Sample records for dna detection methods

  1. Single-copy gene detection using branched DNA (bDNA) in situ hybridization.

    PubMed

    Player, A N; Shen, L P; Kenny, D; Antao, V P; Kolberg, J A

    2001-05-01

    We have developed a branched DNA in situ hybridization (bDNA ISH) method for detection of human papillomavirus (HPV) DNA in whole cells. Using human cervical cancer cell lines with known copies of HPV DNA, we show that the bDNA ISH method is highly sensitive, detecting as few as one or two copies of HPV DNA per cell. By modifying sample pretreatment, viral mRNA or DNA sequences can be detected using the same set of oligonucleotide probes. In experiments performed on mixed populations of cells, the bDNA ISH method is highly specific and can distinguish cells with HPV-16 from cells with HPV-18 DNA. Furthermore, we demonstrate that the bDNA ISH method provides precise localization, yielding positive signals retained within the subcellular compartments in which the target nucleic acid sequences are localized. As an effective and convenient means for nucleic acid detection, the bDNA ISH method is applicable to the detection of cancers and infectious agents. (J Histochem Cytochem 49:603-611, 2001)

  2. Methods of DNA methylation detection

    NASA Technical Reports Server (NTRS)

    Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

    2010-01-01

    The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

  3. Field calibration of blowfly-derived DNA against traditional methods for assessing mammal diversity in tropical forests.

    PubMed

    Lee, Ping-Shin; Gan, Han Ming; Clements, Gopalasamy Reuben; Wilson, John-James

    2016-11-01

    Mammal diversity assessments based on DNA derived from invertebrates have been suggested as alternatives to assessments based on traditional methods; however, no study has field-tested both approaches simultaneously. In Peninsular Malaysia, we calibrated the performance of mammal DNA derived from blowflies (Diptera: Calliphoridae) against traditional methods used to detect species. We first compared five methods (cage trapping, mist netting, hair trapping, scat collection, and blowfly-derived DNA) in a forest reserve with no recent reports of megafauna. Blowfly-derived DNA and mist netting detected the joint highest number of species (n = 6). Only one species was detected by multiple methods. Compared to the other methods, blowfly-derived DNA detected both volant and non-volant species. In another forest reserve, rich in megafauna, we calibrated blowfly-derived DNA against camera traps. Blowfly-derived DNA detected more species (n = 11) than camera traps (n = 9), with only one species detected by both methods. The rarefaction curve indicated that blowfly-derived DNA would continue to detect more species with greater sampling effort. With further calibration, blowfly-derived DNA may join the list of traditional field methods. Areas for further investigation include blowfly feeding and dispersal biology, primer biases, and the assembly of a comprehensive and taxonomically-consistent DNA barcode reference library.

  4. A fluorescence method for detection of DNA and DNA methylation based on graphene oxide and restriction endonuclease HpaII.

    PubMed

    Wei, Wei; Gao, Chunyan; Xiong, Yanxiang; Zhang, Yuanjian; Liu, Songqin; Pu, Yuepu

    2015-01-01

    DNA methylation plays an important role in many biological events and is associated with various diseases. Most traditional methods for detection of DNA methylation are based on the complex and expensive bisulfite method. In this paper, we report a novel fluorescence method to detect DNA and DNA methylation based on graphene oxide (GO) and restriction endonuclease HpaII. The skillfully designed probe DNA labeled with 5-carboxyfluorescein (FAM) and optimized GO concentration keep the probe/target DNA still adsorbed on the GO. After the cleavage action of HpaII the labeled FAM is released from the GO surface and its fluorescence recovers, which could be used to detect DNA in the linear range of 50 pM-50 nM with a detection limit of 43 pM. DNA methylation induced by transmethylase (Mtase) or other chemical reagents prevents HpaII from recognizing and cleaving the specific site; as a result, fluorescence cannot recover. The fluorescence recovery efficiency is closely related to the DNA methylation level, which can be used to detect DNA methylation by comparing it with the fluorescence in the presence of intact target DNA. The method for detection of DNA and DNA methylation is simple, reliable and accurate. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Environmental DNA method for estimating salamander distribution in headwater streams, and a comparison of water sampling methods.

    PubMed

    Katano, Izumi; Harada, Ken; Doi, Hideyuki; Souma, Rio; Minamoto, Toshifumi

    2017-01-01

    Environmental DNA (eDNA) has recently been used for detecting the distribution of macroorganisms in various aquatic habitats. In this study, we applied an eDNA method to estimate the distribution of the Japanese clawed salamander, Onychodactylus japonicus, in headwater streams. Additionally, we compared the detection of eDNA and hand-capturing methods used for determining the distribution of O. japonicus. For eDNA detection, we designed a qPCR primer/probe set for O. japonicus using the 12S rRNA region. We detected the eDNA of O. japonicus at all sites (with the exception of one), where we also observed them by hand-capturing. Additionally, we detected eDNA at two sites where we were unable to observe individuals using the hand-capturing method. Moreover, we found that eDNA concentrations and detection rates of the two water sampling areas (stream surface and under stones) were not significantly different, although the eDNA concentration in the water under stones was more varied than that on the surface. We, therefore, conclude that eDNA methods could be used to determine the distribution of macroorganisms inhabiting headwater systems by using samples collected from the surface of the water.

  6. Portable and sensitive quantitative detection of DNA based on personal glucose meters and isothermal circular strand-displacement polymerization reaction.

    PubMed

    Xu, Xue-tao; Liang, Kai-yi; Zeng, Jia-ying

    2015-02-15

    A portable and sensitive quantitative DNA detection method based on personal glucose meters and isothermal circular strand-displacement polymerization reaction was developed. The target DNA triggered target recycling process, which opened capture DNA. The released target then found another capture DNA to trigger another polymerization cycle, which was repeated for many rounds, resulting in the multiplication of the DNA-invertase conjugation on the surface of Streptavidin-MNBs. The DNA-invertase was used to catalyze the hydrolysis of sucrose into glucose for PGM readout. There was a liner relationship between the signal of PGM and the concentration of target DNA in the range of 5.0 to 1000 fM, which is lower than some DNA detection method. In addition, the method exhibited excellent sequence selectivity and there was almost no effect of biological complex to the detection performance, which suggested our method can be successfully applied to DNA detection in real biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Critical considerations for the application of environmental DNA methods to detect aquatic species

    USGS Publications Warehouse

    Goldberg, Caren S.; Turner, Cameron R.; Deiner, Kristy; Klymus, Katy E.; Thomsen, Philip Francis; Murphy, Melanie A.; Spear, Stephen F.; McKee, Anna; Oyler-McCance, Sara J.; Cornman, Robert S.; Laramie, Matthew B.; Mahon, Andrew R.; Lance, Richard F.; Pilliod, David S.; Strickler, Katherine M.; Waits, Lisette P.; Fremier, Alexander K.; Takahara, Teruhiko; Herder, Jelger E.; Taberlet, Pierre

    2016-01-01

    Species detection using environmental DNA (eDNA) has tremendous potential for contributing to the understanding of the ecology and conservation of aquatic species. Detecting species using eDNA methods, rather than directly sampling the organisms, can reduce impacts on sensitive species and increase the power of field surveys for rare and elusive species. The sensitivity of eDNA methods, however, requires a heightened awareness and attention to quality assurance and quality control protocols. Additionally, the interpretation of eDNA data demands careful consideration of multiple factors. As eDNA methods have grown in application, diverse approaches have been implemented to address these issues. With interest in eDNA continuing to expand, supportive guidelines for undertaking eDNA studies are greatly needed.Environmental DNA researchers from around the world have collaborated to produce this set of guidelines and considerations for implementing eDNA methods to detect aquatic macroorganisms.Critical considerations for study design include preventing contamination in the field and the laboratory, choosing appropriate sample analysis methods, validating assays, testing for sample inhibition and following minimum reporting guidelines. Critical considerations for inference include temporal and spatial processes, limits of correlation of eDNA with abundance, uncertainty of positive and negative results, and potential sources of allochthonous DNA.We present a synthesis of knowledge at this stage for application of this new and powerful detection method.

  8. I Environmental DNA sampling is more sensitive than a traditional survey technique for detecting an aquatic invader.

    PubMed

    Smart, Adam S; Tingley, Reid; Weeks, Andrew R; van Rooyen, Anthony R; McCarthy, Michael A

    2015-10-01

    Effective management of alien species requires detecting populations in the early stages of invasion. Environmental DNA (eDNA) sampling can detect aquatic species at relatively low densities, but few studies have directly compared detection probabilities of eDNA sampling with those of traditional sampling methods. We compare the ability of a traditional sampling technique (bottle trapping) and eDNA to detect a recently established invader, the smooth newt Lissotriton vulgaris vulgaris, at seven field sites in Melbourne, Australia. Over a four-month period, per-trap detection probabilities ranged from 0.01 to 0.26 among sites where L. v. vulgaris was detected, whereas per-sample eDNA estimates were much higher (0.29-1.0). Detection probabilities of both methods varied temporally (across days and months), but temporal variation appeared to be uncorrelated between methods. Only estimates of spatial variation were strongly correlated across the two sampling techniques. Environmental variables (water depth, rainfall, ambient temperature) were not clearly correlated with detection probabilities estimated via trapping, whereas eDNA detection probabilities were negatively correlated with water depth, possibly reflecting higher eDNA concentrations at lower water levels. Our findings demonstrate that eDNA sampling can be an order of magnitude more sensitive than traditional methods, and illustrate that traditional- and eDNA-based surveys can provide independent information on species distributions when occupancy surveys are conducted over short timescales.

  9. [Detection of KRAS mutation in colorectal cancer patients' cfDNA with droplet digital PCR].

    PubMed

    Luo, Yuwen; Li, Yao

    2018-03-25

    This study aims to develop a new method for the detection of KRAS mutations related to colorectal cancer in cfDNA, and to evaluate the sensitivity and accuracy of the detection. We designed a method of cfDNA based KRAS detection by droplets digital PCR (ddPCR). The theoretical performance of the method is evaluated by reference standard and compared to the ARMS PCR method. Two methods, ddPCR and qPCR, were successfully established to detect KRAS wild type and 7 mutants. Both methods were validated using plasmid standards and actual samples. The results were evaluated by false positive rate, linearity, and limit of detection. Finally, 52 plasma cfDNA samples from patients and 20 samples from healthy people were tested, the clinical sensitivity is 97.64%, clinical specificity is 81.43%. ddPCR method shows higher performance than qPCR. The LOD of ddPCR method reached single digits of cfDNA copies, it can detect as low as 0.01% to 0.04% mutation abundance.

  10. Direct detection of methylation in genomic DNA

    PubMed Central

    Bart, A.; van Passel, M. W. J.; van Amsterdam, K.; van der Ende, A.

    2005-01-01

    The identification of methylated sites on bacterial genomic DNA would be a useful tool to study the major roles of DNA methylation in prokaryotes: distinction of self and nonself DNA, direction of post-replicative mismatch repair, control of DNA replication and cell cycle, and regulation of gene expression. Three types of methylated nucleobases are known: N6-methyladenine, 5-methylcytosine and N4-methylcytosine. The aim of this study was to develop a method to detect all three types of DNA methylation in complete genomic DNA. It was previously shown that N6-methyladenine and 5-methylcytosine in plasmid and viral DNA can be detected by intersequence trace comparison of methylated and unmethylated DNA. We extended this method to include N4-methylcytosine detection in both in vitro and in vivo methylated DNA. Furthermore, application of intersequence trace comparison was extended to bacterial genomic DNA. Finally, we present evidence that intrasequence comparison suffices to detect methylated sites in genomic DNA. In conclusion, we present a method to detect all three natural types of DNA methylation in bacterial genomic DNA. This provides the possibility to define the complete methylome of any prokaryote. PMID:16091626

  11. Detection of dopamine in dopaminergic cell using nanoparticles-based barcode DNA analysis.

    PubMed

    An, Jeung Hee; Kim, Tae-Hyung; Oh, Byung-Keun; Choi, Jeong Woo

    2012-01-01

    Nanotechnology-based bio-barcode-amplification analysis may be an innovative approach to dopamine detection. In this study, we evaluated the efficacy of this bio-barcode DNA method in detecting dopamine from dopaminergic cells. Herein, a combination DNA barcode and bead-based immunoassay for neurotransmitter detection with PCR-like sensitivity is described. This method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA, and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated in order to remove the conjugated barcode DNA. The DNA barcodes were then identified via PCR analysis. The dopamine concentration in dopaminergic cells can be readily and rapidly detected via the bio-barcode assay method. The bio-barcode assay method is, therefore, a rapid and high-throughput screening tool for the detection of neurotransmitters such as dopamine.

  12. The DNA isolation method has effect on allele drop-out and on the results of fluorescent PCR and DNA fragment analysis.

    PubMed

    Nagy, Bálint; Bán, Zoltán; Papp, Zoltán

    2005-10-01

    The quality and the quantity of isolated DNA have an effect on PCR amplifications. The authors studied three DNA isolation protocols (resin binding method using fresh and frozen amniotic fluid samples, and silica adsorption method using fresh samples) on the quantity and on the quality of the isolated DNA. Amniotic fluid samples were obtained from 20 pregnant women. The isolated DNA concentrations were determined by real-time fluorimeter using SYBRGreen I method. Each sample was studied for the presence of 8 STR markers. The authors compared the number of the detected alleles, electrophoretograms and peak areas. There was a significant difference between the concentration of the obtained DNA and in the peak areas between the three isolation protocols. The numbers of detected alleles were different, we observed the most allele drop outs in the resin type DNA isolation protocol from the fresh sample (detected allele numbers 182), followed by resin binding protocol from the frozen samples (detected allele number 243) and by the silica adsorption method (detected allele number 264). The authors demonstrated that the DNA isolation method has an effect on the quantity and quality of the isolated DNA, and on further PCR amplifications.

  13. Enzyme-free detection and quantification of double-stranded nucleic acids.

    PubMed

    Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Hänni, Catherine; Daniel, Isabelle

    2012-08-01

    We have developed a fully enzyme-free SERRS hybridization assay for specific detection of double-stranded DNA sequences. Although all DNA detection methods ranging from PCR to high-throughput sequencing rely on enzymes, this method is unique for being totally non-enzymatic. The efficiency of enzymatic processes is affected by alterations, modifications, and/or quality of DNA. For instance, a limitation of most DNA polymerases is their inability to process DNA damaged by blocking lesions. As a result, enzymatic amplification and sequencing of degraded DNA often fail. In this study we succeeded in detecting and quantifying, within a mixture, relative amounts of closely related double-stranded DNA sequences from Rupicapra rupicapra (chamois) and Capra hircus (goat). The non-enzymatic SERRS assay presented here is the corner stone of a promising approach to overcome the failure of DNA polymerase when DNA is too degraded or when the concentration of polymerase inhibitors is too high. It is the first time double-stranded DNA has been detected with a truly non-enzymatic SERRS-based method. This non-enzymatic, inexpensive, rapid assay is therefore a breakthrough in nucleic acid detection.

  14. Flow cytometric detection method for DNA samples

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Round Rock, TX

    2011-07-05

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

  15. Flow cytometric detection method for DNA samples

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA; Langlois, Richard G [Livermore, CA; Venkateswaran, Kodumudi S [Livermore, CA

    2006-08-01

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

  16. A novel SERRS sandwich-hybridization assay to detect specific DNA target.

    PubMed

    Feuillie, Cécile; Merheb, Maxime Mohamad; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

    2011-01-01

    In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS) technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR). In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification) or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method) with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics.

  17. A Novel SERRS Sandwich-Hybridization Assay to Detect Specific DNA Target

    PubMed Central

    Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

    2011-01-01

    In this study, we have applied Surface Enhanced Resonance Raman Scattering (SERRS) technology to the specific detection of DNA. We present an innovative SERRS sandwich-hybridization assay that allows specific DNA detection without any enzymatic amplification, such as is the case with Polymerase Chain Reaction (PCR). In some substrates, such as ancient or processed remains, enzymatic amplification fails due to DNA alteration (degradation, chemical modification) or to the presence of inhibitors. Consequently, the development of a non-enzymatic method, allowing specific DNA detection, could avoid long, expensive and inconclusive amplification trials. Here, we report the proof of concept of a SERRS sandwich-hybridization assay that leads to the detection of a specific chamois DNA. This SERRS assay reveals its potential as a non-enzymatic alternative technology to DNA amplification methods (particularly the PCR method) with several applications for species detection. As the amount and type of damage highly depend on the preservation conditions, the present SERRS assay would enlarge the range of samples suitable for DNA analysis and ultimately would provide exciting new opportunities for the investigation of ancient DNA in the fields of evolutionary biology and molecular ecology, and of altered DNA in food frauds detection and forensics. PMID:21655320

  18. Development and Validation of Environmental DNA (eDNA) Markers for Detection of Freshwater Turtles.

    PubMed

    Davy, Christina M; Kidd, Anne G; Wilson, Chris C

    2015-01-01

    Environmental DNA (eDNA) is a potentially powerful tool for detection and monitoring of rare species, including threatened native species and recently arrived invasive species. Here, we develop DNA primers for a suite of nine sympatric freshwater turtles, and use it to test whether turtle eDNA can be successfully detected in samples from aquaria and an outdoor pond. We also conduct a cost comparison between eDNA detection and detection through traditional survey methods, using data from field surveys at two sites in our target area. We find that eDNA from turtles can be detected using both conventional polymerase chain reaction (PCR) and quantitative PCR (qPCR), and that the cost of detection through traditional survey methods is 2-10X higher than eDNA detection for the species in our study range. We summarize necessary future steps for application of eDNA surveys to turtle monitoring and conservation and propose specific cases in which the application of eDNA could further the conservation of threatened turtle species.

  19. Development and Validation of Environmental DNA (eDNA) Markers for Detection of Freshwater Turtles

    PubMed Central

    Davy, Christina M.; Kidd, Anne G.; Wilson, Chris C.

    2015-01-01

    Environmental DNA (eDNA) is a potentially powerful tool for detection and monitoring of rare species, including threatened native species and recently arrived invasive species. Here, we develop DNA primers for a suite of nine sympatric freshwater turtles, and use it to test whether turtle eDNA can be successfully detected in samples from aquaria and an outdoor pond. We also conduct a cost comparison between eDNA detection and detection through traditional survey methods, using data from field surveys at two sites in our target area. We find that eDNA from turtles can be detected using both conventional polymerase chain reaction (PCR) and quantitative PCR (qPCR), and that the cost of detection through traditional survey methods is 2–10X higher than eDNA detection for the species in our study range. We summarize necessary future steps for application of eDNA surveys to turtle monitoring and conservation and propose specific cases in which the application of eDNA could further the conservation of threatened turtle species. PMID:26200348

  20. Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples

    USGS Publications Warehouse

    Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

    2013-01-01

    Environmental DNA (eDNA) methods for detecting aquatic species are advancing rapidly, but with little evaluation of field protocols or precision of resulting estimates. We compared sampling results from traditional field methods with eDNA methods for two amphibians in 13 streams in central Idaho, USA. We also evaluated three water collection protocols and the influence of sampling location, time of day, and distance from animals on eDNA concentration in the water. We found no difference in detection or amount of eDNA among water collection protocols. eDNA methods had slightly higher detection rates than traditional field methods, particularly when species occurred at low densities. eDNA concentration was positively related to field-measured density, biomass, and proportion of transects occupied. Precision of eDNA-based abundance estimates increased with the amount of eDNA in the water and the number of replicate subsamples collected. eDNA concentration did not vary significantly with sample location in the stream, time of day, or distance downstream from animals. Our results further advance the implementation of eDNA methods for monitoring aquatic vertebrates in stream habitats.

  1. PCR method of detecting pork in foods for verifying allergen labeling and for identifying hidden pork ingredients in processed foods.

    PubMed

    Tanabe, Soichi; Miyauchi, Eiji; Muneshige, Akemi; Mio, Kazuhiro; Sato, Chikara; Sato, Masahiko

    2007-07-01

    A PCR method to detect porcine DNA was developed for verifying the allergen labeling of foods and for identifying hidden pork ingredients in processed foods. The primer pair, F2/R1, was designed to detect the gene encoding porcine cytochrome b for the specific detection of pork with high sensitivity. The amplified DNA fragment (130 bp) was specifically detected from porcine DNA, while no amplification occurred with other species such as cattle, chicken, sheep, and horse. When the developed PCR method was used for investigating commercial food products, porcine DNA was clearly detected in those containing pork in the list of ingredients. In addition, 100 ppb of pork in heated gyoza (pork and vegetable dumpling) could be detected by this method. This method is rapid, specific and sensitive, making it applicable for detecting trace amounts of pork in processed foods.

  2. PCR-based detection of a rare linear DNA in cell culture.

    PubMed

    Saveliev, Sergei V.

    2002-11-11

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.

  3. PCR-based detection of a rare linear DNA in cell culture

    PubMed Central

    2002-01-01

    The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials. PMID:12734566

  4. Detection of viral infection and gene expression in clinical tissue specimens using branched DNA (bDNA) in situ hybridization.

    PubMed

    Kenny, Daryn; Shen, Lu-Ping; Kolberg, Janice A

    2002-09-01

    In situ hybridization (ISH) methods for detection of nucleic acid sequences have proved especially powerful for revealing genetic markers and gene expression in a morphological context. Although target and signal amplification technologies have enabled researchers to detect relatively low-abundance molecules in cell extracts, the sensitive detection of nucleic acid sequences in tissue specimens has proved more challenging. We recently reported the development of a branched DNA (bDNA) ISH method for detection of DNA and mRNA in whole cells. Based on bDNA signal amplification technology, bDNA ISH is highly sensitive and can detect one or two copies of DNA per cell. In this study we evaluated bDNA ISH for detection of nucleic acid sequences in tissue specimens. Using normal and human papillomavirus (HPV)-infected cervical biopsy specimens, we explored the cell type-specific distribution of HPV DNA and mRNA by bDNA ISH. We found that bDNA ISH allowed rapid, sensitive detection of nucleic acids with high specificity while preserving tissue morphology. As an adjunct to conventional histopathology, bDNA ISH may improve diagnostic accuracy and prognosis for viral and neoplastic diseases.

  5. Methods to maximise recovery of environmental DNA from water samples.

    PubMed

    Hinlo, Rheyda; Gleeson, Dianne; Lintermans, Mark; Furlan, Elise

    2017-01-01

    The environmental DNA (eDNA) method is a detection technique that is rapidly gaining credibility as a sensitive tool useful in the surveillance and monitoring of invasive and threatened species. Because eDNA analysis often deals with small quantities of short and degraded DNA fragments, methods that maximize eDNA recovery are required to increase detectability. In this study, we performed experiments at different stages of the eDNA analysis to show which combinations of methods give the best recovery rate for eDNA. Using Oriental weatherloach (Misgurnus anguillicaudatus) as a study species, we show that various combinations of DNA capture, preservation and extraction methods can significantly affect DNA yield. Filtration using cellulose nitrate filter paper preserved in ethanol or stored in a -20°C freezer and extracted with the Qiagen DNeasy kit outperformed other combinations in terms of cost and efficiency of DNA recovery. Our results support the recommendation to filter water samples within 24hours but if this is not possible, our results suggest that refrigeration may be a better option than freezing for short-term storage (i.e., 3-5 days). This information is useful in designing eDNA detection of low-density invasive or threatened species, where small variations in DNA recovery can signify the difference between detection success or failure.

  6. Assessment of environmental DNA for detecting presence of imperiled aquatic amphibian species in isolated wetlands

    USGS Publications Warehouse

    Mckee, Anna; Calhoun, Daniel L.; Barichivich, William J.; Spear, Stephen F.; Goldberg, Caren S.; Glenn, Travis C

    2015-01-01

    Environmental DNA (eDNA) is an emerging tool that allows low-impact sampling for aquatic species by isolating DNA from water samples and screening for DNA sequences specific to species of interest. However, researchers have not tested this method in naturally acidic wetlands that provide breeding habitat for a number of imperiled species, including the frosted salamander (Ambystoma cingulatum), reticulated flatwoods salamanders (Ambystoma bishopi), striped newt (Notophthalmus perstriatus), and gopher frog (Lithobates capito). Our objectives for this study were to develop and optimize eDNA survey protocols and assays to complement and enhance capture-based survey methods for these amphibian species. We collected three or more water samples, dipnetted or trapped larval and adult amphibians, and conducted visual encounter surveys for egg masses for target species at 40 sites on 12 different longleaf pine (Pinus palustris) tracts. We used quantitative PCRs to screen eDNA from each site for target species presence. We detected flatwoods salamanders at three sites with eDNA but did not detect them during physical surveys. Based on the sample location we assumed these eDNA detections to indicate the presence of frosted flatwoods salamanders. We did not detect reticulated flatwoods salamanders. We detected striped newts with physical and eDNA surveys at two wetlands. We detected gopher frogs at 12 sites total, three with eDNA alone, two with physical surveys alone, and seven with physical and eDNA surveys. We detected our target species with eDNA at 9 of 11 sites where they were present as indicated from traditional surveys and at six sites where they were not detected with traditional surveys. It was, however, critical to use at least three water samples per site for eDNA. Our results demonstrate eDNA surveys can be a useful complement to traditional survey methods for detecting imperiled pond-breeding amphibians. Environmental DNA may be particularly useful in situations where detection probability using traditional survey methods is low or access by trained personnel is limited.

  7. Mass Spectrometry Based Ultrasensitive DNA Methylation Profiling Using Target Fragmentation Assay.

    PubMed

    Lin, Xiang-Cheng; Zhang, Ting; Liu, Lan; Tang, Hao; Yu, Ru-Qin; Jiang, Jian-Hui

    2016-01-19

    Efficient tools for profiling DNA methylation in specific genes are essential for epigenetics and clinical diagnostics. Current DNA methylation profiling techniques have been limited by inconvenient implementation, requirements of specific reagents, and inferior accuracy in quantifying methylation degree. We develop a novel mass spectrometry method, target fragmentation assay (TFA), which enable to profile methylation in specific sequences. This method combines selective capture of DNA target from restricted cleavage of genomic DNA using magnetic separation with MS detection of the nonenzymatic hydrolysates of target DNA. This method is shown to be highly sensitive with a detection limit as low as 0.056 amol, allowing direct profiling of methylation using genome DNA without preamplification. Moreover, this method offers a unique advantage in accurately determining DNA methylation level. The clinical applicability was demonstrated by DNA methylation analysis using prostate tissue samples, implying the potential of this method as a useful tool for DNA methylation profiling in early detection of related diseases.

  8. Highly sensitive detection of DNA methylation levels by using a quantum dot-based FRET method

    NASA Astrophysics Data System (ADS)

    Ma, Yunfei; Zhang, Honglian; Liu, Fangming; Wu, Zhenhua; Lu, Shaohua; Jin, Qinghui; Zhao, Jianlong; Zhong, Xinhua; Mao, Hongju

    2015-10-01

    DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers.DNA methylation is the most frequently studied epigenetic modification that is strongly involved in genomic stability and cellular plasticity. Aberrant changes in DNA methylation status are ubiquitous in human cancer and the detection of these changes can be informative for cancer diagnosis. Herein, we reported a facile quantum dot-based (QD-based) fluorescence resonance energy transfer (FRET) technique for the detection of DNA methylation. The method relies on methylation-sensitive restriction enzymes for the differential digestion of genomic DNA based on its methylation status. Digested DNA is then subjected to PCR amplification for the incorporation of Alexa Fluor-647 (A647) fluorophores. DNA methylation levels can be detected qualitatively through gel analysis and quantitatively by the signal amplification from QDs to A647 during FRET. Furthermore, the methylation levels of three tumor suppressor genes, PCDHGB6, HOXA9 and RASSF1A, in 20 lung adenocarcinoma and 20 corresponding adjacent nontumorous tissue (NT) samples were measured to verify the feasibility of the QD-based FRET method and a high sensitivity for cancer detection (up to 90%) was achieved. Our QD-based FRET method is a convenient, continuous and high-throughput method, and is expected to be an alternative for detecting DNA methylation as a biomarker for certain human cancers. Electronic supplementary information (ESI) available: Synthesis of CdSe/CdS/ZnS core/shell/shell QDs. Sequences of primers used for amplifying the promoter regions in bisulfate-modified DNA. Comparison of detected methylation levels in different gene promoters using the QD-based FRET method versus bisulfite pyrosequencing. Methylation levels of the RASSF1A gene in one pair of NT and cancer samples as indicated by pyrosequencing. Theoretical calculation of the Förster distance R0. See DOI: 10.1039/c5nr04956c

  9. Validated method for quantification of genetically modified organisms in samples of maize flour.

    PubMed

    Kunert, Renate; Gach, Johannes S; Vorauer-Uhl, Karola; Engel, Edwin; Katinger, Hermann

    2006-02-08

    Sensitive and accurate testing for trace amounts of biotechnology-derived DNA from plant material is the prerequisite for detection of 1% or 0.5% genetically modified ingredients in food products or raw materials thereof. Compared to ELISA detection of expressed proteins, real-time PCR (RT-PCR) amplification has easier sample preparation and detection limits are lower. Of the different methods of DNA preparation CTAB method with high flexibility in starting material and generation of sufficient DNA with relevant quality was chosen. Previous RT-PCR data generated with the SYBR green detection method showed that the method is highly sensitive to sample matrices and genomic DNA content influencing the interpretation of results. Therefore, this paper describes a real-time DNA quantification based on the TaqMan probe method, indicating high accuracy and sensitivity with detection limits of lower than 18 copies per sample applicable and comparable to highly purified plasmid standards as well as complex matrices of genomic DNA samples. The results were evaluated with ValiData for homology of variance, linearity, accuracy of the standard curve, and standard deviation.

  10. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

    PubMed

    Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

    2016-04-28

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

  11. Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

    PubMed Central

    Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

    2016-01-01

    Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

  12. Detection and differentiation of coxiella burnetii in biological fluids

    DOEpatents

    Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

    1990-01-01

    Methods for detecting the presence of Coxiella burenetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

  13. Detection and differentiation of coxiella burnetii in biological fluids

    DOEpatents

    Frazier, Marvin E.; Mallavia, Louis P.; Baca, Oswald G.; Samuel, James E.

    1989-01-01

    Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA (specifically rickettsial DNA) with a C. burnetii-specific labeled DNA probe. Radioisotope and biotin labels are preferred, allowing detection through autoradiography and colorimetric assays, respectively.

  14. Optimizing techniques to capture and extract environmental DNA for detection and quantification of fish.

    PubMed

    Eichmiller, Jessica J; Miller, Loren M; Sorensen, Peter W

    2016-01-01

    Few studies have examined capture and extraction methods for environmental DNA (eDNA) to identify techniques optimal for detection and quantification. In this study, precipitation, centrifugation and filtration eDNA capture methods and six commercially available DNA extraction kits were evaluated for their ability to detect and quantify common carp (Cyprinus carpio) mitochondrial DNA using quantitative PCR in a series of laboratory experiments. Filtration methods yielded the most carp eDNA, and a glass fibre (GF) filter performed better than a similar pore size polycarbonate (PC) filter. Smaller pore sized filters had higher regression slopes of biomass to eDNA, indicating that they were potentially more sensitive to changes in biomass. Comparison of DNA extraction kits showed that the MP Biomedicals FastDNA SPIN Kit yielded the most carp eDNA and was the most sensitive for detection purposes, despite minor inhibition. The MoBio PowerSoil DNA Isolation Kit had the lowest coefficient of variation in extraction efficiency between lake and well water and had no detectable inhibition, making it most suitable for comparisons across aquatic environments. Of the methods tested, we recommend using a 1.5 μm GF filter, followed by extraction with the MP Biomedicals FastDNA SPIN Kit for detection. For quantification of eDNA, filtration through a 0.2-0.6 μm pore size PC filter, followed by extraction with MoBio PowerSoil DNA Isolation Kit was optimal. These results are broadly applicable for laboratory studies on carps and potentially other cyprinids. The recommendations can also be used to inform choice of methodology for field studies. © 2015 John Wiley & Sons Ltd.

  15. Simultaneous analysis of six aldehyde-DNA adducts in salivary DNA of nonsmokers and smokers using stable isotope dilution liquid chromatography electrospray ionization-tandem mass spectrometry.

    PubMed

    Li, Xiangyu; Liu, Lujuan; Wang, Hongjuan; Chen, Jian; Zhu, Beibei; Chen, Huan; Hou, Hongwei; Hu, Qingyuan

    2017-08-15

    A stable method, using isotope dilution liquid chromatography-tandem mass spectrometry (LC-MS/MS), to simultaneously determine six aldehyde-DNA adducts was developed and applied to the analysis of human salivary DNA samples. The detection limit of these six DNA adducts was in the range of 0.006-0.014ng/mL and that of the quantification limit was 0.017-0.026ng/mL. The intra-day and inter-day precision of all aldehyde-DNA adducts was <10%. The analysis was completed within 25min. Additionally, a noninvasive technique was used to collect the DNA samples from human saliva. The new method was successfully applied for the analysis of salivary DNA of nonsmokers and smokers. Five aldehyde-DNA adducts were detected in both smoker and nonsmoker salivary DNA, while α-Acr-dG was not detected in all the samples. Among these detected DNA adducts, no significant differences were found between smoker and nonsmoker (p>0.05). This may due to the individual detoxifying differences or environmental and endogenous exposure. Our study provides a rapid and selective method to simultaneously detect six aldehyde-DNA adducts and to assess potential DNA damage induced by aldehydes. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. [Research Progress on the Detection Method of DNA Methylation and Its Application in Forensic Science].

    PubMed

    Nie, Y C; Yu, L J; Guan, H; Zhao, Y; Rong, H B; Jiang, B W; Zhang, T

    2017-06-01

    As an important part of epigenetic marker, DNA methylation involves in the gene regulation and attracts a wide spread attention in biological auxology, geratology and oncology fields. In forensic science, because of the relative stable, heritable, abundant, and age-related characteristics, DNA methylation is considered to be a useful complement to the classic genetic markers for age-prediction, tissue-identification, and monozygotic twins' discrimination. Various methods for DNA methylation detection have been validated based on methylation sensitive restriction endonuclease, bisulfite modification and methylation-CpG binding protein. In recent years, it is reported that the third generation sequencing method can be used to detect DNA methylation. This paper aims to make a review on the detection method of DNA methylation and its applications in forensic science. Copyright© by the Editorial Department of Journal of Forensic Medicine.

  17. Detecting and Estimating Contamination of Human DNA Samples in Sequencing and Array-Based Genotype Data

    PubMed Central

    Jun, Goo; Flickinger, Matthew; Hetrick, Kurt N.; Romm, Jane M.; Doheny, Kimberly F.; Abecasis, Gonçalo R.; Boehnke, Michael; Kang, Hyun Min

    2012-01-01

    DNA sample contamination is a serious problem in DNA sequencing studies and may result in systematic genotype misclassification and false positive associations. Although methods exist to detect and filter out cross-species contamination, few methods to detect within-species sample contamination are available. In this paper, we describe methods to identify within-species DNA sample contamination based on (1) a combination of sequencing reads and array-based genotype data, (2) sequence reads alone, and (3) array-based genotype data alone. Analysis of sequencing reads allows contamination detection after sequence data is generated but prior to variant calling; analysis of array-based genotype data allows contamination detection prior to generation of costly sequence data. Through a combination of analysis of in silico and experimentally contaminated samples, we show that our methods can reliably detect and estimate levels of contamination as low as 1%. We evaluate the impact of DNA contamination on genotype accuracy and propose effective strategies to screen for and prevent DNA contamination in sequencing studies. PMID:23103226

  18. Sensitive and specific miRNA detection method using SplintR Ligase

    PubMed Central

    Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.

    2016-01-01

    We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271

  19. Potential of DNA barcoding for detecting quarantine fungi.

    PubMed

    Gao, Ruifang; Zhang, Guiming

    2013-11-01

    The detection of live quarantine pathogenic fungi plays an important role in guaranteeing regional biological safety. DNA barcoding, an emerging species identification technology, holds promise for the reliable, quick, and accurate detection of quarantine fungi. International standards for phytosanitary guidelines are urgently needed. The varieties of quarantine fungi listed for seven countries/regions, the currently applied detection methods, and the status of DNA barcoding for detecting quarantine fungi are summarized in this study. Two approaches have been proposed to apply DNA barcoding to fungal quarantine procedures: (i) to verify the reliability of known internal transcribed spacer (ITS)/cytochrome c oxidase subunit I (COI) data for use as barcodes, and (ii) to determine other barcodes for species that cannot be identified by ITS/COI. As a unique, standardizable, and universal species identification tool, DNA barcoding offers great potential for integrating detection methods used in various countries/regions and establishing international detection standards based on accepted DNA barcodes. Through international collaboration, interstate disputes can be eased and many problems related to routine quarantine detection methods can be solved for global trade.

  20. Detection and persistence of environmental DNA from an invasive, terrestrial mammal.

    PubMed

    Williams, Kelly E; Huyvaert, Kathryn P; Vercauteren, Kurt C; Davis, Amy J; Piaggio, Antoinette J

    2018-01-01

    Invasive Sus scrofa , a species commonly referred to as wild pig or feral swine, is a destructive invasive species with a rapidly expanding distribution across the United States. We used artificial wallows and small waterers to determine the minimum amount of time needed for pig eDNA to accumulate in the water source to a detectable level. We removed water from the artificial wallows and tested eDNA detection over the course of 2 weeks to understand eDNA persistence. We show that our method is sensitive enough to detect very low quantities of eDNA shed by a terrestrial mammal that has limited interaction with water. Our experiments suggest that the number of individuals shedding into a water system can affect persistence of eDNA. Use of an eDNA detection technique can benefit management efforts by providing a sensitive method for finding even small numbers of individuals that may be elusive using other methods.

  1. A comparison of DNA extraction procedures for the detection of Mycobacterium ulcerans, the causative agent of Buruli ulcer, in clinical and environmental specimens.

    PubMed

    Durnez, Lies; Stragier, Pieter; Roebben, Karen; Ablordey, Anthony; Leirs, Herwig; Portaels, Françoise

    2009-02-01

    Mycobacterium ulcerans is the causative agent of Buruli ulcer, the third most common mycobacterial disease in humans after tuberculosis and leprosy. Although the disease is associated with aquatic ecosystems, cultivation of the bacillus from the environment is difficult to achieve. Therefore, at the moment, research is based on the detection by PCR of the insertion sequence IS2404 present in M. ulcerans and some closely related mycobacteria. In the present study, we compared four DNA extraction methods for detection of M. ulcerans DNA, namely the one tube cell lysis and DNA extraction procedure (OT), the FastPrep procedure (FP), the modified Boom procedure (MB), and the Maxwell 16 Procedure (M16). The methods were performed on serial dilutions of M. ulcerans, followed by PCR analysis with different PCR targets in M. ulcerans to determine the detection limit (DL) of each method. The purity of the extracted DNA and the time and effort needed were compared as well. All methods were performed on environmental specimens and the two best methods (MB and M16) were tested on clinical specimens for detection of M. ulcerans DNA. When comparing the DLs of the DNA extraction methods, the MB and M16 had a significantly lower DL than the OT and FP. For the different PCR targets, IS2404 showed a significantly lower DL than mlsA, MIRU1, MIRU5 and VNTR6. The FP and M16 were considerably faster than the MB and OT, while the purity of the DNA extracted with the MB was significantly higher than the DNA extracted with the other methods. The MB performed best on the environmental and clinical specimens. This comparative study shows that the modified Boom procedure, although lengthy, provides a better method of DNA extraction than the other methods tested for detection and identification of M. ulcerans in both clinical and environmental specimens.

  2. Using occupancy modelling to compare environmental DNA to traditional field methods for regional-scale monitoring of an endangered aquatic species.

    PubMed

    Schmelzle, Molly C; Kinziger, Andrew P

    2016-07-01

    Environmental DNA (eDNA) monitoring approaches promise to greatly improve detection of rare, endangered and invasive species in comparison with traditional field approaches. Herein, eDNA approaches and traditional seining methods were applied at 29 research locations to compare method-specific estimates of detection and occupancy probabilities for endangered tidewater goby (Eucyclogobius newberryi). At each location, multiple paired seine hauls and water samples for eDNA analysis were taken, ranging from two to 23 samples per site, depending upon habitat size. Analysis using a multimethod occupancy modelling framework indicated that the probability of detection using eDNA was nearly double (0.74) the rate of detection for seining (0.39). The higher detection rates afforded by eDNA allowed determination of tidewater goby occupancy at two locations where they have not been previously detected and at one location considered to be locally extirpated. Additionally, eDNA concentration was positively related to tidewater goby catch per unit effort, suggesting eDNA could potentially be used as a proxy for local tidewater goby abundance. Compared to traditional field sampling, eDNA provided improved occupancy parameter estimates and can be applied to increase management efficiency across a broad spatial range and within a diversity of habitats. © 2015 John Wiley & Sons Ltd.

  3. Sensitive DNA detection and SNP discrimination using ultrabright SERS nanorattles and magnetic beads for malaria diagnostics.

    PubMed

    Ngo, Hoan T; Gandra, Naveen; Fales, Andrew M; Taylor, Steve M; Vo-Dinh, Tuan

    2016-07-15

    One of the major obstacles to implement nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is the lack of sensitive and practical DNA detection methods that can be seamlessly integrated into portable platforms. Herein we present a sensitive yet simple DNA detection method using a surface-enhanced Raman scattering (SERS) nanoplatform: the ultrabright SERS nanorattle. The method, referred to as the nanorattle-based method, involves sandwich hybridization of magnetic beads that are loaded with capture probes, target sequences, and ultrabright SERS nanorattles that are loaded with reporter probes. Upon hybridization, a magnet was applied to concentrate the hybridization sandwiches at a detection spot for SERS measurements. The ultrabright SERS nanorattles, composed of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for signal detection. Using this method, a specific DNA sequence of the malaria parasite Plasmodium falciparum could be detected with a detection limit of approximately 100 attomoles. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. These test models demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. Furthermore, the method's simplicity makes it a suitable candidate for integration into portable platforms for POC and in resource-limited settings applications. Copyright © 2016. Published by Elsevier B.V.

  4. Non-invasive prenatal detection of achondroplasia using circulating fetal DNA in maternal plasma.

    PubMed

    Lim, Ji Hyae; Kim, Mee Jin; Kim, Shin Young; Kim, Hye Ok; Song, Mee Jin; Kim, Min Hyoung; Park, So Yeon; Yang, Jae Hyug; Ryu, Hyun Mee

    2011-02-01

    To perform a reliable non-invasive detection of the fetal achondroplasia using maternal plasma. We developed a quantitative fluorescent-polymerase chain reaction (QF-PCR) method suitable for detection of the FGFR3 mutation (G1138A) causing achondroplasia. This method was applied in a non-invasive detection of the fetal achondroplasia using circulating fetal-DNA (cf-DNA) in maternal plasma. Maternal plasmas were obtained at 27 weeks of gestational age from women carrying an achondroplasia fetus or a normal fetus. Two percent or less achondroplasia DNA was reliably detected by QF-PCR. In a woman carrying a normal fetus, analysis of cf-DNA showed only one peak of the wild-type G allele. In a woman expected an achondroplasia fetus, analysis of cf-DNA showed the two peaks of wild-type G allele and mutant-type A allele and accurately detected the fetal achondroplasia. The non-invasive method using maternal plasma and QF-PCR may be useful for diagnosis of the fetal achondroplasia.

  5. Detection of proteins using a colorimetric bio-barcode assay.

    PubMed

    Nam, Jwa-Min; Jang, Kyung-Jin; Groves, Jay T

    2007-01-01

    The colorimetric bio-barcode assay is a red-to-blue color change-based protein detection method with ultrahigh sensitivity. This assay is based on both the bio-barcode amplification method that allows for detecting miniscule amount of targets with attomolar sensitivity and gold nanoparticle-based colorimetric DNA detection method that allows for a simple and straightforward detection of biomolecules of interest (here we detect interleukin-2, an important biomarker (cytokine) for many immunodeficiency-related diseases and cancers). The protocol is composed of the following steps: (i) conjugation of target capture molecules and barcode DNA strands onto silica microparticles, (ii) target capture with probes, (iii) separation and release of barcode DNA strands from the separated probes, (iv) detection of released barcode DNA using DNA-modified gold nanoparticle probes and (v) red-to-blue color change analysis with a graphic software. Actual target detection and quantification steps with premade probes take approximately 3 h (whole protocol including probe preparations takes approximately 3 days).

  6. Detection of human papillomavirus DNA in urine. A review of the literature.

    PubMed

    Vorsters, A; Micalessi, I; Bilcke, J; Ieven, M; Bogers, J; Van Damme, P

    2012-05-01

    The detection of human papillomavirus (HPV) DNA in urine, a specimen easily obtained by a non-invasive self-sampling method, has been the subject of a considerable number of studies. This review provides an overview of 41 published studies; assesses how different methods and settings may contribute to the sometimes contradictory outcomes; and discusses the potential relevance of using urine samples in vaccine trials, disease surveillance, epidemiological studies, and specific settings of cervical cancer screening. Urine sampling, storage conditions, sample preparation, DNA extraction, and DNA amplification may all have an important impact on HPV DNA detection and the form of viral DNA that is detected. Possible trends in HPV DNA prevalence in urine could be inferred from the presence of risk factors or the diagnosis of cervical lesions. HPV DNA detection in urine is feasible and may become a useful tool but necessitates further improvement and standardization.

  7. Discrepancy between culture and DNA probe analysis for the detection of periodontal bacteria.

    PubMed

    van Steenbergen, T J; Timmerman, M F; Mikx, F H; de Quincey, G; van der Weijden, G A; van der Velden, U; de Graaff, J

    1996-10-01

    The purpose of this study was to compare a commercially available DNA probe technique with conventional cultural techniques for the detection of Actinobacillus actinomycetemcomitans, Porphyromonas gingivalis and Prevotella intermedia in subgingival plaque samples. Samples from 20 patients with moderate to severe periodontitis were evaluated at baseline and during a 15 months period of periodontal treatment. Paperpoints from 4 periodontal pockets per patient were forwarded to Omnigene for DNA probe analysis, and simultaneously inserted paperpoints from the same pockets were analyzed by standard culture techniques. In addition, mixed bacterial samples were constructed harbouring known proportions of 25 strains of A. actinomycetemcomitans, P. gingivalis and P. intermedia each. A relatively low concordance was found between both methods. At baseline a higher detection frequency was found for A. actinomycetemcomitans and P. gingivalis for the DNA probe technique; for P. intermedia the detection frequency by culture was higher. For A. actinomycetemcomitans, 21% of the culture positive samples was positive with the DNA probe. Testing the constructed bacterial samples with the DNA probe method resulted in about 16% false positive results for the 3 species tested. Furthermore, 40% of P. gingivalis strains were not detected by the DNA probe. The present data suggest that at least part of the discrepancies found between the DNA probe technique used and cultural methods are caused by false positive and false negative DNA probe results. Therefore, the value of this DNA probe method for the detection of periodontal pathogens is questionable.

  8. Environmental DNA as a new method for early detection of New Zealand mudsnails (Potamopyrgus antipodarum)

    USGS Publications Warehouse

    Goldberg, Caren S.; Sepulveda, Adam; Ray, Andrew; Baumgardt, Jeremy A.; Waits, Lisette P.

    2013-01-01

    Early detection of aquatic invasive species is a critical task for management of aquatic ecosystems. This task is hindered by the difficulty and cost of surveying aquatic systems thoroughly. The New Zealand mudsnail (Potamopyrgus antipodarum) is a small, invasive parthenogenic mollusk that can reach very high population densities and severely affects ecosystem functioning. To assist in the early detection of this invasive species, we developed and validated a highly sensitive environmental deoxyribonucleic acid (eDNA) assay. We used a dose–response laboratory experiment to investigate the relationship between New Zealand mudsnail density and eDNA detected through time. We documented that as few as 1 individual in 1.5 L of water for 2 d could be detected with this method, and that eDNA from this species may remain detectable for 21 to 44 d after mudsnail removal. We used the eDNA method to confirm the presence of New Zealand mudsnail eDNA at densities as low as 11 to 144 snails/m2 in a eutrophic 5th-order river. Combined, these results demonstrate the high potential for eDNA surveys to assist with early detection of a widely distributed invasive aquatic invertebrate.

  9. Detection of Babesia bovis carrier cattle by using polymerase chain reaction amplification of parasite DNA.

    PubMed Central

    Fahrimal, Y; Goff, W L; Jasmer, D P

    1992-01-01

    Carrier cattle infected with Babesia bovis are difficult to detect because of the low numbers of parasites that occur in peripheral blood. However, diagnosis of low-level infections with the parasite is important for evaluating the efficacies of vaccines and in transmission and epidemiological studies. We used the polymerase chain reaction (PCR) to amplify a portion of the apocytochrome b gene from the parasite and tested the ability of this method to detect carrier cattle. The target sequence is associated with a 7.4-kb DNA element in undigested B. bovis genomic DNA (as shown previously), and the amplified product was detected by Southern and dot blot hybridization. The assay was specific for B. bovis, since no amplification was detected with Babesia bigemina, Trypanosoma brucei, Anaplasma marginale, or leukocyte DNA. The target sequence was amplified in DNA from B. bovis Mexico, Texas, and Australia S and L strains, demonstrating the applicability of the method to strains from different geographic regions. The sensitivity of the method ranged from 1 to 10 infected erythrocytes extracted from 0.5 ml of blood. This sensitivity was about 1,000 times greater than that from the use of unamplified parasite DNA. By the PCR method, six B. bovis carrier cattle were detected 86% of the time (range, 66 to 100%) when they were tested 11 times, while with microscopic examination of thick blood smears, the same carrier cattle were detected only 36% of the time (range, 17 to 66%). The method provides a useful diagnostic tool for detecting B. bovis carrier cattle, and the sensitivity is significantly improved over that of current methods. The results also suggest that characteristics of the apocytchrome b gene may make this a valuable target DNA for PCR-based detection of other hemoparasites. Images PMID:1624551

  10. [Real-time PCR kits for the detection of the African Swine Fever virus].

    PubMed

    Latyshev, O E; Eliseeva, O V; Grebennikova, T V; Verkhovskiĭ, O A; Tsibezov, V V; Chernykh, O Iu; Dzhailidi, G A; Aliper, T I

    2014-01-01

    The results obtained using the diagnostic kit based on real-time polymerase chain reaction to detect the DNA of the African Swine Fever in the pathological material, as well as in the culture fluid, are presented. A high sensitivity and specificity for detection of the DNA in the organs and tissues of animals was shown to be useful for detection in the European Union referentiality reagent kits for DNA detection by real time PCR of ASFV. More rapid and effective method of DNA extraction using columns mini spin Quick gDNA(TM) MiniPrep was suggested and compared to the method of DNA isolation on the inorganic sorbent. High correlation of the results of the DNA detection of ASFV by real-time PCR and antigen detection results ASFV by competitive ELISA obtained with the ELISA SEROTEST/INGEZIM COMRAC PPA was demonstrated. The kit can be used in the veterinary services for effective monitoring of ASFV to contain, eliminate and prevent further spread of the disease.

  11. Microwave-Accelerated Method for Ultra-Rapid Extraction of Neisseria gonorrhoeae DNA for Downstream Detection

    PubMed Central

    Melendez, Johan H.; Santaus, Tonya M.; Brinsley, Gregory; Kiang, Daniel; Mali, Buddha; Hardick, Justin; Gaydos, Charlotte A.; Geddes, Chris D.

    2016-01-01

    Nucleic acid-based detection of gonorrhea infections typically require a two-step process involving isolation of the nucleic acid, followed by the detection of the genomic target often involving PCR-based approaches. In an effort to improve on current detection approaches, we have developed a unique two-step microwave-accelerated approach for rapid extraction and detection of Neisseria gonorrhoeae (GC) DNA. Our approach is based on the use of highly-focused microwave radiation to rapidly lyse bacterial cells, release, and subsequently fragment microbial DNA. The DNA target is then detected by a process known as microwave-accelerated metal-enhanced fluorescence (MAMEF), an ultra-sensitive direct DNA detection analytical technique. In the present study, we show that highly focused microwaves at 2.45 GHz, using 12.3 mm gold film equilateral triangles, are able to rapidly lyse both bacteria cells and fragment DNA in a time- and microwave power-dependent manner. Detection of the extracted DNA can be performed by MAMEF, without the need for DNA amplification in less than 10 minutes total time or by other PCR-based approaches. Collectively, the use of a microwave-accelerated method for the release and detection of DNA represents a significant step forward towards the development of a point-of-care (POC) platform for detection of gonorrhea infections. PMID:27325503

  12. Seasonal distribution of Legionella spp. and L. pneumophila in a river in Taiwan evaluated with culture-confirmed and direct DNA extraction methods

    NASA Astrophysics Data System (ADS)

    Tung, Min-Che; Chang, Tien-Yu; Hsu, Bing-Mu; Shen, Shu-Min; Huang, Jen-Te; Kao, Po-Min; Chiu, Yi-Chou; Fan, Cheng-Wei; Huang, Yu-Li

    2013-07-01

    In this study, we evaluated the presence and amount of Legionella in along a river in Taiwan, and the relations between seasonal distribution of Legionella spp. and geographic characteristics in the watershed were also evaluated. Water samples were pre-treated and analyzed with culture-confirmed and direct DNA extraction methods. For culture-confirmed method, water samples were cultivated through a series of selective media, and candidate colonies were confirmed by PCR. For direct DNA extraction method, direct DNA extraction was performed from pre-treated water samples. The DNA extracts were analyzed with PCR and DNA sequence analysis for species determination, quantitative PCR (qPCR) was performed to quantify Legionella concentration in the water sample. In all, 150 water samples were included in this study, with 73 (48.6%) water samples detected with Legionella spp., and 17 with L. pneumophila. Over 80% Legionella spp. detections were through direct DNA extraction method, but more than 80% L. pneumophila detections were through culture-confirmed method. While detection of Legionella spp. was done with two methods, positive results were found through only one method. Legionella spp. was detected in all seasons with detection rate ranging between 34.3-58.8% and seasonal average concentration from 1.9 × 102 to 7.1 × 103 CFU/L. Most of the L. pneumophila detections were from samples collected in fall (38.2%) and summer (6.0%), which also coincided with increased cases of Legionellosis reported through Center of Disease Control in Taiwan. The high prevalence and concentration of Legionella spp. and L. pneumophila in the surface waters should be further evaluated for potential health risks.

  13. Detection and differentiation of coxiella burnetii in biological fluids

    DOEpatents

    Frazier, Marvin E.; Mallavia, Louis P.; Samuel, James E.; Baca, Oswald G.

    1993-01-01

    Methods for detecting the presence of Coxiella burnetii in biological samples, as well as a method for differentiating strains of C. burnetii that are capable of causing acute disease from those strains capable of causing chronic disease are disclosed. The methods generally comprise treating cells contained within the biological sample to expose cellular DNA, and hybridizing the cellular DNA with a DNA probe containing DNA sequences that specifically hybridize with C. burnetii DNA of strains associated with the capacity to cause acute or chronic disease.

  14. Existing and emerging detection technologies for DNA (Deoxyribonucleic Acid) finger printing, sequencing, bio- and analytical chips: a multidisciplinary development unifying molecular biology, chemical and electronics engineering.

    PubMed

    Kumar Khanna, Vinod

    2007-01-01

    The current status and research trends of detection techniques for DNA-based analysis such as DNA finger printing, sequencing, biochips and allied fields are examined. An overview of main detectors is presented vis-à-vis these DNA operations. The biochip method is explained, the role of micro- and nanoelectronic technologies in biochip realization is highlighted, various optical and electrical detection principles employed in biochips are indicated, and the operational mechanisms of these detection devices are described. Although a diversity of biochips for diagnostic and therapeutic applications has been demonstrated in research laboratories worldwide, only some of these chips have entered the clinical market, and more chips are awaiting commercialization. The necessity of tagging is eliminated in refractive-index change based devices, but the basic flaw of indirect nature of most detection methodologies can only be overcome by generic and/or reagentless DNA sensors such as the conductance-based approach and the DNA-single electron transistor (DNA-SET) structure. Devices of the electrical detection-based category are expected to pave the pathway for the next-generation DNA chips. The review provides a comprehensive coverage of the detection technologies for DNA finger printing, sequencing and related techniques, encompassing a variety of methods from the primitive art to the state-of-the-art scenario as well as promising methods for the future.

  15. Label-free optical detection of single-base mismatches by the combination of nuclease and gold nanoparticles.

    PubMed

    Liu, Meiying; Yuan, Min; Lou, Xinhui; Mao, Hongju; Zheng, Dongmei; Zou, Ruxing; Zou, Nengli; Tang, Xiangrong; Zhao, Jianlong

    2011-07-15

    We report here an optical approach that enables highly selective and colorimetric single-base mismatch detection without the need of target modification, precise temperature control or stringent washes. The method is based on the finding that nucleoside monophosphates (dNMPs), which are digested elements of DNA, can better stabilize unmodified gold nanoparticles (AuNPs) than single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) with the same base-composition and concentration. The method combines the exceptional mismatch discrimination capability of the structure-selective nucleases with the attractive optical property of AuNPs. Taking S1 nuclease as one example, the perfectly matched 16-base synthetic DNA target was distinctively differentiated from those with single-base mutation located at any position of the 16-base synthetic target. Single-base mutations present in targets with varied length up to 80-base, located either in the middle or near to the end of the targets, were all effectively detected. In order to prove that the method can be potentially used for real clinic samples, the single-base mismatch detections with two HBV genomic DNA samples were conducted. To further prove the generality of this method and potentially overcome the limitation on the detectable lengths of the targets of the S1 nuclease-based method, we also demonstrated the use of a duplex-specific nuclease (DSN) for color reversed single-base mismatch detection. The main limitation of the demonstrated methods is that it is limited to detect mutations in purified ssDNA targets. However, the method coupled with various convenient ssDNA generation and purification techniques, has the potential to be used for the future development of detector-free testing kits in single nucleotide polymorphism screenings for disease diagnostics and treatments. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. Rapid Detection and Identification of a Pathogen's DNA Using Phi29 DNA Polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xu, Y.; Dunn, J.; Gao, S.

    2008-10-31

    Zoonotic pathogens including those transmitted by insect vectors are some of the most deadly of all infectious diseases known to mankind. A number of these agents have been further weaponized and are widely recognized as being potentially significant biothreat agents. We describe a novel method based on multiply-primed rolling circle in vitro amplification for profiling genomic DNAs to permit rapid, cultivation-free differential detection and identification of circular plasmids in infectious agents. Using Phi29 DNA polymerase and a two-step priming reaction we could reproducibly detect and characterize by DNA sequencing circular DNA from Borrelia burgdorferi B31 in DNA samples containing asmore » little as 25 pg of Borrelia DNA amongst a vast excess of human DNA. This simple technology can ultimately be adapted as a sensitive method to detect specific DNA from both known and unknown pathogens in a wide variety of complex environments.« less

  17. Detection of DNA Sequences Refractory to PCR Amplification Using a Biophysical SERRS Assay (Surface Enhanced Resonant Raman Spectroscopy)

    PubMed Central

    Feuillie, Cécile; Merheb, Maxime M.; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

    2014-01-01

    The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction – based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage. PMID:25502338

  18. Detection of DNA sequences refractory to PCR amplification using a biophysical SERRS assay (Surface Enhanced Resonant Raman Spectroscopy).

    PubMed

    Feuillie, Cécile; Merheb, Maxime M; Gillet, Benjamin; Montagnac, Gilles; Daniel, Isabelle; Hänni, Catherine

    2014-01-01

    The analysis of ancient or processed DNA samples is often a great challenge, because traditional Polymerase Chain Reaction - based amplification is impeded by DNA damage. Blocking lesions such as abasic sites are known to block the bypass of DNA polymerases, thus stopping primer elongation. In the present work, we applied the SERRS-hybridization assay, a fully non-enzymatic method, to the detection of DNA refractory to PCR amplification. This method combines specific hybridization with detection by Surface Enhanced Resonant Raman Scattering (SERRS). It allows the detection of a series of double-stranded DNA molecules containing a varying number of abasic sites on both strands, when PCR failed to detect the most degraded sequences. Our SERRS approach can quickly detect DNA molecules without any need for DNA repair. This assay could be applied as a pre-requisite analysis prior to enzymatic reparation or amplification. A whole new set of samples, both forensic and archaeological, could then deliver information that was not yet available due to a high degree of DNA damage.

  19. A label-free amplified fluorescence DNA detection based on isothermal circular strand-displacement polymerization reaction and graphene oxide.

    PubMed

    Li, Zhen; Zhu, Wenping; Zhang, Jinwen; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin

    2013-07-07

    A label-free fluorescent DNA biosensor has been presented based on isothermal circular strand-displacement polymerization reaction (ICSDPR) combined with graphene oxide (GO) binding. The proposed method is simple and cost-effective with a low detection limit of 4 pM, which compares favorably with other GO-based homogenous DNA detection methods.

  20. A 5-mC Dot Blot Assay Quantifying the DNA Methylation Level of Chondrocyte Dedifferentiation In Vitro.

    PubMed

    Jia, Zhaofeng; Liang, Yujie; Ma, Bin; Xu, Xiao; Xiong, Jianyi; Duan, Li; Wang, Daping

    2017-05-17

    The dedifferentiation of hyaline chondrocytes into fibroblastic chondrocytes often accompanies monolayer expansion of chondrocytes in vitro. The global DNA methylation level of chondrocytes is considered to be a suitable biomarker for the loss of the chondrocyte phenotype. However, results based on different experimental methods can be inconsistent. Therefore, it is important to establish a precise, simple, and rapid method to quantify global DNA methylation levels during chondrocyte dedifferentiation. Current genome-wide methylation analysis techniques largely rely on bisulfite genomic sequencing. Due to DNA degradation during bisulfite conversion, these methods typically require a large sample volume. Other methods used to quantify global DNA methylation levels include high-performance liquid chromatography (HPLC). However, HPLC requires complete digestion of genomic DNA. Additionally, the prohibitively high cost of HPLC instruments limits HPLC's wider application. In this study, genomic DNA (gDNA) was extracted from human chondrocytes cultured with varying number of passages. The gDNA methylation level was detected using a methylation-specific dot blot assay. In this dot blot approach, a gDNA mixture containing the methylated DNA to be detected was spotted directly onto an N + membrane as a dot inside a previously drawn circular template pattern. Compared with other gel electrophoresis-based blotting approaches and other complex blotting procedures, the dot blot method saves significant time. In addition, dot blots can detect overall DNA methylation level using a commercially available 5-mC antibody. We found that the DNA methylation level differed between the monolayer subcultures, and therefore could play a key role in chondrocyte dedifferentiation. The 5-mC dot blot is a reliable, simple, and rapid method to detect the general DNA methylation level to evaluate chondrocyte phenotype.

  1. Integrated digital error suppression for improved detection of circulating tumor DNA

    PubMed Central

    Kurtz, David M.; Chabon, Jacob J.; Scherer, Florian; Stehr, Henning; Liu, Chih Long; Bratman, Scott V.; Say, Carmen; Zhou, Li; Carter, Justin N.; West, Robert B.; Sledge, George W.; Shrager, Joseph B.; Loo, Billy W.; Neal, Joel W.; Wakelee, Heather A.; Diehn, Maximilian; Alizadeh, Ash A.

    2016-01-01

    High-throughput sequencing of circulating tumor DNA (ctDNA) promises to facilitate personalized cancer therapy. However, low quantities of cell-free DNA (cfDNA) in the blood and sequencing artifacts currently limit analytical sensitivity. To overcome these limitations, we introduce an approach for integrated digital error suppression (iDES). Our method combines in silico elimination of highly stereotypical background artifacts with a molecular barcoding strategy for the efficient recovery of cfDNA molecules. Individually, these two methods each improve the sensitivity of cancer personalized profiling by deep sequencing (CAPP-Seq) by ~3 fold, and synergize when combined to yield ~15-fold improvements. As a result, iDES-enhanced CAPP-Seq facilitates noninvasive variant detection across hundreds of kilobases. Applied to clinical non-small cell lung cancer (NSCLC) samples, our method enabled biopsy-free profiling of EGFR kinase domain mutations with 92% sensitivity and 96% specificity and detection of ctDNA down to 4 in 105 cfDNA molecules. We anticipate that iDES will aid the noninvasive genotyping and detection of ctDNA in research and clinical settings. PMID:27018799

  2. Recombinase Polymerase Amplification (RPA) of CaMV-35S Promoter and nos Terminator for Rapid Detection of Genetically Modified Crops

    PubMed Central

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-01-01

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37–42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15–25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops. PMID:25310647

  3. Recombinase polymerase amplification (RPA) of CaMV-35S promoter and nos terminator for rapid detection of genetically modified crops.

    PubMed

    Xu, Chao; Li, Liang; Jin, Wujun; Wan, Yusong

    2014-10-10

    Recombinase polymerase amplification (RPA) is a novel isothermal DNA amplification and detection technology that enables the amplification of DNA within 30 min at a constant temperature of 37-42 °C by simulating in vivo DNA recombination. In this study, based on the regulatory sequence of the cauliflower mosaic virus 35S (CaMV-35S) promoter and the Agrobacterium tumefaciens nopaline synthase gene (nos) terminator, which are widely incorporated in genetically modified (GM) crops, we designed two sets of RPA primers and established a real-time RPA detection method for GM crop screening and detection. This method could reliably detect as few as 100 copies of the target molecule in a sample within 15-25 min. Furthermore, the real-time RPA detection method was successfully used to amplify and detect DNA from samples of four major GM crops (maize, rice, cotton, and soybean). With this novel amplification method, the test time was significantly shortened and the reaction process was simplified; thus, this method represents an effective approach to the rapid detection of GM crops.

  4. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

    USGS Publications Warehouse

    Wilcox, Taylor M; Mckelvey, Kevin S.; Young, Michael K.; Sepulveda, Adam; Shepard, Bradley B.; Jane, Stephen F; Whiteley, Andrew R.; Lowe, Winsor H.; Schwartz, Michael K.

    2016-01-01

    Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive independent estimates of eDNA production rates and downstream persistence from brook trout (Salvelinus fontinalis) in streams. We use these estimates to parameterize models comparing the false negative detection rates of eDNA sampling and traditional backpack electrofishing. We find that using the protocols in this study eDNA had reasonable detection probabilities at extremely low animal densities (e.g., probability of detection 0.18 at densities of one fish per stream kilometer) and very high detection probabilities at population-level densities (e.g., probability of detection > 0.99 at densities of ≥ 3 fish per 100 m). This is substantially more sensitive than traditional electrofishing for determining the presence of brook trout and may translate into important cost savings when animals are rare. Our findings are consistent with a growing body of literature showing that eDNA sampling is a powerful tool for the detection of aquatic species, particularly those that are rare and difficult to sample using traditional methods.

  5. [Comparative analysis between diatom nitric acid digestion method and plankton 16S rDNA PCR method].

    PubMed

    Han, Jun-ge; Wang, Cheng-bao; Li, Xing-biao; Fan, Yan-yan; Feng, Xiang-ping

    2013-10-01

    To compare and explore the application value of diatom nitric acid digestion method and plankton 16S rDNA PCR method for drowning identification. Forty drowning cases from 2010 to 2011 were collected from Department of Forensic Medicine of Wenzhou Medical University. Samples including lung, kidney, liver and field water from each case were tested with diatom nitric acid digestion method and plankton 16S rDNA PCR method, respectively. The Diatom nitric acid digestion method and plankton 16S rDNA PCR method required 20 g and 2 g of each organ, and 15 mL and 1.5 mL of field water, respectively. The inspection time and detection rate were compared between the two methods. Diatom nitric acid digestion method mainly detected two species of diatoms, Centriae and Pennatae, while plankton 16S rDNA PCR method amplified a length of 162 bp band. The average inspection time of each case of the Diatom nitric acid digestion method was (95.30 +/- 2.78) min less than (325.33 +/- 14.18) min of plankton 16S rDNA PCR method (P < 0.05). The detection rates of two methods for field water and lung were both 100%. For liver and kidney, the detection rate of plankton 16S rDNA PCR method was both 80%, higher than 40% and 30% of diatom nitric acid digestion method (P < 0.05), respectively. The laboratory testing method needs to be appropriately selected according to the specific circumstances in the forensic appraisal of drowning. Compared with diatom nitric acid digestion method, plankton 16S rDNA PCR method has practice values with such advantages as less quantity of samples, huge information and high specificity.

  6. A sensitive and accurate quantification method for the detection of hepatitis B virus covalently closed circular DNA by the application of a droplet digital polymerase chain reaction amplification system.

    PubMed

    Mu, Di; Yan, Liang; Tang, Hui; Liao, Yong

    2015-10-01

    To develop a sensitive and accurate assay system for the quantification of covalently closed circular HBV DNA (cccDNA) for future clinical monitoring of cccDNA fluctuation during antiviral therapy in the liver of infected patients. A droplet digital PCR (ddPCR)-based assay system detected template DNA input at the single copy level (or ~10(-5) pg of plasmid HBV DNA) by using serially diluted plasmid HBV DNA samples. Compared with the conventional quantitative PCR assay in the detection of cccDNA, which required at least 50 ng of template DNA input, a parallel experiment applying a ddPCR system demonstrates that the lowest detection limit of cccDNA from HepG2.215 cellular DNA samples is around 1 ng, which is equivalent to 0.54 ± 0.94 copies of cccDNA. In addition, we demonstrated that the addition of cccDNA-safe exonuclease and utilization of cccDNA-specific primers in the ddPCR assay system significantly improved the detection accuracy of HBV cccDNA from HepG2.215 cellular DNA samples. The ddPCR-based cccDNA detection system is a sensitive and accurate assay for the quantification of cccDNA in HBV-transfected HepG2.215 cellular DNA samples and may represent an important method for future application in monitoring cccDNA fluctuation during antiviral therapy.

  7. A simple method of DNA isolation from jute (Corchorus olitorius) seed suitable for PCR-based detection of the pathogen Macrophomina phaseolina (Tassi) Goid.

    PubMed

    Biswas, C; Dey, P; Satpathy, S; Sarkar, S K; Bera, A; Mahapatra, B S

    2013-02-01

    A simple method was developed for isolating DNA from jute seed, which contains high amounts of mucilage and secondary metabolites, and a PCR protocol was standardized for detecting the seedborne pathogen Macrophomina phaseolina. The cetyl trimethyl ammonium bromide method was modified with increased salt concentration and a simple sodium acetate treatment to extract genomic as well as fungal DNA directly from infected jute seed. The Miniprep was evaluated along with five other methods of DNA isolation in terms of yield and quality of DNA and number of PCR positive samples. The Miniprep consistently recovered high amounts of DNA with good spectral qualities at A260/A280. The DNA isolated from jute seed was found suitable for PCR amplification. Macrophomina phaseolina could be detected by PCR from artificially inoculated as well as naturally infected jute seeds. The limit of PCR-based detection of M. phaseolina in jute seed was determined to be 0·62 × 10(-7) CFU g(-1) seed. © 2012 The Society for Applied Microbiology.

  8. Highly sensitive fluorescence quantitative detection of specific DNA sequences with molecular beacons and nucleic acid dye SYBR Green I.

    PubMed

    Xiang, Dongshan; Zhai, Kun; Xiang, Wenjun; Wang, Lianzhi

    2014-11-01

    A highly sensitive fluorescence method of quantitative detection for specific DNA sequence is developed based on molecular beacon (MB) and nucleic acid dye SYBR Green I by synchronous fluorescence analysis. It is demonstrated by an oligonucleotide sequence of wild-type HBV (target DNA) as a model system. In this strategy, the fluorophore of MB is designed to be 6-carboxyfluorescein group (FAM), and the maximum excitation wavelength and maximum emission wavelength are both very close to that of SYBR Green I. In the presence of targets DNA, the MBs hybridize with the targets DNA and form double-strand DNA (dsDNA), the fluorophore FAM is separated from the quencher BHQ-1, thus the fluorophore emit fluorescence. At the same time, SYBR Green I binds to dsDNA, the fluorescence intensity of SYBR Green I is significantly enhanced. When targets DNA are detected by synchronous fluorescence analysis, the fluorescence peaks of FAM and SYBR Green I overlap completely, so the fluorescence signal of system will be significantly enhanced. Thus, highly sensitive fluorescence quantitative detection for DNA can be realized. Under the optimum conditions, the total fluorescence intensity of FAM and SYBR Green I exhibits good linear dependence on concentration of targets DNA in the range from 2×10(-11) to 2.5×10(-9)M. The detection limit of target DNA is estimated to be 9×10(-12)M (3σ). Compared with previously reported methods of detection DNA with MB, the proposed method can significantly enhance the detection sensitivity. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Detection of regional DNA methylation using DNA-graphene affinity interactions.

