Science.gov

Sample records for dna direct chemical

  1. Chemical adjuvants for plasmid DNA vaccines.

    PubMed

    Greenland, John R; Letvin, Norman L

    2007-05-10

    Plasmid DNA vaccines are a promising modality for immunization against a variety of human pathogens. Immunization via multiple routes with plasmid DNA can elicit potent cellular immune responses, and these immunogens can be administered repeatedly without inducing anti-vector immunity. Nonetheless, the immunogenicity of plasmid DNA vaccines has been limited by problems associated with delivery. A number of adjuvants have been designed to improve plasmid DNA immunogenicity, either by directly stimulating the immune system or by enhancing plasmid DNA expression. Chemical adjuvants for enhancing plasmid DNA expression include liposomes, polymers, and microparticles, all of which have shown promise for enhancing the expression and immunogenicity of plasmid DNA vaccines in animal models. Micro- and nanoparticles have not been shown to enhance immune responses to plasmid DNA vaccines. However, formulation of plasmid DNA with some non-particulate polymeric adjuvants has led to a statistically significant enhancement of immune responses. Further development of these technologies will significantly improve the utility of plasmid DNA vaccination.

  2. Targeting of chemical mutagens to differentiating B-lymphocytes in vivo: detection by direct DNA labeling and sister chromatid exchange induction

    SciTech Connect

    Bloom, S.E.; Nanna, U.C.; Dietert, R.R.

    1987-01-01

    In vivo systems for analyzing mutagen interactions with a specific differentiating cell population are rare. Taking advantage of the unique anatomical features of the bursa of Fabricius in the chicken, the authors explored the possibility of targeting chemical mutagens to a defined differentiating cell population in the animal, namely, the B-lymphocytes series. Such cells are known to be the targets for the oncogene-activating avian leukosis virus. Targeting of chemicals to cells of the bursa was demonstrated by application of the DNA-specific fluorochrome 4'-6-diamidino-2-phenylindole (DAPI) to the anal lips of neonatal chicks. Bright nuclear fluorescence of cells in the bursa demonstrated to occur within minutes after the application of 500..mu..l of DAPI. DAPI labeling of nuclei was detected up to several days after a single application. No nuclear labeling was exhibited in cells of neighboring tissues. Methyl methanesulfonate (MMS)(10..mu..l) was applied to the anal lips of day-old chicks to study dose-response kinetics for mutagen targeting to DNA of dividing B-lymphocytes in the bursa. Since the mitotic index was found to be quite high (25-30%) in the bursa, chromosome analysis was used to assay for genome damage. Sister chromatid exchange frequencies of 3.9, 7.3, and 9.0 (baseline 2.5) per cell were obtained at MMS dosages per animal of 50 ..mu..g, 100..mu..g, and 200..mu..g, respectively. These results indicate the rapid and quantitative localization of DNA-binding chemicals to cells of the bursa, particularly the resident B-lymphocytes. The bursa should be a useful system for studying mutagen-DNA interactions in the differentiating B-lymphocyte and subsequent influences on the development of immunity and lymphoproliferative disease.

  3. On the chemical yield of base lesions, strand breaks, and clustered damage generated in plasmid DNA by the direct effect of X rays.

    PubMed

    Purkayastha, Shubhadeep; Milligan, Jamie R; Bernhard, William A

    2007-09-01

    The purpose of this study was to determine the yield of DNA base damages, deoxyribose damage, and clustered lesions due to the direct effects of ionizing radiation and to compare these with the yield of DNA trapped radicals measured previously in the same pUC18 plasmid. The plasmids were prepared as films hydrated in the range 2.5 < Gamma < 22.5 mol water/mol nucleotide. Single-strand breaks (SSBs) and double-strand breaks (DSBs) were detected by agarose gel electrophoresis. Specific types of base lesions were converted into SSBs and DSBs using the base-excision repair enzymes endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of base damage detected by this method displayed a strikingly different dependence on the level of hydration (Gamma) compared with that for the yield of DNA trapped radicals; the former decreased by 3.2 times as Gamma was varied from 2.5 to 22.5 and the later increased by 2.4 times over the same range. To explain this divergence, we propose that SSB yields produced in plasmid DNA by the direct effect cannot be analyzed properly with a Poisson process that assumes an average of one strand break per plasmid and neglects the possibility of a single track producing multiple SSBs within a plasmid. The yields of DSBs, on the other hand, are consistent with changes in free radical trapping as a function of hydration. Consequently, the composition of these clusters could be quantified. Deoxyribose damage on each of the two opposing strands occurs with a yield of 3.5 +/- 0.5 nmol/J for fully hydrated pUC18, comparable to the yield of 4.1 +/- 0.9 nmol/J for DSBs derived from opposed damages in which at least one of the sites is a damaged base.

  4. Chemical Information: Print. Directed Study.

    ERIC Educational Resources Information Center

    Stone, Catherine C.

    This report provides a survey and evaluation of chemical information literature. Contained in this survey are an overview of the chemical literature field, comments on obtaining access to this literature and annotated bibliographies of primary, secondary, and tertiary sources as well as special topics. Primary sources include journals, patents,…

  5. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  6. RNA-directed DNA methylation in Arabidopsis

    PubMed Central

    Aufsatz, Werner; Mette, M. Florian; van der Winden, Johannes; Matzke, Antonius J. M.; Matzke, Marjori

    2002-01-01

    In plants, double-stranded RNA that is processed to short RNAs ≈21–24 nt in length can trigger two types of epigenetic gene silencing. Posttranscriptional gene silencing, which is related to RNA interference in animals and quelling in fungi, involves targeted elimination of homologous mRNA in the cytoplasm. RNA-directed DNA methylation involves de novo methylation of almost all cytosine residues within a region of RNA–DNA sequence identity. RNA-directed DNA methylation is presumed to be responsible for the methylation observed in protein coding regions of posttranscriptionally silenced genes. Moreover, a type of transcriptional gene silencing and de novo methylation of homologous promoters in trans can occur if a double-stranded RNA contains promoter sequences. Although RNA-directed DNA methylation has been described so far only in plants, there is increasing evidence that RNA can also target genome modifications in other organisms. To understand how RNA directs methylation to identical DNA sequences and how changes in chromatin configuration contribute to initiating or maintaining DNA methylation induced by RNA, a promoter double-stranded RNA-mediated transcriptional gene silencing system has been established in Arabidopsis. A genetic analysis of this system is helping to unravel the relationships among RNA signals, DNA methylation, and chromatin structure. PMID:12169664

  7. DNA-decorated graphene chemical sensors

    NASA Astrophysics Data System (ADS)

    Goldsmith, Brett; Lu, Ye; Kybert, Nicholas; Johnson, A. T. Charlie

    2010-03-01

    We measure the sensing response of DNA functionalized graphene to various analytes. Graphene is the current flagship nanomaterial and has been actively studied as a chemical sensor since shortly after it was isolated. Increasingly sophisticated device processing has revealed that some early measurements of graphene chemical sensing have been amplified by unintentional functionalization. We start with chemically clean graphene transistors and purposefully functionalize them to allow chemical sensing responses not found using pristine graphene. By using different DNA sequences during our functionalization, we are able to change the chemical sensitivity of the graphene. The resulting devices show fast response times, complete recovery at room temperature and discrimination between several similar analytes. This work has been supported by the IC Postdoc program, REU and the Nano/Bio Interface Center.

  8. Chemically-enzymatic synthesis of photosensitive DNA.

    PubMed

    Westphal, Kinga; Zdrowowicz, Magdalena; Zylicz-Stachula, Agnieszka; Rak, Janusz

    2017-02-01

    The sensitizing propensity of radio-/photosensitizing nucleoside depends on DNA sequence surrounding a sensitizer. Therefore, in order to compare sensitizers with regard to their ability to induce a DNA damage one has to study the sequence dependence of damage yield. However, chemical synthesis of oligonucleotides labeled with sensitizing nucleosides is hindered due to the fact that a limited number of such nucleoside phosphoramidites are accessible. Here, we report on a chemically-enzymatic method, employing a DNA polymerase and ligase, that enables a modified nucleoside, in the form of its 5'-triphosphate, to be incorporated into DNA fragment in a pre-determined site. Using such a protocol two double-stranded DNA fragments - a long one, 75 base pairs (bp), and a short one, 30bp in length - were pin-point labeled with 5-bromodeoxyuridine. Four DNA polymerases together with DHPLC for the inspection of reaction progress were used to optimize the process under consideration. As an ultimate test showing that the product possessing an assumed nucleotide sequence was actually obtained, we irradiated the synthesized oligonucleotide with UVB photons and analyzed its photoreactivity with the LC-MS method. Our results prove that a general approach enabling precise labeling of DNA with any nucleoside modification processed by DNA polymerase and ligase has been worked out.

  9. The structure of DNA by direct imaging

    PubMed Central

    Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo

    2015-01-01

    The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations. PMID:26601243

  10. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    PubMed

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions.

  11. T7 replisome directly overcomes DNA damage

    NASA Astrophysics Data System (ADS)

    Sun, Bo; Pandey, Manjula; Inman, James T.; Yang, Yi; Kashlev, Mikhail; Patel, Smita S.; Wang, Michelle D.

    2015-12-01

    Cells and viruses possess several known `restart' pathways to overcome lesions during DNA replication. However, these `bypass' pathways leave a gap in replicated DNA or require recruitment of accessory proteins, resulting in significant delays to fork movement or even cell division arrest. Using single-molecule and ensemble methods, we demonstrate that the bacteriophage T7 replisome is able to directly replicate through a leading-strand cyclobutane pyrimidine dimer (CPD) lesion. We show that when a replisome encounters the lesion, a substantial fraction of DNA polymerase (DNAP) and helicase stay together at the lesion, the replisome does not dissociate and the helicase does not move forward on its own. The DNAP is able to directly replicate through the lesion by working in conjunction with helicase through specific helicase-DNAP interactions. These observations suggest that the T7 replisome is fundamentally permissive of DNA lesions via pathways that do not require fork adjustment or replisome reassembly.

  12. DNA dynamically directs its own transcription initiation

    SciTech Connect

    Rasmussen, K. O.; Kalosakas, G.; Bishop, A. R.; Choi, C. H.; Usheva, A.

    2004-01-01

    Initiation of DNA gene transcription requires a transient opening in the double helix at the transcriptional start site. It is generally assumed that the location of this 'transcriptional bubble' is determined by sequence-specific protein binding, and that the energy required for unwinding the double helix comes from torsional strain. Physical twisting should cause DNA to open consistently in weakly bonded A/T rich stretches, however, simple base-pairing energetics alone can not account for the variety of observed transcriptional start sites. Applying the Peyrard-Bishop nonlinear cooperativity model to DNA, we are able to predict that thermally-induced DNA bubbles, similar in size to transcription bubbles, form at specific locations on DNA promoters. These predicted openings agree remarkably well with experiment, and that they correlate exactly with known transcription start sites and important regulatory sites on three different promoters. We propose that the sequence-specific location of the transcriptional start site is predetermined by the inherent opening patterns of specific DNA sequences. As DNA bubble formation is independent of protein binding, it appears that DNA is not only a passive carrier of information, but its dynamics plays an important role in directing the transcription and regulation of the genes it contains.

  13. Small-molecule discovery from DNA-encoded chemical libraries.

    PubMed

    Kleiner, Ralph E; Dumelin, Christoph E; Liu, David R

    2011-12-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this tutorial review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity.

  14. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-09-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  15. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-01-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  16. Programmable chemical controllers made from DNA

    PubMed Central

    Chen, Yuan-Jyue; Dalchau, Neil; Srinivas, Niranjan; Phillips, Andrew; Cardelli, Luca; Soloveichik, David; Seelig, Georg

    2014-01-01

    Biological organisms use complex molecular networks to navigate their environment and regulate their internal state. The development of synthetic systems with similar capabilities could lead to applications such as smart therapeutics or fabrication methods based on self-organization. To achieve this, molecular control circuits need to be engineered to perform integrated sensing, computation and actuation. Here we report a DNA-based technology for implementing the computational core of such controllers. We use the formalism of chemical reaction networks as a 'programming language', and our DNA architecture can, in principle, implement any behaviour that can be mathematically expressed as such. Unlike logic circuits, our formulation naturally allows complex signal processing of intrinsically analogue biological and chemical inputs. Controller components can be derived from biologically synthesized (plasmid) DNA, which reduces errors associated with chemically synthesized DNA. We implement several building-block reaction types and then combine them into a network that realizes, at the molecular level, an algorithm used in distributed control systems for achieving consensus between multiple agents. PMID:24077029

  17. Programmable chemical controllers made from DNA

    NASA Astrophysics Data System (ADS)

    Chen, Yuan-Jyue; Dalchau, Neil; Srinivas, Niranjan; Phillips, Andrew; Cardelli, Luca; Soloveichik, David; Seelig, Georg

    2013-10-01

    Biological organisms use complex molecular networks to navigate their environment and regulate their internal state. The development of synthetic systems with similar capabilities could lead to applications such as smart therapeutics or fabrication methods based on self-organization. To achieve this, molecular control circuits need to be engineered to perform integrated sensing, computation and actuation. Here we report a DNA-based technology for implementing the computational core of such controllers. We use the formalism of chemical reaction networks as a 'programming language' and our DNA architecture can, in principle, implement any behaviour that can be mathematically expressed as such. Unlike logic circuits, our formulation naturally allows complex signal processing of intrinsically analogue biological and chemical inputs. Controller components can be derived from biologically synthesized (plasmid) DNA, which reduces errors associated with chemically synthesized DNA. We implement several building-block reaction types and then combine them into a network that realizes, at the molecular level, an algorithm used in distributed control systems for achieving consensus between multiple agents.

  18. UVA Generates Pyrimidine Dimers in DNA Directly

    PubMed Central

    Jiang, Yong; Rabbi, Mahir; Kim, Minkyu; Ke, Changhong; Lee, Whasil; Clark, Robert L.; Mieczkowski, Piotr A.; Marszalek, Piotr E.

    2009-01-01

    There is increasing evidence that UVA radiation, which makes up ∼95% of the solar UV light reaching the Earth's surface and is also commonly used for cosmetic purposes, is genotoxic. However, in contrast to UVC and UVB, the mechanisms by which UVA produces various DNA lesions are still unclear. In addition, the relative amounts of various types of UVA lesions and their mutagenic significance are also a subject of debate. Here, we exploit atomic force microscopy (AFM) imaging of individual DNA molecules, alone and in complexes with a suite of DNA repair enzymes and antibodies, to directly quantify UVA damage and reexamine its basic mechanisms at a single-molecule level. By combining the activity of endonuclease IV and T4 endonuclease V on highly purified and UVA-irradiated pUC18 plasmids, we show by direct AFM imaging that UVA produces a significant amount of abasic sites and cyclobutane pyrimidine dimers (CPDs). However, we find that only ∼60% of the T4 endonuclease V-sensitive sites, which are commonly counted as CPDs, are true CPDs; the other 40% are abasic sites. Most importantly, our results obtained by AFM imaging of highly purified native and synthetic DNA using T4 endonuclease V, photolyase, and anti-CPD antibodies strongly suggest that CPDs are produced by UVA directly. Thus, our observations contradict the predominant view that as-yet-unidentified photosensitizers are required to transfer the energy of UVA to DNA to produce CPDs. Our results may help to resolve the long-standing controversy about the origin of UVA-produced CPDs in DNA. PMID:19186150

  19. Novel encoding methods for DNA-templated chemical libraries.

    PubMed

    Li, Gang; Zheng, Wenlu; Liu, Ying; Li, Xiaoyu

    2015-06-01

    Among various types of DNA-encoded chemical libraries, DNA-templated library takes advantage of the sequence-specificity of DNA hybridization, enabling not only highly effective DNA-templated chemical reactions, but also high fidelity in library encoding. This brief review summarizes recent advances that have been made on the encoding strategies for DNA-templated libraries, and it also highlights their respective advantages and limitations for the preparation of DNA-encoded libraries.

