolayer containing the small molecule epitope conjugated double stranded DNA probes on gold electrode. The target antibody binds the epitope on the dsDNA probe and lowers the melting temperature of the duplex, which facilitates the displacement of the antibody-linked strand of the duplex probe by an invading methylene blue-tagged single stranded DNA (MB-ssDNA) through the strand displacement reaction and leads to the capture of many MB-ssDNA on the sensor surface. Subsequent electrochemical oxidation of the methylene blue labels results in amplified current response for sensitive monitoring of the antibodies. The antibody assay conditions are optimized and the sensor exhibits a linear range between 1.0 and 25.0nM with a detection limit of 0.67nM for the target antibody. The sensor is also selective and can be employed to detect the target antibodies in human serum samples. With the advantages of using small molecule epitope as the antibody recognition element over traditional antigen, the versatile manipulability of the DNA probes and the unique properties of the electrochemical transduction technique, the developed sensor thus hold great potential for simple and sensitive detection of different antibodies and other proteins in real samples. Copyright © 2016 Elsevier B.V. All rights reserved.
Bombyx mori Nucleopolyhedrovirus Encodes a DNA-Binding Protein Capable of Destabilizing Duplex DNA
Mikhailov, Victor S.; Mikhailova, Alla L.; Iwanaga, Masashi; Gomi, Sumiko; Maeda, Susumu
1998-01-01
A DNA-binding protein (designated DBP) with an apparent molecular mass of 38 kDa was purified to homogeneity from BmN cells (derived from Bombyx mori) infected with the B. mori nucleopolyhedrovirus (BmNPV). Six peptides obtained after digestion of the isolated protein with Achromobacter protease I were partially or completely sequenced. The determined amino acid sequences indicated that DBP was encoded by an open reading frame (ORF16) located at nucleotides (nt) 16189 to 17139 in the BmNPV genome (GenBank accession no. L33180). This ORF (designated dbp) is a homolog of Autographa californica multicapsid NPV ORF25, whose product has not been identified. BmNPV DBP is predicted to contain 317 amino acids (calculated molecular mass of 36.7 kDa) and to have an isoelectric point of 7.8. DBP showed a tendency to multimerization in the course of purification and was found to bind preferentially to single-stranded DNA. When bound to oligonucleotides, DBP protected them from hydrolysis by phage T4 DNA polymerase-associated 3′→5′ exonuclease. The sizes of the protected fragments indicated that a binding site size for DBP is about 30 nt per protein monomer. DBP, but not BmNPV LEF-3, was capable of unwinding partial DNA duplexes in an in vitro system. This helix-destabilizing ability is consistent with the prediction that DBP functions as a single-stranded DNA binding protein in virus replication. PMID:9525636
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N.
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures. PMID:23285245
Nadai, Matteo; Palù, Giorgio; Palumbo, Manlio; Richter, Sara N
2012-01-01
Non-canonical DNA structures have been postulated to mediate protein-nucleic acid interactions and to function as intermediates in the generation of frame-shift mutations when errors in DNA replication occur, which result in a variety of diseases and cancers. Compounds capable of binding to non-canonical DNA conformations may thus have significant diagnostic and therapeutic potential. Clerocidin is a natural diterpenoid which has been shown to selectively react with single-stranded bases without targeting the double helix. Here we performed a comprehensive analysis on several non-canonical DNA secondary structures, namely mismatches, nicks, bulges, hairpins, with sequence variations in both the single-stranded region and the double-stranded flanking segment. By analysis of clerocidin reactivity, we were able to identify the exposed reactive residues which provided information on both the secondary structure and the accessibility of the non-paired sites. Mismatches longer than 1 base were necessary to be reached by clerocidin reactive groups, while 1-base nicks were promptly targeted by clerocidin; in hairpins, clerocidin reactivity increased with the length of the hairpin loop, while, interestingly, reactivity towards bulges reached a maximum in 3-base-long bulges and declined in longer bulges. Electrophoretic mobility shift analysis demonstrated that bulges longer than 3 bases (i.e. 5- and 7-bases) folded or stacked on the duplex region therefore being less accessible by the compound. Clerocidin thus represents a new valuable diagnostic tool to dissect DNA secondary structures.
Kim, Mi-Ju; Kim, Hae-Yeong
2018-04-25
A multiple loop-mediated isothermal amplification (LAMP) method was developed to detect cow and goat milk in the field using a portable fluorescence device. For rapid on-site detection, this duplex LAMP assay was used in combination with direct amplification, without DNA extraction. The cow- and goat-specific LAMP primer sets were designed based on the mitochondrial cytochrome b gene, and showed specificity against 13 other animal species in the reactions. The sensitivity of the duplex LAMP assay for cow and goat was 0.1 and 1 pg, respectively. The detection limit for both target species in milk mixtures was 2%. This assay successfully amplified and identified the two target species in 24 samples of commercial milk and yogurt products, with 30 min sampling-to-result analysis time. Therefore, this direct duplex real-time LAMP assay is useful for on-site simultaneous detection of cow and goat milk in commercial products, a capability needed to confirm accurate labeling. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kim, Mi-Ju; Lee, Shin-Young; Kim, Hyun-Joong; Lee, Jeong Su; Joo, In Sun; Kwak, Hyo Sun; Kim, Hae-Yeong
2016-08-28
The simultaneous detection and accurate identification of hepatitis A virus (HAV) is critical in food safety and epidemiological studies to prevent the spread of HAV outbreaks. Towards this goal, a one-step duplex reverse-transcription (RT)-PCR method was developed targeting the VP1/P2B and VP3/VP1 regions of the HAV genome for the qualitative detection of HAV. An HAV RT-qPCR standard curve was produced for the quantification of HAV RNA. The detection limit of the duplex RT-PCR method was 2.8 × 10(1) copies of HAV. The PCR products enabled HAV genotyping analysis through DNA sequencing, which can be applied for epidemiological investigations. The ability of this duplex RT-PCR method to detect HAV was evaluated with HAV-spiked samples of fresh lettuce, frozen strawberries, and oysters. The limit of detection of the one-step duplex RT-PCR for each food model was 9.4 × 10(2) copies/20 g fresh lettuce, 9.7 × 10(3) copies/20 g frozen strawberries, and 4.1 × 10(3) copies/1.5 g oysters. Use of a one-step duplex RT-PCR method has advantages such as shorter time, decreased cost, and decreased labor owing to the single amplification reaction instead of four amplifications necessary for nested RT-PCR.
Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA
NASA Technical Reports Server (NTRS)
Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.
1982-01-01
The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.
Diepoxybutane Interstrand Cross-Links Induce DNA Bending
Millard, Julie T.; McGowan, Erin E.; Bradley, Sharonda Q.
2011-01-01
The bifunctional alkylating agent 1,2,3,4-diepoxybutane (DEB) is thought to be a major contributor to the carcinogenicity of 1,3-butadiene, from which it is derived in vivo. DEB forms DNA interstrand cross-links primarily between distal deoxyguanosine residues at the duplex sequence 5’-GNC. In order for the short butanediol tether to span this distance, distortion of the DNA target has been postulated. We determined that the electrophoretic mobility of ligated DNA oligomers containing DEB cross-links was retarded in comparison with control, uncross-linked DNA. Our data are consistent with DNA bending of ~34° per lesion towards the major groove. PMID:21839139
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
DNA Polymorphism: A Comparison of Force Fields for Nucleic Acids
Reddy, Swarnalatha Y.; Leclerc, Fabrice; Karplus, Martin
2003-01-01
The improvements of the force fields and the more accurate treatment of long-range interactions are providing more reliable molecular dynamics simulations of nucleic acids. The abilities of certain nucleic acid force fields to represent the structural and conformational properties of nucleic acids in solution are compared. The force fields are AMBER 4.1, BMS, CHARMM22, and CHARMM27; the comparison of the latter two is the primary focus of this paper. The performance of each force field is evaluated first on its ability to reproduce the B-DNA decamer d(CGATTAATCG)2 in solution with simulations in which the long-range electrostatics were treated by the particle mesh Ewald method; the crystal structure determined by Quintana et al. (1992) is used as the starting point for all simulations. A detailed analysis of the structural and solvation properties shows how well the different force fields can reproduce sequence-specific features. The results are compared with data from experimental and previous theoretical studies. PMID:12609851
Pipathsouk, Anne; Belotserkovskii, Boris P; Hanawalt, Philip C
2017-02-01
Non-canonical DNA structures can obstruct transcription. This transcription blockage could have various biological consequences, including genomic instability and gratuitous transcription-coupled repair. Among potential structures causing transcription blockage are Holliday junctions (HJs), which can be generated as intermediates in homologous recombination or during processing of stalled replication forks. Of particular interest is the double Holliday junction (DHJ), which contains two HJs. Topological considerations impose the constraint that the total number of helical turns in the DNA duplexes between the junctions cannot be altered as long as the flanking DNA duplexes are intact. Thus, the DHJ structure should strongly resist transient unwinding during transcription; consequently, it is predicted to cause significantly stronger blockage than single HJ structures. The patterns of transcription blockage obtained for RNA polymerase II transcription in HeLa cell nuclear extracts were in accordance with this prediction. However, we did not detect transcription blockage with purified T7 phage RNA polymerase; we discuss a possible explanation for this difference. In general, our findings implicate naturally occurring Holliday junctions in transcription arrest. Copyright © 2016 Elsevier B.V. All rights reserved.
DNA denaturation bubbles: free-energy landscape and nucleation/closure rates.