    PubMed

    Haque, Md Hakimul; Gopalan, Vinod; Yadav, Sharda; Islam, Md Nazmul; Eftekhari, Ehsan; Li, Qin; Carrascosa, Laura G; Nguyen, Nam-Trung; Lam, Alfred K; Shiddiky, Muhammad J A

    2017-01-15

    We report a new method for the detection of regional DNA methylation using base-dependent affinity interaction (i.e., adsorption) of DNA with graphene. Due to the strongest adsorption affinity of guanine bases towards graphene, bisulfite-treated guanine-enriched methylated DNA leads to a larger amount of the adsorbed DNA on the graphene-modified electrodes in comparison to the adenine-enriched unmethylated DNA. The level of the methylation is quantified by monitoring the differential pulse voltammetric current as a function of the adsorbed DNA. The assay is sensitive to distinguish methylated and unmethylated DNA sequences at single CpG resolution by differentiating changes in DNA methylation as low as 5%. Furthermore, this method has been used to detect methylation levels in a collection of DNA samples taken from oesophageal cancer tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Understanding environmental DNA detection probabilities: A case study using a stream-dwelling char Salvelinus fontinalis

    Treesearch

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Adam J. Sepulveda; Bradley B. Shepard; Stephen F. Jane; Andrew R. Whiteley; Winsor H. Lowe; Michael K. Schwartz

    2016-01-01

    Environmental DNA sampling (eDNA) has emerged as a powerful tool for detecting aquatic animals. Previous research suggests that eDNA methods are substantially more sensitive than traditional sampling. However, the factors influencing eDNA detection and the resulting sampling costs are still not well understood. Here we use multiple experiments to derive...

  11. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules.

    PubMed

    Mohamad, Nurhidayatul Asma; Mustafa, Shuhaimi; Khairil Mokhtar, Nur Fadhilah; El Sheikha, Aly Farag

    2018-03-05

    The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared. A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA. The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

  12. Assessment of circulating copy number variant detection for cancer screening.

    PubMed

    Molparia, Bhuvan; Nichani, Eshaan; Torkamani, Ali

    2017-01-01

    Current high-sensitivity cancer screening methods, largely utilizing correlative biomarkers, suffer from false positive rates that lead to unnecessary medical procedures and debatable public health benefit overall. Detection of circulating tumor DNA (ctDNA), a causal biomarker, has the potential to revolutionize cancer screening. Thus far, the majority of ctDNA studies have focused on detection of tumor-specific point mutations after cancer diagnosis for the purpose of post-treatment surveillance. However, ctDNA point mutation detection methods developed to date likely lack either the scope or analytical sensitivity necessary to be useful for cancer screening, due to the low (<1%) ctDNA fraction derived from early stage tumors. On the other hand, tumor-derived copy number variant (CNV) detection is hypothetically a superior means of ctDNA-based cancer screening for many tumor types, given that, relative to point mutations, each individual tumor CNV contributes a much larger number of ctDNA fragments to the overall pool of circulating free DNA (cfDNA). A small number of studies have demonstrated the potential of ctDNA CNV-based screening in select cancer types. Here we perform an in silico assessment of the potential for ctDNA CNV-based cancer screening across many common cancers, and suggest ctDNA CNV detection shows promise as a broad cancer screening methodology.

  13. Comparison of oral fluid collection methods for the molecular detection of hepatitis B virus.

    PubMed

    Portilho, M M; Mendonça, Acf; Marques, V A; Nabuco, L C; Villela-Nogueira, C A; Ivantes, Cap; Lewis-Ximenez, L L; Lampe, E; Villar, L M

    2017-11-01

    This study aims to compare the efficiency of four oral fluid collection methods (Salivette, FTA Card, spitting and DNA-Sal) to detect HBV DNA by qualitative PCR. Seventy-four individuals (32 HBV reactive and 42 with no HBV markers) donated serum and oral fluid. In-house qualitative PCR to detect HBV was used for both samples and commercial quantitative PCR for serum. HBV DNA was detected in all serum samples from HBV-infected individuals, and it was not detected in control group. HBV DNA from HBV group was detected in 17 samples collected with Salivette device, 16 samples collected by FTA Card device, 16 samples collected from spitting and 13 samples collected by DNA-Sal device. Samples that corresponded to a higher viral load in their paired serum sample could be detected using all oral fluid collection methods, but Salivette collection device yielded the largest numbers of positive samples and had a wide range of viral load that was detected. It was possible to detect HBV DNA using all devices tested, but higher number of positive samples was observed when samples were collected using Salivette device, which shows high concordance to viral load observed in the paired serum samples. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd. All rights reserved.

  14. Detection of genetically modified organisms in foods by DNA amplification techniques.

    PubMed

    García-Cañas, Virginia; Cifuentes, Alejandro; González, Ramón

    2004-01-01

    In this article, the different DNA amplification techniques that are being used for detecting genetically modified organisms (GMOs) in foods are examined. This study intends to provide an updated overview (including works published till June 2002) on the principal applications of such techniques together with their main advantages and drawbacks in GMO detection in foods. Some relevant facts on sampling, DNA isolation, and DNA amplification methods are discussed. Moreover; these analytical protocols are discuissed from a quantitative point of view, including the newest investigations on multiplex detection of GMOs in foods and validation of methods.

  15. Microwave-accelerated method for ultra-rapid extraction of Neisseria gonorrhoeae DNA for downstream detection.

    PubMed

    Melendez, Johan H; Santaus, Tonya M; Brinsley, Gregory; Kiang, Daniel; Mali, Buddha; Hardick, Justin; Gaydos, Charlotte A; Geddes, Chris D

    2016-10-01

    Nucleic acid-based detection of gonorrhea infections typically require a two-step process involving isolation of the nucleic acid, followed by detection of the genomic target often involving polymerase chain reaction (PCR)-based approaches. In an effort to improve on current detection approaches, we have developed a unique two-step microwave-accelerated approach for rapid extraction and detection of Neisseria gonorrhoeae (gonorrhea, GC) DNA. Our approach is based on the use of highly focused microwave radiation to rapidly lyse bacterial cells, release, and subsequently fragment microbial DNA. The DNA target is then detected by a process known as microwave-accelerated metal-enhanced fluorescence (MAMEF), an ultra-sensitive direct DNA detection analytical technique. In the current study, we show that highly focused microwaves at 2.45 GHz, using 12.3-mm gold film equilateral triangles, are able to rapidly lyse both bacteria cells and fragment DNA in a time- and microwave power-dependent manner. Detection of the extracted DNA can be performed by MAMEF, without the need for DNA amplification, in less than 10 min total time or by other PCR-based approaches. Collectively, the use of a microwave-accelerated method for the release and detection of DNA represents a significant step forward toward the development of a point-of-care (POC) platform for detection of gonorrhea infections. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Comprehensive GMO detection using real-time PCR array: single-laboratory validation.

    PubMed

    Mano, Junichi; Harada, Mioko; Takabatake, Reona; Furui, Satoshi; Kitta, Kazumi; Nakamura, Kosuke; Akiyama, Hiroshi; Teshima, Reiko; Noritake, Hiromichi; Hatano, Shuko; Futo, Satoshi; Minegishi, Yasutaka; Iizuka, Tayoshi

    2012-01-01

    We have developed a real-time PCR array method to comprehensively detect genetically modified (GM) organisms. In the method, genomic DNA extracted from an agricultural product is analyzed using various qualitative real-time PCR assays on a 96-well PCR plate, targeting for individual GM events, recombinant DNA (r-DNA) segments, taxon-specific DNAs, and donor organisms of the respective r-DNAs. In this article, we report the single-laboratory validation of both DNA extraction methods and component PCR assays constituting the real-time PCR array. We selected some DNA extraction methods for specified plant matrixes, i.e., maize flour, soybean flour, and ground canola seeds, then evaluated the DNA quantity, DNA fragmentation, and PCR inhibition of the resultant DNA extracts. For the component PCR assays, we evaluated the specificity and LOD. All DNA extraction methods and component PCR assays satisfied the criteria set on the basis of previous reports.

  17. Sensitive detection of Treponema pallidum DNA from the whole blood of patients with syphilis by the nested PCR assay.

    PubMed

    Wang, Cuini; Cheng, Yuanyuan; Liu, Biao; Wang, Yuanyuan; Gong, Weiming; Qian, Yihong; Guan, Zhifang; Lu, Haikong; Gu, Xin; Shi, Mei; Zhou, Pingyu

    2018-05-09

    The aim of this work was to investigate the application of the nested PCR assay for the detection of Treponema pallidum (TP) DNA from the blood of patients with different stages of syphilis. In this study, a nested PCR method targeting the Tpp47 and polA genes (Tpp47-Tp-PCR and polA-Tp-PCR) was developed to detect TP-DNA in whole blood samples collected from 262 patients with different stages of syphilis (84 primary syphilis, 97 secondary syphilis, and 81 latent syphilis patients). The PCR assay detected T. pallidum DNA in 53.6% and 62.9% of the patients with primary and secondary syphilis, respectively, which was much higher than the detection levels in patients with latent syphilis (7.4%) (both p < 0.001). For primary syphilis, a low RPR (0-16) was correlated with a higher detection rate of TP-DNA, whereas for secondary syphilis, the higher detection rate of blood TP-DNA was correlated with higher blood RPR titers (at or beyond 32). For latent syphilis, TP-DNA was only detectable by PCR in the early phase of the latent infection. Thus, blood RPR titers were correlated with the blood T. pallidum burden, but the correlations varied with primary and secondary syphilis. The results indicate that nested PCR is a sensitive method for detecting blood TP-DNA and is especially useful for detecting early syphilis including primary syphilis and secondary syphilis. The findings also suggest that the PCR assay may be used to complement other methods to enhance the diagnosis of syphilis.

  18. Facile and rapid DNA extraction and purification from food matrices using IFAST (immiscible filtration assisted by surface tension).

    PubMed

    Strotman, Lindsay N; Lin, Guangyun; Berry, Scott M; Johnson, Eric A; Beebe, David J

    2012-09-07

    Extraction and purification of DNA is a prerequisite to detection and analytical techniques. While DNA sample preparation methods have improved over the last few decades, current methods are still time consuming and labor intensive. Here we demonstrate a technology termed IFAST (Immiscible Filtration Assisted by Surface Tension), that relies on immiscible phase filtration to reduce the time and effort required to purify DNA. IFAST replaces the multiple wash and centrifugation steps required by traditional DNA sample preparation methods with a single step. To operate, DNA from lysed cells is bound to paramagnetic particles (PMPs) and drawn through an immiscible fluid phase barrier (i.e. oil) by an external handheld magnet. Purified DNA is then eluted from the PMPs. Here, detection of Clostridium botulinum type A (BoNT/A) in food matrices (milk, orange juice), a bioterrorism concern, was used as a model system to establish IFAST's utility in detection assays. Data validated that the DNA purified by IFAST was functional as a qPCR template to amplify the bont/A gene. The sensitivity limit of IFAST was comparable to the commercially available Invitrogen ChargeSwitch® method. Notably, pathogen detection via IFAST required only 8.5 μL of sample and was accomplished in five-fold less time. The simplicity, rapidity and portability of IFAST offer significant advantages when compared to existing DNA sample preparation methods.

  19. Signal-on fluorescence biosensor for microRNA-21 detection based on DNA strand displacement reaction and Mg2+-dependent DNAzyme cleavage.

    PubMed

    Yin, Huan-Shun; Li, Bing-Chen; Zhou, Yun-Lei; Wang, Hai-Yan; Wang, Ming-Hui; Ai, Shi-Yun

    2017-10-15

    MicroRNAs have been involved into many biological processes and are regarded as disease biomarkers. Simple, rapid, sensitive and selective method for microRNA detection is crucial for early diagnosis and therapy of diseases. In this work, sensitive fluorescence assay was developed for microRNA-21 detection based on DNA polymerase induced strand displacement amplification reaction, Mg 2+ -dependent DNAzyme catalysis reaction, and magnetic separation. In the presence of target microRNA-21, amounts of trigger DNA could be produced with DNA polymerase induced strand displacement amplification reaction, and the trigger DNA could be further hybridized with signal DNA, which was labeled with biotin and AMCA dye. After introduction of Mg 2+ , trigger DNA could form DNAzyme to cleave signal DNA. After magnetic separation, the DNA fragment with AMCA dye could give fluorescence signal, which was related to microRNA-21 concentration. Based on the two efficient signal amplifications, the developed method showed high detection sensitivity with low detection limit of 0.27fM (3σ). In addition, this fluorescence strategy also possessed excellent detection specificity, and could be applied to analyze microRNA-21 expression level in serum of cancer patient. According to the obtained results, the developed fluorescence method might be a promising detection platform for microRNA-21 quantitative analysis in biomedical research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. Detection of genetically modified organisms (GMOs) using isothermal amplification of target DNA sequences.

    PubMed

    Lee, David; La Mura, Maurizio; Allnutt, Theo R; Powell, Wayne

    2009-02-02

    The most common method of GMO detection is based upon the amplification of GMO-specific DNA amplicons using the polymerase chain reaction (PCR). Here we have applied the loop-mediated isothermal amplification (LAMP) method to amplify GMO-related DNA sequences, 'internal' commonly-used motifs for controlling transgene expression and event-specific (plant-transgene) junctions. We have tested the specificity and sensitivity of the technique for use in GMO studies. Results show that detection of 0.01% GMO in equivalent background DNA was possible and dilutions of template suggest that detection from single copies of the template may be possible using LAMP. This work shows that GMO detection can be carried out using LAMP for routine screening as well as for specific events detection. Moreover, the sensitivity and ability to amplify targets, even with a high background of DNA, here demonstrated, highlights the advantages of this isothermal amplification when applied for GMO detection.

  1. Methods for Integrated Air Sampling and DNA Analysis for Detection of Airborne Fungal Spores

    PubMed Central

    Williams, Roger H.; Ward, Elaine; McCartney, H. Alastair

    2001-01-01

    Integrated air sampling and PCR-based methods for detecting airborne fungal spores, using Penicillium roqueforti as a model fungus, are described. P. roqueforti spores were collected directly into Eppendorf tubes using a miniature cyclone-type air sampler. They were then suspended in 0.1% Nonidet P-40, and counted using microscopy. Serial dilutions of the spores were made. Three methods were used to produce DNA for PCR tests: adding untreated spores to PCRs, disrupting spores (fracturing of spore walls to release the contents) using Ballotini beads, and disrupting spores followed by DNA purification. Three P. roqueforti-specific assays were tested: single-step PCR, nested PCR, and PCR followed by Southern blotting and probing. Disrupting the spores was found to be essential for achieving maximum sensitivity of the assay. Adding untreated spores to the PCR did allow the detection of P. roqueforti, but this was never achieved when fewer than 1,000 spores were added to the PCR. By disrupting the spores, with or without subsequent DNA purification, it was possible to detect DNA from a single spore. When known quantities of P. roqueforti spores were added to air samples consisting of high concentrations of unidentified fungal spores, pollen, and dust, detection sensitivity was reduced. P. roqueforti DNA could not be detected using untreated or disrupted spore suspensions added to the PCRs. However, using purified DNA, it was possible to detect 10 P. roqueforti spores in a background of 4,500 other spores. For all DNA extraction methods, nested PCR was more sensitive than single-step PCR or PCR followed by Southern blotting. PMID:11375150

  2. Direct Detection and Sequencing of Damaged DNA Bases

    PubMed Central

    2011-01-01

    Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications. PMID:22185597

  3. Direct detection and sequencing of damaged DNA bases.

    PubMed

    Clark, Tyson A; Spittle, Kristi E; Turner, Stephen W; Korlach, Jonas

    2011-12-20

    Products of various forms of DNA damage have been implicated in a variety of important biological processes, such as aging, neurodegenerative diseases, and cancer. Therefore, there exists great interest to develop methods for interrogating damaged DNA in the context of sequencing. Here, we demonstrate that single-molecule, real-time (SMRT®) DNA sequencing can directly detect damaged DNA bases in the DNA template - as a by-product of the sequencing method - through an analysis of the DNA polymerase kinetics that are altered by the presence of a modified base. We demonstrate the sequencing of several DNA templates containing products of DNA damage, including 8-oxoguanine, 8-oxoadenine, O6-methylguanine, 1-methyladenine, O4-methylthymine, 5-hydroxycytosine, 5-hydroxyuracil, 5-hydroxymethyluracil, or thymine dimers, and show that these base modifications can be readily detected with single-modification resolution and DNA strand specificity. We characterize the distinct kinetic signatures generated by these DNA base modifications.

  4. Comparison of American Fisheries Society (AFS) standard fish sampling techniques and environmental DNA for characterizing fish communities in a large reservoir

    USGS Publications Warehouse

    Perez, Christina R.; Bonar, Scott A.; Amberg, Jon J.; Ladell, Bridget; Rees, Christopher B.; Stewart, William T.; Gill, Curtis J.; Cantrell, Chris; Robinson, Anthony

    2017-01-01

    Recently, methods involving examination of environmental DNA (eDNA) have shown promise for characterizing fish species presence and distribution in waterbodies. We evaluated the use of eDNA for standard fish monitoring surveys in a large reservoir. Specifically, we compared the presence, relative abundance, biomass, and relative percent composition of Largemouth Bass Micropterus salmoides and Gizzard Shad Dorosoma cepedianum measured through eDNA methods and established American Fisheries Society standard sampling methods for Theodore Roosevelt Lake, Arizona. Catches at electrofishing and gillnetting sites were compared with eDNA water samples at sites, within spatial strata, and over the entire reservoir. Gizzard Shad were detected at a higher percentage of sites with eDNA methods than with boat electrofishing in both spring and fall. In contrast, spring and fall gillnetting detected Gizzard Shad at more sites than eDNA. Boat electrofishing and gillnetting detected Largemouth Bass at more sites than eDNA; the exception was fall gillnetting, for which the number of sites of Largemouth Bass detection was equal to that for eDNA. We observed no relationship between relative abundance and biomass of Largemouth Bass and Gizzard Shad measured by established methods and eDNA copies at individual sites or lake sections. Reservoirwide catch composition for Largemouth Bass and Gizzard Shad (numbers and total weight [g] of fish) as determined through a combination of gear types (boat electrofishing plus gillnetting) was similar to the proportion of total eDNA copies from each species in spring and fall field sampling. However, no similarity existed between proportions of fish caught via spring and fall boat electrofishing and the proportion of total eDNA copies from each species. Our study suggests that eDNA field sampling protocols, filtration, DNA extraction, primer design, and DNA sequencing methods need further refinement and testing before incorporation into standard fish sampling surveys.

  5. Comparison of 16S rDNA-based PCR and checkerboard DNA-DNA hybridisation for detection of selected endodontic pathogens.

    PubMed

    Siqueira, José F; Rôças, Isabela N; De Uzeda, Milton; Colombo, Ana P; Santos, Kátia R N

    2002-12-01

    Molecular methods have been used recently to investigate the bacteria encountered in human endodontic infections. The aim of the present study was to compare the ability of a 16S rDNA-based PCR assay and checkerboard DNA-DNA hybridisation in detecting Actinobacillus actinomycetemcomitans, Bacteroides forsythus, Peptostreptococcus micros, Porphyromonas endodontalis, Por. gingivalis and Treponema denticola directly from clinical samples. Specimens were obtained from 50 cases of endodontic infections and the presence of the target species was investigated by whole genomic DNA probes and checkerboard DNA-DNA hybridisation or taxon-specific oligonucleotides with PCR assay. Prevalence of the target species was based on data obtained by each method. The sensitivity and specificity of each molecular method was compared with the data generated by the other method as the reference--a value of 1.0 representing total agreement with the chosen standard. The methods were also compared with regard to the prevalence values for each target species. Regardless of the detection method used, T. denticola, Por. gingivalis, Por. endodontalis and B. forsythus were the most prevalent species. If the checkerboard data for these four species were used as the reference, PCR detection sensitivities ranged from 0.53 to 1.0, and specificities from 0.5 to 0.88, depending on the target bacterial species. When PCR data for the same species were used as the reference, the detection sensitivities for the checkerboard method ranged from 0.17 to 0.73, and specificities from 0.75 to 1.0. Accuracy values ranged from 0.6 to 0.74. On the whole, matching results between the two molecular methods ranged from 60% to 97.5%, depending on the target species. The major discrepancies between the methods comprised a number of PCR-positive but checkerboard-negative results. Significantly higher prevalence figures for Por. endodontalis and T. denticola were observed after PCR assessment. There was no further significant difference between the methods with regard to detection of the other target species.

  6. Non-Enzymatic Detection of Bacterial Genomic DNA Using the Bio-Barcode Assay

    PubMed Central

    Hill, Haley D.; Vega, Rafael A.; Mirkin, Chad A.

    2011-01-01

    The detection of bacterial genomic DNA through a non-enzymatic nanomaterials based amplification method, the bio-barcode assay, is reported. The assay utilizes oligonucleotide functionalized magnetic microparticles to capture the target of interest from the sample. A critical step in the new assay involves the use of blocking oligonucleotides during heat denaturation of the double stranded DNA. These blockers bind to specific regions of the target DNA upon cooling, and prevent the duplex DNA from re-hybridizing, which allows the particle probes to bind. Following target isolation using the magnetic particles, oligonucleotide functionalized gold nanoparticles act as target recognition agents. The oligonucleotides on the nanoparticle (barcodes) act as amplification surrogates. The barcodes are then detected using the Scanometric method. The limit of detection for this assay was determined to be 2.5 femtomolar, and this is the first demonstration of a barcode type assay for the detection of double stranded, genomic DNA. PMID:17927207

  7. DNA Extraction Method Affects the Detection of a Fungal Pathogen in Formalin-Fixed Specimens Using qPCR.

    PubMed

    Adams, Andrea J; LaBonte, John P; Ball, Morgan L; Richards-Hrdlicka, Kathryn L; Toothman, Mary H; Briggs, Cheryl J

    2015-01-01

    Museum collections provide indispensable repositories for obtaining information about the historical presence of disease in wildlife populations. The pathogenic amphibian chytrid fungus Batrachochytrium dendrobatidis (Bd) has played a significant role in global amphibian declines, and examining preserved specimens for Bd can improve our understanding of its emergence and spread. Quantitative PCR (qPCR) enables Bd detection with minimal disturbance to amphibian skin and is significantly more sensitive to detecting Bd than histology; therefore, developing effective qPCR methodologies for detecting Bd DNA in formalin-fixed specimens can provide an efficient and effective approach to examining historical Bd emergence and prevalence. Techniques for detecting Bd in museum specimens have not been evaluated for their effectiveness in control specimens that mimic the conditions of animals most likely to be encountered in museums, including those with low pathogen loads. We used American bullfrogs (Lithobates catesbeianus) of known infection status to evaluate the success of qPCR to detect Bd in formalin-fixed specimens after three years of ethanol storage. Our objectives were to compare the most commonly used DNA extraction method for Bd (PrepMan, PM) to Macherey-Nagel DNA FFPE (MN), test optimizations for Bd detection with PM, and provide recommendations for maximizing Bd detection. We found that successful detection is relatively high (80-90%) when Bd loads before formalin fixation are high, regardless of the extraction method used; however, at lower infection levels, detection probabilities were significantly reduced. The MN DNA extraction method increased Bd detection by as much as 50% at moderate infection levels. Our results indicate that, for animals characterized by lower pathogen loads (i.e., those most commonly encountered in museum collections), current methods may underestimate the proportion of Bd-infected amphibians. Those extracting DNA from archived museum specimens should ensure that the techniques they are using are known to provide high-quality throughput DNA for later analysis.

  8. Phosphorescent quantum dots/doxorubicin nanohybrids based on photoinduced electron transfer for detection of DNA.

    PubMed

    Miao, Yanming; Zhang, Zhifeng; Gong, Yan; Yan, Guiqin

    2014-09-15

    MPA-capped Mn-doped ZnS QDs/DXR nanohybrids (MPA: 3-mercaptopropionic acid; QDs: quantum dots; DXR: cetyltrimethyl ammonium bromide) were constructed via photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for detection of DNA. DXR as a quencher will quench the RTP of Mn-doped ZnS QDs via PIET, thereby forming Mn-doped ZnS QDs/DXR nanohybrids and storing RTP. With the addition of DNA, it will be inserted into DXR and thus DXR will be competitively desorbed from the surface of Mn-doped ZnS QDs, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this, a new method for DNA detection was built. The sensor for DNA has a detection limit of 0.039 mg L(-1) and a linear range from 0.1 to 14 mg L(-1). The present QDs-based RTP method does not need deoxidants or other inducers as required by conventional RTP detection methods, and avoids interference from autofluorescence and the scattering light of the matrix that are encountered in spectrofluorometry. Therefore, this method can be used to detect the DNA content in body fluid. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Single-tube analysis of DNA methylation with silica superparamagnetic beads.

    PubMed

    Bailey, Vasudev J; Zhang, Yi; Keeley, Brian P; Yin, Chao; Pelosky, Kristen L; Brock, Malcolm; Baylin, Stephen B; Herman, James G; Wang, Tza-Huei

    2010-06-01

    DNA promoter methylation is a signature for the silencing of tumor suppressor genes. Most widely used methods to detect DNA methylation involve 3 separate, independent processes: DNA extraction, bisulfite conversion, and methylation detection via a PCR method, such as methylation-specific PCR (MSP). This method includes many disconnected steps with associated losses of material, potentially reducing the analytical sensitivity required for analysis of challenging clinical samples. Methylation on beads (MOB) is a new technique that integrates DNA extraction, bisulfite conversion, and PCR in a single tube via the use of silica superparamagnetic beads (SSBs) as a common DNA carrier for facilitating cell debris removal and buffer exchange throughout the entire process. In addition, PCR buffer is used to directly elute bisulfite-treated DNA from SSBs for subsequent target amplifications. The diagnostic sensitivity of MOB was evaluated by methylation analysis of the CDKN2A [cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4); also known as p16(INK4a)] promoter in serum DNA of lung cancer patients and compared with that of conventional methods. Methylation analysis consisting of DNA extraction followed by bisulfite conversion and MSP was successfully carried out within 9 h in a single tube. The median pre-PCR DNA yield was 6.61-fold higher with the MOB technique than with conventional techniques. Furthermore, MOB increased the diagnostic sensitivity in our analysis of the CDKN2A promoter in patient serum by successfully detecting methylation in 74% of cancer patients, vs the 45% detection rate obtained with conventional techniques. The MOB technique successfully combined 3 processes into a single tube, thereby allowing ease in handling and an increased detection throughput. The increased pre-PCR yield in MOB allowed efficient, diagnostically sensitive methylation detection.

  10. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip.

    PubMed

    Kawai, Kazuhiro; Inada, Mika; Ito, Keiko; Hashimoto, Koji; Nikaido, Masaru; Hata, Eiji; Katsuda, Ken; Kiku, Yoshio; Tagawa, Yuichi; Hayashi, Tomohito

    2017-12-22

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program.

  11. Detection of bovine mastitis pathogens by loop-mediated isothermal amplification and an electrochemical DNA chip

    PubMed Central

    KAWAI, Kazuhiro; INADA, Mika; ITO, Keiko; HASHIMOTO, Koji; NIKAIDO, Masaru; HATA, Eiji; KATSUDA, Ken; KIKU, Yoshio; TAGAWA, Yuichi; HAYASHI, Tomohito

    2017-01-01

    Bovine mastitis causes significant economic losses in the dairy industry. Effective prevention of bovine mastitis requires an understanding of the infection status of a pathogenic microorganism in a herd that has not yet shown clinical signs of mastitis and appropriate treatment specific for the pathogenic microorganism. However, bacterial identification by culture has drawbacks in that the sensitivity may be low and the procedure can be complex. In this study, we developed a genetic detection method to identify mastitis pathogens using a simple and highly sensitive electrochemical DNA chip which can specifically detect bacterial DNA in milk specimens. First, we selected microorganisms belonging to 12 families and/or genera associated with mastitis for which testing should be performed. Next, we optimized the conditions for amplifying microorganism DNA by loop-mediated isothermal amplification (LAMP) using 32 primers and the use of a DNA chip capable of measuring all pathogens simultaneously. Sample detection could be completed in just a few hours using this method. Comparison of the results obtained with our DNA chip method and those obtained by bacterial culture verified that when the culture method was set to 100%, the total positive concordance rate of the DNA chip was 85.0% and the total negative concordance rate was 86.9%. Furthermore, the proposed method allows both rapid and highly sensitive detection of mastitis pathogens. We believe that this method will contribute to the development of an effective mastitis control program. PMID:29093278

  12. Clearing muddied waters: Capture of environmental DNA from turbid waters.

    PubMed

    Williams, Kelly E; Huyvaert, Kathryn P; Piaggio, Antoinette J

    2017-01-01

    Understanding the differences in efficiencies of various methods to concentrate, extract, and amplify environmental DNA (eDNA) is vital for best performance of eDNA detection. Aquatic systems vary in characteristics such as turbidity, eDNA concentration, and inhibitor load, thus affecting eDNA capture efficiency. Application of eDNA techniques to the detection of terrestrial invasive or endangered species may require sampling at intermittent water sources that are used for drinking and cooling; these water bodies may often be stagnant and turbid. We present our best practices technique for the detection of wild pig eDNA in water samples, a protocol that will have wide applicability to the detection of elusive vertebrate species. We determined the best practice for eDNA capture in a turbid water system was to concentrate DNA from a 15 mL water sample via centrifugation, purify DNA with the DNeasy mericon Food kit, and remove inhibitors with Zymo Inhibitor Removal Technology columns. Further, we compared the sensitivity of conventional PCR to quantitative PCR and found that quantitative PCR was more sensitive in detecting lower concentrations of eDNA. We show significant differences in efficiencies among methods in each step of eDNA capture, emphasizing the importance of optimizing best practices for the system of interest.

  13. Clearing muddied waters: Capture of environmental DNA from turbid waters

    PubMed Central

    Huyvaert, Kathryn P.; Piaggio, Antoinette J.

    2017-01-01

    Understanding the differences in efficiencies of various methods to concentrate, extract, and amplify environmental DNA (eDNA) is vital for best performance of eDNA detection. Aquatic systems vary in characteristics such as turbidity, eDNA concentration, and inhibitor load, thus affecting eDNA capture efficiency. Application of eDNA techniques to the detection of terrestrial invasive or endangered species may require sampling at intermittent water sources that are used for drinking and cooling; these water bodies may often be stagnant and turbid. We present our best practices technique for the detection of wild pig eDNA in water samples, a protocol that will have wide applicability to the detection of elusive vertebrate species. We determined the best practice for eDNA capture in a turbid water system was to concentrate DNA from a 15 mL water sample via centrifugation, purify DNA with the DNeasy mericon Food kit, and remove inhibitors with Zymo Inhibitor Removal Technology columns. Further, we compared the sensitivity of conventional PCR to quantitative PCR and found that quantitative PCR was more sensitive in detecting lower concentrations of eDNA. We show significant differences in efficiencies among methods in each step of eDNA capture, emphasizing the importance of optimizing best practices for the system of interest. PMID:28686659

  14. Evaluation of digital PCR for detecting low-level EGFR mutations in advanced lung adenocarcinoma patients: a cross-platform comparison study

    PubMed Central

    Liu, Bing; Li, Lei; Huang, Lixia; Li, Shaoli; Rao, Guanhua; Yu, Yang; Zhou, Yanbin

    2017-01-01

    Emerging evidence has indicated that circulating tumor DNA (ctDNA) from plasma could be used to analyze EGFR mutation status for NSCLC patients; however, due to the low level of ctDNA in plasma, highly sensitive approaches are required to detect low frequency mutations. In addition, the cutoff for the mutation abundance that can be detected in tumor tissue but cannot be detected in matched ctDNA is still unknown. To assess a highly sensitive method, we evaluated the use of digital PCR in the detection of EGFR mutations in tumor tissue from 47 advanced lung adenocarcinoma patients through comparison with NGS and ARMS. We determined the degree of concordance between tumor tissue DNA and paired ctDNA and analyzed the mutation abundance relationship between them. Digital PCR and Proton had a high sensitivity (96.00% vs. 100%) compared with that of ARMS in the detection of mutations in tumor tissue. Digital PCR outperformed Proton in identifying more low abundance mutations. The ctDNA detection rate of digital PCR was 87.50% in paired tumor tissue with a mutation abundance above 5% and 7.59% in paired tumor tissue with a mutation abundance below 5%. When the DNA mutation abundance of tumor tissue was above 3.81%, it could identify mutations in paired ctDNA with a high sensitivity. Digital PCR will help identify alternative methods for detecting low abundance mutations in tumor tissue DNA and plasma ctDNA. PMID:28978074

  15. Detection of an enigmatic plethodontid Salamander using Environmental DNA

    USGS Publications Warehouse

    Pierson, Todd W.; Mckee, Anna; Spear, Stephen F.; Maerz, John C.; Camp, Carlos D.; Glenn, Travis C.

    2016-01-01

    The isolation and identification of environmental DNA (eDNA) offers a non-invasive and efficient method for the detection of rare and secretive aquatic wildlife, and it is being widely integrated into inventory and monitoring efforts. The Patch-Nosed Salamander (Urspelerpes brucei) is a tiny, recently discovered species of plethodontid salamander known only from headwater streams in a small region of Georgia and South Carolina. Here, we present results of a quantitative PCR-based eDNA assay capable of detecting Urspelerpes in more than 75% of 33 samples from five confirmed streams. We deployed the method at 31 additional streams and located three previously undocumented populations of Urspelerpes. We compare the results of our eDNA assay with our attempt to use aquatic leaf litterbags for the rapid detection of Urspelerpes and demonstrate the relative efficacy of the eDNA assay. We suggest that eDNA offers great potential for use in detecting other aquatic and semi-aquatic plethodontid salamanders.

  16. Improved Methods for Capture, Extraction, and Quantitative Assay of Environmental DNA from Asian Bigheaded Carp (Hypophthalmichthys spp.)

    PubMed Central

    Turner, Cameron R.; Miller, Derryl J.; Coyne, Kathryn J.; Corush, Joel

    2014-01-01

    Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species. PMID:25474207

  17. Improved methods for capture, extraction, and quantitative assay of environmental DNA from Asian bigheaded carp (Hypophthalmichthys spp.).

    PubMed

    Turner, Cameron R; Miller, Derryl J; Coyne, Kathryn J; Corush, Joel

    2014-01-01

    Indirect, non-invasive detection of rare aquatic macrofauna using aqueous environmental DNA (eDNA) is a relatively new approach to population and biodiversity monitoring. As such, the sensitivity of monitoring results to different methods of eDNA capture, extraction, and detection is being investigated in many ecosystems and species. One of the first and largest conservation programs with eDNA-based monitoring as a central instrument focuses on Asian bigheaded carp (Hypophthalmichthys spp.), an invasive fish spreading toward the Laurentian Great Lakes. However, the standard eDNA methods of this program have not advanced since their development in 2010. We developed new, quantitative, and more cost-effective methods and tested them against the standard protocols. In laboratory testing, our new quantitative PCR (qPCR) assay for bigheaded carp eDNA was one to two orders of magnitude more sensitive than the existing endpoint PCR assays. When applied to eDNA samples from an experimental pond containing bigheaded carp, the qPCR assay produced a detection probability of 94.8% compared to 4.2% for the endpoint PCR assays. Also, the eDNA capture and extraction method we adapted from aquatic microbiology yielded five times more bigheaded carp eDNA from the experimental pond than the standard method, at a per sample cost over forty times lower. Our new, more sensitive assay provides a quantitative tool for eDNA-based monitoring of bigheaded carp, and the higher-yielding eDNA capture and extraction method we describe can be used for eDNA-based monitoring of any aquatic species.

  18. A comparison of DNA fragmentation methods - Applications for the biochip technology.

    PubMed

    Sapojnikova, Nelly; Asatiani, Nino; Kartvelishvili, Tamar; Asanishvili, Lali; Zinkevich, Vitaly; Bogdarina, Irina; Mitchell, Julian; Al-Humam, Abdulmohsen

    2017-08-20

    The efficiency of hybridization signal detection in a biochip is affected by the method used for test DNA preparation, such as fragmentation, amplification and fluorescent labelling. DNA fragmentation is the commonest methods used and it is recognised as a critical step in biochip analysis. Currently methods used for DNA fragmentation are based either on sonication or on the enzymatic digestion. In this study, we compared the effect of different types of enzymatic DNA fragmentations, using DNase I to generate ssDNA breaks, NEBNext dsDNA fragmentase and SaqAI restrictase, on DNA labelling. DNA from different Desulfovibrio species was used as a substrate for these enzymes. Of the methods used, DNA fragmented by NEBNext dsDNA Fragmentase digestion was subsequently labelled with the greatest efficiency. As a result of this, the use of this enzyme to fragment target DNA increases the sensitivity of biochip-based detection significantly, and this is an important consideration when determining the presence of targeted DNA in ecological and medical samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Colorimetric Detection of Ehrlichia Canis via Nucleic Acid Hybridization in Gold Nano-Colloids

    PubMed Central

    Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong

    2014-01-01

    Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease. PMID:25111239

  20. Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids.

    PubMed

    Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong

    2014-08-08

    Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease.

  1. [DNA quantification of blood samples pre-treated with pyramidon].

    PubMed

    Zhu, Chuan-Hong; Zheng, Dao-Li; Ni, Rao-Zhi; Wang, Hai-Sheng; Ning, Ping; Fang, Hui; Liu, Yan

    2014-06-01

    To study DNA quantification and STR typing of samples pre-treated with pyramidon. The blood samples of ten unrelated individuals were anticoagulated in EDTA. The blood stains were made on the filter paper. The experimental groups were divided into six groups in accordance with the storage time, 30 min, 1 h, 3 h, 6 h, 12 h and 24h after pre-treated with pyramidon. DNA was extracted by three methods: magnetic bead-based extraction, QIAcube DNA purification method and Chelex-100 method. The quantification of DNA was made by fluorescent quantitative PCR. STR typing was detected by PCR-STR fluorescent technology. In the same DNA extraction method, the sample DNA decreased gradually with times after pre-treatment with pyramidon. In the same storage time, the DNA quantification in different extraction methods had significant differences. Sixteen loci DNA typing were detected in 90.56% of samples. Pyramidon pre-treatment could cause DNA degradation, but effective STR typing can be achieved within 24 h. The magnetic bead-based extraction is the best method for STR profiling and DNA extraction.

  2. A Simple and Efficient Method of Extracting DNA from Aged Bones and Teeth.

    PubMed

    Liu, Qiqi; Liu, Liyan; Zhang, Minli; Zhang, Qingzhen; Wang, Qiong; Ding, Xiaoran; Shao, Liting; Zhou, Zhe; Wang, Shengqi

    2018-05-01

    DNA is often difficult to extract from old bones and teeth due to low levels of DNA and high levels of degradation. This study established a simple yet efficient method for extracting DNA from 20 aged bones and teeth (approximately 60 years old). Based on the concentration and STR typing results, the new method of DNA extraction (OM) developed in this study was compared with the PrepFiler™ BTA Forensic DNA Extraction Kit (BM). The total amount of DNA extracted using the OM method was not significantly different from that extracted using the commercial kit (p > 0.05). However, the number of STR loci detected was significantly higher in the samples processed using the OM method than using the BM method (p < 0.05). This study aimed to establish a DNA extraction method for aged bones and teeth to improve the detection rate of STR typing and reduce costs compared to the BM technique. © 2017 American Academy of Forensic Sciences.

  3. Screening Test for Shed Skin Cells by Measuring the Ratio of Human DNA to Staphylococcus epidermidis DNA.

    PubMed

    Nakanishi, Hiroaki; Ohmori, Takeshi; Hara, Masaaki; Takahashi, Shirushi; Kurosu, Akira; Takada, Aya; Saito, Kazuyuki

    2016-05-01

    A novel screening method for shed skin cells by detecting Staphylococcus epidermidis (S. epidermidis), which is a resident bacterium on skin, was developed. Staphylococcus epidermidis was detected using real-time PCR. Staphylococcus epidermidis was detected in all 20 human skin surface samples. Although not present in blood and urine samples, S. epidermidis was detected in 6 of 20 saliva samples, and 5 of 18 semen samples. The ratio of human DNA to S. epidermidisDNA was significantly smaller in human skin surface samples than in saliva and semen samples in which S. epidermidis was detected. Therefore, although skin cells could not be identified by detecting only S. epidermidis, they could be distinguished by measuring the S. epidermidis to human DNA ratio. This method could be applied to casework touch samples, which suggests that it is useful for screening whether skin cells and human DNA are present on potential evidentiary touch samples. © 2016 American Academy of Forensic Sciences.

  4. Sensitive fluorescence detection of nucleic acids based on isothermal circular strand-displacement polymerization reaction.

    PubMed

    Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin

    2009-02-01

    Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.

  5. Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water

    USGS Publications Warehouse

    Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.

    2007-01-01

    The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.

  6. An electrochemical biosensor for double-stranded Wnt7B gene detection based on enzymatic isothermal amplification.

    PubMed

    Li, Junlong; Chen, Zhongping; Xiang, Yu; Zhou, Lili; Wang, Ting; Zhang, Zhang; Sun, Kexin; Yin, Dan; Li, Yi; Xie, Guoming

    2016-12-15

    Wnt7B gene plays an important role in the development and progression of breast cancer, gastric cancer, esophageal cancer and pancreatic cancer. While, the natural state of DNA is double stranded, which makes it difficult to be directly detected. Here, we develop an electrochemical biosensor method for Wnt7B gene detection without the need to denature the target. This method firstly used nicking enzyme for exploiting in the double-stranded DNA (dsDNA). Then, long single-stranded DNA (ssDNA) was generated from the cutting site through polymerase extension reaction. Whereafter, the long ssDNA triggered a hairpin self-assembly recycling reaction, which gave rise to another isothermal amplification reaction. Last, short ssDNA was formed after the this amplification process, which could hybridize with the capture probe immobilized on Au electrode and result in signal variation. This method showed excellent analytical performance for dsDNA, of which the linear range was 2fM to 500pM and the detection limit was 1.6fM (S/N=3). It also showed an good results when applied to the real sample of Wnt7B gene detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Absolute quantification of DNA methylation using microfluidic chip-based digital PCR.

    PubMed

    Wu, Zhenhua; Bai, Yanan; Cheng, Zule; Liu, Fangming; Wang, Ping; Yang, Dawei; Li, Gang; Jin, Qinghui; Mao, Hongju; Zhao, Jianlong

    2017-10-15

    Hypermethylation of CpG islands in the promoter region of many tumor suppressor genes downregulates their expression and in a result promotes tumorigenesis. Therefore, detection of DNA methylation status is a convenient diagnostic tool for cancer detection. Here, we reported a novel method for the integrative detection of methylation by the microfluidic chip-based digital PCR. This method relies on methylation-sensitive restriction enzyme HpaII, which cleaves the unmethylated DNA strands while keeping the methylated ones intact. After HpaII treatment, the DNA methylation level is determined quantitatively by the microfluidic chip-based digital PCR with the lower limit of detection equal to 0.52%. To validate the applicability of this method, promoter methylation of two tumor suppressor genes (PCDHGB6 and HOXA9) was tested in 10 samples of early stage lung adenocarcinoma and their adjacent non-tumorous tissues. The consistency was observed in the analysis of these samples using our method and a conventional bisulfite pyrosequencing. Combining high sensitivity and low cost, the microfluidic chip-based digital PCR method might provide a promising alternative for the detection of DNA methylation and early diagnosis of epigenetics-related diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

    PubMed

    do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira

    2012-04-01

    Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p < 0.001). No differences were found between groups 1 and 2 (p > 0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

  9. Direct detection of circulating free DNA extracted from serum samples of breast cancer using locked nucleic acid molecular beacon.

    PubMed

    Gui, Zhen; Wang, Quanbo; Li, Jinchang; Zhu, Mingchen; Yu, Lili; Xun, Tang; Yan, Feng; Ju, Huangxian

    2016-07-01

    As an emerging noninvasive blood biomarker, circulating free DNA (cfDNA) can be utilized to assess diagnosis, progression and evaluate prognosis of cancer. However, cfDNAs are not "naked", they can be part of complexes, or are bound to the surface of the cells via proteins, which make the detection more challenging. Here, a simple method for the detection of Ubiquitin-like with PHD and ring finger domains 1 (UHRF1) DNA exacted from serum of breast cancer (BC) has been developed using a novel locked nucleic acid molecular beacon (LNA-MB). In order to enhance the stability and detection efficiency of the probe in biofluids, we design a shared-stem molecular beacon containing a 27-mer loop and a 4-mer stem with DNA/LNA alternating bases. The fluorescence is released in the presence of target. The detection procedure is simple and can be completed within 1h. This method shows a sensitive response to UHRF1 DNA with a dynamic range of 3 orders of magnitude. The limit of detection is 11nM (S/N=3) with excellent selectivity. It can discriminate UHRF1 DNA from three-base mismatched DNA with a high specificity. More importantly, this method can distinguish the expression of serum UHRF1 DNA among 5 breast cancer patients and 5 healthy controls. The mentioned superiority may suggest that this assay can be served as a promising noninvasive detection tool for early BC diagnosis and monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme

    NASA Astrophysics Data System (ADS)

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2018-06-01

    Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562 nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50 ng mL-1 with the limit detection of 9.899 ng mL-1. Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 103 to 108 CFU mL-1 in real samples with a detection limit of 320 CFU mL-1.

  11. Detection of DNA damage by using hairpin molecular beacon probes and graphene oxide.

    PubMed

    Zhou, Jie; Lu, Qian; Tong, Ying; Wei, Wei; Liu, Songqin

    2012-09-15

    A hairpin molecular beacon tagged with carboxyfluorescein in combination with graphene oxide as a quencher reagent was used to detect the DNA damage by chemical reagents. The fluorescence of molecular beacon was quenched sharply by graphene oxide; while in the presence of its complementary DNA the quenching efficiency decreased because their hybridization prevented the strong adsorbability of molecular beacon on graphene oxide. If the complementary DNA was damaged by a chemical reagent and could not form intact duplex structure with molecular beacon, more molecular beacon would adsorb on graphene oxide increasing the quenching efficiency. Thus, damaged DNA could be detected based on different quenching efficiencies afforded by damaged and intact complementary DNA. The damage effects of chlorpyrifos-methyl and three metabolites of styrene such as mandelieaeids, phenylglyoxylieaeids and epoxystyrene on DNA were studied as models. The method for detection of DNA damage was reliable, rapid and simple compared to the biological methods. Copyright © 2012 Elsevier B.V. All rights reserved.

  12. Investigating the potential use of environmental DNA (eDNA) for genetic monitoring of marine mammals.

    PubMed

    Foote, Andrew D; Thomsen, Philip Francis; Sveegaard, Signe; Wahlberg, Magnus; Kielgast, Jos; Kyhn, Line A; Salling, Andreas B; Galatius, Anders; Orlando, Ludovic; Gilbert, M Thomas P

    2012-01-01

    The exploitation of non-invasive samples has been widely used in genetic monitoring of terrestrial species. In aquatic ecosystems, non-invasive samples such as feces, shed hair or skin, are less accessible. However, the use of environmental DNA (eDNA) has recently been shown to be an effective tool for genetic monitoring of species presence in freshwater ecosystems. Detecting species in the marine environment using eDNA potentially offers a greater challenge due to the greater dilution, amount of mixing and salinity compared with most freshwater ecosystems. To determine the potential use of eDNA for genetic monitoring we used specific primers that amplify short mitochondrial DNA sequences to detect the presence of a marine mammal, the harbor porpoise, Phocoena phocoena, in a controlled environment and in natural marine locations. The reliability of the genetic detections was investigated by comparing with detections of harbor porpoise echolocation clicks by static acoustic monitoring devices. While we were able to consistently genetically detect the target species under controlled conditions, the results from natural locations were less consistent and detection by eDNA was less successful than acoustic detections. However, at one site we detected long-finned pilot whale, Globicephala melas, a species rarely sighted in the Baltic. Therefore, with optimization aimed towards processing larger volumes of seawater this method has the potential to compliment current visual and acoustic methods of species detection of marine mammals.

  13. Optimization of HPV DNA detection in urine by improving collection, storage, and extraction.

    PubMed

    Vorsters, A; Van den Bergh, J; Micalessi, I; Biesmans, S; Bogers, J; Hens, A; De Coster, I; Ieven, M; Van Damme, P

    2014-11-01

    The benefits of using urine for the detection of human papillomavirus (HPV) DNA have been evaluated in disease surveillance, epidemiological studies, and screening for cervical cancers in specific subgroups. HPV DNA testing in urine is being considered for important purposes, notably the monitoring of HPV vaccination in adolescent girls and young women who do not wish to have a vaginal examination. The need to optimize and standardize sampling, storage, and processing has been reported.In this paper, we examined the impact of a DNA-conservation buffer, the extraction method, and urine sampling on the detection of HPV DNA and human DNA in urine provided by 44 women with a cytologically normal but HPV DNA-positive cervical sample. Ten women provided first-void and midstream urine samples. DNA analysis was performed using real-time PCR to allow quantification of HPV and human DNA.The results showed that an optimized method for HPV DNA detection in urine should (a) prevent DNA degradation during extraction and storage, (b) recover cell-free HPV DNA in addition to cell-associated DNA, (c) process a sufficient volume of urine, and (d) use a first-void sample.In addition, we found that detectable human DNA in urine may not be a good internal control for sample validity. HPV prevalence data that are based on urine samples collected, stored, and/or processed under suboptimal conditions may underestimate infection rates.

  14. DNA-PK assay

    DOEpatents

    Anderson, Carl W.; Connelly, Margery A.

    2004-10-12

    The present invention provides a method for detecting DNA-activated protein kinase (DNA-PK) activity in a biological sample. The method includes contacting a biological sample with a detectably-labeled phosphate donor and a synthetic peptide substrate defined by the following features to provide specific recognition and phosphorylation by DNA-PK: (1) a phosphate-accepting amino acid pair which may include serine-glutamine (Ser-Gln) (SQ), threonine-glutamine (Thr-Gln) (TQ), glutamine-serine (Gln-Ser) (QS), or glutamine-threonine (Gln-Thr) (QT); (2) enhancer amino acids which may include glutamic acid or glutamine immediately adjacent at the amino- or carboxyl- side of the amino acid pair and forming an amino acid pair-enhancer unit; (3) a first spacer sequence at the amino terminus of the amino acid pair-enhancer unit; (4) a second spacer sequence at the carboxyl terminus of the amino acid pair-enhancer unit, which spacer sequences may include any combination of amino acids that does not provide a phosphorylation site consensus sequence motif; and, (5) a tag moiety, which may be an amino acid sequence or another chemical entity that permits separating the synthetic peptide from the phosphate donor. A compostion and a kit for the detection of DNA-PK activity are also provided. Methods for detecting DNA, protein phosphatases and substances that alter the activity of DNA-PK are also provided. The present invention also provides a method of monitoring protein kinase and DNA-PK activity in living cells. -A composition and a kit for monitoring protein kinase activity in vitro and a composition and a kit for monitoring DNA-PK activities in living cells are also provided. A method for identifying agents that alter protein kinase activity in vitro and a method for identifying agents that alter DNA-PK activity in living cells are also provided.

  15. Accurate quantitation of circulating cell-free mitochondrial DNA in plasma by droplet digital PCR.

    PubMed

    Ye, Wei; Tang, Xiaojun; Liu, Chu; Wen, Chaowei; Li, Wei; Lyu, Jianxin

    2017-04-01

    To establish a method for accurate quantitation of circulating cell-free mitochondrial DNA (ccf-mtDNA) in plasma by droplet digital PCR (ddPCR), we designed a ddPCR method to determine the copy number of ccf-mtDNA by amplifying mitochondrial ND1 (MT-ND1). To evaluate the sensitivity and specificity of the method, a recombinant pMD18-T plasmid containing MT-ND1 sequences and mtDNA-deleted (ρ 0 ) HeLa cells were used, respectively. Subsequently, different plasma samples were prepared for ddPCR to evaluate the feasibility of detecting plasma ccf-mtDNA. In the results, the ddPCR method showed high sensitivity and specificity. When the DNA was extracted from plasma prior to ddPCR, the ccf-mtDNA copy number was higher than that measured without extraction. This difference was not due to a PCR inhibitor, such as EDTA-Na 2 , an anti-coagulant in plasma, because standard EDTA-Na 2 concentration (5 mM) did not significantly inhibit ddPCR reactions. The difference might be attributable to plasma exosomal mtDNA, which was 4.21 ± 0.38 copies/μL of plasma, accounting for ∼19% of plasma ccf-mtDNA. Therefore, ddPCR can quickly and reliably detect ccf-mtDNA from plasma with a prior DNA extraction step, providing for a more accurate detection of ccf-mtDNA. The direct use of plasma as a template in ddPCR is suitable for the detection of exogenous cell-free nucleic acids within plasma, but not of nucleic acids that have a vesicle-associated form, such as exosomal mtDNA. Graphical Abstract Designs of the present work. *: Module 1, #: Module 2, &: Module 3.

  16. Detection of DNA via the fluorescence quenching of Mn-doped ZnSe D-dots/doxorubicin/DNA ternary complexes system.

    PubMed

    Gao, Xue; Niu, Lu; Su, Xingguang

    2012-01-01

    This manuscript reports a method for the detection of double-stranded DNA, based on Mn:ZnSe d-dots and intercalating agent doxorubicin (DOX). DOX can quench the photoluminescence (PL) of Mn:ZnSe d-dots through photoinduced electron transfer process, after binding with Mn:ZnSe d-dots. The addition of DNA can result in the formation of the Mn:ZnSe d-dots-DOX-DNA ternary complexes, the fluorescence of the Mn:ZnSe d-dots-DOX complexes would be further quenched by the addition of DNA, thus allowing the detection of DNA. The formation mechanism of the Mn:ZnSe d-dots-DOX-DNA ternary complexes was studied in detail in this paper. Under optimal conditions, the quenched fluorescence intensity of Mn:ZnSe d-dots-DOX system are perfectly described by Stern-Volmer equation with the concentration of hsDNA ranging from 0.006 μg mL(-1) to 6.4 μg mL(-1). The detection limit (S/N = 3) for hsDNA is 0.5 ng mL(-1). The proposed method was successfully applied to the detection of DNA in synthetic samples and the results were satisfactory.

  17. A novel, sensitive and label-free loop-mediated isothermal amplification detection method for nucleic acids using luminophore dyes.

    PubMed

    Roy, Sharmili; Wei, Sim Xiao; Ying, Jean Liew Zhi; Safavieh, Mohammadali; Ahmed, Minhaz Uddin

    2016-12-15

    Electrochemiluminescence (ECL) has been widely rendered for nucleic acid testing. Here, we integrate loop-mediated isothermal amplification (LAMP) with ECL technique for DNA detection and quantification. The target LAMP DNA bound electrostatically with [Ru(bpy)3](+2) on the carbon electrode surface, and an ECL reaction was triggered by tripropylamine (TPrA) to yield luminescence. We illustrated this method as a new and highly sensitive strategy for the detection of sequence-specific DNA from different meat species at picogram levels. The proposed strategy renders the signal amplification capacities of TPrA and combines LAMP with inherently high sensitivity of the ECL technique, to facilitate the detection of low quantities of DNA. By leveraging this technique, target DNA of Sus scrofa (pork) meat was detected as low as 1pg/µL (3.43×10(-1)copies/µL). In addition, the proposed technique was applied for detection of Bacillus subtilis DNA samples and detection limit of 10pg/µL (2.2×10(3)copies/µL) was achieved. The advantages of being isothermal, sensitive and robust with ability for multiplex detection of bio-analytes makes this method a facile and appealing sensing modality in hand-held devices to be used at the point-of-care (POC). Copyright © 2016 Elsevier B.V. All rights reserved.

  18. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  19. DNA-based authentication method for detection of yak (Bos grunniens) in meat products.

    PubMed

    Wang, Ping; Hu, Yue; Yang, Hairong; Han, Jiangxun; Zhao, Yongsheng; Chen, Ying

    2013-01-01

    A TaqMan probe real-time PCR method was developed for rapid detection of yak component in raw and cooked meat products. Specific primers and TaqMan probes of yak (Bos grunniens) were designed in the cytochrome b gene. The specificity of the method was evaluated using pure meat of eight yak breeds (Jiulong, Qinghai plateau, Maiwa, Gannan, Bazhou, Sibu, Zhongdian, and Jiali) samples and nine non-Bos grunniens animals (sheep, goat, pig, chicken, cattle, water buffalo, donkey, horse, and rabbit). DNA showed no cross-reaction with non-Bos grunniens animal DNA. This method proved to be sensitive in detecting the presence of low levels of target DNA obtained from 0.001% (w/w) component in a mixed meat sample. The method also successfully identified commercial yak meat products. The results showed that some yak meat might be involved in business fraud by using cattle meat (in this paper, cattle meat means meat of Bos taurus) instead of yak meat. In conclusion, real-time PCR assay used in this study was shown to be a rapid and sensitive method for detection of yak DNA in fresh meat and cooked meat products.

  20. Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

    PubMed

    Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

    2018-06-05

    We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

  1. Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

    PubMed

    Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

    2018-06-13

    The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

  2. Moving environmental DNA methods from concept to practice for monitoring aquatic macroorganisms

    USGS Publications Warehouse

    Goldberg, Caren S.; Strickler, Katherine M.; Pilliod, David S.

    2015-01-01

    The discovery that macroorganisms can be detected from their environmental DNA (eDNA) in aquatic systems has immense potential for the conservation of biological diversity. This special issue contains 11 papers that review and advance the field of eDNA detection of vertebrates and other macroorganisms, including studies of eDNA production, transport, and degradation; sample collection and processing to maximize detection rates; and applications of eDNA for conservation using citizen scientists. This body of work is an important contribution to the ongoing efforts to take eDNA detection of macroorganisms from technical breakthrough to established, reliable method that can be used in survey, monitoring, and research applications worldwide. While the rapid advances in this field are remarkable, important challenges remain, including consensus on best practices for collection and analysis, understanding of eDNA diffusion and transport, and avoidance of inhibition in sample collection and processing. Nonetheless, as demonstrated in this special issue, eDNA techniques for research and monitoring are beginning to realize their potential for contributing to the conservation of biodiversity globally.

  3. Detecting an elusive invasive species: a diagnostic PCR to detect Burmese python in Florida waters and an assessment of persistence of environmental DNA.

    PubMed

    Piaggio, Antoinette J; Engeman, Richard M; Hopken, Matthew W; Humphrey, John S; Keacher, Kandy L; Bruce, William E; Avery, Michael L

    2014-03-01

    Recent studies have demonstrated that detection of environmental DNA (eDNA) from aquatic vertebrates in water bodies is possible. The Burmese python, Python bivittatus, is a semi-aquatic, invasive species in Florida where its elusive nature and cryptic coloration make its detection difficult. Our goal was to develop a diagnostic PCR to detect P. bivittatus from water-borne eDNA, which could assist managers in monitoring this invasive species. First, we used captive P. bivittatus to determine whether reptilian DNA could be isolated and amplified from water samples. We also evaluated the efficacy of two DNA isolation methods and two DNA extraction kits commonly used in eDNA preparation. A fragment of the mitochondrial cytochrome b gene from P. bivittatus was detected in all water samples isolated with the sodium acetate precipitate and the QIAamp DNA Micro Kit. Next, we designed P. bivittatus-specific primers and assessed the degradation rate of eDNA in water. Our primers did not amplify DNA from closely related species, and we found that P. bivittatus DNA was consistently detectable up to 96 h. Finally, we sampled water from six field sites in south Florida. Samples from five sites, where P. bivittatus has been observed, tested positive for eDNA. The final site was negative and had no prior documented evidence of P. bivittatus. This study shows P. bivittatus eDNA can be isolated from water samples; thus, this method is a new and promising technique for the management of invasive reptiles. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  4. [A quantitative real time polymerase chain reaction for detection of HBV covalently closed circular DNA in livers of the HBV infected patients].

    PubMed

    Wang, Mei-Rong; Qiu, Ning; Lu, Shi-Chun; Xiu, Dian-Rong; Yu, Jian-Guo; Li, Tong; Liu, Xue-En; Zhuang, Hui

    2011-05-01

    To establish and optimize a sensitive and specific quantitative real-time polymerase chain reaction (PCR) method for detection of hepatitis B virus covalently closed circular DNA (HBV cccDNA) in liver tissue. Specific primers and probes were designed to detect HBV DNA (tDNA) and cccDNA. A series of plasmids (3.44 × 10(0) - 3.44 × 10(9) copies/µl) containing a full double-stranded copies of HBV genome (genotype C) were used to establish the standard curve of real-time PCR. Liver samples of 33 patients with HBV related hepatocellular carcinoma (HCC), 13 Chronic hepatitis B patients (CHB) and 10 non-HBV patients were collected to verify the sensitivity and specificity of the assay. A fraction of extracted DNA was digested with a Plasmid-Safe ATP-dependent Dnase (PSAD) for HBV cccDNA detection and the remaining was used for tDNA and β-globin detection. The amount (copies/cell) of HBV cccDNA and tDNA were measured by a real-time PCR, using β-globin housekeeping gene as a quantitation standard. The standard curves of real-time PCR with a linear range of 3.44 × 10(0) to 3.44 × 10(9) copies/µl were established for detecting HBV cccDNA and tDNA, and both of the lowest detection limits of HBV cccDNA and tDNA were 3.44 × 10(0) copies/µl. The lowest quantitation levels of HBV cccDNA in liver tissues tested in 33 HBV related HCC patients and 13 CHB patients were 0.003 copies/cell and 0.031 copies/cell, respectively. HBV cccDNA and tDNA in liver tissue of 10 non-HBV patient appeared to be negative. The true positive rate was increasing through the digestion of HBV DNA by PSAD, and the analytic specificity of cccDNA detection improved by 7.24 × 10(2) times. Liver tissues of 2 patients were retested 5 times in the PCR for detecting cccDNA and the coefficient of variations on cycle threshold (Ct) were between 0.224% - 0.609%. A highly sensitive and specific quantitative real time PCR method for the detection of HBV cccDNA in liver tissue was established and could be used for clinical and epidemiological studies.

  5. Compositions and methods for detecting single nucleotide polymorphisms

    DOEpatents

    Yeh, Hsin-Chih; Werner, James; Martinez, Jennifer S.

    2016-11-22

    Described herein are nucleic acid based probes and methods for discriminating and detecting single nucleotide variants in nucleic acid molecules (e.g., DNA). The methods include use of a pair of probes can be used to detect and identify polymorphisms, for example single nucleotide polymorphism in DNA. The pair of probes emit a different fluorescent wavelength of light depending on the association and alignment of the probes when hybridized to a target nucleic acid molecule. Each pair of probes is capable of discriminating at least two different nucleic acid molecules that differ by at least a single nucleotide difference. The methods can probes can be used, for example, for detection of DNA polymorphisms that are indicative of a particular disease or condition.

  6. Comparing efficiency of American Fisheries Society standard snorkeling techniques to environmental DNA sampling techniques

    USGS Publications Warehouse

    Ulibarri, Roy M.; Bonar, Scott A.; Rees, Christopher B.; Amberg, Jon J.; Ladell, Bridget; Jackson, Craig

    2017-01-01

    Analysis of environmental DNA (eDNA) is an emerging technique used to detect aquatic species through water sampling and the extraction of biological material for amplification. Our study compared the efficacy of eDNA methodology to American Fisheries Society (AFS) standard snorkeling surveys with regard to detecting the presence of rare fish species. Knowing which method is more efficient at detecting target species will help managers to determine the best way to sample when both traditional sampling methods and eDNA sampling are available. Our study site included three Navajo Nation streams that contained Navajo Nation Genetic Subunit Bluehead Suckers Catostomus discobolus and Zuni Bluehead Suckers C. discobolus yarrowi. We first divided the entire wetted area of streams into consecutive 100-m reaches and then systematically selected 10 reaches/stream for snorkel and eDNA surveys. Surface water samples were taken in 10-m sections within each 100-m reach, while fish presence was noted via snorkeling in each 10-m section. Quantitative PCR was run on each individual water sample in quadruplicate to test for the presence or absence of the target species. With eDNA sampling techniques, we were able to positively detect both species in two out of the three streams. Snorkeling resulted in positive detection of both species in all three streams. In streams where the target species were detected with eDNA sampling, snorkeling detected fish at 11–29 sites/stream, whereas eDNA detected fish at 3–12 sites/stream. Our results suggest that AFS standard snorkeling is more effective than eDNA for detecting target fish species. To improve our eDNA procedures, the amount of water collected and tested should be increased. Additionally, filtering water on-site may improve eDNA techniques for detecting fish. Future research should focus on standardization of eDNA sampling to provide a widely operational sampling tool.

  7. Highly Sensitive GMO Detection Using Real-Time PCR with a Large Amount of DNA Template: Single-Laboratory Validation.

    PubMed

    Mano, Junichi; Hatano, Shuko; Nagatomi, Yasuaki; Futo, Satoshi; Takabatake, Reona; Kitta, Kazumi

    2018-03-01

    Current genetically modified organism (GMO) detection methods allow for sensitive detection. However, a further increase in sensitivity will enable more efficient testing for large grain samples and reliable testing for processed foods. In this study, we investigated real-time PCR-based GMO detection methods using a large amount of DNA template. We selected target sequences that are commonly introduced into many kinds of GM crops, i.e., 35S promoter and nopaline synthase (NOS) terminator. This makes the newly developed method applicable to a wide range of GMOs, including some unauthorized ones. The estimated LOD of the new method was 0.005% of GM maize events; to the best of our knowledge, this method is the most sensitive among the GM maize detection methods for which the LOD was evaluated in terms of GMO content. A 10-fold increase in the DNA amount as compared with the amount used under common testing conditions gave an approximately 10-fold reduction in the LOD without PCR inhibition. Our method is applicable to various analytical samples, including processed foods. The use of other primers and fluorescence probes would permit highly sensitive detection of various recombinant DNA sequences besides the 35S promoter and NOS terminator.

  8. Surveying Europe's Only Cave-Dwelling Chordate Species (Proteus anguinus) Using Environmental DNA.

    PubMed

    Vörös, Judit; Márton, Orsolya; Schmidt, Benedikt R; Gál, Júlia Tünde; Jelić, Dušan

    2017-01-01

    In surveillance of subterranean fauna, especially in the case of rare or elusive aquatic species, traditional techniques used for epigean species are often not feasible. We developed a non-invasive survey method based on environmental DNA (eDNA) to detect the presence of the red-listed cave-dwelling amphibian, Proteus anguinus, in the caves of the Dinaric Karst. We tested the method in fifteen caves in Croatia, from which the species was previously recorded or expected to occur. We successfully confirmed the presence of P. anguinus from ten caves and detected the species for the first time in five others. Using a hierarchical occupancy model we compared the availability and detection probability of eDNA of two water sampling methods, filtration and precipitation. The statistical analysis showed that both availability and detection probability depended on the method and estimates for both probabilities were higher using filter samples than for precipitation samples. Combining reliable field and laboratory methods with robust statistical modeling will give the best estimates of species occurrence.

  9. Simple, Sensitive and Accurate Multiplex Detection of Clinically Important Melanoma DNA Mutations in Circulating Tumour DNA with SERS Nanotags

    PubMed Central

    Wee, Eugene J.H.; Wang, Yuling; Tsao, Simon Chang-Hao; Trau, Matt

    2016-01-01

    Sensitive and accurate identification of specific DNA mutations can influence clinical decisions. However accurate diagnosis from limiting samples such as circulating tumour DNA (ctDNA) is challenging. Current approaches based on fluorescence such as quantitative PCR (qPCR) and more recently, droplet digital PCR (ddPCR) have limitations in multiplex detection, sensitivity and the need for expensive specialized equipment. Herein we describe an assay capitalizing on the multiplexing and sensitivity benefits of surface-enhanced Raman spectroscopy (SERS) with the simplicity of standard PCR to address the limitations of current approaches. This proof-of-concept method could reproducibly detect as few as 0.1% (10 copies, CV < 9%) of target sequences thus demonstrating the high sensitivity of the method. The method was then applied to specifically detect three important melanoma mutations in multiplex. Finally, the PCR/SERS assay was used to genotype cell lines and ctDNA from serum samples where results subsequently validated with ddPCR. With ddPCR-like sensitivity and accuracy yet at the convenience of standard PCR, we believe this multiplex PCR/SERS method could find wide applications in both diagnostics and research. PMID:27446486

  10. Simple, Sensitive and Accurate Multiplex Detection of Clinically Important Melanoma DNA Mutations in Circulating Tumour DNA with SERS Nanotags.

    PubMed

    Wee, Eugene J H; Wang, Yuling; Tsao, Simon Chang-Hao; Trau, Matt

    2016-01-01

    Sensitive and accurate identification of specific DNA mutations can influence clinical decisions. However accurate diagnosis from limiting samples such as circulating tumour DNA (ctDNA) is challenging. Current approaches based on fluorescence such as quantitative PCR (qPCR) and more recently, droplet digital PCR (ddPCR) have limitations in multiplex detection, sensitivity and the need for expensive specialized equipment. Herein we describe an assay capitalizing on the multiplexing and sensitivity benefits of surface-enhanced Raman spectroscopy (SERS) with the simplicity of standard PCR to address the limitations of current approaches. This proof-of-concept method could reproducibly detect as few as 0.1% (10 copies, CV < 9%) of target sequences thus demonstrating the high sensitivity of the method. The method was then applied to specifically detect three important melanoma mutations in multiplex. Finally, the PCR/SERS assay was used to genotype cell lines and ctDNA from serum samples where results subsequently validated with ddPCR. With ddPCR-like sensitivity and accuracy yet at the convenience of standard PCR, we believe this multiplex PCR/SERS method could find wide applications in both diagnostics and research.

  11. Statistical approaches to account for false-positive errors in environmental DNA samples.

    PubMed

    Lahoz-Monfort, José J; Guillera-Arroita, Gurutzeta; Tingley, Reid

    2016-05-01

    Environmental DNA (eDNA) sampling is prone to both false-positive and false-negative errors. We review statistical methods to account for such errors in the analysis of eDNA data and use simulations to compare the performance of different modelling approaches. Our simulations illustrate that even low false-positive rates can produce biased estimates of occupancy and detectability. We further show that removing or classifying single PCR detections in an ad hoc manner under the suspicion that such records represent false positives, as sometimes advocated in the eDNA literature, also results in biased estimation of occupancy, detectability and false-positive rates. We advocate alternative approaches to account for false-positive errors that rely on prior information, or the collection of ancillary detection data at a subset of sites using a sampling method that is not prone to false-positive errors. We illustrate the advantages of these approaches over ad hoc classifications of detections and provide practical advice and code for fitting these models in maximum likelihood and Bayesian frameworks. Given the severe bias induced by false-negative and false-positive errors, the methods presented here should be more routinely adopted in eDNA studies. © 2015 John Wiley & Sons Ltd.