  20. Determining orientation and direction of DNA sequences

    DOEpatents

    Goodwin, Edwin H.; Meyne, Julianne

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  1. Nucleotide exchange and excision technology DNA shuffling and directed evolution.

    PubMed

    Speck, Janina; Stebel, Sabine C; Arndt, Katja M; Müller, Kristian M

    2011-01-01

    Remarkable success in optimizing complex properties within DNA and proteins has been achieved by directed evolution. In contrast to various random mutagenesis methods and high-throughput selection methods, the number of available DNA shuffling procedures is limited, and protocols are often difficult to adjust. The strength of the nucleotide exchange and excision technology (NExT) DNA shuffling described here is the robust, efficient, and easily controllable DNA fragmentation step based on random incorporation of the so-called 'exchange nucleotides' by PCR. The exchange nucleotides are removed enzymatically, followed by chemical cleavage of the DNA backbone. The oligonucleotide pool is reassembled into full-length genes by internal primer extension, and the recombined gene library is amplified by standard PCR. The technique has been demonstrated by shuffling a defined gene library of chloramphenicol acetyltransferase variants using uridine as fragmentation defining exchange nucleotide. Substituting 33% of the dTTP with dUTP in the incorporation PCR resulted in shuffled clones with an average parental fragment size of 86 bases and revealed a mutation rate of only 0.1%. Additionally, a computer program (NExTProg) has been developed that predicts the fragment size distribution depending on the relative amount of the exchange nucleotide.

  2. The fate of the chemical warfare agent during DNA extraction.

    PubMed

    Wilkinson, Della A; Hulst, Albert G; de Reuver, Leo P J; van Krimpen, Simon H; van Baar, Ben M L

    2007-11-01

    Forensic laboratories do not have the infrastructure to process or store contaminated DNA samples that have been recovered from a crime scene contaminated with chemical or biological warfare agents. Previous research has shown that DNA profiles can be recovered from blood exposed to several chemical warfare agents after the agent has been removed. The fate of four toxic agents, sulfur mustard, sodium 2-fluoroacetate, sarin, and diazinon, in a lysis buffer used in Promega DNA IQ extraction protocol was studied to determine if extraction would render the samples safe. Two independent analytical methods were used per agent, selected from GC-MS, 1H NMR, 19F NMR, (31)P NMR, or LC-ES MS. The methods were validated before use. Determinations were carried out in a semi-quantitative way, by direct comparison to standards. Agent levels in the elution buffer were found to be below the detectable limits for mustard, sarin, sodium 2-fluoroacetate or low (<0.02 mg/mL) for diazinon. Therefore, once extracted these DNA samples could be safely processed in a forensic laboratory.

  3. Direct numerical simulation of chemically reacting turbulence

    NASA Astrophysics Data System (ADS)

    Miyauchi, Toshio; Tanahashi, Mamoru

    In this paper, we present two results of direct numerical simulation of chemically reacting flows. One is direct numerical simulation of chemically reacting two-dimensional mixing layer and the other is direct numerical simulation of chemically reacting compressible isotropic turbulence. As for the mixing layer, a low Mach number approximation was used to take into account the variable density effects on the flow fields and to clarify the effects of heat release and density difference of a mean flow. In the case of density difference, expansion and baroclinic torque has a negative contribution to the local vorticity transport in the high density side and a positive contribution in the low density side which results in an asymmetric vortical structure structure. Thes density difference suppresses the growth of mixing layer and causes the overshoot of mean velocity only in the high density side which coincides with an experimental result. Coupling effects of heat release and desnity difference are also investigated. As for the homogeneous turbulence, fully compressible Navier-Stokes equations are solved to clarify the interaction between turbulence and chemical reaction in turbulent diffusion flame. The chemical reaction is suppressed by the increase of heat release because of the decrease of density and local Reynolds number. However, the decay of enstrophy with heat release is slower than that without heat release because of strong baroclinic torque which is generated near the reaction zone. Also, large amount of heat release causes increase in turbulent energy through the pressure dilatation term. The pressure dilatation term shows the periodic fluctuation which has an acoustic time scale. The fluctuation is enhanced by the heat release and travels in the turbulent field as pressure and dilatation waves.

  4. Chemical Space of DNA-Encoded Libraries.

    PubMed

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  5. Deficient repair of chemical adducts in alpha DNA of monkey cells

    SciTech Connect

    Zolan, M.E.; Cortopassi, G.A.; Smith, C.A.; Hanawalt, P.C.

    1982-03-01

    Researchers have examined excision repair of DNA damage in the highly repeated alpha DNA sequence of cultured African green monkey cells. Irradiation of cells with 254 nm ultraviolet light resulted in the same frequency of pyrimidine dimers in alpha DNA and the bulk of the DNA. The rate and extent of pyrimidine dimer removal, as judged by measurement of repair synthesis, was also similar for alpha DNA and bulk DNA. In cells treated with furocoumarins and long-wave-length ultraviolet light, however, repair synthesis in alpha DNA was only 30% of that in bulk DNA, although it followed the same time course. Researchers found that this reduced repair was not caused by different initial amounts of furocoumarin damage or by different sizes of repair patches, as researchers found these to be similar in the two DNA species. Direct quantification demonstrated that fewer furocoumarin adducts were removed from alpha DNA than from bulk DNA. In cells treated with another chemical DNA-damaging agent, N-acetoxy-2-acetylaminofluorene, repair synthesis in alpha DNA was 60% of that in bulk DNA. These results show that the repair of different kinds of DNA damage can be affected to different extents by some property of this tandemly repeated heterochromatic DNA. To our knowledge, this is the first demonstration in primate cells of differential repair of cellular DNA sequences.

  6. Dual-pharmacophore DNA-encoded chemical libraries.

    PubMed

    Scheuermann, Jörg; Neri, Dario

    2015-06-01

    In contrast to single-pharmacophore DNA-encoded libraries, where only one chemical moiety is linked to DNA, dual-pharmacophore DNA-encoded chemical libraries feature the display of two independent small-molecules in close proximity. This, in principle, allows to explore adjacent epitopes on a pharmaceutical target of choice and hence the discovery of simultaneously binding pairs of fragments, by virtue of the chelate effect.

  7. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  8. Direct DNA binding by Brca1

    PubMed Central

    Paull, Tanya T.; Cortez, David; Bowers, Blair; Elledge, Stephen J.; Gellert, Martin

    2001-01-01

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein–DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription. PMID:11353843

  9. Calculations of physical and chemical reactions with DNA in aqueous solution from Auger cascades

    SciTech Connect

    Wright, H.A.; Hamm, R.N.; Turner, J.E.; Howell, R.W.; Rao, D.V.; Sastry, K.S.R.

    1989-01-01

    Monte Carlo calculations are performed of the physical and chemical interactions in liquid water by electrons produced during Auger cascades resulting from the decay of various radionuclides. Estimates are also made of the number of direct physical and indirect chemical interactions that would be produced on DNA located near the decay site. 13 refs., 8 figs.

  10. Direct PCR Improves the Recovery of DNA from Various Substrates.

    PubMed

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Skuza, Pawel; Linacre, Adrian

    2015-11-01

    This study reports on the comparison of a standard extraction process with the direct PCR approach of processing low-level DNA swabs typical in forensic investigations. Varying concentrations of control DNA were deposited onto three commonly encountered substrates, brass, plastic, and glass, left to dry, and swabbed using premoistened DNA-free nylon FLOQswabs(™) . Swabs (n = 90) were either processed using the DNA IQ(™) kit or, for direct PCR, swab fibers (~2 mm(2) ) were added directly to the PCR with no prior extraction. A significant increase in the height of the alleles (p < 0.005) was observed when using the direct PCR approach over the extraction methodology when controlling for surface type and mass of DNA deposited. The findings indicate the potential use of direct PCR for increasing the PCR product obtained from low-template DNA samples in addition to minimizing contamination and saving resources.

  11. Melting transition of directly linked gold nanoparticle DNA assembly

    NASA Astrophysics Data System (ADS)

    Sun, Y.; Harris, N. C.; Kiang, C.-H.

    2005-05-01

    DNA melting and hybridization is a fundamental biological process as well as a crucial step in many modern biotechnology applications. DNA confined on surfaces exhibits a behavior different from that in free solutions. The system of DNA-capped gold nanoparticles exhibits unique phase transitions and represents a new class of complex fluids. Depending on the sequence of the DNA, particles can be linked to each other through direct complementary DNA sequences or via a ‘linker’ DNA, whose sequence is complementary to the sequence attached to the gold nanoparticles. We observed different melting transitions for these two distinct systems.

  12. Assay to detect chemically induced DNA repair in rat spermatocytes

    SciTech Connect

    Working, P.K.; Butterworth, B.E.

    1984-01-01

    An in vivo/in vitro DNA repair assay has been developed to quantitate chemically induced unscheduled DNA synthesis (UDS) in rat spermatocytes utilizing autoradiography. Male Fischer-344 rats were treated by i.p. injection or gavage with a variety of genotoxic agents dissolved in dimethyl sulfoxide, corn oil, or water. At selected times after treatment, spermatocytes were isolated by trypsin digestion of testes and cultured for 24 hr in the presence of /sup 3/H-thymidine. The direct-acting genotoxicants methyl methanesulfonate (MMS) and ethyl methanesulfonate and the chemotherapeutic agent cyclophosphamide (CPA) produced positive UDS responses in spermatocyes isolated l hr after i.p. injection. Other known genotoxicants--including dimethylnitrosamine, aflatoxin B/sub 1/, 2-acetylaminofluorene, 2, 6-dinitrotoluene, and l,6-dinitropyrene--failed to induce UDS, even with routes of administration and at times of exposure known to produce a positive response in hepatocytes. These results demonstrate that the in vivo/in vitro spermatocyte DNA repair assay may be useful as a predictive screen for germ cell mutagens.

  13. Directed Chemical Evolution with an Outsized Genetic Code

    PubMed Central

    Krusemark, Casey J.; Tilmans, Nicolas P.; Brown, Patrick O.; Harbury, Pehr B.

    2016-01-01

    The first demonstration that macromolecules could be evolved in a test tube was reported twenty-five years ago. That breakthrough meant that billions of years of chance discovery and refinement could be compressed into a few weeks, and provided a powerful tool that now dominates all aspects of protein engineering. A challenge has been to extend this scientific advance into synthetic chemical space: to enable the directed evolution of abiotic molecules. The problem has been tackled in many ways. These include expanding the natural genetic code to include unnatural amino acids, engineering polyketide and polypeptide synthases to produce novel products, and tagging combinatorial chemistry libraries with DNA. Importantly, there is still no small-molecule analog of directed protein evolution, i.e. a substantiated approach for optimizing complex (≥ 10^9 diversity) populations of synthetic small molecules over successive generations. We present a key advance towards this goal: a tool for genetically-programmed synthesis of small-molecule libraries from large chemical alphabets. The approach accommodates alphabets that are one to two orders of magnitude larger than any in Nature, and facilitates evolution within the chemical spaces they create. This is critical for small molecules, which are built up from numerous and highly varied chemical fragments. We report a proof-of-concept chemical evolution experiment utilizing an outsized genetic code, and demonstrate that fitness traits can be passed from an initial small-molecule population through to the great-grandchildren of that population. The results establish the practical feasibility of engineering synthetic small molecules through accelerated evolution. PMID:27508294

  14. DNA-encoded chemistry: enabling the deeper sampling of chemical space.

    PubMed

    Goodnow, Robert A; Dumelin, Christoph E; Keefe, Anthony D

    2017-02-01

    DNA-encoded chemical library technologies are increasingly being adopted in drug discovery for hit and lead generation. DNA-encoded chemistry enables the exploration of chemical spaces four to five orders of magnitude more deeply than is achievable by traditional high-throughput screening methods. Operation of this technology requires developing a range of capabilities including aqueous synthetic chemistry, building block acquisition, oligonucleotide conjugation, large-scale molecular biological transformations, selection methodologies, PCR, sequencing, sequence data analysis and the analysis of large chemistry spaces. This Review provides an overview of the development and applications of DNA-encoded chemistry, highlighting the challenges and future directions for the use of this technology.

  15. How Can Plant DNA Viruses Evade siRNA-Directed DNA Methylation and Silencing?

    PubMed Central

    Pooggin, Mikhail M.

    2013-01-01

    Plants infected with DNA viruses produce massive quantities of virus-derived, 24-nucleotide short interfering RNAs (siRNAs), which can potentially direct viral DNA methylation and transcriptional silencing. However, growing evidence indicates that the circular double-stranded DNA accumulating in the nucleus for Pol II-mediated transcription of viral genes is not methylated. Hence, DNA viruses most likely evade or suppress RNA-directed DNA methylation. This review describes the specialized mechanisms of replication and silencing evasion evolved by geminiviruses and pararetoviruses, which rescue viral DNA from repressive methylation and interfere with transcriptional and post-transcriptional silencing of viral genes. PMID:23887650

  16. Detecting Chemically Modified DNA Bases Using Surface Enhanced Raman Spectroscopy.

    PubMed

    Barhoumi, Aoune; Halas, Naomi J

    2011-12-15

    Post-translational modifications of DNA- changes in the chemical structure of individual bases that occur without changes in the DNA sequence- are known to alter gene expression. They are believed to result in frequently deleterious phenotypic changes, such as cancer. Methylation of adenine, methylation and hydroxymethylation of cytosine, and guanine oxidation are the primary DNA base modifications identified to date. Here we show it is possible to use surface enhanced Raman spectroscopy (SERS) to detect these primary DNA base modifications. SERS detection of modified DNA bases is label-free and requires minimal additional sample preparation, reducing the possibility of additional chemical modifications induced prior to measurement. This approach shows the feasibility of DNA base modification assessment as a potentially routine analysis that may be further developed for clinical diagnostics.

  17. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  18. Chemically modified diamondoids as biosensors for DNA

    NASA Astrophysics Data System (ADS)

    Sivaraman, Ganesh; Fyta, Maria

    2014-03-01

    Understanding the interaction of biological molecules with materials is essential in view of the novel potential applications arising when these two are combined. To this end, we investigate the interaction of DNA with diamondoids, a broad family of tiny hydrogen-terminated diamond clusters with high technological potential. We model this interaction through quantum-mechanical computer simulations and focus on the hydrogen bonding possibilities of the different DNA nucleobases to the lower amine-modified diamondoids with respect to their relative distance and orientation. Our aim is to promote the binding between these two units, and probe this through the association energy, the electronic structure of the nucleobase-diamondoid system, and the specific role of their frontier orbitals. We discuss the relevance of our results in view of biosensing applications and specifically nanopore sequencing of DNA.

  19. Directional sliding of histone octamers caused by DNA bending

    NASA Astrophysics Data System (ADS)

    Wang, Peng-Ye; Li, Wei; Dou, Shuo-Xing; Xie, Ping

    2006-03-01

    Chromatin-remodeling complexes such as SWI/SNF and RSC of yeast can perturb the structure of nucleosomes in an ATP-dependent manner. Experimental results prove that this chromatin remodeling process involves DNA bending. We simulate the effect of DNA bending, caused by chromatin-remodeling complexes, on directional sliding of histone octamers by Brownian dynamics simulation. The simulation results show that, after a DNA loop being generated at the side of a nucleosome, the histone octamer slides towards this DNA loop until the loop disappears. The DNA loop size is an important factor affecting the process of directional sliding of the histone octamer. A model for directional sliding of histone octamers induced by chromatin-remodeling complexes is suggested. (This research was supported by National Natural Science Foundation of China, and the Innovation Project of the Chinese Academy of Sciences.) (Email: pywang@aphy.iphy.ac.cn)

  20. DNA Charge Transport: From Chemical Principles to the Cell

    PubMed Central

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  1. Perturbation of DNA tertiary structure by physical and chemical carcinogens: effects on DNA repair processes.