Sicard, François; Destainville, Nicolas; Manghi, Manoel
2015-01-21
The issue of the nucleation and slow closure mechanisms of non-superhelical stress-induced denaturation bubbles in DNA is tackled using coarse-grained MetaDynamics and Brownian simulations. A minimal mesoscopic model is used where the double helix is made of two interacting bead-spring rotating strands with a prescribed torsional modulus in the duplex state. We demonstrate that timescales for the nucleation (respectively, closure) of an approximately 10 base-pair bubble, in agreement with experiments, are associated with the crossing of a free-energy barrier of 22 kBT (respectively, 13 kBT) at room temperature T. MetaDynamics allows us to reconstruct accurately the free-energy landscape, to show that the free-energy barriers come from the difference in torsional energy between the bubble and duplex states, and thus to highlight the limiting step, a collective twisting, that controls the nucleation/closure mechanism, and to access opening time scales on the millisecond range. Contrary to small breathing bubbles, those more than 4 base-pair bubbles are of biological relevance, for example, when a pre-existing state of denaturation is required by specific DNA-binding proteins.
Yang, Haozhe; Seela, Frank
2016-01-22
A highly effective and convenient "bis-click" strategy was developed for the template-independent circularization of single-stranded oligonucleotides by employing copper(I)-assisted azide-alkyne cycloaddition. Terminal triple bonds were incorporated at both ends of linear oligonucleotides. Alkynylated 7-deaza-2'-deoxyadenosine and 2'-deoxyuridine residues with different side chains were used in solid-phase synthesis with phosphoramidite chemistry. The bis-click ligation of linear 9- to 36-mer oligonucleotides with 1,4-bis(azidomethyl)benzene afforded circular DNA in a simple and selective way; azido modification of the oligonucleotide was not necessary. Short ethynyl side chains were compatible with the circularization of longer oligonucleotides, whereas octadiynyl residues were used for short 9-mers. Compared with linear duplexes, circular bis-click constructs exhibit a significantly increased duplex stability over their linear counterparts. The intramolecular bis-click ligation protocol is not limited to DNA, but may also be suitable for the construction of other macrocycles, such as circular RNAs, peptides, or polysaccharides. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Nucleic Acid Chaperone Activity of the ORF1 Protein from the Mouse LINE-1 Retrotransposon
Martin, Sandra L.; Bushman, Frederic D.
2001-01-01
Non-LTR retrotransposons such as L1 elements are major components of the mammalian genome, but their mechanism of replication is incompletely understood. Like retroviruses and LTR-containing retrotransposons, non-LTR retrotransposons replicate by reverse transcription of an RNA intermediate. The details of cDNA priming and integration, however, differ between these two classes. In retroviruses, the nucleocapsid (NC) protein has been shown to assist reverse transcription by acting as a “nucleic acid chaperone,” promoting the formation of the most stable duplexes between nucleic acid molecules. A protein-coding region with an NC-like sequence is present in most non-LTR retrotransposons, but no such sequence is evident in mammalian L1 elements or other members of its class. Here we investigated the ORF1 protein from mouse L1 and found that it does in fact display nucleic acid chaperone activities in vitro. L1 ORF1p (i) promoted annealing of complementary DNA strands, (ii) facilitated strand exchange to form the most stable hybrids in competitive displacement assays, and (iii) facilitated melting of an imperfect duplex but stabilized perfect duplexes. These findings suggest a role for L1 ORF1p in mediating nucleic acid strand transfer steps during L1 reverse transcription. PMID:11134335
Simplex and duplex event-specific analytical methods for functional biotech maize.
Lee, Seong-Hun; Kim, Su-Jeong; Yi, Bu-Young
2009-08-26
Analytical methods are very important in the control of genetically modified organism (GMO) labeling systems or living modified organism (LMO) management for biotech crops. Event-specific primers and probes were developed for qualitative and quantitative analysis for biotech maize event 3272 and LY 038 on the basis of the 3' flanking regions, respectively. The qualitative primers confirmed the specificity by a single PCR product and sensitivity to 0.05% as a limit of detection (LOD). Simplex and duplex quantitative methods were also developed using TaqMan real-time PCR. One synthetic plasmid was constructed from two taxon-specific DNA sequences of maize and two event-specific 3' flanking DNA sequences of event 3272 and LY 038 as reference molecules. In-house validation of the quantitative methods was performed using six levels of mixing samples, from 0.1 to 10.0%. As a result, the biases from the true value and the relative deviations were all within the range of +/-30%. Limits of quantitation (LOQs) of the quantitative methods were all 0.1% for simplex real-time PCRs of event 3272 and LY 038 and 0.5% for duplex real-time PCR of LY 038. This study reports that event-specific analytical methods were applicable for qualitative and quantitative analysis for biotech maize event 3272 and LY 038.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
McManus, Hilary A; Sanchez, Daniel J; Karol, Kenneth G
2017-01-01
Comparative studies of chloroplast genomes (plastomes) across the Chlorophyceae are revealing dynamic patterns of size variation, gene content, and genome rearrangements. Phylogenomic analyses are improving resolution of relationships, and uncovering novel lineages as new plastomes continue to be characterized. To gain further insight into the evolution of the chlorophyte plastome and increase the number of representative plastomes for the Sphaeropleales, this study presents two fully sequenced plastomes from the green algal family Hydrodictyaceae (Sphaeropleales, Chlorophyceae), one from Hydrodictyon reticulatum and the other from Pediastrum duplex . Genomic DNA from Hydrodictyon reticulatum and Pediastrum duplex was subjected to Illumina paired-end sequencing and the complete plastomes were assembled for each. Plastome size and gene content were characterized and compared with other plastomes from the Sphaeropleales. Homology searches using BLASTX were used to characterize introns and open reading frames (orfs) ≥ 300 bp. A phylogenetic analysis of gene order across the Sphaeropleales was performed. The plastome of Hydrodictyon reticulatum is 225,641 bp and Pediastrum duplex is 232,554 bp. The plastome structure and gene order of H. reticulatum and P. duplex are more similar to each other than to other members of the Sphaeropleales. Numerous unique open reading frames are found in both plastomes and the plastome of P. duplex contains putative viral protein genes, not found in other Sphaeropleales plastomes. Gene order analyses support the monophyly of the Hydrodictyaceae and their sister relationship to the Neochloridaceae. The complete plastomes of Hydrodictyon reticulatum and Pediastrum duplex , representing the largest of the Sphaeropleales sequenced thus far, once again highlight the variability in size, architecture, gene order and content across the Chlorophyceae. Novel intron insertion sites and unique orfs indicate recent, independent invasions into each plastome, a hypothesis testable with an expanded plastome investigation within the Hydrodictyaceae.
Fazakerley, G V; Quignard, E; Teoule, R; Guy, A; Guschlbauer, W
1987-09-15
We report two-dimensional NOE (NOESY) spectra on the sequence d(GCGATCATGG).d(CCATGATCGC) which contains the unmethylated dam site. As expected the DNA adopts a B-form conformation but appears to be distorted at the TG step of the second strand. This distorsion, probably bending, is not seen on the opposite strand. When the first strand is methylated on adenine in the GATC or CATG sequence the NOESY spectra indicate little or no change in the conformation. However the single strand-duplex exchange is slowed down to the slow-exchange region on a proton NMR time scale. We have assigned the exchangeable imino and cytidine amino resonances of the three duplexes. From the imino linewidths as a function of temperature, we observe that the unmethylated and the hemimethylated Gm6ATC duplexes melt normally from the ends. However, this is not so for the hemimethylated Cm6ATG duplex which, apart from the terminal base pairs, melts cooperatively and at higher temperature. In spectra recorded in H2O a second duplex is observed, for the Gm6ATC sequence, which we have not been able to identify. It is however unlikely to be a hairpin structure. Ultraviolet-melting curves also indicate the presence of two transitions for this duplex. The effect of methylation upon base-pair lifetimes has been studied by comparing the above three duplexes. Little effect is observed upon methylation in the GATC sequence but a drastic increase in the lifetimes of all base pairs is observed upon methylation in the CATG sequence.
Evidence of Liquid Crystal-Assisted Abiotic Ligation of Nucleic Acids
NASA Astrophysics Data System (ADS)
Fraccia, Tommaso P.; Zanchetta, Giuliano; Rimoldi, Valeria; Clark, Noel A.; Bellini, Tommaso
2015-06-01
The emergence of early life must have been marked by the appearance in the prebiotic era of complex molecular structures and systems, motivating the investigation of conditions that could not only facilitate appropriate chemical synthesis, but also provide the mechanisms of molecular selection and structural templating necessary to pilot the complexification toward specific molecular patterns. We recently proposed and demonstrated that these functions could be afforded by the spontaneous ordering of ultrashort nucleic acids oligomers into Liquid Crystal (LC) phases. In such supramolecular assemblies, duplex-forming oligomers are held in average end-to-end contact to form chemically discontinuous but physically continuous double helices. Using blunt ended duplexes, we found that LC formation could both provide molecular selection mechanisms and boost inter-oligomer ligation. This paper provides an essential extension to this notion by investigating the catalytic effects of LC ordering in duplexes with mutually interacting overhangs. Specifically, we studied the influence of LC ordering of 5'-hydroxy-3'-phosphate partially self-complementary DNA 14mers with 3'-CG sticky-ends, on the efficiency of non-enzymatic ligation reaction induced by water-soluble carbodiimide EDC as condensing agent. We investigated the ligation products in mixtures of DNA with poly-ethylene glycol (PEG) at three PEG concentrations at which the system phase separates creating DNA-rich droplets that organize into isotropic, nematic LC and columnar LC phases. We observe remarkable LC-enhanced chain lengthening, and we demonstrate that such lengthening effectively promotes and stabilizes LC domains, providing the kernel of a positive feedback cycle by which LC ordering promotes elongation, in turn stabilizing the LC ordering.