  12. International Study to Evaluate PCR Methods for Detection of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients

    PubMed Central

    Schijman, Alejandro G.; Bisio, Margarita; Orellana, Liliana; Sued, Mariela; Duffy, Tomás; Mejia Jaramillo, Ana M.; Cura, Carolina; Auter, Frederic; Veron, Vincent; Qvarnstrom, Yvonne; Deborggraeve, Stijn; Hijar, Gisely; Zulantay, Inés; Lucero, Raúl Horacio; Velazquez, Elsa; Tellez, Tatiana; Sanchez Leon, Zunilda; Galvão, Lucia; Nolder, Debbie; Monje Rumi, María; Levi, José E.; Ramirez, Juan D.; Zorrilla, Pilar; Flores, María; Jercic, Maria I.; Crisante, Gladys; Añez, Néstor; De Castro, Ana M.; Gonzalez, Clara I.; Acosta Viana, Karla; Yachelini, Pedro; Torrico, Faustino; Robello, Carlos; Diosque, Patricio; Triana Chavez, Omar; Aznar, Christine; Russomando, Graciela; Büscher, Philippe; Assal, Azzedine; Guhl, Felipe; Sosa Estani, Sergio; DaSilva, Alexandre; Britto, Constança; Luquetti, Alejandro; Ladzins, Janis

    2011-01-01

    Background A century after its discovery, Chagas disease still represents a major neglected tropical threat. Accurate diagnostics tools as well as surrogate markers of parasitological response to treatment are research priorities in the field. The purpose of this study was to evaluate the performance of PCR methods in detection of Trypanosoma cruzi DNA by an external quality evaluation. Methodology/Findings An international collaborative study was launched by expert PCR laboratories from 16 countries. Currently used strategies were challenged against serial dilutions of purified DNA from stocks representing T. cruzi discrete typing units (DTU) I, IV and VI (set A), human blood spiked with parasite cells (set B) and Guanidine Hidrochloride-EDTA blood samples from 32 seropositive and 10 seronegative patients from Southern Cone countries (set C). Forty eight PCR tests were reported for set A and 44 for sets B and C; 28 targeted minicircle DNA (kDNA), 13 satellite DNA (Sat-DNA) and the remainder low copy number sequences. In set A, commercial master mixes and Sat-DNA Real Time PCR showed better specificity, but kDNA-PCR was more sensitive to detect DTU I DNA. In set B, commercial DNA extraction kits presented better specificity than solvent extraction protocols. Sat-DNA PCR tests had higher specificity, with sensitivities of 0.05–0.5 parasites/mL whereas specific kDNA tests detected 5.10−3 par/mL. Sixteen specific and coherent methods had a Good Performance in both sets A and B (10 fg/µl of DNA from all stocks, 5 par/mL spiked blood). The median values of sensitivities, specificities and accuracies obtained in testing the Set C samples with the 16 tests determined to be good performing by analyzing Sets A and B samples varied considerably. Out of them, four methods depicted the best performing parameters in all three sets of samples, detecting at least 10 fg/µl for each DNA stock, 0.5 par/mL and a sensitivity between 83.3–94.4%, specificity of 85–95%, accuracy of 86.8–89.5% and kappa index of 0.7–0.8 compared to consensus PCR reports of the 16 good performing tests and 63–69%, 100%, 71.4–76.2% and 0.4–0.5, respectively compared to serodiagnosis. Method LbD2 used solvent extraction followed by Sybr-Green based Real time PCR targeted to Sat-DNA; method LbD3 used solvent DNA extraction followed by conventional PCR targeted to Sat-DNA. The third method (LbF1) used glass fiber column based DNA extraction followed by TaqMan Real Time PCR targeted to Sat-DNA (cruzi 1/cruzi 2 and cruzi 3 TaqMan probe) and the fourth method (LbQ) used solvent DNA extraction followed by conventional hot-start PCR targeted to kDNA (primer pairs 121/122). These four methods were further evaluated at the coordinating laboratory in a subset of human blood samples, confirming the performance obtained by the participating laboratories. Conclusion/Significance This study represents a first crucial step towards international validation of PCR procedures for detection of T. cruzi in human blood samples. PMID:21264349

  13. Target-triggering multiple-cycle signal amplification strategy for ultrasensitive detection of DNA based on QCM and SPR.

    PubMed

    Song, Weiling; Yin, Wenshuo; Sun, Wenbo; Guo, Xiaoyan; He, Peng; Yang, Xiaoyan; Zhang, Xiaoru

    2018-04-24

    Detection of ultralow concentrations of nucleic acid sequences is a central challenge in the early diagnosis of genetic diseases. Herein, we developed a target-triggering cascade multiple cycle amplification for ultrasensitive DNA detection using quartz crystal microbalance (QCM) and surface plasmon resonance (SPR). It was based on the exonuclease Ⅲ (Exo Ⅲ)-assisted signal amplification and the hybridization chain reaction (HCR). The streptavidin-coated Au-NPs (Au-NPs-SA) were assembled on the HCR products as recognition element. Upon sensing of target DNA, the duplex DNA probe triggered the Exo Ⅲ cleavage process, accompanied by generating a new secondary target DNA and releasing target DNA. The released target DNA and the secondary target DNA were recycled. Simultaneously, numerous single strands were liberated and acted as the trigger of HCR to generate further signal amplification, resulting in the immobilization of abundant Au-NPs-SA on the gold substrate. The QCM sensor results were found to be comparable to that achieved using a SPR sensor platform. This method exhibited a high sensitivity toward target DNA with a detection limit of 0.70 fM. The high sensitivity and specificity make this method a great potential for detecting DNA with trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier Inc. All rights reserved.

  14. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction.

    PubMed

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA ® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. The CTAB method showed more positive results at 1:10-1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor.

  15. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    PubMed

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  16. Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

    PubMed

    Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

    1997-11-01

    The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation.

  17. Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

    PubMed Central

    Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

    1997-01-01

    The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation. PMID:9336449

  18. Colorimetric and dynamic light scattering detection of DNA sequences by using positively charged gold nanospheres: a comparative study with gold nanorods

    NASA Astrophysics Data System (ADS)

    Pylaev, T. E.; Khanadeev, V. A.; Khlebtsov, B. N.; Dykman, L. A.; Bogatyrev, V. A.; Khlebtsov, N. G.

    2011-07-01

    We introduce a new genosensing approach employing CTAB (cetyltrimethylammonium bromide)-coated positively charged colloidal gold nanoparticles (GNPs) to detect target DNA sequences by using absorption spectroscopy and dynamic light scattering. The approach is compared with a previously reported method employing unmodified CTAB-coated gold nanorods (GNRs). Both approaches are based on the observation that whereas the addition of probe and target ssDNA to CTAB-coated particles results in particle aggregation, no aggregation is observed after addition of probe and nontarget DNA sequences. Our goal was to compare the feasibility and sensitivity of both methods. A 21-mer ssDNA from the human immunodeficiency virus type 1 HIV-1 U5 long terminal repeat (LTR) sequence and a 23-mer ssDNA from the Bacillus anthracis cryptic protein and protective antigen precursor (pagA) genes were used as ssDNA models. In the case of GNRs, unexpectedly, the colorimetric test failed with perfect cigar-like particles but could be performed with dumbbell and dog-bone rods. By contrast, our approach with cationic CTAB-coated GNPs is easy to implement and possesses excellent feasibility with retention of comparable sensitivity—a 0.1 nM concentration of target cDNA can be detected with the naked eye and 10 pM by dynamic light scattering (DLS) measurements. The specificity of our method is illustrated by successful DLS detection of one-three base mismatches in cDNA sequences for both DNA models. These results suggest that the cationic GNPs and DLS can be used for genosensing under optimal DNA hybridization conditions without any chemical modifications of the particle surface with ssDNA molecules and signal amplification. Finally, we discuss a more than two-three-order difference in the reported estimations of the detection sensitivity of colorimetric methods (0.1 to 10-100 pM) to show that the existing aggregation models are inconsistent with the detection limits of about 0.1-1 pM DNA and that other explanations should be developed.

  19. Rapid detection of ssDNA and RNA using multi-walled carbon nanotubes modified screen-printed carbon electrode.

    PubMed

    Ye, Yongkang; Ju, Huangxian

    2005-11-15

    A method for rapid sensitive detection of DNA or RNA was designed using a composite screen-printed carbon electrode modified with multi-walled carbon nanotubes (MWNTs). MWNTs showed catalytic characteristics for the direct electrochemical oxidation of guanine or adenine residues of signal strand DNA (ssDNA) and adenine residues of RNA, leading to indicator-free detection of ssDNA and RNA concentrations. With an accumulation time of 5 min, the proposed method could be used for detection of calf thymus ssDNA ranging from 17.0 to 345 microg ml(-1) with a detection limit of 2.0 microg ml(-1) at 3 sigma and yeast tRNA ranging from 8.2 microg ml(-1) to 4.1 mg ml(-1). AC impedance was employed to characterize the surface of modified electrodes. The advantages of convenient fabrication, low-cost detection, short analysis time and combination with nanotechnology for increasing the sensitivity made the subject worthy of special emphasis in the research programs and sources of new commercial products.

  20. ERASE-Seq: Leveraging replicate measurements to enhance ultralow frequency variant detection in NGS data

    PubMed Central

    Kamps-Hughes, Nick; McUsic, Andrew; Kurihara, Laurie; Harkins, Timothy T.; Pal, Prithwish; Ray, Claire

    2018-01-01

    The accurate detection of ultralow allele frequency variants in DNA samples is of interest in both research and medical settings, particularly in liquid biopsies where cancer mutational status is monitored from circulating DNA. Next-generation sequencing (NGS) technologies employing molecular barcoding have shown promise but significant sensitivity and specificity improvements are still needed to detect mutations in a majority of patients before the metastatic stage. To address this we present analytical validation data for ERASE-Seq (Elimination of Recurrent Artifacts and Stochastic Errors), a method for accurate and sensitive detection of ultralow frequency DNA variants in NGS data. ERASE-Seq differs from previous methods by creating a robust statistical framework to utilize technical replicates in conjunction with background error modeling, providing a 10 to 100-fold reduction in false positive rates compared to published molecular barcoding methods. ERASE-Seq was tested using spiked human DNA mixtures with clinically realistic DNA input quantities to detect SNVs and indels between 0.05% and 1% allele frequency, the range commonly found in liquid biopsy samples. Variants were detected with greater than 90% sensitivity and a false positive rate below 0.1 calls per 10,000 possible variants. The approach represents a significant performance improvement compared to molecular barcoding methods and does not require changing molecular reagents. PMID:29630678

  1. An evaluation of the efficacy of using environmental DNA (eDNA) to detect giant gartersnakes (Thamnophis gigas)

    USGS Publications Warehouse

    Halstead, Brian J.; Wood, Dustin A.; Bowen, Lizabeth; Waters, Shannon C.; Vandergast, Amy G.; Ersan, Julia S.; Skalos, Shannon M.; Casazza, Michael L.

    2017-09-28

    Detecting populations of rare or cryptic species is essential for their conservation. For species like giant gartersnakes (Thamnophis gigas), conventional survey methods can be expensive and inefficient. These sampling difficulties might be overcome by modern techniques that detect deoxyribonucleic acid (DNA) shed by organisms into the environment (eDNA). We evaluated the efficacy of detecting giant gartersnake eDNA in water samples from the laboratory and at locations with known giant gartersnake populations in the Sacramento Valley of California, and failed to detect giant gartersnake DNA in most laboratory and all field samples. Aspects of giant gartersnake biology—such as highly keratinized skin and spending extensive time in the terrestrial environment, as well as hot, sunny, and turbid conditions in wetlands and canals of the Sacramento Valley—likely contributed to low detection probabilities. Although detection of eDNA shows promise under many conditions, further development is needed before sampling for eDNA is a viable option for detecting giant gartersnake populations.

  2. Screening DNA chip and event-specific multiplex PCR detection methods for biotech crops.

    PubMed

    Lee, Seong-Hun

    2014-11-01

    There are about 80 biotech crop events that have been approved by safety assessment in Korea. They have been controlled by genetically modified organism (GMO) and living modified organism (LMO) labeling systems. The DNA-based detection method has been used as an efficient scientific management tool. Recently, the multiplex polymerase chain reaction (PCR) and DNA chip have been developed as simultaneous detection methods for several biotech crops' events. The event-specific multiplex PCR method was developed to detect five biotech maize events: MIR604, Event 3272, LY 038, MON 88017 and DAS-59122-7. The specificity was confirmed and the sensitivity was 0.5%. The screening DNA chip was developed from four endogenous genes of soybean, maize, cotton and canola respectively along with two regulatory elements and seven genes: P35S, tNOS, pat, bar, epsps1, epsps2, pmi, cry1Ac and cry3B. The specificity was confirmed and the sensitivity was 0.5% for four crops' 12 events: one soybean, six maize, three cotton and two canola events. The multiplex PCR and DNA chip can be available for screening, gene-specific and event-specific analysis of biotech crops as efficient detection methods by saving on workload and time. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  3. Analytical Validation of Quantitative Real-Time PCR Methods for Quantification of Trypanosoma cruzi DNA in Blood Samples from Chagas Disease Patients

    PubMed Central

    Ramírez, Juan Carlos; Cura, Carolina Inés; Moreira, Otacilio da Cruz; Lages-Silva, Eliane; Juiz, Natalia; Velázquez, Elsa; Ramírez, Juan David; Alberti, Anahí; Pavia, Paula; Flores-Chávez, María Delmans; Muñoz-Calderón, Arturo; Pérez-Morales, Deyanira; Santalla, José; Guedes, Paulo Marcos da Matta; Peneau, Julie; Marcet, Paula; Padilla, Carlos; Cruz-Robles, David; Valencia, Edward; Crisante, Gladys Elena; Greif, Gonzalo; Zulantay, Inés; Costales, Jaime Alfredo; Alvarez-Martínez, Miriam; Martínez, Norma Edith; Villarroel, Rodrigo; Villarroel, Sandro; Sánchez, Zunilda; Bisio, Margarita; Parrado, Rudy; Galvão, Lúcia Maria da Cunha; da Câmara, Antonia Cláudia Jácome; Espinoza, Bertha; de Noya, Belkisyole Alarcón; Puerta, Concepción; Riarte, Adelina; Diosque, Patricio; Sosa-Estani, Sergio; Guhl, Felipe; Ribeiro, Isabela; Aznar, Christine; Britto, Constança; Yadón, Zaida Estela; Schijman, Alejandro G.

    2015-01-01

    An international study was performed by 26 experienced PCR laboratories from 14 countries to assess the performance of duplex quantitative real-time PCR (qPCR) strategies on the basis of TaqMan probes for detection and quantification of parasitic loads in peripheral blood samples from Chagas disease patients. Two methods were studied: Satellite DNA (SatDNA) qPCR and kinetoplastid DNA (kDNA) qPCR. Both methods included an internal amplification control. Reportable range, analytical sensitivity, limits of detection and quantification, and precision were estimated according to international guidelines. In addition, inclusivity and exclusivity were estimated with DNA from stocks representing the different Trypanosoma cruzi discrete typing units and Trypanosoma rangeli and Leishmania spp. Both methods were challenged against 156 blood samples provided by the participant laboratories, including samples from acute and chronic patients with varied clinical findings, infected by oral route or vectorial transmission. kDNA qPCR showed better analytical sensitivity than SatDNA qPCR with limits of detection of 0.23 and 0.70 parasite equivalents/mL, respectively. Analyses of clinical samples revealed a high concordance in terms of sensitivity and parasitic loads determined by both SatDNA and kDNA qPCRs. This effort is a major step toward international validation of qPCR methods for the quantification of T. cruzi DNA in human blood samples, aiming to provide an accurate surrogate biomarker for diagnosis and treatment monitoring for patients with Chagas disease. PMID:26320872

  4. MethylMeter®: bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples

    PubMed Central

    McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

    2016-01-01

    Aim: Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Materials & methods: Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter®. Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. Results: MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. Conclusion: MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas. PMID:27337298

  5. Isothermal amplification detection of nucleic acids by a double-nicked beacon.

    PubMed

    Shi, Chao; Zhou, Meiling; Pan, Mei; Zhong, Guilin; Ma, Cuiping

    2016-03-01

    Isothermal and rapid amplification detection of nucleic acids is an important technology in environmental monitoring, foodborne pathogen detection, and point-of-care clinical diagnostics. Here we have developed a novel method of isothermal signal amplification for single-stranded DNA (ssDNA) detection. The ssDNA target could be used as an initiator, coupled with a double-nicked molecular beacon, to originate amplification cycles, achieving cascade signal amplification. In addition, the method showed good specificity and strong anti-jamming capability. Overall, it is a one-pot and isothermal strand displacement amplification method without the requirement of a stepwise procedure, which greatly simplifies the experimental procedure and decreases the probability of contamination of samples. With its advantages, the method would be very useful to detect nucleic acids in point-of-care or field use. Copyright © 2015 Elsevier Inc. All rights reserved.

  6. Long-Term Frozen Storage of Urine Samples: A Trouble to Get PCR Results in Schistosoma spp. DNA Detection?

    PubMed Central

    Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio

    2013-01-01

    Background Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples’ storage or conditions for handling and DNA preservation and extraction methods. Methodology/Principal Findings We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patientś urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Conclusions/Significance Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used. PMID:23613907

  7. Long-term frozen storage of urine samples: a trouble to get PCR results in Schistosoma spp. DNA detection?

    PubMed

    Fernández-Soto, Pedro; Velasco Tirado, Virginia; Carranza Rodríguez, Cristina; Pérez-Arellano, José Luis; Muro, Antonio

    2013-01-01

    Human schistosomiasis remains a serious worldwide public health problem. At present, a sensitive and specific assay for routine diagnosis of schistosome infection is not yet available. The potential for detecting schistosome-derived DNA by PCR-based methods in human clinical samples is currently being investigated as a diagnostic tool with potential application in routine schistosomiasis diagnosis. Collection of diagnostic samples such as stool or blood is usually difficult in some populations. However, urine is a biological sample that can be collected in a non-invasive method, easy to get from people of all ages and easy in management, but as a sample for PCR diagnosis is still not widely used. This could be due to the high variability in the reported efficiency of detection as a result of the high variation in urine samples' storage or conditions for handling and DNA preservation and extraction methods. We evaluate different commercial DNA extraction methods from a series of long-term frozen storage human urine samples from patients with parasitological confirmed schistosomiasis in order to assess the PCR effectiveness for Schistosoma spp. detection. Patients urine samples were frozen for 18 months up to 7 years until use. Results were compared with those obtained in PCR assays using fresh healthy human urine artificially contaminated with Schistosoma mansoni DNA and urine samples from mice experimentally infected with S. mansoni cercariae stored frozen for at least 12 months before use. PCR results in fresh human artificial urine samples using different DNA based extraction methods were much more effective than those obtained when long-term frozen human urine samples were used as the source of DNA template. Long-term frozen human urine samples are probably not a good source for DNA extraction for use as a template in PCR detection of Schistosoma spp., regardless of the DNA method of extraction used.

  8. Comparison of preprocessing methods and storage times for touch DNA samples

    PubMed Central

    Dong, Hui; Wang, Jing; Zhang, Tao; Ge, Jian-ye; Dong, Ying-qiang; Sun, Qi-fan; Liu, Chao; Li, Cai-xia

    2017-01-01

    Aim To select appropriate preprocessing methods for different substrates by comparing the effects of four different preprocessing methods on touch DNA samples and to determine the effect of various storage times on the results of touch DNA sample analysis. Method Hand touch DNA samples were used to investigate the detection and inspection results of DNA on different substrates. Four preprocessing methods, including the direct cutting method, stubbing procedure, double swab technique, and vacuum cleaner method, were used in this study. DNA was extracted from mock samples with four different preprocessing methods. The best preprocess protocol determined from the study was further used to compare performance after various storage times. DNA extracted from all samples was quantified and amplified using standard procedures. Results The amounts of DNA and the number of alleles detected on the porous substrates were greater than those on the non-porous substrates. The performances of the four preprocessing methods varied with different substrates. The direct cutting method displayed advantages for porous substrates, and the vacuum cleaner method was advantageous for non-porous substrates. No significant degradation trend was observed as the storage times increased. Conclusion Different substrates require the use of different preprocessing method in order to obtain the highest DNA amount and allele number from touch DNA samples. This study provides a theoretical basis for explorations of touch DNA samples and may be used as a reference when dealing with touch DNA samples in case work. PMID:28252870

  9. Detection of tyrosine hydroxylase in dopaminergic neuron cell using gold nanoparticles-based barcode DNA.

    PubMed

    An, Jeung Hee; Oh, Byung-Keun; Choi, Jeong Woo

    2013-04-01

    Tyrosine hydroxylase, the rate-limiting enzyme of catecholamine biosysthesis, is predominantly expressed in several cell groups within the brain, including the dopaminergic neurons of the substantia nigra and ventral tegmental area. We evaluated the efficacy of this protein-detection method in detecting tyrosine hydroxylase in normal and oxidative stress damaged dopaminergic cells. In this study, a coupling of DNA barcode and bead-based immnunoassay for detecting tyrosine hydroxylaser with PCR-like sensitivity is reported. The method relies on magnetic nanoparticles with antibodies and nanoparticles that are encoded with DNA and antibodies that can sandwich the target protein captured by the nanoparticle-bound antibodies. The aggregate sandwich structures are magnetically separated from solution, and treated to remove the conjugated barcode DNA. The DNA barcodes were identified by PCR analysis. The concentration of tyrosine hydroxylase in dopaminergic cell can be easily and rapidly detected using bio-barcode assay. The bio-barcode assay is a rapid and high-throughput screening tool to detect of neurotransmitter such as dopamine.

  10. Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application

    PubMed Central

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-01

    Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808

  11. MethylMeter(®): bisulfite-free quantitative and sensitive DNA methylation profiling and mutation detection in FFPE samples.

    PubMed

    McCarthy, David; Pulverer, Walter; Weinhaeusel, Andreas; Diago, Oscar R; Hogan, Daniel J; Ostertag, Derek; Hanna, Michelle M

    2016-06-01

    Development of a sensitive method for DNA methylation profiling and associated mutation detection in clinical samples. Formalin-fixed and paraffin-embedded tumors received by clinical laboratories often contain insufficient DNA for analysis with bisulfite or methylation sensitive restriction enzymes-based methods. To increase sensitivity, methyl-CpG DNA capture and Coupled Abscription PCR Signaling detection were combined in a new assay, MethylMeter(®). Gliomas were analyzed for MGMT methylation, glioma CpG island methylator phenotype and IDH1 R132H. MethylMeter had 100% assay success rate measuring all five biomarkers in formalin-fixed and paraffin-embedded tissue. MGMT methylation results were supported by survival and mRNA expression data. MethylMeter is a sensitive and quantitative method for multitarget DNA methylation profiling and associated mutation detection. The MethylMeter-based GliomaSTRAT assay measures methylation of four targets and one mutation to simultaneously grade gliomas and predict their response to temozolomide. This information is clinically valuable in management of gliomas.

  12. DNA extraction methods for detecting genetically modified foods: A comparative study.

    PubMed

    Elsanhoty, Rafaat M; Ramadan, Mohamed Fawzy; Jany, Klaus Dieter

    2011-06-15

    The work presented in this manuscript was achieved to compare six different methods for extracting DNA from raw maize and its derived products. The methods that gave higher yield and quality of DNA were chosen to detect the genetic modification in the samples collected from the Egyptian market. The different methods used were evaluated for extracting DNA from maize kernels (without treatment), maize flour (mechanical treatment), canned maize (sweet corn), frozen maize (sweet corn), maize starch, extruded maize, popcorn, corn flacks, maize snacks, and bread made from corn flour (mechanical and thermal treatments). The quality and quantity of the DNA extracted from the standards, containing known percentages of GMO material and from the different food products were evaluated. For qualitative detection of the GMO varieties in foods, the GMOScreen 35S/NOS test kit was used, to screen the genetic modification in the samples. The positive samples for the 35S promoter and/or the NOS terminator were identified by the standard methods adopted by EU. All of the used methods extracted yielded good DNA quality. However, we noted that the purest DNA extract were obtained using the DNA extraction kit (Roche) and this generally was the best method for extracting DNA from most of the maize-derived foods. We have noted that the yield of DNA extracted from maize-derived foods was generally lower in the processed products. The results indicated that 17 samples were positive for the presence of 35S promoter, while 34% from the samples were positive for the genetically modified maize line Bt-176. Copyright © 2010 Elsevier Ltd. All rights reserved.

  13. A self-assembled deoxyribonucleic acid concatemer for sensitive detection of single nucleotide polymorphism.

    PubMed

    Wu, Wei; Chen, Junhua; Fang, Zhiyuan; Ge, Chenchen; Xiang, Zhicheng; Ouyang, Chuanyan; Lie, Puchang; Xiao, Zhuo; Yu, Luxin; Wang, Lin; Zeng, Lingwen

    2013-12-04

    Polymerase-free and label-free strategies for DNA detection have shown excellent sensitivity and specificity in various biological samples. Herein, we propose a method for single nucleotide polymorphism (SNP) detection by using self-assembled DNA concatemers. Capture probes, bound to magnetic beads, can joint mediator probes by T4 DNA ligase in the presence of target DNA that is complementary to the capture probe and mediator probe. The mediator probes trigger self-assembly of two auxiliary probes on magnetic beads to form DNA concatemers. Separated by a magnetic rack, the double-stranded concatemers on beads can recruit a great amount of SYBR Green I and eventually result in amplified fluorescent signals. In comparison with reported methods for SNP detection, the concatemer-based approach has significant advantages of low background, simplicity, and ultrasensitivity, making it as a convenient platform for clinical applications. As a proof of concept, BRAF(T1799A) oncogene mutation, a SNP involved in diverse human cancers, was used as a model target. The developed approach using a fluorescent intercalator can detect as low as 0.1 fM target BRAF(T1799A) DNA, which is better than those previously published methods for SNP detection. This method is robust and can be used directly to measure the BRAF(T1799A) DNA in complex human serum with excellent recovery (94-103%). It is expected that this assay principle can be directed toward other SNP genes by simply changing the mediator probe and auxiliary probes. Copyright © 2013 Elsevier B.V. All rights reserved.

  14. Electrochemical DNA sensor for anthrax toxin activator gene atxA-detection of PCR amplicons.

    PubMed

    Das, Ritu; Goel, Ajay K; Sharma, Mukesh K; Upadhyay, Sanjay

    2015-12-15

    We report the DNA probe functionalized electrochemical genosensor for the detection of Bacillus anthracis, specific towards the regulatory gene atxA. The DNA sensor is fabricated on electrochemically deposited gold nanoparticle on self assembled layer of (3-Mercaptopropyl) trimethoxysilane (MPTS) on GC electrode. DNA hybridization is monitored by differential pulse voltammogram (DPV). The modified GC electrode is characterized by atomic force microscopy (AFM), cyclic voltammetry (CV), and electrochemical impedance spectroscopy (EIS) method. We also quantified the DNA probe density on electrode surface by the chronocoulometric method. The detection is specific and selective for atxA gene by DNA probe on the electrode surface. No report is available for the detection of B. anthracis by using atxA an anthrax toxin activator gene. In the light of real and complex sample, we have studied the PCR amplicons of 303, 361 and 568 base pairs by using symmetric and asymmetric PCR approaches. The DNA probe of atxA gene efficiently hybridizes with different base pairs of PCR amplicons. The detection limit is found to be 1.0 pM (S/N ratio=3). The results indicate that the DNA sensor is able to detect synthetic target as well as PCR amplicons of different base pairs. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. High-resolution melting (HRM) re-analysis of a polyposis patients cohort reveals previously undetected heterozygous and mosaic APC gene mutations.

    PubMed

    Out, Astrid A; van Minderhout, Ivonne J H M; van der Stoep, Nienke; van Bommel, Lysette S R; Kluijt, Irma; Aalfs, Cora; Voorendt, Marsha; Vossen, Rolf H A M; Nielsen, Maartje; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Tops, Carli M J; Hes, Frederik J

    2015-06-01

    Familial adenomatous polyposis is most frequently caused by pathogenic variants in either the APC gene or the MUTYH gene. The detection rate of pathogenic variants depends on the severity of the phenotype and sensitivity of the screening method, including sensitivity for mosaic variants. For 171 patients with multiple colorectal polyps without previously detectable pathogenic variant, APC was reanalyzed in leukocyte DNA by one uniform technique: high-resolution melting (HRM) analysis. Serial dilution of heterozygous DNA resulted in a lowest detectable allelic fraction of 6% for the majority of variants. HRM analysis and subsequent sequencing detected pathogenic fully heterozygous APC variants in 10 (6%) of the patients and pathogenic mosaic variants in 2 (1%). All these variants were previously missed by various conventional scanning methods. In parallel, HRM APC scanning was applied to DNA isolated from polyp tissue of two additional patients with apparently sporadic polyposis and without detectable pathogenic APC variant in leukocyte DNA. In both patients a pathogenic mosaic APC variant was present in multiple polyps. The detection of pathogenic APC variants in 7% of the patients, including mosaics, illustrates the usefulness of a complete APC gene reanalysis of previously tested patients, by a supplementary scanning method. HRM is a sensitive and fast pre-screening method for reliable detection of heterozygous and mosaic variants, which can be applied to leukocyte and polyp derived DNA.

  16. A universal DNA-based protein detection system.

    PubMed

    Tran, Thua N N; Cui, Jinhui; Hartman, Mark R; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C; Lis, John T; Cui, Haixin; Luo, Dan

    2013-09-25

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability.

  17. A Universal DNA-Based Protein Detection System

    PubMed Central

    Tran, Thua N. N.; Cui, Jinhui; Hartman, Mark R.; Peng, Songming; Funabashi, Hisakage; Duan, Faping; Yang, Dayong; March, John C.; Lis, John T.; Cui, Haixin; Luo, Dan

    2014-01-01

    Protein immune detection requires secondary antibodies which must be carefully selected in order to avoid interspecies cross-reactivity, and is therefore restricted by the limited availability of primary/secondary antibody pairs. Here we present a versatile DNA-based protein detection system using a universal adapter to interface between IgG antibodies and DNA-modified reporter molecules. As a demonstration of this capability, we successfully used DNA nano-barcodes, quantum dots, and horseradish peroxidase enzyme to detect multiple proteins using our DNA-based labeling system. Our system not only eliminates secondary antibodies but also serves as a novel method platform for protein detection with modularity, high capacity, and multiplexed capability. PMID:23978265

  18. Whole blood and tissue fungal DNA quantification in the diagnosis of canine sino-nasal aspergillosis.

    PubMed

    Peeters, Dominique; Peters, Iain R; Helps, Chris R; Dehard, Sandrine; Day, Michael J; Clercx, Cécile

    2008-04-01

    Various combinations of tests are used to confirm the diagnosis of canine sino-nasal aspergillosis (SNA) because false-positive and false-negative results can occur with each test. Therefore, the aim of this study was to evaluate whether detection of fungal DNA in blood and nasal tissue samples was of value in the clinical diagnosis of this disease. Four groups were included in the study (dogs with SNA, lymphoplasmacytic rhinitis or nasal neoplasia, and control animals). Real-time PCR assays detecting DNA from all Penicillium and Aspergillus species (PenAsp assay) or species-specific DNA from A. fumigatus, A. terreus, A. flavus and A. niger were applied to whole blood and nasal tissue samples. Results obtained by PCR were compared between the groups. Sensitivity, specificity, positive and negative predictive values (PPV and NPV) for fungal DNA detection were compared with those for alternative diagnostic procedures including histopathology, serology and fungal culture. Significantly more fungal DNA was detected by the PenAsp assay in tissue biopsies from dogs with SNA than in the three other groups. Sensitivity, specificity, PPV and NPV for this method were 1.00, 0.06, 0.32 and 1.00. A. fumigatus DNA was detected in seven tissue biopsies from dogs with SNA and in one biopsy from a dog with a nasal tumour. Sensitivity, specificity, PPV and NPV for this diagnostic test were 0.50, 0.97, 0.87 and 0.82. No significant difference was found between the groups with respect to the amount of DNA detected in blood by the PenAsp assay. Sensitivity, specificity, PPV and NPV for this method were 0.71, 0.24, 0.31 and 0.64. A. fumigatus DNA was detected in the blood of three dogs with SNA and sixteen dogs without SNA. Sensitivity, specificity, PPV and NPV for this diagnostic tool were 0.21, 0.45, 0.15 and 0.54. Detection of A. fumigatus DNA in nasal tissue had the highest specificity, PPV and NPV but sensitivity of this method was low. Detection of fungal DNA in whole blood was of no value in the diagnosis of SNA.

  19. Validation of DESS as a DNA Preservation Method for the Detection of Strongyloides spp. in Canine Feces.

    PubMed

    Beknazarova, Meruyert; Millsteed, Shelby; Robertson, Gemma; Whiley, Harriet; Ross, Kirstin

    2017-06-09

    Strongyloides stercoralis is a gastrointestinal parasitic nematode with a life cycle that includes free-living and parasitic forms. For both clinical (diagnostic) and environmental evaluation, it is important that we can detect Strongyloides spp. in both human and non-human fecal samples. Real-time PCR is the most feasible method for detecting the parasite in both clinical and environmental samples that have been preserved. However, one of the biggest challenges with PCR detection is DNA degradation during the postage time from rural and remote areas to the laboratory. This study included a laboratory assessment and field validation of DESS (dimethyl sulfoxide, disodium EDTA, and saturated NaCl) preservation of Strongyloides spp. DNA in fecal samples. The laboratory study investigated the capacity of 1:1 and 1:3 sample to DESS ratios to preserve Strongyloides ratti in spike canine feces. It was found that both ratios of DESS significantly prevented DNA degradation compared to the untreated sample. This method was then validated by applying it to the field-collected canine feces and detecting Strongyloides DNA using PCR. A total of 37 canine feces samples were collected and preserved in the 1:3 ratio (sample: DESS) and of these, 17 were positive for Strongyloides spp. The study shows that both 1:1 and 1:3 sample to DESS ratios were able to preserve the Strongyloides spp. DNA in canine feces samples stored at room temperature for up to 56 days. This DESS preservation method presents the most applicable and feasible method for the Strongyloides DNA preservation in field-collected feces.

  20. SPRi-based biosensing platforms for detection of specific DNA sequences using thiolate and dithiocarbamate assemblies

    NASA Astrophysics Data System (ADS)

    Drozd, Marcin; Pietrzak, Mariusz D.; Malinowska, Elżbieta

    2018-05-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0,66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 ·1012 molecules • cm-2 (with the calculated area occupied by single nanoparticle label of 132.7 nm2), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  1. SPRi-Based Biosensing Platforms for Detection of Specific DNA Sequences Using Thiolate and Dithiocarbamate Assemblies.

    PubMed

    Drozd, Marcin; Pietrzak, Mariusz D; Malinowska, Elżbieta

    2018-01-01

    The framework of presented study covers the development and examination of the analytical performance of surface plasmon resonance-based (SPR) DNA biosensors dedicated for a detection of model target oligonucleotide sequence. For this aim, various strategies of immobilization of DNA probes on gold transducers were tested. Besides the typical approaches: chemisorption of thiolated ssDNA (DNA-thiol) and physisorption of non-functionalized oligonucleotides, relatively new method based on chemisorption of dithiocarbamate-functionalized ssDNA (DNA-DTC) was applied for the first time for preparation of DNA-based SPR biosensor. The special emphasis was put on the correlation between the method of DNA immobilization and the composition of obtained receptor layer. The carried out studies focused on the examination of the capability of developed receptors layers to interact with both target DNA and DNA-functionalized AuNPs. It was found, that the detection limit of target DNA sequence (27 nb length) depends on the strategy of probe immobilization and backfilling method, and in the best case it amounted to 0.66 nM. Moreover, the application of ssDNA-functionalized gold nanoparticles (AuNPs) as plasmonic labels for secondary enhancement of SPR response is presented. The influence of spatial organization and surface density of a receptor layer on the ability to interact with DNA-functionalized AuNPs is discussed. Due to the best compatibility of receptors immobilized via DTC chemisorption: 1.47 ± 0.4 · 10 12 molecules · cm -2 (with the calculated area occupied by single nanoparticle label of ~132.7 nm 2 ), DNA chemisorption based on DTCs is pointed as especially promising for DNA biosensors utilizing indirect detection in competitive assays.

  2. Reverse transcription strand invasion based amplification (RT-SIBA): a method for rapid detection of influenza A and B.

    PubMed

    Eboigbodin, Kevin; Filén, Sanna; Ojalehto, Tuomas; Brummer, Mirko; Elf, Sonja; Pousi, Kirsi; Hoser, Mark

    2016-06-01

    Rapid and accurate diagnosis of influenza viruses plays an important role in infection control, as well as in preventing the misuse of antibiotics. Isothermal nucleic acid amplification methods offer significant advantages over the polymerase chain reaction (PCR), since they are more rapid and do not require the sophisticated instruments needed for thermal cycling. We previously described a novel isothermal nucleic acid amplification method, 'Strand Invasion Based Amplification' (SIBA®), with high analytical sensitivity and specificity, for the detection of DNA. In this study, we describe the development of a variant of the SIBA method, namely, reverse transcription SIBA (RT-SIBA), for the rapid detection of viral RNA targets. The RT-SIBA method includes a reverse transcriptase enzyme that allows one-step reverse transcription of RNA to complementary DNA (cDNA) and simultaneous amplification and detection of the cDNA by SIBA under isothermal reaction conditions. The RT-SIBA method was found to be more sensitive than PCR for the detection of influenza A and B and could detect 100 copies of influenza RNA within 15 min. The development of RT-SIBA will enable rapid and accurate diagnosis of viral RNA targets within point-of-care or central laboratory settings.

  3. Quantitative Method of Measuring Metastatic Activity

    NASA Technical Reports Server (NTRS)

    Morrison, Dennis R. (Inventor)

    1999-01-01

    The metastatic potential of tumors can be evaluated by the quantitative detection of urokinase and DNA. The cell sample selected for examination is analyzed for the presence of high levels of urokinase and abnormal DNA using analytical flow cytometry and digital image analysis. Other factors such as membrane associated uroldnase, increased DNA synthesis rates and certain receptors can be used in the method for detection of potentially invasive tumors.

  4. Methodological considerations for detection of terrestrial small-body salamander eDNA and implications for biodiversity conservation

    USGS Publications Warehouse

    Walker, Donald M.; Leys, Jacob E.; Dunham, Kelly E.; Oliver, Joshua C.; Schiller, Emily E.; Stephenson, Kelsey S.; Kimrey, John T.; Wooten, Jessica; Rogers, Mark W.

    2017-01-01

    Environmental DNA (eDNA) can be used as an assessment tool to detect populations of threatened species and provide fine-scale data required to make management decisions. The objectives of this project were to use quantitative PCR (qPCR) to: (i) detect spiked salamander DNA in soil, (ii) quantify eDNA degradation over time, (iii) determine detectability of salamander eDNA in a terrestrial environment using soil, faeces, and skin swabs, (iv) detect salamander eDNA in a mesocosm experiment. Salamander eDNA was positively detected in 100% of skin swabs and 66% of faecal samples and concentrations did not differ between the two sources. However, eDNA was not detected in soil samples collected from directly underneath wild-caught living salamanders. Salamander genomic DNA (gDNA) was detected in all qPCR reactions when spiked into soil at 10.0, 5.0, and 1.0 ng/g soil and spike concentration had a significant effect on detected concentrations. Only 33% of samples showed recoverable eDNA when spiked with 0.25 ng/g soil, which was the low end of eDNA detection. To determine the rate of eDNA degradation, gDNA (1 ng/g soil) was spiked into soil and quantified over seven days. Salamander eDNA concentrations decreased across days, but eDNA was still amplifiable at day 7. Salamander eDNA was detected in two of 182 mesocosm soil samples over 12 weeks (n = 52 control samples; n = 65 presence samples; n = 65 eviction samples). The discrepancy in detection success between experiments indicates the potential challenges for this method to be used as a monitoring technique for small-bodied wild terrestrial salamander populations.

  5. Methodological considerations for detection of terrestrial small-body salamander eDNA and implications for biodiversity conservation.

    PubMed

    Walker, Donald M; Leys, Jacob E; Dunham, Kelly E; Oliver, Joshua C; Schiller, Emily E; Stephenson, Kelsey S; Kimrey, John T; Wooten, Jessica; Rogers, Mark W

    2017-11-01

    Environmental DNA (eDNA) can be used as an assessment tool to detect populations of threatened species and provide fine-scale data required to make management decisions. The objectives of this project were to use quantitative PCR (qPCR) to: (i) detect spiked salamander DNA in soil, (ii) quantify eDNA degradation over time, (iii) determine detectability of salamander eDNA in a terrestrial environment using soil, faeces, and skin swabs, (iv) detect salamander eDNA in a mesocosm experiment. Salamander eDNA was positively detected in 100% of skin swabs and 66% of faecal samples and concentrations did not differ between the two sources. However, eDNA was not detected in soil samples collected from directly underneath wild-caught living salamanders. Salamander genomic DNA (gDNA) was detected in all qPCR reactions when spiked into soil at 10.0, 5.0, and 1.0 ng/g soil and spike concentration had a significant effect on detected concentrations. Only 33% of samples showed recoverable eDNA when spiked with 0.25 ng/g soil, which was the low end of eDNA detection. To determine the rate of eDNA degradation, gDNA (1 ng/g soil) was spiked into soil and quantified over seven days. Salamander eDNA concentrations decreased across days, but eDNA was still amplifiable at day 7. Salamander eDNA was detected in two of 182 mesocosm soil samples over 12 weeks (n = 52 control samples; n = 65 presence samples; n = 65 eviction samples). The discrepancy in detection success between experiments indicates the potential challenges for this method to be used as a monitoring technique for small-bodied wild terrestrial salamander populations. © 2017 John Wiley & Sons Ltd.

  6. Detection and differentiation of Fusarium oxysporum f. sp. lycopersici race 1 using loop-mediated isothermal amplification with three primer sets.

    PubMed

    Ayukawa, Y; Komatsu, K; Kashiwa, T; Akai, K; Yamada, M; Teraoka, T; Arie, T

    2016-09-01

    Fusarium oxysporum f. sp. lycopersici (Fol) causes tomato wilt. Based on the difference in pathogenicity towards tomato cultivars, Fol is classified into three races. In this study, a rapid method is developed for the detection and discrimination of Fol race 1 using a loop-mediated isothermal amplification (LAMP) assay with two primer sets targeting a region of the nucleotide sequence of the SIX4 gene specific for race 1 and a primer set targeting the SIX5 gene, conserved in all known Fol isolates. Upon LAMP reaction, amplification using all three primer sets was observed only when DNA of Fol race 1 was used as a template, and not when DNA of other Fol races or other fungal species was used. This method could detect 300 fg of Fol race 1 DNA, a 100-fold higher sensitivity than that obtained by conventional PCR. The method can also detect DNA extracted from soil artificially infested with Fol race 1. It is now possible to detect Fol race 1 in colonies and infected tomato stems without DNA isolation. This method is a rapid and simple tool for discrimination of Fol race 1. This study developed a loop-mediated isothermal amplification (LAMP) assay for detection and differentiation of Fusarium oxysporum f. sp. lycopersici (Fol) race 1 by using three primer sets targeting for the SIX4 and SIX5 genes. These genes are present together only in Fol race 1. This method can detect Fol race 1 in infected tomato stems without DNA extraction, affording an efficient diagnosis of Fusarium wilt on tomatoes in the field. © 2016 The Society for Applied Microbiology.

  7. Detection of a Diverse Marine Fish Fauna Using Environmental DNA from Seawater Samples

    PubMed Central

    Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

    2012-01-01

    Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources. PMID:22952584

  8. Detection of a diverse marine fish fauna using environmental DNA from seawater samples.

    PubMed

    Thomsen, Philip Francis; Kielgast, Jos; Iversen, Lars Lønsmann; Møller, Peter Rask; Rasmussen, Morten; Willerslev, Eske

    2012-01-01

    Marine ecosystems worldwide are under threat with many fish species and populations suffering from human over-exploitation. This is greatly impacting global biodiversity, economy and human health. Intriguingly, marine fish are largely surveyed using selective and invasive methods, which are mostly limited to commercial species, and restricted to particular areas with favourable conditions. Furthermore, misidentification of species represents a major problem. Here, we investigate the potential of using metabarcoding of environmental DNA (eDNA) obtained directly from seawater samples to account for marine fish biodiversity. This eDNA approach has recently been used successfully in freshwater environments, but never in marine settings. We isolate eDNA from ½-litre seawater samples collected in a temperate marine ecosystem in Denmark. Using next-generation DNA sequencing of PCR amplicons, we obtain eDNA from 15 different fish species, including both important consumption species, as well as species rarely or never recorded by conventional monitoring. We also detect eDNA from a rare vagrant species in the area; European pilchard (Sardina pilchardus). Additionally, we detect four bird species. Records in national databases confirmed the occurrence of all detected species. To investigate the efficiency of the eDNA approach, we compared its performance with 9 methods conventionally used in marine fish surveys. Promisingly, eDNA covered the fish diversity better than or equal to any of the applied conventional methods. Our study demonstrates that even small samples of seawater contain eDNA from a wide range of local fish species. Finally, in order to examine the potential dispersal of eDNA in oceans, we performed an experiment addressing eDNA degradation in seawater, which shows that even small (100-bp) eDNA fragments degrades beyond detectability within days. Although further studies are needed to validate the eDNA approach in varying environmental conditions, our findings provide a strong proof-of-concept with great perspectives for future monitoring of marine biodiversity and resources.

  9. A novel method for sex determination by detecting the number of X chromosomes.

    PubMed

    Nakanishi, Hiroaki; Shojo, Hideki; Ohmori, Takeshi; Hara, Masaaki; Takada, Aya; Adachi, Noboru; Saito, Kazuyuki

    2015-01-01

    A novel method for sex determination, based on the detection of the number of X chromosomes, was established. Current methods, based on the detection of the Y chromosome, can directly identify an unknown sample as male, but female gender is determined indirectly, by not detecting the Y chromosome. Thus, a direct determination of female gender is important because the quality (e.g., fragmentation and amelogenin-Y null allele) of the Y chromosome DNA may lead to a false result. Thus, we developed a novel sex determination method by analyzing the number of X chromosomes using a copy number variation (CNV) detection technique (the comparative Ct method). In this study, we designed a primer set using the amelogenin-X gene without the CNV region as the target to determine the X chromosome copy number, to exclude the influence of the CNV region from the comparative Ct value. The number of X chromosomes was determined statistically using the CopyCaller software with real-time PCR. All DNA samples from participants (20 males, 20 females) were evaluated correctly using this method with 1-ng template DNA. A minimum of 0.2-ng template DNA was found to be necessary for accurate sex determination with this method. When using ultraviolet-irradiated template DNA, as mock forensic samples, the sex of the samples could not be determined by short tandem repeat (STR) analysis but was correctly determined using our method. Thus, we successfully developed a method of sex determination based on the number of X chromosomes. Our novel method will be useful in forensic practice for sex determination.

  10. Gold Nanoparticles-Based Barcode Analysis for Detection of Norepinephrine.

    PubMed

    An, Jeung Hee; Lee, Kwon-Jai; Choi, Jeong-Woo

    2016-02-01

    Nanotechnology-based bio-barcode amplification analysis offers an innovative approach for detecting neurotransmitters. We evaluated the efficacy of this method for detecting norepinephrine in normal and oxidative-stress damaged dopaminergic cells. Our approach use a combination of DNA barcodes and bead-based immunoassays for detecting neurotransmitters with surface-enhanced Raman spectroscopy (SERS), and provides polymerase chain reaction (PCR)-like sensitivity. This method relies on magnetic Dynabeads containing antibodies and nanoparticles that are loaded both with DNA barcords and with antibodies that can sandwich the target protein captured by the Dynabead-bound antibodies. The aggregate sandwich structures are magnetically separated from the solution and treated to remove the conjugated barcode DNA. The DNA barcodes are then identified by SERS and PCR analysis. The concentration of norepinephrine in dopaminergic cells can be readily detected using the bio-barcode assay, which is a rapid, high-throughput screening tool for detecting neurotransmitters.

  11. Identification of gamma-irradiated papaya, melon and watermelon

    NASA Astrophysics Data System (ADS)

    Marín-Huachaca, Nélida S.; Mancini-Filho, Jorge; Delincée, Henry; Villavicencio, Anna Lúcia C. H.

    2004-09-01

    Ionizing radiation can be used to control spoilage microorganisms and to increase the shelf life of fresh fruits and vegetables in replacement for the treatment with chemical fumigants. In order to enforce labelling regulations, methods for detecting the irradiation treatment directly in the produce are required. Recently, a number of detection methods for irradiated food have been adopted by the Codex Comission. A rapid screening method for qualitative detection of irradiation is the DNA Comet Assay. The applicability of the DNA Comet Assay for distinguishing irradiated papaya, melon, and watermelon was evaluated. The samples were treated in a 60Co facility at dose levels of 0.0, 0.5, 0.75, and 1.0kGy. The irradiated samples showed typical DNA fragmentation whereas cells from non-irradiated ones appeared intact. In addition to the DNA Comet Assay also the half-embryo test was applied in melon and watermelon to detect the irradiation treatment.

  12. Optimal DNA Isolation Method for Detection of Nontuberculous Mycobacteria by Polymerase Chain Reaction

    PubMed Central

    Mohammadi, Samira; Esfahani, Bahram Nasr; Moghim, Sharareh; Mirhendi, Hossein; Zaniani, Fatemeh Riyahi; Safaei, Hajieh Ghasemian; Fazeli, Hossein; Salehi, Mahshid

    2017-01-01

    Background: Nontuberculous mycobacteria (NTM) are a group of opportunistic pathogens and these are widely dispersed in water and soil resources. Identification of mycobacteria isolates by conventional methods including biochemical tests, growth rates, colony pigmentation, and presence of acid-fast bacilli is widely used, but these methods are time-consuming, labor-intensive, and may sometimes remain inconclusive. Materials and Methods: The DNA was extracted from NTM cultures using CTAB, Chelex, Chelex + Nonidet P-40, FTA® Elute card, and boiling The quantity and quality of the DNA extracted via these methods were determined using UV-photometer at 260 and 280 nm, and polymerase chain reaction (PCR) amplification of the heat-shock protein 65 gene with serially diluted DNA samples. Results: The CTAB method showed more positive results at 1:10–1:100,000 at which the DNA amount was substantial. With the Chelex method of DNA extraction, PCR amplification was detected at 1:10 and 1:1000 dilutions. Conclusions: According to the electrophoresis results, the CTAB and Chelex DNA extraction methods were more successful in comparison with the others as regard producing suitable concentrations of DNA with the minimum use of PCR inhibitor. PMID:29279831

  13. DNA detection and single nucleotide mutation identification using SERS for molecular diagnostics and global health

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Gandra, Naveen; Fales, Andrew M.; Taylor, Steve M.; Vo-Dinh, Tuan

    2017-02-01

    Nucleic acid-based molecular diagnostics at the point-of-care (POC) and in resource-limited settings is still a challenge. We present a sensitive yet simple DNA detection method with single nucleotide polymorphism (SNP) identification capability. The detection scheme involves sandwich hybridization of magnetic beads conjugated with capture probes, target sequences, and ultrabright surface-enhanced Raman Scattering (SERS) nanorattles conjugated with reporter probes. Upon hybridization, the sandwich probes are concentrated at the detection focus controlled by a magnetic system for SERS measurements. The ultrabright SERS nanorattles, consisting of a core and a shell with resonance Raman reporters loaded in the gap space between the core and the shell, serve as SERS tags for ultrasensitive signal detection. Specific DNA sequences of the malaria parasite Plasmodium falciparum and dengue virus 1 (DENV1) were used as the model marker system. Detection limit of approximately 100 attomoles was achieved. Single nucleotide polymorphism (SNP) discrimination of wild type malaria DNA and mutant malaria DNA, which confers resistance to artemisinin drugs, was also demonstrated. The results demonstrate the molecular diagnostic potential of the nanorattle-based method to both detect and genotype infectious pathogens. The method's simplicity makes it a suitable candidate for molecular diagnosis at the POC and in resource-limited settings.

  14. Quantum dot-fluorescence in situ hybridisation for Ectromelia virus detection based on biotin-streptavidin interactions.

    PubMed

    Wang, Ting; Zheng, Zhenhua; Zhang, Xian-En; Wang, Hanzhong

    2016-09-01

    Ectromelia virus (ECTV) is an pathogen that can lead to a lethal, acute toxic disease known as mousepox in mice. Prevention and control of ECTV infection requires the establishment of a rapid and sensitive diagnostic system for detecting the virus. In the present study, we developed a method of quantum-dot-fluorescence based in situ hybridisation for detecting ECTV genome DNA. Using biotin-dUTP to replace dTTP, biotin was incorporated into a DNA probe during polymerase chain reaction. High sensitivity and specificity of ECTV DNA detection were displayed by fluorescent quantum dots based on biotin-streptavidin interactions. ECTV DNA was then detected by streptavidin-conjugated quantum dots that bound the biotin-labelled probe. Results indicated that the established method can visualise ECTV genomic DNA in both infected cells and mouse tissues. To our knowledge, this is the first study reporting quantum-dot-fluorescence based in situ hybridisation for the detection of viral nucleic acids, providing a reference for the identification and detection of other viruses. Copyright © 2016. Published by Elsevier B.V.

  15. Label-free and ultrasensitive fluorescence detection of cocaine based on a strategy that utilizes DNA-templated silver nanoclusters and the nicking endonuclease-assisted signal amplification method.

    PubMed

    Zhang, Kai; Wang, Ke; Zhu, Xue; Zhang, Jue; Xu, Lan; Huang, Biao; Xie, Minhao

    2014-01-07

    A general and reliable strategy for the detection of cocaine was proposed utilizing DNA-templated silver nanoclusters as signal indicators and the nicking endonuclease-assisted signal amplification method. This strategy can detect cocaine specifically with a detection limit as low as 2 nM by using a small volume of 5 μL.

  16. Evaluation of formalin-fixed paraffin-embedded tissues obtained from vaccine site-associated sarcomas of cats for DNA of feline immunodeficiency virus.

    PubMed

    Kidney, B A; Ellis, J A; Haines, D M; Jackson, M L

    2000-09-01

    To evaluate the use of a polymerase chain reaction (PCR) method for detection of feline immunodeficiency virus (FIV) DNA, using formalin-fixed paraffin-embedded (FFPE) tissues, and to use this method to evaluate tissues obtained from vaccine site-associated sarcomas (VSS) of cats for FIV DNA. 50 FFPE tissue blocks from VSS of cats and 50 FFPE tissue blocks from cutaneous non-vaccine site-associated fibrosarcomas (non-VSS) of cats. DNA was extracted from FFPE sections of each tumor and regions of the gag gene of FIV were amplified by a PCR, using 3 sets of primers. Sensitivity of the method was compared between frozen and FFPE tissues, using splenic tissue obtained from a cat that had been experimentally infected with FIV. We did not detect FIV DNA in VSS or non-VSS tissues. Sensitivity of the PCR method was identical for frozen or FFPE tissues. It is possible to detect FIV DNA in FFPE tissues by use of a PCR. We did not find evidence to support direct FIV involvement in the pathogenesis of VSS in cats.

  17. Protocol for the use of a rapid real-time PCR method for the detection of HIV-1 proviral DNA using double-stranded primer.

    PubMed

    Pau, Chou-Pong; Wells, Susan K; Granade, Timothy C

    2012-01-01

    This chapter describes a real-time PCR method for the detection of HIV-1 proviral DNA in whole blood samples using a novel double-stranded primer system. The assay utilizes a simple commercially available DNA extraction method and a rapid and easy-to-perform real-time PCR protocol to consistently detect a minimum of four copies of HIV-1 group M proviral DNA in as little as 90 min after sample (whole blood) collection. Co-amplification of the human RNase P gene serves as an internal control to monitor the efficiency of both the DNA extraction and amplification. Once the assay is validated properly, it may be suitable as an alternative confirmation test for HIV-1 infections in a variety of HIV testing venues including the mother-to-child transmission testing sites, clinics, and diagnostic testing centers.

  18. Environmental DNA detection of rare and invasive fish species in two Great Lakes tributaries.

    PubMed

    Balasingham, Katherine D; Walter, Ryan P; Mandrak, Nicholas E; Heath, Daniel D

    2018-01-01

    The extraction and characterization of DNA from aquatic environmental samples offers an alternative, noninvasive approach for the detection of rare species. Environmental DNA, coupled with PCR and next-generation sequencing ("metabarcoding"), has proven to be very sensitive for the detection of rare aquatic species. Our study used a custom-designed group-specific primer set and next-generation sequencing for the detection of three species at risk (Eastern Sand Darter, Ammocrypta pellucida; Northern Madtom, Noturus stigmosus; and Silver Shiner, Notropis photogenis), one invasive species (Round Goby, Neogobius melanostomus) and an additional 78 native species from two large Great Lakes tributary rivers in southern Ontario, Canada: the Grand River and the Sydenham River. Of 82 fish species detected in both rivers using capture-based and eDNA methods, our eDNA method detected 86.2% and 72.0% of the fish species in the Grand River and the Sydenham River, respectively, which included our four target species. Our analyses also identified significant positive and negative species co-occurrence patterns between our target species and other identified species. Our results demonstrate that eDNA metabarcoding that targets the fish community as well as individual species of interest provides a better understanding of factors affecting the target species spatial distribution in an ecosystem than possible with only target species data. Additionally, eDNA is easily implemented as an initial survey tool, or alongside capture-based methods, for improved mapping of species distribution patterns. © 2017 John Wiley & Sons Ltd.

  19. Spectrophotometric, colorimetric and visually detection of Pseudomonas aeruginosa ETA gene based gold nanoparticles DNA probe and endonuclease enzyme.

    PubMed

    Amini, Bahram; Kamali, Mehdi; Salouti, Mojtaba; Yaghmaei, Parichehreh

    2018-06-15

    Colorimetric DNA detection is preferred over other methods for clinical molecular diagnosis because it does not require expensive equipment. In the present study, the colorimetric method based on gold nanoparticles (GNPs) and endonuclease enzyme was used for the detection of P. aeruginosa ETA gene. Firstly, the primers and probe for P. aeruginosa exotoxin A (ETA) gene were designed and checked for specificity by the PCR method. Then, GNPs were synthesized using the citrate reduction method and conjugated with the prepared probe to develop the new nano-biosensor. Next, the extracted target DNA of the bacteria was added to GNP-probe complex to check its efficacy for P. aeruginosa ETA gene diagnosis. A decrease in absorbance was seen when GNP-probe-target DNA cleaved into the small fragments of BamHI endonuclease due to the weakened electrostatic interaction between GNPs and the shortened DNA. The right shift of the absorbance peak from 530 to 562nm occurred after adding the endonuclease. It was measured using a UV-VIS absorption spectroscopy that indicates the existence of the P. aeruginosa ETA gene. Sensitivity was determined in the presence of different concentrations of target DNA of P. aeruginosa. The results obtained from the optimized conditions showed that the absorbance value has linear correlation with concentration of target DNA (R: 0.9850) in the range of 10-50ngmL -1 with the limit detection of 9.899ngmL -1 . Thus, the specificity of the new method for detection of P. aeruginosa was established in comparison with other bacteria. Additionally, the designed assay was quantitatively applied to detect the P. aeruginosa ETA gene from 10 3 to 10 8 CFUmL -1 in real samples with a detection limit of 320CFUmL -1 . Copyright © 2018 Elsevier B.V. All rights reserved.

  20. Methods to alter levels of a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-10-17

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  1. Cytometry of DNA Replication and RNA Synthesis: Historical Perspective and Recent Advances Based on “Click Chemistry”

    PubMed Central

    Darzynkiewicz, Zbigniew; Traganos, Frank; Zhao, Hong; Halicka, H. Dorota; Li, Jiangwei

    2011-01-01

    This review covers progress in the development of cytometric methodologies designed to assess DNA replication and RNA synthesis. The early approaches utilizing autoradiography to detect incorporation of 3H- or 14C-labeled thymidine were able to identify the four fundamental phases of the cell cycle G1, S, G2, and M, and by analysis of the fraction of labeled mitosis (FLM), to precisely define the kinetics of cell progression through these phases. Analysis of 3H-uridine incorporation and RNA content provided the means to distinguish quiescent G0 from cycling G1 cells. Subsequent progress in analysis of DNA replication was based on the use of BrdU as a DNA precursor and its detection by the quenching of the fluorescence intensity of DNA-bound fluorochromes such as Hoechst 33358 or acridine orange as measured by flow cytometry. Several variants of this methodology have been designed and used in studies to detect anticancer drug-induced perturbations of cell cycle kinetics. The next phase of method development, which was particularly useful in studies of the cell cycle in vivo, including clinical applications, relied on immunocytochemical detection of incorporated halogenated DNA or RNA precursors. This approach however was hampered by the need for DNA denaturation, which made it difficult to concurrently detect other cell constituents for multiparametric analysis. The recently introduced “click chemistry” approach has no such limitation and is the method of choice for analysis of DNA replication and RNA synthesis. This method is based on the use of 5-ethynyl-2′deoxyuridine (EdU) as a DNA precursor or 5-ethynyluridine (EU) as an RNA precursor and their detection with fluorochrome-tagged azides utilizing a copper (I) catalyzed [3+2] cycloaddition. Several examples are presented that illustrate incorporation of EdU or EU in cells subjected to DNA damage detected as histone H2AX phosphorylation that have been analyzed by flow or laser scanning cytometry. PMID:21425239

  2. Carbon nanostructures as immobilization platform for DNA: A review on current progress in electrochemical DNA sensors.

    PubMed

    Rasheed, P Abdul; Sandhyarani, N

    2017-11-15

    Development of a sensitive, specific and cost-effective DNA detection method is motivated by increasing demand for the early stage diagnosis of genetic diseases. Recent developments in the design and fabrication of efficient sensor platforms based on nanostructures make the highly sensitive sensors which could indicate very low detection limit to the level of few molecules, a realistic possibility. Electrochemical detection methods are widely used in DNA diagnostics as it provide simple, accurate and inexpensive platform for DNA detection. In addition, the electrochemical DNA sensors provide direct electronic signal without the use of expensive signal transduction equipment and facilitates the immobilization of single stranded DNA (ssDNA) probe sequences on a wide variety of electrode substrates. It has been found that a range of nanomaterials such as metal nanoparticles (MNPs), carbon based nanomaterials, quantum dots (QDs), magnetic nanoparticles and polymeric NPs have been introduced in the sensor design to enhance the sensing performance of electrochemical DNA sensor. In this review, we discuss recent progress in the design and fabrication of efficient electrochemical genosensors based on carbon nanostructures such as carbon nanotubes, graphene, graphene oxide and nanodiamonds. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Rapid detection of Listeria monocytogenes in foods, by a combination of PCR and DNA probe.

    PubMed

    Ingianni, A; Floris, M; Palomba, P; Madeddu, M A; Quartuccio, M; Pompei, R

    2001-10-01

    Listeria monocytogenes is a frequent contaminant of water and foods. Its rapid detection is needed before some foods can be prepared for marketing. In this work L. monocytogenes has been searched for in foods, by a combination of polymerase chain reaction (PCR) and a DNA probe. Both PCR and the probe were prepared for recognizing a specific region of the internalin gene, which is responsible for the production of one of the most important pathogenic factors of Listeria. The combined use of PCR and the DNA probe was used for the detection of L. monocytogenes in over 180 environmental and food samples. Several detection methods were compared in this study, namely conventional culture methods; direct PCR; PCR after an enrichment step; a DNA probe alone; a DNA probe after enrichment and another commercially available gene-probe. Finally PCR and the DNA probe were used in series on all the samples collected. When the DNA probe was associated with the PCR, specific and accurate detection of listeria in the samples could be obtained in about a working-day. The present molecular method showed some advantages in terms of rapidity and specificity in comparison to the other aforementioned tests. In addition, it resulted as being easy to handle, even for non-specialized personnel in small diagnostic microbiology laboratories. Copyright 2001 Academic Press.

  4. A PCR method for the detection and differentiation of Lentinus edodes and Trametes versicolor in defined-mixed cultures used for wastewater treatment.

    PubMed

    García-Mena, Jaime; Cano-Ramirez, Claudia; Garibay-Orijel, Claudio; Ramirez-Canseco, Sergio; Poggi-Varaldo, Héctor M

    2005-06-01

    A PCR-based method for the quantitative detection of Lentinus edodes and Trametes versicolor, two ligninolytic fungi applied for wastewater treatment and bioremediation, was developed. Genomic DNA was used to optimize a PCR method targeting the conserved copper-binding sequence of laccase genes. The method allowed the quantitative detection and differentiation of these fungi in single and defined-mixed cultures after fractionation of the PCR products by electrophoresis in agarose gels. Amplified products of about 150 bp for L. edodes, and about 200 bp for T. versicolor were purified and cloned. The PCR method showed a linear detection response in the 1.0 microg-1 ng range. The same method was tested with genomic DNA from a third fungus (Phanerochaete chrysosporium), yielding a fragment of about 400 bp. Southern-blot and DNA sequence analysis indicated that a specific PCR product was amplified from each genome, and that these corresponded to sequences of laccase genes. This PCR protocol permits the detection and differentiation of three ligninolytic fungi by amplifying DNA fragments of different sizes using a single pair of primers, without further enzymatic restriction of the PCR products. This method has potential use in the monitoring, evaluation, and improvement of fungal cultures used in wastewater treatment processes.

  5. Strand-specific transcriptome profiling with directly labeled RNA on genomic tiling microarrays

    PubMed Central

    2011-01-01

    Background With lower manufacturing cost, high spot density, and flexible probe design, genomic tiling microarrays are ideal for comprehensive transcriptome studies. Typically, transcriptome profiling using microarrays involves reverse transcription, which converts RNA to cDNA. The cDNA is then labeled and hybridized to the probes on the arrays, thus the RNA signals are detected indirectly. Reverse transcription is known to generate artifactual cDNA, in particular the synthesis of second-strand cDNA, leading to false discovery of antisense RNA. To address this issue, we have developed an effective method using RNA that is directly labeled, thus by-passing the cDNA generation. This paper describes this method and its application to the mapping of transcriptome profiles. Results RNA extracted from laboratory cultures of Porphyromonas gingivalis was fluorescently labeled with an alkylation reagent and hybridized directly to probes on genomic tiling microarrays specifically designed for this periodontal pathogen. The generated transcriptome profile was strand-specific and produced signals close to background level in most antisense regions of the genome. In contrast, high levels of signal were detected in the antisense regions when the hybridization was done with cDNA. Five antisense areas were tested with independent strand-specific RT-PCR and none to negligible amplification was detected, indicating that the strong antisense cDNA signals were experimental artifacts. Conclusions An efficient method was developed for mapping transcriptome profiles specific to both coding strands of a bacterial genome. This method chemically labels and uses extracted RNA directly in microarray hybridization. The generated transcriptome profile was free of cDNA artifactual signals. In addition, this method requires fewer processing steps and is potentially more sensitive in detecting small amount of RNA compared to conventional end-labeling methods due to the incorporation of more fluorescent molecules per RNA fragment. PMID:21235785

  6. Method and apparatus for staining immobilized nucleic acids

    DOEpatents

    Ramsey, J. Michael; Foote, Robert S.; Jacobson, Stephen C.

    2000-01-01

    A method for staining immobilized nucleic acids includes the steps of affixing DNA probes to a solid substrate, moving target DNA material into proximity with the DNA probes, whereby the target DNA hybridized with specific ones of the DNA probes, and moving a fluorescent dye into proximity with the hybridized target DNA, whereby the fluorescent dye binds to the hybridized DNA to enable subsequent detection of fluorescence.

  7. Quantitative method of measuring cancer cell urokinase and metastatic potential

    NASA Technical Reports Server (NTRS)

    Morrison, Dennis R. (Inventor)

    1993-01-01

    The metastatic potential of tumors can be evaluated by the quantitative detection of urokinase and DNA. The cell sample selected for examination is analyzed for the presence of high levels of urokinase and abnormal DNA using analytical flow cytometry and digital image analysis. Other factors such as membrane associated urokinase, increased DNA synthesis rates and certain receptors can be used in the method for detection of potentially invasive tumors.

  8. A Fluorescence Quenching Assay Based on Molecular Beacon Formation through a Ligase Detection Reaction for Facile and Rapid Detection of Point Mutations.

    PubMed

    Sawamura, Kensuke; Hashimoto, Masahiko

    2017-01-01

    A fluorescence quenching assay based on a ligase detection reaction was developed for facile and rapid detection of point mutations present in a mixed population of non-variant DNA. If the test DNA carried a targeted mutation, then the two allele-specific primers were ligated to form a molecular beacon resulting in the expected fluorescence quenching signatures. Using this method, we successfully detected as low as 5% mutant DNA in a mixture of wild-type DNA (t test at 99% confidence level).

  9. Colorimetric detection of UV light-induced single-strand DNA breaks using gold nanoparticles.

    PubMed

    Kim, Joong Hyun; Chung, Chan Ho; Chung, Bong Hyun

    2013-02-21

    We developed a colorimetric method to specifically detect single-strand DNA breaks using gold nanoparticles. In our assay, broken DNA cannot stabilize gold nanoparticles to prevent salt-induced aggregation as good as intact DNA can, and this effect can be easily observed with the naked eye as a red-to-purple color change.

  10. Irradiation influence on the detection of genetic-modified soybeans

    NASA Astrophysics Data System (ADS)

    Villavicencio, A. L. C. H.; Araújo, M. M.; Baldasso, J. G.; Aquino, S.; Konietzny, U.; Greiner, R.

    2004-09-01

    Three soybean varieties were analyzed to evaluate the irradiation influence on the detection of genetic modification. Samples were treated in a 60Co facility at dose levels of 0, 500, 800, and 1000Gy. The seeds were at first analyzed by Comet Assay as a rapid screening irradiation detection method. Secondly, germination test was performed to detect the viability of irradiated soybeans. Finally, because of its high sensitivity, its specificity and rapidity the polimerase chain reaction was the method applied for genetic modified organism detection. The analysis of DNA by the single technique of microgel electrophoresis of single cells (DNA Comet Assay) showed that DNA damage increased with increasing radiation doses. No negative influence of irradiation on the genetic modification detection was found.

  11. Phosphorescent quantum dots/ethidium bromide nanohybrids based on photoinduced electron transfer for DNA detection.

    PubMed

    Bi, Lin; Yu, Yuan-Hua

    2015-04-05

    Mercaptopropionic acid-capped Mn-doped ZnS quantum dots/ethidium bromide (EB) nanohybrids were constructed for photoinduced electron transfer (PIET) and then used as a room-temperature phosphorescence (RTP) probe for DNA detection. EB could quench the RTP of Mn-doped ZnS QDs by PIET, thereby forming Mn-doped ZnS QDs/EB nanohybrids and storing RTP. Meanwhile, EB could be inserted into DNA and EB could be competitively desorbed from the surface of Mn-doped ZnS QDs by DNA, thereby releasing the RTP of Mn-doped ZnS QDs. Based on this mechanism, a RTP sensor for DNA detection was developed. Under optimal conditions, the detection limit for DNA was 0.045 mg L(-1), the relative standard deviation was 1.7%, and the method linear ranged from 0.2 to 20 mg L(-1). The proposed method was applied to biological fluids, in which satisfactory results were obtained. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. A Novel Computational Method to Reduce Leaky Reaction in DNA Strand Displacement.

    PubMed

    Li, Xin; Wang, Xun; Song, Tao; Lu, Wei; Chen, Zhihua; Shi, Xiaolong

    2015-01-01

    DNA strand displacement technique is widely used in DNA programming, DNA biosensors, and gene analysis. In DNA strand displacement, leaky reactions can cause DNA signals decay and detecting DNA signals fails. The mostly used method to avoid leakage is cleaning up after upstream leaky reactions, and it remains a challenge to develop reliable DNA strand displacement technique with low leakage. In this work, we address the challenge by experimentally evaluating the basic factors, including reaction time, ratio of reactants, and ion concentration to the leakage in DNA strand displacement. Specifically, fluorescent probes and a hairpin structure reporting DNA strand are designed to detect the output of DNA strand displacement, and thus can evaluate the leakage of DNA strand displacement reactions with different reaction time, ratios of reactants, and ion concentrations. From the obtained data, mathematical models for evaluating leakage are achieved by curve derivation. As a result, it is obtained that long time incubation, high concentration of fuel strand, and inappropriate amount of ion concentration can weaken leaky reactions. This contributes to a method to set proper reaction conditions to reduce leakage in DNA strand displacement.

  13. Novel strategy combining SYBR Green I with carbon nanotubes for highly sensitive detection of Salmonella typhimurium DNA.