    PubMed

    Pedrini, A M; Tornaletti, S; Barabino, S; Menichini, P; Fronza, G; Abbondandolo, A

    1989-01-01

    DNA within the cell is organized into higher-order structures characterized by negative supercoiling. Supercoiling is a property of any DNA molecule lacking ends capable of rotation. Parameters defining the properties of supercoiled DNA are significant for the description of the reactive state of DNA molecules. We have investigated whether physical and chemical DNA modifying agents alter the parameters describing the DNA tertiary structure. The variations in DNA tertiary structure of partially relaxed topoisomers obtained from plasmid DNA have been studied by one dimensional agarose gel electrophoresis, a technique allowing the measurement of alterations in the degree of supercoiling equivalent to fractions of superhelical turns. Unwinding angles of 8.5 degrees for pyrimidine dimers and of 8.5 degrees for acetyl-4-hydroxyaminoquinoline-I-oxide (Ac-4-HAQO) adducts have been determined by titrating for each topoisomers the number of damaged sites necessary to reduce the superhelical turns by one. Analogous unwinding was observed for topoisomers obtained from in vivo irradiated plasmid DNA. We have also shown that local alterations in DNA structure caused by UV irradiation inhibit bacterial type I DNA topoisomerases. In addition, we have demonstrated that E. coli mutants lacking DNA topoisomerase I are sensitive to UV light. The pronounced inhibition of DNA synthesis as well as the chromosome instability observed after UV irradiation of this strain, suggest that DNA topoisomerase I might be involved in those cellular responses elicited by the proximity of damaged bases to sites of active replication.(ABSTRACT TRUNCATED AT 250 WORDS)

  2. A DNA-based assay for toxic chemicals in wastewater.

    PubMed

    Foreman, Amy L; Phillips, Leo; Kanellis, Vangelis G; Hammoudeh, Daoud; Naumann, Christoph; Wong, Henri; Chisari, Robert; Hibbert, D Brynn; Lee, Garry S H; Patra, Ronald; Julli, Moreno; Chapman, John; Cooke, A Roger; dos Remedios, Cristobal G

    2011-08-01

    Chemical toxicants, particularly metal ions, are a major contaminant in global waterways. Live-organism bioassays used to monitor chemical toxicants commonly involve measurements of activity or survival of a freshwater cladoceran (Ceriodaphnia dubia) or light emitted by the marine bacterium Vibrio fischeri, used in the commercial Microtox® bioassay. Here we describe a novel molecule-based assay system employing DNA as the chemical biosensor. Metals bind to DNA, causing structural changes that expel a bound (intercalated) fluorescent reporter dye. Analyses of test data using 48 wastewater samples potentially contaminated by metal ions show that the DNA-dye assay results correlate with those from C. dubia and Microtox bioassays. All three assays exhibit additive, antagonistic, and synergistic responses that cannot be predicted by knowing individual metal concentrations. Analyses of metals in these samples imply the presence of chemical toxicants other than metal ions. The DNA-dye assay is robust, has a 12-month shelf life, and is only slightly affected by sample pH in the range 4 to 9. The assay is completed in a matter of minutes, and its portability makes it well suited as a screening assay for use in the field. We conclude that the DNA-dye test is a surrogate bioassay suitable for screening chemical toxicity.

  3. Chemical ligation methods for the tagging of DNA-encoded chemical libraries.

    PubMed

    Keefe, Anthony D; Clark, Matthew A; Hupp, Christopher D; Litovchick, Alexander; Zhang, Ying

    2015-06-01

    The generation of DNA-encoded chemical libraries requires the unimolecular association of multiple encoding oligonucleotides with encoded chemical entities during combinatorial synthesis processes. This has traditionally been achieved using enzymatic ligation. We discuss a range of chemical ligation methods that provide alternatives to enzymatic ligation. These chemical ligation methods include the generation of modified internucleotide linkages that support polymerase translocation and other modified linkages that while not supporting the translocation of polymerases can also be used to generate individual cDNA molecules containing encoded chemical information specifying individual library members. We also describe which of these approaches have been successfully utilized for the preparation of DNA-encoded chemical libraries and those that were subsequently used for the discovery of inhibitors.

  4. Noncanonical views of homology-directed DNA repair

    PubMed Central

    Verma, Priyanka; Greenberg, Roger A.

    2016-01-01

    DNA repair is essential to maintain genomic integrity and initiate genetic diversity. While gene conversion and classical nonhomologous end-joining are the most physiologically predominant forms of DNA repair mechanisms, emerging lines of evidence suggest the usage of several noncanonical homology-directed repair (HDR) pathways in both prokaryotes and eukaryotes in different contexts. Here we review how these alternative HDR pathways are executed, specifically focusing on the determinants that dictate competition between them and their relevance to cancers that display complex genomic rearrangements or maintain their telomeres by homology-directed DNA synthesis. PMID:27222516

  5. A novel DNA selection and direct extraction process and its application in DNA recombination.

    PubMed

    Wang, An-Bang; Cheng, Chia-Wei; Lin, I-Chun; Lu, Fei-Yau; Tsai, Huai-Jen; Lin, Chiu-Chun; Yang, Chun-Hui; Pan, Po-Ting; Kuan, Chen-Chi; Chen, Yen-Chih; Lin, Yi-Wei; Chang, Chih-Ning; Wu, Yi-Hung; Kurniawan, Tetuko; Lin, Chii-Wann; Wo, Andrew M; Chen, Lin-Chi

    2011-02-01

    In the conventional bench-top approach, the DNA recombination process is time- and effort-consuming due to laborious procedures lasting from several hours to a day. A novel DNA selection and direct extraction process has been proposed, integrated and tested on chip. The integrative microfluidic chip can perform the whole procedure of DNA recombination, including DNA digestion, gel electrophoresis, DNA extraction and insert-vector ligation within 1 h. In this high-throughput design, the manual gel cutting was replaced by an automatic processing system that performed high-quality and high-recovery efficiency in DNA extraction process. With no need of gel-dissolving reagents and manipulation, the application of selection and direct extraction process could significantly eliminate the risks from UV and EtBr and also facilitate DNA recombination. Reliable output with high success rate of cloning has been achieved with a significant reduction in operational hazards, required materials, efforts and time.

  6. Direct surface-enhanced Raman scattering analysis of DNA duplexes.

    PubMed

    Guerrini, Luca; Krpetić, Željka; van Lierop, Danny; Alvarez-Puebla, Ramon A; Graham, Duncan

    2015-01-19

    The exploration of the genetic information carried by DNA has become a major scientific challenge. Routine DNA analysis, such as PCR, still suffers from important intrinsic limitations. Surface-enhanced Raman spectroscopy (SERS) has emerged as an outstanding opportunity for the development of DNA analysis, but its application to duplexes (dsDNA) has been largely hampered by reproducibility and/or sensitivity issues. A simple strategy is presented to perform ultrasensitive direct label-free analysis of unmodified dsDNA with the means of SERS by using positively charged silver colloids. Electrostatic adhesion of DNA promotes nanoparticle aggregation into stable clusters yielding intense and reproducible SERS spectra at nanogram level. As potential applications, we report the quantitative recognition of hybridization events as well as the first examples of SERS recognition of single base mismatches and base methylations (5-methylated cytosine and N6-methylated Adenine) in duplexes.

  7. The p53 Protein is an Unusually Shaped Tetramer that Binds Directly to DNA

    NASA Astrophysics Data System (ADS)

    Friedman, Paula N.; Chen, Xinbin; Bargonetti, Jill; Prives, Carol

    1993-04-01

    We have analyzed the size and structure of native immunopurified human p53 protein. By using a combination of chemical crosslinking, gel filtration chromatography, and zonal velocity gradient centrifugation, we have determined that the predominant form of p53 in such preparations is a tetramer. The behavior of purified p53 in gels and sucrose gradients implies that the protein has an extended shape. Wild-type p53 has been shown to bind specifically to sites in cellular and viral DNA. We show in this study by Southwestern ligand blotting and by analysis of DNA-bound crosslinked p53 that p53 monomers, dimers, and tetramers can bind directly to DNA.

  8. Novel selection methods for DNA-encoded chemical libraries.

    PubMed

    Chan, Alix I; McGregor, Lynn M; Liu, David R

    2015-06-01

    Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries.

  9. Drug discovery with DNA-encoded chemical libraries.

    PubMed

    Buller, Fabian; Mannocci, Luca; Scheuermann, Jörg; Neri, Dario

    2010-09-15

    DNA-encoded chemical libraries represent a novel avenue for the facile discovery of small molecule ligands against target proteins of biological or pharmaceutical importance. Library members consist of small molecules covalently attached to unique DNA fragments that serve as amplifiable identification barcodes. This encoding allows the in vitro selection of ligands at subpicomolar concentrations from large library populations by affinity capture on a target protein of interest, in analogy to established technologies for the selection of binding polypeptides (e.g., antibodies). Different library formats have been explored by various groups, allowing the construction of chemical libraries comprising up to millions of DNA-encoded compounds. Libraries before and after selection have been characterized by PCR amplification of the DNA codes and subsequent relative quantification of library members using high-throughput sequencing. The most enriched compounds have then been further analyzed in biological assays, in the presence or in the absence of linked DNA. This article reviews experimental strategies used for the construction of DNA-encoded chemical libraries, revealing how selection, decoding, and hit validation technologies have been used for drug discovery programs.

  10. Chemical Biology Probes from Advanced DNA-encoded Libraries.

    PubMed

    Salamon, Hazem; Klika Škopić, Mateja; Jung, Kathrin; Bugain, Olivia; Brunschweiger, Andreas

    2016-02-19

    The identification of bioactive compounds is a crucial step toward development of probes for chemical biology studies. Screening of DNA-encoded small molecule libraries (DELs) has emerged as a validated technology to interrogate vast chemical space. DELs consist of chimeric molecules composed of a low-molecular weight compound that is conjugated to a DNA identifier tag. They are screened as pooled libraries using selection to identify "hits." Screening of DELs has identified numerous bioactive compounds. Some of these molecules were instrumental in gaining a deeper understanding of biological systems. One of the main challenges in the field is the development of synthesis methodology for DELs.

  11. DNA-directed mutations. Leading and lagging strand specificity

    NASA Technical Reports Server (NTRS)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  12. RNA Splicing Factors and RNA-Directed DNA Methylation.

    PubMed

    Huang, Chao-Feng; Zhu, Jian-Kang

    2014-03-26

    RNA-directed histone and/or DNA modification is a conserved mechanism for the establishment of epigenetic marks from yeasts and plants to mammals. The heterochromation formation in yeast is mediated by RNAi-directed silencing mechanism, while the establishment of DNA methylation in plants is through the RNA-directed DNA methylation (RdDM) pathway. Recently, splicing factors are reported to be involved in both RNAi-directed heterochromatin formation in yeast and the RdDM pathway in plants. In yeast, splicing factors may provide a platform for facilitating the siRNA generation through an interaction with RDRC and thereby affect the heterochromatin formation, whereas in plants, various splicing factors seem to act at different steps in the RdDM pathway.

  13. 20 years of DNA-encoded chemical libraries.

    PubMed

    Mannocci, Luca; Leimbacher, Markus; Wichert, Moreno; Scheuermann, Jörg; Neri, Dario

    2011-12-28

    The identification of specific binding molecules is a central problem in chemistry, biology and medicine. Therefore, technologies, which facilitate ligand discovery, may substantially contribute to a better understanding of biological processes and to drug discovery. DNA-encoded chemical libraries represent a new inexpensive tool for the fast and efficient identification of ligands to target proteins of choice. Such libraries consist of collections of organic molecules, covalently linked to a unique DNA tag serving as an amplifiable identification bar code. DNA-encoding enables the in vitro selection of ligands by affinity capture at sub-picomolar concentrations on virtually any target protein of interest, in analogy to established selection methodologies like antibody phage display. Multiple strategies have been investigated by several academic and industrial laboratories for the construction of DNA-encoded chemical libraries comprising up to millions of DNA-encoded compounds. The implementation of next generation high-throughput sequencing enabled the rapid identification of binding molecules from DNA-encoded libraries of unprecedented size. This article reviews the development of DNA-encoded library technology and its evolution into a novel drug discovery tool, commenting on challenges, perspectives and opportunities for the different experimental approaches.

  14. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  15. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  16. Mesoporous silica nanoparticles deliver DNA and chemicals into plants

    NASA Astrophysics Data System (ADS)

    Torney, François; Trewyn, Brian G.; Lin, Victor S.-Y.; Wang, Kan

    2007-05-01

    Surface-functionalized silica nanoparticles can deliver DNA and drugs into animal cells and tissues. However, their use in plants is limited by the cell wall present in plant cells. Here we show a honeycomb mesoporous silica nanoparticle (MSN) system with 3-nm pores that can transport DNA and chemicals into isolated plant cells and intact leaves. We loaded the MSN with the gene and its chemical inducer and capped the ends with gold nanoparticles to keep the molecules from leaching out. Uncapping the gold nanoparticles released the chemicals and triggered gene expression in the plants under controlled-release conditions. Further developments such as pore enlargement and multifunctionalization of these MSNs may offer new possibilities in target-specific delivery of proteins, nucleotides and chemicals in plant biotechnology.

  17. Direct Visualization of DNA Replication Dynamics in Zebrafish Cells.

    PubMed

    Kuriya, Kenji; Higashiyama, Eriko; Avşar-Ban, Eriko; Tamaru, Yutaka; Ogata, Shin; Takebayashi, Shin-ichiro; Ogata, Masato; Okumura, Katsuzumi

    2015-12-01

    Spatiotemporal regulation of DNA replication in the S-phase nucleus has been extensively studied in mammalian cells because it is tightly coupled with the regulation of other nuclear processes such as transcription. However, little is known about the replication dynamics in nonmammalian cells. Here, we analyzed the DNA replication processes of zebrafish (Danio rerio) cells through the direct visualization of replicating DNA in the nucleus and on DNA fiber molecules isolated from the nucleus. We found that zebrafish chromosomal DNA at the nuclear interior was replicated first, followed by replication of DNA at the nuclear periphery, which is reminiscent of the spatiotemporal regulation of mammalian DNA replication. However, the relative duration of interior DNA replication in zebrafish cells was longer compared to mammalian cells, possibly reflecting zebrafish-specific genomic organization. The rate of replication fork progression and ori-to-ori distance measured by the DNA combing technique were ∼ 1.4 kb/min and 100 kb, respectively, which are comparable to those in mammalian cells. To our knowledge, this is a first report that measures replication dynamics in zebrafish cells.