Mo, Jingjie; Håkansson, Kristina
2007-10-15
We have implemented gas-phase hydrogen/deuterium exchange (HDX) experiments in the external collision cell of a hybrid quadrupole-Fourier transform ion cyclotron resonance mass spectrometer. In this configuration, multiply charged oligonucleotide anions undergo significant exchange with D(2)S at reaction intervals ranging from 0.11 to 60.1 s. For DNA homohexamers, relative exchange rates were dC(6) approximately dA(6) > dG(6) > dT(6), correlating with the gas-phase acidities of nucleobases (C > A > T > G), except for guanine. Our results are consistent with a relay mechanism in which D(2)S interacts with both a backbone phosphate group and a neutral nucleobase through hydrogen bonding. We propose that the faster exchange of polyguanosine compared to polythymidine is due to the larger size of guanine and the orientation of its labile hydrogens, which may result in gas-phase conformations more favorable for forming complexes with D(2)S. Similar trends were observed for RNA homohexamers, although their HDX rates were faster than for DNA, suggesting they can also exchange via another relay process involving the 2'-hydroxyl group. HDX of DNA duplexes further supports the involvement of nucleobase hydrogens because duplexes exchanged slower than their corresponding single strands, presumably due to the intermolecular hydrogen bonds between nucleobases. This work constitutes the first investigation of the mechanisms of oligonucleotide gas-phase HDX. Our results on duplexes show promise for application of this strategy to the characterization of structured nucleic acids.
Development of duplex real-time PCR for the detection of WSSV and PstDV1 in cultivated shrimp.
Leal, Carlos A G; Carvalho, Alex F; Leite, Rômulo C; Figueiredo, Henrique C P
2014-07-05
The White spot syndrome virus (WSSV) and Penaeus stylirostris penstyldensovirus 1 (previously named Infectious hypodermal and hematopoietic necrosis virus-IHHNV) are two of the most important viral pathogens of penaeid shrimp. Different methods have been applied for diagnosis of these viruses, including Real-time PCR (qPCR) assays. A duplex qPCR method allows the simultaneous detection of two viruses in the same sample, which is more cost-effective than assaying for each virus separately. Currently, an assay for the simultaneous detection of the WSSV and the PstDV1 in shrimp is unavailable. The aim of this study was to develop and standardize a duplex qPCR assay for the simultaneous detection of the WSSV and the PstDV1 in clinical samples of diseased L. vannamei. In addition, to evaluate the performance of two qPCR master mixes with regard to the clinical sensitivity of the qPCR assay, as well as, different methods for qPCR results evaluation. The duplex qPCR assay for detecting WSSV and PstDV1 in clinical samples was successfully standardized. No difference in the amplification of the standard curves was observed between the duplex and singleplex assays. Specificities and sensitivities similar to those of the singleplex assays were obtained using the optimized duplex qPCR. The analytical sensitivities of duplex qPCR were two copies of WSSV control plasmid and 20 copies of PstDV1 control plasmid. The standardized duplex qPCR confirmed the presence of viral DNA in 28 from 43 samples tested. There was no difference for WSSV detection using the two kits and the distinct methods for qPCR results evaluation. High clinical sensitivity for PstDV1 was obtained with TaqMan Universal Master Mix associated with relative threshold evaluation. Three cases of simultaneous infection by the WSSV and the PstDV1 were identified with duplex qPCR. The standardized duplex qPCR was shown to be a robust, highly sensitive, and feasible diagnostic tool for the simultaneous detection of the WSSV and the PstDV1 in whiteleg shrimp. The use of the TaqMan Universal Master Mix and the relative threshold method of data analysis in our duplex qPCR method provided optimal levels of sensitivity and specificity.
Highly sensitive self-complementary DNA nanoswitches triggered by polyelectrolytes
NASA Astrophysics Data System (ADS)
Wu, Jincai; Yu, Feng; Zhang, Zheng; Chen, Yong; Du, Jie; Maruyama, Atsushi
2015-12-01
Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation.Dimerization of two homologous strands of genomic DNA/RNA is an essential feature of retroviral replication. Herein we show that a cationic comb-type copolymer (CCC), poly(l-lysine)-graft-dextran, accelerates the dimerization of self-complementary stem-loop DNA, frequently found in functional DNA/RNA molecules, such as aptamers. Furthermore, an anionic polymer poly(sodium vinylsulfonate) (PVS) dissociates CCC from the duplex shortly within a few seconds. Then single stem-loop DNA spontaneously transforms from its dimer. Thus we can easily control the dimer and stem-loop DNA by switching on/off CCC activity. Both polyelectrolytes and DNA concentrations are in the nanomole per liter range. The polyelectrolyte-assisted transconformation and sequences design strategy ensures the reversible state control with rapid response and effective switching under physiologically relevant conditions. A further application of this sensitive assembly is to construct an aptamer-type drug delivery system, bind or release functional molecules responding to its transconformation. Electronic supplementary information (ESI) available: I. Sequences of DIS25, DIS25-2a and DIS25-3a. II. Structural formula of poly(l-lysine)-graft-dextran (PLL-g-Dex). 1H-NMR spectra of PLL-g-Dex in D2O. III. Gel electrophoretic analysis of dimerization of DIS25 with various N/P ratios. IV. The effect of polyelectrolyte on the fluorescence polarity of TAMRA-labeled duplex. V. UV absorption/Tm profiles of DIS25. VI. Arrhenius plots for spontaneous dissociation of the DIS25 dimer and PLL-g-Dex-assisted dimerization of DIS25.VII. Switching between double stem-loop DIS42 and extended multiplex drived by PLL-g-Dex and PVS. See DOI: 10.1039/c5nr05193b
Nick-free formation of reciprocal heteroduplexes: a simple solution to the topological problem.
Wilson, J H
1979-01-01
Because the individual strands of DNA are intertwined, formation of heteroduplex structures between duplexes--as in presumed recombination intermediates--presents a topological puzzle, known as the winding problem. Previous approaches to this problem have assumed that single-strand breaks are required to permit formation of fully coiled heteroduplexes. This paper describes a simple, nick-free solution to the winding problem that satisfies all topological constraints. Homologous duplexes associated by their minor-groove surfaces can switch strand pairing to form reciprocal heteroduplexes that coil together into a compact, four-stranded helix throughout the region of pairing. Model building shows that this fused heteroduplex structure is plausible, being composed entirely of right-handed primary helices with Watson-Crick base pairing throughout. Its simplicity of formation, structural symmetry, and high degree of specificity are suggestive of a natural mechanism for alignment by base pairing between intact homologous duplexes. Implications for genetic recombination are discussed. Images PMID:291028
Kothera, Linda; Byrd, Brian; Savage, Harry M
2017-11-07
Aedes aegypti (L.) and Ae. albopictus (Skuse) are important arbovirus vectors in the United States, and the recent emergence of Zika virus disease as a public health concern in the Americas has reinforced a need for tools to rapidly distinguish between these species in collections made by vector control agencies. We developed a duplex real-time PCR assay that detects both species and does not cross-amplify in any of the other seven Aedes species tested. The lower limit of detection for our assay is equivalent to ∼0.03 of a first-instar larva in a 60-µl sample (0.016 ng of DNA per real-time PCR reaction). The assay was sensitive and specific in mixtures of both species that reflected up to a 2,000-fold difference in DNA concentration. In addition, we developed a simple protocol to extract DNA from sonicated first-instar larvae, and used that DNA to test the assay. Because it uses real-time PCR, the assay saves time by not requiring a separate visualization step. This assay can reduce the time needed for vector control agencies to make species identifications, and thus inform decisions about surveillance and control. Published by Oxford University Press on behalf of Entomological Society of America 2017 This work is written by US Government employees and is in the public domain in the US.
NASA Astrophysics Data System (ADS)
Ma, Kun; Cui, Qinghua; Liu, Guiying; Wu, Fei; Xu, Shujuan; Shao, Yong
2011-07-01
DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Melchior, P.; Suchyta, E.; Huff, E.
2015-03-31
We measure the weak-lensing masses and galaxy distributions of four massive galaxy clusters observed during the Science Verification phase of the Dark Energy Survey. This pathfinder study is meant to 1) validate the DECam imager for the task of measuring weak-lensing shapes, and 2) utilize DECam's large field of view to map out the clusters and their environments over 90 arcmin. We conduct a series of rigorous tests on astrometry, photometry, image quality, PSF modeling, and shear measurement accuracy to single out flaws in the data and also to identify the optimal data processing steps and parameters. We find Sciencemore » Verification data from DECam to be suitable for the lensing analysis described in this paper. The PSF is generally well-behaved, but the modeling is rendered difficult by a flux-dependent PSF width and ellipticity. We employ photometric redshifts to distinguish between foreground and background galaxies, and a red-sequence cluster finder to provide cluster richness estimates and cluster-galaxy distributions. By fitting NFW profiles to the clusters in this study, we determine weak-lensing masses that are in agreement with previous work. For Abell 3261, we provide the first estimates of redshift, weak-lensing mass, and richness. In addition, the cluster-galaxy distributions indicate the presence of filamentary structures attached to 1E 0657-56 and RXC J2248.7-4431, stretching out as far as 1 degree (approximately 20 Mpc), showcasing the potential of DECam and DES for detailed studies of degree-scale features on the sky.« less
Melchior, P.; Suchyta, E.; Huff, E.; ...