    PubMed

    Mao, Pingdao; Ning, Yi; Li, Wenkai; Peng, Zhihui; Chen, Yongzhe; Deng, Le

    2014-01-10

    A simple, selective, sensitive and label-free fluorescent method for detecting trpS-harboring Salmonella typhimurium was developed in this study. This assay used the non-covalent interaction of single-stranded DNA (ssDNA) probes with SWNTs, since SWNTs can quench fluorescence. Fluorescence recovery (78% with 1.8 nM target DNA) was detected in the presence of target DNA as ssDNA probes detached from SWNTs hybridized with target DNA, and the resulting double-stranded DNA (dsDNA) intercalated with SYBR Green I (SG) dyes. The increasing fluorescence intensity reached 4.54-fold. In contrast, mismatched oligonucleotides (1- or 3-nt difference to the target DNA) did not contribute to significant fluorescent recovery, which demonstrated the specificity of the assay. The increasing fluorescence intensity increased 3.15-fold when purified PCR products containing complementary sequences of trpS gene were detected. These results confirmed the ability to use this assay for detecting real samples. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Aptamer-based microspheres for highly sensitive protein detection using fluorescently-labeled DNA nanostructures.

    PubMed

    Han, Daehoon; Hong, Jinkee; Kim, Hyun Cheol; Sung, Jong Hwan; Lee, Jong Bum

    2013-11-01

    Many highly sensitive protein detection techniques have been developed and have played an important role in the analysis of proteins. Herein, we report a novel technique that can detect proteins sensitively and effectively using aptamer-based DNA nanostructures. Thrombin was used as a target protein and aptamer was used to capture fluorescent dye-labeled DNA nanobarcodes or thrombin on a microsphere. The captured DNA nanobarcodes were replaced by a thrombin and aptamer interaction. The detection ability of this approach was confirmed by flow cytometry with different concentrations of thrombin. Our detection method has great potential for rapid and simple protein detection with a variety of aptamers.

  15. Methylsorb: a simple method for quantifying DNA methylation using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Carrascosa, Laura G; Palanisamy, Ramkumar; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-10-21

    The analysis of DNA methylation is becoming increasingly important both in the clinic and also as a research tool to unravel key epigenetic molecular mechanisms in biology. Current methodologies for the quantification of regional DNA methylation (i.e., the average methylation over a region of DNA in the genome) are largely affected by comprehensive DNA sequencing methodologies which tend to be expensive, tedious, and time-consuming for many applications. Herein, we report an alternative DNA methylation detection method referred to as "Methylsorb", which is based on the inherent affinity of DNA bases to the gold surface (i.e., the trend of the affinity interactions is adenine > cytosine ≥ guanine > thymine).1 Since the degree of gold-DNA affinity interaction is highly sequence dependent, it provides a new capability to detect DNA methylation by simply monitoring the relative adsorption of bisulfite treated DNA sequences onto a gold chip. Because the selective physical adsorption of DNA fragments to gold enable a direct read-out of regional DNA methylation, the current requirement for DNA sequencing is obviated. To demonstrate the utility of this method, we present data on the regional methylation status of two CpG clusters located in the EN1 and MIR200B genes in MCF7 and MDA-MB-231 cells. The methylation status of these regions was obtained from the change in relative mass on gold surface with respect to relative adsorption of an unmethylated DNA source and this was detected using surface plasmon resonance (SPR) in a label-free and real-time manner. We anticipate that the simplicity of this method, combined with the high level of accuracy for identifying the methylation status of cytosines in DNA, could find broad application in biology and diagnostics.

  16. Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Haab, B.B.; Mathies, R.A.

    A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

  17. Rapid colorimetric assay for detection of Listeria monocytogenes in food samples using LAMP formation of DNA concatemers and gold nanoparticle-DNA probe complex

    NASA Astrophysics Data System (ADS)

    Wachiralurpan, Sirirat; Sriyapai, Thayat; Areekit, Supatra; Sriyapai, Pichapak; Augkarawaritsawong, Suphitcha; Santiwatanakul, Somchai; Chansiri, Kosum

    2018-04-01

    ABSTRACT Listeria monocytogenes is a major foodborne pathogen of global health concern. Herein, the rapid diagnosis of L. monocytogenes has been achieved using loop-mediated isothermal amplification (LAMP) based on the phosphatidylcholine-phospholipase C gene (plcB). Colorimetric detection was then performed through the formation of DNA concatemers and a gold nanoparticle/DNA probe complex (GNP/DNA probe). The overall detection process was accomplished within approximately 1 h with no need for complicated equipment. The limits of detection for L. monocytogenes in the forms of purified genomic DNA and pure culture were 800 fg and 2.82 CFU mL-1, respectively. No cross reactions were observed from closely related bacteria species. The LAMP-GNP/DNA probe assay was applied to the detection of 200 raw chicken meat samples and compared to routine standard methods. The data revealed that the specificity, sensitivity and accuracy were 100%, 90.20% and 97.50%, respectively. The present assay was 100% in conformity with LAMP-agarose gel electrophoresis assay. Five samples that were negative by both assays appeared to have the pathogen at below the level of detection. The assay can be applied as a rapid direct screening method for L. monocytogenes.

  18. Nucleic acid detection system and method for detecting influenza

    DOEpatents

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  19. Surveying Europe’s Only Cave-Dwelling Chordate Species (Proteus anguinus) Using Environmental DNA

    PubMed Central

    Márton, Orsolya; Schmidt, Benedikt R.; Gál, Júlia Tünde; Jelić, Dušan

    2017-01-01

    In surveillance of subterranean fauna, especially in the case of rare or elusive aquatic species, traditional techniques used for epigean species are often not feasible. We developed a non-invasive survey method based on environmental DNA (eDNA) to detect the presence of the red-listed cave-dwelling amphibian, Proteus anguinus, in the caves of the Dinaric Karst. We tested the method in fifteen caves in Croatia, from which the species was previously recorded or expected to occur. We successfully confirmed the presence of P. anguinus from ten caves and detected the species for the first time in five others. Using a hierarchical occupancy model we compared the availability and detection probability of eDNA of two water sampling methods, filtration and precipitation. The statistical analysis showed that both availability and detection probability depended on the method and estimates for both probabilities were higher using filter samples than for precipitation samples. Combining reliable field and laboratory methods with robust statistical modeling will give the best estimates of species occurrence. PMID:28129383

  20. Self-reference and random sampling approach for label-free identification of DNA composition using plasmonic nanomaterials.

    PubMed

    Freeman, Lindsay M; Pang, Lin; Fainman, Yeshaiahu

    2018-05-09

    The analysis of DNA has led to revolutionary advancements in the fields of medical diagnostics, genomics, prenatal screening, and forensic science, with the global DNA testing market expected to reach revenues of USD 10.04 billion per year by 2020. However, the current methods for DNA analysis remain dependent on the necessity for fluorophores or conjugated proteins, leading to high costs associated with consumable materials and manual labor. Here, we demonstrate a potential label-free DNA composition detection method using surface-enhanced Raman spectroscopy (SERS) in which we identify the composition of cytosine and adenine within single strands of DNA. This approach depends on the fact that there is one phosphate backbone per nucleotide, which we use as a reference to compensate for systematic measurement variations. We utilize plasmonic nanomaterials with random Raman sampling to perform label-free detection of the nucleotide composition within DNA strands, generating a calibration curve from standard samples of DNA and demonstrating the capability of resolving the nucleotide composition. The work represents an innovative way for detection of the DNA composition within DNA strands without the necessity of attached labels, offering a highly sensitive and reproducible method that factors in random sampling to minimize error.

  1. Novel approach for the simultaneous detection of DNA from different fish species based on a nuclear target: quantification potential.

    PubMed

    Prado, Marta; Boix, Ana; von Holst, Christoph

    2012-07-01

    The development of DNA-based methods for the identification and quantification of fish in food and feed samples is frequently focused on a specific fish species and/or on the detection of mitochondrial DNA of fish origin. However, a quantitative method for the most common fish species used by the food and feed industry is needed for official control purposes, and such a method should rely on the use of a single-copy nuclear DNA target owing to its more stable copy number in different tissues. In this article, we report on the development of a real-time PCR method based on the use of a nuclear gene as a target for the simultaneous detection of fish DNA from different species and on the evaluation of its quantification potential. The method was tested in 22 different fish species, including those most commonly used by the food and feed industry, and in negative control samples, which included 15 animal species and nine feed ingredients. The results show that the method reported here complies with the requirements concerning specificity and with the criteria required for real-time PCR methods with high sensitivity.

  2. Novel quantitative real-time LCR for the sensitive detection of SNP frequencies in pooled DNA: method development, evaluation and application.

    PubMed

    Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios

    2011-01-19

    Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.

  3. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  4. Electronic Properties of Synthetic Shrimp Pathogens-derived DNA Schottky Diodes.

    PubMed

    Rizan, Nastaran; Yew, Chan Yen; Niknam, Maryam Rajabpour; Krishnasamy, Jegenathan; Bhassu, Subha; Hong, Goh Zee; Devadas, Sridevi; Din, Mohamed Shariff Mohd; Tajuddin, Hairul Anuar; Othman, Rofina Yasmin; Phang, Siew Moi; Iwamoto, Mitsumasa; Periasamy, Vengadesh

    2018-01-17

    The exciting discovery of the semiconducting-like properties of deoxyribonucleic acid (DNA) and its potential applications in molecular genetics and diagnostics in recent times has resulted in a paradigm shift in biophysics research. Recent studies in our laboratory provide a platform towards detecting charge transfer mechanism and understanding the electronic properties of DNA based on the sequence-specific electronic response, which can be applied as an alternative to identify or detect DNA. In this study, we demonstrate a novel method for identification of DNA from different shrimp viruses and bacteria using electronic properties of DNA obtained from both negative and positive bias regions in current-voltage (I-V) profiles. Characteristic electronic properties were calculated and used for quantification and further understanding in the identification process. Aquaculture in shrimp industry is a fast-growing food sector throughout the world. However, shrimp culture in many Asian countries faced a huge economic loss due to disease outbreaks. Scientists have been using specific established methods for detecting shrimp infection, but those methods do have their significant drawbacks due to many inherent factors. As such, we believe that this simple, rapid, sensitive and cost-effective tool can be used for detection and identification of DNA from different shrimp viruses and bacteria.

  5. Evaluation of DNA extraction methods for PCR-based detection of Listeria monocytogenes from vegetables.

    PubMed

    Vojkovska, H; Kubikova, I; Kralik, P

    2015-03-01

    Epidemiological data indicate that raw vegetables are associated with outbreaks of Listeria monocytogenes. Therefore, there is a demand for the availability of rapid and sensitive methods, such as PCR assays, for the detection and accurate discrimination of L. monocytogenes. However, the efficiency of PCR methods can be negatively affected by inhibitory compounds commonly found in vegetable matrices that may cause false-negative results. Therefore, the sample processing and DNA isolation steps must be carefully evaluated prior to the introduction of such methods into routine practice. In this study, we compared the ability of three column-based and four magnetic bead-based commercial DNA isolation kits to extract DNA of the model micro-organism L. monocytogenes from raw vegetables. The DNA isolation efficiency of all isolation kits was determined using a triplex real-time qPCR assay designed to specifically detect L. monocytogenes. The kit with best performance, the PowerSoil(™) Microbial DNA Isolation Kit, is suitable for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. Coupled with the triplex real-time qPCR assay, this DNA isolation kit is applicable to the samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. Several recent outbreaks of Listeria monocytogenes have been associated with the consumption of fruits and vegetables. Real-time PCR assays allow fast detection and accurate quantification of microbes. However, the success of real-time PCR is dependent on the success with which template DNA can be extracted. The results of this study suggest that the PowerSoil(™) Microbial DNA Isolation Kit can be used for the extraction of amplifiable DNA from L. monocytogenes cells in vegetable with efficiencies ranging between 29.6 and 70.3%. This method is applicable to samples with bacterial loads of 10(3) bacterial cells per gram of L. monocytogenes. © 2014 The Society for Applied Microbiology.

  6. Using occupancy modeling to compare traditional versus DNA metabarcoding methods for characterizing zooplankton biodiversity

    EPA Science Inventory

    DNA metabarcoding tools could increase our ability to detect changes in zooplankton communities and to detect invasive zooplankton taxa while they are still rare. Nonetheless, the use of DNA-metabarcoding for characterizing zooplankton biodiversity in the Great Lakes has not bee...

  7. An accurate algorithm for the detection of DNA fragments from dilution pool sequencing experiments.

    PubMed

    Bansal, Vikas

    2018-01-01

    The short read lengths of current high-throughput sequencing technologies limit the ability to recover long-range haplotype information. Dilution pool methods for preparing DNA sequencing libraries from high molecular weight DNA fragments enable the recovery of long DNA fragments from short sequence reads. These approaches require computational methods for identifying the DNA fragments using aligned sequence reads and assembling the fragments into long haplotypes. Although a number of computational methods have been developed for haplotype assembly, the problem of identifying DNA fragments from dilution pool sequence data has not received much attention. We formulate the problem of detecting DNA fragments from dilution pool sequencing experiments as a genome segmentation problem and develop an algorithm that uses dynamic programming to optimize a likelihood function derived from a generative model for the sequence reads. This algorithm uses an iterative approach to automatically infer the mean background read depth and the number of fragments in each pool. Using simulated data, we demonstrate that our method, FragmentCut, has 25-30% greater sensitivity compared with an HMM based method for fragment detection and can also detect overlapping fragments. On a whole-genome human fosmid pool dataset, the haplotypes assembled using the fragments identified by FragmentCut had greater N50 length, 16.2% lower switch error rate and 35.8% lower mismatch error rate compared with two existing methods. We further demonstrate the greater accuracy of our method using two additional dilution pool datasets. FragmentCut is available from https://bansal-lab.github.io/software/FragmentCut. vibansal@ucsd.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  8. Study of DNA extraction methods for use in loop-mediated isothermal amplification detection of single resting cysts in the toxic dinoflagellates Alexandrium tamarense and A. catenella.

    PubMed

    Nagai, Satoshi; Yamamoto, Keigo; Hata, Naotugu; Itakura, Shigeru

    2012-09-01

    In a previous study, we experienced instable amplification and a low amplification success in loop-mediated isothermal amplification (LAMP) reactions from naturally occurring vegetative cells or resting cysts of the toxic dinoflagellates Alexandrium tamarense and Alexandrium catenella. In this study, we examined 4 methods for extracting DNA from single resting cysts of A. tamarense and A. catenella to obtain more stable and better amplification success and to facilitate unambiguous detection using the LAMP method. Apart from comparing the 4 different DNA extraction methods, namely, (1) boiling in Tris-EDTA (TE) buffer, (2) heating at 65 °C in hexadecyltrimethylammonium bromide buffer, (3) boiling in 0.5% Chelex buffer, and (4) boiling in 5% Chelex buffer, we also examined the need for homogenization to crush the resting cysts before DNA extraction in each method. Homogenization of resting cysts was found to be essential for DNA extraction in all 4 methods. The detection time was significantly shorter in 5% Chelex buffer than in the other buffers and the amplification success was 100% (65/65), indicating the importance of DNA extraction and the effectiveness of 5% Chelex buffer in the Alexandrium LAMP. Copyright © 2012 Elsevier B.V. All rights reserved.

  9. A cascade signal amplification strategy for sensitive and label-free DNA detection based on Exo III-catalyzed recycling coupled with rolling circle amplification.

    PubMed

    Liu, Xingti; Xue, Qingwang; Ding, Yongshun; Zhu, Jing; Wang, Lei; Jiang, Wei

    2014-06-07

    A sensitive and label-free fluorescence assay for DNA detection has been developed based on cascade signal amplification combining exonuclease III (Exo III)-catalyzed recycling with rolling circle amplification. In this assay, probe DNA hybridized with template DNA was coupled onto magnetic nanoparticles to prepare a magnetic bead-probe (MNB-probe)-template complex. The complex could hybridize with the target DNA, which transformed the protruding 3' terminus of template DNA into a blunt end. Exo III could then digest template DNA, liberating the MNB-probe and target DNA. The intact target DNA then hybridized with other templates and released more MNB-probes. The liberated MNB-probe captured the primer, circular DNA and then initiated the rolling circle amplification (RCA) reaction, realizing a cascade signal amplification. Using this cascade amplification strategy, a sensitive DNA detection method was developed which was superior to many existing Exo III-based signal amplification methods. Moreover, N-methyl mesoporphyrin IX, which had a pronounced structural selectivity for the G-quadruplex, was used to combine with the G-quadruplex RCA products and generate a fluorescence signal, avoiding the need for any fluorophore-label probes. The spike and recovery experiments in a human serum sample indicated that our assay also had great potential for DNA detection in real biological samples.

  10. A novel single-stranded DNA detection method based on organic semiconductor heterojunction

    NASA Astrophysics Data System (ADS)

    Gu, Wen; Liu, Hongbo; Zhang, Xia; Zhang, Hao; Chen, Xiong; Wang, Jun

    2016-12-01

    We demonstrate a novel DNA detection method with low-cost and disposable advantages by utilizing F16CuPc/CuPc planar organic heterojunction device. Single-stranded DNA (ssDNA) molecules have been well immobilized on the surface of CuPc film observed by atomic force microscopy, producing an obvious electrical response of the device. The conductivity of the organic heterojunction film was significantly increased by ssDNA immobilization because ssDNA molecules brought additional positive charges at heterojunction interface. Furthermore, the thickness dependence of CuPc upper layer on the electrical response was studied to optimize the sensitivity. This study will be helpful for the development of organic heterojunction based biosensors.

  11. Label-Free Detection of Sequence-Specific DNA Based on Fluorescent Silver Nanoclusters-Assisted Surface Plasmon-Enhanced Energy Transfer.

    PubMed

    Ma, Jin-Liang; Yin, Bin-Cheng; Le, Huynh-Nhu; Ye, Bang-Ce

    2015-06-17

    We have developed a label-free method for sequence-specific DNA detection based on surface plasmon enhanced energy transfer (SPEET) process between fluorescent DNA/AgNC string and gold nanoparticles (AuNPs). DNA/AgNC string, prepared by a single-stranded DNA template encoded two emitter-nucleation sequences at its termini and an oligo spacer in the middle, was rationally designed to produce bright fluorescence emission. The proposed method takes advantage of two strategies. The first one is the difference in binding properties of single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA) toward AuNPs. The second one is SPEET process between fluorescent DNA/AgNC string and AuNPs, in which fluorescent DNA/AgNC string can be spontaneously adsorbed onto the surface of AuNPs and correspondingly AuNPs serve as "nanoquencher" to quench the fluorescence of DNA/AgNC string. In the presence of target DNA, the sensing probe hybridized with target DNA to form duplex DNA, leading to a salt-induced AuNP aggregation and subsequently weakened SPEET process between fluorescent DNA/AgNC string and AuNPs. A red-to-blue color change of AuNPs and a concomitant fluorescence increase were clearly observed in the sensing system, which had a concentration dependent manner with specific DNA. The proposed method achieved a detection limit of ∼2.5 nM, offering the following merits of simple design, convenient operation, and low experimental cost because of no chemical modification, organic dye, enzymatic reaction, or separation procedure involved.

  12. Synthetic oligonucleotide antigens modified with locked nucleic acids detect disease specific antibodies

    NASA Astrophysics Data System (ADS)

    Samuelsen, Simone V.; Solov'Yov, Ilia A.; Balboni, Imelda M.; Mellins, Elizabeth; Nielsen, Christoffer Tandrup; Heegaard, Niels H. H.; Astakhova, Kira

    2016-10-01

    New techniques to detect and quantify antibodies to nucleic acids would provide a significant advance over current methods, which often lack specificity. We investigate the potential of novel antigens containing locked nucleic acids (LNAs) as targets for antibodies. Particularly, employing molecular dynamics we predict optimal nucleotide composition for targeting DNA-binding antibodies. As a proof of concept, we address a problem of detecting anti-DNA antibodies that are characteristic of systemic lupus erythematosus, a chronic autoimmune disease with multiple manifestations. We test the best oligonucleotide binders in surface plasmon resonance studies to analyze binding and kinetic aspects of interactions between antigens and target DNA. These DNA and LNA/DNA sequences showed improved binding in enzyme-linked immunosorbent assay using human samples of pediatric lupus patients. Our results suggest that the novel method is a promising tool to create antigens for research and point-of-care monitoring of anti-DNA antibodies.

  13. Laser desorption mass spectrometry for biomolecule detection and its applications

    NASA Astrophysics Data System (ADS)

    Winston Chen, C. H.; Sammartano, L. J.; Isola, N. R.; Allman, S. L.

    2001-08-01

    During the past few years, we developed and used laser desorption mass spectrometry for biomolecule detections. Matrix-assisted laser desorption/ionization (MALDI) was successfully used to detect DNA fragments with the size larger than 3000 base pairs. It was also successfully used to sequence DNA with both enzymatic and chemical degradation methods to produce DNA ladders. We also developed MALDI with fragmentation for direct DNA sequencing for short DNA probes. Since laser desorption mass spectrometry for DNA detection has the advantages of fast speed and no need of labeling, it has a great potential for molecular diagnosis for disease and person identification by DNA fingerprinting. We applied laser desorption mass spectrometry to succeed in the diagnosis of cystic fibrosis and several other nerve degenerative diseases such as Huntington's disease. We also succeeded in demonstrating DNA typing for forensic applications.

  14. Robust detection of rare species using environmental DNA: The importance of primer specificity

    Treesearch

    Taylor M. Wilcox; Kevin S. McKelvey; Michael K. Young; Stephen F. Jane; Winsor H. Lowe; Andrew R. Whiteley; Michael K. Schwartz

    2013-01-01

    Environmental DNA (eDNA) is being rapidly adopted as a tool to detect rare animals. Quantitative PCR (qPCR) using probebased chemistries may represent a particularly powerful tool because of the method's sensitivity, specificity, and potential to quantify target DNA. However, there has been little work understanding the performance of these assays in the presence...

  15. The Rapid-Heat LAMPellet Method: A Potential Diagnostic Method for Human Urogenital Schistosomiasis

    PubMed Central

    Carranza-Rodríguez, Cristina; Pérez-Arellano, José Luis; Vicente, Belén; López-Abán, Julio; Muro, Antonio

    2015-01-01

    Background Urogenital schistosomiasis due to Schistosoma haematobium is a serious underestimated public health problem affecting 112 million people - particularly in sub-Saharan Africa. Microscopic examination of urine samples to detect parasite eggs still remains as definitive diagnosis. This work was focussed on developing a novel loop-mediated isothermal amplification (LAMP) assay for detection of S. haematobium DNA in human urine samples as a high-throughput, simple, accurate and affordable diagnostic tool to use in diagnosis of urogenital schistosomiasis. Methodology/Principal Findings A LAMP assay targeting a species specific sequence of S. haematobium ribosomal intergenic spacer was designed. The effectiveness of our LAMP was assessed in a number of patients´ urine samples with microscopy confirmed S. haematobium infection. For potentially large-scale application in field conditions, different DNA extraction methods, including a commercial kit, a modified NaOH extraction method and a rapid heating method were tested using small volumes of urine fractions (whole urine, supernatants and pellets). The heating of pellets from clinical samples was the most efficient method to obtain good-quality DNA detectable by LAMP. The detection limit of our LAMP was 1 fg/µL of S. haematobium DNA in urine samples. When testing all patients´ urine samples included in our study, diagnostic parameters for sensitivity and specificity were calculated for LAMP assay, 100% sensitivity (95% CI: 81.32%-100%) and 86.67% specificity (95% CI: 75.40%-94.05%), and also for microscopy detection of eggs in urine samples, 69.23% sensitivity (95% CI: 48.21% -85.63%) and 100% specificity (95% CI: 93.08%-100%). Conclusions/Significance We have developed and evaluated, for the first time, a LAMP assay for detection of S. haematobium DNA in heated pellets from patients´ urine samples using no complicated requirement procedure for DNA extraction. The procedure has been named the Rapid-Heat LAMPellet method and has the potential to be developed further as a field diagnostic tool for use in urogenital schistosomiasis-endemic areas. PMID:26230990

  16. Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA

    USGS Publications Warehouse

    Hunter, Margaret; Dorazio, Robert M.; Butterfield, John S.; Meigs-Friend, Gaia; Nico, Leo; Ferrante, Jason A.

    2017-01-01

    A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species’ presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty – indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis, and forensic and clinical diagnostics.

  17. Evaluation of a Freezer Mill for Bone Pulverization prior to DNA Extraction: An Improved Workflow for STR Analysis.

    PubMed

    Morales Colón, Emely; Hernández, Mireya; Candelario, Mariel; Meléndez, María; Dawson Cruz, Tracey

    2018-03-01

    Traditional methods for bone pulverization typically generate heat, risking stability of DNA sample. SPEX™ has developed cryogenic grinders which introduce liquid nitrogen to cool the sample and aid in the grinding process. In this study, the Freezer Mill 6970 EFM was used with two DNA extraction methods and routine downstream STR analysis procedures. DNA from as little as 0.1 g of bone powder was used to develop full STR profiles after freezer mill pulverization, and the method was reproducible. Further, no contamination was detected upon cleaning/reuse of the sample vials. There were no significant differences in DNA yield, STR alleles detected, or peak heights using the freezer mill as compared to traditional grinding, and successful DNA profiles were achieved from as low as 0.1 g of bone powder with this method. Overall, this work indicates that this cryogenic mill method may be used as a viable alternative to traditional tissue grinders. © 2017 American Academy of Forensic Sciences.

  18. Photocleavable DNA barcode-antibody conjugates allow sensitive and multiplexed protein analysis in single cells.

    PubMed

    Agasti, Sarit S; Liong, Monty; Peterson, Vanessa M; Lee, Hakho; Weissleder, Ralph

    2012-11-14

    DNA barcoding is an attractive technology, as it allows sensitive and multiplexed target analysis. However, DNA barcoding of cellular proteins remains challenging, primarily because barcode amplification and readout techniques are often incompatible with the cellular microenvironment. Here we describe the development and validation of a photocleavable DNA barcode-antibody conjugate method for rapid, quantitative, and multiplexed detection of proteins in single live cells. Following target binding, this method allows DNA barcodes to be photoreleased in solution, enabling easy isolation, amplification, and readout. As a proof of principle, we demonstrate sensitive and multiplexed detection of protein biomarkers in a variety of cancer cells.

  19. A Versatile Nanowire Platform for Highly Efficient Isolation and Direct PCR-free Colorimetric Detection of Human Papillomavirus DNA from Unprocessed Urine

    PubMed Central

    Lee, HyungJae; Choi, Mihye; Hwang, Sang-Hyun; Cho, Youngnam

    2018-01-01

    Purpose: As human papillomavirus (HPV) is primarily responsible for the development of cervical cancer, significant efforts have been devoted to develop novel strategies for detecting and identifying HPV DNA in urine. The analysis of target DNA sequences in urine offers a potential alternative to conventional methods as a non-invasive clinical screening and diagnostic assessment tool for the detection of HPV. However, the lack of efficient approaches to isolate and directly detect HPV DNA in urine has restricted its potential clinical use. In this study, we demonstrated a novel approach of using polyethylenimine-conjugated magnetic polypyrrole nanowires (PEI-mPpy NWs) for the extraction, identification, and PCR-free colorimetric detection of high-risk strains of HPV DNA sequences, particularly HPV-16 and HPV-18, in urine specimens of cervical cancer patients. Materials and Methods: We fabricated and characterized polyethylenimine-conjugated magnetic nanowires (PEI/mPpy NWs). PEI/mPpy NWs-based HPV DNA isolation and detection strategy appears to be a cost-effective and practical technology with greater sensitivity and accuracy than other urine-based methods. Results: The analytical and clinical performance of PEI-mPpy NWs was evaluated and compared with those of cervical swabs, demonstrating a superior type-specific concordance rate of 100% between urine and cervical swabs, even when using a small volume of urine (300 µL). Conclusion: We envision that PEI-mPpy NWs provide substantive evidence for clinical diagnosis and management of HPV-associated disease with their excellent performance in the recovery and detection of HPV DNA from minimal amounts of urine samples. PMID:29290816

  20. Development of a PCR/LDR/flow-through hybridization assay using a capillary tube, probe DNA-immobilized magnetic beads and chemiluminescence detection.

    PubMed

    Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko

    2013-01-01

    A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.

  1. Electrochemical detection of DNA damage induced by acrylamide and its metabolite at the graphene-ionic liquid-Nafion modified pyrolytic graphite electrode.

    PubMed

    Qiu, Yanyan; Qu, Xiangjin; Dong, Jing; Ai, Shiyun; Han, Ruixia

    2011-06-15

    A new electrochemical biosensor for directly detecting DNA damage induced by acrylamide (AA) and its metabolite was presented in this work. The graphene-ionic liquid-Nafion modified pyrolytic graphite electrode (PGE) was prepared, and then horseradish peroxidase (HRP) and natural double-stranded DNA were alternately assembled on the modified electrode by the layer-by-layer method. The PGE/graphene-ionic liquid-Nafion and the construction of the (HRP/DNA)(n) film were characterized by electrochemical impedance spectroscopy. With the guanine signal in DNA as an indicator, the damage of DNA was detected by differential pulse voltammetry after PGE/graphene-ionic liquid-Nafion/(HRP/DNA)(n) was incubated in AA solution or AA+H(2)O(2) solution at 37°C. This method provides a new model to mimic and directly detect DNA damage induced by chemical pollutants and their metabolites in vitro. The results indicated that, in the presence of H(2)O(2), HRP was activated and catalyzed the transformation of AA to glycidamide, which could form DNA adducts and induce more serious damage of DNA than AA. In order to further verify these results, UV-vis spectrophotometry was also used to investigate DNA damage induced by AA and its metabolites in solution and the similar results were obtained. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. eMethylsorb: electrochemical quantification of DNA methylation at CpG resolution using DNA-gold affinity interactions.

    PubMed

    Sina, Abu Ali Ibn; Howell, Sidney; Carrascosa, Laura G; Rauf, Sakandar; Shiddiky, Muhammad J A; Trau, Matt

    2014-11-07

    We report a simple electrochemical method referred to as "eMethylsorb" for the detection of DNA methylation. The method relies on the base dependent affinity interaction of DNA with gold. The methylation status of DNA is quantified by monitoring the electrochemical current as a function of the relative adsorption level of bisulphite treated DNA samples onto a bare gold electrode. This method can successfully distinguish methylated and unmethylated epigenotypes at single CpG resolution.

  3. Construction and Evaluation of Internal Control DNA for PCR Amplification of Chlamydia trachomatis DNA from Urine Samples

    PubMed Central

    Betsou, Fotini; Beaumont, Katy; Sueur, Jean Marie; Orfila, Jeanne

    2003-01-01

    An internal control DNA (ICD) with the same primer binding sequences as the target Chlamydia trachomatis DNA was constructed and evaluated in a PCR assay with immunoenzymatic detection. One hundred urine specimens were tested, and 23 were found to contain inhibitors of the PCR, if not subjected to DNA extraction prior to amplification. Coamplification and detection of the ICD appeared to be a useful method for estimating the effects of inhibitors on C. trachomatis DNA amplification. PMID:12624066

  4. DNA Clutch Probes for Circulating Tumor DNA Analysis.

    PubMed

    Das, Jagotamoy; Ivanov, Ivaylo; Sargent, Edward H; Kelley, Shana O

    2016-08-31

    Progress toward the development of minimally invasive liquid biopsies of disease is being bolstered by breakthroughs in the analysis of circulating tumor DNA (ctDNA): DNA released from cancer cells into the bloodstream. However, robust, sensitive, and specific methods of detecting this emerging analyte are lacking. ctDNA analysis has unique challenges, since it is imperative to distinguish circulating DNA from normal cells vs mutation-bearing sequences originating from tumors. Here we report the electrochemical detection of mutated ctDNA in samples collected from cancer patients. By developing a strategy relying on the use of DNA clutch probes (DCPs) that render specific sequences of ctDNA accessible, we were able to readout the presence of mutated ctDNA. DCPs prevent reassociation of denatured DNA strands: they make one of the two strands of a dsDNA accessible for hybridization to a probe, and they also deactivate other closely related sequences in solution. DCPs ensure thereby that only mutated sequences associate with chip-based sensors detecting hybridization events. The assay exhibits excellent sensitivity and specificity in the detection of mutated ctDNA: it detects 1 fg/μL of a target mutation in the presence of 100 pg/μL of wild-type DNA, corresponding to detecting mutations at a level of 0.01% relative to wild type. This approach allows accurate analysis of samples collected from lung cancer and melanoma patients. This work represents the first detection of ctDNA without enzymatic amplification.

  5. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  6. A novel single-cell method provides direct evidence of persistent DNA damage in senescent cells and aged mammalian tissues.

    PubMed

    Galbiati, Alessandro; Beauséjour, Christian; d'Adda di Fagagna, Fabrizio

    2017-04-01

    The DNA damage response (DDR) arrests cell cycle progression until DNA lesions, like DNA double-strand breaks (DSBs), are repaired. The presence of DSBs in cells is usually detected by indirect techniques that rely on the accumulation of proteins at DSBs, as part of the DDR. Such detection may be biased, as some factors and their modifications may not reflect physical DNA damage. The dependency on DDR markers of DSB detection tools has left questions unanswered. In particular, it is known that senescent cells display persistent DDR foci, that we and others have proposed to be persistent DSBs, resistant to endogenous DNA repair activities. Others have proposed that these peculiar DDR foci might not be sites of damaged DNA per se but instead stable chromatin modifications, termed DNA-SCARS. Here, we developed a method, named 'DNA damage in situ ligation followed by proximity ligation assay' (DI-PLA) for the detection and imaging of DSBs in cells. DI-PLA is based on the capture of free DNA ends in fixed cells in situ, by ligation to biotinylated double-stranded DNA oligonucleotides, which are next recognized by antibiotin anti-bodies. Detection is enhanced by PLA with a partner DDR marker at the DSB. We validated DI-PLA by demonstrating its ability to detect DSBs induced by various genotoxic insults in cultured cells and tissues. Most importantly, by DI-PLA, we demonstrated that both senescent cells in culture and tissues from aged mammals retain true unrepaired DSBs associated with DDR markers. © 2017 The Authors. Aging Cell published by the Anatomical Society and John Wiley & Sons Ltd.

  7. Spectroscopic quantification of 5-hydroxymethylcytosine in genomic DNA using boric acid-functionalized nano-microsphere fluorescent probes.

    PubMed

    Chen, Hua-Yan; Wei, Jing-Ru; Pan, Jiong-Xiu; Zhang, Wei; Dang, Fu-Quan; Zhang, Zhi-Qi; Zhang, Jing

    2017-05-15

    5-hydroxymethylcytosine (5hmC) is the sixth base of DNA. It is involved in active DNA demethylation and can be a marker of diseases such as cancer. In this study, we developed a simple and sensitive 2-(4-boronophenyl)quinoline-4-carboxylic acid modified poly (glycidyl methacrylate (PBAQA-PGMA) fluorescent probe to detect the 5hmC content of genomic DNA based on T4 β-glucosyltransferase-catalyzed glucosylation of 5hmC. The fluorescence-enhanced intensity recorded from the DNA sample was proportional to its 5-hydroxymethylcytosine content and could be quantified by fluorescence spectrophotometry. The developed probe showed good detection sensitivity and selectivity and a good linear relationship between the fluorescence intensity and the concentration of 5 hmC within a 0-100nM range. Compared with other fluorescence detection methods, this method not only could determine trace amounts of 5 hmC from genomic DNA but also could eliminate the interference of fluorescent dyes and the need for purification. It also could avoid multiple labeling. Because the PBAQA-PGMA probe could enrich the content of glycosyl-5-hydroxymethyl-2-deoxycytidine from a complex ground substance, it will broaden the linear detection range and improve sensitivity. The limit of detection was calculated to be 0.167nM after enrichment. Furthermore, the method was successfully used to detect 5-hydroxymethylcytosine from mouse tissues. Copyright © 2016 Elsevier B.V. All rights reserved.

  8. Electrochemical Aptamer Scaffold Biosensors for Detection of Botulism and Ricin Proteins.

    PubMed

    Daniel, Jessica; Fetter, Lisa; Jett, Susan; Rowland, Teisha J; Bonham, Andrew J

    2017-01-01

    Electrochemical DNA (E-DNA) biosensors enable the detection and quantification of a variety of molecular targets, including oligonucleotides, small molecules, heavy metals, antibodies, and proteins. Here we describe the design, electrode preparation and sensor attachment, and voltammetry conditions needed to generate and perform measurements using E-DNA biosensors against two protein targets, the biological toxins ricin and botulinum neurotoxin. This method can be applied to generate E-DNA biosensors for the detection of many other protein targets, with potential advantages over other systems including sensitive detection limits typically in the nanomolar range, real-time monitoring, and reusable biosensors.

  9. Ultrasensitive electrochemical biosensor for detection of DNA from Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification.

    PubMed

    Hu, Yuhua; Xu, Xueqin; Liu, Qionghua; Wang, Ling; Lin, Zhenyu; Chen, Guonan

    2014-09-02

    A simple, ultrasensitive, and specific electrochemical biosensor was designed to determine the given DNA sequence of Bacillus subtilis by coupling target-induced strand displacement and nicking endonuclease signal amplification. The target DNA (TD, the DNA sequence from the hypervarient region of 16S rDNA of Bacillus subtilis) could be detected by the differential pulse voltammetry (DPV) in a range from 0.1 fM to 20 fM with the detection limit down to 0.08 fM at the 3s(blank) level. This electrochemical biosensor exhibits high distinction ability to single-base mismatch, double-bases mismatch, and noncomplementary DNA sequence, which may be expected to detect single-base mismatch and single nucleotide polymorphisms (SNPs). Moreover, the applicability of the designed biosensor for detecting the given DNA sequence from Bacillus subtilis was investigated. The result obtained by electrochemical method is approximately consistent with that by a real-time quantitative polymerase chain reaction detecting system (QPCR) with SYBR Green.

  10. A new s-adenosylhomocysteine hydrolase-linked method for adenosine detection based on DNA-templated fluorescent Cu/Ag nanoclusters.

    PubMed

    Ahn, Jun Ki; Kim, Hyo Yong; Baek, Songyi; Park, Hyun Gyu

    2017-07-15

    We herein describe a novel fluorescent method for the rapid and selective detection of adenosine by utilizing DNA-templated Cu/Ag nanoclusters (NCs) and employing s-adenosylhomocysteine hydrolase (SAHH). SAHH is allowed to promote hydrolysis reaction of s-adenosylhomocysteine (SAH) and consequently produces homocysteine, which would quench the fluorescence signal from DNA-templated Cu/Ag nanoclusters employed as a signaling probe in this study. On the other hand, adenosine significantly inhibits the hydrolysis reaction and prevent the formation of homocysteine. Consequently, highly enhanced fluorescence signal from DNA-Cu/Ag NCs is retained, which could be used to identify the presence of adenosine. By employing this design principle, adenosine was sensitively detected down to 19nM with high specificity over other adenosine analogs such as AMP, ADP, ATP, cAMP, guanosine, cytidine, and urine. Finally, the diagnostic capability of this method was successfully verified by reliably detecting adenosine present in a real human serum sample. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Fluorescence turn-on detection of target sequence DNA based on silicon nanodot-mediated quenching.

    PubMed

    Zhang, Yanan; Ning, Xinping; Mao, Guobin; Ji, Xinghu; He, Zhike

    2018-05-01

    We have developed a new enzyme-free method for target sequence DNA detection based on the dynamic quenching of fluorescent silicon nanodots (SiNDs) toward Cy5-tagged DNA probe. Fascinatingly, the water-soluble SiNDs can quench the fluorescence of cyanine (Cy5) in Cy5-tagged DNA probe in homogeneous solution, and the fluorescence of Cy5-tagged DNA probe can be restored in the presence of target sequence DNA (the synthetic target miRNA-27a). Based on this phenomenon, a SiND-featured fluorescent sensor has been constructed for "turn-on" detection of the synthetic target miRNA-27a for the first time. This newly developed approach possesses the merits of low cost, simple design, and convenient operation since no enzymatic reaction, toxic reagents, or separation procedures are involved. The established method achieves a detection limit of 0.16 nM, and the relative standard deviation of this method is 9% (1 nM, n = 5). The linear range is 0.5-20 nM, and the recoveries in spiked human fluids are in the range of 90-122%. This protocol provides a new tactic in the development of the nonenzymic miRNA biosensors and opens a promising avenue for early diagnosis of miRNA-associated disease. Graphical abstract The SiND-based fluorescent sensor for detection of S-miR-27a.

  12. Is "dried stool spots on filter paper method (DSSFP)" more sensitive and effective for detecting Blastocystis spp. and their subtypes by PCR and sequencing?

    PubMed

    Seyer, Ayse; Karasartova, Djursun; Ruh, Emrah; Güreser, Ayse Semra; Imir, Turgut; Taylan-Ozkan, Aysegul

    2016-12-01

    PCR and DNA sequencing are currently the diagnostic methods of choice for detection of Blastocystis spp. and their suptypes. Fresh or frozen stool samples have disadvantages in terms of several aspects such as transportation, storage, and existence of PCR inhibitors. Filter paper technology may provide a solution to these issues. The aim of the present study was to detect Blastocystis spp. and their subtypes by employing two different preservation methods: conventional frozen stool (FS) and dried stool spots on filter paper (DSSFP). Concentration and purity of DNA, sensitivity of PCR, and DNA sequencing results obtained from the two methods were also compared. A total of 230 fecal samples were included and separated into two parts: one part of the fecal samples were directly frozen and stored at -20 °C. The remaining portion of the specimens were homogenized with saline and spread onto the filter papers as thin layer with a diameter of approximately 3 cm. After air-dried, the filter papers were stored at room temperature. DSSFP samples were collected by scraping from the filter papers. DNA were extracted by EURx Stool DNA Extraction Kit from both samples. Concentration and purity were measured with Nano-Drop, then PCR and sequencing were conducted for detection of Blastocystis spp. and its genotypes. Pure DNA was obtained with a A260/A280 ratio of 1.7-2.2 in both methods. DNA yield from FS was 25-405 ng/μl and average DNA concentration was 151 ng/μl, while these were 7-339 and 122 ng/μl for DSSFP, respectively. No PCR inhibition was observed in two methods. DNA from DSSFP were found to be stable and PCR were reproducible for at least 1 year. FS-PCR- and DSSFP-PCR-positive samples were 49 (21.3 %) and 58 (25.3 %), respectively (p = 0.078). The 43 specimens were concordantly positive by both FS-PCR and DSSFP-PCR. When the microscopy was taken as the gold standard, sensitivity of DSSFP-PCR and FS-PCR was 95.5 and 86.4 %, while specificity of both tests was 99.4 and 98.3 %, respectively. DNA sequencing results of 19 microscopically confirmed cases were strictly identical (concordance 100 %) in both methods, and ST2:6, ST3:8, ST4:3, and ST6:2 were the detected subtypes. Among the 230 fecal samples, the most predominant subtypes were ST3, ST2, ST4, and ST1 by both FS and DSSFP methods. Concordance of DNA sequencing results obtained from the two methods was noted to be 90.7 %. To our knowledge, this is the first study that demonstrates DNA extraction from DSSFP is more sensitive and effective than the FS method for diagnosis of Blastocystis spp. and their subtypes by PCR and DNA sequencing.

  13. A method for release and multiple strand amplification of small quantities of DNA from endospores of the fastidious bacterium Pasteuria penetrans.

    PubMed

    Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R

    2010-05-01

    To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.

  14. Detection of DNA–protein crosslinks (DPCs) by novel direct fluorescence labeling methods: distinct stabilities of aldehyde and radiation-induced DPCs

    PubMed Central

    Shoulkamy, Mahmoud I.; Nakano, Toshiaki; Ohshima, Makiko; Hirayama, Ryoichi; Uzawa, Akiko; Furusawa, Yoshiya; Ide, Hiroshi

    2012-01-01

    Proteins are covalently trapped on DNA to form DNA–protein crosslinks (DPCs) when cells are exposed to DNA-damaging agents. DPCs interfere with many aspects of DNA transactions. The current DPC detection methods indirectly measure crosslinked proteins (CLPs) through DNA tethered to proteins. However, a major drawback of such methods is the non-linear relationship between the amounts of DNA and CLPs, which makes quantitative data interpretation difficult. Here we developed novel methods of DPC detection based on direct CLP measurement, whereby CLPs in DNA isolated from cells are labeled with fluorescein isothiocyanate (FITC) and quantified by fluorometry or western blotting using anti-FITC antibodies. Both formats successfully monitored the induction and elimination of DPCs in cultured cells exposed to aldehydes and mouse tumors exposed to ionizing radiation (carbon-ion beams). The fluorometric and western blotting formats require 30 and 0.3 μg of DNA, respectively. Analyses of the isolated genomic DPCs revealed that both aldehydes and ionizing radiation produce two types of DPC with distinct stabilities. The stable components of aldehyde-induced DPCs have half-lives of up to days. Interestingly, that of radiation-induced DPCs has an infinite half-life, suggesting that the stable DPC component exerts a profound effect on DNA transactions over many cell cycles. PMID:22730301

  15. Efficacy of the detection of Legionella in hot and cold water samples by culture and PCR. I. Standardization of methods.

    PubMed

    Wójcik-Fatla, Angelina; Stojek, Nimfa Maria; Dutkiewicz, Jacek

    2012-01-01

    The aim of the present study was: - to compare methods for concentration and isolation of Legionella DNA from water; - to examine the efficacy of various modifications of PCR test (PCR, semi-nested PCR, and real-time PCR) for the detection of known numbers of Legionella pneumophila in water samples artificially contaminated with the strain of this bacterium and in randomly selected samples of environmental water, in parallel with examination by culture. It was found that filtration is much more effective than centrifugation for the concentration of DNA in water samples, and that the Qiamp DNA Mini-Kit is the most efficient for isolation of Legionella DNA from water. The semi-nested PCR and real-time PCR proved to be the most sensitive methods for detection of Legionella DNA in water samples. Both PCR modifications showed a high correlation with recovery of Legionella by culture (p<0.01), while no correlation occurred between the results of one-stage PCR and culture (p>0.1).

  16. Development of a polymerase chain reaction-based assay for the detection of Alternaria fungal contamination in food products.

    PubMed

    Zur, G; Hallerman, E M; Sharf, R; Kashi, Y

    1999-10-01

    Alternaria sp. are important fungal contaminants of vegetable, fruit, and grain products, including Alternaria alternata, a contaminant of tomato products. To date, the Howard method, based on microscopic observation of fungal filaments, has been the standard examination for inspection of tomato products. We report development of a polymerase chain reaction (PCR)-based method for detection of Alternaria DNA. PCR primers were designed to anneal to the internal transcribed regions ITS1 and ITS2 of the 5.8S rRNA gene of Alternaria but not to other microbial or tomato DNA. We demonstrate use of the PCR assay to detect Alternaria DNA in experimentally infested and commercially obtained tomato sauce and tomato powder. Use of the PCR method offers a rapid and sensitive assay for the presence of Alternaria DNA in tomato products. The apparent breakdown of DNA in tomato sauce may limit the utility of the assay to freshly prepared products. The assay for tomato powder is not affected by storage time.

  17. Visual and highly sensitive detection of cancer cells by a colorimetric aptasensor based on cell-triggered cyclic enzymatic signal amplification.

    PubMed

    Zhang, Xianxia; Xiao, Kunyi; Cheng, Liwei; Chen, Hui; Liu, Baohong; Zhang, Song; Kong, Jilie

    2014-06-03

    Rapid and efficient detection of cancer cells at their earliest stages is one of the central challenges in cancer diagnostics. We developed a simple, cost-effective, and highly sensitive colorimetric method for visually detecting rare cancer cells based on cell-triggered cyclic enzymatic signal amplification (CTCESA). In the absence of target cells, hairpin aptamer probes (HAPs) and linker DNAs stably coexist in solution, and the linker DNA assembles DNA-AuNPs, producing a purple solution. In the presence of target cells, the specific binding of HAPs to the target cells triggers a conformational switch that results in linker DNA hybridization and cleavage by nicking endonuclease-strand scission cycles. Consequently, the cleaved fragments of linker DNA can no longer assemble into DNA-AuNPs, resulting in a red color. UV-vis spectrometry and photograph analyses demonstrated that this CTCESA-based method exhibited selective and sensitive colorimetric responses to the presence of target CCRF-CEM cells, which could be detected by the naked eye. The linear response for CCRF-CEM cells in a concentration range from 10(2) to 10(4) cells was obtained with a detection limit of 40 cells, which is approximately 20 times lower than the detection limit of normal AuNP-based methods without amplification. Given the high specificity and sensitivity of CTCESA, this colorimetric method provides a sensitive, label-free, and cost-effective approach for early cancer diagnosis and point-to-care applications.

  18. Nested PCR detection of malaria directly using blood filter paper samples from epidemiological surveys.

    PubMed

    Li, Peipei; Zhao, Zhenjun; Wang, Ying; Xing, Hua; Parker, Daniel M; Yang, Zhaoqing; Baum, Elizabeth; Li, Wenli; Sattabongkot, Jetsumon; Sirichaisinthop, Jeeraphat; Li, Shuying; Yan, Guiyun; Cui, Liwang; Fan, Qi

    2014-05-08

    Nested PCR is considered a sensitive and specific method for detecting malaria parasites and is especially useful in epidemiological surveys. However, the preparation of DNA templates for PCR is often time-consuming and costly. A simplified PCR method was developed to directly use a small blood filter paper square (2 × 2 mm) as the DNA template after treatment with saponin. This filter paper-based nested PCR method (FP-PCR) was compared to microscopy and standard nested PCR with DNA extracted by using a Qiagen DNA mini kit from filter paper blood spots of 204 febrile cases. The FP-PCR technique was further applied to evaluate malaria infections in 1,708 participants from cross-sectional epidemiological surveys conducted in Myanmar and Thailand. The FP-PCR method had a detection limit of ~0.2 parasites/μL blood, estimated using cultured Plasmodium falciparum parasites. With 204 field samples, the sensitivity of the FP-PCR method was comparable to that of the standard nested PCR method, which was significantly higher than that of microscopy. Application of the FP-PCR method in large cross-sectional studies conducted in Myanmar and Thailand detected 1.9% (12/638) and 6.2% (66/1,070) asymptomatic Plasmodium infections, respectively, as compared to the detection rates of 1.3% (8/638) and 0.04% (4/1,070) by microscopy. This FP-PCR method was much more sensitive than microscopy in detecting Plasmodium infections. It drastically increased the detection sensitivity of asymptomatic infections in cross-sectional surveys conducted in Thailand and Myanmar, suggesting that this FP-PCR method has a potential for future applications in malaria epidemiology studies.

  19. A Novel Computational Method to Reduce Leaky Reaction in DNA Strand Displacement

    PubMed Central

    Li, Xin; Wang, Xun; Song, Tao; Lu, Wei; Chen, Zhihua; Shi, Xiaolong

    2015-01-01

    DNA strand displacement technique is widely used in DNA programming, DNA biosensors, and gene analysis. In DNA strand displacement, leaky reactions can cause DNA signals decay and detecting DNA signals fails. The mostly used method to avoid leakage is cleaning up after upstream leaky reactions, and it remains a challenge to develop reliable DNA strand displacement technique with low leakage. In this work, we address the challenge by experimentally evaluating the basic factors, including reaction time, ratio of reactants, and ion concentration to the leakage in DNA strand displacement. Specifically, fluorescent probes and a hairpin structure reporting DNA strand are designed to detect the output of DNA strand displacement, and thus can evaluate the leakage of DNA strand displacement reactions with different reaction time, ratios of reactants, and ion concentrations. From the obtained data, mathematical models for evaluating leakage are achieved by curve derivation. As a result, it is obtained that long time incubation, high concentration of fuel strand, and inappropriate amount of ion concentration can weaken leaky reactions. This contributes to a method to set proper reaction conditions to reduce leakage in DNA strand displacement. PMID:26491602

  20. Transport Distance of Invertebrate Environmental DNA in a Natural River

    PubMed Central

    Deiner, Kristy; Altermatt, Florian

    2014-01-01

    Environmental DNA (eDNA) monitoring is a novel molecular technique to detect species in natural habitats. Many eDNA studies in aquatic systems have focused on lake or ponds, and/or on large vertebrate species, but applications to invertebrates in river systems are emerging. A challenge in applying eDNA monitoring in flowing waters is that a species' DNA can be transported downstream. Whether and how far eDNA can be detected due to downstream transport remains largely unknown. In this study we tested for downstream detection of eDNA for two invertebrate species, Daphnia longispina and Unio tumidus, which are lake dwelling species in our study area. The goal was to determine how far away from the source population in a lake their eDNA could be detected in an outflowing river. We sampled water from eleven river sites in regular intervals up to 12.3 km downstream of the lake, developed new eDNA probes for both species, and used a standard PCR and Sanger sequencing detection method to confirm presence of each species' eDNA in the river. We detected D. longispina at all locations and across two time points (July and October); whereas with U. tumidus, we observed a decreased detection rate and did not detect its eDNA after 9.1 km. We also observed a difference in detection for this species at different times of year. The observed movement of eDNA from the source amounting to nearly 10 km for these species indicates that the resolution of an eDNA sample can be large in river systems. Our results indicate that there may be species' specific transport distances for eDNA and demonstrate for the first time that invertebrate eDNA can persist over relatively large distances in a natural river system. PMID:24523940

  1. Environmental DNA (eDNA): A tool for quantifying the abundant but elusive round goby (Neogobius melanostomus)

    USGS Publications Warehouse

    Nevers, Meredith; Byappanahalli, Muruleedhara; Morris, Charles C.; Shively, Dawn; Przybyla-Kelly, Katarzyna; Spoljaric, Ashley M.; Dickey, Joshua; Roseman, Edward

    2018-01-01

    Environmental DNA (eDNA) is revolutionizing biodiversity monitoring, occupancy estimates, and real-time detections of invasive species. In the Great Lakes, the round goby (Neogobius melanostomus), an invasive benthic fish from the Black Sea, has spread to encompass all five lakes and many tributaries, outcompeting or consuming native species; however, estimates of round goby abundance are confounded by behavior and habitat preference, which impact reliable methods for estimating their population. By integrating eDNA into round goby monitoring, improved estimates of biomass may be obtainable. We conducted mesocosm experiments to estimate rates of goby DNA shedding and decay. Further, we compared eDNA with several methods of traditional field sampling to compare its use as an alternative/complementary monitoring method. Environmental DNA decay was comparable to other fish species, and first-order decay was lower at 12°C (k = 0.043) than at 19°C (k = 0.058). Round goby eDNA was routinely detected in known invaded sites of Lake Michigan and its tributaries (range log10 4.8–6.2 CN/L), but not upstream of an artificial fish barrier. Traditional techniques (mark-recapture, seining, trapping) in Lakes Michigan and Huron resulted in fewer, more variable detections than eDNA, but trapping and eDNA were correlated (Pearson R = 0.87). Additional field testing will help correlate round goby abundance with eDNA, providing insight on its role as a prey fish and its impact on food webs.

  2. Analysis of 4-hydroxy-1-(-3-pyridyl)-1-butanone (HPB)-releasing DNA adducts in human exfoliated oral mucosa cells by liquid chromatography-electrospray ionization-tandem mass spectrometry

    PubMed Central

    Stepanov, Irina; Muzic, John; Le, Chap T.; Sebero, Erin; Villalta, Peter; Ma, Bin; Jensen, Joni; Hatsukami, Dorothy; Hecht, Stephen S.

    2013-01-01

    Quantitation of DNA adducts could provide critical information on the relationship between exposure to tobacco smoke and cancer risk in smokers. In this study, we developed a robust and sensitive liquid chromatography-tandem mass spectrometry method for the analysis of 4-hydroxy-1-(3-pyridyl)-1-butanone (HPB1)-releasing DNA adducts in human oral cells, a non-invasive source of DNA for biomarker studies. Isolated DNA undergoes acid hydrolysis, after which samples are purified by solid-phase extraction and analyzed by LC-ESI-MS/MS. The developed method was applied for analysis of samples obtained via collection with a commercial mouthwash from 30 smokers and 15 nonsmokers. In smokers, the levels of HPB-releasing DNA adducts averaged 12.0 pmol HPB/mg DNA (detected in 20 out of 28 samples with quantifiable DNA yield) and in nonsmokers, the levels of adducts averaged 0.23 pmol/mg DNA (detected in 3 out of 15 samples). For the 30 smoking subjects, matching buccal brushings were also analyzed and HPB-releasing DNA adducts were detected in 24 out of 27 samples with quantifiable DNA yield, averaging 44.7 pmol HPB/mg DNA. The levels of adducts in buccal brushings correlated with those in mouthwash samples of smokers (R = 0.73, p < 0.0001). Potentially the method can be applied in studies of individual susceptibility to tobacco-induced cancers in humans. PMID:23252610

  3. Environmental DNA (eDNA): A tool for quantifying the abundant but elusive round goby (Neogobius melanostomus)

    PubMed Central

    Byappanahalli, Murulee N.; Morris, Charles C.; Shively, Dawn; Przybyla-Kelly, Kasia; Spoljaric, Ashley M.; Dickey, Joshua; Roseman, Edward F.

    2018-01-01

    Environmental DNA (eDNA) is revolutionizing biodiversity monitoring, occupancy estimates, and real-time detections of invasive species. In the Great Lakes, the round goby (Neogobius melanostomus), an invasive benthic fish from the Black Sea, has spread to encompass all five lakes and many tributaries, outcompeting or consuming native species; however, estimates of round goby abundance are confounded by behavior and habitat preference, which impact reliable methods for estimating their population. By integrating eDNA into round goby monitoring, improved estimates of biomass may be obtainable. We conducted mesocosm experiments to estimate rates of goby DNA shedding and decay. Further, we compared eDNA with several methods of traditional field sampling to compare its use as an alternative/complementary monitoring method. Environmental DNA decay was comparable to other fish species, and first-order decay was lower at 12°C (k = 0.043) than at 19°C (k = 0.058). Round goby eDNA was routinely detected in known invaded sites of Lake Michigan and its tributaries (range log10 4.8–6.2 CN/L), but not upstream of an artificial fish barrier. Traditional techniques (mark-recapture, seining, trapping) in Lakes Michigan and Huron resulted in fewer, more variable detections than eDNA, but trapping and eDNA were correlated (Pearson R = 0.87). Additional field testing will help correlate round goby abundance with eDNA, providing insight on its role as a prey fish and its impact on food webs. PMID:29357382

  4. Environmental DNA (eDNA): A tool for quantifying the abundant but elusive round goby (Neogobius melanostomus).

    PubMed

    Nevers, Meredith B; Byappanahalli, Murulee N; Morris, Charles C; Shively, Dawn; Przybyla-Kelly, Kasia; Spoljaric, Ashley M; Dickey, Joshua; Roseman, Edward F

    2018-01-01

    Environmental DNA (eDNA) is revolutionizing biodiversity monitoring, occupancy estimates, and real-time detections of invasive species. In the Great Lakes, the round goby (Neogobius melanostomus), an invasive benthic fish from the Black Sea, has spread to encompass all five lakes and many tributaries, outcompeting or consuming native species; however, estimates of round goby abundance are confounded by behavior and habitat preference, which impact reliable methods for estimating their population. By integrating eDNA into round goby monitoring, improved estimates of biomass may be obtainable. We conducted mesocosm experiments to estimate rates of goby DNA shedding and decay. Further, we compared eDNA with several methods of traditional field sampling to compare its use as an alternative/complementary monitoring method. Environmental DNA decay was comparable to other fish species, and first-order decay was lower at 12°C (k = 0.043) than at 19°C (k = 0.058). Round goby eDNA was routinely detected in known invaded sites of Lake Michigan and its tributaries (range log10 4.8-6.2 CN/L), but not upstream of an artificial fish barrier. Traditional techniques (mark-recapture, seining, trapping) in Lakes Michigan and Huron resulted in fewer, more variable detections than eDNA, but trapping and eDNA were correlated (Pearson R = 0.87). Additional field testing will help correlate round goby abundance with eDNA, providing insight on its role as a prey fish and its impact on food webs.

  5. Method for assaying clustered DNA damages

    DOEpatents

    Sutherland, Betsy M.

    2004-09-07

    Disclosed is a method for detecting and quantifying clustered damages in DNA. In this method, a first aliquot of the DNA to be tested for clustered damages with one or more lesion-specific cleaving reagents under conditions appropriate for cleavage of the DNA to produce single-strand nicks in the DNA at sites of damage lesions. The number average molecular length (Ln) of double stranded DNA is then quantitatively determined for the treated DNA. The number average molecular length (Ln) of double stranded DNA is also quantitatively determined for a second, untreated aliquot of the DNA. The frequency of clustered damages (.PHI..sub.c) in the DNA is then calculated.

  6. Selective enzymatic cleavage and labeling for sensitive capillary electrophoresis laser-induced fluorescence analysis of oxidized DNA bases.

    PubMed

    Li, Cuiping; Wang, Hailin

    2015-08-07

    Oxidatively generated DNA damage is considered to be a significant contributing factor to cancer, aging, and age-related human diseases. It is important to detect oxidatively generated DNA damage to understand and clinically diagnosis diseases caused by oxidative damage. In this study, using selective enzymatic cleavage and quantum dot (QD) labeling, we developed a novel capillary electrophoresis-laser induced fluorescence method for the sensitive detection of oxidized DNA bases. First, oxidized DNA bases are recognized and removed by one DNA base excision repair glycosylase, leaving apurinic and apyrimidinic sites (AP sites) at the oxidized positions. The AP sites are further excised by the AP nicking activity of the chosen glycosylase, generating a nucleotide gap with 5'- and 3'- phosphate groups. After dephosphorylation with one alkaline phosphatase, a biotinylated ddNTP is introduced into the nucleotide space within the DNA strand by DNA polymerase I. The biotin-tagged DNA is further labeled with a QD-streptavidin conjugate via non-covalent interactions. The DNA-bound QD is well-separated from excess DNA-unbound QD by highly efficient capillary electrophoresis and is sensitively detected by online coupled laser-induced fluorescence analysis. Using this method, we can assess the trace levels of oxidized DNA bases induced by the Fenton reaction and UV irradiation. Interestingly, the use of the formamidopyrimidine glycosylase (FPG) protein and endonuclease VIII enables the detection of oxidized purine and pyrimidine bases, respectively. Using the synthesized standard DNA, the approach has low limits of detection of 1.1×10(-19)mol in mass and 2.9pM in concentration. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. A rapid low-cost high-density DNA-based multi-detection test for routine inspection of meat species.

    PubMed

    Lin, Chun Chi; Fung, Lai Ling; Chan, Po Kwok; Lee, Cheuk Man; Chow, Kwok Fai; Cheng, Shuk Han

    2014-02-01

    The increasing occurrence of food frauds suggests that species identification should be part of food authentication. Current molecular-based species identification methods have their own limitations or drawbacks, such as relatively time-consuming experimental steps, expensive equipment and, in particular, these methods cannot identify mixed species in a single experiment. This project proposes an improved method involving PCR amplification of the COI gene and detection of species-specific sequences by hybridisation. Major innovative breakthrough lies in the detection of multiple species, including pork, beef, lamb, horse, cat, dog and mouse, from a mixed sample within a single experiment. The probes used are species-specific either in sole or mixed species samples. As little as 5 pg of DNA template in the PCR is detectable in the proposed method. By designing species-specific probes and adopting reverse dot blot hybridisation and flow-through hybridisation, a low-cost high-density DNA-based multi-detection test suitable for routine inspection of meat species was developed. © 2013.

  8. RNase H-assisted RNA-primed rolling circle amplification for targeted RNA sequence detection.

    PubMed

    Takahashi, Hirokazu; Ohkawachi, Masahiko; Horio, Kyohei; Kobori, Toshiro; Aki, Tsunehiro; Matsumura, Yukihiko; Nakashimada, Yutaka; Okamura, Yoshiko

    2018-05-17

    RNA-primed rolling circle amplification (RPRCA) is a useful laboratory method for RNA detection; however, the detection of RNA is limited by the lack of information on 3'-terminal sequences. We uncovered that conventional RPRCA using pre-circularized probes could potentially detect the internal sequence of target RNA molecules in combination with RNase H. However, the specificity for mRNA detection was low, presumably due to non-specific hybridization of non-target RNA with the circular probe. To overcome this technical problem, we developed a method for detecting a sequence of interest in target RNA molecules via RNase H-assisted RPRCA using padlocked probes. When padlock probes are hybridized to the target RNA molecule, they are converted to the circular form by SplintR ligase. Subsequently, RNase H creates nick sites only in the hybridized RNA sequence, and single-stranded DNA is finally synthesized from the nick site by phi29 DNA polymerase. This method could specifically detect at least 10 fmol of the target RNA molecule without reverse transcription. Moreover, this method detected GFP mRNA present in 10 ng of total RNA isolated from Escherichia coli without background DNA amplification. Therefore, this method can potentially detect almost all types of RNA molecules without reverse transcription and reveal full-length sequence information.

  9. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Belinsky, Steven A; Palmisano, William A

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection ofmore » lung and other cancers.« less

  10. Evaluation by latent class analysis of a magnetic capture based DNA extraction followed by real-time qPCR as a new diagnostic method for detection of Echinococcus multilocularis in definitive hosts.

    PubMed

    Maas, Miriam; van Roon, Annika; Dam-Deisz, Cecile; Opsteegh, Marieke; Massolo, Alessandro; Deksne, Gunita; Teunis, Peter; van der Giessen, Joke

    2016-10-30

    A new method, based on a magnetic capture based DNA extraction followed by qPCR, was developed for the detection of the zoonotic parasite Echinococcus multilocularis in definitive hosts. Latent class analysis was used to compare this new method with the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. In total, 60 red foxes and coyotes from three different locations were tested with both molecular methods and the sedimentation and counting technique (SCT) or intestinal scraping technique (IST). Though based on a limited number of samples, it could be established that the magnetic capture based DNA extraction followed by qPCR showed similar sensitivity and specificity as the currently used phenol-chloroform DNA extraction followed by single tube nested PCR. All methods have a high specificity as shown by Bayesian latent class analysis. Both molecular assays have higher sensitivities than the combined SCT and IST, though the uncertainties in sensitivity estimates were wide for all assays tested. The magnetic capture based DNA extraction followed by qPCR has the advantage of not requiring hazardous chemicals like the phenol-chloroform DNA extraction followed by single tube nested PCR. This supports the replacement of the phenol-chloroform DNA extraction followed by single tube nested PCR by the magnetic capture based DNA extraction followed by qPCR for molecular detection of E. multilocularis in definitive hosts. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Bakhori, Noremylia Mohd; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-12

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10-9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  12. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense.

    PubMed

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-12-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10(-9) M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense.

  13. Simple, multiplexed, PCR-based barcoding of DNA enables sensitive mutation detection in liquid biopsies using sequencing.

    PubMed

    Ståhlberg, Anders; Krzyzanowski, Paul M; Jackson, Jennifer B; Egyud, Matthew; Stein, Lincoln; Godfrey, Tony E

    2016-06-20

    Detection of cell-free DNA in liquid biopsies offers great potential for use in non-invasive prenatal testing and as a cancer biomarker. Fetal and tumor DNA fractions however can be extremely low in these samples and ultra-sensitive methods are required for their detection. Here, we report an extremely simple and fast method for introduction of barcodes into DNA libraries made from 5 ng of DNA. Barcoded adapter primers are designed with an oligonucleotide hairpin structure to protect the molecular barcodes during the first rounds of polymerase chain reaction (PCR) and prevent them from participating in mis-priming events. Our approach enables high-level multiplexing and next-generation sequencing library construction with flexible library content. We show that uniform libraries of 1-, 5-, 13- and 31-plex can be generated. Utilizing the barcodes to generate consensus reads for each original DNA molecule reduces background sequencing noise and allows detection of variant alleles below 0.1% frequency in clonal cell line DNA and in cell-free plasma DNA. Thus, our approach bridges the gap between the highly sensitive but specific capabilities of digital PCR, which only allows a limited number of variants to be analyzed, with the broad target capability of next-generation sequencing which traditionally lacks the sensitivity to detect rare variants. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Overview of hybridization and detection techniques.

    PubMed

    Hilario, Elena

    2007-01-01

    A misconception regarding the sensitivity of nonradioactive methods for screening genomic DNA libraries often hinders the establishment of these environmentally friendly techniques in molecular biology laboratories. Nonradioactive probes, properly prepared and quantified, can detect DNA target molecules to the femtomole range. However, appropriate hybridization techniques and detection methods should also be adopted for an efficient use of nonradioactive techniques. Detailed descriptions of genomic library handling before and during the nonradioactive hybridization and detection are often omitted from publications. This chapter aims to fill this void by providing a collection of technical tips on hybridization and detection techniques.

  15. Alkaline Comet Assay for Assessing DNA Damage in Individual Cells.

    PubMed

    Pu, Xinzhu; Wang, Zemin; Klaunig, James E

    2015-08-06

    Single-cell gel electrophoresis, commonly called a comet assay, is a simple and sensitive method for assessing DNA damage at the single-cell level. It is an important technique in genetic toxicological studies. The comet assay performed under alkaline conditions (pH >13) is considered the optimal version for identifying agents with genotoxic activity. The alkaline comet assay is capable of detecting DNA double-strand breaks, single-strand breaks, alkali-labile sites, DNA-DNA/DNA-protein cross-linking, and incomplete excision repair sites. The inclusion of digestion of lesion-specific DNA repair enzymes in the procedure allows the detection of various DNA base alterations, such as oxidative base damage. This unit describes alkaline comet assay procedures for assessing DNA strand breaks and oxidative base alterations. These methods can be applied in a variety of cells from in vitro and in vivo experiments, as well as human studies. Copyright © 2015 John Wiley & Sons, Inc.

  16. Signal-on electrochemiluminescence biosensor for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction.

    PubMed

    Wang, Minghui; Zhou, Yunlei; Yin, Huanshun; Jiang, Wenjing; Wang, Haiyan; Ai, Shiyun

    2018-06-01

    MicroRNAs play crucial role in regulating gene expression in organism, thus it is very necessary to exploit an efficient method for the sensitive and specific detection of microRNA. Herein, a signal-on electrochemiluminescence biosensor was fabricated for microRNA-319a detection based on two-stage isothermal strand-displacement polymerase reaction (ISDPR). In the presence of target microRNA, amounts of trigger DNA could be generated by the first ISDPR. Then, the trigger DNA and the primer hybridized simultaneously with the hairpin probe to open the stem of the probe, and then the ECL signal will be emitted. In the presence of phi29 DNA polymerase and dNTPs, the trigger DNA could be displaced to initiate a new cycle which was the second ISDPR. Due to the two-stage amplification, this method presented excellent detection sensitivity with a low detection limit of 0.14 fM. Moreover, the applicability of the developed method was demonstrated by detecting the change of microRNA-319a content in the leaves of rice seedlings after the rice seeds were incubated with chemical mutagen of ethyl methanesulfonate. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. PCR-Free Detection of Genetically Modified Organisms Using Magnetic Capture Technology and Fluorescence Cross-Correlation Spectroscopy

    PubMed Central

    Zhou, Xiaoming; Xing, Da; Tang, Yonghong; Chen, Wei R.

    2009-01-01

    The safety of genetically modified organisms (GMOs) has attracted much attention recently. Polymerase chain reaction (PCR) amplification is a common method used in the identification of GMOs. However, a major disadvantage of PCR is the potential amplification of non-target DNA, causing false-positive identification. Thus, there remains a need for a simple, reliable and ultrasensitive method to identify and quantify GMO in crops. This report is to introduce a magnetic bead-based PCR-free method for rapid detection of GMOs using dual-color fluorescence cross-correlation spectroscopy (FCCS). The cauliflower mosaic virus 35S (CaMV35S) promoter commonly used in transgenic products was targeted. CaMV35S target was captured by a biotin-labeled nucleic acid probe and then purified using streptavidin-coated magnetic beads through biotin-streptavidin linkage. The purified target DNA fragment was hybridized with two nucleic acid probes labeled respectively by Rhodamine Green and Cy5 dyes. Finally, FCCS was used to detect and quantify the target DNA fragment through simultaneously detecting the fluorescence emissions from the two dyes. In our study, GMOs in genetically engineered soybeans and tomatoes were detected, using the magnetic bead-based PCR-free FCCS method. A detection limit of 50 pM GMOs target was achieved and PCR-free detection of GMOs from 5 µg genomic DNA with magnetic capture technology was accomplished. Also, the accuracy of GMO determination by the FCCS method is verified by spectrophotometry at 260 nm using PCR amplified target DNA fragment from GM tomato. The new method is rapid and effective as demonstrated in our experiments and can be easily extended to high-throughput and automatic screening format. We believe that the new magnetic bead-assisted FCCS detection technique will be a useful tool for PCR-free GMOs identification and other specific nucleic acids. PMID:19956680

  18. Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.