  18. Depurinating acylfulvene-DNA adducts: characterizing cellular chemical reactions of a selective antitumor agent.

    PubMed

    Gong, Jiachang; Vaidyanathan, V G; Yu, Xiang; Kensler, Thomas W; Peterson, Lisa A; Sturla, Shana J

    2007-02-21

    Acylfulvenes (AFs) are a class of semisynthetic agents with high toxicity toward certain tumor cells, and for one analogue, hydroxymethylacylfulvene (HMAF), clinical trials are in progress. DNA alkylation by AFs, mediated by bioreductive activation, is believed to contribute to cytotoxicity, but the structures and chemical properties of corresponding DNA adducts are unknown. This study provides the first structural characterization of AF-specific DNA adducts. In the presence of a reductive enzyme, alkenal/one oxidoreductase (AOR), AF selectively alkylates dAdo and dGuo in reactions with a monomeric nucleoside, as well as in reactions with naked or cellular DNA, with 3-alkyl-dAdo as the apparently most abundant AF-DNA adduct. Characterization of this adduct was facilitated by independent chemical synthesis of the corresponding 3-alkyl-Ade adduct. In addition, in naked or cellular DNA, evidence was obtained for the formation of an additional type of adduct resulting from direct conjugate addition of Ade to AF followed by hydrolytic cyclopropane ring-opening, indicating the potential for a competing reaction pathway involving direct DNA alkylation. The major AF-dAdo and AF-dGuo adducts are unstable under physiologically relevant conditions and depurinate to release an alkylated nucleobase in a process that has a half-life of 8.5 h for 3-alkyladenine and less than approximately 2 h for dGuo adducts. DNA alkylation further leads to single-stranded DNA cleavage, occurring exclusively at dGuo and dAdo sites, in a nonsequence-specific manner. In AF-treated cells that were transfected with either AOR or control vectors, the DNA adducts identified match those from in vitro studies. Moreover, a positive correlation was observed between DNA adduct levels and cell sensitivity to AF. The potential contributing roles of AOR-mediated bioactivation and adduct stability to the cytotoxicity of AF are discussed.

  19. DNA damage response pathway and replication fork stress during oligonucleotide directed gene editing.

    PubMed

    Bonner, Melissa; Strouse, Bryan; Applegate, Mindy; Livingston, Paula; Kmiec, Eric B

    2012-04-03

    Single-stranded DNA oligonucleotides (ODNs) can be used to direct the exchange of nucleotides in the genome of mammalian cells in a process known as gene editing. Once refined, gene editing should become a viable option for gene therapy and molecular medicine. Gene editing is regulated by a number of DNA recombination and repair pathways whose natural activities often lead to single- and double-stranded DNA breaks. It has been previously shown that introduction of a phosphorotioated ODN, designed to direct a gene-editing event, into cells results in the activation of γH2AX, a well-recognized protein biomarker for double-stranded DNA breakage. Using a single copy, integrated mutant enhanced green fluorescent protein (eGFP) gene as our target, we now demonstrate that several types of ODNs, capable of directing gene editing, also activate the DNA damage response and the post-translational modification of proliferating cell nuclear antigen (PCNA), a signature modification of replication stress. We find that the gene editing reaction itself leads to transient DNA breakage, perhaps through replication fork collapse. Unmodified specific ODNs elicit a lesser degree of replication stress than their chemically modified counterparts, but are also less active in gene editing. Modified phosphothioate oligonucleotides (PTOs) are detrimental irrespective of the DNA sequence. Such collateral damage may prove problematic for proliferation of human cells genetically modified by gene editing.

  20. Direct-to-PCR tissue preservation for DNA profiling.

    PubMed

    Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis

    2016-05-01

    Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.

  1. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    PubMed Central

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.

    2016-01-01

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  2. Direct Extraction and Amplification of DNA from Soil.

    ERIC Educational Resources Information Center

    Trevors, Jack T.; Leung, K.

    1998-01-01

    Presents an exercise that describes the direct extraction and purification of DNA from a small soil sample. Also discusses the subsequent amplification of a 343-bp Tn7 transposate A gene fragment (tnsA) from a strain of Pseudomonas aureofaciens 3732RNL11. Contains 21 references. (DDR)

  3. DNA micropatterning on polycrystalline diamond via one-step direct amination.

    PubMed

    Zhang, Guo-Jun; Song, Kwang-Soup; Nakamura, Yusuke; Ueno, Taro; Funatsu, Takashi; Ohdomari, Iwao; Kawarada, Hiroshi

    2006-04-11

    We report a novel method of one-step direct amination on polycrystalline diamond to produce functionalized surfaces for DNA micropatterning by photolithography. Polycrystalline diamond was exposed to UV irradiation in ammonia gas to generate amine groups directly. After patterning, optical microscopy confirmed that micropatterns covered with an Au mask were regular in size and shape. The regions outside the micropatterns were passivated with fluorine termination by C3F8 plasma, and the chemical changes on the two different surfaces--the amine groups inside the patterned regions by one-step direct amination and fluorine termination outside the patterned regions--were characterized by spatially resolved X-ray photoelectron spectroscopy (XPS). The patterned areas terminated with active amine groups were then immobilized with probe DNA via a bifunctional molecule. The sequence specificity was conducted by hybridizing fluorescently labeled target DNA to both complementary and noncomplementary probe DNA attached inside the micropatterns. The fluorescence micropatterns observed by epifluorescence microscopy corresponded to those imaged by optical microscopy. DNA hybridization and denaturation experiments on a DNA-modified diamond show that the diamond surfaces reveal superior stability. The influence of a different amination time on fluorescence intensity was compared. Different terminations as passivated layers were investigated, and as a result, fluorine termination points to the greatest signal-to-noise ratio.

  4. Acanthamoeba DNA can be directly amplified from corneal scrapings.

    PubMed

    El-Sayed, Nagwa Mostafa; Younis, Mohamed Saad; Elhamshary, Azza Mohamed; Abd-Elmaboud, Amina Ibrahim; Kishik, Shereen Magdy

    2014-09-01

    This study evaluated the performance of direct amplification of Acanthamoeba-DNA bypassing DNA extraction in the diagnosis of Acanthamoeba keratitis in clinically suspected cases in comparison to direct microscopic examination and in vitro culture. Corneal scrapings were collected from 110 patients who were clinically suspected to have Acanthamoeba keratitis, 63 contact lens wearers (CLW), and 47 non-contact lens wearers (NCLW). Taken samples were subjected to direct microscopic examination, cultivation onto the non-nutrient agar plate surface seeded with Escherichia coli, and PCR amplification. The diagnostic performance of these methods was statistically compared. The results showed that Acanthamoeba infection was detected in 21 (19.1%) of clinically suspected cases (110); 17 (81%) of them were CLW and the remaining 4 (19%) positive cases were NCLW. Regarding the used diagnostic methods, it was found that direct amplification of Acanthamoeba DNA bypassing nucleic acid extraction was superior to microscopy and culture in which 21 cases (19.1%) were positive for Acanthamoeba by PCR compared to 19 positive cases by culture (17.3%) and one case (0.9%) by direct smear. The difference in detection rates between culture and direct smear was highly statistically significant (P = 0.001). On the other hand, there was no significant difference in detection rates between culture and PCR (P = 0.86). On using culture as the gold standard, PCR showed three false-positive samples that were negative by culture and one false-negative sample that was positive by culture. At the same time, direct smear showed 18 false-negative samples. The sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of PCR were 94.7, 96.7, 85.7, 98.9, and 96.4, respectively, while those of direct smear were 5.3, 100, 100, 83.5, and 83.6, respectively. In conclusion, direct amplification of Acanthamoeba-DNA bypassing DNA extraction is a reliable

  5. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior.

    PubMed

    Kearney, Cathal J; Lucas, Christopher R; O'Brien, Fergal J; Castro, Carlos E

    2016-07-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2D and 3D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargoes including drugs, antibodies, nucleic acid sequences, small molecules, and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing, and synthetic nanopore formation. Here, the advances in the DNA-origami field since its inception several years ago are reviewed with a focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior.

  6. Chemically amplified laser direct-writing of aluminum

    NASA Astrophysics Data System (ADS)

    Tsao, J. Y.; Ehrlich, D. J.

    Laser microchemical direct writing has important advantages over other techniques for the deposition of thin-film patterns. Disadvantages, however, are lower throughput and the need to suppress competing processes such as gas phase nucleation of particles or substrate damage. Methods for increasing the overall speed of laser direct writing by microchemistry were investigated. A class of laser deposition techniques has emerged in which laser radiation is used only to enhance or to impede the initial nucleation of a thin film. In general, it is convenient to draw a distinction between nucleation barriers due to physical effects and those due to chemical effects. The first type of barrier is derived from surface tension. The laser deposits a pattern of heterogeneous catalyst to initiate a subsequent transformation that is chemically self-sustaining or autocatalytic. Experiments, in which the laser direct writing of patterned thin films of Al is chemically amplified by subsequent selective pyrolytic chemical vapor deposition are summarized.

  7. Selective Chemical Labeling of Natural T Modifications in DNA

    PubMed Central

    2015-01-01

    We present a chemical method to selectively tag and enrich thymine modifications, 5-formyluracil (5-fU) and 5-hydroxymethyluracil (5-hmU), found naturally in DNA. Inherent reactivity differences have enabled us to tag 5-fU chemoselectively over its C modification counterpart, 5-formylcytosine (5-fC). We rationalized the enhanced reactivity of 5-fU compared to 5-fC via ab initio quantum mechanical calculations. We exploited this chemical tagging reaction to provide proof of concept for the enrichment of 5-fU containing DNA from a pool that contains 5-fC or no modification. We further demonstrate that 5-hmU can be chemically oxidized to 5-fU, providing a strategy for the enrichment of 5-hmU. These methods will enable the mapping of 5-fU and 5-hmU in genomic DNA, to provide insights into their functional role and dynamics in biology. PMID:25946119

  8. DNA Conjugation and DNA Directed Self-Assembly of Quantum Dots for Nanophotonic Applications

    NASA Astrophysics Data System (ADS)

    Samanta, Anirban

    Colloidal quantum dots (QDs) or semiconductor nanocrystals are often used to describe 2--20 nm solution processed nanoparticles of various semiconductor materials that display quantum confinement effects. Compared to traditional fluorescent organic dyes, QDs provide many advantages. For biological applications it is necessary to develop reliable methods to functionalize QDs with hydrophilic biomolecules so that they may maintain their stability and functionality in physiological conditions. DNA, a molecule that encodes genetic information, is arguably the smartest molecule that nature has ever produced and one of the most explored bio-macromolecules. QDs that are functionalized with DNA can potentially be organized with nanometer precision by DNA directed self-assembly, and the resulting arrangements may facilitate the display of novel optical properties. The goal of this dissertation was to achieve a robust reliable yet simple strategy to link DNA to QDs so that they can be used for DNA directed self assembly by which we can engineer their optical properties. Presented here is a series of studies to achieve this goal. First we demonstrate the aqueous synthesis of colloidal nanocrystal heterostructures consisting of the CdTe core encapsulated by CdS/ZnS or CdSe/ZnS shells using glutathione (GSH), a tripeptide, as the capping ligand. We next employed this shell synthesis strategy to conjugate PS-PO chimeric DNA to QDs at the time of shell synthesis. We synthesized a library of DNA linked QDs emitting from UV to near IR that are very stable in high salt concentrations. These DNA functionalized QDs were further site-specifically organized on DNA origami in desired patterns directed by DNA self-assembly. We further extended our capability to functionalize DNA to real IR emitting CdxPb 1-xTe alloyed QDs, and demonstrated their stability by self-assembling them on DNA origami. The photo-physical properties of the QDs were further engineered by attaching a QD and a gold

  9. The chemical stability of abasic RNA compared to abasic DNA.

    PubMed

    Küpfer, Pascal A; Leumann, Christian J

    2007-01-01

    We describe the synthesis of an abasic RNA phosphoramidite carrying a photocleavable 1-(2-nitrophenyl)ethyl (NPE) group at the anomeric center and a triisopropylsilyloxymethyl (TOM) group as 2'-O-protecting group together with the analogous DNA and the 2'-OMe RNA abasic building blocks. These units were incorporated into RNA-, 2'-OMe-RNA- and DNA for the purpose of studying their chemical stabilities towards backbone cleavage in a comparative way. Stability measurements were performed under basic conditions (0.1 M NaOH) and in the presence of aniline (pH 4.6) at 37 degrees C. The kinetics and mechanisms of strand cleavage were followed by High pressure liquid chromotography and ESI-MS. Under basic conditions, strand cleavage at abasic RNA sites can occur via beta,delta-elimination and 2',3'-cyclophosphate formation. We found that beta,delta-elimination was 154-fold slower compared to the same mechanism in abasic DNA. Overall strand cleavage of abasic RNA (including cyclophosphate formation) was still 16.8 times slower compared to abasic DNA. In the presence of aniline at pH 4.6, where only beta,delta-elimination contributes to strand cleavage, a 15-fold reduced cleavage rate at the RNA abasic site was observed. Thus abasic RNA is significantly more stable than abasic DNA. The higher stability of abasic RNA is discussed in the context of its potential biological role.

  10. The chemical stability of abasic RNA compared to abasic DNA

    PubMed Central

    Küpfer, Pascal A.; Leumann, Christian J.

    2007-01-01

    We describe the synthesis of an abasic RNA phosphoramidite carrying a photocleavable 1-(2-nitrophenyl)ethyl (NPE) group at the anomeric center and a triisopropylsilyloxymethyl (TOM) group as 2′-O-protecting group together with the analogous DNA and the 2′-OMe RNA abasic building blocks. These units were incorporated into RNA-, 2′-OMe-RNA- and DNA for the purpose of studying their chemical stabilities towards backbone cleavage in a comparative way. Stability measurements were performed under basic conditions (0.1 M NaOH) and in the presence of aniline (pH 4.6) at 37°C. The kinetics and mechanisms of strand cleavage were followed by High pressure liquid chromotography and ESI-MS. Under basic conditions, strand cleavage at abasic RNA sites can occur via β,δ-elimination and 2′,3′-cyclophosphate formation. We found that β,δ-elimination was 154-fold slower compared to the same mechanism in abasic DNA. Overall strand cleavage of abasic RNA (including cyclophosphate formation) was still 16.8 times slower compared to abasic DNA. In the presence of aniline at pH 4.6, where only β,δ-elimination contributes to strand cleavage, a 15-fold reduced cleavage rate at the RNA abasic site was observed. Thus abasic RNA is significantly more stable than abasic DNA. The higher stability of abasic RNA is discussed in the context of its potential biological role. PMID:17151071

  11. Directional emission from dye-functionalized plasmonic DNA superlattice microcavities.

    PubMed

    Park, Daniel J; Ku, Jessie C; Sun, Lin; Lethiec, Clotilde M; Stern, Nathaniel P; Schatz, George C; Mirkin, Chad A

    2017-01-17

    Three-dimensional plasmonic superlattice microcavities, made from programmable atom equivalents comprising gold nanoparticles functionalized with DNA, are used as a testbed to study directional light emission. DNA-guided nanoparticle colloidal crystallization allows for the formation of micrometer-scale single-crystal body-centered cubic gold nanoparticle superlattices, with dye molecules coupled to the DNA strands that link the particles together, in the form of a rhombic dodecahedron. Encapsulation in silica allows one to create robust architectures with the plasmonically active particles and dye molecules fixed in space. At the micrometer scale, the anisotropic rhombic dodecahedron crystal habit couples with photonic modes to give directional light emission. At the nanoscale, the interaction between the dye dipoles and surface plasmons can be finely tuned by coupling the dye molecules to specific sites of the DNA particle-linker strands, thereby modulating dye-nanoparticle distance (three different positions are studied). The ability to control dye position with subnanometer precision allows one to systematically tune plasmon-excition interaction strength and decay lifetime, the results of which have been supported by electrodynamics calculations that span length scales from nanometers to micrometers. The unique ability to control surface plasmon/exciton interactions within such superlattice microcavities will catalyze studies involving quantum optics, plasmon laser physics, strong coupling, and nonlinear phenomena.