2015-03-31
We measure the weak-lensing masses and galaxy distributions of four massive galaxy clusters observed during the Science Verification phase of the Dark Energy Survey. This pathfinder study is meant to 1) validate the DECam imager for the task of measuring weak-lensing shapes, and 2) utilize DECam's large field of view to map out the clusters and their environments over 90 arcmin. We conduct a series of rigorous tests on astrometry, photometry, image quality, PSF modelling, and shear measurement accuracy to single out flaws in the data and also to identify the optimal data processing steps and parameters. We find Sciencemore » Verification data from DECam to be suitable for the lensing analysis described in this paper. The PSF is generally well-behaved, but the modelling is rendered difficult by a flux-dependent PSF width and ellipticity. We employ photometric redshifts to distinguish between foreground and background galaxies, and a red-sequence cluster finder to provide cluster richness estimates and cluster-galaxy distributions. By fitting NFW profiles to the clusters in this study, we determine weak-lensing masses that are in agreement with previous work. For Abell 3261, we provide the first estimates of redshift, weak-lensing mass, and richness. Additionally, the cluster-galaxy distributions indicate the presence of filamentary structures attached to 1E 0657-56 and RXC J2248.7-4431, stretching out as far as 1degree (approximately 20 Mpc), showcasing the potential of DECam and DES for detailed studies of degree-scale features on the sky.« less
Genetic Homologies Among Streptomyces violaceoruber Strains
Monson, A. M.; Bradley, S. G.; Enquist, L. W.; Cruces, Griselda
1969-01-01
Most of the genetic studies on streptomycetes have been done with cultures erroneously designated as Streptomyces coelicolor. To determine whether these cultures are genetically homologous with the S. violaceoruber nominifer, their deoxyribonucleic acids (DNA) were analyzed, and selected pairs of mutants were crossed. The four cultures used in genetic studies, and called S. coelicolor in the literature, were found to constitute a genospecies, based upon DNA hybridization and recombination tests. In addition, DNA from Actinopycnidium caeruleum formed extensive duplexes with S. violaceoruber DNA. S. violaceoruber cultures and A. caeruleum were distinctly different from the S. coelicolor nominifer. PMID:5370275
Procedure for normalization of cDNA libraries
Bonaldo, Maria DeFatima; Soares, Marcelo Bento
1997-01-01
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.
Confirming the 3D Solution Structure of a Short Double-Stranded DNA Sequence Using NMR Spectroscopy
ERIC Educational Resources Information Center
Ruhayel, Rasha A.; Berners-Price, Susan J.
2010-01-01
2D [superscript 1]H NOESY NMR spectroscopy is routinely used to give information on the closeness of hydrogen atoms through space. This work is based on a 2D [superscript 1]H NOESY NMR spectrum of a 12 base-pair DNA duplex. This 6-h laboratory workshop aims to provide advanced-level chemistry students with a basic, yet solid, understanding of how…
Liu, Shasha; Xu, Kunhua; Wu, Zhigang; Xie, Xiao; Feng, Junli
2016-09-01
Tunas are economically important fishery worldwide, and are often used for commercial processed production. For effective fishery management and protection of consumers' rights, it is important to develop a molecular method to identify species in canned tuna products rapidly and reliably. Here, we have developed a duplex quantitative real-time PCR (qPCR) for identification of five highly priced tuna species (Thunnus maccoyii, Thunnus obesus, Thunnus albacares, Thunnus alalunga and Katsuwonus pelamis) from processed as well as fresh fish. After amplification and sequencing of seven genetic markers commonly used for species identification, 16S rDNA and control region (CR) of mitochondrial DNA were selected as the reference gene markers for genus Thunnus and tuna species identification, respectively. Subsequently, a 73 bp fragment of 16S rDNA and 85-99 bp fragment of CR were simultaneously amplified from each target species by qPCR. The qPCR efficiency of each reaction was calculated according to the standard curves, and the method was validated by amplification DNA extracted from single or mixed tuna specimen. The developed duplex qPCR system was applied to authenticate species of 14 commercial tuna products successfully, which demonstrated it was really a useful and academic technique to identify highly priced tuna species.
Polymerase chain reaction system
Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.
2004-03-02
A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.
NASA Astrophysics Data System (ADS)
Rahmawati, E.; Ibrahim, F.; Imran, D.; Sudarmono, P.
2017-08-01
Focal brain lesion is a neurological complication in HIV, which is marked as a space occupying lesion (SOL) and needs rapid and effective treatment. This lesion is mainly caused by encephalitis toxoplasma and primary central nervous system lymphoma related to the Epstein-Barr virus (EBV) infection, which is difficult to distinguish using CT scan or magnetic resonance imaging (MRI). The gold standard of diagnosing focal brain lesion has been brain biopsy, but this examination is an invasive procedure that causes complications. The objective of this study is to obtain the rapid laboratory diagnosis of Toxoplasma gondii (T. gondii) and EBV infection. In this experimental study, blood and cerebrospinal fluid were obtained from HIV patients who were admitted to the Neurology Department of Cipto Mangunkusumo Hospital. The samples were examined using duplex real-time polymerase chain reaction (PCR) to detect T. gondii and EBV. The first step was the optimization of duplex real-time PCR, including the annealing temperature, primer and probe concentration, elution volume, and template volume. Minimal DNA detection was used to measure minimal T. gondii and EBV. Cross reactions were determined for technical specificity using the bacteria and viruses Staphylococcus aureus, Klebsiella pneumonia, Pseudomonas aeruginosa, Mycobacterium tuberculosis H37Rv, Candida spp, cytomegalovirus, herpes zoster virus, and varicella zoster virus. Duplex real-time PCR was applied optimally to patients. In the optimization of duplex real-time PCR, the annealing temperature of T. gondii and EBV were 58 °C, the concentration of primer forward and reverse for T. gondii and EBV were 0.2 μM, the concentration of probe for T. gondii and EBV were 0.4μM and 0.2 μM, respectively. Minimal DNA detection of T. gondii and EBV were 5.68 copy/ml and 1.31 copy/ml, respectively. There was no cross reaction between another bacteria and virus that were used as the primer and probe for T. gondii and EBV. The blood duplex real-time PCR was positive for T. gondii (16%), EBV (40%), and both (16%). The cerebrospinal fluid samples were positive for T. gondii (20%), EBV (28%), and both (4%).
Melting of DNA double strand after binding to geroprotective tetrapeptide.
Khavinson, V Kh; Solovyov, A Yu; Shataeva, L K
2008-11-01
Experimental relationship between the hyperchromic effect of DNA [poly(dA-dT):poly(dA-dT)] interacting with Ala-Glu-Asp-Gly peptide is presented by a saturation isotherm. The free DNA double strand is melting (the strands separate) at 69.5 degrees C and at higher energy expenditures (enthalpy increase by 976.4 kJ/mol b.p.) in comparison with melting of the DNA-peptide complex (28 degrees C and 444.6 kJ/mol b.p.). The detected regularities of melting of duplex DNA and the thermodynamic parameters of this process indicate the natural mechanism of interaction between DNA and regulatory peptides underlying functioning of the living matter.
Mandal, Pradeep K; Collie, Gavin W; Kauffmann, Brice; Huc, Ivan
2014-12-22
Racemates increase the chances of crystallization by allowing molecular contacts to be formed in a greater number of ways. With the advent of protein synthesis, the production of protein racemates and racemic-protein crystallography are now possible. Curiously, racemic DNA crystallography had not been investigated despite the commercial availability of L- and D-deoxyribo-oligonucleotides. Here, we report a study into racemic DNA crystallography showing the strong propensity of racemic DNA mixtures to form racemic crystals. We describe racemic crystal structures of various DNA sequences and folded conformations, including duplexes, quadruplexes, and a four-way junction, showing that the advantages of racemic crystallography should extend to DNA. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparative gene expression in sexual and apomictic ovaries of Pennisetum ciliare (L.) Link.
Vielle-Calzada, J P; Nuccio, M L; Budiman, M A; Thomas, T L; Burson, B L; Hussey, M A; Wing, R A
1996-12-01
Limited emphasis has been given to the molecular study of apomixis, an asexual method of reproduction where seeds are produced without fertilization. Most buffelgrass (Pennisetum ciliare (L.) Link syn = Cenchrus ciliaris L.) genotypes reproduce by obligate apomixis (apospory); however, rare sexual plants have been recovered. A modified differential display procedure was used to compare gene expression in unpollinated ovaries containing ovules with either sexual or apomictic female gametophytes. The modification incorporated end-labeled poly(A)+ anchored primers as the only isotopic source, and was a reliable and consistent approach for detecting differentially displayed transcripts. Using 20 different decamers and two anchor primers, 2268 cDNA fragments between 200 and 600 bp were displayed. From these, eight reproducible differentially displayed cDNAs were identified and cloned. Based on northern analysis, one cDNA was detected in only the sexual ovaries, two cDNAs in only apomictic ovaries and one cDNA was present in both types of ovaries. Three fragments could not be detected and one fragment was detected in ovaries, stems, and leaves. Comparison of gene expression during sexual and apomictic development in buffelgrass represents a new model system and a strategy for investigating female reproductive development in the angiosperms.
Crystal structure of a DNA/Ba2+ G-quadruplex containing a water-mediated C-tetrad.
Zhang, Diana; Huang, Terry; Lukeman, Philip S; Paukstelis, Paul J
2014-12-01
We have determined the 1.50 Å crystal structure of the DNA decamer, d(CCA(CNV)KGCGTGG) ((CNV)K, 3-cyanovinylcarbazole), which forms a G-quadruplex structure in the presence of Ba(2+). The structure contains several unique features including a bulged nucleotide and the first crystal structure observation of a C-tetrad. The structure reveals that water molecules mediate contacts between the divalent cations and the C-tetrad, allowing Ba(2+) ions to occupy adjacent steps in the central ion channel. One ordered Mg(2+) facilitates 3'-3' stacking of two quadruplexes in the asymmetric unit, while the bulged nucleotide mediates crystal contacts. Despite the high diffraction limit, the first four nucleotides including the (CNV)K nucleoside are disordered though they are still involved in crystal packing. This work suggests that the bulky hydrophobic groups may locally influence the formation of non-Watson-Crick structures from otherwise complementary sequences. These observations lead to the intriguing possibility that certain types of DNA damage may act as modulators of G-quadruplex formation. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Eukaryotic DNA Ligases: Structural and Functional Insights
Ellenberger, Tom; Tomkinson, Alan E.