    There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

  19. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

    PubMed

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-10-30

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

  20. Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

    PubMed Central

    Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

    2007-01-01

    We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

  1. Surface Modification of Silicon Pillar Arrays To Enhance Fluorescence Detection of Uranium and DNA

    DOE PAGES

    Lincoln, Danielle R.; Charlton, Jennifer J.; Hatab, Nahla A.; ...

    2017-10-27

    There is an ever-growing need for detection methods that are both sensitive and efficient, such that reagent and sample consumption is minimized. Nanopillar arrays offer an attractive option to fill this need by virtue of their small scale in conjunction with their field enhancement intensity gains. This work investigates the use of nanopillar substrates for the detection of the uranyl ion and DNA, two analytes unalike but for their low quantum efficiencies combined with the need for high-throughput analyses. Here in this paper, the adaptability of these platforms was explored, as methods for the successful surface immobilization of both analytesmore » were developed and compared, resulting in a limit of detection for the uranyl ion of less than 1 ppm with a 0.2 μL sample volume. Moreover, differentiation between single-stranded and double-stranded DNA was possible, including qualitative identification between double-stranded DNA and DNA of the same sequence, but with a 10-base-pair mismatch.« less

  2. Identification of tissue-specific cell death using methylation patterns of circulating DNA

    PubMed Central

    Lehmann-Werman, Roni; Neiman, Daniel; Zemmour, Hai; Moss, Joshua; Magenheim, Judith; Vaknin-Dembinsky, Adi; Rubertsson, Sten; Nellgård, Bengt; Blennow, Kaj; Zetterberg, Henrik; Spalding, Kirsty; Haller, Michael J.; Wasserfall, Clive H.; Schatz, Desmond A.; Greenbaum, Carla J.; Dorrell, Craig; Grompe, Markus; Zick, Aviad; Hubert, Ayala; Maoz, Myriam; Fendrich, Volker; Bartsch, Detlef K.; Golan, Talia; Ben Sasson, Shmuel A.; Zamir, Gideon; Razin, Aharon; Cedar, Howard; Shapiro, A. M. James; Glaser, Benjamin; Shemer, Ruth; Dor, Yuval

    2016-01-01

    Minimally invasive detection of cell death could prove an invaluable resource in many physiologic and pathologic situations. Cell-free circulating DNA (cfDNA) released from dying cells is emerging as a diagnostic tool for monitoring cancer dynamics and graft failure. However, existing methods rely on differences in DNA sequences in source tissues, so that cell death cannot be identified in tissues with a normal genome. We developed a method of detecting tissue-specific cell death in humans based on tissue-specific methylation patterns in cfDNA. We interrogated tissue-specific methylome databases to identify cell type-specific DNA methylation signatures and developed a method to detect these signatures in mixed DNA samples. We isolated cfDNA from plasma or serum of donors, treated the cfDNA with bisulfite, PCR-amplified the cfDNA, and sequenced it to quantify cfDNA carrying the methylation markers of the cell type of interest. Pancreatic β-cell DNA was identified in the circulation of patients with recently diagnosed type-1 diabetes and islet-graft recipients; oligodendrocyte DNA was identified in patients with relapsing multiple sclerosis; neuronal/glial DNA was identified in patients after traumatic brain injury or cardiac arrest; and exocrine pancreas DNA was identified in patients with pancreatic cancer or pancreatitis. This proof-of-concept study demonstrates that the tissue origins of cfDNA and thus the rate of death of specific cell types can be determined in humans. The approach can be adapted to identify cfDNA derived from any cell type in the body, offering a minimally invasive window for diagnosing and monitoring a broad spectrum of human pathologies as well as providing a better understanding of normal tissue dynamics. PMID:26976580

  3. Development of a quantitative fluorescence single primer isothermal amplification-based method for the detection of Salmonella.

    PubMed

    Wang, Jianchang; Li, Rui; Hu, Lianxia; Sun, Xiaoxia; Wang, Jinfeng; Li, Jing

    2016-02-16

    Food-borne disease caused by Salmonella has long been, and continues to be, an important global public health problem, necessitating rapid and accurate detection of Salmonella in food. Real time PCR is the most recently developed approach for Salmonella detection. Single primer isothermal amplification (SPIA), a novel gene amplification technique, has emerged as an attractive microbiological testing method. SPIA is performed under a constant temperature, eliminating the need for an expensive thermo-cycler. In addition, SPIA reactions can be accomplished in 30 min, faster than real time PCR that usually takes over 2h. We developed a quantitative fluorescence SPIA-based method for the detection of Salmonella. Using Salmonella Typhimurium genomic DNA as template and a primer targeting Salmonella invA gene, we showed the detection limit of SPIA was 2.0 × 10(1)fg DNA. Its successful amplification of different serotypic Salmonella genomic DNA but not non-Salmonella bacterial DNA demonstrated the specificity of SPIA. Furthermore, this method was validated with artificially contaminated beef. In conclusion, we showed high sensitivity and specificity of SPIA in the detection of Salmonella, comparable to real time PCR. In addition, SPIA is faster and more cost-effective (non-use of expensive cyclers), making it a potential alternative for field detection of Salmonella in resource-limited settings that are commonly encountered in developing countries. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. Sensitivity of a real-time PCR method for the detection of transgenes in a mixture of transgenic and non-transgenic seeds of papaya (Carica papaya L.).

    PubMed

    Nageswara-Rao, Madhugiri; Kwit, Charles; Agarwal, Sujata; Patton, Mariah T; Skeen, Jordan A; Yuan, Joshua S; Manshardt, Richard M; Stewart, C Neal

    2013-09-01

    Genetically engineered (GE) ringspot virus-resistant papaya cultivars 'Rainbow' and 'SunUp' have been grown in Hawai'i for over 10 years. In Hawai'i, the introduction of GE papayas into regions where non-GE cultivars are grown and where feral non-GE papayas exist have been accompanied with concerns associated with transgene flow. Of particular concern is the possibility of transgenic seeds being found in non-GE papaya fruits via cross-pollination. Development of high-throughput methods to reliably detect the adventitious presence of such transgenic material would benefit both the scientific and regulatory communities. We assessed the accuracy of using conventional qualitative polymerase chain reaction (PCR) as well as real-time PCR-based assays to quantify the presence of transgenic DNA from bulk samples of non-GE papaya seeds. In this study, an optimized method of extracting high quality DNA from dry seeds of papaya was standardized. A reliable, sensitive real-time PCR method for detecting and quantifying viral coat protein (cp) transgenes in bulk seed samples utilizing the endogenous papain gene is presented. Quantification range was from 0.01 to 100 ng/μl of GE-papaya DNA template with a detection limit as low as 0.01% (10 pg). To test this system, we simulated transgene flow using known quantities of GE and non-GE DNA and determined that 0.038% (38 pg) GE papaya DNA could be detected using real-time PCR. We also validated this system by extracting DNA from known ratios of GE seeds to non-GE seeds of papaya followed by real-time PCR detection and observed a reliable detection limit of 0.4%. This method for the quick and sensitive detection of transgenes in bulked papaya seed lots using conventional as well as real-time PCR-based methods will benefit numerous stakeholders. In particular, this method could be utilized to screen selected fruits from maternal non-GE papaya trees in Hawai'i for the presence of transgenic seed at typical regulatory threshold levels. Incorporation of subtle differences in primers and probes for variations in cp worldwide should allow this method to be utilized elsewhere when and if deregulation of transgenic papaya occurs.

  5. Sensitivity of a real-time PCR method for the detection of transgenes in a mixture of transgenic and non-transgenic seeds of papaya (Carica papaya L.)

    PubMed Central

    2013-01-01

    Background Genetically engineered (GE) ringspot virus-resistant papaya cultivars ‘Rainbow’ and ‘SunUp’ have been grown in Hawai’i for over 10 years. In Hawai’i, the introduction of GE papayas into regions where non-GE cultivars are grown and where feral non-GE papayas exist have been accompanied with concerns associated with transgene flow. Of particular concern is the possibility of transgenic seeds being found in non-GE papaya fruits via cross-pollination. Development of high-throughput methods to reliably detect the adventitious presence of such transgenic material would benefit both the scientific and regulatory communities. Results We assessed the accuracy of using conventional qualitative polymerase chain reaction (PCR) as well as real-time PCR-based assays to quantify the presence of transgenic DNA from bulk samples of non-GE papaya seeds. In this study, an optimized method of extracting high quality DNA from dry seeds of papaya was standardized. A reliable, sensitive real-time PCR method for detecting and quantifying viral coat protein (cp) transgenes in bulk seed samples utilizing the endogenous papain gene is presented. Quantification range was from 0.01 to 100 ng/μl of GE-papaya DNA template with a detection limit as low as 0.01% (10 pg). To test this system, we simulated transgene flow using known quantities of GE and non-GE DNA and determined that 0.038% (38 pg) GE papaya DNA could be detected using real-time PCR. We also validated this system by extracting DNA from known ratios of GE seeds to non-GE seeds of papaya followed by real-time PCR detection and observed a reliable detection limit of 0.4%. Conclusions This method for the quick and sensitive detection of transgenes in bulked papaya seed lots using conventional as well as real-time PCR-based methods will benefit numerous stakeholders. In particular, this method could be utilized to screen selected fruits from maternal non-GE papaya trees in Hawai’i for the presence of transgenic seed at typical regulatory threshold levels. Incorporation of subtle differences in primers and probes for variations in cp worldwide should allow this method to be utilized elsewhere when and if deregulation of transgenic papaya occurs. PMID:24004548

  6. Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

    NASA Astrophysics Data System (ADS)

    Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

    2017-05-01

    We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

  7. Development of a dual test procedure for DNA typing and methamphetamine detection using a trace amount of stimulant-containing blood.

    PubMed

    Irii, Toshiaki; Maebashi, Kyoko; Fukui, Kenji; Sohma, Ryoko; Matsumoto, Sari; Takasu, Shojiro; Iwadate, Kimiharu

    2016-05-01

    Investigation of drug-related crimes, such as violation of the Stimulant Drug Control Law, requires identifying the used drug (mainly stimulant drugs, methamphetamine hydrochloride) from a drug solution and the DNA type of the drug user from a trace of blood left in the syringe used to inject the drug. In current standard test procedures, DNA typing and methamphetamine detection are performed as independent tests that use two separate portions of a precious sample. The sample can be entirely used up by either analysis. Therefore, we developed a new procedure involving partial lysis of a stimulant-containing blood sample followed by separation of the lysate into a precipitate for DNA typing and a liquid-phase fraction for methamphetamine detection. The method enables these two tests to be run in parallel using a single portion of sample. Samples were prepared by adding methamphetamine hydrochloride water solution to blood. Samples were lysed with Proteinase K in PBS at 56°C for 20min, cooled at -20°C after adding methanol, and then centrifuged at 15,000rpm. Based on the biopolymer-precipitating ability of alcohol, the precipitate was used for DNA typing and the liquid-phase fraction for methamphetamine detection. For DNA typing, the precipitate was dissolved and DNA was extracted, quantified, and subjected to STR analysis using the AmpFℓSTR® Identifiler® Plus PCR Amplification Kit. For methamphetamine detection, the liquid-phase fraction was evaporated with N2 gas after adding 20μL acetic acid and passed through an extraction column; the substances captured in the column were eluted with a solvent, derivatized, and quantitatively detected using gas chromatograph/mass spectrometry. This method was simple and could be completed in approximately 2h. Both DNA typing and methamphetamine detection were possible, which suggests that this method may be valuable for use in criminal investigations. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Molecular DNA-based detection of ionising radiation in meat.

    PubMed

    Şakalar, Ergün

    2017-05-01

    Ionising radiation induces molecular alterations, such as formation of ions, free radicals, and new stable molecules, and cleavage of the chemical bonds of the molecules present in food. Irradiation-treated meat should be labelled to control the process and to ensure free consumer choice. Therefore, sensitive analytical methods are required to detect the irradiation dose. Meat samples were exposed to radiation doses of 0, 0.272, 0.497, 1.063, 3.64, 8.82 and 17.42 kGy in an industrial 60 Co gamma cell. Primers were designed to amplify 998, 498 and 250-base pair (bp) regions of the 18S rRNA gene of nuclear DNA from the irradiated samples. A new DNA-based method was developed to quantify the radiation exposed to the unstored meat and the meat stored at -20 °C for 3 and 6 months. The method was able to detect meat samples stored and unstored with dose limits of 1.063 and 3.64 kGy, respectively. The level of irradiation can be detected using primer pairs that target particularly different-sized sequences for DNA amplification by PCR. This method can be widely used for the analysis of not only meat samples, but also all biological materials containing DNA. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.

  9. A new electrochemical method for the detection of cancer cells based on small molecule-linked DNA.

    PubMed

    Zhao, Jing; Zhu, Li; Guo, Chao; Gao, Tao; Zhu, Xiaoli; Li, Genxi

    2013-11-15

    Sensitive and accurate detection of cancer cells plays a crucial role in clinical diagnosis, treatment and prognosis of tumors. In this paper, we report a new electrochemical method for highly selective and sensitive detection of cancer cells by using small molecule-linked DNA as probes. The methodology is based on the fact that exonuclease I can catalyze the digestion of folate-linked DNA probes that are immobilized on an electrode surface; however, in the presence of the target cells, such as human breast cancer MCF-7 cells, the probes can be protected from digestion upon the binding with folate receptor that is over-expressed on the cell surface. Consequently, cancer cells can be efficiently detected by monitoring the status of the probe DNA with electrochemical techniques. In this study, the protection to exonuclease I-catalyzed digestion has also been proven by electrochemical studies. Moreover, the proposed method has been proven to linearly detect MCF-7 cells in a wide range from 10(2)-10(6) cell mL(-1) with a low detection limit of 67 cell mL(-1), which can also easily distinguish the folate receptor-negative normal cells, for instance, islet β cells. The reproduction of the detection is also satisfactory, since the relative standard deviations for three independent measurements of different concentration of MCF-7 cells are all within 10%. By replacing the small molecules linked on the DNA probe, other cancer cells can also be detected by making use of this proposed method. Therefore, our cytosensor may have great potential in clinical applications. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. A paper-based device for double-stranded DNA detection with Zif268

    NASA Astrophysics Data System (ADS)

    Zhang, Daohong

    2017-05-01

    Here, a small analytical device was fabricated on both nitrocellulose membrane and filter paper, for the detection of biotinylated double-stranded DNA (dsDNA) from 1 nM. Zif268 was utilized for capturing the target DNA, which was a zinc finger protein that recognized only a dsDNA with specific sequence. Therefore, this detection platform could be utilized for PCR result detection, with the well-designed primers (interpolate both biotin and Zif268 binding sequence). The result of the assay could be recorded by a camera-phone, and analyzed with software. The whole assay finished within 1 hour. Due to the easy fabrication, operation and disposal of this device, this method can be employed in point-of-care detection or on-site monitoring.

  11. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  12. PMA-PhyloChip DNA Microarray to Elucidate Viable Microbial Community Structure

    NASA Technical Reports Server (NTRS)

    Venkateswaran, Kasthuri J.; Stam, Christina N.; Andersen, Gary L.; DeSantis, Todd

    2011-01-01

    Since the Viking missions in the mid-1970s, traditional culture-based methods have been used for microbial enumeration by various NASA programs. Viable microbes are of particular concern for spacecraft cleanliness, for forward contamination of extraterrestrial bodies (proliferation of microbes), and for crew health/safety (viable pathogenic microbes). However, a "true" estimation of viable microbial population and differentiation from their dead cells using the most sensitive molecular methods is a challenge, because of the stability of DNA from dead cells. The goal of this research is to evaluate a rapid and sensitive microbial detection concept that will selectively estimate viable microbes. Nucleic acid amplification approaches such as the polymerase chain reaction (PCR) have shown promise for reducing time to detection for a wide range of applications. The proposed method is based on the use of a fluorescent DNA intercalating agent, propidium monoazide (PMA), which can only penetrate the membrane of dead cells. The PMA-quenched reaction mixtures can be screened, where only the DNA from live cells will be available for subsequent PCR reaction and microarray detection, and be identified as part of the viable microbial community. An additional advantage of the proposed rapid method is that it will detect viable microbes and differentiate from dead cells in only a few hours, as opposed to less comprehensive culture-based assays, which take days to complete. This novel combination approach is called the PMA-Microarray method. DNA intercalating agents such as PMA have previously been used to selectively distinguish between viable and dead bacterial cells. Once in the cell, the dye intercalates with the DNA and, upon photolysis under visible light, produces stable DNA adducts. DNA cross-linked in this way is unavailable for PCR. Environmental samples suspected of containing a mixture of live and dead microbial cells/spores will be treated with PMA, and then incubated in the dark. Thereafter, the sample is exposed to visible light for five minutes, so that the DNA from dead cells will be cross-linked. Following this PMA treatment step, the sample is concentrated by centrifugation and washed (to remove excessive PMA) before DNA is extracted. The 16S rRNA gene fragments will be amplified by PCR to screen the total microbial community using PhyloChip DNA microarray analysis. This approach will detect only the viable microbial community since the PMA intercalated DNA from dead cells would be unavailable for PCR amplification. The total detection time including PCR reaction for low biomass samples will be a few hours. Numerous markets may use this technology. The food industry uses spore detection to validate new alternative food processing technologies, sterility, and quality. Pharmaceutical and medical equipment companies also detect spores as a marker for sterility. This system can be used for validating sterilization processes, water treatment systems, and in various public health and homeland security applications.

  13. Rapid and label-free electrochemical DNA biosensor for detecting hepatitis A virus.

    PubMed

    Manzano, Marisa; Viezzi, Sara; Mazerat, Sandra; Marks, Robert S; Vidic, Jasmina

    2018-02-15

    Diagnostic systems that can deliver highly specific and sensitive detection of hepatitis A virus (HAV) in food and water are of particular interest in many fields including food safety, biosecurity and control of outbreaks. Our aim was the development of an electrochemical method based on DNA hybridization to detect HAV. A ssDNA probe specific for HAV (capture probe) was designed and tested on DNAs from various viral and bacterial samples using Nested-Reverse Transcription Polymerase Chain Reaction (nRT-PCR). To develop the electrochemical device, a disposable gold electrode was functionalized with the specific capture probe and tested on complementary ssDNA and on HAV cDNA. The DNA hybridization on the electrode was measured through the monitoring of the oxidative peak potential of the indicator tripropylamine by cyclic voltammetry. To prevent non-specific binding the gold surface was treated with 3% BSA before detection. High resolution atomic force microscopy (AFM) confirmed the efficiency of electrode functionalization and on-electrode hybridization. The proposed device showed a limit of detection of 0.65pM for the complementary ssDNA and 6.94fg/µL for viral cDNA. For a comparison, nRT-PCR quantified the target HAV cDNA with a limit of detection of 6.4fg/µL. The DNA-sensor developed can be adapted to a portable format to be adopted as an easy-to- use and low cost method for screening HAV in contaminated food and water. In addition, it can be useful for rapid control of HAV infections as it takes only a few minutes to provide the results. Copyright © 2017. Published by Elsevier B.V.

  14. Detection limits of quantitative and digital PCR assays and their influence in presence-absence surveys of environmental DNA.

    PubMed

    Hunter, Margaret E; Dorazio, Robert M; Butterfield, John S S; Meigs-Friend, Gaia; Nico, Leo G; Ferrante, Jason A

    2017-03-01

    A set of universal guidelines is needed to determine the limit of detection (LOD) in PCR-based analyses of low-concentration DNA. In particular, environmental DNA (eDNA) studies require sensitive and reliable methods to detect rare and cryptic species through shed genetic material in environmental samples. Current strategies for assessing detection limits of eDNA are either too stringent or subjective, possibly resulting in biased estimates of species' presence. Here, a conservative LOD analysis grounded in analytical chemistry is proposed to correct for overestimated DNA concentrations predominantly caused by the concentration plateau, a nonlinear relationship between expected and measured DNA concentrations. We have used statistical criteria to establish formal mathematical models for both quantitative and droplet digital PCR. To assess the method, a new Grass Carp (Ctenopharyngodon idella) TaqMan assay was developed and tested on both PCR platforms using eDNA in water samples. The LOD adjustment reduced Grass Carp occupancy and detection estimates while increasing uncertainty-indicating that caution needs to be applied to eDNA data without LOD correction. Compared to quantitative PCR, digital PCR had higher occurrence estimates due to increased sensitivity and dilution of inhibitors at low concentrations. Without accurate LOD correction, species occurrence and detection probabilities based on eDNA estimates are prone to a source of bias that cannot be reduced by an increase in sample size or PCR replicates. Other applications also could benefit from a standardized LOD such as GMO food analysis and forensic and clinical diagnostics. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  15. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, J.H.; Keller, R.A.; Martin, J.C.; Posner, R.G.; Marrone, B.L.; Hammond, M.L.; Simpson, D.J.

    1995-04-11

    A method is described for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand. 4 figures.

  16. Method for rapid base sequencing in DNA and RNA with two base labeling

    DOEpatents

    Jett, James H.; Keller, Richard A.; Martin, John C.; Posner, Richard G.; Marrone, Babetta L.; Hammond, Mark L.; Simpson, Daniel J.

    1995-01-01

    Method for rapid-base sequencing in DNA and RNA with two-base labeling and employing fluorescent detection of single molecules at two wavelengths. Bases modified to accept fluorescent labels are used to replicate a single DNA or RNA strand to be sequenced. The bases are then sequentially cleaved from the replicated strand, excited with a chosen spectrum of electromagnetic radiation, and the fluorescence from individual, tagged bases detected in the order of cleavage from the strand.

  17. Recombinase Polymerase Amplification Combined with Lateral Flow Strip for Listeria monocytogenes Detection in Food.

    PubMed

    Du, Xin-Jun; Zang, Yu-Xuan; Liu, Hai-Bin; Li, Ping; Wang, Shuo

    2018-04-01

    Listeria monocytogenes is an important food-borne pathogenic bacterium that causes human disease, resulting in economic losses worldwide. The current detection methods for L. monocytogenes are not well suited for direct field testing because they involve complicated, time-consuming operations. A simple, efficient method is vital for L. monocytogenes detection. In this study, we combined isothermal recombinase polymerase amplification (RPA) with a lateral flow (LF) strip to rapidly and reliably detect L. monocytogenes. In the presence of biotin- and digoxin-modified primers, RPA produced numerous digoxin- and biotin-attached duplex DNA products. These products were detected on an LF strip via dual immunoreactions (digoxin on the duplex DNA reacted with the anti-digoxin antibody on the gold nanoparticle (Au-NP) and the biotin on the duplex DNA captured by the streptavidin on the LF test zone). The accumulation of Au-NPs produced characteristic bands, enabling the visual detection of L. monocytogenes without instrumentation. This assay could be used to detect L. monocytogenes within 15 min, including DNA amplification with RPA for 10 min at 39 °C and visualization of the amplicons by LF strips for 5 min. Experiments confirmed a detection limit as low as 300 fg of DNA and 1.5 × 10 1 CFU in pure cultures. Furthermore, RPA-LF exhibited no cross-reactions with pathogens. Evaluation of the method with food samples indicated that the detection limit was substantially improved to 1.5 × 10° CFU for the original bacterial content in 25 g/mL samples after enrichment for 6 hr. RPA-LF can be used as a sensitive and rapid detection technique for L. monocytogenes. Recombinase polymerase amplification (RPA) can amplify target DNA at 37 to 42 °C without a thermal cycler. Lateral flow (LF) strips are portable, cheap and easy to operate. RPA combined with LF strips to detect Listeria monocytogenes can be widely used in remote areas. © 2018 Institute of Food Technologists®.

  18. Cell-Free DNA Analysis in Maternal Blood: Differences in Estimates between Laboratories with Different Methodologies Using a Propensity Score Approach.

    PubMed

    Bevilacqua, Elisa; Jani, Jacques C; Letourneau, Alexandra; Duiella, Silvia F; Kleinfinger, Pascale; Lohmann, Laurence; Resta, Serena; Cos Sanchez, Teresa; Fils, Jean-François; Mirra, Marilyn; Benachi, Alexandra; Costa, Jean-Marc

    2018-06-13

    To evaluate the failure rate and performance of cell-free DNA (cfDNA) testing, mainly in terms of detection rates for trisomy 21, performed by 2 laboratories using different analytical methods. cfDNA testing was performed on 2,870 pregnancies with the HarmonyTM Prenatal Test using the targeted digital analysis of selected regions (DANSR) method, and on 2,635 pregnancies with the "Cerba test" using the genome-wide massively parallel sequencing (GW-MPS) method, with available outcomes. Propensity score analysis was used to match patients between the 2 groups. A comparison of the detection rates for trisomy 21 between the 2 laboratories was made. In all, 2,811 patients in the Harmony group and 2,530 patients in the Cerba group had no trisomy 21, 18, or 13. Postmatched comparisons of the patient characteristics indicated a higher no-result rate in the Harmony group (1.30%) than in the Cerba group (0.75%; p = 0.039). All 41 cases of trisomy 21 in the Harmony group and 93 cases in the Cerba group were detected. Both methods of cfDNA testing showed low no-result rates and a comparable performance in detecting trisomy 21; yet GW-MPS had a slightly lower no-result rate than the DANSR method. © 2018 S. Karger AG, Basel.

  19. RNA Flow Cytometry Using the Branched DNA Technique.

    PubMed

    Soh, Kah Teong; Wallace, Paul K

    2018-01-01

    The systematic modulation of mRNA and proteins governs the complicated and intermingled biological functions of our cells. Traditionally, transcriptomic technologies such as DNA microarray and RNA-Seq have been used to identify, characterize, and profile gene expression data. These are, however, considered bulk methods as they are unable to measure gene expression at the single-cell level, unless the cells are pre-sorted. Branched DNA is a flow cytometry-based detection platform that has been developed recently to measure mRNA at the single-cell level. Originally adapted from microscopy, the current system has been modified to achieve compatibility with the detection of surface and intracellular antigens using monoclonal antibodies conjugated to fluorochromes, thus permitting simultaneous detection of mRNAs and proteins. The Branched DNA method offers a variety of advantages when compared to traditional or standard methods used for the quantification of mRNA, such as (a) the detection of specific mRNA on a per cell basis, (b) an alternate detection tool when the measurement of a protein is technically infeasible (i.e., no quality antibody exists) or the epitope is not assessable, and (c) correlate the analysis of mRNA with protein. Compared to earlier attempts at measuring nucleic acid by flow cytometry, the hybridization temperature applied in the Branched DNA assay is much lower, thus preserving the integrity of cellular structures for further characterization. It also has greatly increased specificity and sensitivity. Here, we provide detailed instruction for performing the Branched DNA method using it in a model system to correlate the expression of CD8 mRNA and CD8 protein by flow cytometry.

  20. PCR-free quantitative detection of genetically modified organism from raw materials – A novel electrochemiluminescence-based bio-barcode method

    PubMed Central

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R.

    2018-01-01

    Bio-barcode assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio-barcode assay requires lengthy experimental procedures including the preparation and release of barcode DNA probes from the target-nanoparticle complex, and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio-barcode assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2’2’-bipyridyl) ruthenium (TBR)-labele barcode DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products. PMID:18386909

  1. PCR-free quantitative detection of genetically modified organism from raw materials. An electrochemiluminescence-based bio bar code method.

    PubMed

    Zhu, Debin; Tang, Yabing; Xing, Da; Chen, Wei R

    2008-05-15

    A bio bar code assay based on oligonucleotide-modified gold nanoparticles (Au-NPs) provides a PCR-free method for quantitative detection of nucleic acid targets. However, the current bio bar code assay requires lengthy experimental procedures including the preparation and release of bar code DNA probes from the target-nanoparticle complex and immobilization and hybridization of the probes for quantification. Herein, we report a novel PCR-free electrochemiluminescence (ECL)-based bio bar code assay for the quantitative detection of genetically modified organism (GMO) from raw materials. It consists of tris-(2,2'-bipyridyl) ruthenium (TBR)-labeled bar code DNA, nucleic acid hybridization using Au-NPs and biotin-labeled probes, and selective capture of the hybridization complex by streptavidin-coated paramagnetic beads. The detection of target DNA is realized by direct measurement of ECL emission of TBR. It can quantitatively detect target nucleic acids with high speed and sensitivity. This method can be used to quantitatively detect GMO fragments from real GMO products.

  2. Portable evanescent wave fiber biosensor for highly sensitive detection of Shigella

    NASA Astrophysics Data System (ADS)

    Xiao, Rui; Rong, Zhen; Long, Feng; Liu, Qiqi

    2014-11-01

    A portable evanescent wave fiber biosensor was developed to achieve the rapid and highly sensitive detection of Shigella. In this study, a DNA probe was covalently immobilized onto fiber-optic biosensors that can hybridize with a fluorescently labeled complementary DNA. The sensitivity of detection for synthesized oligonucleotides can reach 10-10 M. The surface of the sensor can be regenerated with 0.5% sodium dodecyl sulfate solution (pH 1.9) for over 30 times without significant deterioration of performance. The total analysis time for a single sample, including the time for measurement and surface regeneration, was less than 6 min. We employed real-time polymerase chain reaction (PCR) and compared the results of both methods to investigate the actual Shigella DNA detection capability of the fiber-optic biosensor. The fiber-optic biosensor could detect as low as 102 colony-forming unit/mL Shigella. This finding was comparable with that by real-time PCR, which suggests that this method is a potential alternative to existing detection methods.

  3. Length polymorphism scanning is an efficient approach for revealing chloroplast DNA variation.

    Treesearch

    Matthew E. Horning; Richard C. Cronn

    2006-01-01

    Phylogeographic and population genetic screens of chloroplast DNA (cpDNA) provide insights into seedbased gene flow in angiosperms, yet studies are frequently hampered by the low mutation rate of this genome. Detection methods for intraspecific variation can be either direct (DNA sequencing) or indirect (PCR-RFLP), although no single method incorporates the best...

  4. Environmental DNA for freshwater fish monitoring: insights for conservation within a protected area.

    PubMed

    Fernandez, Sara; Sandin, Miguel M; Beaulieu, Paul G; Clusa, Laura; Martinez, Jose L; Ardura, Alba; García-Vázquez, Eva

    2018-01-01

    Many fish species have been introduced in wild ecosystems around the world to provide food or leisure, deliberately or from farm escapes. Some of those introductions have had large ecological effects. The north American native rainbow trout ( Oncorhynchus mykiss Walbaum, 1792) is one of the most widely farmed fish species in the world. It was first introduced in Spain in the late 19th century for sport fishing (Elvira 1995) and nowadays is used there for both fishing and aquaculture. On the other hand, the European native brown trout ( Salmo trutta L.) is catalogued as vulnerable in Spain. Detecting native and invasive fish populations in ecosystem monitoring is crucial, but it may be difficult from conventional sampling methods such as electrofishing. These techniques encompass some mortality, thus are not adequate for some ecosystems as the case of protected areas. Environmental DNA (eDNA) analysis is a sensitive and non-invasive method that can be especially useful for rare and low-density species detection and inventory in water bodies. In this study we employed two eDNA based methods (qPCR and nested PCR-RFLP) to detect salmonid species from mountain streams within a protected area, The Biosphere Reserve and Natural Park of Redes (Upper Nalón Basin, Asturias, Northern Spain), where brown trout is the only native salmonid. We also measured some habitat variables to see how appropriate for salmonids the area is. The sampling area is located upstream impassable dams and contains one rainbow trout fish farm. Employing qPCR methodology, brown trout eDNA was detected in all the nine sampling sites surveyed, while nested PCR-RFLP method failed to detect it in two sampling points. Rainbow trout eDNA was detected with both techniques at all sites in the Nalón River' (n1, n2 and n3). Salmonid habitat units and water quality were high from the area studied. In this study, a high quantity of rainbow trout eDNA was found upstream and downstream of a fish farm located inside a Biosphere Reserve. Unreported escapes from the fish farm are a likely explanation of these results. Since salmonid habitat is abundant and the water quality high, the establishment of rainbow trout populations would be favored should escapes occur. Environmental DNA has here proved to be a valuable tool for species detection in freshwater environments, and the probe-based qPCR highly sensitive technique for detection of scarce species. We would recommend this method for routine monitoring and early detection of introduced species within natural reserves.

  5. Simultaneous detection of bovine and porcine DNA in pharmaceutical gelatin capsules by duplex PCR assay for Halal authentication.

    PubMed

    Nikzad, Jafar; Shahhosseini, Soraya; Tabarzad, Maryam; Nafissi-Varcheh, Nastaran; Torshabi, Maryam

    2017-02-14

    In the pharmaceutical industry, hard- and soft-shelled capsules are typically made from gelatin, commonly derived from bovine and porcine sources. To ensure that pharmaceutical products comply with halal regulations in Muslim countries (no porcine products allowed), development of a valid, reliable, quick, and most importantly, cost-effective tests are of utmost importance. We developed a species-specific duplex polymerase chain reaction (PCR) assay targeting 149 bp porcine and 271 bp bovine mitochondrial DNA (mtDNA) to simultaneously detect both porcine and bovine DNA (in one reaction at the same time) in gelatin. Some additional simplex PCR tests (targeting 126 bp bovine and 212 bp porcine mtDNA) and real-time PCR using a commercially available kit (for identification of porcine DNA) were used to verify the selectivity and sensitivity of our duplex PCR. After optimization of DNA extraction and PCR methods, hard/soft pharmaceutical gelatin capsules (containing drug) were tested for the presence of porcine and/or bovine DNA. Duplex PCR detected the presence of as little as 0.1% porcine DNA, which was more accurate than the commercially available kit. Of all gelatin capsules tested (n = 24), 50% contained porcine DNA (pure porcine gelatin alone or in combination with bovine gelatin). Duplex PCR presents an easy-to-follow, quick, low-cost and reliable method to simultaneously detect porcine and bovine DNAs (>100 bp) in minute amounts in highly processed gelatin-containing pharmaceutical products (with a 0.1% sensitivity for porcine DNA) which may be used for halal authentication. Simultaneous detection of porcine and bovine DNA in gelatin capsules by duplex PCR.

  6. Comparison of four PCR methods for efficient detection of Trypanosoma cruzi in routine diagnostics.

    PubMed

    Seiringer, Peter; Pritsch, Michael; Flores-Chavez, María; Marchisio, Edoardo; Helfrich, Kerstin; Mengele, Carolin; Hohnerlein, Stefan; Bretzel, Gisela; Löscher, Thomas; Hoelscher, Michael; Berens-Riha, Nicole

    2017-07-01

    Due to increased migration, Chagas disease has become an international health problem. Reliable diagnosis of chronically infected people is crucial for prevention of non-vectorial transmission as well as treatment. This study compared four distinct PCR methods for detection of Trypanosoma cruzi DNA for the use in well-equipped routine diagnostic laboratories. DNA was extracted of T. cruzi-positive and negative patients' blood samples and cultured T. cruzi, T. rangeli as well as Leishmania spp. One conventional and two real-time PCR methods targeting a repetitive Sat-DNA sequence as well as one conventional PCR method targeting the variable region of the kDNA minicircle were compared for sensitivity, intra- and interassay precision, limit of detection, specificity and cross-reactivity. Considering the performance, costs and ease of use, an algorithm for PCR-diagnosis of patients with a positive serology for T. cruzi antibodies was developed. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  7. Naked eye detection of mutagenic DNA photodimers using gold nanoparticles.

    PubMed

    Kim, Joong Hyun; Chung, Bong Hyun

    2011-01-15

    We developed a method to detect mutagenic DNA photodimers by the naked eye using gold nanoparticles. The stability of gold nanoparticles in a high ionic strength solution is maintained by straight ssDNA adsorbed physically on the AuNPs. However, we found that UV-irradiated DNA was less adsorptive onto gold nanoparticles because of a conformational change of UV-irradiated DNA. The accumulated deformation of the DNA structure by multiple-dimer formation triggered aggregation of the gold nanoparticles mixed with the UV-irradiated DNA and thus red to purple color changes of the mixture, which allowed colorimetric detection of the DNA photodimers by the naked eye. No fragmented mass and reactive oxygen species production under the UVB irradiation confirmed that the aggregation of gold nanoparticles was solely attributed to the accumulated deformation of the UV irradiated DNA. The degree of gold nanoparticles-aggregation was dependent on the UVB irradiated time and base compositions of the UV-irradiated oligonucleotides. In addition, we successfully demonstrated how to visually qualify the photosensitizing effect of chemical compounds in parallel within only 10 min by applying this new method. Since our method does not require any chemical or biochemical treatments or special instruments for purifying and qualifying the DNA photolesions, it should provide a feasible tool for the studies of the UV-induced mutagenic or carcinogenic DNA dimers and accelerate screening of a large number of drug candidates. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.

  8. Label-free detection of specific DNA sequence-telomere using unmodified gold nanoparticles as colorimetric probes

    NASA Astrophysics Data System (ADS)

    Qi, Yingying; Li, Li; Li, Baoxin

    2009-09-01

    A simple and sensitive label-free colorimetric detection of telomere DNA has been developed. It was based on the color change of gold nanoparticles (AuNPs) due to DNA hybridization. UV-vis spectra and transmission electron microscopy (TEM) were used to investigate the change of AuNPs. Under the optimized conditions, the linear range for determination of telomere DNA was 5.7 × 10 -13 to 4.5 × 10 -6 mol/L. The detection limit (3 σ) of this method has decreased to pico-molar level.

  9. Potentiometric Aptasensing of Vibrio alginolyticus Based on DNA Nanostructure-Modified Magnetic Beads.

    PubMed

    Zhao, Guangtao; Ding, Jiawang; Yu, Han; Yin, Tanji; Qin, Wei

    2016-12-02

    A potentiometric aptasensing assay that couples the DNA nanostructure-modified magnetic beads with a solid-contact polycation-sensitive membrane electrode for the detection of Vibrio alginolyticus is herein described. The DNA nanostructure-modified magnetic beads are used for amplification of the potential response and elimination of the interfering effect from a complex sample matrix. The solid-contact polycation-sensitive membrane electrode using protamine as an indicator is employed to chronopotentiometrically detect the change in the charge or DNA concentration on the magnetic beads, which is induced by the interaction between Vibrio alginolyticus and the aptamer on the DNA nanostructures. The present potentiometric aptasensing method shows a linear range of 10-100 CFU mL -1 with a detection limit of 10 CFU mL -1 , and a good specificity for the detection of Vibrio alginolyticus . This proposed strategy can be used for the detection of other microorganisms by changing the aptamers in the DNA nanostructures.

  10. [Detection of Toxoplasma gondii DNA in human lymph node tissue by in situ hybridization].

    PubMed

    Liu, C; Ke, O; Tan, D; Zhang, Z

    1998-01-01

    To detect the presence of Toxoplasma gondii in lymph node tissue in patients with Toxoplasma infection. T. gondii (RH strain) specific DNA fragment clones were obtained by using PCR and gene recombination technique. The DNA fragments used as hybridization probes were labelled with digoxigenin by random primer method. The technique of in situ hybridization (ISH) was used to detect T. g DNA in the lymph node sections. Four out of 120 samples T. g DNA were found positive, one with Hodgkin's disease (HD) (1/32), one with non-Hodgkin's lymphoma (NHL) (1/41) and 2 with chronic lymphadenitis (CL) (2/47). The total positive rate was 3.3%. It was demonstrated that this highly specific probe could detect 10 pg of the total RH strain T. g DNA. ISH was applicable in detecting pathogens in the lymph node tissues of individuals with Toxoplasma infection.

  11. Real-time PCR detection of Plasmodium directly from whole blood and filter paper samples

    PubMed Central

    2011-01-01

    Background Real-time PCR is a sensitive and specific method for the analysis of Plasmodium DNA. However, prior purification of genomic DNA from blood is necessary since PCR inhibitors and quenching of fluorophores from blood prevent efficient amplification and detection of PCR products. Methods Reagents designed to specifically overcome PCR inhibition and quenching of fluorescence were evaluated for real-time PCR amplification of Plasmodium DNA directly from blood. Whole blood from clinical samples and dried blood spots collected in the field in Colombia were tested. Results Amplification and fluorescence detection by real-time PCR were optimal with 40× SYBR® Green dye and 5% blood volume in the PCR reaction. Plasmodium DNA was detected directly from both whole blood and dried blood spots from clinical samples. The sensitivity and specificity ranged from 93-100% compared with PCR performed on purified Plasmodium DNA. Conclusions The methodology described facilitates high-throughput testing of blood samples collected in the field by fluorescence-based real-time PCR. This method can be applied to a broad range of clinical studies with the advantages of immediate sample testing, lower experimental costs and time-savings. PMID:21851640

  12. Evaluation of fluorescence in situ hybridization techniques to study long non-coding RNA expression in cultured cells

    PubMed Central

    Soares, Ricardo J; Maglieri, Giulia; Gutschner, Tony; Lund, Anders H; Nielsen, Boye S

    2018-01-01

    Abstract Deciphering the functions of long non-coding RNAs (lncRNAs) is facilitated by visualization of their subcellular localization using in situ hybridization (ISH) techniques. We evaluated four different ISH methods for detection of MALAT1 and CYTOR in cultured cells: a multiple probe detection approach with or without enzymatic signal amplification, a branched-DNA (bDNA) probe and an LNA-modified probe with enzymatic signal amplification. All four methods adequately stained MALAT1 in the nucleus in all of three cell lines investigated, HeLa, NHDF and T47D, and three of the methods detected the less expressed CYTOR. The sensitivity of the four ISH methods was evaluated by image analysis. In all three cell lines, the two methods involving enzymatic amplification gave the most intense MALAT1 signal, but the signal-to-background ratios were not different. CYTOR was best detected using the bDNA method. All four ISH methods showed significantly reduced MALAT1 signal in knock-out cells, and siRNA-induced knock-down of CYTOR resulted in significantly reduced CYTOR ISH signal, indicating good specificity of the probe designs and detection systems. Our data suggest that the ISH methods allow detection of both abundant and less abundantly expressed lncRNAs, although the latter required the use of the most specific and sensitive probe detection system. PMID:29059327

  13. Detection of an endangered aquatic heteropteran using environmental DNA in a wetland ecosystem

    PubMed Central

    Katano, Izumi; Sakata, Yusuke; Souma, Rio; Kosuge, Toshihiro; Nagano, Mariko; Ikeda, Kousuke; Yano, Koki; Tojo, Koji

    2017-01-01

    The use of environmental DNA (eDNA) has recently been employed to evaluate the distribution of various aquatic macroorganisms. Although this technique has been applied to a broad range of taxa, from vertebrates to invertebrates, its application is limited for aquatic insects such as aquatic heteropterans. Nepa hoffmanni (Heteroptera: Nepidae) is a small (approx. 23 mm) aquatic heteropteran that inhabits wetlands, can be difficult to capture and is endangered in Japan. The molecular tool eDNA was used to evaluate the species distribution of N. hoffmanni in comparison to that determined using hand-capturing methods in two regions of Japan. The eDNA of N. hoffmanni was detected at nearly all sites (10 eDNA-detected sites out of 14 sites), including sites where N. hoffmanni was not captured by hand (five eDNA-detected sites out of six captured sites). Thus, this species-specific eDNA technique can be applied to detect small, sparsely distributed heteropterans in wetland ecosystems. In conclusion, eDNA could be a valuable technique for the detection of aquatic insects inhabiting wetland habitats, and could make a significant contribution to providing distribution data necessary to species conservation. PMID:28791177

  14. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    PubMed Central

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta’ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-01-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology. PMID:27435636

  15. Measuring the Electronic Properties of DNA-Specific Schottky Diodes Towards Detecting and Identifying Basidiomycetes DNA

    NASA Astrophysics Data System (ADS)

    Periasamy, Vengadesh; Rizan, Nastaran; Al-Ta'Ii, Hassan Maktuff Jaber; Tan, Yee Shin; Tajuddin, Hairul Annuar; Iwamoto, Mitsumasa

    2016-07-01

    The discovery of semiconducting behavior of deoxyribonucleic acid (DNA) has resulted in a large number of literatures in the study of DNA electronics. Sequence-specific electronic response provides a platform towards understanding charge transfer mechanism and therefore the electronic properties of DNA. It is possible to utilize these characteristic properties to identify/detect DNA. In this current work, we demonstrate a novel method of DNA-based identification of basidiomycetes using current-voltage (I-V) profiles obtained from DNA-specific Schottky barrier diodes. Electronic properties such as ideality factor, barrier height, shunt resistance, series resistance, turn-on voltage, knee-voltage, breakdown voltage and breakdown current were calculated and used to quantify the identification process as compared to morphological and molecular characterization techniques. The use of these techniques is necessary in order to study biodiversity, but sometimes it can be misleading and unreliable and is not sufficiently useful for the identification of fungi genera. Many of these methods have failed when it comes to identification of closely related species of certain genus like Pleurotus. Our electronics profiles, both in the negative and positive bias regions were however found to be highly characteristic according to the base-pair sequences. We believe that this simple, low-cost and practical method could be useful towards identifying and detecting DNA in biotechnology and pathology.

  16. DNA encoding a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  17. Loop-mediated isothermal amplification (LAMP) assay-A rapid detection tool for identifying red fox (Vulpes vulpes) DNA in the carcasses of harbour porpoises (Phocoena phocoena).

    PubMed

    Heers, Teresa; van Neer, Abbo; Becker, André; Grilo, Miguel Luca; Siebert, Ursula; Abdulmawjood, Amir

    2017-01-01

    Carcasses of wild animals are often visited by different scavengers. However, determining which scavenger caused certain types of bite marks is particularly difficult and knowledge thereof is lacking. Therefore, a loop-mediated isothermal amplification (LAMP) assay (target sequence cytochrome b) was developed to detect red fox DNA in carcasses of harbour porpoises. The MSwab™ method for direct testing without prior DNA isolation was validated. As a detection device, the portable real-time fluorometer Genie® II was used, which yields rapid results and can be used in field studies without huge laboratory equipment. In addition to in vitro evaluation and validation, a stranded and scavenged harbour porpoise carcass was successfully examined for red fox DNA residues. The developed LAMP method is a valuable diagnostic tool for confirming presumable red fox bite wounds in harbour porpoises without further DNA isolation steps.

  18. Two alternative DNA extraction methods to improve the detection of Mycobacterium-tuberculosis-complex members in cattle and red deer tissue samples.

    PubMed

    Fell, Shari; Bröckl, Stephanie; Büttner, Mathias; Rettinger, Anna; Zimmermann, Pia; Straubinger, Reinhard K

    2016-09-15

    Bovine tuberculosis (bTB), which is caused by Mycobacterium bovis and M. caprae, is a notifiable animal disease in Germany. Diagnostic procedure is based on a prescribed protocol that is published in the framework of German bTB legislation. In this protocol small sample volumes are used for DNA extraction followed by real-time PCR analyses. As mycobacteria tend to concentrate in granuloma and the infected tissue in early stages of infection does not necessarily show any visible lesions, it is likely that DNA extraction from only small tissue samples (20-40 mg) of a randomly chosen spot from the organ and following PCR testing may result in false negative results. In this study two DNA extraction methods were developed to process larger sample volumes to increase the detection sensitivity of mycobacterial DNA in animal tissue. The first extraction method is based on magnetic capture, in which specific capture oligonucleotides were utilized. These nucleotides are linked to magnetic particles and capture Mycobacterium-tuberculosis-complex (MTC) DNA released from 10 to 15 g of tissue material. In a second approach remaining sediments from the magnetic capture protocol were further processed with a less complex extraction protocol that can be used in daily routine diagnostics. A total number of 100 tissue samples from 34 cattle (n = 74) and 18 red deer (n = 26) were analyzed with the developed protocols and results were compared to the prescribed protocol. All three extraction methods yield reliable results by the real-time PCR analysis. The use of larger sample volume led to a sensitivity increase of DNA detection which was shown by the decrease of Ct-values. Furthermore five samples which were tested negative or questionable by the official extraction protocol were detected positive by real time PCR when the alternative extraction methods were used. By calculating the kappa index, the three extraction protocols resulted in a moderate (0.52; protocol 1 vs 3) to almost perfect agreement (1.00; red deer sample testing with all protocols). Both new methods yielded increased detection rates for MTC DNA detection in large sample volumes and consequently improve the official diagnostic protocol.

  19. DNA-Based Diet Analysis for Any Predator

    PubMed Central

    Dunshea, Glenn

    2009-01-01

    Background Prey DNA from diet samples can be used as a dietary marker; yet current methods for prey detection require a priori diet knowledge and/or are designed ad hoc, limiting their scope. I present a general approach to detect diverse prey in the feces or gut contents of predators. Methodology/Principal Findings In the example outlined, I take advantage of the restriction site for the endonuclease Pac I which is present in 16S mtDNA of most Odontoceti mammals, but absent from most other relevant non-mammalian chordates and invertebrates. Thus in DNA extracted from feces of these mammalian predators Pac I will cleave and exclude predator DNA from a small region targeted by novel universal primers, while most prey DNA remain intact allowing prey selective PCR. The method was optimized using scat samples from captive bottlenose dolphins (Tursiops truncatus) fed a diet of 6–10 prey species from three phlya. Up to five prey from two phyla were detected in a single scat and all but one minor prey item (2% of the overall diet) were detected across all samples. The same method was applied to scat samples from free-ranging bottlenose dolphins; up to seven prey taxa were detected in a single scat and 13 prey taxa from eight teleost families were identified in total. Conclusions/Significance Data and further examples are provided to facilitate rapid transfer of this approach to any predator. This methodology should prove useful to zoologists using DNA-based diet techniques in a wide variety of study systems. PMID:19390570

  20. A General Method for Discovering Inhibitors of Protein–DNA Interactions Using Photonic Crystal Biosensors

    PubMed Central

    Chan, Leo L.; Pineda, Maria; Heeres, James T.; Hergenrother, Paul J.; Cunningham, Brian T.

    2009-01-01

    Protein–DNA interactions are essential for fundamental cellular processes such as transcription, DNA damage repair, and apoptosis. As such, small molecule disruptors of these interactions could be powerful tools for investigation of these biological processes, and such compounds would have great potential as therapeutics. Unfortunately, there are few methods available for the rapid identification of compounds that disrupt protein–DNA interactions. Here we show that photonic crystal (PC) technology can be utilized to detect protein–DNA interactions, and can be used in a high-throughput screening mode to identify compounds that prevent protein–DNA binding. The PC technology is used to detect binding between protein–DNA interactions that are DNA-sequence-dependent (the bacterial toxin–antitoxin system MazEF) and those that are DNA-sequence-independent (the human apoptosis inducing factor (AIF)). The PC technology was further utilized in a screen for inhibitors of the AIF–DNA interaction, and through this screen aurin tricarboxylic acid was identified as the first in vitro inhibitor of AIF. The generality and simplicity of the photonic crystal method should enable this technology to find broad utility for identification of compounds that inhibit protein–DNA binding. PMID:18582039

  1. The detection of HBV DNA with gold-coated iron oxide nanoparticle gene probes

    NASA Astrophysics Data System (ADS)

    Xi, Dong; Luo, XiaoPing; Lu, QiangHua; Yao, KaiLun; Liu, ZuLi; Ning, Qin

    2008-03-01

    Gold-coated iron oxide nanoparticle Hepatitis B virus (HBV) DNA probes were prepared, and their application for HBV DNA measurement was studied. Gold-coated iron oxide nanoparticles were prepared by the citrate reduction of tetra-chloroauric acid in the presence of iron oxide nanoparticles which were added as seeds. With a fluorescence-based method, the maximal surface coverage of hexaethiol 30-mer oligonucleotides and the maximal percentage of hybridization strands on gold-coated iron oxide nanoparticles were (120 ± 8) oligonucleotides per nanoparticle, and (14 ± 2%), respectively, which were comparable with those of (132 ± 10) and (22 ± 3%) in Au nanoparticle groups. Large network aggregates were formed when gold-coated iron oxide nanoparticle HBV DNA gene probe was applied to detect HBV DNA molecules as evidenced by transmission electron microscopy and the high specificity was verified by blot hybridization. Our results further suggested that detecting DNA with iron oxide nanoparticles and magnetic separator was feasible and might be an alternative effective method.

  2. [Application of Liquid Biopsy for Lung Cancer Treatment.

    PubMed

    Mori, Shunsuke; Yatabe, Yasushi

    2016-05-01

    Liquid biopsy is defined as a non-invasive blood test that detects features of tumor cells, which are shed into the blood stream from the primary tumor and/or metastatic sites. This method is developing based on research on circulating tumor cells (CTCs) and the circulating free/fragments of tumor DNA (cfDNA). CfDNA can be detected in the absence of detectable CTCs, and has been shown to increase with the disease condition. The detection of cfDNA can be used for tumor genotyping, monitoring of the tumor burden, and monitoring minimal residual diseases, and recent results showed that cfDNA is a highly specific biomarker with intermediate sensitivity. Liquid biopsy with cfDNA is promising, and is becoming an alternative to re- biopsy. However, there are some caveats: it has not been elucidated which patients and tumor types can be accessed with cfDNA. Further research is warranted.

  3. Environmental DNA (eDNA) Sampling Improves Occurrence and Detection Estimates of Invasive Burmese Pythons

    PubMed Central

    Hunter, Margaret E.; Oyler-McCance, Sara J.; Dorazio, Robert M.; Fike, Jennifer A.; Smith, Brian J.; Hunter, Charles T.; Reed, Robert N.; Hart, Kristen M.

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models. PMID:25874630

  4. Environmental DNA (eDNA) sampling improves occurrence and detection estimates of invasive Burmese pythons

    USGS Publications Warehouse

    Hunter, Margaret E.; Oyler-McCance, Sara J.; Dorazio, Robert M.; Fike, Jennifer A.; Smith, Brian J.; Hunter, Charles T.; Reed, Robert N.; Hart, Kristen M.

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models.

  5. Environmental DNA (eDNA) sampling improves occurrence and detection estimates of invasive burmese pythons.

    PubMed

    Hunter, Margaret E; Oyler-McCance, Sara J; Dorazio, Robert M; Fike, Jennifer A; Smith, Brian J; Hunter, Charles T; Reed, Robert N; Hart, Kristen M

    2015-01-01

    Environmental DNA (eDNA) methods are used to detect DNA that is shed into the aquatic environment by cryptic or low density species. Applied in eDNA studies, occupancy models can be used to estimate occurrence and detection probabilities and thereby account for imperfect detection. However, occupancy terminology has been applied inconsistently in eDNA studies, and many have calculated occurrence probabilities while not considering the effects of imperfect detection. Low detection of invasive giant constrictors using visual surveys and traps has hampered the estimation of occupancy and detection estimates needed for population management in southern Florida, USA. Giant constrictor snakes pose a threat to native species and the ecological restoration of the Florida Everglades. To assist with detection, we developed species-specific eDNA assays using quantitative PCR (qPCR) for the Burmese python (Python molurus bivittatus), Northern African python (P. sebae), boa constrictor (Boa constrictor), and the green (Eunectes murinus) and yellow anaconda (E. notaeus). Burmese pythons, Northern African pythons, and boa constrictors are established and reproducing, while the green and yellow anaconda have the potential to become established. We validated the python and boa constrictor assays using laboratory trials and tested all species in 21 field locations distributed in eight southern Florida regions. Burmese python eDNA was detected in 37 of 63 field sampling events; however, the other species were not detected. Although eDNA was heterogeneously distributed in the environment, occupancy models were able to provide the first estimates of detection probabilities, which were greater than 91%. Burmese python eDNA was detected along the leading northern edge of the known population boundary. The development of informative detection tools and eDNA occupancy models can improve conservation efforts in southern Florida and support more extensive studies of invasive constrictors. Generic sampling design and terminology are proposed to standardize and clarify interpretations of eDNA-based occupancy models.

  6. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction

    NASA Astrophysics Data System (ADS)

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-01

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag+-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science.

  7. A direct detection of Escherichia coli genomic DNA using gold nanoprobes

    PubMed Central

    2012-01-01

    Background In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. Results We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction with non-Escherichia coli strains. Conclusion This work gives entry into a new class of DNA/gold nanoparticles hybrid materials which might have optical property that can be controlled for application in diagnostics. We note that it should be possible to extend this strategy easily for developing new types of DNA biosensor for point of care detection. The salient feature of this approach includes low-cost, robust reagents and simple colorimetric detection of pathogen. PMID:22309695

  8. Environmental DNA for freshwater fish monitoring: insights for conservation within a protected area

    PubMed Central

    Sandin, Miguel M.; Beaulieu, Paul G.; Clusa, Laura; Martinez, Jose L.; Ardura, Alba; García-Vázquez, Eva

    2018-01-01

    Background Many fish species have been introduced in wild ecosystems around the world to provide food or leisure, deliberately or from farm escapes. Some of those introductions have had large ecological effects. The north American native rainbow trout (Oncorhynchus mykiss Walbaum, 1792) is one of the most widely farmed fish species in the world. It was first introduced in Spain in the late 19th century for sport fishing (Elvira 1995) and nowadays is used there for both fishing and aquaculture. On the other hand, the European native brown trout (Salmo trutta L.) is catalogued as vulnerable in Spain. Detecting native and invasive fish populations in ecosystem monitoring is crucial, but it may be difficult from conventional sampling methods such as electrofishing. These techniques encompass some mortality, thus are not adequate for some ecosystems as the case of protected areas. Environmental DNA (eDNA) analysis is a sensitive and non-invasive method that can be especially useful for rare and low-density species detection and inventory in water bodies. Methods In this study we employed two eDNA based methods (qPCR and nested PCR-RFLP) to detect salmonid species from mountain streams within a protected area, The Biosphere Reserve and Natural Park of Redes (Upper Nalón Basin, Asturias, Northern Spain), where brown trout is the only native salmonid. We also measured some habitat variables to see how appropriate for salmonids the area is. The sampling area is located upstream impassable dams and contains one rainbow trout fish farm. Results Employing qPCR methodology, brown trout eDNA was detected in all the nine sampling sites surveyed, while nested PCR-RFLP method failed to detect it in two sampling points. Rainbow trout eDNA was detected with both techniques at all sites in the Nalón River’ (n1, n2 and n3). Salmonid habitat units and water quality were high from the area studied. Discussion In this study, a high quantity of rainbow trout eDNA was found upstream and downstream of a fish farm located inside a Biosphere Reserve. Unreported escapes from the fish farm are a likely explanation of these results. Since salmonid habitat is abundant and the water quality high, the establishment of rainbow trout populations would be favored should escapes occur. Environmental DNA has here proved to be a valuable tool for species detection in freshwater environments, and the probe-based qPCR highly sensitive technique for detection of scarce species. We would recommend this method for routine monitoring and early detection of introduced species within natural reserves. PMID:29527421

  9. High-speed shaking of frozen blood clots for extraction of human and malaria parasite DNA

    PubMed Central

    2011-01-01

    Background Frozen blood clots remaining after serum collection is an often disregarded source of host and pathogen DNA due to troublesome handling and suboptimal outcome. Methods High-speed shaking of clot samples in a cell disruptor manufactured for homogenization of tissue and faecal specimens was evaluated for processing frozen blood clots for DNA extraction. The method was compared to two commercial clot protocols based on a chemical kit and centrifugation through a plastic sieve, followed by the same DNA extraction protocol. Blood clots with different levels of parasitaemia (1-1,000 p/μl) were prepared from parasite cultures to assess sensitivity of PCR detection. In addition, clots retrieved from serum samples collected within two epidemiological studies in Kenya (n = 630) were processed by high speed shaking and analysed by PCR for detection of malaria parasites and the human α-thalassaemia gene. Results High speed shaking succeeded in fully dispersing the clots and the method generated the highest DNA yield. The level of PCR detection of P. falciparum parasites and the human thalassaemia gene was the same as samples optimally collected with an anticoagulant. The commercial clot protocol and centrifugation through a sieve failed to fully dissolve the clots and resulted in lower sensitivity of PCR detection. Conclusions High speed shaking was a simple and efficacious method for homogenizing frozen blood clots before DNA purification and resulted in PCR templates of high quality both from humans and malaria parasites. This novel method enables genetic studies from stored blood clots. PMID:21824391

  10. A real-time RT-PCR method to detect viable Giardia lamblia cysts in environmental waters.

    PubMed

    Baque, Robert H; Gilliam, Amy O; Robles, Liza D; Jakubowski, Walter; Slifko, Theresa R

    2011-05-01

    Currently, USEPA Method 1623 is the standard assay used for simultaneous detection of Giardia cysts and Cryptosporidium oocysts in various water matrices. However, the method is unable to distinguish between species, genotype, or to assess viability. Therefore, the objective of the present study was to address the shortcomings of USEPA Method 1623 by developing a novel molecular-based method that can assess viability of Giardia cysts in environmental waters and identify genotypes that pose a human health threat (assemblage groups A and B). Primers and TaqMan(®) probes were designed to target the beta-giardin gene in order to discriminate among species and assemblages. Viability was determined by detection of de-novo mRNA synthesis after heat induction. The beta-giardin primer/probe sets were able to detect and differentiate between Giardia lamblia assemblages A and B, and did not detect Giardia muris (mouse species) or G. lamblia assemblages C, D, E and F (non-human), with the exception of Probe A which did detect G. lamblia assemblage F DNA. Additionally, DNA or cDNA of other waterborne organisms were not detected, suggesting that the method is specific to Giardia assemblages. Assay applicability was demonstrated by detection of viable G. lamblia cysts in spiked (assemblage B) and unspiked (assemblage A and B) reclaimed water samples. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. A fast and simple method for detecting and quantifying donor-derived cell-free DNA in sera of solid organ transplant recipients as a biomarker for graft function.

    PubMed

    Adamek, Martina; Opelz, Gerhard; Klein, Katrin; Morath, Christian; Tran, Thuong Hien

    2016-07-01

    Timely detection of graft rejection is an important issue in the follow-up care after solid organ transplantation. Until now, biopsy has been considered the "gold standard" in the diagnosis of graft rejection. However, non-invasive tests such as monitoring the levels of cell-free DNA (cfDNA) as a sensitive biomarker for graft integrity have attracted increasing interest. The rationale of this approach is that a rejected organ will lead to a significant release of donor-derived cfDNA, which can be detected in the serum of the transplant recipient. We have developed a novel quantitative real-time PCR (qPCR) approach for detecting an increase of donor-derived cfDNA in the recipient's serum. Common insertion/deletion (InDel) genetic polymorphisms, which differ between donor and recipient, are targeted in our qPCR assay. In contrast to some other strategies, no specific donor/recipient constellations such as certain gender combinations or human leukocyte antigen (HLA) discrepancies are required for the application of our test. The method was first validated with serial dilutions of serum mixtures obtained from healthy blood donors and then used to determine donor-derived cfDNA levels in patients' sera within the first 3 days after their kidney transplantation had been performed. Our method represents a universally applicable, simple and cost-effective tool which can potentially be used to detect graft dysfunction in transplant recipients.

  12. High-speed shaking of frozen blood clots for extraction of human and malaria parasite DNA.

    PubMed

    Lundblom, Klara; Macharia, Alex; Lebbad, Marianne; Mohammed, Adan; Färnert, Anna

    2011-08-08

    Frozen blood clots remaining after serum collection is an often disregarded source of host and pathogen DNA due to troublesome handling and suboptimal outcome. High-speed shaking of clot samples in a cell disruptor manufactured for homogenization of tissue and faecal specimens was evaluated for processing frozen blood clots for DNA extraction. The method was compared to two commercial clot protocols based on a chemical kit and centrifugation through a plastic sieve, followed by the same DNA extraction protocol. Blood clots with different levels of parasitaemia (1-1,000 p/μl) were prepared from parasite cultures to assess sensitivity of PCR detection. In addition, clots retrieved from serum samples collected within two epidemiological studies in Kenya (n = 630) were processed by high speed shaking and analysed by PCR for detection of malaria parasites and the human α-thalassaemia gene. High speed shaking succeeded in fully dispersing the clots and the method generated the highest DNA yield. The level of PCR detection of P. falciparum parasites and the human thalassaemia gene was the same as samples optimally collected with an anticoagulant. The commercial clot protocol and centrifugation through a sieve failed to fully dissolve the clots and resulted in lower sensitivity of PCR detection. High speed shaking was a simple and efficacious method for homogenizing frozen blood clots before DNA purification and resulted in PCR templates of high quality both from humans and malaria parasites. This novel method enables genetic studies from stored blood clots.

  13. Using environmental DNA (eDNA) to determine Hellbender distribution : interim report.

    DOT National Transportation Integrated Search

    2017-03-10

    Environmental DNA (eDNA) methods are non-invasive genetic sampling in which DNA from organisms is detected via sampling of water or soil, typically for the purposes of determining the presence or absence of an organism. In this project, we have evalu...

  14. A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.

    PubMed

    Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao

    2011-10-01

    To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.

  15. Development of a Fluorescence Resonance Energy Transfer (FRET)-Based DNA Biosensor for Detection of Synthetic Oligonucleotide of Ganoderma boninense

    PubMed Central

    Mohd Bakhori, Noremylia; Yusof, Nor Azah; Abdullah, Abdul Halim; Hussein, Mohd Zobir

    2013-01-01

    An optical DNA biosensor based on fluorescence resonance energy transfer (FRET) utilizing synthesized quantum dot (QD) has been developed for the detection of specific-sequence of DNA for Ganoderma boninense, an oil palm pathogen. Modified QD that contained carboxylic groups was conjugated with a single-stranded DNA probe (ssDNA) via amide-linkage. Hybridization of the target DNA with conjugated QD-ssDNA and reporter probe labeled with Cy5 allows for the detection of related synthetic DNA sequence of Ganoderma boninense gene based on FRET signals. Detection of FRET emission before and after hybridization was confirmed through the capability of the system to produce FRET at 680 nm for hybridized sandwich with complementary target DNA. No FRET emission was observed for non-complementary system. Hybridization time, temperature and effect of different concentration of target DNA were studied in order to optimize the developed system. The developed biosensor has shown high sensitivity with detection limit of 3.55 × 10−9 M. TEM results show that the particle size of QD varies in the range between 5 to 8 nm after ligand modification and conjugation with ssDNA. This approach is capable of providing a simple, rapid and sensitive method for detection of related synthetic DNA sequence of Ganoderma boninense. PMID:25587406

  16. Quartz crystal microbalance detection of DNA single-base mutation based on monobase-coded cadmium tellurium nanoprobe.

    PubMed

    Zhang, Yuqin; Lin, Fanbo; Zhang, Youyu; Li, Haitao; Zeng, Yue; Tang, Hao; Yao, Shouzhuo

    2011-01-01

    A new method for the detection of point mutation in DNA based on the monobase-coded cadmium tellurium nanoprobes and the quartz crystal microbalance (QCM) technique was reported. A point mutation (single-base, adenine, thymine, cytosine, and guanine, namely, A, T, C and G, mutation in DNA strand, respectively) DNA QCM sensor was fabricated by immobilizing single-base mutation DNA modified magnetic beads onto the electrode surface with an external magnetic field near the electrode. The DNA-modified magnetic beads were obtained from the biotin-avidin affinity reaction of biotinylated DNA and streptavidin-functionalized core/shell Fe(3)O(4)/Au magnetic nanoparticles, followed by a DNA hybridization reaction. Single-base coded CdTe nanoprobes (A-CdTe, T-CdTe, C-CdTe and G-CdTe, respectively) were used as the detection probes. The mutation site in DNA was distinguished by detecting the decreases of the resonance frequency of the piezoelectric quartz crystal when the coded nanoprobe was added to the test system. This proposed detection strategy for point mutation in DNA is proved to be sensitive, simple, repeatable and low-cost, consequently, it has a great potential for single nucleotide polymorphism (SNP) detection. 2011 © The Japan Society for Analytical Chemistry

  17. Factors influencing detection of eDNA from a stream-dwelling amphibian

    USGS Publications Warehouse

    Pilliod, David S.; Goldberg, Caren S.; Arkle, Robert S.; Waits, Lisette P.

    2013-01-01

    Environmental DNA (eDNA) methods for detecting and estimating abundance of aquatic species are emerging rapidly, but little is known about how processes such as secretion rate, environmental degradation, and time since colonization or extirpation from a given site affect eDNA measurements. Using stream-dwelling salamanders and quantitative PCR (qPCR) analysis, we conducted three experiments to assess eDNA: (i) production rate; (ii) persistence time under different temperature and light conditions; and (iii) detectability and concentration through time following experimental introduction and removal of salamanders into previously unoccupied streams. We found that 44–50 g individuals held in aquaria produced 77 ng eDNA/h for 2 h, after which production either slowed considerably or began to equilibrate with degradation. eDNA in both full-sun and shaded treatments degraded exponentially to 2) and when samples were collected within 5 m of the animals. Concentrations of eDNA detected were very low and increased steadily from 6–24 h after introduction, reaching 0.0022 ng/L. Within 1 h of removing salamanders from the stream, eDNA was no longer detectable. These results suggest that eDNA detectability and concentration depend on production rates of individuals, environmental conditions, density of animals, and their residence time.

  18. Sensitive detection of mercury and copper ions by fluorescent DNA/Ag nanoclusters in guanine-rich DNA hybridization

    NASA Astrophysics Data System (ADS)

    Peng, Jun; Ling, Jian; Zhang, Xiu-Qing; Bai, Hui-Ping; Zheng, Liyan; Cao, Qiu-E.; Ding, Zhong-Tao

    2015-02-01

    In this work, we designed a new fluorescent oligonucleotides-stabilized silver nanoclusters (DNA/AgNCs) probe for sensitive detection of mercury and copper ions. This probe contains two tailored DNA sequence. One is a signal probe contains a cytosine-rich sequence template for AgNCs synthesis and link sequence at both ends. The other is a guanine-rich sequence for signal enhancement and link sequence complementary to the link sequence of the signal probe. After hybridization, the fluorescence of hybridized double-strand DNA/AgNCs is 200-fold enhanced based on the fluorescence enhancement effect of DNA/AgNCs in proximity of guanine-rich DNA sequence. The double-strand DNA/AgNCs probe is brighter and stable than that of single-strand DNA/AgNCs, and more importantly, can be used as novel fluorescent probes for detecting mercury and copper ions. Mercury and copper ions in the range of 6.0-160.0 and 6-240 nM, can be linearly detected with the detection limits of 2.1 and 3.4 nM, respectively. Our results indicated that the analytical parameters of the method for mercury and copper ions detection are much better than which using a single-strand DNA/AgNCs.

  19. Loop-mediated isothermal amplification assay for detection and discrimination of Toxocara canis and Toxocara cati eggs directly from sand samples.

    PubMed

    Macuhova, K; Kumagai, T; Akao, N; Ohta, N

    2010-12-01

    We developed a novel and simple method, using loop-mediated isothermal amplification (LAMP), for the detection and discrimination of Toxocara canis and Toxocara cati eggs. The new method employs 4 steps: (1) concentration of Toxocara eggs in a small amount of sand; (2) dissolution of the proteinaceous membrane of eggs and simultaneously separation of them from the sand using NaClO treatment; (3) extraction of DNA using NaOH treatment; and (4) detection of T. canis / T. cati DNA using a LAMP assay. All these steps are fast, easy to perform, and do not require expensive equipment or reagents. The novel method was tested both experimentally and in a field study. In the laboratory, we could reliably detect as few as 3 T. canis eggs in artificially contaminated sand, if the experiment was repeated twice. In the field trial, we were able to detect T. cati DNA from 4 natural sandpits having moderate to heavy contamination, although not in a single lightly contaminated sandpit. All of the examined sandpits were found to be contaminated with eggs of T. cati, but none appeared to contain T. canis. Our new method could extract DNA from T. canis and T. cati eggs directly from sand samples as well as detect and distinguish these 2 species in a few easy steps, with markedly reduced time and expense.

  20. DNA hybridization assay for detection of Salmonella in foods: collaborative study.

    PubMed

    Flowers, R S; Klatt, M J; Mozola, M A; Curiale, M S; Gabis, D A; Silliker, J H

    1987-01-01

    A collaborative study was performed in 11 laboratories to validate a DNA hybridization (DNAH) procedure for detection of Salmonella in foods. The DNAH procedure was compared to the standard culture method for detection of Salmonella in 6 foods: ground pepper, soy flour, dry whole egg, milk chocolate, nonfat dry milk, and raw deboned turkey. With the exception of turkey which was naturally contaminated, uninoculated and inoculated samples of each food group were analyzed. Results for the DNAH method were significantly better than for the standard culture method at the 5% probability level for the detection of Salmonella in turkey. There was no significant difference between the methods for the other 5 foods. The method has been adopted official first action.