  12. Transcriptional IL-15-Directed in vivo DC Targeting DNA Vaccine

    PubMed Central

    Tian, S; Liu, Z; Donahue, C; Noh, HS; Falo, LD; You, Z

    2009-01-01

    DC engineered in vitro by DNA encoding OVAhsp70 and IL-15 up-regulated their expressions of CD80, CD86, CCR7 and IL-15Rα and promoted their productions of IL-6, IL-12 and TNF-α. Transcriptional IL-15-directed in vivo DC targeting DNA vaccine encoding OVAhsp70 elicited long-lasting Th1 and CTL responses and anti-B16OVA activity. CD8 T cell-mediated primary tumor protection was abrogated by DC or CD4 T cell depletion during the induction phase of immune responses. However, CD4 T cell depletion during immunization did not impair CD8 T cell-dependent long-lasting tumor protection. Furthermore, in vivo DC-derived IL-15 exerted the enhancements of cellular and humoral immune responses and antitumor immunity elicited by OVAhsp70 DNA vaccine. Importantly, the potency of this novel DNA vaccine strategy was proven using a self/tumor Ag (TRP2) in a clinically relevant B16 melanoma model. These findings have implications for developing next generation DNA vaccines against cancers and infectious diseases in both healthy and CD4 deficient individuals. PMID:19727134

  13. DNA hybridization and ligation for directed colloidal assembly

    NASA Astrophysics Data System (ADS)

    Shyr, Margaret

    Colloidal assembly using DNA hybridization has been pursued as a means assemble non-conventional ordered colloidal structures. However, to date it is undetermined whether DNA hybridization can be used to achieve non-FCC colloidal crystals. Using microcontact printing techniques, we have fabricated covalently bound single stranded DNA (ssDNA) two-dimensional arrays on glass surfaces, which were used to direct the assembly of complementary DNA functionalized polystyrene colloids. Two of the hallmarks of DNA hybridization, sequence specificity and thermal reversibility, were demonstrated. Due to the periodicity of these arrays, laser diffraction was used to directly monitor these structures during assembly. To demonstrate the versatility of the 2D colloidal array assembled via DNA hybridization, a catalytic DNA sequence or DNAzyme was incorporated into the colloidal array system. By tethering the enzymatic strand to the patterned glass surface and the substrate strand to polystyrene colloids, we showed that the DNAzyme could prevent the assembly of the arrays when the required Pb2+ cofactor was provided. Attempts to assemble the colloid arrays and disassemble via the Pb2+-DNAzyme induced cleavage were unsuccessful, likely due to the incomplete cleavage of the multitude of hybridized linkages between each colloid and the surface. Since DNA is not only capable of catalyzing reactions, but also capable of being reacted upon by a variety of biological enzymes, we examined the use of DNA ligase as a means to control the assembly of DNA-functionalized colloids. A three-sequence linker system was used for the hybridization mediated assembly of colloids: one sequence was tethered to the surface of the glass slide or colloids, one was tethered to another colloid surface, and the linker sequence hybridizes simultaneously to both tethered sequences. Once hybridized, the two tethered fragments can be ligated using DNA ligase, resulting in a continuous sequence tethered on one end

  14. DNA-osmium complexes: recent developments in the operative chemical analysis of DNA epigenetic modifications.

    PubMed

    Okamoto, Akimitsu

    2014-09-01

    The development of a reaction for the detection of one epigenetic modification in a long DNA strand is a chemically and biologically challenging research subject. Herein, we report and discuss the formation of 5-methylcytosine-osmium complexes that are used as the basis for a bisulfite-free chemical assay for DNA methylation analysis. Osmium in the oxidized state reacts with C5-methylated pyrimidines in the presence of a bipyridine ligand to give a stable ternary complex. On the basis of this reaction, an adenine derivative with a tethered bipyridine moiety has been designed for sequence-specific osmium complex formation. Osmium complexation is then achieved by hybridization of a short DNA molecule containing this functional nucleotide to a target DNA sequence and results in the formation of a cross-linked structure. This novel concept of methylation-specific reaction, based on a straightforward chemical process, expands the range of methods available for the analysis of epigenetic modifications. Advantages of the described method include amplification-insensitive detection, 5-hydroxymethylcytosine complexation, and visualization through methylation-specific in situ hybridization.

  15. Direct chemical evidence for eumelanin pigment from the Jurassic period

    PubMed Central

    Glass, Keely; Ito, Shosuke; Wilby, Philip R.; Sota, Takayuki; Nakamura, Atsushi; Bowers, C. Russell; Vinther, Jakob; Dutta, Suryendu; Summons, Roger; Briggs, Derek E. G.; Wakamatsu, Kazumasa; Simon, John D.

    2012-01-01

    Melanin is a ubiquitous biological pigment found in bacteria, fungi, plants, and animals. It has a diverse range of ecological and biochemical functions, including display, evasion, photoprotection, detoxification, and metal scavenging. To date, evidence of melanin in fossil organisms has relied entirely on indirect morphological and chemical analyses. Here, we apply direct chemical techniques to categorically demonstrate the preservation of eumelanin in two > 160 Ma Jurassic cephalopod ink sacs and to confirm its chemical similarity to the ink of the modern cephalopod, Sepia officinalis. Identification and characterization of degradation-resistant melanin may provide insights into its diverse roles in ancient organisms. PMID:22615359

  16. Direct chemical evidence for eumelanin pigment from the Jurassic period.

    PubMed

    Glass, Keely; Ito, Shosuke; Wilby, Philip R; Sota, Takayuki; Nakamura, Atsushi; Bowers, C Russell; Vinther, Jakob; Dutta, Suryendu; Summons, Roger; Briggs, Derek E G; Wakamatsu, Kazumasa; Simon, John D

    2012-06-26

    Melanin is a ubiquitous biological pigment found in bacteria, fungi, plants, and animals. It has a diverse range of ecological and biochemical functions, including display, evasion, photoprotection, detoxification, and metal scavenging. To date, evidence of melanin in fossil organisms has relied entirely on indirect morphological and chemical analyses. Here, we apply direct chemical techniques to categorically demonstrate the preservation of eumelanin in two > 160 Ma Jurassic cephalopod ink sacs and to confirm its chemical similarity to the ink of the modern cephalopod, Sepia officinalis. Identification and characterization of degradation-resistant melanin may provide insights into its diverse roles in ancient organisms.

  17. Chemical physics of DNA packaging in a nucleosome core particle

    NASA Astrophysics Data System (ADS)

    Spakowitz, Andrew; Sudhanshu, Bariz

    2008-03-01

    The fundamental unit of packaged DNA, the nucleosome core particle, contains 146 base pairs of DNA wrapped 1.7 times around a cationic protein complex called the histone octamer. A string of nucleosomes is organized into higher-order structures at several hierarchical levels to form chromatin, a remarkable complex that is compact yet maintains accessibility for gene expression. We develop a theoretical model of the nucleosome core particle in order to extract detailed quantitative information from single-molecule measurements of a single nucleosome under tension. We employ the wormlike chain model to describe the DNA strand as a thermally fluctuating polymer chain. The chain adsorbs on a spool that represents the histone octamer. This model is directly compared to single-molecule experiments conducted in Carlos Bustamante's lab; we find good agreement between our theory and the experimental data. Our model reveals the mechanism that underlies structural transitions that are apparent in the experimental measurements and predicts the conditions where these transitions occur. We proceed to construct a free energy surface to predict the dynamic response in a single-molecule experiment with a time-dependent rate of unwinding the nucleosome. The combination of single-molecule experiments and our theoretical modeling gives detailed information about the specific interactions between DNA and histone proteins.

  18. Direct facile screening of recombinant DNA vector constructs.

    PubMed

    Winnard, Paul T; Challa, Rushi; Bhujwalla, Zaver M; Raman, Venu

    2014-04-01

    Direct efficient facile screening of bacterial transformants with the goal of selecting, retrieving, and using recombinant DNA is exemplified by simple visual-based colorimetric inspections or fluorescent protein-based assays. We describe pRedScript, which introduces the constitutive expression of a very bright red fluorescent protein into transformants. On agar plates, red colonies are simply visualized in ambient white light in stark contrast to recombinant transformants that are white. In addition, the bright red fluorescence of the reporter protein can also be harnessed as a sensitive signal for screening bacterial promoters during the development of optimized fermentation conditions.

  19. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  20. Multimodal plasmonic biosensing nanostructures prepared by DNA-directed immobilization of multifunctional DNA-gold nanoparticles.

    PubMed

    Tort, Nuria; Salvador, J-Pablo; Marco, M-Pilar

    2017-04-15

    Biofunctional multimodal plasmonic nanostructures suitable for multiplexed localized surface plasmon resonance (LSPR) biosensing have been created by DNA-directed immobilization (DDI) of two distinct multifunctional biohybrid gold nanoparticles. Gold nanoparticles (AuNP) of distinct sizes, and therefore showing distinct plasmon resonant peaks (RP), have been biofunctionalized and codified with two different single stranded-DNA (ssDNA) chains. One of these oligonucleotide chains has been specifically designed to direct each AuNP to a distinct location of the surface of a DNA microarray chip through specific hybridization with complementary oligonucleotide strands. Scanning Electron Microscopy (SEM) has been used to demonstrate selective immobilization of each AuNP on distinct spots. The second ssDNA chain of the AuNPs provides the possibility to introduce by hybridization distinct types of bioactive molecules or bioreceptors, on a reversible manner. In this work, hapten-oligonucleotide bioconjugate probes, with sequences complementary to the second ssDNA linked to the AuNP, have been synthesized and used to create multiplexed hapten-biofuncionalized plasmonic nanostructures. The oligonucleotide probes consist on anabolic androgenic steroid haptens (AAS) covalently linked to specifically designed oligonucleotide sequences. The biofunctionality of these plasmonic nanostructures has been demonstrated by fluorescent microarray immunoassay and LSPR measurements, recording the shift of the RP produced after the antibody binding to the corresponding hapten-oligonucleotide probes immobilized on the nanostructured surface. Preliminary data show that this approach could allow manufacturing multifunctional multimodal LSPR chips for multiplexed analysis of different substances reaching very good detectability. Thus, small molecular weigh, analytes such as stanozolol (ST,) could be detected at concentrations in the low nM range. The results here presented open the door for an

  1. Direct quantification of mitochondria and mitochondrial DNA dynamics.

    PubMed

    Nomura, Yasutomo

    2012-11-01

    Mitochondria are known to be one of major organelles within a cell and to play a crucial role in many cellular functions. These organelles show the dynamic behaviors such as fusion, fission and the movement along cytoskeletal tracks. Besides mitochondria, mitochondrial DNA is also highly motile. Molecular analysis revealed that several proteins are involved in mitochondria and mitochondrial DNA dynamics. In addition to the degeneration of specific nerves with high energy requirement, mutation of genes coding these proteins results in metabolic diseases. During the last few years, a significant amount of relevant data has been obtained on molecular basis of these diseases but mitochondrial dynamics in cells derived from the patients is poorly understood. So far time-lapse fluorescence microscopy, fluorescence recovery after photo bleaching and image correlation methods have been used to study organellar motion. Especially, image correlation method has possibility to evaluate diffusion coefficient of mitochondria and mitochondrial DNA simultaneously and directly. When we search candidates for compounds that modulate mitochondrial dynamics by high throughput screening, image correlation method may be useful although the careful interpretation is required for crowded and heterogeneous environment within a cell.

  2. Label free colorimetric and fluorimetric direct detection of methylated DNA based on silver nanoclusters for cancer early diagnosis.

    PubMed

    Dadmehr, Mehdi; Hosseini, Morteza; Hosseinkhani, Saman; Ganjali, Mohammad Reza; Sheikhnejad, Reza

    2015-11-15

    Epigenetic changes such as DNA methylation of CpG islands located in the promoter region of some tumor suppressor genes are very common in human diseases such as cancer. Detection of aberrant methylation pattern could serve as an excellent diagnostic approach. Recently, the direct detection of methylated DNA sequences without using chemical and enzymatic treatments or antibodies has received great deal of attentions. In this study, we report a colorimetric and fluorimetric technique for direct detection of DNA methylation. Here, the DNA is being used as an effective template for fluorescent silver nanoclusters formation without any chemical modification or DNA labeling. The sensitivity test showed that upon the addition of target methylated DNA, the fluorescence intensity is decreased in a linear range when the concentration of methylated DNA has increased from 2.0×10(-9) to 6.3 ×10(-7) M with the detection limit of 9.4×10(-10) M. The optical and fluorescence spectral behaviors were highly reproducible and clearly discriminated between unmethylated, methylated and even partially methylated DNA in CpG rich sequences. The results were also reproducible when the human plasma was present in our assay system.

  3. DNA profiles from clothing fibers using direct PCR.

    PubMed

    Blackie, Renée; Taylor, Duncan; Linacre, Adrian

    2016-09-01

    We report on the successful use of direct PCR amplification of single fibers from items of worn clothing. Items of clothing were worn throughout the course of a day, with the individual commencing regular activities. Single fibers were taken from the cuff of the clothing at regular intervals and amplified directly. The same areas were subjected to tape-lifting, and also amplified directly for comparison. The NGM™ kit that amplifies 15 STR loci plus amelogenin was used. A total of 35 single fiber samples were processed and analyzed from five items of clothing, with 81 % of samples returning a profile of 14 alleles or more. All tape-lift samples amplified directly produced DNA profiles of 15 alleles or more. The aim was to develop a simple, operational method that could be used routinely in forensic science casework and that has the potential to generate more complete profiles, which would not be detected using standard extraction methods on this type of sample. For ease of implementation, the process also adheres to standard methods with no increase in the cycle number.

  4. DNA Oxidation Profiles of Copper Phenanthrene Chemical Nucleases

    NASA Astrophysics Data System (ADS)

    Molphy, Zara; Slator, Creina; Chatgilialoglu, Chryssostomos; Kellett, Andrew

    2015-04-01

    The deleterious effects of metal-catalyzed reactive oxygen species (ROS) in biological systems can be seen in a wide variety of pathological conditions including cancer, cardiovascular disease, ageing, and neurodegenerative disorder. On the other hand however, targeted ROS production in the vicinity of nucleic acids - as demonstrated by metal-activated bleomycin - has paved the way for ROS-active chemotherapeutic drug development. Herein we report mechanistic investigations into the oxidative nuclease activity and redox properties of copper(II) developmental therapeutics [Cu(DPQ)(phen)]2+ (Cu-DPQ-Phen), [Cu(DPPZ)(phen)]2+ (Cu-DPPZ-Phen), and [{Cu(phen)2}2(μ-terph)](terph) (Cu-Terph), with results being compared directly to Sigman’s reagent [Cu(phen)2]2+ throughout (phen = 1,10-phenanthroline; DPQ = dipyridoquinoxaline; DPPZ = dipyridophenazine). Oxidative DNA damage was identified at the minor groove through use of surface bound recognition elements of methyl green, netropsin, and [Co(NH3)6]Cl3 that functioned to control complex accessibility at selected regions. ROS-specific scavengers and stabilisers were employed to identify the cleavage process, the results of which infer hydrogen peroxide produced metal-hydroxo or free hydroxyl radicals (•OH) as the predominant species. The extent of DNA damage owing to these radicals was then quantified through 8-oxo-2'-deoxyguanosine (8-oxo-dG) lesion detection under ELISA protocol with the overall trend following Cu-DPQ-Phen > Cu-Terph > Cu-Phen > Cu-DPPZ. Finally, the effects of oxidative damage on DNA replication processes were investigated using the polymerase chain reaction (PCR) where amplification of 120 base pair DNA sequences of varying base content were inhibited - particularly along A-T rich chains - through oxidative damage of the template strands.