2010-01-01
DNA ligases are required for DNA replication, repair, and recombination. In eukaryotes, there are three families of ATP-dependent DNA ligases. Members of the DNA ligase I and IV families are found in all eukaryotes, whereas DNA ligase III family members are restricted to vertebrates. These enzymes share a common catalytic region comprising a DNA-binding domain, a nucleotidyltransferase (NTase) domain, and an oligonucleotide/oligosaccharide binding (OB)-fold domain. The catalytic region encircles nicked DNA with each of the domains contacting the DNA duplex. The unique segments adjacent to the catalytic region of eukaryotic DNA ligases are involved in specific protein-protein interactions with a growing number of DNA replication and repair proteins. These interactions determine the specific cellular functions of the DNA ligase isozymes. In mammals, defects in DNA ligation have been linked with an increased incidence of cancer and neurodegeneration. PMID:18518823
Base pairing and structural insights into the 5-formylcytosine in RNA duplex
Wang, Rui; Luo, Zhipu; He, Kaizhang; Delaney, Michael O.; Chen, Doris; Sheng, Jia
2016-01-01
Abstract 5-Formylcytidine (f5C), a previously discovered natural nucleotide in the mitochondrial tRNA of many species including human, has been recently detected as the oxidative product of 5-methylcytidine (m5C) through 5-hydroxymethylcytidine (hm5C) in total RNA of mammalian cells. The discovery indicated that these cytosine derivatives in RNA might also play important epigenetic roles similar as in DNA, which has been intensively investigated in the past few years. In this paper, we studied the base pairing specificity of f5C in different RNA duplex contexts. We found that the 5-formyl group could increase duplex thermal stability and enhance base pairing specificity. We present three high-resolution crystal structures of an octamer RNA duplex [5′-GUA(f5C)GUAC-3′]2 that have been solved under three crystallization conditions with different buffers and pH values. Our results showed that the 5-formyl group is located in the same plane as the cytosine base and forms an intra-residue hydrogen bond with the amino group in the N4 position. In addition, this modification increases the base stacking between the f5C and the neighboring bases while not causing significant global and local structure perturbations. This work provides insights into the effects of 5-formylcytosine on RNA duplex. PMID:27079978
Surface-immobilized DNAzyme-type biocatalysis
NASA Astrophysics Data System (ADS)
Stefan, Loic; Lavergne, Thomas; Spinelli, Nicolas; Defrancq, Eric; Monchaud, David
2014-02-01
The structure of the double helix of deoxyribonucleic acid (DNA, also called duplex-DNA) was elucidated sixty years ago by Watson, Crick, Wilkins and Franklin. Since then, DNA has continued to hold a fascination for researchers in diverse fields including medicine and nanobiotechnology. Nature has indeed excelled in diversifying the use of DNA: beyond its canonical role of repository of genetic information, DNA could also act as a nanofactory able to perform some complex catalytic tasks in an enzyme-mimicking manner. The catalytic capability of DNA was termed DNAzyme; in this context, a peculiar DNA structure, a quadruple helix also named quadruplex-DNA, has recently garnered considerable interest since its autonomous catalytic proficiency relies on its higher-order folding that makes it suitable to interact efficiently with hemin, a natural cofactor of many enzymes. Quadruplexes have thus been widely studied for their hemoprotein-like properties, chiefly peroxidase-like activity, i.e., their ability to perform hemin-mediated catalytic oxidation reactions. Recent literature is replete with applications of quadruplex-based peroxidase-mimicking DNAzyme systems. Herein, we take a further leap along the road to biochemical applications, assessing the actual efficiency of catalytic quadruplexes for the detection of picomolar levels of surface-bound analytes in an enzyme-linked immunosorbent (ELISA)-type assay. To this end, we exploit an innovative strategy based on the functionalization of DNA by a multitasking platform named RAFT (for regioselectivity addressable functionalized template), whose versatility enables the grafting of DNA whatever its nature (duplex-DNA, quadruplex-DNA, etc.). We demonstrate that the resulting biotinylated RAFT/quadruplex systems indeed acquire catalytic properties that allow for efficient luminescent detection of picomoles of surface-bound streptavidin. We also highlight some of the pitfalls that have to be faced during optimization, notably demonstrating that highly optimized experimental conditions can make DNA pre-catalysts catalytically competent whatever their secondary structures.
Wang, Xiaoyu; Hoshika, Shuichi; Peterson, Raymond J; Kim, Myong-Jung; Benner, Steven A; Kahn, Jason D
2017-05-19
Synthetic nucleobases presenting non-Watson-Crick arrangements of hydrogen bond donor and acceptor groups can form additional nucleotide pairs that stabilize duplex DNA independent of the standard A:T and G:C pairs. The pair between 2-amino-3-nitropyridin-6-one 2'-deoxyriboside (presenting a {donor-donor-acceptor} hydrogen bonding pattern on the Watson-Crick face of the small component, trivially designated Z) and imidazo[1,2-a]-1,3,5-triazin-4(8H)one 2'-deoxyriboside (presenting an {acceptor-acceptor-donor} hydrogen bonding pattern on the large component, trivially designated P) is one of these extra pairs for which a substantial amount of molecular biology has been developed. Here, we report the results of UV absorbance melting measurements and determine the energetics of binding of DNA strands containing Z and P to give short duplexes containing Z:P pairs as well as various mismatches comprising Z and P. All measurements were done at 1 M NaCl in buffer (10 mM Na cacodylate, 0.5 mM EDTA, pH 7.0). Thermodynamic parameters (ΔH°, ΔS°, and ΔG° 37 ) for oligonucleotide hybridization were extracted. Consistent with the Watson-Crick model that considers both geometric and hydrogen bonding complementarity, the Z:P pair was found to contribute more to duplex stability than any mismatches involving either nonstandard nucleotide. Further, the Z:P pair is more stable than a C:G pair. The Z:G pair was found to be the most stable mismatch, forming either a deprotonated mismatched pair or a wobble base pair analogous to the stable T:G mismatch. The C:P pair is less stable, perhaps analogous to the wobble pair observed for C:O 6 -methyl-G, in which the pyrimidine is displaced into the minor groove. The Z:A and T:P mismatches are much less stable. Parameters for predicting the thermodynamics of oligonucleotides containing Z and P bases are provided. This represents the first case where this has been done for a synthetic genetic system.
Zhang, Na; Ding, Shuang; Kolbanovskiy, Alexander; Shastry, Anant; Kuzmin, Vladimir A; Bolton, Judy L; Patel, Dinshaw J; Broyde, Suse; Geacintov, Nicholas E
2009-08-04
The equine estrogens equilin (EQ) and equilenin (EN) are the active components in the widely prescribed hormone replacement therapy formulation Premarin. Metabolic activation of EQ and EN generates the catechol 4-hydroxyequilenin (4-OHEN) that autoxidizes to the reactive o-quinone form in aerated aqueous solutions. The o-quinones react predominantly with C, and to a lesser extent with A and G, to form premutagenic cyclic covalent DNA adducts in vitro and in vivo. To obtain insights into the structural properties of these biologically important DNA lesions, we have synthesized site-specifically modified oligonucleotides containing the stereoisomeric 1'S,2'R,3'R-4-OHEN-C3 and 1'R,2'S,3'S-4-OHEN-C4 adducts derived from the reaction of 4-OHEN with the C in the oligonucleotide 5'-GGTAGCGATGG in aqueous solution. A combined NMR and computational approach was utilized to determine the conformational characteristics of the two major 4-OHEN-C3 and 4-OHEN-C4 stereoisomeric adducts formed in this oligonucleotide hybridized with its complementary strand. In both cases, the modified C adopts an anti glycosidic bond conformation; the equilenin distal ring protrudes into the minor groove while its two proximal hydroxyl groups are exposed on the major groove side of the DNA duplex. The bulky 4-OHEN-C adduct distorts the duplex within the central GC*G portion, but Watson-Crick pairing is maintained adjacent to C* in both stereoisomeric adducts. For the 4-OHEN-C3 adduct, the equilenin rings are oriented toward the 5'-end of the modified strand, while in 4-OHEN-C4 the equilenin is 3'-directed. Correspondingly, the distortions of the double-helical structures are more pronounced on the 5'- or the 3'-side of the lesion, respectively. These differences in stereoisomeric adduct conformations may play a role in the processing of these lesions in cellular environments.
Merkes, Christopher; Turnquist, Keith N.; Rees, Christopher B.; Amberg, Jon J.
2015-01-01
The duplex assay was chosen as the most efficient assay and was used at the Upper Midwest Environmental Sciences Center to analyze triplicate samples from 29 streams in Wisconsin, 8 streams in Illinois, and 8 streams in Iowa. In order to verify results, additional triplicate samples were collected from two of the streams in Iowa and two of the streams in Wisconsin for analysis at the Molecular Conservation Genetics Laboratory. All samples at all sites were negative for NZMS DNA.