  1. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay

    PubMed Central

    Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility. PMID:26544710

  2. Ultrasensitive Detection of RNA and DNA Viruses Simultaneously Using Duplex UNDP-PCR Assay.

    PubMed

    Huang, Yong; Xing, Na; Wang, Zengguo; Zhang, Xiujuan; Zhao, Xiaomin; Du, Qian; Chang, Lingling; Tong, Dewen

    2015-01-01

    Mixed infection of multiple viruses is common in modern intensive pig rearing. However, there are no methods available to detect DNA and RNA viruses in the same reaction system in preclinical level. In this study, we aimed to develop a duplex ultrasensitive nanoparticle DNA probe-based PCR assay (duplex UNDP-PCR) that was able to simultaneously detect DNA and RNA viruses in the same reaction system. PCV2 and TGEV are selected as representatives of the two different types of viruses. PCV2 DNA and TGEV RNA were simultaneously released from the serum sample by boiling with lysis buffer, then magnetic beads and gold nanoparticles coated with single and/or duplex specific probes for TGEV and PCV2 were added to form a sandwich-like complex with nucleic acids released from viruses. After magnetic separation, DNA barcodes specific for PCV2 and TGEV were eluted using DTT and characterized by specific PCR assay for specific DNA barcodes subsequently. The duplex UNDP-PCR showed similar sensitivity as that of single UNDP-PCR and was able to detect 20 copies each of PCV2 and TGEV in the serum, showing approximately 250-fold more sensitivity than conventional duplex PCR/RT-PCR assays. No cross-reaction was observed with other viruses. The positive detection rate of single MMPs- and duplex MMPs-based duplex UNDP-PCR was identical, with 29.6% for PCV2, 9.3% for TGEV and 3.7% for PCV2 and TGEV mixed infection. This duplex UNDP-PCR assay could detect TGEV (RNA virus) and PCV2 (DNA virus) from large-scale serum samples simultaneously without the need for DNA/RNA extraction, purification and reverse transcription of RNA, and showed a significantly increased positive detection rate for PCV2 (29%) and TGEV (11.7%) preclinical infection than conventional duplex PCR/RT-PCR. Therefore, the established duplex UNDP-PCR is a rapid and economical detection method, exhibiting high sensitivity, specificity and reproducibility.

  3. Droplet digital polymerase chain reaction (PCR) outperforms real-time PCR in the detection of environmental DNA from an invasive fish species.

    PubMed

    Doi, Hideyuki; Takahara, Teruhiko; Minamoto, Toshifumi; Matsuhashi, Saeko; Uchii, Kimiko; Yamanaka, Hiroki

    2015-05-05

    Environmental DNA (eDNA) has been used to investigate species distributions in aquatic ecosystems. Most of these studies use real-time polymerase chain reaction (PCR) to detect eDNA in water; however, PCR amplification is often inhibited by the presence of organic and inorganic matter. In droplet digital PCR (ddPCR), the sample is partitioned into thousands of nanoliter droplets, and PCR inhibition may be reduced by the detection of the end-point of PCR amplification in each droplet, independent of the amplification efficiency. In addition, real-time PCR reagents can affect PCR amplification and consequently alter detection rates. We compared the effectiveness of ddPCR and real-time PCR using two different PCR reagents for the detection of the eDNA from invasive bluegill sunfish, Lepomis macrochirus, in ponds. We found that ddPCR had higher detection rates of bluegill eDNA in pond water than real-time PCR with either of the PCR reagents, especially at low DNA concentrations. Limits of DNA detection, which were tested by spiking the bluegill DNA to DNA extracts from the ponds containing natural inhibitors, found that ddPCR had higher detection rate than real-time PCR. Our results suggest that ddPCR is more resistant to the presence of PCR inhibitors in field samples than real-time PCR. Thus, ddPCR outperforms real-time PCR methods for detecting eDNA to document species distributions in natural habitats, especially in habitats with high concentrations of PCR inhibitors.

  4. High prevalence of mutant KRAS in circulating exosome-derived DNA from early-stage pancreatic cancer patients

    PubMed Central

    Allenson, K.; Castillo, J.; San Lucas, F. A.; Scelo, G.; Kim, D. U.; Bernard, V.; Davis, G.; Kumar, T.; Katz, M.; Overman, M. J.; Foretova, L.; Fabianova, E.; Holcatova, I.; Janout, V.; Meric-Bernstam, F.; Gascoyne, P.; Wistuba, I.; Varadhachary, G.; Brennan, P.; Hanash, S.; Li, D.; Maitra, A.; Alvarez, H.

    2017-01-01

    Background Exosomes arise from viable cancer cells and may reflect a different biology than circulating cell-free DNA (cfDNA) shed from dying tissues. We compare exosome-derived DNA (exoDNA) to cfDNA in liquid biopsies of patients with pancreatic ductal adenocarcinoma (PDAC). Patients and methods Patient samples were obtained between 2003 and 2010, with clinically annotated follow up to 2015. Droplet digital PCR was performed on exoDNA and cfDNA for sensitive detection of KRAS mutants at codons 12/13. A cumulative series of 263 individuals were studied, including a discovery cohort of 142 individuals: 68 PDAC patients of all stages; 20 PDAC patients initially staged with localized disease, with blood drawn after resection for curative intent; and 54 age-matched healthy controls. A validation cohort of 121 individuals (39 cancer patients and 82 healthy controls) was studied to validate KRAS detection rates in early-stage PDAC patients. Primary outcome was circulating KRAS status as detected by droplet digital PCR. Secondary outcomes were disease-free and overall survival. Results KRAS mutations in exoDNA, were identified in 7.4%, 66.7%, 80%, and 85% of age-matched controls, localized, locally advanced, and metastatic PDAC patients, respectively. Comparatively, mutant KRAS cfDNA was detected in 14.8%, 45.5%, 30.8%, and 57.9% of these individuals. Higher exoKRAS MAFs were associated with decreased disease-free survival in patients with localized disease. In the validation cohort, mutant KRAS exoDNA was detected in 43.6% of early-stage PDAC patients and 20% of healthy controls. Conclusions Exosomes are a distinct source of tumor DNA that may be complementary to other liquid biopsy DNA sources. A higher percentage of patients with localized PDAC exhibited detectable KRAS mutations in exoDNA than previously reported for cfDNA. A substantial minority of healthy samples demonstrated mutant KRAS in circulation, dictating careful consideration and application of liquid biopsy findings, which may limit its utility as a broad cancer-screening method. PMID:28104621

  5. Gold nanoparticle-based probes for the colorimetric detection of Mycobacterium avium subspecies paratuberculosis DNA.

    PubMed

    Ganareal, Thenor Aristotile Charles S; Balbin, Michelle M; Monserate, Juvy J; Salazar, Joel R; Mingala, Claro N

    2018-02-12

    Gold nanoparticle (AuNP) is considered to be the most stable metal nanoparticle having the ability to be functionalized with biomolecules. Recently, AuNP-based DNA detection methods captured the interest of researchers worldwide. Paratuberculosis or Johne's disease, a chronic gastroenteritis in ruminants caused by Mycobacterium avium subsp. paratuberculosis (MAP), was found to have negative effect in the livestock industry. In this study, AuNP-based probes were evaluated for the specific and sensitive detection of MAP DNA. AuNP-based probe was produced by functionalization of AuNPs with thiol-modified oligonucleotide and was confirmed by Fourier-Transform Infrared (FTIR) spectroscopy. UV-Vis spectroscopy and Scanning Electron Microscopy (SEM) were used to characterize AuNPs. DNA detection was done by hybridization of 10 μL of DNA with 5 μL of probe at 63 °C for 10 min and addition of 3 μL salt solution. The method was specific to MAP with detection limit of 103 ng. UV-Vis and SEM showed dispersion and aggregation of the AuNPs for the positive and negative results, respectively, with no observed particle growth. This study therefore reports an AuNP-based probes which can be used for the specific and sensitive detection of MAP DNA. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Rapid detection of Cyprinid herpesvirus-3 (CyHV-3) using a gold nanoparticle-based hybridization assay.

    PubMed

    Saleh, Mona; El-Matbouli, Mansour

    2015-06-01

    Cyprinid herpesvirus-3 (CyHV-3) is a highly infectious pathogen that causes fatal disease in common and koi carp Cyprinus carpio L. CyHV-3 detection is usually based on virus propagation or amplification of the viral DNA using the PCR or LAMP techniques. However, due to the limited susceptibility of cells used for propagation, it is not always possible to successfully isolate CyHV-3 even from tissue samples that have high virus titres. All previously described detection methods including PCR-based assays are time consuming, laborious and require specialized equipment. To overcome these limitations, gold nanoparticles (AuNPs) have been explored for direct and sensitive detection of DNA. In this study, a label-free colorimetric nanodiagnostic method for direct detection of unamplified CyHV-3 DNA using gold nanoparticles is introduced. Under appropriate conditions, DNA probes hybridize with their complementary target sequences in the sample DNA, which results in aggregation of the gold nanoparticles and a concomitant colour change from red to blue, whereas test samples with non complementary DNA sequences remain red. In this study, gold nanoparticles were used to develop and evaluate a specific and sensitive hybridization assay for direct and rapid detection of the highly infectious pathogen termed Cyprinid herpesvirus-3. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Low-cost label-free electrical detection of artificial DNA nanostructures using solution-processed oxide thin-film transistors.

    PubMed

    Kim, Si Joon; Jung, Joohye; Lee, Keun Woo; Yoon, Doo Hyun; Jung, Tae Soo; Dugasani, Sreekantha Reddy; Park, Sung Ha; Kim, Hyun Jae

    2013-11-13

    A high-sensitivity, label-free method for detecting deoxyribonucleic acid (DNA) using solution-processed oxide thin-film transistors (TFTs) was developed. Double-crossover (DX) DNA nanostructures with different concentrations of divalent Cu ion (Cu(2+)) were immobilized on an In-Ga-Zn-O (IGZO) back-channel surface, which changed the electrical performance of the IGZO TFTs. The detection mechanism of the IGZO TFT-based DNA biosensor is attributed to electron trapping and electrostatic interactions caused by negatively charged phosphate groups on the DNA backbone. Furthermore, Cu(2+) in DX DNA nanostructures generates a current path when a gate bias is applied. The direct effect on the electrical response implies that solution-processed IGZO TFTs could be used to realize low-cost and high-sensitivity DNA biosensors.

  8. Surveyor nuclease detection of mutations and polymorphisms of mtDNA in children.

    PubMed

    Pilch, Jacek; Asman, Marek; Jamroz, Ewa; Kajor, Maciej; Kotrys-Puchalska, Elżbieta; Goss, Małgorzata; Krzak, Maria; Witecka, Joanna; Gmiński, Jan; Sieroń, Aleksander L

    2010-11-01

    Mitochondrial encephalomyopathies are complex disorders with wide range of clinical manifestations. Particularly time-consuming is the identification of mutations in mitochondrial DNA. A group of 20 children with clinical manifestations of mitochondrial encephalomyopathies was selected for molecular studies. The aims were (a) to identify mutations in mtDNA isolated from muscle and (b) to verify detected mutations in DNA isolated from blood, in order to assess the utility of a Surveyor nuclease assay kit for patient screening. The most common changes found were polymorphisms, including a few missense mutations altering the amino acid sequence of mitochondrial proteins. In two boys with MELAS (i.e., mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes), a mutation A→G3243 was detected in the tRNALeu gene of mtDNA isolated from muscle and blood. In one boy, the carrier status of his mother was confirmed, based on molecular analysis of DNA isolated from blood. A method using Surveyor nuclease allows systematic screening for small mutations in mtDNA, using as its source blood of the patients and asymptomatic carriers. The method still requires confirmation studying a larger group. In some patients, the use of this method should precede and might limit indications for traumatic muscle and skin biopsy. Copyright © 2010 Elsevier Inc. All rights reserved.

  9. Detection of processed genetically modified food using CIM monolithic columns for DNA isolation.

    PubMed

    Jerman, Sergej; Podgornik, Ales; Cankar, Katarina; Cadet, Neza; Skrt, Mihaela; Zel, Jana; Raspor, Peter

    2005-02-11

    The availability of sufficient quantities of DNA of adequate quality is crucial in polymerase chain reaction (PCR)-based methods for genetically modified food detection. In this work, the suitability of anion-exchange CIM (Convective Interaction Media; BIA Separations, Ljubljana, Slovenia) monolithic columns for isolation of DNA from food was studied. Maize and its derivates corn meal and thermally pretreated corn meal were chosen as model food. Two commercially available CIM disk columns were tested: DEAE (diethylaminoethyl) and QA (quaternary amine). Preliminary separations were performed with standard solution of salmon DNA at different pH values and different NaCl concentrations in mobile phase. DEAE groups and pH 8 were chosen for further isolations of DNA from a complex matrix-food extract. The quality and quantity of isolated DNA were tested on agarose gel electrophoresis, with UV-scanning spectrophotometry, and by amplification with real-time PCR. DNA isolated in this way was of suitable quality for further PCR analyses. The described method is also applicable for DNA isolation from processed foods with decreased DNA content. Furthermore, it is more effective and less time-consuming in comparison with the existing proposed methods for isolation of DNA from plant-derived foods.

  10. Detection of heteroplasmy in individual mitochondrial particles

    PubMed Central

    Poe, Bobby G.; Duffy, Ciarán F.; Greminger, Michael A.; Nelson, Bradley J.

    2011-01-01

    Mitochondrial DNA (mtDNA) mutations have been associated with disease and aging. Since each cell has thousands of mtDNA copies, clustered into nucleoids of five to ten mtDNA molecules each, determining the effects of a given mtDNA mutation and their connection with disease phenotype is not straightforward. It has been postulated that heteroplasmy (coexistence of mutated and wild-type DNA) follows simple probability rules dictated by the random distribution of mtDNA molecules at the nucleoid level. This model has been used to explain how mutation levels correlate with the onset of disease phenotype and loss of cellular function. Nonetheless, experimental evidence of heteroplasmy at the nucleoid level is scarce. Here, we report a new method to determine heteroplasmy of individual mitochondrial particles containing one or more nucleoids. The method uses capillary cytometry with laser-induced fluorescence detection to detect individual mitochondrial particles stained with PicoGreen, which makes it possible to quantify the mtDNA copy number of each particle. After detection, one or more particles are collected into polymerase chain reaction (PCR) wells and then subjected to real-time multiplexed PCR amplification. This PCR strategy is suitable to obtain the relative abundance of mutated and wild-type mtDNA. The results obtained here indicate that individual mitochondrial particles and nucleoids contained within these particles are not heteroplasmic. The results presented here suggest that current models of mtDNA segregation and distribution (i.e., heteroplasmic nucleoids) need further consideration. PMID:20467729

  11. Diagnosis of amphimeriasis by LAMPhimerus assay in human stool samples long-term storage onto filter paper

    PubMed Central

    Calvopiña, Manuel; Buendía-Sánchez, María; López-Abán, Julio; Vicente, Belén; Muro, Antonio

    2018-01-01

    Amphimeriasis, a fish-borne zoonotic disease caused by the liver fluke Amphimerus spp., has recently been reported as an emerging disease affecting an indigenous Ameridian group, the Chachi, living in Ecuador. The only method for diagnosing amphimeriasis was the microscopic detection of eggs from the parasite in patients' stool samples with very low sensitivity. Our group developed an ELISA technique for detection of anti-Amphimerus IgG in human sera and a molecular method based on LAMP technology (named LAMPhimerus) for specific and sensitive parasite DNA detection. The LAMPhimerus method showed to be much more sensitive than classical parasitological methods for amphimeriasis diagnosis using human stool samples for analysis. The objective of this work is to demonstrate the feasibility of using dried stool samples on filter paper as source of DNA in combination with the effectiveness of our previously designed LAMPhimerus assay for successfully Amphimerus sp. detection in clinical stool samples. A total of 102 untreated and undiluted stool samples collected from Chachi population were spread as thin layer onto common filter paper for easily transportation to our laboratory and stored at room temperature for one year until DNA extraction. When LAMPhimerus method was applied for Amphimerus sp. DNA detection, a higher number of positive results was detected (61/102; 59.80%) in comparison to parasitological methods (38/102; 37.25%), including 28/61 (45.90%) microscopy-confirmed Amphimerus sp. infections. The diagnostic parameters for the sensitivity and specificity werecalculated for our LAMPhimerus assay, which were 79.17% and 65.98%, respectively. We demonstrate, for the first time, that common filter paper is useful for easy collection and long-term storage of human stool samples for later DNA extraction and molecular analysis of human-parasitic trematode eggs. This simple, economic and easily handling method combined with the specific and sensible LAMPhimerus assay has the potential to beused as an effective molecular large-scale screening test for amphimeriasis-endemic areas. PMID:29444135

  12. Sensitive diagnosis of cutaneous leishmaniasis by lesion swab sampling coupled to qPCR

    PubMed Central

    ADAMS, EMILY R.; GOMEZ, MARIA ADELAIDA; SCHESKE, LAURA; RIOS, RUBY; MARQUEZ, RICARDO; COSSIO, ALEXANDRA; ALBERTINI, AUDREY; SCHALLIG, HENK; SARAVIA, NANCY GORE

    2015-01-01

    SUMMARY Variation in clinical accuracy of molecular diagnostic methods for cutaneous leishmaniasis (CL) is commonly observed depending on the sample source, the method of DNA recovery and the molecular test. Few attempts have been made to compare these variables. Two swab and aspirate samples from lesions of patients with suspected CL (n = 105) were evaluated alongside standard diagnosis by microscopic detection of amastigotes or culture of parasites from lesion material. Three DNA extraction methods were compared: Qiagen on swab and aspirate specimens, Isohelix on swabs and Boil/Spin of lesion aspirates. Recovery of Leishmania DNA was evaluated for each sample type by real-time polymerase chain reaction detection of parasitic 18S rDNA, and the diagnostic accuracy of the molecular method determined. Swab sampling combined with Qiagen DNA extraction was the most efficient recovery method for Leishmania DNA, and was the most sensitive (98%; 95% CI: 91–100%) and specific (84%; 95% CI: 64–95%) approach. Aspirated material was less sensitive at 80% (95% CI: 70–88%) and 61% (95% CI: 50–72%) when coupled to Qiagen or Boil-Spin DNA extraction, respectively. Swab sampling of lesions was painless, simple to perform and coupled with standardized DNA extraction enhances the feasibility of molecular diagnosis of CL. PMID:25111885

  13. Detection of low-level DNA mutation by ARMS-blocker-Tm PCR.

    PubMed

    Qu, Shoufang; Liu, Licheng; Gan, Shuzhen; Feng, Huahua; Zhao, Jingyin; Zhao, Jing; Liu, Qi; Gao, Shangxiang; Chen, Weijun; Wang, Mengzhao; Jiang, Yongqiang; Huang, Jie

    2016-02-01

    Low-level DNA mutations play important roles in cancer prognosis and treatment. However, most existing methods for the detection of low-level DNA mutations are insufficient for clinical applications because of the high background of wild-type DNA. In this study, a novel assay based on Tm-dependent inhibition of wild type template amplification was developed. The defining characteristic of this assay is an additional annealing step was introduced into the ARMS-blocker PCR. The temperature of this additional annealing step is equal to the Tm of the blocker. Due to this additional annealing step, the blocker can preferentially and specifically bind the wild-type DNA. Thus, the inhibition of wild type template is realized and the mutant DNA is enriched. The sensitivity of this assay was between 10(-4) and 10(-5), which is approximately 5 to 10 times greater than the sensitivity of the assay without the additional annealing step. To evaluate the performance of this assay in detecting K-ras mutation, we analyzed 100 formalin-fixed paraffin-embedded (FFPE) specimens from colorectal cancer patients using this new assay and Sanger sequencing. Of the clinical samples, 27 samples were positive for K-ras mutation by both methods. Our results indicated that this new assay is a highly selective, convenient, and economical method for detecting rare mutations in the presence of higher concentrations of wild-type DNA. Copyright © 2015 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  14. A paralleled readout system for an electrical DNA-hybridization assay based on a microstructured electrode array

    NASA Astrophysics Data System (ADS)

    Urban, Matthias; Möller, Robert; Fritzsche, Wolfgang

    2003-02-01

    DNA analytics is a growing field based on the increasing knowledge about the genome with special implications for the understanding of molecular bases for diseases. Driven by the need for cost-effective and high-throughput methods for molecular detection, DNA chips are an interesting alternative to more traditional analytical methods in this field. The standard readout principle for DNA chips is fluorescence based. Fluorescence is highly sensitive and broadly established, but shows limitations regarding quantification (due to signal and/or dye instability) and the need for sophisticated (and therefore high-cost) equipment. This article introduces a readout system for an alternative detection scheme based on electrical detection of nanoparticle-labeled DNA. If labeled DNA is present in the analyte solution, it will bind on complementary capture DNA immobilized in a microelectrode gap. A subsequent metal enhancement step leads to a deposition of conductive material on the nanoparticles, and finally an electrical contact between the electrodes. This detection scheme offers the potential for a simple (low-cost as well as robust) and highly miniaturizable method, which could be well-suited for point-of-care applications in the context of lab-on-a-chip technologies. The demonstrated apparatus allows a parallel readout of an entire array of microstructured measurement sites. The readout is combined with data-processing by an embedded personal computer, resulting in an autonomous instrument that measures and presents the results. The design and realization of such a system is described, and first measurements are presented.

  15. A Targeted Q-PCR-Based Method for Point Mutation Testing by Analyzing Circulating DNA for Cancer Management Care.

    PubMed

    Thierry, Alain R

    2016-01-01

    Circulating cell-free DNA (cfDNA) is a valuable source of tumor material available with a simple blood sampling enabling a noninvasive quantitative and qualitative analysis of the tumor genome. cfDNA is released by tumor cells and exhibits the genetic and epigenetic alterations of the tumor of origin. Circulating cell-free DNA (cfDNA) analysis constitutes a hopeful approach to provide a noninvasive tumor molecular test for cancer patients. Based upon basic research on the origin and structure of cfDNA, new information on circulating cell-free DNA (cfDNA) structure, and specific determination of cfDNA fragmentation and size, we revisited Q-PCR-based method and recently developed a the allele-specific-Q-PCR-based method with blocker (termed as Intplex) which is the first multiplexed test for cfDNA. This technique, named Intplex(®) and based on a refined Q-PCR method, derived from critical observations made on the specific structure and size of cfDNA. It enables the simultaneous determination of five parameters: the cfDNA total concentration, the presence of a previously known point mutation, the mutant (tumor) cfDNA concentration (ctDNA), the proportion of mutant cfDNA, and the cfDNA fragmentation index. Intplex(®) has enabled the first clinical validation of ctDNA analysis in oncology by detecting KRAS and BRAF point mutations in mCRC patients and has demonstrated that a blood test could replace tumor section analysis for the detection of KRAS and BRAF mutations. The Intplex(®) test can be adapted to all mutations, genes, or cancers and enables rapid, highly sensitive, cost-effective, and repetitive analysis. As regards to the determination of mutations on cfDNA Intplex(®) is limited to the mutational status of known hotspot mutation; it is a "targeted approach." However, it offers the opportunity in detecting quantitatively and dynamically mutation and could constitute a noninvasive attractive tool potentially allowing diagnosis, prognosis, theranostics, therapeutic monitoring, and follow-up of cancer patients expanding the scope of personalized cancer medicine.

  16. Colorimetric detection of DNA damage by using hemin-graphene nanocomposites

    NASA Astrophysics Data System (ADS)

    Wei, W.; Zhang, D. M.; Yin, L. H.; Pu, Y. P.; Liu, S. Q.

    2013-04-01

    A colorimetric method for detection of DNA damage was developed by using hemin-graphene nanosheets (H-GNs). H-GNs were skillfully synthesized by adsorping of hemin on graphene through π-π interactions. The as-prepared H-GNs possessed both the ability of graphene to differentiate the damage DNA from intact DNA and the catalytic action of hemin. The damaged DNA made H-GNs coagulated to different degrees from the intact DNA because there were different amount of negative charge exposed on their surface, which made a great impact on the solubility of H-GNs. As a result, the corresponding centrifugal supernatant of H-GNs solution showed different color in the presence of 3,3',5,5'-tetramethylbenzidine (TMB) and H2O2, which could be discriminated by naked eyes or by ultraviolet (UV)-visible spectrometer. Based on this, the damaged effects of styrene oxide (SO), NaAsO2 and UV radiation on DNA were studied. Results showed that SO exerted most serious damage effect on DNA although all of them damaged DNA seriously. The new method for detection of DNA damage showed good prospect in the evaluation of genotoxicity of new compounds, the maximum limit of pesticide residue, food additives, and so on, which is important in the fields of food science, pharmaceutical science and pesticide science.

  17. Exploring mechanisms of transport and persistence of environmental DNA (eDNA)

    NASA Astrophysics Data System (ADS)

    Shogren, A.; Tank, J. L.; Riis, T.; Rosi, E. J.; Bolster, D.

    2017-12-01

    Sampling for eDNA is a non-intrusive method to detect species presence without direct observation, which allows for earlier detection and more rapid response than conventional sampling methods. However, our current understanding of how eDNA is transported and persists in flowing waters (e.g., streams and rivers) remains imprecise; in flowing waters, the target organism may be some distance away from where the eDNA in water is collected. It is uncertain how the unique transport properties of suspended eDNA or the inherent heterogeneity of natural flowing systems may impact the probability of downstream eDNA detection. To improve understanding of eDNA fate, we first conducted experimental releases and modeled the impact of benthic substrate heterogeneity and size on eDNA transport and retention in streams. We also used recirculating artificial streams to constrain estimates of eDNA degradation in systems with varying flow and microbial biofilm coverage. We found that eDNA retention in streams is substrate-specific, and that streambed hydraulics have significant influence on how far eDNA is transported downstream. Through the degradation experiments, we found that eDNA degradation is strongly context dependent, but even in systems with low velocity, eDNA can remain detectable in the water column >24hrs after introduction. This differential persistence of eDNA particles confirms that eDNA dynamics in flowing waters are not constant along a spatial continuum, which complicates interpretation of a positive detection in flowing waters, which presents a scaling problem for future modeling efforts to support transport predictions. To test our experimental results in a natural system, we compared our previous estimates for eDNA transport, retention, and degradation to field data collected during a longitudinal field survey for zebra mussel eDNA on the Gudena River in Silkeborg, Denmark. We found that though heterogeneity indeed complicates scaling efforts to extrapolate results from small experimental streams to larger natural systems, we can use the small-scale experiments to improve how we interpret spatial variation in eDNA signal in larger scale flowing systems.

  18. Inhibition of recombinase polymerase amplification by background DNA: a lateral flow-based method for enriching target DNA.

    PubMed

    Rohrman, Brittany; Richards-Kortum, Rebecca

    2015-02-03

    Recombinase polymerase amplification (RPA) may be used to detect a variety of pathogens, often after minimal sample preparation. However, previous work has shown that whole blood inhibits RPA. In this paper, we show that the concentrations of background DNA found in whole blood prevent the amplification of target DNA by RPA. First, using an HIV-1 RPA assay with known concentrations of nonspecific background DNA, we show that RPA tolerates more background DNA when higher HIV-1 target concentrations are present. Then, using three additional assays, we demonstrate that the maximum amount of background DNA that may be tolerated in RPA reactions depends on the DNA sequences used in the assay. We also show that changing the RPA reaction conditions, such as incubation time and primer concentration, has little effect on the ability of RPA to function when high concentrations of background DNA are present. Finally, we develop and characterize a lateral flow-based method for enriching the target DNA concentration relative to the background DNA concentration. This sample processing method enables RPA of 10(4) copies of HIV-1 DNA in a background of 0-14 μg of background DNA. Without lateral flow sample enrichment, the maximum amount of background DNA tolerated is 2 μg when 10(6) copies of HIV-1 DNA are present. This method requires no heating or other external equipment, may be integrated with upstream DNA extraction and purification processes, is compatible with the components of lysed blood, and has the potential to detect HIV-1 DNA in infant whole blood with high proviral loads.

  19. Integrated DNA walking system to characterize a broad spectrum of GMOs in food/feed matrices.

    PubMed

    Fraiture, Marie-Alice; Herman, Philippe; Lefèvre, Loic; Taverniers, Isabel; De Loose, Marc; Deforce, Dieter; Roosens, Nancy H

    2015-08-14

    In order to provide a system fully integrated with qPCR screening, usually used in GMO routine analysis, as well as being able to detect, characterize and identify a broad spectrum of GMOs in food/feed matrices, two bidirectional DNA walking methods targeting p35S or tNOS, the most common transgenic elements found in GM crops, were developed. These newly developed DNA walking methods are completing the previously implemented DNA walking method targeting the t35S pCAMBIA element. Food/feed matrices containing transgenic crops (Bt rice or MON863 maize) were analysed using the integrated DNA walking system. First, the newly developed DNA walking methods, anchored on the sequences used for the p35S or tNOS qPCR screening, were tested on Bt rice that contains these two transgenic elements. Second, the methods were assessed on a maize sample containing a low amount of the GM MON863 event, representing a more complex matrix in terms of genome size and sensitivity. Finally, to illustrate its applicability in GMO routine analysis by enforcement laboratories, the entire workflow of the integrated strategy, including qPCR screening to detect the potential presence of GMOs and the subsequent DNA walking methods to characterize and identify the detected GMOs, was applied on a GeMMA Scheme Proficiency Test matrix. Via the characterization of the transgene flanking region between the transgenic cassette and the plant genome as well as of a part of the transgenic cassette, the presence of GMOs was properly confirmed or infirmed in all tested samples. Due to their simple procedure and their short time-frame to get results, the developed DNA walking methods proposed here can be easily implemented in GMO routine analysis by the enforcement laboratories. In providing crucial information about the transgene flanking regions and/or the transgenic cassettes, this DNA walking strategy is a key molecular tool to prove the presence of GMOs in any given food/feed matrix.

  20. Development of fluorescent methods for DNA methyltransferase assay

    NASA Astrophysics Data System (ADS)

    Li, Yueying; Zou, Xiaoran; Ma, Fei; Tang, Bo; Zhang, Chun-yang

    2017-03-01

    DNA methylation modified by DNA methyltransferase (MTase) plays an important role in regulating gene transcription, cell growth and proliferation. The aberrant DNA MTase activity may lead to a variety of human diseases including cancers. Therefore, accurate and sensitive detection of DNA MTase activity is crucial to biomedical research, clinical diagnostics and therapy. However, conventional DNA MTase assays often suffer from labor-intensive operations and time-consuming procedures. Alternatively, fluorescent methods have significant advantages of simplicity and high sensitivity, and have been widely applied for DNA MTase assay. In this review, we summarize the recent advances in the development of fluorescent methods for DNA MTase assay. These emerging methods include amplification-free and the amplification-assisted assays. Moreover, we discuss the challenges and future directions of this area.

  1. Detection of fecal bacteria and source tracking identifiers in environmental waters using rRNA-based RT-qPCR and rDNA-based qPCR assays

    EPA Science Inventory

    The identification of fecal pollution sources is commonly performed using DNA-based methods. However, there is evidence that DNA can be associated with dead cells or present as “naked DNA” in the environment. To this end, we compared the detection frequency of host specific marke...

  2. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, Richard A.; Huang, Xiaohua C.; Quesada, Mark A.

    1995-01-01

    A DNA sequencing method described which uses single lane or channel electrophoresis. Sequencing fragments are separated in said lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radio-isotope labels.

  3. Human Papillomavirus (HPV) Infection in Squamous Cell Carcinomas Arising From the Oropharynx: Detection of HPV DNA and p16 Immunohistochemistry as Diagnostic and Prognostic Indicators—A Pilot Study

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bussu, Francesco, E-mail: francesco.bussu.md@gmail.com; Sali, Michela; Gallus, Roberto

    Purpose: Human papillomavirus (HPV) 16 infection is associated with oropharyngeal carcinogenesis and is likely the cause of the reported increase in disease incidence. We evaluated the prevalence of HPV infection and the reliability of different diagnostic tools using primary tumor samples from a cohort of 50 patients. Methods and Materials: Formalin-fixed paraffin-embedded (FFPE) tumor samples were collected from all 50 consecutive primary oropharyngeal SCC patients who were enrolled in the study; fresh tumor samples were available in 22 cases. NucliSENS EasyQ HPVv1 was used for RNA, and Digene Hybrid Capture-2(HC2) was used for DNA detection. p16 Expression was evaluated bymore » immunohistochemistry in FPPE specimens. Results: Based on the DNA detection assay on FFPE samples, the frequency of high-risk HPV infection was 32%. The agreement rate between HPV RNA and HPV DNA detection in fresh samples was 100%. The agreement rate between p16 immunohistochemistry (IHC) and the detection of HPV DNA in the FFPE samples was fair but not excellent (κ = 0.618). HPV DNA detection was highly significant, as measured by disease-specific survival and determined using a Wilcoxon test (P=.001). p16 IHC also exhibited a prognostic value but with a lower statistical significance (P=.0475). The detection of HPV DNA, but not p16 IHC, was also significantly correlated with locoregional control (P=.0461). Conclusion: Diagnostic methods based on the detection of HPV nucleic acids appear to be more reliable and objective because they do not require reading by a trained histopathologist. Furthermore, the detection of HPV DNA exhibits an improved correlation with survival, and therefore appears definitely more reliable than p16 IHC for routine use in clinical practice.« less

  4. SNPase-ARMS qPCR: Ultrasensitive Mutation-Based Detection of Cell-Free Tumor DNA in Melanoma Patients

    PubMed Central

    Stadler, Julia; Eder, Johanna; Pratscher, Barbara; Brandt, Sabine; Schneller, Doris; Müllegger, Robert; Vogl, Claus; Trautinger, Franz; Brem, Gottfried; Burgstaller, Joerg P.

    2015-01-01

    Cell-free circulating tumor DNA in the plasma of cancer patients has become a common point of interest as indicator of therapy options and treatment response in clinical cancer research. Especially patient- and tumor-specific single nucleotide variants that accurately distinguish tumor DNA from wild type DNA are promising targets. The reliable detection and quantification of these single-base DNA variants is technically challenging. Currently, a variety of techniques is applied, with no apparent “gold standard”. Here we present a novel qPCR protocol that meets the conditions of extreme sensitivity and specificity that are required for detection and quantification of tumor DNA. By consecutive application of two polymerases, one of them designed for extreme base-specificity, the method reaches unprecedented sensitivity and specificity. Three qPCR assays were tested with spike-in experiments, specific for point mutations BRAF V600E, PTEN T167A and NRAS Q61L of melanoma cell lines. It was possible to detect down to one copy of tumor DNA per reaction (Poisson distribution), at a background of up to 200 000 wild type DNAs. To prove its clinical applicability, the method was successfully tested on a small cohort of BRAF V600E positive melanoma patients. PMID:26562020

  5. Attomolar quantitation of Mycobacterium tuberculosis by asymmetric helicase-dependent isothermal DNA-amplification and electrochemical detection.

    PubMed

    Barreda-García, Susana; González-Álvarez, María José; de-Los-Santos-Álvarez, Noemí; Palacios-Gutiérrez, Juan José; Miranda-Ordieres, Arturo J; Lobo-Castañón, María Jesús

    2015-06-15

    A highly sensitive and robust method for the quantification of specific DNA sequences based on coupling asymmetric helicase-dependent DNA amplification to electrochemical detection is described. This method relies on the entrapment of the amplified ssDNA sequences on magnetic beads followed by a post-amplification hybridization assay to provide an added degree of specificity. As a proof-of-concept a 84-bases long sequence specific of Mycobacterium tuberculosis is amplified at 65°C, providing 3×10(6) amplification after 90 min. Using this system 0.5 aM, corresponding to 15 copies of the target gene in 50 µL of sample, can be successfully detected and reliably quantified under isothermal conditions in less than 4h. The assay has been applied to the detection of M. tuberculosis in sputum, pleural fluid and urine samples. Besides this application, the proposed assays is a powerful and general tool for molecular diagnostic that can be applied to the detection of other specific DNA sequences, taking full advantage of the plethora of genomic information now available. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Synthesis of zinc oxide thin films prepared by sol-gel for specific bioactivity

    NASA Astrophysics Data System (ADS)

    Adam, Tijjani; Basri, B.; Dhahi, Th. S.; Mohammed, Mohammed; Hashim, U.; Noriman, N. Z.; Dahham, Omar S.

    2017-09-01

    Zinc oxide (ZnO) thin films this device to used for many application like chemical sensor, biosensor, solar energy, etc but my project to use for bioactivity(biosensor). Zinc oxide (ZnO) thin films have been grown using sol-gel technique. Characterization was done using Scanning Electron Microscope (SEM), Energy Dispersive X-ray(EDX) and Electrical Measurement(I-V). ZnO thin film was successfully synthesized using low cost sol-gel spin coating method. The coupling of DNA probe to ZnO thin film supports modified with carboxylic acid (COOH) is certainly the best practical method to make DNA immobilization and it does not require any coupling agent which could be a source of variability during the spotting with an automatic device. So, selected this coupling procedure for further experiments. The sensor was tested with initial trial with low concentrated DNA and able to detect detection of the disease effectively. Silicon-on-insulator (SOI) wafer device with ZnO can detect at different concentration in order to valid the device capabilities for detecting development. The lowest concentration 1 µM HPV DNA probe can detect is 0.1 nM HPV target DNA.

  7. Detection of Alternaria fungal contamination in cereal grains by a polymerase chain reaction-based assay.

    PubMed

    Zur, Gideon; Shimoni, Eyal; Hallerman, Eric; Kashi, Yechezkel

    2002-09-01

    Alternaria sp. are important fungal contaminants of grain products; they secrete four structural classes of compounds that are toxic or carcinogenic to plants and animals and cause considerable economic losses to growers and the food-processing industry. Alternaria toxins have been detected by high-performance liquid chromatography (HPLC), enzyme-linked immunosorbent assay, and other techniques. Here, we report the development of a polymerase chain reaction (PCR)-based method for the detection of Alternaria DNA. PCR primers were designed to anneal to the ITS1 and ITS2 regions of the 5.8S rDNA gene of Alternaria alternata or Alternaria solani but not to other microbial or plant DNA. We compared the sensitivity of PCR in detecting Alternaria DNA, that of the HPLC method in detecting Alternaria alternariol and alternariol methyl ether toxins, and that of the morphological examination of mycelia and conidia in experimentally infested corn samples. The sensitivity of toxin detection for HPLC was above the level of contamination in a set of commercially obtained grain samples, resulting in negative scores for all samples, while the PCR-based method and mold growth plating followed by morphological identification of Alternaria gave parallel, positive results for 8 of 10 samples. The PCR assay required just 8 h, enabling the rapid and simultaneous testing of many samples at a low cost. PCR-based evidence for the presence of Alternaria DNA followed by positive assay results for Alternaria toxins would support the rejection of a shipment of grain.

  8. DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

    DOEpatents

    Lee, James W.; Thundat, Thomas G.

    2005-06-14

    An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

  9. A Colorimetric Microplate Assay for DNA-Binding Activity of His-Tagged MutS Protein.

    PubMed

    Banasik, Michał; Sachadyn, Paweł

    2016-09-01

    A simple microplate method was designed for rapid testing DNA-binding activity of proteins. The principle of the assay involves binding of tested DNA by his-tagged protein immobilized on a nickel-coated ELISA plate, following colorimetric detection of biotinylated DNA with avidin conjugated to horseradish peroxidase. The method was used to compare DNA mismatch binding activities of MutS proteins from three bacterial species. The assay required relatively low amounts of tested protein (approximately 0.5-10 pmol) and DNA (0.1-10 pmol) and a relatively short time of analysis (up to 60 min). The method is very simple to apply and convenient to test different buffer conditions of DNA-protein binding. Sensitive colorimetric detection enables naked eye observations and quantitation with an ELISA reader. The performance of the assay, which we believe is a distinguishing trait of the method, is based on two strong and specific molecular interactions: binding of a his-tagged protein to a nickel-coated microplate and binding of biotinylated DNA to avidin. In the reported experiments, the solution was used to optimize the conditions for DNA mismatch binding by MutS protein; however, the approach could be implemented to test nucleic acids interactions with any protein of interest.

  10. Effect of food processing on plant DNA degradation and PCR-based GMO analysis: a review.

    PubMed

    Gryson, Nicolas

    2010-03-01

    The applicability of a DNA-based method for GMO detection and quantification depends on the quality and quantity of the DNA. Important food-processing conditions, for example temperature and pH, may lead to degradation of the DNA, rendering PCR analysis impossible or GMO quantification unreliable. This review discusses the effect of several food processes on DNA degradation and subsequent GMO detection and quantification. The data show that, although many of these processes do indeed lead to the fragmentation of DNA, amplification of the DNA may still be possible. Length and composition of the amplicon may, however, affect the result, as also may the method of extraction used. Also, many techniques are used to describe the behaviour of DNA in food processing, which occasionally makes it difficult to compare research results. Further research should be aimed at defining ingredients in terms of their DNA quality and PCR amplification ability, and elaboration of matrix-specific certified reference materials.

  11. A superstructure-based electrochemical assay for signal-amplified detection of DNA methyltransferase activity.

    PubMed

    Zhang, Hui; Yang, Yin; Dong, Huilei; Cai, Chenxin

    2016-12-15

    DNA methyltransferase (MTase) activity is highly correlated with the occurrence and development of cancer. This work reports a superstructure-based electrochemical assay for signal-amplified detection of DNA MTase activity using M.SssI as an example. First, low-density coverage of DNA duplexes on the surface of the gold electrode was achieved by immobilized mercaptohexanol, followed by immobilization of DNA duplexes. The duplex can be cleaved by BstUI endonuclease in the absence of DNA superstructures. However, the cleavage is blocked after the DNA is methylated by M.SssI. The DNA superstructures are formed with the addition of helper DNA. By using an electroactive complex, RuHex, which can bind to DNA double strands, the activity of M.SssI can be quantitatively detected by differential pulse voltammetry. Due to the high site-specific cleavage by BstUI and signal amplification by the DNA superstructure, the biosensor can achieve ultrasensitive detection of DNA MTase activity down to 0.025U/mL. The method can be used for evaluation and screening of the inhibitors of MTase, and thus has potential in the discovery of methylation-related anticancer drugs. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Detecting the Presence of Bacterial DNA and RNA by Polymerase Chain Reaction to Diagnose Suspected Periprosthetic Joint Infection after Antibiotic Therapy.

    PubMed

    Fang, Xin-Yu; Li, Wen-Bo; Zhang, Chao-Fan; Huang, Zi-da; Zeng, Hui-Yi; Dong, Zheng; Zhang, Wen-Ming

    2018-02-01

    To explore the diagnostic efficiency of DNA-based and RNA-based quantitative polymerase chain reaction (qPCR) analyses for periprosthetic joint infection (PJI). To determine the detection limit of DNA-based and RNA-based qPCR in vitro, Staphylococcus aureus and Escherichia coli strains were added to sterile synovial fluid obtained from a patient with knee osteoarthritis. Serial dilutions of samples were analyzed by DNA-based and RNA-based qPCR. Clinically, patients who were suspected of having PJI and eventually underwent revision arthroplasty in our hospital from July 2014 to December 2016 were screened. Preoperative puncture or intraoperative collection was performed on patients who met the inclusion and exclusion criteria to obtain synovial fluid. DNA-based and RNA-based PCR analyses and culture were performed on each synovial fluid sample. The patients' demographic characteristics, medical history, and laboratory test results were recorded. The diagnostic efficiency of both PCR assays was compared with culture methods. The in vitro analysis demonstrated that DNA-based qPCR assay was highly sensitive, with the detection limit being 1200 colony forming units (CFU)/mL of S. aureus and 3200 CFU/mL of E. coli. Meanwhile, The RNA-based qPCR assay could detect 2300 CFU/mL of S. aureus and 11 000 CFU/mL of E. coli. Clinically, the sensitivity, specificity, and accuracy were 65.7%, 100%, and 81.6%, respectively, for the culture method; 81.5%, 84.8%, and 83.1%, respectively, for DNA-based qPCR; and 73.6%, 100%, and 85.9%, respectively, for RNA-based qPCR. DNA-based qPCR could detect suspected PJI with high sensitivity after antibiotic therapy. RNA-based qPCR could reduce the false positive rates of DNA-based assays. qPCR-based methods could improve the efficiency of PJI diagnosis. © 2018 Chinese Orthopaedic Association and John Wiley & Sons Australia, Ltd.

  13. Loop-mediated isothermal amplification (LAMP) shield for Arduino DNA detection.

    PubMed

    Velders, Aldrik H; Schoen, Cor; Saggiomo, Vittorio

    2018-02-01

    Loop-mediated isothermal amplification (LAMP) of DNA is gaining relevance as a method to detect nucleic acids, as it is easier, faster, and more powerful than conventional Polymerase Chain Reaction. However, LAMP is still mostly used in laboratory settings, because of the lack of a cheap and easy, one-button device that can perform LAMP experiments. Here we show how to build and program an Arduino shield for a LAMP and detection of DNA. The here described Arduino Shield is cheap, easy to assemble, to program and use, it is battery operated and the detection of DNA is done by naked-eye so that it can be used in field.

  14. Hall effect biosensors with ultraclean graphene film for improved sensitivity of label-free DNA detection.

    PubMed

    Loan, Phan Thi Kim; Wu, Dongqin; Ye, Chen; Li, Xiaoqing; Tra, Vu Thanh; Wei, Qiuping; Fu, Li; Yu, Aimin; Li, Lain-Jong; Lin, Cheng-Te

    2018-01-15

    The quality of graphene strongly affects the performance of graphene-based biosensors which are highly demanded for the sensitive and selective detection of biomolecules, such as DNA. This work reported a novel transfer process for preparing a residue-free graphene film using a thin gold supporting layer. A Hall effect device made of this gold-transferred graphene was demonstrated to significantly enhance the sensitivity (≈ 5 times) for hybridization detection, with a linear detection range of 1pM to 100nM for DNA target. Our findings provide an efficient method to boost the sensitivity of graphene-based biosensors for DNA recognition. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Studies on DNA damage: discordant responses of rate of DNA disentanglement (viscosimetrically evaluated) and alkaline elution rate, obtained for several compounds. Possible explanations of the discrepancies.

    PubMed

    Parodi, S; Balbi, C; Abelmoschi, M L; Pala, M; Russo, P; Santi, L

    1983-12-01

    Alkaline elution is a well-known method for detecting DNA damage. Recently we have developed a viscosimetric method that is even more sensitive than alkaline elution. Here we report that the two methods, although apparently both revealing alkaline DNA fragmentation, can give dramatically different results for a significant series of compounds. We suspect that alkaline elution might reveal not only DNA fragmentation but also the extent of disentanglement of chromatin structure, whereas this DNA disentanglement rate, when evaluated viscosimetrically , is more strictly correlated with the initiation of DNA unwinding.

  16. Identifying DNA-binding proteins using structural motifs and the electrostatic potential

    PubMed Central

    Shanahan, Hugh P.; Garcia, Mario A.; Jones, Susan; Thornton, Janet M.

    2004-01-01

    Robust methods to detect DNA-binding proteins from structures of unknown function are important for structural biology. This paper describes a method for identifying such proteins that (i) have a solvent accessible structural motif necessary for DNA-binding and (ii) a positive electrostatic potential in the region of the binding region. We focus on three structural motifs: helix–turn-helix (HTH), helix–hairpin–helix (HhH) and helix–loop–helix (HLH). We find that the combination of these variables detect 78% of proteins with an HTH motif, which is a substantial improvement over previous work based purely on structural templates and is comparable to more complex methods of identifying DNA-binding proteins. Similar true positive fractions are achieved for the HhH and HLH motifs. We see evidence of wide evolutionary diversity for DNA-binding proteins with an HTH motif, and much smaller diversity for those with an HhH or HLH motif. PMID:15356290

  17. High-performance liquid chromatography/electrospray mass spectrometry for the analysis of modified bases in DNA: 7-(2-hydroxyethyl)guanine, the major ethylene oxide-DNA adduct.

    PubMed

    Leclercq, L; Laurent, C; De Pauw, E

    1997-05-15

    A method was developed for the analysis of 7-(2-hydroxyethyl)guanine (7HEG), the major DNA adduct formed after exposure to ethylene oxide (EO). The method is based on DNA neutral thermal hydrolysis, adduct micro-concentration, and final characterization and quantification by HPLC coupled to single-ion monitoring electrospray mass spectrometry (HPLC/SIR-ESMS). The method was found to be selective, sensitive, and easy to handle with no need for enzymatic digestion or previous sample derivatization. Detection limit was found to be close to 1 fmol of adduct injected (10(-10) M), thus allowing the detection of approximately three modified bases on 10(8) intact nucleotides in blood sample analysis. Quantification results are shown for 7HEG after calf thymus DNA and blood exposure to various doses of EO, in both cases obtaining clear dose-response relationships.

  18. Evaluation of basal DNA damage and oxidative stress in Wistar rat leukocytes after exposure to microwave radiation.

    PubMed

    Garaj-Vrhovac, Vera; Gajski, Goran; Trosić, Ivancica; Pavicić, Ivan

    2009-05-17

    The aim of this study was to assess whether microwave-induced DNA damage is basal or it is also generated through reactive oxygen species (ROS) formation. After having irradiated Wistar rats with 915MHz microwave radiation, we assessed different DNA alterations in peripheral leukocytes using standard and formamidopyrimidine DNA-glycosylase (Fpg)-modified comet assay. The first is a sensitive tool for detecting primary DNA damage, and the second is much more specific for detecting oxidative damage. The animals were irradiated for 1h a day for 2 weeks at a field power density of 2.4W/m(2), and the whole-body average specific absorption rate (SAR) of 0.6W/kg. Both the standard and the Fpg-modified comet assay detected increased DNA damage in blood leukocytes of the exposed rats. The significant increase in Fpg-detected DNA damage in the exposed rats suggests that oxidative stress is likely to be responsible. DNA damage detected by the standard comet assay indicates that some other mechanisms may also be involved. In addition, both methods served proved sensitive enough to measure basal and oxidative DNA damage after long-term exposure to 915MHz microwave radiation in vivo.

  19. Mapping yeast origins of replication via single-stranded DNA detection.

    PubMed

    Feng, Wenyi; Raghuraman, M K; Brewer, Bonita J

    2007-02-01

    Studies in th Saccharomyces cerevisiae have provided a framework for understanding how eukaryotic cells replicate their chromosomal DNA to ensure faithful transmission of genetic information to their daughter cells. In particular, S. cerevisiae is the first eukaryote to have its origins of replication mapped on a genomic scale, by three independent groups using three different microarray-based approaches. Here we describe a new technique of origin mapping via detection of single-stranded DNA in yeast. This method not only identified the majority of previously discovered origins, but also detected new ones. We have also shown that this technique can identify origins in Schizosaccharomyces pombe, illustrating the utility of this method for origin mapping in other eukaryotes.

  20. Single-Color Digital PCR Provides High-Performance Detection of Cancer Mutations from Circulating DNA.

    PubMed

    Wood-Bouwens, Christina; Lau, Billy T; Handy, Christine M; Lee, HoJoon; Ji, Hanlee P

    2017-09-01

    We describe a single-color digital PCR assay that detects and quantifies cancer mutations directly from circulating DNA collected from the plasma of cancer patients. This approach relies on a double-stranded DNA intercalator dye and paired allele-specific DNA primer sets to determine an absolute count of both the mutation and wild-type-bearing DNA molecules present in the sample. The cell-free DNA assay uses an input of 1 ng of nonamplified DNA, approximately 300 genome equivalents, and has a molecular limit of detection of three mutation DNA genome-equivalent molecules per assay reaction. When using more genome equivalents as input, we demonstrated a sensitivity of 0.10% for detecting the BRAF V600E and KRAS G12D mutations. We developed several mutation assays specific to the cancer driver mutations of patients' tumors and detected these same mutations directly from the nonamplified, circulating cell-free DNA. This rapid and high-performance digital PCR assay can be configured to detect specific cancer mutations unique to an individual cancer, making it a potentially valuable method for patient-specific longitudinal monitoring. Copyright © 2017 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

  1. Evaluation of DNA extraction methods for the analysis of microbial community in biological activated carbon.

    PubMed

    Zheng, Lu; Gao, Naiyun; Deng, Yang

    2012-01-01

    It is difficult to isolate DNA from biological activated carbon (BAC) samples used in water treatment plants, owing to the scarcity of microorganisms in BAC samples. The aim of this study was to identify DNA extraction methods suitable for a long-term, comprehensive ecological analysis of BAC microbial communities. To identify a procedure that can produce high molecular weight DNA, maximizes detectable diversity and is relatively free from contaminants, the microwave extraction method, the cetyltrimethylammonium bromide (CTAB) extraction method, a commercial DNA extraction kit, and the ultrasonic extraction method were used for the extraction of DNA from BAC samples. Spectrophotometry, agarose gel electrophoresis and polymerase chain reaction (PCR)-restriction fragment length polymorphisms (RFLP) analysis were conducted to compare the yield and quality of DNA obtained using these methods. The results showed that the CTAB method produce the highest yield and genetic diversity of DNA from BAC samples, but DNA purity was slightly less than that obtained with the DNA extraction-kit method. This study provides a theoretical basis for establishing and selecting DNA extraction methods for BAC samples.

  2. A SIMPLE AND EFFECTIVE MULTIPLEX PCR TECHNIQUE FOR DETECTING HUMAN PATHOGENIC TAENIA EGGS IN HOUSEFLIES.

    PubMed

    Pornruseetriratn, Siritavee; Maipanich, Wanna; Sa-nguankiat, Surapol; Pubampen, Somchit; Poodeepiyasawat, Akkarin; Thaenkham, Urusa

    2017-01-01

    Taenia solium, T. saginata, and T. asiatica are cestode pathogens causing taeniasis in humans. Houseflies can transfer Taenia eggs to food. However, houseflies are thought to carry only small numbers of Taenia eggs, sometimes fewer than 10. Although several PCR-based methods have been developed to detect Taenia DNA, these require more than 10 eggs for adequate detection. We developed a multiplex PCR method with high specificity for the discrimination among the eggs of the three Taenia species, T. solium, T. saginata, and T. asiatica, using 18S ribosomal DNA (rDNA) as a genetic marker. This technique was found to be highly sensitive, capable of identifying the Taenia species from only one egg. This multiplex PCR technique using 18S rDNA specific primers should be suitable to diagnose Taenia eggs.

  3. Adaptation of red blood cell lysis represents a fundamental breakthrough that improves the sensitivity of Salmonella detection in blood

    PubMed Central

    Boyd, MA; Tennant, SM; Melendez, JH; Toema, D; Galen, JE; Geddes, CD; Levine, MM

    2015-01-01

    Aims Isolation of Salmonella Typhi from blood culture is the standard diagnostic for confirming typhoid fever but it is unavailable in many developing countries. We previously described a Microwave Accelerated Metal Enhanced Fluorescence (MAMEF)-based assay to detect Salmonella in medium. Attempts to detect Salmonella in blood were unsuccessful, presumably due to the interference of erythrocytes. The objective of this study was to evaluate various blood treatment methods that could be used prior to PCR, real-time PCR or MAMEF to increase sensitivity of detection of Salmonella. Methods and Results We tested ammonium chloride and erythrocyte lysis buffer, water, Lymphocyte Separation Medium, BD Vacutainer® CPT™ Tubes and dextran. Erythrocyte lysis buffer was the best isolation method as it is fast, inexpensive and works with either fresh or stored blood. The sensitivity of PCR- and real-time PCR detection of Salmonella in spiked blood was improved when whole blood was first lysed using erythrocyte lysis buffer prior to DNA extraction. Removal of erythrocytes and clotting factors also enabled reproducible lysis of Salmonella and fragmentation of DNA, which are necessary for MAMEF sensing. Conclusions Use of the erythrocyte lysis procedure prior to DNA extraction has enabled improved sensitivity of Salmonella detection by PCR and real-time PCR and has allowed lysis and fragmentation of Salmonella using microwave radiation (for future detection by MAMEF). Significance and Impact of the Study Adaptation of the blood lysis method represents a fundamental breakthrough that improves the sensitivity of DNA-based detection of Salmonella in blood. PMID:25630831

  4. DNA-stabilized silver nanoclusters and carbon nanoparticles oxide: A sensitive platform for label-free fluorescence turn-on detection of HIV-DNA sequences.

    PubMed

    Ye, Yu-Dan; Xia, Li; Xu, Dang-Dang; Xing, Xiao-Jing; Pang, Dai-Wen; Tang, Hong-Wu

    2016-11-15

    Based on the remarkable difference between the interactions of carbon nanoparticles (CNPs) oxide with single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA), and the fact that fluorescence of DNA-stabilized silver nanoclusters (AgNCs) can be quenched by CNPs oxide, DNA-functionalized AgNCs were applied as label-free fluorescence probes and a novel fluorescence resonance energy transfer (FRET) sensor was successfully constructed for the detection of human immunodeficiency virus (HIV) DNA sequences. CNPs oxide were prepared with the oxidation of candle soot, hence it is simple, time-saving and low-cost. The strategy of dual AgNCs probes was applied to improve the detection sensitivity by using dual- probe capturing the same target DNA in a sandwich mode and as the fluorescence donor, and using CNPs oxide as the acceptor. In the presence of target DNA, a dsDNA hybrid forms, leading to the desorption of the ssDNA-AgNCs probes from CNPs oxide, and the recovering of fluorescence of the AgNCs in a HIV-DNA concentration-dependent manner. The results show that HIV-DNA can be detected in the range of 1-50nM with a detection limit of 0.40nM in aqueous buffer. The method is simple, rapid and sensitive with no need of labeled fluorescent probes, and moreover, the design of fluorescent dual-probe makes full use of the excellent fluorescence property of AgNCs and further improves the detection sensitivity. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Deoxyribonucleic Acid Probes Analyses for the Detection of Periodontal Pathogens.

    PubMed

    Al Yahfoufi, Zoubeida; Hadchiti, Wahib; Berberi, Antoine

    2015-09-01

    In clinical microbiology several techniques have been used to identify bacteria. Recently, Deoxyribonucleic acid (DNA)-based techniques have been introduced to detect human microbial pathogens in periodontal diseases. Deoxyribonucleic acid probes can detect bacteria at a very low level if we compared with the culture methods. These probes have shown rapid and cost-effective microbial diagnosis, good sensitivity and specificity for some periodontal pathogens in cases of severe periodontitis. Eighty-five patients were recruited for the study. Twenty-one subjects ranging between 22 and 48 years of age fulfilled the inclusion and exclusion criteria. Seventy-eight samples became available for DNA probe analysis from the deepest pockets in each quadrant. All 21 patients showed positive results for Prevotella intermedia; also, Prevotella gingivalis was identified in 19 subjects, Aggregatibacter actinomycetemcomitans in 6 subjects. P. intermedia was diagnosed positive in 82% of the subgingival samples taken, 79% for P. gingivalis, and 23% for A. actinomycetemcomitans. This study shows a high frequency of putative periodontal pathogens by using DNA probe technology, which is semi-quantitative in this study. Deoxyribonucleic acid probes can detect bacteria at very low level about 10(3) which is below the detection level of culture methods. The detection threshold of cultural methods. The three types of bacteria can be detected rapidly with high sensitivity by using the DNA probe by general practitioners, and thus can help in the diagnosis process and the treatment.

  6. A multiplex microplatform for the detection of multiple DNA methylation events using gold-DNA affinity.

    PubMed

    Sina, Abu Ali Ibn; Foster, Matthew Thomas; Korbie, Darren; Carrascosa, Laura G; Shiddiky, Muhammad J A; Gao, Jing; Dey, Shuvashis; Trau, Matt

    2017-10-07

    We report a new multiplexed strategy for the electrochemical detection of regional DNA methylation across multiple regions. Using the sequence dependent affinity of bisulfite treated DNA towards gold surfaces, the method integrates the high sensitivity of a micro-fabricated multiplex device comprising a microarray of gold electrodes, with the powerful multiplexing capability of multiplex-PCR. The synergy of this combination enables the monitoring of the methylation changes across several genomic regions simultaneously from as low as 500 pg μl -1 of DNA with no sequencing requirement.

  7. Comparison of Four Human Papillomavirus Genotyping Methods: Next-generation Sequencing, INNO-LiPA, Electrochemical DNA Chip, and Nested-PCR.

    PubMed

    Nilyanimit, Pornjarim; Chansaenroj, Jira; Poomipak, Witthaya; Praianantathavorn, Kesmanee; Payungporn, Sunchai; Poovorawan, Yong

    2018-03-01

    Human papillomavirus (HPV) infection causes cervical cancer, thus necessitating early detection by screening. Rapid and accurate HPV genotyping is crucial both for the assessment of patients with HPV infection and for surveillance studies. Fifty-eight cervicovaginal samples were tested for HPV genotypes using four methods in parallel: nested-PCR followed by conventional sequencing, INNO-LiPA, electrochemical DNA chip, and next-generation sequencing (NGS). Seven HPV genotypes (16, 18, 31, 33, 45, 56, and 58) were identified by all four methods. Nineteen HPV genotypes were detected by NGS, but not by nested-PCR, INNO-LiPA, or electrochemical DNA chip. Although NGS is relatively expensive and complex, it may serve as a sensitive HPV genotyping method. Because of its highly sensitive detection of multiple HPV genotypes, NGS may serve as an alternative for diagnostic HPV genotyping in certain situations. © The Korean Society for Laboratory Medicine

  8. Detection of sesame seed DNA in foods using real-time PCR.

    PubMed

    Brzezinski, Jennifer L

    2007-04-01

    The detection of potentially allergenic foods, such as sesame seeds, in food products is a major concern for the food-processing industry. A real-time PCR method was designed to determine if sesame seed DNA is present in food products. The PCR reaction amplifies a 66-bp fragment of the sesame seed 2S albumin gene, which is detected with a sesame-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other seeds present in baked goods, such as pumpkin, poppy, and sunflower seeds. Additionally, this assay will not cross-react with DNA from several tree nut species, such as almond, Brazil nut, cashew, hazelnut, and walnut, as well as four varieties of peanut. This assay is sensitive enough to detect 5 pg of purified sesame seed DNA, as well as sesame seed DNA in a spiked wheat cracker sample.

  9. Quantitative analysis of cell-free DNA in ovarian cancer.

    PubMed

    Shao, Xuefeng; He, Yan; Ji, Min; Chen, Xiaofang; Qi, Jing; Shi, Wei; Hao, Tianbo; Ju, Shaoqing

    2015-12-01

    The aim of the present study was to investigate the association between cell-free DNA (cf-DNA) levels and clinicopathological characteristics of patients with ovarian cancer using a branched DNA (bDNA) technique, and to determine the value of quantitative cf-DNA detection in assisting with the diagnosis of ovarian cancer. Serum specimens were collected from 36 patients with ovarian cancer on days 1, 3 and 7 following surgery, and additional serum samples were also collected from 22 benign ovarian tumor cases, and 19 healthy, non-cancerous ovaries. bDNA techniques were used to detect serum cf-DNA concentrations. All data were analyzed using SPSS version 18.0. The cf-DNA levels were significantly increased in the ovarian cancer group compared with those of the benign ovarian tumor group and healthy ovarian group (P<0.01). Furthermore, cf-DNA levels were significantly increased in stage III and IV ovarian cancer compared with those of stages I and II (P<0.01). In addition, cf-DNA levels were significantly increased on the first day post-surgery (P<0.01), and subsequently demonstrated a gradual decrease. In the ovarian cancer group, the area under the receiver operating characteristic curve of cf-DNA and the sensitivity were 0.917 and 88.9%, respectively, which was higher than those of cancer antigen 125 (0.724, 75%) and human epididymis protein 4 (0.743, 80.6%). There was a correlation between the levels of serum cf-DNA and the occurrence and development of ovarian cancer in the patients evaluated. bDNA techniques possessed higher sensitivity and specificity than other methods for the detection of serum cf-DNA in patients exhibiting ovarian cancer, and bDNA techniques are more useful for detecting cf-DNA than other factors. Thus, the present study demonstrated the potential value for the use of bDNA as an adjuvant diagnostic method for ovarian cancer.

  10. Antibody specific for a DNA repair protein

    DOEpatents

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-07-11

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  11. DNA Hybridization: Nonradioactive Labeling Now Available for the Laboratory.

    ERIC Educational Resources Information Center

    Freeman, Lenore Gardner

    1984-01-01

    The advantages of DNA hybridization procedures for classroom and clinical use can now be realized by the recent development of nonradioactive DNA labeling/detection procedures. These methods (which are described) can replace the use of isotopes in standard DNA hybridization procedures. (JN)

  12. Combining functionalised nanoparticles and SERS for the detection of DNA relating to disease.

    PubMed

    Graham, Duncan; Stevenson, Ross; Thompson, David G; Barrett, Lee; Dalton, Colette; Faulds, Karen

    2011-01-01

    DNA functionalised nanoparticle probes offer new opportunities in analyte detection. Ultrasensitive, molecularly specific targeting of analytes is possible through the use of metallic nanoparticles and their ability to generate a surface enhanced Raman scattering (SERS) response. This is leading to a new range of diagnostic clinical probes based on SERS detection. Our approaches have shown how such probes can detect specific DNA sequences by using a biomolecular recognition event to 'turn on' a SERS response through a controlled assembly process of the DNA functionalised nanoparticles. Further, we have prepared DNA aptamer functionalised SERS probes and demonstrated how introduction of a protein target can change the aggregation state of the nanoparticles in a dose-dependant manner. These approaches are being used as methods to detect biomolecules that indicate a specific disease being present with a view to improving disease management.

  13. Usefulness of in-house PCR methods for hepatitis B virus DNA detection.

    PubMed

    Portilho, Moyra Machado; Baptista, Marcia Leite; da Silva, Messias; de Sousa, Paulo Sérgio Fonseca; Lewis-Ximenez, Lia Laura; Lampe, Elisabeth; Villar, Livia Melo

    2015-10-01

    The aim of the present study was to evaluate the performance of three in-house PCR techniques for HBV DNA detection and compare it with commercial quantitative methods to evaluate the usefulness of in-house methods for HBV diagnosis. Three panels of HBsAg reactive sera samples were evaluated: (i) 50 samples were examined using three methods for in-house qualitative PCR and the Cobas Amplicor HBV Monitor Assay; (ii) 87 samples were assayed using in-house semi-nested PCR and the Cobas TaqMan HBV test; (iii) 11 serial samples obtained from 2 HBV-infected individuals were assayed using the Cobas Amplicor HBV test and semi-nested PCR. In panel I, HBV DNA was detected in 44 samples using the Cobas Amplicor HBV test, 42 samples using semi-nested PCR (90% concordance with Cobas Amplicor), 22 samples using PCR for the core gene (63.6% concordance) and 29 samples using single-round PCR for the pre-S/S gene (75% concordance). In panel II, HBV DNA was quantified in 78 of the 87 HBsAg reactive samples using Cobas TaqMan but 52 samples using semi-nested PCR (67.8% concordance). HBV DNA was detected in serial samples until the 17th and 26th week after first donation using in-house semi-nested PCR and the Cobas Amplicor HBV test, respectively. In-house semi-nested PCR presented adequate concordance with commercial methods as an alternative method for HBV molecular diagnosis in low-resource settings. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Potentiometric Aptasensing of Vibrio alginolyticus Based on DNA Nanostructure-Modified Magnetic Beads

    PubMed Central

    Zhao, Guangtao; Ding, Jiawang; Yu, Han; Yin, Tanji; Qin, Wei

    2016-01-01

    A potentiometric aptasensing assay that couples the DNA nanostructure-modified magnetic beads with a solid-contact polycation-sensitive membrane electrode for the detection of Vibrio alginolyticus is herein described. The DNA nanostructure-modified magnetic beads are used for amplification of the potential response and elimination of the interfering effect from a complex sample matrix. The solid-contact polycation-sensitive membrane electrode using protamine as an indicator is employed to chronopotentiometrically detect the change in the charge or DNA concentration on the magnetic beads, which is induced by the interaction between Vibrio alginolyticus and the aptamer on the DNA nanostructures. The present potentiometric aptasensing method shows a linear range of 10–100 CFU mL−1 with a detection limit of 10 CFU mL−1, and a good specificity for the detection of Vibrio alginolyticus. This proposed strategy can be used for the detection of other microorganisms by changing the aptamers in the DNA nanostructures. PMID:27918423

  15. Development of an Automated DNA Detection System Using an Electrochemical DNA Chip Technology

    NASA Astrophysics Data System (ADS)

    Hongo, Sadato; Okada, Jun; Hashimoto, Koji; Tsuji, Koichi; Nikaido, Masaru; Gemma, Nobuhiro

    A new compact automated DNA detection system Genelyzer™ has been developed. After injecting a sample solution into a cassette with a built-in electrochemical DNA chip, processes from hybridization reaction to detection and analysis are all operated fully automatically. In order to detect a sample DNA, electrical currents from electrodes due to an oxidization reaction of electrochemically active intercalator molecules bound to hybridized DNAs are detected. The intercalator is supplied as a reagent solution by a fluid supply unit of the system. The feasibility test proved that the simultaneous typing of six single nucleotide polymorphisms (SNPs) associated with a rheumatoid arthritis (RA) was carried out within two hours and that all the results were consistent with those by conventional typing methods. It is expected that this system opens a new way to a DNA testing such as a test for infectious diseases, a personalized medicine, a food inspection, a forensic application and any other applications.

  16. Highly Sensitive Detection of Low-Abundance White Spot Syndrome Virus by a Pre-Amplification PCR Method.

    PubMed

    Pan, Xiaoming; Zhang, Yanfang; Sha, Xuejiao; Wang, Jing; Li, Jing; Dong, Ping; Liang, Xingguo

    2017-03-28

    White spot syndrome virus (WSSV) is a major threat to the shrimp farming industry and so far there is no effective therapy for it, and thus early diagnostic of WSSV is of great importance. However, at the early stage of infection, the extremely low-abundance of WSSV DNA challenges the detection sensitivity and accuracy of PCR. To effectively detect low-abundance WSSV, here we developed a pre-amplification PCR (pre-amp PCR) method to amplify trace amounts of WSSV DNA from massive background genomic DNA. Combining with normal specific PCR, 10 copies of target WSSV genes were detected from ~10 10 magnitude of backgrounds. In particular, multiple target genes were able to be balanced amplified with similar efficiency due to the usage of the universal primer. The efficiency of the pre-amp PCR was validated by nested-PCR and quantitative PCR, and pre-amp PCR showed higher efficiency than nested-PCR when multiple targets were detected. The developed method is particularly suitable for the super early diagnosis of WSSV, and has potential to be applied in other low-abundance sample detection cases.

  17. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods.

    PubMed

    Kaneko, Ikuko; Miyamoto, Kazuaki; Mimura, Kanako; Yumine, Natsuko; Utsunomiya, Hirotoshi; Akimoto, Shigeru; McClane, Bruce A

    2011-11-01

    To prevent food-borne bacterial diseases and to trace bacterial contamination events to foods, microbial source tracking (MST) methods provide important epidemiological information. To apply molecular methods to MST, it is necessary not only to amplify bacterial cells to detection limit levels but also to prepare DNA with reduced inhibitory compounds and contamination. Isolates carrying the Clostridium perfringens enterotoxin gene (cpe) on the chromosome or a plasmid rank among the most important food-borne pathogens. Previous surveys indicated that cpe-positive C. perfringens isolates are present in only ∼5% of nonoutbreak food samples and then only at low numbers, usually less than 3 cells/g. In this study, four molecular assays for the detection of cpe-positive C. perfringens isolates, i.e., ordinary PCR, nested PCR, real-time PCR, and loop-mediated isothermal amplification (LAMP), were developed and evaluated for their reliability using purified DNA. For use in the artificial contamination of meat samples, DNA templates were prepared by three different commercial DNA preparation kits. The four molecular assays always detected cpe when >10³ cells/g of cpe-positive C. perfringens were present, using any kit. Of three tested commercial DNA preparation kits, the InstaGene matrix kit appeared to be most suitable for the testing of a large number of samples. By using the InstaGene matrix kit, the four molecular assays efficiently detected cpe using DNA prepared from enrichment culture specimens of meat samples contaminated with low numbers of cpe-positive C. perfringens vegetative cells or spores. Overall, the current study developed molecular assay protocols for MST to detect the contamination of foods with low numbers of cells, and at a low frequency, of cpe-positive C. perfringens isolates.