  5. Small targeted cytotoxics from DNA-encoded chemical libraries.

    PubMed

    Samain, Florent; Casi, Giulio

    2015-06-01

    Conventional chemotherapeutic drugs do not selectively localize to tumors, causing undesired toxicities to healthy organs, and precluding the escalation to therapeutically active regimens. The selective delivery at sites of disease of potent effector molecules represents a promising strategy for the treatment of cancer and other diseases. High affinity antibodies towards disease-associated antigens are currently the vehicles of choice for the targeted delivery of payloads. Low molecular weight ligands have the potential to overcome some of the intrinsic limitations associated with antibodies, and have recently been proposed for the development of a novel class of targeted therapeutics. However, the identification of binding molecules, which display high affinity properties and exquisite specificity against protein of therapeutic interest, remains a great challenge. DNA-encoded chemical library technology relies on small molecule libraries of unprecedented size to identify high affinity ligands towards specific target proteins, and could help in the development of next generation targeted cytotoxics.

  6. A DNA minor groove electronegative potential genome map based on photo-chemical probing.

    PubMed

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten; Møllegaard, Niels Erik

    2011-08-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciated, and it also appears that minor groove electronegative potential may contribute significantly in guiding proteins to their cognate binding sites in the genome. Based on the photo-chemical probing results, we have derived an algorithm that predicts the minor groove electronegative potential in a DNA helix of any given sequence. We have validated this model on a series of protein-DNA binding sites known to involve minor groove electrostatic recognition as well as on stable nucleosome core complexes. The algorithm allows for the first time a full minor groove electrostatic description at the nucleotide resolution of any genome, and it is illustrated how such detailed studies of this sequence dependent, inherent property of the DNA may reflect on genome organization, gene expression and chromosomal condensation.

  7. The invariance of the total direct DNA strand break yield

    SciTech Connect

    Bernal, M. A.; Almeida, C. E. de; Sampaio, C.; Incerti, S.; Champion, C.; Nieminen, P.

    2011-07-15

    Purpose: The invariance of the total direct strand break yield when DNA is irradiated by different types of particles and energies has been reported by previous works. This study is intended to explain the physical causes of this behavior. Methods: The geant4-dna extension of the geant4 general purpose Monte Carlo simulation toolkit has been used to determine direct strand break yields induced by protons and alpha particles impacting on a B-DNA geometrical model, including five organization levels of the human genetic material. The linear energy transfer (LET) of such particles ranges from 4.8 keV/{mu}m (10 MeV protons) to about 235 keV/{mu}m (2 MeV alpha particles), at 5.225 {mu}m depth (near the center of the region of interest). Direct total, single and double strand break probabilities have been determined in a liquid water homogeneous medium with a 1.06 g/cm {sup 3} density. The energetic spectra of single strand breaks (SSB), the number of energy deposition events, and the SSB/event ratio were determined. Results: The target-hit probability was found to be independent of both the type and the energy of the incident particle, even if this latter is a secondary electron. This probability is determined by the geometrical properties of the system. The total strand break yield and the number of energy deposition events required to reach a certain absorbed dose were found nearly independent of the type and energy of the incident ion (proton or alpha). In contrast, the double strand break (DSB) yield was found strongly dependent on the LET of the incident radiation. Conclusions: The SSB generation process is homogeneous and independent of the LET of the particles involved, at least within the proton and alpha particle energy range here studied. The target-hit probability is only determined by the ratio between the total volume occupied by targets and that of the ROI where the radiation deposits its energy. The maximum separation distance between two adjacent SSBs to

  8. Directly repeated sequences associated with pathogenic mitochondrial DNA deletions.

    PubMed Central

    Johns, D R; Rutledge, S L; Stine, O C; Hurko, O

    1989-01-01

    We determined the nucleotide sequences of junctional regions associated with large deletions of mitochondrial DNA found in four unrelated individuals with a phenotype of chronic progressive external ophthalmoplegia. In each patient, the deletion breakpoint occurred within a directly repeated sequence of 13-18 base pairs, present in different regions of the normal mitochondrial genome-separated by 4.5-7.7 kilobases. In two patients, the deletions were identical. When all four repeated sequences are compared, a consensus sequence of 11 nucleotides emerges, similar to putative recombination signals, suggesting the involvement of a recombinational event. Partially deleted and normal mitochondrial DNAs were found in all tissues examined, but in very different proportions, indicating that these mutations originated before the primary cell layers diverged. Images PMID:2813377

  9. Direct reprogramming of mouse fibroblasts into cardiomyocytes with chemical cocktails.

    PubMed

    Fu, Yanbin; Huang, Chenwen; Xu, Xinxiu; Gu, Haifeng; Ye, Youqiong; Jiang, Cizhong; Qiu, Zilong; Xie, Xin

    2015-09-01

    The direct conversion, or transdifferentiation, of non-cardiac cells into cardiomyocytes by forced expression of transcription factors and microRNAs provides promising approaches for cardiac regeneration. However, genetic manipulations raise safety concerns and are thus not desirable in most clinical applications. The discovery of full chemically induced pluripotent stem cells suggest the possibility of replacing transcription factors with chemical cocktails. Here, we report the generation of automatically beating cardiomyocyte-like cells from mouse fibroblasts using only chemical cocktails. These chemical-induced cardiomyocyte-like cells (CiCMs) express cardiomyocyte-specific markers, exhibit sarcomeric organization, and possess typical cardiac calcium flux and electrophysiological features. Genetic lineage tracing confirms the fibroblast origin of these CiCMs. Further studies show the generation of CiCMs passes through a cardiac progenitor stage instead of a pluripotent stage. Bypassing the use of viral-derived factors, this proof of concept study lays a foundation for in vivo cardiac transdifferentiation with pharmacological agents and possibly safer treatment of heart failure.

  10. Direct chemical oxidation of hazardous and mixed wastes

    SciTech Connect

    Cooper, J.F.; Wang, F.; Farmer, J.

    1995-04-11

    Direct Chemical Oxidation (DCO) refers to the use of continuously-regenerated peroxydisulfate (with possible hydrogen peroxide supplements) to effect total destruction of organic wastes in aqueous media. The process does not involve toxic catalysts or the cogeneration of secondary wastes. Peroxydisulfate (S{sub 2}O{sub 8}{sup -2}) is one the strongest known chemical oxidants. It is routinely used in laboratory total carbon analyzers--uncatalyzed at 100{degrees}C, or catalyzed by UV, platinum or dissolved transition metal ions--and detects by oxidative destruction to 0.01 ppm levels. We report: (1) development of a waste treatment approach grounded in industrial electrolysis practice and in reaction rate data for Pt-initiated S{sub 2}O{sub 8}{sup -2} oxidation at 100{degrees}C; (2) tests of an electrochemical cell generating 1.5 N peroxydisulfate solutions; (3) lower-limit rate data for destruction of surrogates for chemical warfare agents and compounds with functional groups resisting oxidation; and (4) destruction of a Dowex{reg_sign} ion exchange resin, such as used in nuclear processing. This technique is particularly suited for applications in analytical laboratories or in manufacturing industries where the waste generation is low in volume, highly toxic or fugitive, or changing. The process may be tailored for destruction of very small to bulk quantities of chemical warfare agents.

  11. Chemical Bonding Technology: Direct Investigation of Interfacial Bonds

    NASA Technical Reports Server (NTRS)

    Koenig, J. L.; Boerio, F. J.; Plueddemann, E. P.; Miller, J.; Willis, P. B.; Cuddihy, E. F.

    1986-01-01

    This is the third Flat-Plate Solar Array (FSA) Project document reporting on chemical bonding technology for terrestrial photovoltaic (PV) modules. The impetus for this work originated in the late 1970s when PV modules employing silicone encapsulation materials were undergoing delamination during outdoor exposure. At that time, manufacturers were not employing adhesion promoters and, hence, module interfaces in common with the silicone materials were only in physical contact and therefore easily prone to separation if, for example, water were to penetrate to the interfaces. Delamination with silicone materials virtually vanished when adhesion promoters, recommended by silicone manufacturers, were used. The activities related to the direct investigation of chemically bonded interfaces are described.

  12. Effects of Tilt Angle, DNA Concentration, and Surface Potential on Directed Alignment of DNA Molecule for the Application to Nanodevices

    NASA Astrophysics Data System (ADS)

    Kim, Hyung Jin; Hong, Byungyou

    2013-03-01

    This paper reports an efficient approach to control both the density and direction of highly aligned DNA molecules and thus DNA-templated gold nanowires (AuNWs) on Si chips. We utilized tilting method to prepare stretched DNA structures on SiO2/Si substrate and found important parameters in the alignment process that tilt angle, DNA concentration, and surface potential are controlled the density and structure of DNA aligned on the surface. In additional, we also can be directly connected DNA-templated AuNWs between two terminal electrodes on Si chips. This method also describes a simple way to form singled, bundled and networked DNA arrays on Si substrates.

  13. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    PubMed

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  14. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  15. Direct single-molecule observations of DNA unwinding by SV40 large tumor antigen under a negative DNA supercoil state.

    PubMed

    Takahashi, Shunsuke; Motooka, Shinya; Kawasaki, Shohei; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-Ichi; Hanaoka, Fumio; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2017-01-05

    Superhelices, which are induced by the twisting and coiling of double-helical DNA in chromosomes, are thought to affect transcription, replication, and other DNA metabolic processes. In this study, we report the effects of negative supercoiling on the unwinding activity of simian virus 40 large tumor antigen (SV40 TAg) at a single-molecular level. The supercoiling density of linear DNA templates was controlled using magnetic tweezers and monitored using a fluorescent microscope in a flow cell. SV40 TAg-mediated DNA unwinding under relaxed and negative supercoil states was analyzed by the direct observation of both single- and double-stranded regions of single DNA molecules. Increased negative superhelicity stimulated SV40 TAg-mediated DNA unwinding more strongly than a relaxed state; furthermore, negative superhelicity was associated with an increased probability of SV40 TAg-mediated DNA unwinding. These results suggest that negative superhelicity helps to regulate the initiation of DNA replication.

  16. Direct qPCR quantification using the Quantifiler(®) Trio DNA quantification kit.

    PubMed

    Liu, Jason Yingjie

    2014-11-01

    The effectiveness of a direct quantification assay is essential to the adoption of the combined direct quantification/direct STR workflow. In this paper, the feasibility of using the Quantifiler(®) Trio DNA quantification kit for the direct quantification of forensic casework samples was investigated. Both low-level touch DNA samples and blood samples were collected on PE swabs and quantified directly. The increased sensitivity of the Quantifiler(®) Trio kit enabled the detection of less than 10pg of DNA in unprocessed touch samples and also minimizes the stochastic effect experienced by different targets in the same sample. The DNA quantity information obtained from a direct quantification assay using the Quantifiler(®) Trio kit can also be used to accurately estimate the optimal input DNA quantity for a direct STR amplification reaction. The correlation between the direct quantification results (Quantifiler(®) Trio kit) and the direct STR results (GlobalFiler™ PCR amplification kit(*)) for low-level touch DNA samples indicates that direct quantification using the Quantifiler(®) Trio DNA quantification kit is more reliable than the Quantifiler(®) Duo DNA quantification kit for predicting the STR results of unprocessed touch DNA samples containing less than 10pg of DNA.

  17. Surface invasive cleavage assay on a maskless light-directed diamond DNA microarray for genome-wide human SNP mapping.

    PubMed

    Nie, Bei; Yang, Min; Fu, Weiling; Liang, Zhiqing

    2015-07-07

    The surface invasive cleavage assay, because of its innate accuracy and ability for self-signal amplification, provides a potential route for the mapping of hundreds of thousands of human SNP sites. However, its performance on a high density DNA array has not yet been established, due to the unusual "hairpin" probe design on the microarray and the lack of chemical stability of commercially available substrates. Here we present an applicable method to implement a nanocrystalline diamond thin film as an alternative substrate for fabricating an addressable DNA array using maskless light-directed photochemistry, producing the most chemically stable and biocompatible system for genetic analysis and enzymatic reactions. The surface invasive cleavage reaction, followed by degenerated primer ligation and post-rolling circle amplification is consecutively performed on the addressable diamond DNA array, accurately mapping SNP sites from PCR-amplified human genomic target DNA. Furthermore, a specially-designed DNA array containing dual probes in the same pixel is fabricated by following a reverse light-directed DNA synthesis protocol. This essentially enables us to decipher thousands of SNP alleles in a single-pot reaction by the simple addition of enzyme, target and reaction buffers.

  18. DNA-encoded chemical libraries: foundations and applications in lead discovery.

    PubMed

    Zimmermann, Gunther; Neri, Dario

    2016-11-01

    DNA-encoded chemical libraries have emerged as a powerful tool for hit identification in the pharmaceutical industry and in academia. Similar to biological display techniques (such as phage display technology), DNA-encoded chemical libraries contain a link between the displayed chemical building block and an amplifiable genetic barcode on DNA. Using routine procedures, libraries containing millions to billions of compounds can be easily produced within a few weeks. The resulting compound libraries are screened in a single test tube against proteins of pharmaceutical interest and hits can be identified by PCR amplification of DNA barcodes and subsequent high-throughput sequencing.

  19. Chemical Probes to Directly Profile Palmitoleoylation of Proteins.

    PubMed

    Zheng, Baohui; Jarugumilli, Gopala K; Chen, Baoen; Wu, Xu

    2016-11-03

    Palmitoleoylation is a unique fatty acylation of proteins in which a monounsaturated fatty acid, palmitoleic acid (C16:1), is covalently attached to a protein. Wnt proteins are known to be palmitoleoylated by cis-Δ9 palmitoleate at conserved serine residues. O-palmitoleoylation plays a critical role in regulating Wnt secretion, binding to the receptors, and in the dynamics of Wnt signaling. Therefore, protein palmitoleoylation is important in tissue homeostasis and tumorigenesis. Chemical probes based on saturated fatty acids, such as ω-alkynyl palmitic acid (Alk-14 or Alk-C16 ), have been used to study Wnt palmitoleoylation. However, such probes require prior conversion to the unsaturated fatty acid by stearoyl-CoA desaturase (SCD) in cells, significantly decreasing their selectivity and efficiency for studying protein palmitoleoylation. We synthesized and characterized ω-alkynyl cis- and trans-palmitoleic acids (cis- and trans-Alk-14:1) as chemical probes to directly study protein palmitoleoylation. We found that cis-Alk-14:1 could more efficiently label Wnt proteins in cells. Interestingly, the DHHC family of palmitoyl acyltransferases can charge both saturated and unsaturated fatty acids, potentially using both as acyl donors in protein palmitoylation and palmitoleoylation. Furthermore, proteomic analysis of targets labeled by these probes revealed new cis- and trans-palmitoleoylated proteins. Our studies provided new chemical tools and revealed new insights into palmitoleoylation in cell signaling.

  20. Direct chemical oxidation of mixed or toxic wastes

    SciTech Connect

    Balazs, G B; Cooper, J F; Farmer, J C; Lewis, P

    1999-05-01

    Direct Chemical Oxidation (DCO) is an ambient-pressure, low-temperature (<100 C), and aqueous-based process for general-purpose destruction of the organic fraction of hazardous or mixed waste. It uses the peroxydisulfate anion (S{sub 2}O{sub 8}{sup 2{minus}}) in acid or base solutions. The byproduct of the oxidation reaction, typically sodium or ammonium hydrogen sulfate, may be recycled electrolytically to produce the oxidant. The oxidation kinetic reaction is first order with respect to the peroxydisulfate concentration, expressed in equivalents. The rate constant is constant for nearly all dissolved organic compounds: k{sub a} = 0.01 {+-} 0.005 min{sup {minus}1}. This reflects a common rate-determining step, which is the decomposition of the peroxydisulfate anion into the chemically active derivative, the sulfate radical anion, SO{sub 4}{sup {minus}}. This decomposition is promoted in DCO by raising the operating temperature into the range of 80-100 C. Rates are given for approximately 30 substances with diverse functional groups at low concentrations, and for a number of solid and liquid wastes typical of nuclear and chemical industries. The process has been scale up for treatment studies on chlorinated hydrocarbons, in which the hydrolysis of solvent mixtures was followed by oxidation of products in a series of stirred tank reactors. Cost estimates, safety considerations, and a comprehensive bibliography are given.