Wang, Li-Juan; Ren, Ming; Zhang, Qianyi; Tang, Bo; Zhang, Chun-Yang
2017-04-18
Uracil-DNA glycosylase (UDG) is an important base excision repair (BER) enzyme responsible for the repair of uracil-induced DNA lesion and the maintenance of genomic integrity, while the aberrant expression of UDG is associated with a variety of cancers. Thus, the accurate detection of UDG activity is essential to biomedical research and clinical diagnosis. Here, we develop a fluorescent method for ultrasensitive detection of UDG activity using excision repair-initiated enzyme-assisted bicyclic cascade signal amplification. This assay involves (1) UDG-actuated uracil-excision repair, (2) excision repair-initiated nicking enzyme-mediated isothermal exponential amplification, (3) ribonuclease H (RNase H)-induced hydrolysis of signal probes for generating fluorescence signal. The presence of UDG enables the removal of uracil from U·A pairs and generates an apurinic/apyrimidinic (AP) site. Endonuclease IV (Endo IV) subsequently cleaves the AP site, resulting in the break of DNA substrate. The cleaved DNA substrate functions as both a primer and a template to initiate isothermal exponential amplification, producing a large number of triggers. The resultant trigger may selectively hybridize with the signal probe which is modified with FAM and BHQ1, forming a RNA-DNA heterogeneous duplex. The subsequent hydrolysis of RNA-DNA duplex by RNase H leads to the generation of fluorescence signal. This assay exhibits ultrahigh sensitivity with a detection limit of 0.0001 U/mL, and it can even measure UDG activity at the single-cell level. Moreover, this method can be applied for the measurement of kinetic parameters and the screening of inhibitors, thereby providing a powerful tool for DNA repair enzyme-related biomedical research and clinical diagnosis.
Štros, Michal; Kučírek, Martin; Sani, Soodabeh Abbasi; Polanská, Eva
2018-03-01
HMGB1 is a chromatin-associated protein that has been implicated in many important biological processes such as transcription, recombination, DNA repair, and genome stability. These functions include the enhancement of binding of a number of transcription factors, including the tumor suppressor protein p53, to their specific DNA-binding sites. HMGB1 is composed of two highly conserved HMG boxes, linked to an intrinsically disordered acidic C-terminal tail. Previous reports have suggested that the ability of HMGB1 to bend DNA may explain the in vitro HMGB1-mediated increase in sequence-specific DNA binding by p53. The aim of this study was to reinvestigate the importance of HMGB1-induced DNA bending in relationship to the ability of the protein to promote the specific binding of p53 to short DNA duplexes in vitro, and to transactivate two major p53-regulated human genes: Mdm2 and p21/WAF1. Using a number of HMGB1 mutants, we report that the HMGB1-mediated increase in sequence-specific p53 binding to DNA duplexes in vitro depends very little on HMGB1-mediated DNA bending. The presence of the acidic C-terminal tail of HMGB1 and/or the oxidation of the protein can reduce the HMGB1-mediated p53 binding. Interestingly, the induction of transactivation of p53-responsive gene promoters by HMGB1 requires both the ability of the protein to bend DNA and the acidic C-terminal tail, and is promoter-specific. We propose that the efficient transactivation of p53-responsive gene promoters by HMGB1 depends on complex events, rather than solely on the promotion of p53 binding to its DNA cognate sites. Copyright © 2018 Elsevier B.V. All rights reserved.
Harsch, A; Marzilli, L A; Bunt, R C; Stubbe, J; Vouros, P
2000-05-01
Bleomycin B(2)(BLM) in the presence of iron [Fe(II)] and O(2)catalyzes single-stranded (ss) and double-stranded (ds) cleavage of DNA. Electrospray ionization ion trap mass spectrometry was used to monitor these cleavage processes. Two duplex oligonucleotides containing an ethylene oxide tether between both strands were used in this investigation, allowing facile monitoring of all ss and ds cleavage events. A sequence for site-specific binding and cleavage by Fe-BLM was incorporated into each analyte. One of these core sequences, GTAC, is a known hot-spot for ds cleavage, while the other sequence, GGCC, is a hot-spot for ss cleavage. Incubation of each oligo-nucleotide under anaerobic conditions with Fe(II)-BLM allowed detection of the non-covalent ternary Fe-BLM/oligonucleotide complex in the gas phase. Cleavage studies were then performed utilizing O(2)-activated Fe(II)-BLM. No work-up or separation steps were required and direct MS and MS/MS analyses of the crude reaction mixtures confirmed sequence-specific Fe-BLM-induced cleavage. Comparison of the cleavage patterns for both oligonucleotides revealed sequence-dependent preferences for ss and ds cleavages in accordance with previously established gel electrophoresis analysis of hairpin oligonucleotides. This novel methodology allowed direct, rapid and accurate determination of cleavage profiles of model duplex oligonucleotides after exposure to activated Fe-BLM.
Nanolock-Nanopore Facilitated Digital Diagnostics of Cancer Driver Mutation in Tumor Tissue.
Wang, Yong; Tian, Kai; Shi, Ruicheng; Gu, Amy; Pennella, Michael; Alberts, Lindsey; Gates, Kent S; Li, Guangfu; Fan, Hongxin; Wang, Michael X; Gu, Li-Qun
2017-07-28
Cancer driver mutations are clinically significant biomarkers. In precision medicine, accurate detection of these oncogenic changes in patients would enable early diagnostics of cancer, individually tailored targeted therapy, and precise monitoring of treatment response. Here we investigated a novel nanolock-nanopore method for single-molecule detection of a serine/threonine protein kinase gene BRAF V600E mutation in tumor tissues of thyroid cancer patients. The method lies in a noncovalent, mutation sequence-specific nanolock. We found that the nanolock formed on the mutant allele/probe duplex can separate the duplex dehybridization procedure into two sequential steps in the nanopore. Remarkably, this stepwise unzipping kinetics can produce a unique nanopore electric marker, with which a single DNA molecule of the cancer mutant allele can be unmistakably identified in various backgrounds of the normal wild-type allele. The single-molecule sensitivity for mutant allele enables both binary diagnostics and quantitative analysis of mutation occurrence. In the current configuration, the method can detect the BRAF V600E mutant DNA lower than 1% in the tumor tissues. The nanolock-nanopore method can be adapted to detect a broad spectrum of both transversion and transition DNA mutations, with applications from diagnostics to targeted therapy.
NASA Astrophysics Data System (ADS)
Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana
2016-10-01
The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.
Dobnik, David; Štebih, Dejan; Blejec, Andrej; Morisset, Dany; Žel, Jana
2016-10-14
The advantages of the digital PCR technology are already well documented until now. One way to achieve better cost efficiency of the technique is to use it in a multiplexing strategy. Droplet digital PCR platforms, which include two fluorescence filters, support at least duplex reactions and with some developments and optimization higher multiplexing is possible. The present study not only shows a development of multiplex assays in droplet digital PCR, but also presents a first thorough evaluation of several parameters in such multiplex digital PCR. Two 4-plex assays were developed for quantification of 8 different DNA targets (7 genetically modified maize events and maize endogene). Per assay, two of the targets were labelled with one fluorophore and two with another. As current analysis software does not support analysis of more than duplex, a new R- and Shiny-based web application analysis tool (http://bit.ly/ddPCRmulti) was developed that automates the analysis of 4-plex results. In conclusion, the two developed multiplex assays are suitable for quantification of GMO maize events and the same approach can be used in any other field with a need for accurate and reliable quantification of multiple DNA targets.
Grove, A; Galeone, A; Mayol, L; Geiduschek, E P
1996-07-12
TF1 is a member of the family of type II DNA-binding proteins, which also includes the bacterial HU proteins and the Escherichia coli integration host factor (IHF). Distinctive to TF1, which is encoded by the Bacillus subtilis bacteriophage SPO1, is its preferential binding to DNA in which thymine is replaced by 5-hydroxymethyluracil (hmU), as it is in the phage genome. TF1 binds to preferred sites within the phage genome and generates pronounced DNA bending. The extent to which DNA flexibility contributes to the sequence-specific binding of TF1, and the connection between hmU preference and DNA flexibility has been examined. Model flexible sites, consisting of consecutive mismatches, increase the affinity of thymine-containing DNA for TF1. In particular, tandem mismatches separated by nine base-pairs generate an increase, by orders of magnitude, in the affinity of TF1 for T-containing DNA with the sequence of a preferred TF1 binding site, and fully match the affinity of TF1 for this cognate site in hmU-containing DNA (Kd approximately 3 nM). Other placements of loops generate suboptimal binding. This is consistent with a significant contribution of site-specific DNA flexibility to complex formation. Analysis of complexes with hmU-DNA of decreasing length shows that a major part of the binding affinity is generated within a central 19 bp segment (delta G0 = 41.7 kJ mol-1) with more-distal DNA contributing modestly to the affinity (delta delta G = -0.42 kJ mol-1 bp-1 on increasing duplex length to 37 bp). However, a previously characterised thermostable and more tightly binding mutant TF1, TF1(E15G/T32I), derives most of its extra affinity from interaction with flanking DNA. We propose that inherent but sequence-dependent deformability of hmU-containing DNA underlies the preferential binding of TF1 and that TF1-induced DNA bendings is a result of distortions at two distinct sites separated by 9 bp of duplex DNA.