  18. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  19. Optimization of circulating cell-free DNA recovery for KRAS mutation and HPV detection in plasma.

    PubMed

    Mazurek, Agnieszka M; Fiszer-Kierzkowska, A; Rutkowski, T; Składowski, K; Pierzyna, M; Scieglińska, D; Woźniak, G; Głowacki, G; Kawczyński, R; Małusecka, E

    2013-01-01

    The precise analysis of tumour markers in blood such as circulating cell-free DNA (cfDNA) could have a significant impact in facilitating monitoring of patients after initial therapy. Although high levels of total cfDNA in plasma of cancer patients are consistently demonstrated, a low sensitivity of DNA alterations is reported. The major question regards the recovery of tumour-specific cfDNA such as KRAS mutated DNA and cancer-associated type 16 of human papillomavirus (HPV16). TaqMan technology was used for detection of KRAS mutation, HPV16 and to quantify cfDNA in blood plasma. Comparison of four different column-based commercial kits shows that the cfDNA purification carried out by the Genomic Mini AX Body Fluids kit and the QIAamp Circulating Nucleic Acid kit gave us the possibility to improve the sensitivity of detection of KRAS mutation and HPV16. The optimized method was used to follow the reduction in cancer-specific cfDNA after therapy. We found that large volume extractions with low volume of DNA eluate enabled trace amounts of tumour-specific cfDNA from cancer patients to be effectively identified. Data presented in this study facilitate detection of tumour-specific cfDNA and improve standards needed for the implementation of cfDNA technology into routine clinical practice.

  20. Enhancing the detection of barcoded reads in high throughput DNA sequencing data by controlling the false discovery rate.

    PubMed

    Buschmann, Tilo; Zhang, Rong; Brash, Douglas E; Bystrykh, Leonid V

    2014-08-07

    DNA barcodes are short unique sequences used to label DNA or RNA-derived samples in multiplexed deep sequencing experiments. During the demultiplexing step, barcodes must be detected and their position identified. In some cases (e.g., with PacBio SMRT), the position of the barcode and DNA context is not well defined. Many reads start inside the genomic insert so that adjacent primers might be missed. The matter is further complicated by coincidental similarities between barcode sequences and reference DNA. Therefore, a robust strategy is required in order to detect barcoded reads and avoid a large number of false positives or negatives.For mass inference problems such as this one, false discovery rate (FDR) methods are powerful and balanced solutions. Since existing FDR methods cannot be applied to this particular problem, we present an adapted FDR method that is suitable for the detection of barcoded reads as well as suggest possible improvements. In our analysis, barcode sequences showed high rates of coincidental similarities with the Mus musculus reference DNA. This problem became more acute when the length of the barcode sequence decreased and the number of barcodes in the set increased. The method presented in this paper controls the tail area-based false discovery rate to distinguish between barcoded and unbarcoded reads. This method helps to establish the highest acceptable minimal distance between reads and barcode sequences. In a proof of concept experiment we correctly detected barcodes in 83% of the reads with a precision of 89%. Sensitivity improved to 99% at 99% precision when the adjacent primer sequence was incorporated in the analysis. The analysis was further improved using a paired end strategy. Following an analysis of the data for sequence variants induced in the Atp1a1 gene of C57BL/6 murine melanocytes by ultraviolet light and conferring resistance to ouabain, we found no evidence of cross-contamination of DNA material between samples. Our method offers a proper quantitative treatment of the problem of detecting barcoded reads in a noisy sequencing environment. It is based on the false discovery rate statistics that allows a proper trade-off between sensitivity and precision to be chosen.

  1. Development of a targeted adductomic method for the determination of polycyclic aromatic hydrocarbon DNA adducts using online column-switching liquid chromatography/tandem mass spectrometry.

    PubMed

    Singh, Rajinder; Teichert, Friederike; Seidel, Albrecht; Roach, Jonathan; Cordell, Rebecca; Cheng, Mai-Kim; Frank, Heinrich; Steward, William P; Manson, Margaret M; Farmer, Peter B

    2010-08-30

    Human exposure to polycyclic aromatic hydrocarbons (PAHs) from sources such as industrial or urban air pollution, tobacco smoke and cooked food is not confined to a single compound, but instead to mixtures of different PAHs. The interaction of different PAHs may lead to additive, synergistic or antagonistic effects in terms of DNA adduct formation and carcinogenic activity resulting from changes in metabolic activation to reactive intermediates and DNA repair. The development of a targeted DNA adductomic approach using liquid chromatography/tandem mass spectrometry (LC/MS/MS) incorporating software-based peak picking and integration for the assessment of exposure to mixtures of PAHs is described. For method development PAH-modified DNA samples were obtained by reaction of the anti-dihydrodiol epoxide metabolites of benzo[a]pyrene, benzo[b]fluoranthene, dibenzo[a,l]pyrene (DB[a,l]P) and dibenz[a,h]anthracene with calf thymus DNA in vitro and enzymatically hydrolysed to 2'-deoxynucleosides. Positive LC/electrospray ionisation (ESI)-MS/MS collision-induced dissociation product ion spectra data showed that the majority of adducts displayed a common fragmentation for the neutral loss of 116 u (2'-deoxyribose) resulting in a major product ion derived from the adducted base. The exception was the DB[a,l]P dihydrodiol epoxide adduct of 2'-deoxyadenosine which resulted in major product ions derived from the PAH moiety being detected. Specific detection of mixtures of PAH-adducted 2'-deoxynucleosides was achieved using online column-switching LC/MS/MS in conjunction with selected reaction monitoring (SRM) of the [M+H](+) to [M+H-116](+) transition plus product ions derived from the PAH moiety for improved sensitivity of detection and a comparison was made to detection by constant neutral loss scanning. In conclusion, different PAH DNA adducts were detected by employing SRM [M+H-116](+) transitions or constant neutral loss scanning. However, for improved sensitivity of detection optimised SRM transitions relating to the PAH moiety product ions are required for certain PAH DNA adducts for the development of targeted DNA adductomic methods. 2010 John Wiley & Sons, Ltd.

  2. Multiple tag labeling method for DNA sequencing

    DOEpatents

    Mathies, R.A.; Huang, X.C.; Quesada, M.A.

    1995-07-25

    A DNA sequencing method is described which uses single lane or channel electrophoresis. Sequencing fragments are separated in the lane and detected using a laser-excited, confocal fluorescence scanner. Each set of DNA sequencing fragments is separated in the same lane and then distinguished using a binary coding scheme employing only two different fluorescent labels. Also described is a method of using radioisotope labels. 5 figs.

  3. Quantitative detection of RASSF1A DNA promoter methylation in tumors and serum of patients with serous epithelial ovarian cancer.

    PubMed

    Bondurant, Amy E; Huang, Zhiqing; Whitaker, Regina S; Simel, Lauren R; Berchuck, Andrew; Murphy, Susan K

    2011-12-01

    Detection of cell free tumor-specific DNA methylation has been proposed as a potentially useful noninvasive mechanism to detect malignancies, including ovarian cancer, and to monitor response to treatment. However, there are few easily implemented quantitative approaches available for DNA methylation analysis. Our objectives were to develop an absolute quantitative method for detection of DNA methylation using RASSF1A, a known target of promoter methylation in ovarian cancer, and test the ability to detect RASSF1A methylation in tumors and serum specimens of women with ovarian cancer. Bisulfite modified DNAs were subjected to real time PCR using nondiscriminatory PCR primers and a probe with sequence containing a single CpG site, theoretically able to capture the methylation status of that CpG for every allele within a given specimen. Input DNA was normalized to ACTB levels detected simultaneously by assay multiplexing. Methylation levels were established by comparison to results obtained from universally methylated DNA. The assay was able to detect one methylated RASSF1A allele in 100,000 unmethylated alleles. RASSF1A was methylated in 54 of 106 (51%) invasive serous ovarian cancers analyzed and methylation status was concordant in 20/20 matched preoperative serum-tumor pairs. Serial serum specimens taken over the course of treatment for 8 of 9 patients showed fluctuations in RASSF1A methylation concomitant with disease status. This novel assay provides a real-time PCR-based method for absolute quantitation of DNA methylation. Our results support feasibility of monitoring RASSF1A methylation from serum samples taken over the course of treatment from women with ovarian cancer. Copyright © 2011 Elsevier Inc. All rights reserved.

  4. Do Circulating Tumor Cells, Exosomes, and Circulating Tumor Nucleic Acids Have Clinical Utility?

    PubMed Central

    Gold, Bert; Cankovic, Milena; Furtado, Larissa V.; Meier, Frederick; Gocke, Christopher D.

    2016-01-01

    Diagnosing and screening for tumors through noninvasive means represent an important paradigm shift in precision medicine. In contrast to tissue biopsy, detection of circulating tumor cells (CTCs) and circulating tumor nucleic acids provides a minimally invasive method for predictive and prognostic marker detection. This allows early and serial assessment of metastatic disease, including follow-up during remission, characterization of treatment effects, and clonal evolution. Isolation and characterization of CTCs and circulating tumor DNA (ctDNA) are likely to improve cancer diagnosis, treatment, and minimal residual disease monitoring. However, more trials are required to validate the clinical utility of precise molecular markers for a variety of tumor types. This review focuses on the clinical utility of CTCs and ctDNA testing in patients with solid tumors, including somatic and epigenetic alterations that can be detected. A comparison of methods used to isolate and detect CTCs and some of the intricacies of the characterization of the ctDNA are also provided. PMID:25908243

  5. A new fluorescence turn-on nanobiosensor for the detection of micro-RNA-21 based on a DNA-gold nanocluster

    NASA Astrophysics Data System (ADS)

    Hosseini, Morteza; Ahmadi, Elnaz; Borghei, Yasaman-Sadat; Ganjali, Mohammad Reza

    2017-03-01

    In this study, DNA/gold nanoclusters (AuNCs) were used to develop an AuNC-based turn-on fluorescence probe for the analysis of mi-RNA-21, which is a potential screening biomarker for cancer detection. AuNCs on a DNA scaffold were prepared through a one-pot wet-chemical route and evaluated by transmission electron microscopy and dynamic light scattering. Experiments revealed that the fluorescence intensity of the DNA-AuNCs showed a gradual increase with the addition of the target species in a concentration range from 1pM to 10 nM. The method had a detection limit of 0.7 pM and was able to discriminate the target species from mismatched mi-RNAs very efficiently. The method was used for the determination of mi-RNA spiked human plasma samples, and was evaluated as a promising nanobiosensor for application in the selective detection of mi-RNA in various biomedical and clinical tests.

  6. Development of highly sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth and lead sulfide nanoparticles for the detection of pathogenic Aeromonas.

    PubMed

    Fernandes, António Maximiano; Abdalhai, Mandour H; Ji, Jian; Xi, Bing-Wen; Xie, Jun; Sun, Jiadi; Noeline, Rasoamandrary; Lee, Byong H; Sun, Xiulan

    2015-01-15

    In this paper, we reported the construction of new high sensitive electrochemical genosensor based on multiwalled carbon nanotubes-chitosan-bismuth complex (MWCNT-Chi-Bi) and lead sulfide nanoparticles for the detection of pathogenic Aeromonas. Lead sulfide nanoparticles capped with 5'-(NH2) oligonucleotides thought amide bond was used as signalizing probe DNA (sz-DNA) and thiol-modified oligonucleotides sequence was used as fixing probe DNA (fDNA). The two probes hybridize with target Aeromonas DNA (tDNA) sequence (fDNA-tDNA-szDNA). The signal of hybridization is detected by differential pulse voltammetry (DPV) after electrodeposition of released lead nanoparticles (PbS) from sz-DNA on the surface of glass carbon electrode decorated with MWCNT-Chi-Bi, which improves the deposition and traducing electrical signal. The optimization of incubation time, hybridization temperature, deposition potential, deposition time and the specificity of the probes were investigated. Our results showed the highest sensibility to detect the target gene when compared with related biosensors and polymerase chain reaction (PCR). The detection limit for this biosensor was 1.0×10(-14) M. We could detect lower than 10(2) CFU mL(-1) of Aeromonas in spiked tap water. This method is rapid and sensitive for the detection of pathogenic bacteria and would become a potential application in biomedical diagnosis, food safety and environmental monitoring. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Detection of DNA damage based on metal-mediated molecular beacon and DNA strands displacement reaction.

    PubMed

    Xiong, Yanxiang; Wei, Min; Wei, Wei; Yin, Lihong; Pu, Yuepu; Liu, Songqin

    2014-01-24

    DNA hairpin structure probes are usually designed by forming intra-molecular duplex based on Watson-Crick hydrogen bonds. In this paper, a molecular beacon based on silver ions-mediated cytosine-Ag(+)-cytosine base pairs was used to detect DNA. The inherent characteristic of the metal ligation facilitated the design of functional probe and the adjustment of its binding strength compared to traditional DNA hairpin structure probes, which make it be used to detect DNA in a simple, rapid and easy way with the help of DNA strands displacement reaction. The method was sensitive and also possesses the good specificity to differentiate the single base mismatched DNA from the complementary DNA. It was also successfully applied to study the damage effect of classic genotoxicity chemicals such as styrene oxide and sodium arsenite on DNA, which was significant in food science, environmental science and pharmaceutical science. Copyright © 2013 Elsevier B.V. All rights reserved.

  8. Non-invasive prenatal testing using cell-free fetal DNA in maternal circulation.

    PubMed

    Liao, Gary J W; Gronowski, Ann M; Zhao, Zhen

    2014-01-20

    The identification of cell-free fetal DNA (cffDNA) in maternal circulation has made non-invasive prenatal testing (NIPT) possible. Maternal plasma cell free DNA is a mixture of maternal and fetal DNA, of which, fetal DNA represents a minor population in maternal plasma. Therefore, methods with high sensitivity and precision are required to detect and differentiate fetal DNA from the large background of maternal DNA. In recent years, technical advances in the molecular analysis of fetal DNA (e.g., digital PCR and massively parallel sequencing (MPS)) has enabled the successful implementation of noninvasive testing into clinical practice, such as fetal sex assessment, RhD genotyping, and fetal chromosomal aneuploidy detection.With the ability to decipher the entire fetal genome from maternal plasma DNA, we foresee that an increased number of non-invasive prenatal tests will be available for detecting many single-gene disorders in the near future. This review briefly summarizes the technical aspects of the NIPT and application of NIPT in clinical practice.

  9. A dual amplification strategy for DNA detection combining bio-barcode assay and metal-enhanced fluorescence modality.

    PubMed

    Zhou, Zhenpeng; Li, Tian; Huang, Hongduan; Chen, Yang; Liu, Feng; Huang, Chengzhi; Li, Na

    2014-11-11

    Silver-enhanced fluorescence was coupled with a bio-barcode assay to facilitate a dual amplification assay to demonstrate a non-enzymatic approach for simple and sensitive detection of DNA. In the assay design, magnetic nanoparticles seeded with silver nanoparticles were modified with the capture DNA, and silver nanoparticles were modified with the binding of ssDNA and the fluorescently labeled barcode dsDNA. Upon introduction of the target DNA, a sandwich structure was formed because of the hybridization reaction. By simple magnetic separation, silver-enhanced fluorescence of barcode DNAs could be readily measured without the need of a further step to liberate barcode DNAs from silver nanoparticles, endowing the method with simplicity and high sensitivity with a detection limit of 1 pM.

  10. A Short Interspersed Nuclear Element (SINE)-Based Real-Time PCR Approach to Detect and Quantify Porcine Component in Meat Products.

    PubMed

    Zhang, Chi; Fang, Xin; Qiu, Haopu; Li, Ning

    2015-01-01

    Real-time PCR amplification of mitochondria gene could not be used for DNA quantification, and that of single copy DNA did not allow an ideal sensitivity. Moreover, cross-reactions among similar species were commonly observed in the published methods amplifying repetitive sequence, which hindered their further application. The purpose of this study was to establish a short interspersed nuclear element (SINE)-based real-time PCR approach having high specificity for species detection that could be used in DNA quantification. After massive screening of candidate Sus scrofa SINEs, one optimal combination of primers and probe was selected, which had no cross-reaction with other common meat species. LOD of the method was 44 fg DNA/reaction. Further, quantification tests showed this approach was practical in DNA estimation without tissue variance. Thus, this study provided a new tool for qualitative detection of porcine component, which could be promising in the QC of meat products.

  11. Triple-helix molecular switch-based aptasensors and DNA sensors.

    PubMed

    Bagheri, Elnaz; Abnous, Khalil; Alibolandi, Mona; Ramezani, Mohammad; Taghdisi, Seyed Mohammad

    2018-07-15

    Utilization of traditional analytical techniques is limited because they are generally time-consuming and require high consumption of reagents, complicated sample preparation and expensive equipment. Therefore, it is of great interest to achieve sensitive, rapid and simple detection methods. It is believed that nucleic acids assays, especially aptamers, are very important in modern life sciences for target detection and biological analysis. Aptamers and DNA-based sensors have been widely used for the design of various sensors owing to their unique features. In recent years, triple-helix molecular switch (THMS)-based aptasensors and DNA sensors have been broadly utilized for the detection and analysis of different targets. The THMS relies on the formation of DNA triplex via Watson-Crick and Hoogsteen base pairings under optimal conditions. This review focuses on recent progresses in the development and applications of electrochemical, colorimetric, fluorescence and SERS aptasensors and DNA sensors, which are based on THMS. Also, the advantages and drawbacks of these methods are discussed. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Minimal methylation classifier (MIMIC): A novel method for derivation and rapid diagnostic detection of disease-associated DNA methylation signatures.

    PubMed

    Schwalbe, E C; Hicks, D; Rafiee, G; Bashton, M; Gohlke, H; Enshaei, A; Potluri, S; Matthiesen, J; Mather, M; Taleongpong, P; Chaston, R; Silmon, A; Curtis, A; Lindsey, J C; Crosier, S; Smith, A J; Goschzik, T; Doz, F; Rutkowski, S; Lannering, B; Pietsch, T; Bailey, S; Williamson, D; Clifford, S C

    2017-10-18

    Rapid and reliable detection of disease-associated DNA methylation patterns has major potential to advance molecular diagnostics and underpin research investigations. We describe the development and validation of minimal methylation classifier (MIMIC), combining CpG signature design from genome-wide datasets, multiplex-PCR and detection by single-base extension and MALDI-TOF mass spectrometry, in a novel method to assess multi-locus DNA methylation profiles within routine clinically-applicable assays. We illustrate the application of MIMIC to successfully identify the methylation-dependent diagnostic molecular subgroups of medulloblastoma (the most common malignant childhood brain tumour), using scant/low-quality samples remaining from the most recently completed pan-European medulloblastoma clinical trial, refractory to analysis by conventional genome-wide DNA methylation analysis. Using this approach, we identify critical DNA methylation patterns from previously inaccessible cohorts, and reveal novel survival differences between the medulloblastoma disease subgroups with significant potential for clinical exploitation.

  13. DNA: Polymer and molecular code

    NASA Astrophysics Data System (ADS)

    Shivashankar, G. V.

    1999-10-01

    The thesis work focusses upon two aspects of DNA, the polymer and the molecular code. Our approach was to bring single molecule micromanipulation methods to the study of DNA. It included a home built optical microscope combined with an atomic force microscope and an optical tweezer. This combined approach led to a novel method to graft a single DNA molecule onto a force cantilever using the optical tweezer and local heating. With this method, a force versus extension assay of double stranded DNA was realized. The resolution was about 10 picoN. To improve on this force measurement resolution, a simple light backscattering technique was developed and used to probe the DNA polymer flexibility and its fluctuations. It combined the optical tweezer to trap a DNA tethered bead and the laser backscattering to detect the beads Brownian fluctuations. With this technique the resolution was about 0.1 picoN with a millisecond access time, and the whole entropic part of the DNA force-extension was measured. With this experimental strategy, we measured the polymerization of the protein RecA on an isolated double stranded DNA. We observed the progressive decoration of RecA on the l DNA molecule, which results in the extension of l , due to unwinding of the double helix. The dynamics of polymerization, the resulting change in the DNA entropic elasticity and the role of ATP hydrolysis were the main parts of the study. A simple model for RecA assembly on DNA was proposed. This work presents a first step in the study of genetic recombination. Recently we have started a study of equilibrium binding which utilizes fluorescence polarization methods to probe the polymerization of RecA on single stranded DNA. In addition to the study of material properties of DNA and DNA-RecA, we have developed experiments for which the code of the DNA is central. We studied one aspect of DNA as a molecular code, using different techniques. In particular the programmatic use of template specificity makes gene expression a prime example of a biological code. We developed a novel method of making DNA micro- arrays, the so-called DNA chip. Using the optical tweezer concept, we were able to pattern biomolecules on a solid substrate, developing a new type of sub-micron laser lithography. A laser beam is focused onto a thin gold film on a glass substrate. Laser ablation of gold results in local aggregation of nanometer scale beads conjugated with small DNA oligonucleotides, with sub-micron resolution. This leads to specific detection of cDNA and RNA molecules. We built a simple micro-array fabrication and detection in the laboratory, based on this method, to probe addressable pools (genes, proteins or antibodies). We have lately used molecular beacons (single stranded DNA with a stem-loop structure containing a fluorophore and quencher), for the direct detection of unlabelled mRNA. As a first step towards a study of the dynamics of the biological code, we have begun to examine the patterns of gene expression during virus (T7 phage) infection of E-coli bacteria.

  14. Rapid and sensitive detection of canine parvovirus type 2 by recombinase polymerase amplification.

    PubMed

    Wang, Jianchang; Liu, Libing; Li, Ruiwen; Wang, Jinfeng; Fu, Qi; Yuan, Wanzhe

    2016-04-01

    A novel recombinase polymerase amplification (RPA)-based method for detection of canine parvovirus type 2 (CPV-2) was developed. Sensitivity analysis showed that the detection limit of RPA was 10 copies of CPV-2 genomic DNA. RPA amplified both CPV-2a and -2b DNA but did not amplify the template of other important dog viruses (CCoV, PRV or CDV), demonstrating high specificity. The method was further validated with 57 canine fecal samples. An outstanding advantage of RPA is that it is an isothermal reaction and can be performed in a water bath, making RPA a potential alternative method for CPV-2 detection in resource-limited settings.

  15. Review of the clinical applications and technological advances of circulating tumor DNA in cancer monitoring.

    PubMed

    Chang, Yi; Tolani, Bhairavi; Nie, Xiuhong; Zhi, Xiuyi; Hu, Mu; He, Biao

    2017-01-01

    Circulating cell-free DNA (cfDNA) released by tumor cells, termed ctDNA, closely reflects the heterogeneity of primary cancers and their metastases. As a noninvasive, real-time monitoring biomarker, ctDNA is a promising tool for detecting driver gene mutations, assessing tumor burden and acquired resistance, and early diagnosis. However, isolation and enrichment of cfDNA is a big challenge due to the high degree of DNA fragmentation and its relatively low abundance in the bloodstream. This review aims to provide insights into the recent technological advances in acquisition of optimal quality cfDNA, the use of preservatives, isolation methods, processing timelines, and detection techniques. It also describes clinical applications of ctDNA in cancer patient management.

  16. System and method for introduction and stabilization of genes in Thermus sp.

    DOEpatents

    Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

    2005-03-01

    A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.

  17. Label-free DNA hybridization detection and single base-mismatch discrimination using CE-ICP-MS assay.

    PubMed

    Li, Yan; Sun, Shao-kai; Yang, Jia-lin; Jiang, Yan

    2011-12-07

    Detecting a specific DNA sequence and discriminating single base-mismatch is critical to clinical diagnosis, paternity testing, forensic sciences, food and drug industry, pathology, genetics, environmental monitoring, and anti-bioterrorism. To this end, capillary electrophoresis (CE) coupled with the inductively coupled plasma mass spectrometry (ICP-MS) method is developed using the displacing interaction between the target ssDNA and the competitor Hg(2+) for the first time. The thymine-rich capture ssDNA 1 is interacted with the competitor Hg(2+), forming an assembled complex in a hairpin-structure between the thymine bases arrangement at both sides of the capture ssDNA 1. In the presence of a target ssDNA with stronger affinity than that of the competitor Hg(2+), the energetically favorable hybridization between capture ssDNA 1 and the target ssDNA destroys the hairpin-structure and releases the competitor as free Hg(2+), which was then read out and accurately quantified by CE-ICP-MS assay. Under the optimal CE separation conditions, free Hg(2+) ions and its capture ssDNA 1 adduct were baseline separated and detected on-line by ICP-MS; the increased peak intensity of free Hg(2+) against the concentration of perfectly complementary target ssDNA was linear over the concentration range of 30-600 nmol L(-1) with a limit of detection of 8 nmol L(-1) (3s, n = 11) in the pre-incubated mixture containing 1 μmol L(-1) Hg(2+) and 0.2 μmol L(-1) capture ssDNA 1. This new assay method is simple in design since any target ssDNA binding can in principle result in free Hg(2+) release by 6-fold Hg(2+) signal amplification, avoiding oligonucleotide labeling or assistance by excess signal transducer and signal reporter to read out the target. Due to element-specific detection of ICP-MS in our assay procedure, the interference from the autofluorescence of substrata was eliminated.

  18. Highly sensitive electrochemical detection of human telomerase activity based on bio-barcode method.

    PubMed

    Li, Ying; Liu, Bangwei; Li, Xia; Wei, Qingli

    2010-07-15

    In the present study, an electrochemical method for highly sensitive detection of human telomerase activity was developed based on bio-barcode amplification assay. Telomerase was extracted from HeLa cells, then the extract was mixed with telomerase substrate (TS) primer to perform extension reaction. The extension product was hybridized with the capture DNA immobilized on the Au electrode and then reacted with the signal DNA on Au nanoparticles to form a sandwich hybridization mode. Electrochemical signals were generated by chronocoulometric interrogation of [Ru(NH(3))(6)](3+) that quantitatively binds to the DNA on Au nanoparticles via electrostatic interaction. This method can detect the telomerase activity from as little as 10 cultured cancer cells without the polymerase chain reaction (PCR) amplification of telomerase extension product. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  19. A comparison of DNA extraction protocols from blood spotted on FTA cards for the detection of tick-borne pathogens by Reverse Line Blot hybridization.

    PubMed

    Hailemariam, Zerihun; Ahmed, Jabbar Sabir; Clausen, Peter-Henning; Nijhof, Ard Menzo

    2017-01-01

    An essential step in the molecular detection of tick-borne pathogens (TBPs) in blood is the extraction of DNA. When cooled storage of blood under field conditions prior to DNA extraction in a dedicated laboratory is not possible, the storage of blood on filter paper forms a promising alternative. We evaluated six DNA extraction methods from blood spotted on FTA Classic ® cards (FTA cards), to determine the optimal protocol for the subsequent molecular detection of TBPs by PCR and the Reverse Line Blot hybridization assay (RLB). Ten-fold serial dilutions of bovine blood infected with Babesia bovis, Theileria mutans, Anaplasma marginale or Ehrlichia ruminantium were made by dilution with uninfected blood and spotted on FTA cards. Subsequently, DNA was extracted from FTA cards using six different DNA extraction protocols. DNA was also isolated from whole blood dilutions using a commercial kit. PCR/RLB results showed that washing of 3mm discs punched from FTA cards with FTA purification reagent followed by DNA extraction using Chelex ® resin was the most sensitive procedure. The detection limit could be improved when more discs were used as starting material for the DNA extraction, whereby the use of sixteen 3mm discs proved to be most practical. The presented best practice method for the extraction of DNA from blood spotted on FTA cards will facilitate epidemiological studies on TBPs. It may be particularly useful for field studies where a cold chain is absent. Copyright © 2016 Elsevier GmbH. All rights reserved.

  20. Signal-on electrochemical assay for label-free detection of TdT and BamHI activity based on grown DNA nanowire-templated copper nanoclusters.

    PubMed

    Hu, Yufang; Zhang, Qingqing; Xu, Lihua; Wang, Jiao; Rao, Jiajia; Guo, Zhiyong; Wang, Sui

    2017-11-01

    Electrochemical methods allow fast and inexpensive analysis of enzymatic activity. Here, a simple and yet efficient "signal-on" electrochemical assay for sensitive, label-free detection of DNA-related enzyme activity was established on the basis of terminal deoxynucleotidyl transferase (TdT)-mediated extension strategy. TdT, which is a template-independent DNA polymerase, can catalyze the sequential addition of deoxythymidine triphosphate (dTTP) at the 3'-OH terminus of single-stranded DNA (ssDNA); then, the TdT-yield T-rich DNA nanowires can be employed as the synthetic template of copper nanoclusters (CuNCs). Grown DNA nanowires-templated CuNCs (noted as DNA-CuNCs) were attached onto graphene oxide (GO) surface and exhibited unique electrocatalytic activity to H 2 O 2 reduction. Under optimal conditions, the proposed biosensor was utilized for quantitatively monitoring TdT activity, with the observed LOD of 0.1 U/mL. It also displayed high selectivity to TdT with excellent stability, and offered a facile, convenient electrochemical method for TdT-relevant inhibitors screening. Moreover, the proposed sensor was successfully used for BamHI activity detection, in which a new 3'-OH terminal was exposed by the digestion of a phosphate group. Ultimately, it has good prospects in DNA-related enzyme-based biochemical studies, disease diagnosis, and drug discovery. Graphical Abstract Extraordinary TdT-generated DNA-CuNCs are synthesized and act as a novel electrochemical sensing platform for sensitive detection of TdT and BamHI activity in biological environments.

  1. Evaluation of a new automated enzyme fluoroimmunoassay using recombinant plasmid dsDNA for the detection of anti-dsDNA antibodies in SLE.

    PubMed

    Villalta, D; Bizzaro, N; Corazza, D; Tozzoli, R; Tonutti, E

    2002-01-01

    ELISA methods to detect anti-double-stranded DNA (anti-dsDNA) antibodies are highly sensitive, but are less specific for the diagnosis of SLE than the immunofluorescence test on Crithidia luciliae (CLIFT) and the Farr assay because they also detect low-avidity antibodies. This study evaluated the specificity, sensitivity, positive predictive value (PPV), and negative predictive value (NPV) of a new automated fluoroimmunoassay (EliA dsDNA; Pharmacia, Freiburg, Germany). We compared the results with those obtained using a commercial CLIFT and an in-house anti-dsDNA IgG ELISA method, and verified its putative ability to detect only high-avidity anti-dsDNA antibodies. Sera from 100 SLE patients and 120 controls were studied. The control group included 20 healthy donors, 70 patients with other rheumatic diseases (32 systemic sclerosis (SSc); 18 primary Sjögren syndrome (pSS), 20 rheumatoid arthritis (RA)), and 30 patients with various infectious diseases (ID). Anti-dsDNA avidity was estimated using an ELISA method based upon the law of mass action, and a simplified Scatchard plot analysis for data elaboration; the apparent affinity constant (Kaa) was calculated and expressed as arbitrary units (L/U). Sensitivity, specificity, PPV, and NPV for SLE were 64%, 95.8%, 93.8% and 72.7%, respectively, for the EliA anti-dsDNA assay; 55%, 99.2%, 98.5%, and 68.8%, respectively, for the CLIFT; and 64%, 93.3%, 90.6%, and 72.3%, respectively, for the in-house ELISA. Although EliA anti-dsDNA was positive mainly in SLE patients with high- (Kaa>80 L/U) and intermediate- (Kaa 30-80 L/U) avidity antibodies (45.3% and 49.9%, respectively), it was also positive in five (7.8%) SLE patients with low-avidity anti-dsDNA antibodies, and five controls (three SSc, one pSS, and one ID) (mean Kaa = 16.4 +/- 9.04 L/U). In conclusion, EliA anti-dsDNA assay showed a higher sensitivity than the CLIFT, and a good specificity and PPV for SLE. Its putative ability to detect only high-avidity anti-dsDNA antibodies remains questionable. Copyright 2002 Wiley-Liss, Inc.

  2. An enhanced chemiluminescence resonance energy transfer system based on target recycling G-guadruplexes/hemin DNAzyme catalysis and its application in ultrasensitive detection of DNA.

    PubMed

    Chen, Jia; Huang, Yong; Vdovenko, Marina; Sakharov, Ivan Yu; Su, Guifa; Zhao, Shulin

    2015-06-01

    An enhanced chemiluminescence resonance energy transfer (CRET) system based on target recycling G-guadruplexes/hemin DNAzyme catalysis was developed for ultrasensitive detection of DNA. CRET system consists of luminol as chemiluminescent donor, and fluorescein isothiocyanate (FITC) as acceptor. The sensitive detection was achieved by using the system consisted of G-riched DNA, blocker DNA, and the Nb.BbvCI biocatalyst. Upon addition of target DNA to the system, target DNA hybridizes with the quasi-circular DNA structure, and forms a DNA duplex. The formation of DNA duplex triggers selective enzymatic cleavage of quasi-circular DNA by Nb.BbvCI, resulting in the release of target DNA and two G-riched DNAzyme segments. Released target DNA then hybridizes with another quasi-circular DNA structure to initiate the cleavage of the quasi-circular DNA structure. Eventually, each target DNA can go through many cycles, resulting in the digestion of many quasi-circular DNA structures, generating many G-riched DNAzyme segments. G-riched DNAzyme segment products assemble with hemin to form stable hemin/G-quadruplexes that exhibit peroxidase-like activity which can catalyze the oxidation of luminol by H2O2 to produce CL signals. In the presence of FITC, CL of luminol can excite FITC molecules, and thus produced CRET between the luminol and FITC. This unique analysis strategy gives a detection limit down to 80 fM, which is at least four orders of magnitude lower than that of unamplified DNA detection methods. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Highly sensitive DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization

    PubMed Central

    Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang

    2014-01-01

    A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528

  4. Detection of Methylated Circulating DNA as Noninvasive Biomarkers for Breast Cancer Diagnosis

    PubMed Central

    Cheuk, Isabella Wai Yin; Shin, Vivian Yvonne

    2017-01-01

    Internationally, breast cancer is the most common female cancer, and is induced by a combination of environmental, genetic, and epigenetic risk factors. Despite the advancement of imaging techniques, invasive sampling of breast epithelial cells is the only definitive diagnostic procedure for patients with breast cancer. To date, molecular biomarkers with high sensitivity and specificity for the screening and early detection of breast cancer are lacking. Recent evidence suggests that the detection of methylated circulating cell-free DNA in the peripheral blood of patients with cancer may be a promising quantitative and noninvasive method for cancer diagnosis. Methylation detection based on a multi-gene panel, rather than on the methylation status of a single gene, may be used to increase the sensitivity and specificity of breast cancer screening. In this review, the results of 14 relevant studies, investigating the efficacy of cell-free DNA methylation screening for breast cancer diagnosis, have been summarized. The genetic risk factors for breast cancer, the methods used for breast cancer detection, and the techniques and limitations related to the detection of cell-free DNA methylation status, have also been reviewed and discussed. From this review, we conclude that the analysis of peripheral blood or other samples to detect differentially methylated cell-free DNA is a promising technique for use in clinical settings, and may improve the sensitivity of screening for both, early detection and disease relapse, and thus improve the future prognosis of patients with breast cancer. PMID:28382090

  5. Biompha-LAMP: A New Rapid Loop-Mediated Isothermal Amplification Assay for Detecting Schistosoma mansoni in Biomphalaria glabrata Snail Host.

    PubMed

    Gandasegui, Javier; Fernández-Soto, Pedro; Hernández-Goenaga, Juan; López-Abán, Julio; Vicente, Belén; Muro, Antonio

    2016-12-01

    Schistosomiasis remains one of the most common endemic parasitic diseases affecting over 230 million people worlwide. Schistosoma mansoni is the main species causing intestinal and hepatic schistosomiasis and the fresh water pulmonate snails of the genus Biomphalaria are best known for their role as intermediate hosts of the parasite. The development of new molecular monitoring assays for large-scale screening of snails from transmission sites to detect the presence of schistosomes is an important point to consider for snail control interventions related to schistosomiasis elimination. Our work was focussed on developing and evaluating a new LAMP assay combined with a simple DNA extraction method to detect S. mansoni in experimentally infected snails as a diagnostic tool for field conditions. A LAMP assay using a set of six primers targeting a sequence of S. mansoni ribosomal intergenic spacer 28S-18S rRNA was designed. The detection limit of the LAMP assay was 0.1 fg of S. mansoni DNA at 63°C for 50 minutes. LAMP was evaluated by examining S. mansoni DNA in B. glabrata snails experimentally exposed to miracidia at different times post-exposure: early prepatent period (before cercarial shedding), light infections (snails exposed to a low number of miracidia) and detection of infected snails in pooled samples (within a group of uninfected snails). DNA for LAMP assays was obtained by using a commercial DNA extraction kit or a simple heat NaOH extraction method. We detected S. mansoni DNA in all groups of snails by using no complicated requirement procedure for DNA obtaining. Our LAMP assay, named Biompha-LAMP, is specific, sensitive, rapid and potentially adaptable as a cost-effective method for screening of intermediate hosts infected with S. mansoni in both individual snails and pooled samples. The assay could be suitable for large-scale field surveys for schistosomes control campaigns in endemic areas.

  6. Biompha-LAMP: A New Rapid Loop-Mediated Isothermal Amplification Assay for Detecting Schistosoma mansoni in Biomphalaria glabrata Snail Host

    PubMed Central

    Hernández-Goenaga, Juan; López-Abán, Julio; Vicente, Belén; Muro, Antonio

    2016-01-01

    Background Schistosomiasis remains one of the most common endemic parasitic diseases affecting over 230 million people worlwide. Schistosoma mansoni is the main species causing intestinal and hepatic schistosomiasis and the fresh water pulmonate snails of the genus Biomphalaria are best known for their role as intermediate hosts of the parasite. The development of new molecular monitoring assays for large-scale screening of snails from transmission sites to detect the presence of schistosomes is an important point to consider for snail control interventions related to schistosomiasis elimination. Our work was focussed on developing and evaluating a new LAMP assay combined with a simple DNA extraction method to detect S. mansoni in experimentally infected snails as a diagnostic tool for field conditions. Methodology/Principal findings A LAMP assay using a set of six primers targeting a sequence of S. mansoni ribosomal intergenic spacer 28S-18S rRNA was designed. The detection limit of the LAMP assay was 0.1 fg of S. mansoni DNA at 63°C for 50 minutes. LAMP was evaluated by examining S. mansoni DNA in B. glabrata snails experimentally exposed to miracidia at different times post-exposure: early prepatent period (before cercarial shedding), light infections (snails exposed to a low number of miracidia) and detection of infected snails in pooled samples (within a group of uninfected snails). DNA for LAMP assays was obtained by using a commercial DNA extraction kit or a simple heat NaOH extraction method. We detected S. mansoni DNA in all groups of snails by using no complicated requirement procedure for DNA obtaining. Conclusions/Significance Our LAMP assay, named Biompha-LAMP, is specific, sensitive, rapid and potentially adaptable as a cost-effective method for screening of intermediate hosts infected with S. mansoni in both individual snails and pooled samples. The assay could be suitable for large-scale field surveys for schistosomes control campaigns in endemic areas. PMID:27941967

  7. Plasmonic SERS nanochips and nanoprobes for medical diagnostics and bio-energy applications

    NASA Astrophysics Data System (ADS)

    Ngo, Hoan T.; Wang, Hsin-Neng; Crawford, Bridget M.; Fales, Andrew M.; Vo-Dinh, Tuan

    2017-02-01

    The development of rapid, easy-to-use, cost-effective, high accuracy, and high sensitive DNA detection methods for molecular diagnostics has been receiving increasing interest. Over the last five years, our laboratory has developed several chip-based DNA detection techniques including the molecular sentinel-on-chip (MSC), the multiplex MSC, and the inverse molecular sentinel-on-chip (iMS-on-Chip). In these techniques, plasmonic surface-enhanced Raman scattering (SERS) Nanowave chips were functionalized with DNA probes for single-step DNA detection. Sensing mechanisms were based on hybridization of target sequences and DNA probes, resulting in a distance change between SERS reporters and the Nanowave chip's gold surface. This distance change resulted in change in SERS intensity, thus indicating the presence and capture of the target sequences. Our techniques were single-step DNA detection techniques. Target sequences were detected by simple delivery of sample solutions onto DNA probe-functionalized Nanowave chips and SERS signals were measured after 1h - 2h incubation. Target sequence labeling or washing to remove unreacted components was not required, making the techniques simple, easy-to-use, and cost effective. The usefulness of the techniques for medical diagnostics was illustrated by the detection of genetic biomarkers for respiratory viral infection and of dengue virus 4 DNA.

  8. Evaluation of DNA extraction methods and their clinical application for direct detection of causative bacteria in continuous ambulatory peritoneal dialysis culture fluids from patients with peritonitis by using broad-range PCR.

    PubMed

    Kim, Si Hyun; Jeong, Haeng Soon; Kim, Yeong Hoon; Song, Sae Am; Lee, Ja Young; Oh, Seung Hwan; Kim, Hye Ran; Lee, Jeong Nyeo; Kho, Weon-Gyu; Shin, Jeong Hwan

    2012-03-01

    The aims of this study were to compare several DNA extraction methods and 16S rDNA primers and to evaluate the clinical utility of broad-range PCR in continuous ambulatory peritoneal dialysis (CAPD) culture fluids. Six type strains were used as model organisms in dilutions from 10(8) to 10(0) colony-forming units (CFU)/mL for the evaluation of 5 DNA extraction methods and 5 PCR primer pairs. Broad-range PCR was applied to 100 CAPD culture fluids, and the results were compared with conventional culture results. There were some differences between the various DNA extraction methods and primer sets with regard to the detection limits. The InstaGene Matrix (Bio-Rad Laboratories, USA) and Exgene Clinic SV kits (GeneAll Biotechnology Co. Ltd, Korea) seem to have higher sensitivities than the others. The results of broad-range PCR were concordant with the results from culture in 97% of all cases (97/100). Two culture-positive cases that were broad-range PCR-negative were identified as Candida albicans, and 1 PCR-positive but culture-negative sample was identified as Bacillus circulans by sequencing. Two samples among 54 broad-range PCR-positive products could not be sequenced. There were differences in the analytical sensitivity of various DNA extraction methods and primers for broad-range PCR. The broad-range PCR assay can be used to detect bacterial pathogens in CAPD culture fluid as a supplement to culture methods.

  9. Gene for ataxia-telangiectasia complementation group D (ATDC)

    DOEpatents

    Murnane, John P.; Painter, Robert B.; Kapp, Leon N.; Yu, Loh-Chung

    1995-03-07

    Disclosed herein is a new gene, an AT gene for complementation group D, the ATDC gene and fragments thereof. Nucleic acid probes for said gene are provided as well as proteins encoded by said gene, cDNA therefrom, preferably a 3 kilobase (kb) cDNA, and recombinant nucleic acid molecules for expression of said proteins. Further disclosed are methods to detect mutations in said gene, preferably methods employing the polymerase chain reaction (PCR). Also disclosed are methods to detect AT genes from other AT complementation groups.

  10. Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

    PubMed

    Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

    2012-04-27

    To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (<25%) of the GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

  11. Partially reduced graphene oxide based FRET on fiber optic interferometer for biochemical detection

    NASA Astrophysics Data System (ADS)

    Yao, B. C.; Wu, Y.; Yu, C. B.; He, J. R.; Rao, Y. J.; Gong, Y.; Chen, Y. F.; Li, Y. R.

    2017-04-01

    An all-fiber graphene oxide (GO) based 'FRET on Fiber' concept is proposed and applied in biochemical detections. This method is of both good selectivity and high sensitivity, with detection limits of 1.2 nM, 1.3 μM and 1 pM, for metal ion, dopamine and single-stranded DNA (ssDNA), respectively.

  12. Segregation and recombination of a multipartite mitochondrial DNA in populations of the potato cyst nematode Globodera pallida.

    PubMed

    Armstrong, Miles R; Husmeier, Dirk; Phillips, Mark S; Blok, Vivian C

    2007-06-01

    The discovery that the potato cyst nematode Globodera pallida has a multipartite mitochondrial DNA (mtDNA) composed, at least in part, of six small circular mtDNAs (scmtDNAs) raised a number of questions concerning the population-level processes that might act on such a complex genome. Here we report our observations on the distribution of some scmtDNAs among a sample of European and South American G. pallida populations. The occurrence of sequence variants of scmtDNA IV in population P4A from South America, and that particular sequence variants are common to the individuals within a single cyst, is described. Evidence for recombination of sequence variants of scmtDNA IV in P4A is also reported. The mosaic structure of P4A scmtDNA IV sequences was revealed using several detection methods and recombination breakpoints were independently detected by maximum likelihood and Bayesian MCMC methods.

  13. Low template STR typing: effect of replicate number and consensus method on genotyping reliability and DNA database search results.

    PubMed

    Benschop, Corina C G; van der Beek, Cornelis P; Meiland, Hugo C; van Gorp, Ankie G M; Westen, Antoinette A; Sijen, Titia

    2011-08-01

    To analyze DNA samples with very low DNA concentrations, various methods have been developed that sensitize short tandem repeat (STR) typing. Sensitized DNA typing is accompanied by stochastic amplification effects, such as allele drop-outs and drop-ins. Therefore low template (LT) DNA profiles are interpreted with care. One can either try to infer the genotype by a consensus method that uses alleles confirmed in replicate analyses, or one can use a statistical model to evaluate the strength of the evidence in a direct comparison with a known DNA profile. In this study we focused on the first strategy and we show that the procedure by which the consensus profile is assembled will affect genotyping reliability. In order to gain insight in the roles of replicate number and requested level of reproducibility, we generated six independent amplifications of samples of known donors. The LT methods included both increased cycling and enhanced capillary electrophoresis (CE) injection [1]. Consensus profiles were assembled from two to six of the replications using four methods: composite (include all alleles), n-1 (include alleles detected in all but one replicate), n/2 (include alleles detected in at least half of the replicates) and 2× (include alleles detected twice). We compared the consensus DNA profiles with the DNA profile of the known donor, studied the stochastic amplification effects and examined the effect of the consensus procedure on DNA database search results. From all these analyses we conclude that the accuracy of LT DNA typing and the efficiency of database searching improve when the number of replicates is increased and the consensus method is n/2. The most functional number of replicates within this n/2 method is four (although a replicate number of three suffices for samples showing >25% of the alleles in standard STR typing). This approach was also the optimal strategy for the analysis of 2-person mixtures, although modified search strategies may be needed to retrieve the minor component in database searches. From the database searches follows the recommendation to specifically mark LT DNA profiles when entering them into the DNA database. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Rapid screening method for male DNA by using the loop-mediated isothermal amplification assay.

    PubMed

    Kitamura, Masashi; Kubo, Seiji; Tanaka, Jin; Adachi, Tatsushi

    2017-08-12

    Screening for male-derived biological material from collected samples plays an important role in criminal investigations, especially those involving sexual assaults. We have developed a loop-mediated isothermal amplification (LAMP) assay targeting multi-repeat sequences of the Y chromosome for detecting male DNA. Successful amplification occurred with 0.5 ng of male DNA under isothermal conditions of 61 to 67 °C, but no amplification occurred with up to 10 ng of female DNA. Under the optimized conditions, the LAMP reaction initiated amplification within 10 min and amplified for 20 min. The LAMP reaction was sensitive at levels as low as 1-pg male DNA, and a quantitative LAMP assay could be developed because of the strong correlation between the reaction time and the amount of template DNA in the range of 10 pg to 10 ng. Furthermore, to apply the LAMP assay to on-site screening for male-derived samples, we evaluated a protocol using a simple DNA extraction method and a colorimetric intercalating dye that allows detection of the LAMP reaction by evaluating the change in color of the solution. Using this protocol, samples of male-derived blood and saliva stains were processed in approximately 30 min from DNA extraction to detection. Because our protocol does not require much hands-on time or special equipment, this LAMP assay promises to become a rapid and simple screening method for male-derived samples in forensic investigations.

  15. Design of a species-specific PCR method for the detection of the heat-resistant fungi Talaromyces macrosporus and Talaromyces trachyspermus.

    PubMed

    Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y

    2018-01-01

    Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.

  16. Using Environmental DNA to Estimate the Distribution of an Invasive Fish Species in Ponds

    PubMed Central

    Takahara, Teruhiko; Minamoto, Toshifumi; Doi, Hideyuki

    2013-01-01

    Knowledge of the presence of an invasive species is critical to monitoring the sustainability of communities and ecosystems. Environmental DNA (eDNA), DNA fragments that are likely to be bound to organic matters in the water or in shed cells, has been used to monitor the presence of aquatic animals. Using an eDNA-based method, we estimated the presence of the invasive bluegill sunfish, Lepomis macrochirus, in 70 ponds located in seven locales on the Japanese mainland and on surrounding islands. We quantified the concentration of DNA copies in a 1 L water sample using quantitative real-time polymerase chain reaction (qPCR) with a primer/probe set. In addition, we visually observed the bluegill presence in the ponds from the shoreline. We detected bluegill eDNA in all the ponds where bluegills were observed visually and some where bluegills were not observed. Bluegills were also less prevalent on the islands than the mainland, likely owing to limited dispersal and introduction by humans. Our eDNA method simply and rapidly detects the presence of this invasive fish species with less disturbance to the environment during field surveys than traditional methods. PMID:23437177

  17. Using environmental DNA to estimate the distribution of an invasive fish species in ponds.

    PubMed

    Takahara, Teruhiko; Minamoto, Toshifumi; Doi, Hideyuki

    2013-01-01

    Knowledge of the presence of an invasive species is critical to monitoring the sustainability of communities and ecosystems. Environmental DNA (eDNA), DNA fragments that are likely to be bound to organic matters in the water or in shed cells, has been used to monitor the presence of aquatic animals. Using an eDNA-based method, we estimated the presence of the invasive bluegill sunfish, Lepomis macrochirus, in 70 ponds located in seven locales on the Japanese mainland and on surrounding islands. We quantified the concentration of DNA copies in a 1 L water sample using quantitative real-time polymerase chain reaction (qPCR) with a primer/probe set. In addition, we visually observed the bluegill presence in the ponds from the shoreline. We detected bluegill eDNA in all the ponds where bluegills were observed visually and some where bluegills were not observed. Bluegills were also less prevalent on the islands than the mainland, likely owing to limited dispersal and introduction by humans. Our eDNA method simply and rapidly detects the presence of this invasive fish species with less disturbance to the environment during field surveys than traditional methods.

  18. Impact of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization method.

    PubMed

    do Nascimento, Cássio; dos Santos, Janine Navarro; Pedrazzi, Vinícius; Pita, Murillo Sucena; Monesi, Nadia; Ribeiro, Ricardo Faria; de Albuquerque, Rubens Ferreira

    2014-01-01

    Molecular diagnosis methods have been largely used in epidemiological or clinical studies to detect and quantify microbial species that may colonize the oral cavity in healthy or disease. The preservation of genetic material from samples remains the major challenge to ensure the feasibility of these methodologies. Long-term storage may compromise the final result. The aim of this study was to evaluate the effect of temperature and time storage on the microbial detection of oral samples by Checkerboard DNA-DNA hybridization. Saliva and supragingival biofilm were taken from 10 healthy subjects, aliquoted (n=364) and processed according to proposed protocols: immediate processing and processed after 2 or 4 weeks, and 6 or 12 months of storage at 4°C, -20°C and -80°C. Either total or individual microbial counts were recorded in lower values for samples processed after 12 months of storage, irrespective of temperatures tested. Samples stored up to 6 months at cold temperatures showed similar counts to those immediately processed. The microbial incidence was also significantly reduced in samples stored during 12 months in all temperatures. Temperature and time of oral samples storage have relevant impact in the detection and quantification of bacterial and fungal species by Checkerboard DNA-DNA hybridization method. Samples should be processed immediately after collection or up to 6 months if conserved at cold temperatures to avoid false-negative results. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Highly selective and sensitive detection of miRNA based on toehold-mediated strand displacement reaction and DNA tetrahedron substrate.

    PubMed

    Li, Wei; Jiang, Wei; Ding, Yongshun; Wang, Lei

    2015-09-15

    MicroRNAs (miRNAs) play important roles in a variety of biological processes and have been regarded as tumor biomarkers in cancer diagnosis and prognosis. In this work, a single-molecule counting method for miRNA analysis was proposed based on toehold-mediated strand displacement reaction (SDR) and DNA tetrahedron substrate. Firstly, a specially designed DNA tetrahedron was assembled with a hairpin at one of the vertex, which has an overhanging toehold domain. Then, the DNA tetrahedron was immobilized on the epoxy-functional glass slide by epoxy-amine reaction, forming a DNA tetrahedron substrate. Next, the target miRNA perhybridized with the toehold domain and initiated a strand displacement reaction along with the unfolding of the hairpin, realizing the selective recognization of miRNA. Finally, a biotin labeled detection DNA was hybridized with the new emerging single strand and the streptavidin coated QDs were used as fluorescent probes. Fluorescent images were acquired via epi-fluorescence microscopy, the numbers of fluorescence dots were counted one by one for quantification. The detection limit is 5 fM, which displayed an excellent sensitivity. Moreover, the proposed method which can accurately be identified the target miRNA among its family members, demonstrated an admirable selectivity. Furthermore, miRNA analysis in total RNA samples from human lung tissues was performed, suggesting the feasibility of this method for quantitative detection of miRNA in biomedical research and early clinical diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Improved Method for Direct Detection of Environmental Microorganisms Using an Amplification of 16S rDNA Region

    NASA Astrophysics Data System (ADS)

    Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.

    2004-12-01

    The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.

  1. Multiplex fluorescent PCR for noninvasive prenatal detection of fetal-derived paternally inherited diseases using circulatory fetal DNA in maternal plasma.

    PubMed

    Tang, Dong-ling; Li, Yan; Zhou, Xin; Li, Xia; Zheng, Fang

    2009-05-01

    To develop a fluorescent polymerase chain reaction (PCR) assay for the detection of circulating fetal DNA in maternal plasma and use the established multiplex in noninvasive prenatal genetic diagnosis and its further applications in forensic casework. The DNA template was extracted from 47 pregnant women and the whole blood samples from the stated biological fathers were used to detect genotype. Using multiplex fluorescent PCR at 16 different polymorphic short tandem repeat (STR) loci, maternal DNA extracted from plasma samples at early pregnancy, medium pregnancy and late pregnancy were used to detect genotype. Their husbands' DNA was also used for fetal genotype ascertainment. Multiplex fluorescent PCR with 16 polymorphic short tandem repeats revealed the presence of fetal DNA in all cases. Every pregnant women/husband pair was informative in at least 3 of 16 loci. The chances of detecting paternally inherited fetal alleles ranged from 66.67 to 94.12%. They are 66.67% in early pregnancy, 85.71% in medium pregnancy and 94.12% in late pregnancy. The accuracy of Multiplex PCR assay to detect fetal DNA was 100%. Circulating fetal DNA analysis can be used as a possible alternative tool in routine laboratory prenatal diagnosis in the near future; this highly polymorphic STR multiplex has greatly improved the chances of detecting paternally inherited fetal alleles compared with other fetal DNA detection systems that use fetus-derived Y sequences to detect only male fetal DNA in maternal plasma. Our proposed technique can be applied to both female and male fetuses, which provides a sensitive, accurate and efficient method for noninvasive prenatal genetic diagnosis and forensic casework.

  2. Direct electrochemical stripping detection of cystic-fibrosis-related DNA linked through cadmium sulfide quantum dots

    NASA Astrophysics Data System (ADS)

    Marin, Sergio; Merkoçi, Arben

    2009-02-01

    Electrochemical detection of a cadmium sulfide quantum dots (CdS QDs)-DNA complex connected to paramagnetic microbeads (MB) was performed without the need for chemical dissolving. The method is based on dropping 20 µl of CdS QD-DNA-MB suspension on the surface of a screen-printed electrode. It is followed by magnetic collection on the surface of the working electrode and electrochemical detection using square-wave voltammetry (SWV), giving a well-shaped and sensitive analytical signal. A cystic-fibrosis-related DNA sequence was sandwiched between the two DNA probes. One DNA probe is linked via biotin-streptavidin bonding with MB and the other one via thiol groups with the CdS QD used as tags. Nonspecific signals of DNA were minimized using a blocking agent and the results obtained were successfully employed in a model DNA sensor with an interest in future applications in the clinical field. The developed nanoparticle biosensing system may offer numerous opportunities in other fields where fast, low cost and efficient detection of small volume samples is required.

  3. Method for detecting point mutations in DNA utilizing fluorescence energy transfer

    DOEpatents

    Parkhurst, Lawrence J.; Parkhurst, Kay M.; Middendorf, Lyle

    2001-01-01

    A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.

  4. Electrochemical detection of glutathione based on Hg(2+)-mediated strand displacement reaction strategy.

    PubMed

    Lv, Yun; Yang, Lili; Mao, Xiaoxia; Lu, Mengjia; Zhao, Jing; Yin, Yongmei

    2016-11-15

    Glutathione (GSH) plays an important role in numerous cellular functions, and the abnormal GSH expression is closely related with many dangerous human diseases. In this work, we have proposed a simple but sensitive electrochemical method for quantitative detection of GSH based on an Hg(2+)-mediated strand displacement reaction. Owing to the specific binding of Hg(2+) with T-T mismatches, helper DNA can bind to 3' terminal of probe DNA 1 and initiate the displacement of probe DNA 2 immobilized on an electrode surface. However, Hg(2+)-mediated strand displacement reaction can be inhibited by the chelation of GSH with Hg(2+), thereby leading to an obvious electrochemical response obtained from methylene blue that is modified onto the probe DNA. Our method can sensitively detect GSH in a wide linear range from 0.5nM to 5μM with a low detection limit of 0.14nM, which can also easily distinguish target molecules in complex serum samples and even cell extractions. Therefore, this method may have great potential to monitor GSH in the physiological and pathological condition in the future. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Polymerase chain reaction-hybridization method using urease gene sequences for high-throughput Ureaplasma urealyticum and Ureaplasma parvum detection and differentiation.

    PubMed

    Xu, Chen; Zhang, Nan; Huo, Qianyu; Chen, Minghui; Wang, Rengfeng; Liu, Zhili; Li, Xue; Liu, Yunde; Bao, Huijing

    2016-04-15

    In this article, we discuss the polymerase chain reaction (PCR)-hybridization assay that we developed for high-throughput simultaneous detection and differentiation of Ureaplasma urealyticum and Ureaplasma parvum using one set of primers and two specific DNA probes based on urease gene nucleotide sequence differences. First, U. urealyticum and U. parvum DNA samples were specifically amplified using one set of biotin-labeled primers. Furthermore, amine-modified DNA probes, which can specifically react with U. urealyticum or U. parvum DNA, were covalently immobilized to a DNA-BIND plate surface. The plate was then incubated with the PCR products to facilitate sequence-specific DNA binding. Horseradish peroxidase-streptavidin conjugation and a colorimetric assay were used. Based on the results, the PCR-hybridization assay we developed can specifically differentiate U. urealyticum and U. parvum with high sensitivity (95%) compared with cultivation (72.5%). Hence, this study demonstrates a new method for high-throughput simultaneous differentiation and detection of U. urealyticum and U. parvum with high sensitivity. Based on these observations, the PCR-hybridization assay developed in this study is ideal for detecting and discriminating U. urealyticum and U. parvum in clinical applications. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

    ERIC Educational Resources Information Center

    Dimitrov, Valentin V.

    2009-01-01

    This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

  7. A simple and rapid DNA extraction method from whole blood for highly sensitive detection and quantitation of HIV-1 proviral DNA by real-time PCR.

    PubMed

    McFall, Sally M; Wagner, Robin L; Jangam, Sujit R; Yamada, Douglas H; Hardie, Diana; Kelso, David M

    2015-03-01

    Early diagnosis and access to treatment for infants with human immunodeficiency virus-1 (HIV-1) is critical to reduce infant mortality. The lack of simple point-of-care tests impedes the timely initiation of antiretroviral therapy. The development of FINA, filtration isolation of nucleic acids, a novel DNA extraction method that can be performed by clinic personnel in less than 2 min has been reported previously. In this report, significant improvements in the DNA extraction and amplification methods are detailed that allow sensitive quantitation of as little as 10 copies of HIV-1 proviral DNA and detection of 3 copies extracted from 100 μl of whole blood. An internal control to detect PCR inhibition was also incorporated. In a preliminary field evaluation of 61 South African infants, the FINA test demonstrated 100% sensitivity and specificity. The proviral copy number of the infant specimens was quantified, and it was established that 100 microliters of whole blood is required for sensitive diagnosis of infants. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  8. New applications of CRISPR/Cas9 system on mutant DNA detection.

    PubMed

    Jia, Chenqiang; Huai, Cong; Ding, Jiaqi; Hu, Lingna; Su, Bo; Chen, Hongyan; Lu, Daru

    2018-01-30

    The detection of mutant DNA is critical for precision medicine, but low-frequency DNA mutation is very hard to be determined. CRISPR/Cas9 is a robust tool for in vivo gene editing, and shows the potential for precise in vitro DNA cleavage. Here we developed a DNA mutation detection system based on CRISPR/Cas9 that can detect gene mutation efficiently even in a low-frequency condition. The system of CRISPR/Cas9 cleavage in vitro showed a high accuracy similar to traditional T7 endonuclease I (T7E1) assay in estimating mutant DNA proportion in the condition of normal frequency. The technology was further used for low-frequency mutant DNA detection of EGFR and HBB somatic mutations. To the end, Cas9 was employed to cleave the wild-type (WT) DNA and to enrich the mutant DNA. Using amplified fragment length polymorphism analysis (AFLPA) and Sanger sequencing, we assessed the sensitivity of CRISPR/Cas9 cleavage-based PCR, in which mutations at 1%-10% could be enriched and detected. When combined with blocker PCR, its sensitivity reached up to 0.1%. Our results suggested that this new application of CRISPR/Cas9 system is a robust and potential method for heterogeneous specimens in the clinical diagnosis and treatment management. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. [Current situation and prospect of breast cancer liquid biopsy].

    PubMed

    Zhou, B; Xin, L; Xu, L; Ye, J M; Liu, Y H

    2018-02-01

    Liquid biopsy is a diagnostic approach by analyzing body fluid samples. Peripheral blood is the most common sample. Urine, saliva, pleural effusion and ascites are also used. Now liquid biopsy is mainly used in the area of neoplasm diagnosis and treatment. Compared with traditional tissue biopsy, liquid biopsy is minimally invasive, convenient to sample and easy to repeat. Liquid biopsy mainly includes circulating tumor cells and circulating tumor DNA (ctDNA) detection. Detection of ctDNA requires sensitive and accurate methods. The progression of next-generation sequencing (NGS) and digital PCR promote the process of studies in ctDNA. In 2016, Nature published the result of whole-genome sequencing study of breast cancer. The study found 1 628 mutations of 93 protein-coding genes which may be driver mutations of breast cancer. The result of this study provided a new platform for breast cancer ctDNA studies. In recent years, there were many studies using ctDNA detection to monitor therapeutic effect and guide treatment. NGS is a promising technique in accessing genetic information and guiding targeted therapy. It must be emphasized that ctDNA detection using NGS is still at research stage. It is important to standardize ctDNA detection technique and perform prospective clinical researches. The time is not ripe for using ctDNA detection to guide large-scale breast cancer clinical practice at present.

  10. Sensitive electrochemical assaying of DNA methyltransferase activity based on mimic-hybridization chain reaction amplified strategy.

    PubMed

    Zhang, Linqun; Liu, Yuanjian; Li, Ying; Zhao, Yuewu; Wei, Wei; Liu, Songqin

    2016-08-24

    A mimic-hybridization chain reaction (mimic-HCR) amplified strategy was proposed for sensitive electrochemically detection of DNA methylation and methyltransferase (MTase) activity In the presence of methylated DNA, DNA-gold nanoparticles (DNA-AuNPs) were captured on the electrode by sandwich-type assembly. It then triggered mimic-HCR of two hairpin probes to produce many long double-helix chains for numerous hexaammineruthenium (III) chloride ([Ru(NH3)6](3+), RuHex) inserting. As a result, the signal for electrochemically detection of DNA MTase activity could be amplified. If DNA was non-methylated, however, the sandwich-type assembly would not form because the short double-stranded DNAs (dsDNA) on the Au electrode could be cleaved and digested by restriction endonuclease HpaII (HapII) and exonuclease III (Exo III), resulting in the signal decrement. Based on this, an electrochemical approach for detection of M.SssI MTase activity with high sensitivity was developed. The linear range for M.SssI MTase activity was from 0.05 U mL(-1) to 10 U mL(-1), with a detection limit down to 0.03 U mL(-1). Moreover, this detecting strategy held great promise as an easy-to-use and highly sensitive method for other MTase activity and inhibition detection by exchanging the corresponding DNA sequence. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Dyes as bifunctional markers of DNA hybridization on surfaces and mutation detection.

    PubMed

    García-Mendiola, Tania; Cerro, María Ramos; López-Moreno, José María; Pariente, Félix; Lorenzo, Encarnación

    2016-10-01

    The interaction of small molecules with DNA has found diagnostic and therapeutic applications. In this work, we propose the use of two different dyes, in particular Azure A and Safranine, as bifunctional markers of on-surface DNA hybridization and potent tools for screening of specific gene mutations directly in real DNA PCR amplicons extracted from blood cells. By combining spectroscopic and electrochemical methods we demonstrate that both dyes can interact with single and double stranded DNA to a different extent, allowing reliable hybridization detection. From these data, we have also elucidated the nature of the interaction. We conclude that the binding mode is fundamentally intercalative with an electrostatic component. The dye fluorescence allows their use as nucleic acid stains for the detection of on-surfaces DNA hybridization. Its redox activity is exploited in the development of selective electrochemical DNA biosensors. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Simplified Identification of mRNA or DNA in Whole Cells

    NASA Technical Reports Server (NTRS)

    Almeida, Eduardo; Kadambi, Geeta

    2007-01-01

    A recently invented method of detecting a selected messenger ribonucleic acid (mRNA) or deoxyribonucleic acid (DNA) sequence offers two important advantages over prior such methods: it is simpler and can be implemented by means of compact equipment. The simplification and miniaturization achieved by this invention are such that this method is suitable for use outside laboratories, in field settings in which space and power supplies may be limited. The present method is based partly on hybridization of nucleic acid, which is a powerful technique for detection of specific complementary nucleic acid sequences and is increasingly being used for detection of changes in gene expression in microarrays containing thousands of gene probes.

  13. Improved EGFR mutation detection using combined exosomal RNA and circulating tumor DNA in NSCLC patient plasma

    PubMed Central

    Krug, A K; Enderle, D; Karlovich, C; Priewasser, T; Bentink, S; Spiel, A; Brinkmann, K; Emenegger, J; Grimm, D G; Castellanos-Rizaldos, E; Goldman, J W; Sequist, L V; Soria, J -C; Camidge, D R; Gadgeel, S M; Wakelee, H A; Raponi, M; Noerholm, M; Skog, J

    2018-01-01

    Abstract Background A major limitation of circulating tumor DNA (ctDNA) for somatic mutation detection has been the low level of ctDNA found in a subset of cancer patients. We investigated whether using a combined isolation of exosomal RNA (exoRNA) and cell-free DNA (cfDNA) could improve blood-based liquid biopsy for EGFR mutation detection in non-small-cell lung cancer (NSCLC) patients. Patients and methods Matched pretreatment tumor and plasma were collected from 84 patients enrolled in TIGER-X (NCT01526928), a phase 1/2 study of rociletinib in mutant EGFR NSCLC patients. The combined isolated exoRNA and cfDNA (exoNA) was analyzed blinded for mutations using a targeted next-generation sequencing panel (EXO1000) and compared with existing data from the same samples using analysis of ctDNA by BEAMing. Results For exoNA, the sensitivity was 98% for detection of activating EGFR mutations and 90% for EGFR T790M. The corresponding sensitivities for ctDNA by BEAMing were 82% for activating mutations and 84% for T790M. In a subgroup of patients with intrathoracic metastatic disease (M0/M1a; n = 21), the sensitivity increased from 26% to 74% for activating mutations (P = 0.003) and from 19% to 31% for T790M (P = 0.5) when using exoNA for detection. Conclusions Combining exoRNA and ctDNA increased the sensitivity for EGFR mutation detection in plasma, with the largest improvement seen in the subgroup of M0/M1a disease patients known to have low levels of ctDNA and poses challenges for mutation detection on ctDNA alone. Clinical Trials NCT01526928 PMID:29216356

  14. Characterization of copy numbers of 16S rDNA and 16S rRNA of Candidatus Liberibacter asiaticus and the implication in detection in planta using quantitative PCR.

    PubMed

    Kim, Jeong-Soon; Wang, Nian

    2009-03-06

    Citrus Huanglongbing (HLB) is one of the most devastating diseases on citrus and is associated with Candidatus Liberibacter spp.. The pathogens are phloem limited and have not been cultured in vitro. The current management strategy of HLB is to remove infected citrus trees and reduce psyllid populations with insecticides to prevent the spreading. This strategy requires sensitive and reliable diagnostic methods for early detection. We investigated the copy numbers of the 16S rDNA and 16S rRNA of the HLB pathogen and the implication of improving the diagnosis of HLB for early detection using Quantitative PCR. We compared the detection of HLB with different Quantitative PCR based methods with primers/probe targeting either 16S rDNA, beta-operon DNA, 16S rRNA, or beta-operon RNA. The 16S rDNA copy number of Ca. Liberibacter asiaticus was estimated to be three times of that of the beta-operon region, thus allowing detection of lower titer of Ca. L. asiaticus. Quantitative reverse transcriptional PCR (QRT-PCR) indicated that the 16S rRNA averaged 7.83 times more than that of 16S rDNA for the same samples. Dilution analysis also indicates that QRT-PCR targeting 16S rRNA is 10 time more sensitive than QPCR targeting 16S rDNA. Thus QRT-PCR was able to increase the sensitivity of detection by targeting 16S rRNA. Our result indicates that Candidatus Liberibacter asiaticus contains three copies of 16S rDNA. The copy number of 16S rRNA of Ca. L. asiaticus in planta averaged about 7.8 times of 16S rDNA for the same set of samples tested in this study. Detection sensitivity of HLB could be improved through the following approaches: using 16S rDNA based primers/probe in the QPCR assays; and using QRT-PCR assays targeting 16S rRNA.

  15. A highly sensitive SPRi biosensing strategy for simultaneous detection of multiplex miRNAs based on strand displacement amplification and AuNP signal enhancement.

    PubMed

    Wei, Xiaotong; Duan, Xiaolei; Zhou, Xiaoyan; Wu, Jiangling; Xu, Hongbing; Min, Xun; Ding, Shijia

    2018-06-07

    Herein, a dual channel surface plasmon resonance imaging (SPRi) biosensor has been developed for the simultaneous and highly sensitive detection of multiplex miRNAs based on strand displacement amplification (SDA) and DNA-functionalized AuNP signal enhancement. In the presence of target miRNAs (miR-21 or miR-192), the miRNAs could specifically hybridize with the corresponding hairpin probes (H) and initiate the SDA, resulting in massive triggers. Subsequently, the two parts of the released triggers could hybridize with capture probes (CP) and DNA-functionalized AuNPs, assembling DNA sandwiches with great mass on the chip surface. A significantly amplified SPR signal readout was achieved. This established biosensing method was capable of simultaneously detecting multiplex miRNAs with a limit of detection down to 0.15 pM for miR-21 and 0.22 pM for miR-192. This method exhibited good specificity and acceptable reproducibility. Moreover, the developed method was applied to the determination of target miRNAs in a complex matrix. Thus, this developed SPRi biosensing method may present a potential alternative tool for miRNA detection in biomedical research and clinical diagnosis.