  1. Direct simulations of chemically reacting turbulent mixing layers, part 2

    NASA Technical Reports Server (NTRS)

    Metcalfe, Ralph W.; Mcmurtry, Patrick A.; Jou, Wen-Huei; Riley, James J.; Givi, Peyman

    1988-01-01

    The results of direct numerical simulations of chemically reacting turbulent mixing layers are presented. This is an extension of earlier work to a more detailed study of previous three dimensional simulations of cold reacting flows plus the development, validation, and use of codes to simulate chemically reacting shear layers with heat release. Additional analysis of earlier simulations showed good agreement with self similarity theory and laboratory data. Simulations with a two dimensional code including the effects of heat release showed that the rate of chemical product formation, the thickness of the mixing layer, and the amount of mass entrained into the layer all decrease with increasing rates of heat release. Subsequent three dimensional simulations showed similar behavior, in agreement with laboratory observations. Baroclinic torques and thermal expansion in the mixing layer were found to produce changes in the flame vortex structure that act to diffuse the pairing vortices, resulting in a net reduction in vorticity. Previously unexplained anomalies observed in the mean velocity profiles of reacting jets and mixing layers were shown to result from vorticity generation by baroclinic torques.

  2. Subfemtosecond directional control of chemical processes in molecules

    NASA Astrophysics Data System (ADS)

    Alnaser, Ali S.; Litvinyuk, Igor V.

    2017-02-01

    Laser pulses with a waveform-controlled electric field and broken inversion symmetry establish the opportunity to achieve directional control of molecular processes on a subfemtosecond timescale. Several techniques could be used to break the inversion symmetry of an electric field. The most common ones include combining a fundamental laser frequency with its second harmonic or with higher -frequency pulses (or pulse trains) as well as using few-cycle pulses with known carrier-envelope phase (CEP). In the case of CEP, control over chemical transformations, typically occurring on a timescale of many femtoseconds, is driven by much faster sub-cycle processes of subfemtosecond to few-femtosecond duration. This is possible because electrons are much lighter than nuclei and fast electron motion is coupled to the much slower nuclear motion. The control originates from populating coherent superpositions of different electronic or vibrational states with relative phases that are dependent on the CEP or phase offset between components of a two-color pulse. In this paper, we review the recent progress made in the directional control over chemical processes, driven by intense few-cycle laser pulses a of waveform-tailored electric field, in different molecules.

  3. RNA-directed DNA methylation induces transcriptional activation in plants

    PubMed Central

    Shibuya, Kenichi; Fukushima, Setsuko; Takatsuji, Hiroshi

    2009-01-01

    A class-C floral homeotic gene of Petunia, pMADS3, is specifically expressed in the stamen and carpels of developing flowers. We had previously reported the ect-pMADS3 phenomenon in which introduction of a part of the pMADS3 genomic sequence, including intron 2, induces ectopic expression of endogenous pMADS3. Unlike transcriptional or posttranscriptional gene silencing triggered by the introduction of homologous sequences, this observation is unique in that the gene expression is up-regulated. In this study, we demonstrated that the ect-pMADS3 phenomenon is due to transcriptional activation based on RNA-directed DNA methylation (RdDM) occurring in a particular CG in a putative cis-element in pMADS3 intron 2. The CG methylation was maintained over generations, along with pMADS3 ectopic expression, even in the absence of RNA triggers. These results demonstrate a previously undescribed transcriptional regulatory mechanism that could lead to the generation of a transcriptionally active epiallele, thereby contributing to plant evolution. Our results also reveal a putative negative cis-element for organ-specific transcriptional regulation of class-C floral homeotic genes, which could be difficult to identify by other approaches. PMID:19164525

  4. Analysis of DNA-protein complexes induced by chemical carcinogens

    SciTech Connect

    Costa, M. )

    1990-11-01

    DNA-protein complexes induced in intact cells by chromate have been isolated and compared with those formed by other agents such as cis-platinum. Actin has been identified as one of the major proteins that is complexed to the DNA by chromate based upon a number of criteria including, a molecular weight and isoelectric point identical to actin, positive reaction with actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of very similar molecular weight and isoelectric points and these complexes can be disrupted by exposure to chelating or reducing agents. These results suggest that the metal itself is participating in rather than catalyzing the formation of a DNA-protein complex. An antiserum which was raised to chromate-induced DNA-protein complexes reacted primarily with a 97,000 protein that could not be detected by silver staining. Western blots and slot blots were utilized to detect p97 DNA-protein complexes formed by cis-platinum, UV, formaldehyde, and chromate. Other work in this area, involving studying whether DNA-protein complexes are formed in actively transcribed DNA compared with genetically inactive DNA, is discussed. Methods to detect DNA-protein complexes, the stability and repair of these lesions, and characterization of DNA-protein complexes are reviewed. Nuclear matrix proteins have been identified as a major substrate for the formation of DNA-protein complexes and these findings are also reviewed.

  5. Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles.

    PubMed

    Liandris, Emmanouil; Gazouli, Maria; Andreadou, Margarita; Comor, Mirjana; Abazovic, Nadica; Sechi, Leonardo A; Ikonomopoulos, John

    2009-09-01

    Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 microl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples.

  6. New approach for direct chemical synthesis of hexagonal Co nanoparticles

    NASA Astrophysics Data System (ADS)

    Abel, Frank M.; Tzitzios, Vasilis; Hadjipanayis, George C.

    2016-02-01

    In this paper, we explore the possibility of producing hexagonal Cobalt nanoparticles, with high saturation magnetization by direct chemical synthesis. The nanoparticles were synthesized by reduction of anhydrous cobalt (II) chloride by NaBH4 in tetraglyme at temperatures in the range of 200-270 °C under a nitrogen-hydrogen atmosphere. The reactions were done at high temperatures to allow for the formation of as-made hexagonal cobalt. The size of the particles was controlled by the addition of different surfactants. The best magnetic properties so far were obtained on spherical hexagonal Co nanoparticles with an average size of 45 nm, a saturation magnetization of 143 emu/g and coercivity of 500 Oe. the saturation magnetization and coercivity were further improved by annealing the Co nanoparticles leading to saturation magnetization of 160 emu/g and coercivity of 540 Oe.

  7. Direct simulations of chemically reacting turbulent mixing layers

    NASA Technical Reports Server (NTRS)

    Riley, J. J.; Metcalfe, R. W.

    1984-01-01

    The report presents the results of direct numerical simulations of chemically reacting turbulent mixing layers. The work consists of two parts: (1) the development and testing of a spectral numerical computer code that treats the diffusion reaction equations; and (2) the simulation of a series of cases of chemical reactions occurring on mixing layers. The reaction considered is a binary, irreversible reaction with no heat release. The reacting species are nonpremixed. The results of the numerical tests indicate that the high accuracy of the spectral methods observed for rigid body rotation are also obtained when diffusion, reaction, and more complex flows are considered. In the simulations, the effects of vortex rollup and smaller scale turbulence on the overall reaction rates are investigated. The simulation results are found to be in approximate agreement with similarity theory. Comparisons of simulation results with certain modeling hypotheses indicate limitations in these hypotheses. The nondimensional product thickness computed from the simulations is compared with laboratory values and is found to be in reasonable agreement, especially since there are no adjustable constants in the method.

  8. Delay chemical master equation: direct and closed-form solutions.

    PubMed

    Leier, Andre; Marquez-Lago, Tatiana T

    2015-07-08

    The stochastic simulation algorithm (SSA) describes the time evolution of a discrete nonlinear Markov process. This stochastic process has a probability density function that is the solution of a differential equation, commonly known as the chemical master equation (CME) or forward-Kolmogorov equation. In the same way that the CME gives rise to the SSA, and trajectories of the latter are exact with respect to the former, trajectories obtained from a delay SSA are exact representations of the underlying delay CME (DCME). However, in contrast to the CME, no closed-form solutions have so far been derived for any kind of DCME. In this paper, we describe for the first time direct and closed solutions of the DCME for simple reaction schemes, such as a single-delayed unimolecular reaction as well as chemical reactions for transcription and translation with delayed mRNA maturation. We also discuss the conditions that have to be met such that such solutions can be derived.

  9. Discovery of small-molecule interleukin-2 inhibitors from a DNA-encoded chemical library.

    PubMed

    Leimbacher, Markus; Zhang, Yixin; Mannocci, Luca; Stravs, Michael; Geppert, Tim; Scheuermann, Jörg; Schneider, Gisbert; Neri, Dario

    2012-06-18

    Libraries of chemical compounds individually coupled to encoding DNA tags (DNA-encoded chemical libraries) hold promise to facilitate exceptionally efficient ligand discovery. We constructed a high-quality DNA-encoded chemical library comprising 30,000 drug-like compounds; this was screened in 170 different affinity capture experiments. High-throughput sequencing allowed the evaluation of 120 million DNA codes for a systematic analysis of selection strategies and statistically robust identification of binding molecules. Selections performed against the tumor-associated antigen carbonic anhydrase IX (CA IX) and the pro-inflammatory cytokine interleukin-2 (IL-2) yielded potent inhibitors with exquisite target specificity. The binding mode of the revealed pharmacophore against IL-2 was confirmed by molecular docking. Our findings suggest that DNA-encoded chemical libraries allow the facile identification of drug-like ligands principally to any protein of choice, including molecules capable of disrupting high-affinity protein-protein interactions.

  10. Direct Evidence for the Formation of Precatenanes during DNA Replication.

    PubMed

    Cebrián, Jorge; Castán, Alicia; Martínez, Víctor; Kadomatsu-Hermosa, Maridian J; Parra, Cristina; Fernández-Nestosa, María José; Schaerer, Christian; Hernández, Pablo; Krimer, Dora B; Schvartzman, Jorge B

    2015-05-29

    The dynamics of DNA topology during replication are still poorly understood. Bacterial plasmids are negatively supercoiled. This underwinding facilitates strand separation of the DNA duplex during replication. Leading the replisome, a DNA helicase separates the parental strands that are to be used as templates. This strand separation causes overwinding of the duplex ahead. If this overwinding persists, it would eventually impede fork progression. In bacteria, DNA gyrase and topoisomerase IV act ahead of the fork to keep DNA underwound. However, the processivity of the DNA helicase might overcome DNA gyrase and topoisomerase IV. It was proposed that the overwinding that builds up ahead of the fork could force it to swivel and diffuse this positive supercoiling behind the fork where topoisomerase IV would also act to maintain replicating the DNA underwound. Putative intertwining of sister duplexes in the replicated region are called precatenanes. Fork swiveling and the formation of precatenanes, however, are still questioned. Here, we used classical genetics and high resolution two-dimensional agarose gel electrophoresis to examine the torsional tension of replication intermediates of three bacterial plasmids with the fork stalled at different sites before termination. The results obtained indicated that precatenanes do form as replication progresses before termination.

  11. Brownian dynamics simulation of directional sliding of histone octamers caused by DNA bending

    NASA Astrophysics Data System (ADS)

    Li, Wei; Dou, Shuo-Xing; Xie, Ping; Wang, Peng-Ye

    2006-05-01

    Chromatin-remodeling complexes such as SWI/SNF and RSC of yeast can perturb the structure of nucleosomes in an ATP-dependent manner. Experimental results prove that this chromatin remodeling process involves DNA bending. We simulate the effect of DNA bending, caused by chromatin-remodeling complexes, on directional sliding of histone octamers by Brownian dynamics simulation. The simulation results show that, after a DNA loop being generated at the side of a nucleosome, the histone octamer slides towards this DNA loop until the loop disappears. The DNA loop size is an important factor affecting the process of directional sliding of the histone octamer.

  12. Chemically directed assembly of nanoparticles for material and biological applications

    NASA Astrophysics Data System (ADS)

    Park, Myoung-Hwan

    The unique electronic, magnetic, and optical properties of nanoparticles (NPs) make them useful building blocks for nanodevices and biofabrication. Site-selective immobilization/deposition of NPs on surfaces at desired positions is an important fabrication step in realizing the potential of nanomaterials in these applications. In this thesis, my research has focused on developing new strategies for mono- and multilayered-NP deposition on surfaces, increasing the stability of NP-assembles upon various surfaces for practical use of NP-based devices. Chemically directed dithiocarbamate binding of amine groups to NPs in the presence of CS2 was used for enhancing the robustness of NP assembles. Such patterning methodologies have allowed me to use site-directed NP immobilization in applications as diverse as microcontact printing, nanomolding in capillaries, nanoimprint lithography, and photolithography. Also, I have developed a simple and reliable one-step technique to form robust dendrimer-NP nanocomposites using dithiocarbamate-based chemistry. These composites are able to encapsulate and release various therapeutics, providing controllable sustained release and to separate small molecules and biomacromolecules.

  13. Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA

    PubMed Central

    Statham, Aaron L.; Robinson, Mark D.; Song, Jenny Z.; Coolen, Marcel W.; Stirzaker, Clare; Clark, Susan J.

    2012-01-01

    The complex relationship between DNA methylation, chromatin modification, and underlying DNA sequence is often difficult to unravel with existing technologies. Here, we describe a novel technique based on high-throughput sequencing of bisulfite-treated chromatin immunoprecipitated DNA (BisChIP-seq), which can directly interrogate genetic and epigenetic processes that occur in normal and diseased cells. Unlike most previous reports based on correlative techniques, we found using direct bisulfite sequencing of Polycomb H3K27me3-enriched DNA from normal and prostate cancer cells that DNA methylation and H3K27me3-marked histones are not always mutually exclusive, but can co-occur in a genomic region-dependent manner. Notably, in cancer, the co-dependency of marks is largely redistributed with an increase of the dual repressive marks at CpG islands and transcription start sites of silent genes. In contrast, there is a loss of DNA methylation in intergenic H3K27me3-marked regions. Allele-specific methylation status derived from the BisChIP-seq data clearly showed that both methylated and unmethylated alleles can simultaneously be associated with H3K27me3 histones, highlighting that DNA methylation status in these regions is not dependent on Polycomb chromatin status. BisChIP-seq is a novel approach that can be widely applied to directly interrogate the genomic relationship between allele-specific DNA methylation, histone modification, or other important epigenetic regulators. PMID:22466171

  14. An Overview of Chemical Processes That Damage Cellular DNA: Spontaneous Hydrolysis, Alkylation, and Reactions with Radicals

    PubMed Central

    Gates, Kent S.

    2009-01-01

    The sequence of heterocyclic bases on the interior of the DNA double helix constitutes the genetic code that drives the operation of all living organisms. With this said, it is not surprising that chemical modification of cellular DNA can have profound biological consequences. Therefore, the organic chemistry of DNA damage is fundamentally important to diverse fields including medicinal chemistry, toxicology, and biotechnology. This review is designed to provide a brief overview of the common types of chemical reactions that lead to DNA damage under physiological conditions. PMID:19757819

  15. Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

    NASA Astrophysics Data System (ADS)

    Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

    1990-09-01

    Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

  16. Obstacles may facilitate and direct DNA search by proteins.

    PubMed

    Marcovitz, Amir; Levy, Yaakov

    2013-05-07

    DNA recognition by DNA-binding proteins (DBPs), which is a pivotal event in most gene regulatory processes, is often preceded by an extensive search for the correct site. A facilitated diffusion process in which a DBP combines three-dimensional diffusion in solution with one-dimensional sliding along DNA has been suggested to explain how proteins can locate their target sites on DNA much faster than predicted by three-dimensional diffusion alone. Although experimental and theoretical studies have recently advanced understanding of the biophysical principles underlying the search mechanism, the process under in vivo cellular conditions is poorly understood. In this study, we used various computational approaches to explore how the presence of obstacle proteins on the DNA influences search efficiency. At a low obstacle occupancy (i.e., when few obstacles occupy sites on the DNA), sliding by the searching DBP may be confined, which may impair search efficiency. The obstacles, however, can be bypassed during hopping events, and the number of bypasses is larger for higher obstacle occupancies. Dynamism on the part of the obstacles may even further facilitate search kinetics. Our study shows that the nature and efficiency of the search process may be governed not only by the intrinsic properties of the DBP and the salt concentration of the medium, but also by the in vivo association of DNA with other macromolecular obstacles, their location, and occupancy.