Koh, Junseock; Saecker, Ruth M.; Record, M. Thomas
2008-01-01
Escherichia coli HUαβ, a major nucleoid associated protein (NAP), organizes the DNA chromosome and facilitates numerous DNA transactions. Using isothermal titration calorimetry (ITC), fluorescence resonance energy transfer (FRET) and a series of DNA lengths (8, 15, 34, 38 and 160 base pairs) we establish that HUαβ interacts with duplex DNA using three different nonspecific binding modes. Both the HU to DNA mole ratio ([HU]/[DNA]) and DNA length dictate the dominant HU binding mode. On sufficiently long DNA (≥ 34 base pairs), at low [HU]/[DNA], HU populates a noncooperative 34 bp binding mode with a binding constant of 2.1 (± 0.4) × 106 M−1, and a binding enthalpy of +7.7 (± 0.6) kcal/mol at 15 °C and 0.15 M Na+. With increasing [HU]/[DNA], HU bound in the noncooperative 34 bp mode progressively converts to two cooperative (ω ~ 20) modes with site sizes of 10 bp and 6 bp. These latter modes exhibit smaller binding constants (1.1 (± 0.2) × 105 M−1 for the 10 bp mode, 3.5 (± 1.4) × 104 M−1 for the 6 bp mode) and binding enthalpies (4.2 (± 0.3) kcal/mol for the 10 bp mode, −1.6 (±0.3) kcal/mol for the 6 bp mode). As DNA length increases to 34 bp or more at low [HU]/[DNA], the small modes are replaced by the 34 bp binding mode. FRET data demonstrate that the 34 bp mode bends DNA by 143 ± 6° whereas the 6 and 10 bp modes do not. The model proposed in this study provides a novel quantitative and comprehensive framework for reconciling previous structural and solution studies of HU, including single molecule (force extension measurement, AFM), fluorescence, and electrophoretic gel mobility shift assays. In particular, it explains how HU condenses or extends DNA depending on the relative concentrations of HU and DNA. PMID:18657548
Chang, Soyoung; Kilic, Tugba; Lee, Chang Kee; Avci, Huseyin; Bae, Hojae; Oskui, Shirin Mesbah; Jung, Sung Mi; Shin, Su Ryon; Kim, Seon Jeong
2018-04-08
The unique biological features of supramolecular DNA have led to an increasing interest in biomedical applications such as biosensors. We have developed an i-motif and G-rich DNA conjugated single-walled carbon nanotube hybrid materials, which shows reversible conformational switching upon external stimuli such as pH (5 and 8) and presence of ions (Li⁺ and K⁺). We observed reversible electrochemical redox activity upon external stimuli in a quick and robust manner. Given the ease and the robustness of this method, we believe that pH- and ion-driven reversible DNA structure transformations will be utilized for future applications for developing novel biosensors.
Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce. PMID:23409088
Nölling, Jörk; Rapireddy, Srinivas; Amburg, Joel I.; Crawford, Elizabeth M.; Prakash, Ranjit A.; Rabson, Arthur R.
2016-01-01
ABSTRACT Bloodstream infections are a leading cause of morbidity and mortality. Early and targeted antimicrobial intervention is lifesaving, yet current diagnostic approaches fail to provide actionable information within a clinically viable time frame due to their reliance on blood culturing. Here, we present a novel pathogen identification (PID) platform that features the use of duplex DNA-invading γ-modified peptide nucleic acids (γPNAs) for the rapid identification of bacterial and fungal pathogens directly from blood, without culturing. The PID platform provides species-level information in under 2.5 hours while reaching single-CFU-per-milliliter sensitivity across the entire 21-pathogen panel. The clinical utility of the PID platform was demonstrated through assessment of 61 clinical specimens, which showed >95% sensitivity and >90% overall correlation to blood culture findings. This rapid γPNA-based platform promises to improve patient care by enabling the administration of a targeted first-line antimicrobial intervention. PMID:27094328
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Near-atomic resolution visualization of human transcription promoter opening
He, Yuan; Yan, Chunli; Fang, Jie; Inouye, Carla; Tjian, Robert; Ivanov, Ivaylo; Nogales, Eva
2016-01-01
In eukaryotic transcription initiation, a large multi-subunit pre-initiation complex (PIC) that assembles at the core promoter is required for the opening of the duplex DNA and identification of the start site for transcription by RNA polymerase II. Here we use cryo-electron microscropy (cryo-EM) to determine near-atomic resolution structures of the human PIC in a closed state (engaged with duplex DNA), an open state (engaged with a transcription bubble), and an initially transcribing complex (containing six base pairs of DNA–RNA hybrid). Our studies provide structures for previously uncharacterized components of the PIC, such as TFIIE and TFIIH, and segments of TFIIA, TFIIB and TFIIF. Comparison of the different structures reveals the sequential conformational changes that accompany the transition from each state to the next throughout the transcription initiation process. This analysis illustrates the key role of TFIIB in transcription bubble stabilization and provides strong structural support for a translocase activity of XPB. PMID:27193682
Matvienko, Marta; Kozik, Alexander; Froenicke, Lutz; Lavelle, Dean; Martineau, Belinda; Perroud, Bertrand; Michelmore, Richard
2013-01-01
Several applications of high throughput genome and transcriptome sequencing would benefit from a reduction of the high-copy-number sequences in the libraries being sequenced and analyzed, particularly when applied to species with large genomes. We adapted and analyzed the consequences of a method that utilizes a thermostable duplex-specific nuclease for reducing the high-copy components in transcriptomic and genomic libraries prior to sequencing. This reduces the time, cost, and computational effort of obtaining informative transcriptomic and genomic sequence data for both fully sequenced and non-sequenced genomes. It also reduces contamination from organellar DNA in preparations of nuclear DNA. Hybridization in the presence of 3 M tetramethylammonium chloride (TMAC), which equalizes the rates of hybridization of GC and AT nucleotide pairs, reduced the bias against sequences with high GC content. Consequences of this method on the reduction of high-copy and enrichment of low-copy sequences are reported for Arabidopsis and lettuce.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, S.B.
Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less
Procedure for normalization of cDNA libraries
Bonaldo, M.D.; Soares, M.B.
1997-12-30
This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
The effects of DNA supercoiling on G-quadruplex formation.
Sekibo, Doreen A T; Fox, Keith R
2017-12-01
Guanine-rich DNAs can fold into four-stranded structures that contain stacks of G-quartets. Bioinformatics studies have revealed that G-rich sequences with the potential to adopt these structures are unevenly distributed throughout genomes, and are especially found in gene promoter regions. With the exception of the single-stranded telomeric DNA, all genomic G-rich sequences will always be present along with their C-rich complements, and quadruplex formation will be in competition with the corresponding Watson-Crick duplex. Quadruplex formation must therefore first require local dissociation (melting) of the duplex strands. Since negative supercoiling is known to facilitate the formation of alternative DNA structures, we have investigated G-quadruplex formation within negatively supercoiled DNA plasmids. Plasmids containing multiple copies of (G3T)n and (G3T4)n repeats, were probed with dimethylsulphate, potassium permanganate and S1 nuclease. While dimethylsulphate footprinting revealed some evidence for G-quadruplex formation in (G3T)n sequences, this was not affected by supercoiling, and permanganate failed to detect exposed thymines in the loop regions. (G3T4)n sequences were not protected from DMS and showed no reaction with permanganate. Similarly, both S1 nuclease and 2D gel electrophoresis of DNA topoisomers did not detect any supercoil-dependent structural transitions. These results suggest that negative supercoiling alone is not sufficient to drive G-quadruplex formation. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Self-Assembly of 3D DNA Crystals Containing a Torsionally Stressed Component
Hernandez, Carina; Birktoft, Jens J.; Ohayon, Yoel P.; ...
2017-10-05
There is an increasing appreciation for structural diversity of DNA that is of interest to both DNA nanotechnology and basic biology. Here, we have explored how DNA responds to torsional stress by building on a previously reported two-turn DNA tensegrity triangle and demonstrating that we could introduce an extra nucleotide pair (np) into the original sequence without affecting assembly and crystallization. The extra np imposes a significant torsional stress, which is accommodated by global changes throughout the B-DNA duplex and the DNA lattice. Furthermore, the work reveals a near-atomic structure of naked DNA under a torsional stress of approximately 14%,more » and thus provides an example of DNA distortions that occur without a requirement for either an external energy source or the free energy available from protein or drug binding.« less
Self-Assembly of 3D DNA Crystals Containing a Torsionally Stressed Component.
Hernandez, Carina; Birktoft, Jens J; Ohayon, Yoel P; Chandrasekaran, Arun Richard; Abdallah, Hatem; Sha, Ruojie; Stojanoff, Vivian; Mao, Chengde; Seeman, Nadrian C
2017-11-16
There is an increasing appreciation for structural diversity of DNA that is of interest to both DNA nanotechnology and basic biology. Here, we have explored how DNA responds to torsional stress by building on a previously reported two-turn DNA tensegrity triangle and demonstrating that we could introduce an extra nucleotide pair (np) into the original sequence without affecting assembly and crystallization. The extra np imposes a significant torsional stress, which is accommodated by global changes throughout the B-DNA duplex and the DNA lattice. The work reveals a near-atomic structure of naked DNA under a torsional stress of approximately 14%, and thus provides an example of DNA distortions that occur without a requirement for either an external energy source or the free energy available from protein or drug binding. Copyright © 2017 Elsevier Ltd. All rights reserved.
Self-Assembly of 3D DNA Crystals Containing a Torsionally Stressed Component
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hernandez, Carina; Birktoft, Jens J.; Ohayon, Yoel P.