  16. Single Fluorescence Channel-based Multiplex Detection of Avian Influenza Virus by Quantitative PCR with Intercalating Dye

    PubMed Central

    Ahberg, Christian D.; Manz, Andreas; Neuzil, Pavel

    2015-01-01

    Since its invention in 1985 the polymerase chain reaction (PCR) has become a well-established method for amplification and detection of segments of double-stranded DNA. Incorporation of fluorogenic probe or DNA intercalating dyes (such as SYBR Green) into the PCR mixture allowed real-time reaction monitoring and extraction of quantitative information (qPCR). Probes with different excitation spectra enable multiplex qPCR of several DNA segments using multi-channel optical detection systems. Here we show multiplex qPCR using an economical EvaGreen-based system with single optical channel detection. Previously reported non quantitative multiplex real-time PCR techniques based on intercalating dyes were conducted once the PCR is completed by performing melting curve analysis (MCA). The technique presented in this paper is both qualitative and quantitative as it provides information about the presence of multiple DNA strands as well as the number of starting copies in the tested sample. Besides important internal control, multiplex qPCR also allows detecting concentrations of more than one DNA strand within the same sample. Detection of the avian influenza virus H7N9 by PCR is a well established method. Multiplex qPCR greatly enhances its specificity as it is capable of distinguishing both haemagglutinin (HA) and neuraminidase (NA) genes as well as their ratio. PMID:26088868

  17. Photocleavable DNA Barcoding Antibodies for Multiplexed Protein Analysis in Single Cells.

    PubMed

    Ullal, Adeeti V; Weissleder, Ralph

    2015-01-01

    We describe a DNA-barcoded antibody sensing technique for single cell protein analysis in which the barcodes are photocleaved and digitally detected without amplification steps (Ullal et al., Sci Transl Med 6:219, 2014). After photocleaving the unique ~70 mer DNA barcodes we use a fluorescent hybridization technology for detection, similar to what is commonly done for nucleic acid readouts. This protocol offers a simple method for multiplexed protein detection using 100+ antibodies and can be performed on clinical samples as well as single cells.

  18. Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA

    PubMed Central

    Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus

    2018-01-01

    One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017

  19. Enhanced Detection of Bacteria in Environmental Waters: an RNA-based Approach

    EPA Science Inventory

    Molecular assays (i.e., PCR and qPCR) used in microbial water quality studies often target ribosomal RNA genes (rDNA). However, using DNA as the PCR template does not discriminate between active and dead cells. The use of RNA-based detection methods has recently been proposed as ...

  20. Evaluation of efficiency of nested multiplex allele-specific PCR assay for detection of multidrug resistant tuberculosis directly from sputum samples.

    PubMed

    Mistri, S K; Sultana, M; Kamal, S M M; Alam, M M; Irin, F; Nessa, J; Ahsan, C R; Yasmin, M

    2016-05-01

    For an effective control of tuberculosis, rapid detection of multidrug resistant tuberculosis (MDR-TB) is necessary. Therefore, we developed a modified nested multiplex allele-specific polymerase chain reaction (MAS-PCR) method that enables rapid MDR-TB detection directly from sputum samples. The efficacy of this method was evaluated using 79 sputum samples collected from suspected tuberculosis patients. The performance of nested MAS-PCR method was compared with other MDR-TB detection methods like drug susceptibility testing (DST) and DNA sequencing. As rifampicin (RIF) resistance conforms to MDR-TB in greater than 90% cases, only the presence of RIF-associated mutations in rpoB gene was determined by DNA sequencing and nested MAS-PCR to detect MDR-TB. The concordance between nested MAS-PCR and DNA sequencing results was found to be 96·3%. When compared with DST, the sensitivity and specificity of nested MAS-PCR for RIF-resistance detection were determined to be 92·9 and 100% respectively. For developing- and high-TB burden countries, molecular-based tests have been recommended by the World Health Organization for rapid detection of MDR-TB. The results of this study indicate that, nested MAS-PCR assay might be a practical and relatively cost effective molecular method for rapid detection of MDR-TB from suspected sputum samples in developing countries with resource poor settings. © 2016 The Society for Applied Microbiology.

  1. A high-throughput method for GMO multi-detection using a microfluidic dynamic array.

    PubMed

    Brod, Fábio Cristiano Angonesi; van Dijk, Jeroen P; Voorhuijzen, Marleen M; Dinon, Andréia Zilio; Guimarães, Luis Henrique S; Scholtens, Ingrid M J; Arisi, Ana Carolina Maisonnave; Kok, Esther J

    2014-02-01

    The ever-increasing production of genetically modified crops generates a demand for high-throughput DNA-based methods for the enforcement of genetically modified organisms (GMO) labelling requirements. The application of standard real-time PCR will become increasingly costly with the growth of the number of GMOs that is potentially present in an individual sample. The present work presents the results of an innovative approach in genetically modified crops analysis by DNA based methods, which is the use of a microfluidic dynamic array as a high throughput multi-detection system. In order to evaluate the system, six test samples with an increasing degree of complexity were prepared, preamplified and subsequently analysed in the Fluidigm system. Twenty-eight assays targeting different DNA elements, GM events and species-specific reference genes were used in the experiment. The large majority of the assays tested presented expected results. The power of low level detection was assessed and elements present at concentrations as low as 0.06 % were successfully detected. The approach proposed in this work presents the Fluidigm system as a suitable and promising platform for GMO multi-detection.

  2. Using eDNA to estimate distribution of fish species in a complex river system (presentation)

    EPA Science Inventory

    Environmental DNA (eDNA) analysis of biological material shed by aquatic organisms is a noninvasive genetic tool that can improve efficiency and reduce costs associated with species detection in aquatic systems. eDNA methods are widely used to assess presence/absence of a target ...

  3. Using eDNA to estimate distribution of fish species in the St. Louis River

    EPA Science Inventory

    Environmental DNA (eDNA) analysis of extracellular material shed by aquatic organisms is a noninvasive genetic tool that can improve efficiency and reduce costs associated with species detection in aquatic systems. eDNA methods are widely used to assess presence/absence of a targ...

  4. Hairpin DNA Switch for Ultrasensitive Spectrophotometric Detection of DNA Hybridization Based on Gold Nanoparticles and Enzyme Signal Amplification

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Youyu; Tang, Zhiwen; Wang, Jun

    2010-08-01

    A novel DNA detection platform based on a hairpin-DNA switch, nanoparticles, and enzyme signal amplification for ultrasensitive detection of DNA hybridization has been developed in this work. In this DNA assay, a “stem-loop” DNA probe dually labeled with a thiol at its 5’ end and a biotin at its 3’ end, respectively, was used. This probe was immobilized on the gold nanoparticles (AuNPs) anchored by a protein, globulin, on a 96-well microplate. In the absence of target DNA, the immobilized probe with the stem-loop structure shields the biotin from being approached by a bulky horseradish peroxidase linked-avidin (avidin-HRP) conjugate duemore » to the steric hindrance. However, in the presence of target DNA, the hybridization between the hairpin DNA probe and the target DNA causes significant conformational change of the probe, which forces biotin away from the surface of AuNPs. As a result, the biotin becomes accessible by the avidin-HRP, and the target hybridization event can be sensitively detected via the HRP catalyzed substrate 3, 3', 5, 5'-tetramethylbenzidine using spectrophometric method. Some experimental parameters governing the performance of the assay have been optimized. At optimal conditions, this DNA assay can detect DNA at the concentration of femtomolar level by means of a signal amplification strategy based on the combination of enzymes and nanoparticles. This approach also has shown excellent specificity to distinguish single-base mismatches of DNA targets because of the intrinsic high selectivity of the hairpin DNA probe.« less

  5. Real-time quantitative PCR detection of circulating tumor cells using tag DNA mediated signal amplification strategy.

    PubMed

    Mei, Ting; Lu, Xuewen; Sun, Ning; Li, Xiaomei; Chen, Jitao; Liang, Min; Zhou, Xinke; Fang, Zhiyuan

    2018-06-05

    The level of circulating tumor cell (CTCs) is a reliable marker for tumor burden and malignant progression. Quantification of CTCs remains technically challenging due to the rarity of these cells in peripheral blood. In the present study, we established a real-time quantitative PCR (Q-PCR) based method for sensitive detection of CTCs without DNA extraction. Blood sample was first turned to erythrocyte lyses and then incubated with two antibodies, tag-DNA modified CK-19 antibody and magnetic beads conjugated EpCAM antibody. Tumor cells were further enriched by magnetic separation. Tag-DNA that immobilized on tumor cells through CK-19 antibodies were also retrieved, which was further quantified by Q-PCR. This assay was able to detect single tumor cell in a 5 mL blood sample. The detection rate of clinical tumor blood sample was 92.3%. Furthermore, CTC count in patient was correlated with tumor stage and tumor status. The signal amplification was based on tag DNA rather than tumor gene, which was independent of nucleic acid extraction. With high sensitivity and convenience, this method can be a good alternative for the determination of cancer progress. Copyright © 2018 Elsevier B.V. All rights reserved.

  6. [Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

    PubMed

    Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

    2017-01-01

    Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

  7. EGFR mutation detection in circulating cell-free DNA of lung adenocarcinoma patients: analysis of LUX-Lung 3 and 6

    PubMed Central

    Wu, Yi-Long; Sequist, Lecia V; Hu, Cheng-Ping; Feng, Jifeng; Lu, Shun; Huang, Yunchao; Li, Wei; Hou, Mei; Schuler, Martin; Mok, Tony; Yamamoto, Nobuyuki; O'Byrne, Kenneth; Hirsh, Vera; Gibson, Neil; Massey, Dan; Kim, Miyoung; Yang, James Chih-Hsin

    2017-01-01

    Background: In the Phase III LUX-Lung 3/6 (LL3/LL6) trials in epidermal growth factor receptor (EGFR) mutation-positive lung adenocarcinoma patients, we evaluated feasibility of EGFR mutation detection using circulating cell-free DNA (cfDNA) and prognostic and predictive utility of cfDNA positivity (cfDNA+). Methods: Paired tumour and blood samples were prospectively collected from randomised patients. Mutations were detected using cfDNA from serum (LL3) or plasma (LL6) by a validated allele-specific quantitative real-time PCR kit. Results: EGFR mutation detection rates in cfDNA were 28.6% (serum) and 60.5% (plasma). Mutation detection in blood was associated with advanced disease characteristics, including higher performance score, number of metastatic sites and bone/liver metastases, and poorer prognosis. In patients with common EGFR mutations, afatinib improved progression-free survival vs chemotherapy in cfDNA+ (LL3: HR, 0.35; P=0.0009; LL6: HR, 0.25; P<0.0001) and cfDNA− (LL3: HR, 0.46; P<0.0001; LL6: HR, 0.12; P<0.0001) cohorts. A trend towards overall survival benefit with afatinib was observed in cfDNA+ patients. Conclusions: Plasma cfDNA is a promising alternative to biopsy for EGFR testing. Detectable mutation in blood was associated with more advanced disease and poorer prognosis. Afatinib improved outcomes in EGFR mutation-positive patients regardless of blood mutation status. PMID:28006816

  8. Distribution of DNA in human Sertoli cell nucleoli.

    PubMed

    Mosgöller, W; Schöfer, C; Derenzini, M; Steiner, M; Maier, U; Wachtler, F

    1993-10-01

    For better understanding of nucleolar architecture, different techniques have been used to localize DNA within the dense fibrillar component (DF) or within the fibrillar centers (FC) by electron microscopy (EM). Since it still remains controversial which components contain DNA, we investigated the distribution of DNA in human Sertoli cells using various approaches. In situ hybridization (ISH) with human total genomic DNA as probe and the use of anti-DNA antibody were followed by immunogold detection. This allowed statistical evaluation of the signal density over individual components. The Feulgen-like osmium-ammine (OA) technique for the selective visualization of DNA was also applied. The anti-DNA antibodies detected DNA in mitochondria, in chromatin, and in the DF of the nucleolus. ISH using human total genomic DNA showed similar labeling patterns. The OA technique revealed DNA filaments in the FC and focal agglomerates of decondensed DNA within the DF. We conclude that (a) EM staining techniques that utilize colloidal gold appear to be less sensitive for DNA detection than the OA method, (b) the DF consists of different domains with different molecular composition, and (c) decondensed DNA is not necessarily confined to one particular nucleolar component.

  9. Sensitive detection of porcine DNA in processed animal proteins using a TaqMan real-time PCR assay.

    PubMed

    Pegels, N; González, I; Fernández, S; García, T; Martín, R

    2012-01-01

    A TaqMan real-time PCR method was developed for specific detection of porcine-prohibited material in industrial feeds. The assay combines the use of a porcine-specific primer pair, which amplifies a 79 bp fragment of the mitochondrial (mt) 12 S rRNA gene, and a locked nucleic acid (LNA) TaqMan probe complementary to a target sequence lying between the porcine-specific primers. The nuclear 18 S rRNA gene system, yielding a 77 bp amplicon, was employed as a positive amplification control to monitor the total content of amplifiable DNA in the samples. The specificity of the porcine primers-probe system was verified against different animal and plant species, including mammals, birds and fish. The applicability of the real-time PCR protocol to detect the presence of porcine mt DNA in feeds was determined through the analysis of 190 industrial feeds (19 known reference and 171 blind samples) subjected to stringent processing treatments. The performance of the method allows qualitative and highly sensitive detection of short fragments from porcine DNA in all the industrial feeds declared to contain porcine material. Although the method has quantitative potential, the real quantitative capability of the assay is limited by the existing variability in terms of composition and processing conditions of the feeds, which affect the amount and quality of amplifiable DNA.

  10. Usefulness of FTA® cards as a Pneumocystis-DNA extraction method in bronchoalveolar lavage samples.

    PubMed

    Rodiño, Jenniffer M; Aguilar, Yudy A; Rueda, Zulma Vanessa; Vélez, Lázaro A

    2016-01-01

    FTA® cards (Fast Technology for Analysis of Nucleic Acids) are an alternative DNA extraction method in bronchoalveolar lavage (BAL) samples for Pneumocystis jirovecii molecular analyses. The goal was to evaluate the usefulness of FTA® cards to detect P. jirovecii-DNA by PCR in BAL samples compared to silica adsorption chromatography (SAC). This study used 134 BAL samples from immunocompromised patients previously studied to establish microbiological aetiology of pneumonia, among them 15 cases of Pneumocystis pneumonia (PCP) documented by staining and 119 with other alternative diagnoses. The FTA® system and SAC were used for DNA extraction and then amplified by nested PCR to detect P. jirovecii. Performance and concordance of the two DNA extraction methods compared to P. jirovecii microscopy were calculated. The influence of the macroscopic characteristics, transportation of samples and the duration of the FTA® card storage (1, 7, 10 or 12 months) were also evaluated. Among 134 BAL samples, 56% were positive for P. jirovecii-DNA by SAC and 27% by FTA®. All 15 diagnosed by microscopy were detected by FTA® and SAC. Specificity of the FTA® system and SAC were 82.4% and 49.6%, respectively. Compared to SAC, positivity by FTA® decreased with the presence of blood in BAL (62% vs 13.5%). The agreement between samples at 7, 10 and 12 months was 92.5% for FTA®. Positive cases by FTA® remained the same after shipment by mail. Results suggest that FTA® is a practical, safe and economical method to preserve P. jirovecii-DNA in BAL samples for molecular studies.

  11. Microfabricated plastic chips by hot embossing methods and their applications for DNA separation and detection

    NASA Astrophysics Data System (ADS)

    Lee, Gwo-Bin; Chen, Shu-Hui; Huang, Guan-Ruey; Lin, Yen-Heng; Sung, Wang-Chou

    2000-08-01

    Design and fabrication of microfluidic devices on polymethylmethacrylate (PMMA) substrates using novel microfabrication methods are described. The image of microfluidic devices is transferred from quartz master templates possessing inverse image of the devices to plastic plates by using hot embossing method. The micro channels on master templates are formed by the combination of metal etch mask and wet chemical etching. The micromachined quartz templates can be used repeatedly to fabricate cheap and disposable plastic devices. The reproducibility of the hot embossing method is evaluated after using 10 channels on different plastics. The relative standard deviation of the plastic channel profile from ones on quartz templates is less than 1%. In this study, the PMMA chips have been demonstrated as a micro capillary electrophoresis ((mu) -CE) device for DNA separation and detection. The capability of the fabricated chip for electrophoretic injection and separation is characterized via the analysis of DNA fragments (phi) X174. Results indicate that all of the 11 DNA fragments of the size marker could be identified in less than 3 minutes with relative standard deviations less than 0.4% and 8% for migration time and peak area, respectively. Moreover, with the use of near IR dye, fluorescence signals of the higher molecular weight fragments ($GTR 603 bp in length) could be detected at total DNA concentrations as low as 0.1 (mu) g/mL. In addition to DNA fragments (phi) X174, DNA sizing of hepatitis C viral (HCV) amplicon is also achieved using microchip electrophoresis fabricated on PMMA substrate.

  12. Loop-mediated isothermal amplification (LAMP): a versatile technique for detection of micro-organisms.

    PubMed

    Wong, Y-P; Othman, S; Lau, Y-L; Radu, S; Chee, H-Y

    2018-03-01

    Loop-mediated isothermal amplification (LAMP) amplifies DNA with high specificity, efficiency and rapidity under isothermal conditions by using a DNA polymerase with high displacement strand activity and a set of specifically designed primers to amplify targeted DNA strands. Following its first discovery by Notomi et al. ( Nucleic Acids Res 28: E63), LAMP was further developed over the years which involved the combination of this technique with other molecular approaches, such as reverse transcription and multiplex amplification for the detection of infectious diseases caused by micro-organisms in humans, livestock and plants. In this review, available types of LAMP techniques will be discussed together with their applications in detection of various micro-organisms. Up to date, there are varieties of LAMP detection methods available including colorimetric and fluorescent detection, real-time monitoring using turbidity metre and detection using lateral flow device which will also be highlighted in this review. Apart from that, commercialization of LAMP technique had also been reported such as lyophilized form of LAMP reagents kit and LAMP primer sets for detection of pathogenic micro-organisms. On top of that, advantages and limitations of this molecular detection method are also described together with its future potential as a diagnostic method for infectious disease. © 2017 The Society for Applied Microbiology.

  13. [Application of DNA extraction kit, 'GM quicker' for detection of genetically modified soybeans].

    PubMed

    Sato, Noriko; Sugiura, Yoshitsugu; Tanaka, Toshitsugu

    2012-01-01

    Several DNA extraction methods have been officially introduced to detect genetically modified soybeans, but the choice of DNA extraction kits depend on the nature of the samples, such as grains or processed foods. To overcome this disadvantage, we examined whether the GM quicker kit is available for both grains and processed foods. We compared GM quicker with four approved DNA extraction kits in respect of DNA purity, copy numbers of lectin gene, and working time. We found that the DNA quality of GM quicker was superior to that of the other kits for grains, and the procedure was faster. However, in the case of processed foods, GM quicker was not superior to the other kits. We therefore investigated an unapproved GM quicker 3 kit, which is available for DNA extraction from processed foods, such as tofu and boiled soybeans. The GM quicker 3 kit provided good DNA quality from both grains and processed foods, so we made a minor modification of the GM quicker-based protocol that was suitable for processed foods, using GM quicker and its reagents. The modified method enhanced the performance of GM quicker with processed foods. We believe that GM quicker with the modified protocol is an excellent tool to obtain high-quality DNA from grains and processed foods for detection of genetically modified soybeans.

  14. Systematic cloning of human minisatellites from ordered array charomid libraries.

    PubMed

    Armour, J A; Povey, S; Jeremiah, S; Jeffreys, A J

    1990-11-01

    We present a rapid and efficient method for the isolation of minisatellite loci from human DNA. The method combines cloning a size-selected fraction of human MboI DNA fragments in a charomid vector with hybridization screening of the library in ordered array. Size-selection of large MboI fragments enriches for the longer, more variable minisatellites and reduces the size of the library required. The library was screened with a series of multi-locus probes known to detect a large number of hypervariable loci in human DNA. The gridded library allowed both the rapid processing of positive clones and the comparative evaluation of the different multi-locus probes used, in terms of both the relative success in detecting hypervariable loci and the degree of overlap between the sets of loci detected. We report 23 new human minisatellite loci isolated by this method, which map to 14 autosomes and the sex chromosomes.

  15. Differences between clinical and laboratory findings in patients with recent diagnosis of SLE according to the positivity of anti-dsDNA by the Crithidia luciliae method.

    PubMed

    Sarbu, M I; Salman-Monte, T C; Rubio Muñoz, P; Lisbona, M P; Almirall Bernabé, M; Carbonell, J

    2015-10-01

    Of all anti-dsDNA antibody detection methods, the Crithidia luciliae immunofluorescence test (CLIF) is considered to have the highest specificity for systemic lupus erythematosus (SLE). The objective of this report is to evaluate whether the presence of anti-dsDNA antibodies detected by the CLIF method is associated with a specific clinical phenotype in recently diagnosed SLE. This retrospective cross-sectional study included all patients with newly diagnosed SLE between 1990 and 2011 and followed up in our institution. Demographic, clinical and laboratory findings were assessed. Correlations between positivity of anti-dsDNA by the CLIF method, clinical and laboratory data were analyzed. A total of 104 patients were included in the analysis. Patients who were positive for anti-dsDNA by the CLIF method at the time of diagnosis had (statistically) significantly higher titers of anti-dsDNA by the ELISA method, antinuclear (ANA) and anticardiolipin antibodies, lymphopenia and complement consumption compared with the other two groups. Also they presented significantly more musculoskeletal symptoms at baseline. The presence of anti-dsDNA by the CLIF method in newly diagnosed SLE was associated with certain markers of increased disease activity. Its use could be a useful biomarker for a specific clinical phenotype suggestive of a more severe involvement at the time of the diagnosis. © The Author(s) 2015 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

  16. Electrochemical biosensing strategies for DNA methylation analysis.

    PubMed

    Hossain, Tanvir; Mahmudunnabi, Golam; Masud, Mostafa Kamal; Islam, Md Nazmul; Ooi, Lezanne; Konstantinov, Konstantin; Hossain, Md Shahriar Al; Martinac, Boris; Alici, Gursel; Nguyen, Nam-Trung; Shiddiky, Muhammad J A

    2017-08-15

    DNA methylation is one of the key epigenetic modifications of DNA that results from the enzymatic addition of a methyl group at the fifth carbon of the cytosine base. It plays a crucial role in cellular development, genomic stability and gene expression. Aberrant DNA methylation is responsible for the pathogenesis of many diseases including cancers. Over the past several decades, many methodologies have been developed to detect DNA methylation. These methodologies range from classical molecular biology and optical approaches, such as bisulfite sequencing, microarrays, quantitative real-time PCR, colorimetry, Raman spectroscopy to the more recent electrochemical approaches. Among these, electrochemical approaches offer sensitive, simple, specific, rapid, and cost-effective analysis of DNA methylation. Additionally, electrochemical methods are highly amenable to miniaturization and possess the potential to be multiplexed. In recent years, several reviews have provided information on the detection strategies of DNA methylation. However, to date, there is no comprehensive evaluation of electrochemical DNA methylation detection strategies. Herein, we address the recent developments of electrochemical DNA methylation detection approaches. Furthermore, we highlight the major technical and biological challenges involved in these strategies and provide suggestions for the future direction of this important field. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Data-Independent Mass Spectrometry Approach for Screening and Identification of DNA Adducts.

    PubMed

    Guo, Jingshu; Villalta, Peter W; Turesky, Robert J

    2017-11-07

    Long-term exposures to environmental toxicants and endogenous electrophiles are causative factors for human diseases including cancer. DNA adducts reflect the internal exposure to genotoxicants and can serve as biomarkers for risk assessment. Liquid chromatography-multistage mass spectrometry (LC-MS n ) is the most common method for biomonitoring DNA adducts, generally targeting single exposures and measuring up to several adducts. However, the data often provide limited evidence for a role of a chemical in the etiology of cancer. An "untargeted" method is required that captures global exposures to chemicals, by simultaneously detecting their DNA adducts in the genome; some of which may induce cancer-causing mutations. We established a wide selected ion monitoring tandem mass spectrometry (wide-SIM/MS 2 ) screening method utilizing ultraperformance-LC nanoelectrospray ionization Orbitrap MS n with online trapping to enrich bulky, nonpolar adducts. Wide-SIM scan events are followed by MS 2 scans to screen for modified nucleosides by coeluting peaks containing precursor and fragment ions differing by -116.0473 Da, attributed to the neutral loss of deoxyribose. Wide-SIM/MS 2 was shown to be superior in sensitivity, specificity, and breadth of adduct coverage to other tested adductomic methods with detection possible at adduct levels as low as 4 per 10 9 nucleotides. Wide-SIM/MS 2 data can be analyzed in a "targeted" fashion by generation of extracted ion chromatograms or in an "untargeted" fashion where a chromatographic peak-picking algorithm can be used to detect putative DNA adducts. Wide-SIM/MS 2 successfully detected DNA adducts, derived from chemicals in the diet and traditional medicines and from lipid peroxidation products, in human prostate and renal specimens.

  18. Pneumocystis jiroveci in HIV/AIDS patients: detection by FTA filter paper together with PCR in noninvasive induced sputum specimens.

    PubMed

    Jaijakul, Siraya; Saksirisampant, Wilai; Prownebon, Juraratt; Yenthakam, Sutin; Mungthin, Mathirut; Leelayoova, Saovanee; Nuchprayoon, Surang

    2005-09-01

    To detect P. jiroveci (previously named P. carinii) by PCR using FTA filter paper to extract the DNA, from noninvasive induced sputum samples of HIV/AIDS patients. Fifty two HIV/AIDS patients suspected of Pneumocystis jiroveci pneumonia (PJP) in King Chulalongkorn Memorial Hospital were recruited. Both cytological method and PCR with FTA filter paper technique were performed to detect P jiroveci from each specimen. The detectability rate of P. jiroveci infection was 21%. The PCR with FTA filter paper method was 4 folds much more sensitive than Giemsa staining technique. P. jiroveci was detected in 18% of the HIV/AIDS patients in spite of receiving standard PJP prophylaxis. Detection of P. jiroveci by using FTA filter paper together with PCR in induced sputum samples could detect more cases of P. jiroveci infection than by using cytological method. DNA extraction using the FTA filter paper was more rapid and convenient than other extraction methods. The causes of failure of PJP prophylaxis should be evaluated.

  19. The Relationship between the Distribution of Common Carp and Their Environmental DNA in a Small Lake

    PubMed Central

    Eichmiller, Jessica J.; Bajer, Przemyslaw G.; Sorensen, Peter W.

    2014-01-01

    Although environmental DNA (eDNA) has been used to infer the presence of rare aquatic species, many facets of this technique remain unresolved. In particular, the relationship between eDNA and fish distribution is not known. We examined the relationship between the distribution of fish and their eDNA (detection rate and concentration) in a lake. A quantitative PCR (qPCR) assay for a region within the cytochrome b gene of the common carp (Cyprinus carpio or ‘carp’), an ubiquitous invasive fish, was developed and used to measure eDNA in Lake Staring (MN, USA), in which both the density of carp and their distribution have been closely monitored for several years. Surface water, sub-surface water, and sediment were sampled from 22 locations in the lake, including areas frequently used by carp. In water, areas of high carp use had a higher rate of detection and concentration of eDNA, but there was no effect of fish use on sediment eDNA. The detection rate and concentration of eDNA in surface and sub-surface water were not significantly different (p≥0.5), indicating that eDNA did not accumulate in surface water. The detection rate followed the trend: high-use water > low-use water > sediment. The concentration of eDNA in sediment samples that were above the limit of detection were several orders of magnitude greater than water on a per mass basis, but a poor limit of detection led to low detection rates. The patchy distribution of eDNA in the water of our study lake suggests that the mechanisms that remove eDNA from the water column, such as decay and sedimentation, are rapid. Taken together, these results indicate that effective eDNA sampling methods should be informed by fish distribution, as eDNA concentration was shown to vary dramatically between samples taken less than 100 m apart. PMID:25383965

  20. The relationship between the distribution of common carp and their environmental DNA in a small lake.

    PubMed

    Eichmiller, Jessica J; Bajer, Przemyslaw G; Sorensen, Peter W

    2014-01-01

    Although environmental DNA (eDNA) has been used to infer the presence of rare aquatic species, many facets of this technique remain unresolved. In particular, the relationship between eDNA and fish distribution is not known. We examined the relationship between the distribution of fish and their eDNA (detection rate and concentration) in a lake. A quantitative PCR (qPCR) assay for a region within the cytochrome b gene of the common carp (Cyprinus carpio or 'carp'), an ubiquitous invasive fish, was developed and used to measure eDNA in Lake Staring (MN, USA), in which both the density of carp and their distribution have been closely monitored for several years. Surface water, sub-surface water, and sediment were sampled from 22 locations in the lake, including areas frequently used by carp. In water, areas of high carp use had a higher rate of detection and concentration of eDNA, but there was no effect of fish use on sediment eDNA. The detection rate and concentration of eDNA in surface and sub-surface water were not significantly different (p≥0.5), indicating that eDNA did not accumulate in surface water. The detection rate followed the trend: high-use water > low-use water > sediment. The concentration of eDNA in sediment samples that were above the limit of detection were several orders of magnitude greater than water on a per mass basis, but a poor limit of detection led to low detection rates. The patchy distribution of eDNA in the water of our study lake suggests that the mechanisms that remove eDNA from the water column, such as decay and sedimentation, are rapid. Taken together, these results indicate that effective eDNA sampling methods should be informed by fish distribution, as eDNA concentration was shown to vary dramatically between samples taken less than 100 m apart.

  1. DNA-modified electrodes fabricated using copper-free click chemistry for enhanced protein detection.

    PubMed

    Furst, Ariel L; Hill, Michael G; Barton, Jacqueline K

    2013-12-31

    A method of DNA monolayer formation has been developed using copper-free click chemistry that yields enhanced surface homogeneity and enables variation in the amount of DNA assembled; extremely low-density DNA monolayers, with as little as 5% of the monolayer being DNA, have been formed. These DNA-modified electrodes (DMEs) were characterized visually, with AFM, and electrochemically, and were found to facilitate DNA-mediated reduction of a distally bound redox probe. These low-density monolayers were found to be more homogeneous than traditional thiol-modified DNA monolayers, with greater helix accessibility through an increased surface area-to-volume ratio. Protein binding efficiency of the transcriptional activator TATA-binding protein (TBP) was also investigated on these surfaces and compared to that on DNA monolayers formed with standard thiol-modified DNA. Our low-density monolayers were found to be extremely sensitive to TBP binding, with a signal decrease in excess of 75% for 150 nM protein. This protein was detectable at 4 nM, on the order of its dissociation constant, with our low-density monolayers. The improved DNA helix accessibility and sensitivity of our low-density DNA monolayers to TBP binding reflects the general utility of this method of DNA monolayer formation for DNA-based electrochemical sensor development.

  2. Ribosomal DNA status inferred from DNA cloud assays and mass spectrometry identification of agarose-squeezed proteins interacting with chromatin (ASPIC-MS).

    PubMed

    Krol, Kamil; Jendrysek, Justyna; Debski, Janusz; Skoneczny, Marek; Kurlandzka, Anna; Kaminska, Joanna; Dadlez, Michal; Skoneczna, Adrianna

    2017-04-11

    Ribosomal RNA-encoding genes (rDNA) are the most abundant genes in eukaryotic genomes. To meet the high demand for rRNA, rDNA genes are present in multiple tandem repeats clustered on a single or several chromosomes and are vastly transcribed. To facilitate intensive transcription and prevent rDNA destabilization, the rDNA-encoding portion of the chromosome is confined in the nucleolus. However, the rDNA region is susceptible to recombination and DNA damage, accumulating mutations, rearrangements and atypical DNA structures. Various sophisticated techniques have been applied to detect these abnormalities. Here, we present a simple method for the evaluation of the activity and integrity of an rDNA region called a "DNA cloud assay". We verified the efficacy of this method using yeast mutants lacking genes important for nucleolus function and maintenance (RAD52, SGS1, RRM3, PIF1, FOB1 and RPA12). The DNA cloud assay permits the evaluation of nucleolus status and is compatible with downstream analyses, such as the chromosome comet assay to identify DNA structures present in the cloud and mass spectrometry of agarose squeezed proteins (ASPIC-MS) to detect nucleolar DNA-bound proteins, including Las17, the homolog of human Wiskott-Aldrich Syndrome Protein (WASP).

  3. Ribosomal DNA status inferred from DNA cloud assays and mass spectrometry identification of agarose-squeezed proteins interacting with chromatin (ASPIC-MS)

    PubMed Central

    Krol, Kamil; Jendrysek, Justyna; Debski, Janusz; Skoneczny, Marek; Kurlandzka, Anna; Kaminska, Joanna; Dadlez, Michal; Skoneczna, Adrianna

    2017-01-01

    Ribosomal RNA-encoding genes (rDNA) are the most abundant genes in eukaryotic genomes. To meet the high demand for rRNA, rDNA genes are present in multiple tandem repeats clustered on a single or several chromosomes and are vastly transcribed. To facilitate intensive transcription and prevent rDNA destabilization, the rDNA-encoding portion of the chromosome is confined in the nucleolus. However, the rDNA region is susceptible to recombination and DNA damage, accumulating mutations, rearrangements and atypical DNA structures. Various sophisticated techniques have been applied to detect these abnormalities. Here, we present a simple method for the evaluation of the activity and integrity of an rDNA region called a “DNA cloud assay”. We verified the efficacy of this method using yeast mutants lacking genes important for nucleolus function and maintenance (RAD52, SGS1, RRM3, PIF1, FOB1 and RPA12). The DNA cloud assay permits the evaluation of nucleolus status and is compatible with downstream analyses, such as the chromosome comet assay to identify DNA structures present in the cloud and mass spectrometry of agarose squeezed proteins (ASPIC-MS) to detect nucleolar DNA-bound proteins, including Las17, the homolog of human Wiskott-Aldrich Syndrome Protein (WASP). PMID:28212567

  4. Detection of Adriamycin–DNA adducts by accelerator mass spectrometry at clinically relevant Adriamycin concentrations

    PubMed Central

    Coldwell, Kate E.; Cutts, Suzanne M.; Ognibene, Ted J.; Henderson, Paul T.; Phillips, Don R.

    2008-01-01

    Limited sensitivity of existing assays has prevented investigation of whether Adriamycin–DNA adducts are involved in the anti-tumour potential of Adriamycin. Previous detection has achieved a sensitivity of a few Adriamycin–DNA adducts/104 bp DNA, but has required the use of supra-clinical drug concentrations. This work sought to measure Adriamycin–DNA adducts at sub-micromolar doses using accelerator mass spectrometry (AMS), a technique with origins in geochemistry for radiocarbon dating. We have used conditions previously validated (by less sensitive decay counting) to extract [14C]Adriamycin–DNA adducts from cells and adapted the methodology to AMS detection. Here we show the first direct evidence of Adriamycin–DNA adducts at clinically-relevant Adriamycin concentrations. [14C]Adriamycin treatment (25 nM) resulted in 4.4 ± 1.0 adducts/107 bp (∼1300 adducts/cell) in MCF-7 breast cancer cells, representing the best sensitivity and precision reported to date for the covalent binding of Adriamycin to DNA. The exceedingly sensitive nature of AMS has enabled over three orders of magnitude increased sensitivity of Adriamycin–DNA adduct detection and revealed adduct formation within an hour of drug treatment. This method has been shown to be highly reproducible for the measurement of Adriamycin–DNA adducts in tumour cells in culture and can now be applied to the detection of these adducts in human tissues. PMID:18632763

  5. The value of the first trimester ultrasound in the era of cell free DNA screening.

    PubMed

    Rao, Rashmi R; Valderramos, Stephanie G; Silverman, Neil S; Han, Christina S; Platt, Lawrence D

    2016-12-01

    To describe the clinically relevant findings detected by the first trimester ultrasound (FTU) and to determine the additional value of the FTU compared to cell free DNA (cfDNA) alone. Retrospective cohort study of patients undergoing a FTU at a maternal-fetal medicine referral practice. Fetal, gynecologic, and placental findings detected by ultrasound were analyzed with available cfDNA and diagnostic testing results. A subgroup analysis of positive ultrasound findings and cfDNA results was performed to assess the additional benefit of ultrasound evaluation in FT prenatal screening. There were 1906 FTU between 1 October 2013 and 1 October 2014. CfDNA results were available for 959 (50%) patients. FTU detected: 42 fetal (2.2%), 286 gynecologic (15.0%), and 317 placental (16.6%) findings. CfDNA results were discordant with invasive testing results in 8/61 cases (13%) and with ultrasound findings in 18/42 (42%) cases. There were six false positive and two false negative cfDNA results confirmed by diagnostic testing. Subgroup analysis revealed that cfDNA as the sole method of prenatal screening in the FT would miss 95% of the fetal findings detected with ultrasound. The comprehensive FTU provides valuable clinical information about fetal and maternal anatomy that cannot be detected with cfDNA alone. © 2016 John Wiley & Sons, Ltd. © 2016 John Wiley & Sons, Ltd.

  6. Detection of Invasive Mosquito Vectors Using Environmental DNA (eDNA) from Water Samples

    PubMed Central

    Schneider, Judith; Valentini, Alice; Dejean, Tony; Montarsi, Fabrizio; Taberlet, Pierre

    2016-01-01

    Repeated introductions and spread of invasive mosquito species (IMS) have been recorded on a large scale these last decades worldwide. In this context, members of the mosquito genus Aedes can present serious risks to public health as they have or may develop vector competence for various viral diseases. While the Tiger mosquito (Aedes albopictus) is a well-known vector for e.g. dengue and chikungunya viruses, the Asian bush mosquito (Ae. j. japonicus) and Ae. koreicus have shown vector competence in the field and the laboratory for a number of viruses including dengue, West Nile fever and Japanese encephalitis. Early detection and identification is therefore crucial for successful eradication or control strategies. Traditional specific identification and monitoring of different and/or cryptic life stages of the invasive Aedes species based on morphological grounds may lead to misidentifications, and are problematic when extensive surveillance is needed. In this study, we developed, tested and applied an environmental DNA (eDNA) approach for the detection of three IMS, based on water samples collected in the field in several European countries. We compared real-time quantitative PCR (qPCR) assays specific for these three species and an eDNA metabarcoding approach with traditional sampling, and discussed the advantages and limitations of these methods. Detection probabilities for eDNA-based approaches were in most of the specific comparisons higher than for traditional survey and the results were congruent between both molecular methods, confirming the reliability and efficiency of alternative eDNA-based techniques for the early and unambiguous detection and surveillance of invasive mosquito vectors. The ease of water sampling procedures in the eDNA approach tested here allows the development of large-scale monitoring and surveillance programs of IMS, especially using citizen science projects. PMID:27626642

  7. Detection of Invasive Mosquito Vectors Using Environmental DNA (eDNA) from Water Samples.

    PubMed

    Schneider, Judith; Valentini, Alice; Dejean, Tony; Montarsi, Fabrizio; Taberlet, Pierre; Glaizot, Olivier; Fumagalli, Luca

    2016-01-01

    Repeated introductions and spread of invasive mosquito species (IMS) have been recorded on a large scale these last decades worldwide. In this context, members of the mosquito genus Aedes can present serious risks to public health as they have or may develop vector competence for various viral diseases. While the Tiger mosquito (Aedes albopictus) is a well-known vector for e.g. dengue and chikungunya viruses, the Asian bush mosquito (Ae. j. japonicus) and Ae. koreicus have shown vector competence in the field and the laboratory for a number of viruses including dengue, West Nile fever and Japanese encephalitis. Early detection and identification is therefore crucial for successful eradication or control strategies. Traditional specific identification and monitoring of different and/or cryptic life stages of the invasive Aedes species based on morphological grounds may lead to misidentifications, and are problematic when extensive surveillance is needed. In this study, we developed, tested and applied an environmental DNA (eDNA) approach for the detection of three IMS, based on water samples collected in the field in several European countries. We compared real-time quantitative PCR (qPCR) assays specific for these three species and an eDNA metabarcoding approach with traditional sampling, and discussed the advantages and limitations of these methods. Detection probabilities for eDNA-based approaches were in most of the specific comparisons higher than for traditional survey and the results were congruent between both molecular methods, confirming the reliability and efficiency of alternative eDNA-based techniques for the early and unambiguous detection and surveillance of invasive mosquito vectors. The ease of water sampling procedures in the eDNA approach tested here allows the development of large-scale monitoring and surveillance programs of IMS, especially using citizen science projects.

  8. An Electrochemical DNA Sensing System Using Modified Nanoparticle Probes for Detecting Methicillin-Resistant Staphylococcus aureus.

    PubMed

    Sakamoto, Hiroaki; Amano, Yoshihisa; Satomura, Takenori; Suye, Shin-Ichiro

    2017-01-01

    We have developed a novel, highly sensitive, biosensing system for detecting methicillin-resistant Staphylococcus aureus (MRSA). The system employs gold nanoparticles (AuNPs), magnetic nanoparticles (mNPs), and an electrochemical detection method. We have designed and synthesized ferrocene- and single-stranded DNA-conjugated nanoparticles that hybridize to MRSA DNA. Hybridized complexes are easily separated by taking advantage of mNPs. A current response could be obtained through the oxidation of ferrocene on the AuNP surface when a constant potential of +250 mV vs. Ag/AgCl is applied. The enzymatic reaction of L-proline dehydrogenase provides high signal amplification. This sensing system, using a nanoparticle-modified probe, has the ability to detect 10 pM of genomic DNA from MRSA without amplification by the polymerase chain reaction. Current responses are linearly related to the amount of genomic DNA in the range of 10-166 pM. Selectivity is confirmed by demonstrating that this sensing system could distinguish MRSA from Staphylococcus aureus (SA) DNA.

  9. Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

    PubMed Central

    2012-01-01

    Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

  10. Detection of Fungi from an Indoor Environment using Loop-mediated Isothermal Amplification (LAMP) Method.

    PubMed

    Nakayama, Takako; Yamazaki, Takashi; Yo, Ayaka; Tone, Kazuya; Mahdi Alshahni, Mohamed; Fujisaki, Ryuichi; Makimura, Koichi

    2017-01-01

     Loop-mediated isothermal amplification (LAMP) is a useful DNA detection method with high specificity and sensitivity. The LAMP reaction is carried out within a short time at a constant temperature without the need for thermal cycling. We developed a LAMP primer set for detecting a wide range of fungi by aligning the sequences of the large subunit ribosomal RNA gene of Candida albicans (Ascomycota), Cryptococcus neoformans (Basidiomycota), and Mucor racemosus (Mucorales). The threshold of C. albicans rDNA as template with our LAMP primer set was in the range of 10-100 copies per a reaction. In this study, we evaluated the correlation between colony forming units (CFU) and LAMP detection rate using the LAMP method for environmental fungi. The LAMP method should be a useful means of detecting fungi in indoor environments, disaster areas, or even in confined manned spacecraft to prevent allergies or infections caused by fungi.

  11. DNA Nucleotides Detection via capacitance properties of Graphene

    NASA Astrophysics Data System (ADS)

    Khadempar, Nahid; Berahman, Masoud; Yazdanpanah, Arash

    2016-05-01

    In the present paper a new method is suggested to detect the DNA nucleotides on a first-principles calculation of the electronic features of DNA bases which chemisorbed to a graphene sheet placed between two gold electrodes in a contact-channel-contact system. The capacitance properties of graphene in the channel are surveyed using non-equilibrium Green's function coupled with the Density Functional Theory. Thus, the capacitance properties of graphene are theoretically investigated in a biological environment, and, using a novel method, the effect of the chemisorbed DNA nucleotides on electrical charges on the surface of graphene is deciphered. Several parameters in this method are also extracted including Electrostatic energy, Induced density, induced electrostatic potential, Electron difference potential and Electron difference density. The qualitative and quantitative differences among these parameters can be used to identify DNA nucleotides. Some of the advantages of this approach include its ease and high accuracy. What distinguishes the current research is that it is the first experiment to investigate the capacitance properties of gaphene changes in the biological environment and the effect of chemisorbed DNA nucleotides on the surface of graphene on the charge.

  12. Rogue athletes and recombinant DNA technology: challenges for doping control.

    PubMed

    Azzazy, Hassan M E; Mansour, Mai M H

    2007-10-01

    The quest for athletic excellence holds no limit for some athletes, and the advances in recombinant DNA technology have handed these athletes the ultimate doping weapons: recombinant proteins and gene doping. Some detection methods are now available for several recombinant proteins that are commercially available as pharmaceuticals and being abused by dopers. However, researchers are struggling to come up with efficient detection methods in preparation for the imminent threat of gene doping, expected in the 2008 Olympics. This Forum article presents the main detection strategies for recombinant proteins and the forthcoming detection strategies for gene doping as well as the prime analytical challenges facing them.

  13. Detecting and identifying DNA via the THz backbone frequency using a metamaterial-based label-free biosensor

    NASA Astrophysics Data System (ADS)

    Mirzaei, Sahar; Green, Nicolas G.; Rotaru, Mihai; Pu, Suan Hui

    2017-02-01

    In genetic diagnostics, laboratory-based equipment generally uses analytical techniques requiring complicated and expensive fluorescent labelling of target DNA molecules. Intense research effort into, and commercial development of, Point-of-Care diagnostics and Personalized Healthcare are driving the development of simple, fast and cost-effective detection methods. One potential label-free DNA detection method uses Terahertz (THz) spectroscopy of the natural responses of DNA in metamaterial structures, which are engineered to have properties that are impossible to obtain in natural materials. This paper presents a study of the development of metamaterials based on asymmetric X-shaped resonator inclusions as a functional sensor for DNA. Gold X-shaped resonator structures with dimensions of 90/85 μm were demonstrated to produce trapped mode resonant frequency in the correct range for DNA detection. Realistic substrate materials in the form of 375 μm thick quartz were investigated, demonstrating that the non-transparent nature of the material resulted in the production of standing waves, affecting the system response, as well as requiring a reduction in scale of the resonator of 85%. As a result, the effect of introducing etched windows in the substrate material were investigated, demonstrating that increased window size significantly reduces the effect of the substrate on the system response. The device design showed a good selectivity when RNA samples were introduced to the model, demonstrating the potential for this design of device in the development of sensors capable of performing cheap and simple genetic analysis of DNA, giving label-free detection at high sensitivity.

  14. Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay

    NASA Astrophysics Data System (ADS)

    Zhou, Huijuan; Wu, Baoyan

    2008-12-01

    The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.

  15. Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

    PubMed

    Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

    2013-07-15

    Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Persistence of bacterial DNA in orthopedic infections.

    PubMed

    Kaplan, Heidi B; Miranda, Justin A; Gogola, Gloria R; Gomez, Karen; Ambrose, Catherine G

    2018-06-01

    Polymerase chain reaction (PCR) has been proposed as a method to identify bacteria in clinical samples because it is more sensitive than culture techniques and can produce results rapidly. However, PCR can detect DNA from dead cells and thus cannot distinguish between live and dead cells in a tissue sample. Killed Staphylococcus aureus cells were implanted into the femurs and knee joints of rats to determine the length of time that DNA from dead cells is detectable in a living animal under conditions similar to common orthopedic infections. In the joint infection model studied here, the DNA from the dead planktonic bacteria was detected using PCR immediately after injection or 24 h later, but was undetectable 48 and 72 h after injection. In the biofilm implanted-device model studied, the DNA from these dead biofilm cells was detected by PCR immediately after implantation and at 24 h, but not at 48 or 72 h. Thus, our results indicate that DNA from dead cells does not persist in these animal model systems for more than 2 days, which should reduce concerns about possible false positive results using molecular DNA-based techniques for the detection of pathogens. Copyright © 2018. Published by Elsevier Inc.

  17. Detection of Toxoplasma oocysts from soil by modified sucrose flotation and PCR methods.

    PubMed

    Matsuo, Junji; Kimura, Daisuke; Rai, Shiba Kumar; Uga, Shoji

    2004-06-01

    A detection method of Toxoplasma gondii oocysts from soil was evaluated using the sucrose flotation technique with modification involving addition of 0.1% gelatin into washing and floating solutions. PCR was performed on untreated samples and after treatment with polyvinylpyrrolidone (PVP), heating and cooling, and NaCl. The addition of gelatin in the sucrose solution yielded a higher number of oocysts. A very thin band was observed when DNA extract was diluted to 1:1024, indicating the presence of PCR inhibitor in the soil. PCR performed on untreated DNA, on PVP-treated, and on PVP-treated with heating and cooling without added bovine serum albumin (BSA) showed a band only at higher dilutions (1:1024 and 1:512) but at a much lower dilution (1:8) with BSA. In contrast, DNA treated with all three agents showed a band at a much lower dilution (1:64), even without added BSA, and no dilution was required when BSA was added. The PCR inhibitors present in the soil were removed by employing various treatment procedures during DNA extraction, and BSA in PCR. Furthermore, the detection limit with the method was 1 oocyst/g of soil, indicating that this method is useful in epidemiological studies.

  18. Technical adequacy of bisulfite sequencing and pyrosequencing for detection of mitochondrial DNA methylation: Sources and avoidance of false-positive detection.

    PubMed

    Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi

    2018-01-01

    The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.

  19. From molecules to management: adopting DNA-based methods for monitoring biological invasions in aquatic environments

    EPA Science Inventory

    Recent technological advances have driven rapid development of DNA-based methods designed to facilitate detection and monitoring of invasive species in aquatic environments. These tools promise to significantly alleviate difficulties associated with traditional monitoring approac...

  20. Determination for Enterobacter cloacae based on a europium ternary complex labeled DNA probe

    NASA Astrophysics Data System (ADS)

    He, Hui; Niu, Cheng-Gang; Zeng, Guang-Ming; Ruan, Min; Qin, Pin-Zhu; Liu, Jing

    2011-11-01

    The fast detection and accurate diagnosis of the prevalent pathogenic bacteria is very important for the treatment of disease. Nowadays, fluorescence techniques are important tools for diagnosis. A two-probe tandem DNA hybridization assay was designed for the detection of Enterobacter cloacae based on time-resolved fluorescence. In this work, the authors synthesized a novel europium ternary complex Eu(TTA) 3(5-NH 2-phen) with intense luminescence, high fluorescence quantum yield and long lifetime before. We developed a method based on this europium complex for the specific detection of original extracted DNA from E. cloacae. In the hybridization assay format, the reporter probe was labeled with Eu(TTA) 3(5-NH 2-phen) on the 5'-terminus, and the capture probe capture probe was covalent immobilized on the surface of the glutaraldehyde treated glass slides. The original extracted DNA of samples was directly used without any DNA purification and amplification. The detection was conducted by monitoring the fluorescence intensity from the glass surface after DNA hybridization. The detection limit of the DNA was 5 × 10 -10 mol L -1. The results of the present work proved that this new approach was easy to operate with high sensitivity and specificity. It could be conducted as a powerful tool for the detection of pathogen microorganisms in the environment.

  1. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  2. [Examination of processed vegetable foods for the presence of common DNA sequences of genetically modified tomatoes].

    PubMed

    Kitagawa, Mamiko; Nakamura, Kosuke; Kondo, Kazunari; Ubukata, Shoji; Akiyama, Hiroshi

    2014-01-01

    The contamination of processed vegetable foods with genetically modified tomatoes was investigated by the use of qualitative PCR methods to detect the cauliflower mosaic virus 35S promoter (P35S) and the kanamycin resistance gene (NPTII). DNA fragments of P35S and NPTII were detected in vegetable juice samples, possibly due to contamination with the genomes of cauliflower mosaic virus infecting juice ingredients of Brassica species and soil bacteria, respectively. Therefore, to detect the transformation construct sequences of GM tomatoes, primer pairs were designed for qualitative PCR to specifically detect the border region between P35S and NPTII, and the border region between nopaline synthase gene promoter and NPTII. No amplification of the targeted sequences was observed using genomic DNA purified from the juice ingredients. The developed qualitative PCR method is considered to be a reliable tool to check contamination of products with GM tomatoes.

  3. Automatic detection of spermatozoa for laser capture microdissection.

    PubMed

    Vandewoestyne, Mado; Van Hoofstat, David; Van Nieuwerburgh, Filip; Deforce, Dieter

    2009-03-01

    In sexual assault crimes, differential extraction of spermatozoa from vaginal swab smears is often ineffective, especially when only a few spermatozoa are present in an overwhelming amount of epithelial cells. Laser capture microdissection (LCM) enables the precise separation of spermatozoa and epithelial cells. However, standard sperm-staining techniques are non-specific and rely on sperm morphology for identification. Moreover, manual screening of the microscope slides is time-consuming and labor-intensive. Here, we describe an automated screening method to detect spermatozoa stained with Sperm HY-LITER. Different ratios of spermatozoa and epithelial cells were used to assess the automatic detection method. In addition, real postcoital samples were also screened. Detected spermatozoa were isolated using LCM and DNA analysis was performed. Robust DNA profiles without allelic dropout could be obtained from as little as 30 spermatozoa recovered from postcoital samples, showing that the staining had no significant influence on DNA recovery.

  4. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots.

    PubMed

    Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

    2015-05-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at -20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at -20°C or extracted immediately, especially if anticipating 2 or more years of storage. © The American Society of Tropical Medicine and Hygiene.

  5. The Effect of Storage and Extraction Methods on Amplification of Plasmodium falciparum DNA from Dried Blood Spots

    PubMed Central

    Schwartz, Alanna; Baidjoe, Amrish; Rosenthal, Philip J.; Dorsey, Grant; Bousema, Teun; Greenhouse, Bryan

    2015-01-01

    Extraction and amplification of DNA from dried blood spots (DBS) collected in field studies is commonly used for detection of Plasmodium falciparum. However, there have been few systematic efforts to determine the effects of storage and extraction methods on the sensitivity of DNA amplification. We investigated the effects of storage conditions, length of storage, and DNA extraction methods on amplification via three PCR-based assays using field samples and laboratory controls. Samples stored as DBS for 2 or more years at ambient temperature showed a significant loss of sensitivity that increased with time; after 10 years only 10% samples with parasite densities > 1,000 parasites/μL were detectable by nested polymerase chain reaction (PCR). Conversely, DBS and extracted DNA stored at −20°C showed no loss of sensitivity with time. Samples with low parasite densities amplified more successfully with saponin/Chelex compared with spin-column-based extraction, though the latter method performed better on samples with higher parasite densities stored for 2 years at ambient temperature. DNA extracted via both methods was stable after 20 freeze-thaw cycles. Our results suggest that DBS should be stored at −20°C or extracted immediately, especially if anticipating 2 or more years of storage. PMID:25758652

  6. Using personal glucose meters and functional DNA sensors to quantify a variety of analytical targets

    NASA Astrophysics Data System (ADS)

    Xiang, Yu; Lu, Yi

    2011-09-01

    Portable, low-cost and quantitative detection of a broad range of targets at home and in the field has the potential to revolutionize medical diagnostics and environmental monitoring. Despite many years of research, very few such devices are commercially available. Taking advantage of the wide availability and low cost of the pocket-sized personal glucose meter—used worldwide by diabetes sufferers—we demonstrate a method to use such meters to quantify non-glucose targets, ranging from a recreational drug (cocaine, 3.4 µM detection limit) to an important biological cofactor (adenosine, 18 µM detection limit), to a disease marker (interferon-gamma of tuberculosis, 2.6 nM detection limit) and a toxic metal ion (uranium, 9.1 nM detection limit). The method is based on the target-induced release of invertase from a functional-DNA-invertase conjugate. The released invertase converts sucrose into glucose, which is detectable using the meter. The approach should be easily applicable to the detection of many other targets through the use of suitable functional-DNA partners (aptamers, DNAzymes or aptazymes).

  7. Laser-induced heating integrated with a microfluidic platform for real-time DNA replication and detection

    NASA Astrophysics Data System (ADS)

    Hung, Min-Sheng; Ho, Chia-Chin; Chen, Chih-Pin

    2016-08-01

    This study developed a microfluidic platform for replicating and detecting DNA in real time by integrating a laser and a microfluidic device composed of polydimethylsiloxane. The design of the microchannels consisted of a laser-heating area and a detection area. An infrared laser was used as the heating source for DNA replication, and the laser power was adjusted to heat the solutions directly. In addition, strong biotin-avidin binding was used to capture and detect the replicated products. The biotin on one end was bound to avidin and anchored to the surface of the microchannels, whereas the biotin on the other end was bound to the quantum dots (Qdots). The results showed that the fluorescent intensity of the Qdots bound to the replicated products in the detection area increased with the number of thermal cycles created by the laser. When the number of thermal cycles was ≥10, the fluorescent intensity of the Qdots was directly detectable on the surface of the microchannels. The proposed method is more sensitive than detection methods entailing gel electrophoresis.

  8. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection.

    PubMed

    Lau, Han Yih; Botella, Jose R

    2017-01-01

    Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail.

  9. Advanced DNA-Based Point-of-Care Diagnostic Methods for Plant Diseases Detection

    PubMed Central

    Lau, Han Yih; Botella, Jose R.

    2017-01-01

    Diagnostic technologies for the detection of plant pathogens with point-of-care capability and high multiplexing ability are an essential tool in the fight to reduce the large agricultural production losses caused by plant diseases. The main desirable characteristics for such diagnostic assays are high specificity, sensitivity, reproducibility, quickness, cost efficiency and high-throughput multiplex detection capability. This article describes and discusses various DNA-based point-of care diagnostic methods for applications in plant disease detection. Polymerase chain reaction (PCR) is the most common DNA amplification technology used for detecting various plant and animal pathogens. However, subsequent to PCR based assays, several types of nucleic acid amplification technologies have been developed to achieve higher sensitivity, rapid detection as well as suitable for field applications such as loop-mediated isothermal amplification, helicase-dependent amplification, rolling circle amplification, recombinase polymerase amplification, and molecular inversion probe. The principle behind these technologies has been thoroughly discussed in several review papers; herein we emphasize the application of these technologies to detect plant pathogens by outlining the advantages and disadvantages of each technology in detail. PMID:29375588

  10. Quantification of 3-nitrobenzanthrone-DNA adducts using online column-switching HPLC-electrospray tandem mass spectrometry.

    PubMed

    Gamboa da Costa, Gonçalo; Singh, Rajinder; Arlt, Volker M; Mirza, Amin; Richards, Meirion; Takamura-Enya, Takeji; Schmeiser, Heinz H; Farmer, Peter B; Phillips, David H

    2009-11-01

    The aromatic nitroketone 3-nitrobenzanthrone (3-nitro-7H-benz[de]anthracen-7-one; 3-NBA) is an extremely potent mutagen and a suspected human carcinogen detected in the exhaust of diesel engines and in airborne particulate matter. 3-NBA is metabolically activated via reduction of the nitro group to the hydroxylamine (N-OH-3-ABA) to form covalent DNA adducts. Thus far, the detection and quantification of covalent 3-NBA-DNA adducts has relied solely on (32)P-postlabeling methodologies. In order to expand the range of available techniques for the detection and improved quantification of 3-NBA-DNA adducts, we have developed a method based upon online column-switching HPLC coupled to electrospray tandem mass spectrometry, with isotopic dilution of (15)N-labeled internal standards. This methodology was applied to the determination of three 3-NBA-derived adducts: 2-(2'-deoxyguanosin-N(2)-yl)-3-aminobenzanthrone (dG-N(2)-3-ABA), N-(2'-deoxyguanosin-8-yl)-3-aminobenzanthrone (dG-C8-N-3-ABA) and 2-(2'-deoxyguanosine-8-yl)-3-aminobenzanthrone (dG-C8-C2-3-ABA). Dose-dependent increases were observed for all three adducts when salmon testis DNA was reacted with N-acetoxy-3-aminobenzanthrone (N-AcO-3-ABA). dG-C8-C2-3-ABA was detected at much lower levels (overall 1%) than the other two adducts. DNA samples isolated from tissues of rats treated either intratracheally with 3-NBA or intraperitoneally with N-OH-3-ABA were analyzed by mass spectrometry, and the results compared to those obtained by (32)P-postlabeling. The method required 50 microg of hydrolyzed animal DNA on column and the limit of detection was 2.0 fmol for each adduct. dG-C8-C2-3-ABA was not observed in any of the samples providing confirmation that it is not formed in vivo. Linear regression analysis of the levels of dG-N(2)-3-ABA and dG-C8-N-3-ABA in the rat DNA showed a reasonable correlation between the two methods (R(2) = 0.88 and 0.93, respectively). In summary, the mass spectrometric method is a faster, more automated analytical approach that also provides structural confirmation of the adducts detected by (32)P-postlabeling, and it has sufficient sensitivity and precision to analyze DNA adducts in animals exposed to 3-NBA or its hydroxylamine metabolite.

  11. Molecular methods for pathogen detection and quantification

    USDA-ARS?s Scientific Manuscript database

    Ongoing interest in convenient, inexpensive, fast, sensitive and accurate techniques for detecting and/or quantifying the presence of soybean pathogens has resulted in increased usage of molecular tools. The method of extracting a molecular target (usually DNA or RNA) for detection depends wholly up...

  12. Heat-transfer resistance at solid-liquid interfaces: a tool for the detection of single-nucleotide polymorphisms in DNA.

    PubMed

    van Grinsven, Bart; Vanden Bon, Natalie; Strauven, Hannelore; Grieten, Lars; Murib, Mohammed; Monroy, Kathia L Jiménez; Janssens, Stoffel D; Haenen, Ken; Schöning, Michael J; Vermeeren, Veronique; Ameloot, Marcel; Michiels, Luc; Thoelen, Ronald; De Ceuninck, Ward; Wagner, Patrick

    2012-03-27

    In this article, we report on the heat-transfer resistance at interfaces as a novel, denaturation-based method to detect single-nucleotide polymorphisms in DNA. We observed that a molecular brush of double-stranded DNA grafted onto synthetic diamond surfaces does not notably affect the heat-transfer resistance at the solid-to-liquid interface. In contrast to this, molecular brushes of single-stranded DNA cause, surprisingly, a substantially higher heat-transfer resistance and behave like a thermally insulating layer. This effect can be utilized to identify ds-DNA melting temperatures via the switching from low- to high heat-transfer resistance. The melting temperatures identified with this method for different DNA duplexes (29 base pairs without and with built-in mutations) correlate nicely with data calculated by modeling. The method is fast, label-free (without the need for fluorescent or radioactive markers), allows for repetitive measurements, and can also be extended toward array formats. Reference measurements by confocal fluorescence microscopy and impedance spectroscopy confirm that the switching of heat-transfer resistance upon denaturation is indeed related to the thermal on-chip denaturation of DNA. © 2012 American Chemical Society

  13. An eDNA Assay to Monitor a Globally Invasive Fish Species from Flowing Freshwater.

    PubMed

    Adrian-Kalchhauser, Irene; Burkhardt-Holm, Patricia

    2016-01-01

    Ponto-Caspian gobies are a flock of five invasive fish species that have colonized freshwaters and brackish waters in Europe and North America. One of them, the round goby Neogobius melanostomus, figures among the 100 worst invaders in Europe. Current methods to detect the presence of Ponto-Caspian gobies involve catching or sighting the fish. These approaches are labor intense and not very sensitive. Consequently, populations are usually detected only when they have reached high densities and when management or containment efforts are futile. To improve monitoring, we developed an assay based on the detection of DNA traces (environmental DNA, or eDNA) of Ponto-Caspian gobies in river water. The assay specifically detects invasive goby DNA and does not react to any native fish species. We apply the assay to environmental samples and demonstrate that parameters such as sampling depth, sampling location, extraction protocol, PCR protocol and PCR inhibition greatly impact detection. We further successfully outline the invasion front of Ponto-Caspian gobies in a large river, the High Rhine in Switzerland, and thus demonstrate the applicability of the assay to lotic environments. The eDNA assay requires less time, equipment, manpower, skills, and financial resources than the conventional monitoring methods such as electrofishing, angling or diving. Samples can be taken by untrained individuals, and the assay can be performed by any molecular biologist on a conventional PCR machine. Therefore, this assay enables environment managers to map invaded areas independently of fishermen's' reports and fish community monitorings.

  14. Sensitive detection of microRNAs based on the conversion of colorimetric assay into electrochemical analysis with duplex-specific nuclease-assisted signal amplification

    PubMed Central

    Xia, Ning; Liu, Ke; Zhou, Yingying; Li, Yuanyuan; Yi, Xinyao

    2017-01-01

    miRNAs have emerged as new biomarkers for the detection of a wide variety of cancers. By employing duplex-specific nuclease for signal amplification and gold nanoparticles (AuNPs) as the carriers of detection probes, a novel electrochemical assay of miRNAs was performed. The method is based on conversion of the well-known colorimetric assay into electrochemical analysis with enhanced sensitivity. DNA capture probes immobilized on the electrode surface and ferrocene (Fc)-labeled DNA detection probes (denoted “Fc-DNA-Fc”) presented in the solution induced the assembly of positively charged AuNPs on the electrode surface through the electrostatic interaction. As a result, a large number of Fc-DNA-Fc molecules were attached on the electrode surface, thus amplifying the electrochemical signal. When duplex-specific nuclease was added to recycle the process of miRNA-initiated digestion of the immobilized DNA probes, Fc-DNA-Fc-induced assembly of AuNPs on the electrode surface could not occur. This resulted in a significant fall in the oxidation current of Fc. The current was found to be inversely proportional to the concentration of miRNAs in the range of 0–25 fM, and a detection limit of 0.1 fM was achieved. Moreover, this work presents a new method for converting colorimetric assays into sensitive electrochemical analyses, and thus would be valuable for design of novel chemical/biosensors. PMID:28761341

  15. Exogenous and endogenous DNA modifications as monitored by 32P-postlabeling: relationships to cancer and aging.

    PubMed

    Randerath, K; Li, D; Nath, R; Randerath, E

    1992-01-01

    32P-postlabeling analysis, a highly sensitive method for the detection and measurement of covalent carcinogen-DNA adducts and other DNA modifications, does not require radioactive test substances and, therefore, can be applied to DNA of mammals, including humans exposed to low doses of environmental or occupational genotoxicants. The basic procedure entails the enzymatic incorporation of 32P-label into hydrolysis products of DNA, followed by chromatographic mapping and autoradiography of the 32P-labeled digestion products and quantitative scintillation spectrometry. Microgram amounts of DNA are analyzed: Thus the assay is suited for limited amounts of cells or tissues. Various versions of the assay afford different sensitivities of adduct detection. A single aromatic or bulky/hydrophobic adduct in 10(8)-10(10) nucleotides can be detected and measured (corresponding to 0.3-30 amol adduct/micrograms DNA or 0.1-10 nmol adduct/mol DNA-P). In animal models, the assay has been successfully applied to a variety of mutagenic (genotoxic) as well as nonmutagenic carcinogens. In humans, DNA specimens from cigarette smokers, iron foundry workers, and coke oven workers whose total aromatic adduct levels ranged from 1 adduct in 10(6)-10(8) DNA nucleotides have been examined by 32P-postlabeling. The assay also detects DNA modifications--Indigenous (I)-compounds--that increase with age in untreated animals. I-compound profiles and levels are highly species-, strain-, sex-, and tissue-specific, and also depend on diet composition. Caloric restriction, a highly efficient method for improving resistance to carcinogenesis and extending life span, increased rather than decreased I-compound levels in various tissues of male rats. Nonmutagenic hepatocarcinogens reduced levels of I-compounds in the target organ. Because of the specificity of this effect, reduction of I-compound levels appears to represent a novel biomarker for the action of nonmutagenic carcinogens. DNA from various hepatomas was found largely devoid of I-compounds. The results support a possible antineoplastic and antiaging role of these DNA modifications.

  16. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    NASA Astrophysics Data System (ADS)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  17. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores.

    PubMed

    Bell, Nicholas A W; Keyser, Ulrich F

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  18. Metal-enhanced fluorescence/visual bimodal platform for multiplexed ultrasensitive detection of microRNA with reusable paper analytical devices.

    PubMed

    Liang, Linlin; Lan, Feifei; Yin, Xuemei; Ge, Shenguang; Yu, Jinghua; Yan, Mei

    2017-09-15

    Convenient biosensor for simultaneous multi-analyte detection was increasingly required in biological analysis. A novel flower-like silver (FLS)-enhanced fluorescence/visual bimodal platform for the ultrasensitive detection of multiple miRNAs was successfully constructed for the first time based on the principle of multi-channel microfluidic paper-based analytical devices (µPADs). Fluorophore-functionalized DNA 1 (DNA 1 -N-CDs) was combined with FLS, which was hybridized with quencher-carrying strand (DNA 2 -CeO 2 ) to form FLS-enhanced fluorescence biosensor. Upon the addition of the target miRNA, the fluorescent intensity of DNA 1 -N-CDs within the proximity of the FLS was strengthened. The disengaged DNA/CeO 2 complex could result in color change after joining H 2 O 2 , leading to real-time visual detection of miRNA firstly. If necessary, then the fluorescence method was applied for a accurate determination. In this strategy, the growth of FLS in µPADs not only reduced the background fluorescence but also provided an enrichment of "hot spots" for surface enhanced fluorescence detection of miRNAs. Results also showed versatility of the FLS in the enhancement of sensitivity and selectivity of the miRNA biosensor. Remarkably, this biosensor could detect as low as 0.03fM miRNA210 and 0.06fM miRNA21. Interestingly, the proposed biosensor also possessed good capability of recycling in three cycles upon change of the supplementation of DNA 2 -CeO 2 and visual substitutive device. This method opened new opportunities for further studies of miRNA related bioprocesses and will provide a new instrument for simultaneous detection of multiple low-level biomarkers. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Development of loop-mediated isothermal amplification (LAMP) assay for the rapid detection of Penicillium nordicum in dry-cured meat products.

    PubMed

    Ferrara, M; Perrone, G; Gallo, A; Epifani, F; Visconti, A; Susca, A

    2015-06-02

    The need of powerful diagnostic tools for rapid, simple, and cost-effective detection of food-borne fungi has become very important in the area of food safety. Currently, several isothermal nucleic acid amplification methods have been developed as an alternative to PCR-based analyses. Loop-mediated isothermal amplification (LAMP) is one of these innovative methods; it requires neither gel electrophoresis to separate and visualize the products nor expensive laboratory equipment and it has been applied already for detection of pathogenic organisms. In the current study, we developed a LAMP assay for the specific detection of Penicillium nordicum, the major causative agent of ochratoxin A contamination in protein-rich food, especially dry-cured meat products. The assay was based on targeting otapksPN gene, a key gene in the biosynthesis of ochratoxin A (OTA) in P. nordicum. Amplification of DNA during the reaction was detected directly in-tube by color transition of hydroxynaphthol blue from violet to sky blue, visible to the naked eye, avoiding further post amplification analyses. Only DNAs isolated from several P. nordicum strains led to positive results and no amplification was observed from non-target OTA and non OTA-producing strains. The assay was able to detect down to 100 fg of purified targeted genomic DNA or 10(2) conidia/reaction within 60 min. The LAMP assay for detection and identification of P. nordicum was combined with a rapid DNA extraction method set up on serially diluted conidia, providing an alternative rapid, specific and sensitive DNA-based method suitable for application directly "on-site", notably in key steps of dry-cured meat production. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Direct detection of Marek's disease virus in poultry dust by loop-mediated isothermal amplification.

    PubMed

    Woźniakowski, Grzegorz; Samorek-Salamonowicz, Elżbieta

    2014-11-01

    Marek's disease virus (MDV) is a serious concern for poultry production and represents a unique herpesvirus model. MDV can be shed by doubly infected chickens despite vaccination. The fully infectious MDV particles are produced in the feather follicle epithelium (FFE), and MDV remains infectious for many months in fine skin particles and feather debris. Molecular biology methods including PCR and real-time PCR have been shown to be valuable for the detection of MDV DNA in farm dust. Recently, loop-mediated isothermal amplification (LAMP) was found to be useful in the detection of MDV in feathers and internal organs of infected chickens. LAMP is also less affected by the inhibitors present in DNA samples. Taking into account the advantages of LAMP, direct detection of MDV DNA in poultry dust has been conducted in this research. The detection of MDV DNA was possible in 11 out of the 12 examined dust samples without DNA extraction. The DNA was retrieved from dust samples by dilution and incubation at 95 °C for 5 min. The direct detection of MDV DNA in the dust was possible within 30 min using a water bath and UV light. The results were confirmed by electrophoresis and melting curve analysis of the LAMP products. Our results show that LAMP may be used to test for the presence of virulent MDV in poultry farm dust without DNA extraction.

Top