There is an increasing appreciation for structural diversity of DNA that is of interest to both DNA nanotechnology and basic biology. Here, we have explored how DNA responds to torsional stress by building on a previously reported two-turn DNA tensegrity triangle and demonstrating that we could introduce an extra nucleotide pair (np) into the original sequence without affecting assembly and crystallization. The extra np imposes a significant torsional stress, which is accommodated by global changes throughout the B-DNA duplex and the DNA lattice. Furthermore, the work reveals a near-atomic structure of naked DNA under a torsional stress of approximately 14%,more » and thus provides an example of DNA distortions that occur without a requirement for either an external energy source or the free energy available from protein or drug binding.« less
2015-01-01
Fisetin (3,7,3′,4′-tetrahydroxyflavone) and quercetin (3,5,7,3′,4′-pentahydroxyflavone) are the bioactive plant flavonoids that are potentially useful therapeutic drugs for the treatment of a broad spectrum of diseases, including atherosclerosis, cardiovascular disease, obesity, hypertension, and cancer. 3-Hydroxyflavone (3HF) and 7-hydroxyflavone (7HF) are the synthetic chromophores of fisetin and quercetin. We have exploited dual luminescence properties of fisetin and quercetin along with 3-HF and 7HF to examine their efficacy of binding and compare their interactions with DNA, which is one of the macromolecular targets of flavonoids in physiological systems. Following the sequence of the human telomeric DNA 5′-d (CCCTAA-)n/(-TTAGGG)n-5′, two single-stranded DNA oligonucleotides, 5′-d(C3TA2)3C3-3′ and 5′-d(T2AG3)4-3′, and their duplex were used as receptors to study binding by the ligands quercetin, fisetin, and their chromophores. Circular dichroism, differential absorption, UV thermal melting, and size exclusion chromatographic studies indicated the formation of unusual DNA structures (such as C4 and G4 tetraplexes) for both the C- and G-rich single-stranded DNAs. Upon binding to DNA, dramatic changes were observed in the intrinsic fluorescence behavior of the flavonoids. Molecular docking studies were performed to describe the likely binding sites for the ligands. The spectroscopic studies on flavonoid–DNA interactions described herein demonstrate a powerful approach for examining their DNA binding through exploiting the highly sensitive intrinsic fluorescence properties of the flavonoids as their own “reporter” for their interactions with macromolecular targets. PMID:25393681
Hoang, Tony; Patel, Dhruv S; Halvorsen, Ken
2016-08-01
The centrifuge force microscope (CFM) was recently introduced as a platform for massively parallel single-molecule manipulation and analysis. Here we developed a low-cost and self-contained CFM module that works directly within a commercial centrifuge, greatly improving accessibility and ease of use. Our instrument incorporates research grade video microscopy, a power source, a computer, and wireless transmission capability to simultaneously monitor many individually tethered microspheres. We validated the instrument by performing single-molecule force shearing of short DNA duplexes. For a 7 bp duplex, we observed over 1000 dissociation events due to force dependent shearing from 2 pN to 12 pN with dissociation times in the range of 10-100 s. We extended the measurement to a 10 bp duplex, applying a 12 pN force clamp and directly observing single-molecule dissociation over an 85 min experiment. Our new CFM module facilitates simple and inexpensive experiments that dramatically improve access to single-molecule analysis.
Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul
2011-08-05
5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.
Current-voltage characteristics of double stranded versus single stranded DNA molecules
NASA Astrophysics Data System (ADS)
Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.
2004-03-01
Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)
NASA Astrophysics Data System (ADS)
Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin
2014-01-01
DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.
Nolte, Robert T.; Conlin, Rachel M.; Harrison, Stephen C.; Brown, Raymond S.
1998-01-01
The crystal structure of the six NH2-terminal zinc fingers of Xenopus laevis transcription factor IIIA (TFIIIA) bound with 31 bp of the 5S rRNA gene promoter has been determined at 3.1 Å resolution. Individual zinc fingers are positioned differently in the major groove and across the minor groove of DNA to span the entire length of the duplex. These results show how TFIIIA can recognize several separated DNA sequences by using fewer fingers than necessary for continuous winding in the major groove. PMID:9501194
2011-01-01
Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy. PMID:21864341
Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr
2011-08-24
Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an indispensable condition for the understanding and optimization of DNA photo- and radio-degradation, which are prerequisites for clinical trials of Hal-NBs in anticancer therapy.
Kashida, Hiromu; Yamaguchi, Kyohei; Hara, Yuichi; Asanuma, Hiroyuki
2012-07-15
In this study, we synthesized a simple but efficient quencher-free molecular beacon tethering 7-hydroxycoumarin on D-threoninol based on its pK(a) change. The pK(a) of 7-hydroxycoumarin in a single strand was determined as 8.8, whereas that intercalated in the duplex was over 10. This large pK(a) shift (more than 1.2) upon hybridization could be attributed to the anionic and hydrophobic microenvironment inside the DNA duplex. Because 7-hydroxycoumarin quenches its fluorescence upon protonation, the emission intensity of the duplex at pH 8.5 was 1/15 that of the single strand. We applied this quenching mechanism to the preparation of a quencher-free molecular beacon by introducing the dye into the middle of the stem part. In the absence of the target, the stem region formed a duplex and fluorescence was quenched. However, when the target was added, the molecular beacon opened and the dye was deprotonated. As a result, the emission intensity of the molecular beacon with the target was 10 times higher than that without the target. Accordingly, a quencher-free molecular beacon utilizing the pK(a) change was successfully developed. Copyright © 2012 Elsevier Ltd. All rights reserved.
Recent Advances in the Structural Mechanisms of DNA Glycosylases
Brooks, Sonja C.; Adhikary, Suraj; Rubinson, Emily H.; Eichman, Brandt F.
2012-01-01
DNA glycosylases safeguard the genome by locating and excising a diverse array of aberrant nucleobases created from oxidation, alkylation, and deamination of DNA. Since the discovery 28 years ago that these enzymes employ a base flipping mechanism to trap their substrates, six different protein architectures have been identified to perform the same basic task. Work over the past several years has unraveled details for how the various DNA glycosylases survey DNA, detect damage within the duplex, select for the correct modification, and catalyze base excision. Here, we provide a broad overview of these latest advances in glycosylase mechanisms gleaned from structural enzymology, highlighting features common to all glycosylases as well as key differences that define their particular substrate specificities. PMID:23076011
Samson, Maria Cristina; Gullì, Mariolina; Marmiroli, Nelson
2010-07-01
Methodologies that enable the detection of genetically modified organisms (GMOs) (authorized and non-authorized) in food and feed strongly influence the potential for adequate updating and implementation of legislation together with labeling requirements. Quantitative polymerase chain reaction (qPCR) systems were designed to boost the sensitivity and specificity on the identification of GMOs in highly degraded DNA samples; however, such testing will become economically difficult to cope with due to increasing numbers of approved genetically modified (GM) lines. Multiplexing approaches are therefore in development to provide cost-efficient solution. Construct-specific primers and probe were developed for quantitative analysis of Roundup Ready soybean (RRS) event glyphosate-tolerant soybean (GTS) 40-3-2. The lectin gene (Le1) was used as a reference gene, and its specificity was verified. RRS- and Le1-specific quantitative real-time PCR (qRTPCR) were optimized in a duplex platform that has been validated with respect to limit of detection (LOD) and limit of quantification (LOQ), as well as accuracy. The analysis of model processed food samples showed that the degradation of DNA has no adverse or little effects on the performance of quantification assay. In this study, a duplex qRTPCR using TaqMan minor groove binder-non-fluorescent quencher (MGB-NFQ) chemistry was developed for specific detection and quantification of RRS event GTS 40-3-2 that can be used for practical monitoring in processed food products.
Four human Plasmodium species quantification using droplet digital PCR.
Srisutham, Suttipat; Saralamba, Naowarat; Malleret, Benoit; Rénia, Laurent; Dondorp, Arjen M; Imwong, Mallika
2017-01-01
Droplet digital polymerase chain reaction (ddPCR) is a partial PCR based on water-oil emulsion droplet technology. It is a highly sensitive method for detecting and delineating minor alleles from complex backgrounds and provides absolute quantification of DNA targets. The ddPCR technology has been applied for detection of many pathogens. Here the sensitive assay utilizing ddPCR for detection and quantification of Plasmodium species was investigated. The assay was developed for two levels of detection, genus specific for all Plasmodium species and for specific Plasmodium species detection. The ddPCR assay was developed based on primers and probes specific to the Plasmodium genus 18S rRNA gene. Using ddPCR for ultra-sensitive P. falciparum assessment, the lower level of detection from concentrated DNA obtained from a high volume (1 mL) blood sample was 11 parasites/mL. For species identification, in particular for samples with mixed infections, a duplex reaction was developed for detection and quantification P. falciparum/ P. vivax and P. malariae/ P. ovale. Amplification of each Plasmodium species in the duplex reaction showed equal sensitivity to singleplex single species detection. The duplex ddPCR assay had higher sensitivity to identify minor species in 32 subpatent parasitaemia samples from Cambodia, and performed better than real-time PCR. The ddPCR assay shows high sensitivity to assess very low parasitaemia of all human Plasmodium species. This provides a useful research tool for studying the role of the asymptomatic parasite reservoir for transmission in regions aiming for malaria elimination.
Acid-induced exchange of the imino proton in G.C pairs.
Nonin, S; Leroy, J L; Gueron, M
1996-01-01
Acid-induced catalysis of imino proton exchange in G.C pairs of DNA duplexes is surprisingly fast, being nearly as fast as for the isolated nucleoside, despite base-pair dissociation constants in the range of 10(-5) at neutral or basic pH. It is also observed in terminal G.C pairs of duplexes and in base pairs of drug-DNA complexes. We have measured imino proton exchange in deoxyguanosine and in the duplex (ATATAGATCTATAT) as a function of pH. We show that acid-induced exchange can be assigned to proton transfer from N7-protonated guanosine to cytidine in the open state of the pair. This is faster than transfer from neutral guanosine (the process of intrinsic catalysis previously characterized at neutral ph) due to the lower imino proton pK of the protonated form, 7.2 instead of 9.4. Other interpretations are excluded by a study of exchange catalysis by formiate and cytidine as exchange catalysts. The cross-over pH between the regimes of pH-independent and acid-induced exchange rates is more basic in the case of base pairs than in the mononucleoside, suggestive of an increase by one to two decades in the dissociation constant of the base pair upon N7 protonation of G. Acid-induced catalysis is much weaker in A.T base pairs, as expected in view of the low pK for protonation of thymidine. PMID:8604298