  17. {beta}-carboline derivatives: Novel photosensitizers that intercalate into DNA to cause direct DNA damage in photodynamic therapy

    SciTech Connect

    Guan Huaji; Liu Xiaodong; Peng Wenlie; Cao Rihui; Ma Yan; Chen Hongsheng; Xu Anlong . E-mail: ls36@zsu.edu.cn

    2006-04-14

    Novel 1,3,9-trisubstituted {beta}-carboline derivatives were found to exhibit DNA photocleavage properties under visible light irradiation in a cell-free system, which could be reduced by antioxidant vitamin E. Their photo-cytotoxicity to human tumor cell line HeLa was confirmed, in which apoptosis only contributed a small part to the cell death, and necrosis was the dominating outcome of HeLa cells in photodynamic therapy (PDT) using {beta}-carboline derivatives. Different from other clinical PDT drugs, {beta}-carboline derivatives were demonstrated to be able to distribute in the nucleus and intercalate into DNA, and consequently cause direct DNA damage by photochemical reaction products in PDT, which was proved by the distinct DNA tails in the comet assay and the considerable amount of DNA damaged cells quantified by flow cytometry. This mechanism could be the explanation for the delay of cell proliferation at DNA synthesis and mitosis.

  18. High-throughput STR analysis for DNA database using direct PCR.

    PubMed

    Sim, Jeong Eun; Park, Su Jeong; Lee, Han Chul; Kim, Se-Yong; Kim, Jong Yeol; Lee, Seung Hwan

    2013-07-01

    Since the Korean criminal DNA database was launched in 2010, we have focused on establishing an automated DNA database profiling system that analyzes short tandem repeat loci in a high-throughput and cost-effective manner. We established a DNA database profiling system without DNA purification using a direct PCR buffer system. The quality of direct PCR procedures was compared with that of conventional PCR system under their respective optimized conditions. The results revealed not only perfect concordance but also an excellent PCR success rate, good electropherogram quality, and an optimal intra/inter-loci peak height ratio. In particular, the proportion of DNA extraction required due to direct PCR failure could be minimized to <3%. In conclusion, the newly developed direct PCR system can be adopted for automated DNA database profiling systems to replace or supplement conventional PCR system in a time- and cost-saving manner.

  19. Direct optical visualization of DNA-DNA interaction by nanoparticle-capture on resonant PET-films.

    PubMed

    Bauer, Maria; Haglmüller, Jakob; Pittner, Fritz; Schalkhammer, Thomas

    2006-12-01

    Based on the understanding of the absorption behavior of metal nanoparticles we aimed at the direct detection of sub-monomolecular layers of DNA with the naked eye. This extremely sensitive detection needs optical amplification techniques to be used in replacement of nanoparticle-aggregates applied e.g., in agglutination assays. We focus on the nanolayer-coated metallized-PET-chip setup and on the synthesis of DNA-nanoparticle conjugates suitable for 'resonance enhanced absorption'-point of care-tests and the application of those particles in the direct visualization of DNA-DNA binding events. Stabilization of nanoparticles and their sequence specific binding was proven with direct optical visibility of sub-monolayers of colored nanoclusters. Synthetic routes leading to suitable conjugates as well as stability tests and a biorecognition test are described in detail adding to the repertoire of tools that contribute to the application of nanoparticles in novel nano-enhanced devices.

  20. Construction of a DNA Nano-Object Directly Demonstrates Computation

    PubMed Central

    Wu, Gang; Jonoska, Natasha; Seeman, Nadrian C.

    2009-01-01

    We demonstrate a computing method in which a DNA nano-object representing the solution of a problem emerges as a result of self-assembly. We report an experiment in which three-vertex colorability for a 6-vertex graph with 9 edges is solved by constructing a DNA molecule representing the colored graph itself. Our findings show that computation based on “shape processing” is a viable alternative to symbol processing when computing by molecular self-assembly. PMID:19607875

  1. Fabrication of Ultrasensitive Field-Effect Transistor DNA Biosensors by a Directional Transfer Technique Based on CVD-Grown Graphene.

    PubMed

    Zheng, Chao; Huang, Le; Zhang, Hong; Sun, Zhongyue; Zhang, Zhiyong; Zhang, Guo-Jun

    2015-08-12

    Most graphene field-effect transistor (G-FET) biosensors are fabricated through a routine process, in which graphene is transferred onto a Si/SiO2 substrate and then devices are subsequently produced by micromanufacture processes. However, such a fabrication approach can introduce contamination onto the graphene surface during the lithographic process, resulting in interference for the subsequent biosensing. In this work, we have developed a novel directional transfer technique to fabricate G-FET biosensors based on chemical-vapor-deposition- (CVD-) grown single-layer graphene (SLG) and applied this biosensor for the sensitive detection of DNA. A FET device with six individual array sensors was first fabricated, and SLG obtained by the CVD-growth method was transferred onto the sensor surface in a directional manner. Afterward, peptide nucleic acid (PNA) was covalently immobilized on the graphene surface, and DNA detection was realized by applying specific target DNA to the PNA-functionalized G-FET biosensor. The developed G-FET biosensor was able to detect target DNA at concentrations as low as 10 fM, which is 1 order of magnitude lower than those reported in a previous work. In addition, the biosensor was capable of distinguishing the complementary DNA from one-base-mismatched DNA and noncomplementary DNA. The directional transfer technique for the fabrication of G-FET biosensors is simple, and the as-constructed G-FET DNA biosensor shows ultrasensitivity and high specificity, indicating its potential application in disease diagnostics as a point-of-care tool.

  2. Direct measurement of the dielectric polarization properties of DNA

    PubMed Central

    Cuervo, Ana; Dans, Pablo D.; Carrascosa, José L.; Orozco, Modesto; Gomila, Gabriel; Fumagalli, Laura

    2014-01-01

    The electric polarizability of DNA, represented by the dielectric constant, is a key intrinsic property that modulates DNA interaction with effector proteins. Surprisingly, it has so far remained unknown owing to the lack of experimental tools able to access it. Here, we experimentally resolved it by detecting the ultraweak polarization forces of DNA inside single T7 bacteriophages particles using electrostatic force microscopy. In contrast to the common assumption of low-polarizable behavior like proteins (εr ∼ 2–4), we found that the DNA dielectric constant is ∼8, considerably higher than the value of ∼3 found for capsid proteins. State-of-the-art molecular dynamic simulations confirm the experimental findings, which result in sensibly decreased DNA interaction free energy than normally predicted by Poisson–Boltzmann methods. Our findings reveal a property at the basis of DNA structure and functions that is needed for realistic theoretical descriptions, and illustrate the synergetic power of scanning probe microscopy and theoretical computation techniques. PMID:25136104

  3. MALS: an efficient strategy for multiple site-directed mutagenesis employing a combination of DNA amplification, ligation and suppression PCR

    PubMed Central

    Fushan, Alexey A; Drayna, Dennis T

    2009-01-01

    Background Multiple approaches for the site-directed mutagenesis (SDM) have been developed. However, only several of them are designed for simultaneous introduction of multiple nucleotide alterations, and these are time consuming. In addition, many of the existing multiple SDM methods have technical limitations associated with type and number of mutations that can be introduced, or are technically demanding and require special chemical reagents. Results In this study we developed a quick and efficient strategy for introduction of multiple complex mutations in a target DNA without intermediate subcloning by using a combination of connecting SDM and suppression PCR. The procedure consists of sequential rounds, with each individual round including PCR amplification of target DNA with two non-overlapping pairs of oligonucleotides. The desired mutation is incorporated at the 5' end of one or both internal oligonucleotides. DNA fragments obtained during amplification are mixed and ligated. The resulting DNA mixture is amplified with external oligonucleotides that act as suppression adapters. Suppression PCR limits amplification to DNA molecules representing full length target DNA, while amplification of other types of molecules formed during ligation is suppressed. To create additional mutations, an aliquot of the ligation mixture is then used directly for the next round of mutagenesis employing internal oligonucleotides specific for another region of target DNA. Conclusion A wide variety of complex multiple mutations can be generated in a short period of time. The procedure is rapid, highly efficient and does not require special chemical reagents. Thus, MALS represents a powerful alternative to the existing methods for multiple SDM. PMID:19778447

  4. Cell specificity in DNA binding and repair of chemical carcinogens.

    PubMed Central

    Swenberg, J A; Rickert, D E; Baranyi, B L; Goodman, J I

    1983-01-01

    Many animal models for organ specific neoplasia have been developed and used to study the pathogenesis of cancer. Morphologic studies have usually concentrated on the response of target cells, whereas biochemical investigations have usually employed whole organ homogenates. Since hepatocytes comprise nearly 90% of the liver's mass and 70-80% of its DNA, alterations in DNA replication, covalent binding and DNA repair of nonparenchymal cells are usually obscured when whole organ homogenates are used. By utilizing cell separation methods, we have been able to demonstrate differences between hepatocyte and nonparenchymal cell replication. DNA damage and repair following exposure to a variety of hepatocarcinogen. Differences in removal of simple O6-alkylguanine and DNA replication correlate with cell specific carcinogenesis of simply alkylating agents. For several other procarcinogens, including 2-acetylaminofluorene and dinitroluene, cell specificity appears to reside primarily in the differential metabolic competence of hepatocytes and nonparenchymal cells. This results in greater covalent binding of the carcinogen to hepatocyte DNA, although the DNA adducts are removed at a similar rate in both cell types. Images FIGURE 1. PMID:6832089

  5. Chemical proteomics reveals a γH2AX-53BP1 interaction in the DNA damage response

    PubMed Central

    Kleiner, Ralph E.; Verma, Priyanka; Molloy, Kelly R.; Chait, Brian T.; Kapoor, Tarun M.

    2015-01-01

    DNA double-strand break repair involves phosphorylation of histone variant H2AX (‘γH2AX’), which accumulates in foci at sites of damage. In current models, the recruitment of multiple DNA repair proteins to γH2AX foci depends mainly on recognition of this ‘mark’ by a single protein, MDC1. However, DNA repair proteins accumulate at γH2AX sites without MDC1, suggesting that other ‘readers’ exist. Here, we use a quantitative chemical proteomics approach to profile direct, phospho-selective γH2AX binders in native proteomes. We identify γH2AX binders, including the DNA repair mediator, 53BP1, which we show recognizes γH2AX through its BRCT domains. Furthermore, we investigate targeting of wild-type 53BP1 or a mutant form deficient in γH2AX binding, to chromosomal breaks resulting from endogenous and exogenous DNA damage. Our results show how direct recognition of γH2AX modulates protein localization at DNA damage sites, and suggest how specific chromatin ‘mark’-‘reader’ interactions contribute to essential mechanisms ensuring genome stability. PMID:26344695

  6. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis

    SciTech Connect

    Stella, Stefano; Cascio, Duilio; Johnson, Reid C.

    2010-06-21

    The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of {approx}65{sup o}, and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.

  7. Direct chemical oxidation: applications to demilitarization and decontamination

    SciTech Connect

    Cooper, J.F.; Balazs, B.; Lewis, P.

    1998-04-01

    The applicability of using aqueous solutions of sodium peroxydisulfate in the destruction of mustard gas surrogates has been demonstrated. This technique, known as Direct Chemical Oxidation (DCO), resulted in oxidative destruction of these surrogates, and a refinement was added to prevent the formation of slow-to-oxidize intermediates. Specifically, it was shown that `one-armed mustard` gas could be hydrolyzed to thiodiethanol and free chloride ion, and this species could then be partially oxidized to either the sulfoxide or sulfone depending on oxidant stoichiometry. Hydrolysis was accomplished on a mild basic solution at ambient temperature over a number of hours; oxidation was carried out at 90{degrees}C using peroxydisulfate solutions, Partial oxidation of thiodiethanol in the presence of chloride under basic conditions resulted in a a substantially pure mixture of the corresponding sulfone and sulfoxide, with no formation of chlorine gas. Analogous experiments in acid solutions produced a more complex mix of products and some oxidant was consumed in the evolution of chlorine. Complete destruction of the surrogates (to ppm level of detection) was achieved in either acid or base solution with less than a 7-fold excess of oxidant.

  8. Physical controls on directed virus assembly at nanoscale chemical templates

    SciTech Connect

    Cheung, C L; Chung, S; Chatterji, A; Lin, T; Johnson, J E; Hok, S; Perkins, J; De Yoreo, J

    2006-05-10

    Viruses are attractive building blocks for nanoscale heterostructures, but little is understood about the physical principles governing their directed assembly. In-situ force microscopy was used to investigate organization of Cowpea Mosaic Virus engineered to bind specifically and reversibly at nanoscale chemical templates with sub-30nm features. Morphological evolution and assembly kinetics were measured as virus flux and inter-viral potential were varied. The resulting morphologies were similar to those of atomic-scale epitaxial systems, but the underlying thermodynamics was analogous to that of colloidal systems in confined geometries. The 1D templates biased the location of initial cluster formation, introduced asymmetric sticking probabilities, and drove 1D and 2D condensation at subcritical volume fractions. The growth kinetics followed a t{sup 1/2} law controlled by the slow diffusion of viruses. The lateral expansion of virus clusters that initially form on the 1D templates following introduction of polyethylene glycol (PEG) into the solution suggests a significant role for weak interaction.

  9. Theoretical studies of chemical reactivity of metabolically activated forms of aromatic amines toward DNA.

    PubMed

    Shamovsky, Igor; Ripa, Lena; Blomberg, Niklas; Eriksson, Leif A; Hansen, Peter; Mee, Christine; Tyrchan, Christian; O'Donovan, Mike; Sjö, Peter

    2012-10-15

    The metabolism of aromatic and heteroaromatic amines (ArNH₂) results in nitrenium ions (ArNH⁺) that modify nucleobases of DNA, primarily deoxyguanosine (dG), by forming dG-C8 adducts. The activated amine nitrogen in ArNH⁺ reacts with the C8 of dG, which gives rise to mutations in DNA. For the most mutagenic ArNH₂, including the majority of known genotoxic carcinogens, the stability of ArNH⁺ is of intermediate magnitude. To understand the origin of this observation as well as the specificity of reactions of ArNH⁺ with guanines in DNA, we investigated the chemical reactivity of the metabolically activated forms of ArNH₂, that is, ArNHOH and ArNHOAc, toward 9-methylguanine by DFT calculations. The chemical reactivity of these forms is determined by the rate constants of two consecutive reactions leading to cationic guanine intermediates. The formation of ArNH⁺ accelerates with resonance stabilization of ArNH⁺, whereas the formed ArNH⁺ reacts with guanine derivatives with the constant diffusion-limited rate until the reaction slows down when ArNH⁺ is about 20 kcal/mol more stable than PhNH⁺. At this point, ArNHOH and ArNHOAc show maximum reactivity. The lowest activation energy of the reaction of ArNH⁺ with 9-methylguanine corresponds to the charge-transfer π-stacked transition state (π-TS) that leads to the direct formation of the C8 intermediate. The predicted activation barriers of this reaction match the observed absolute rate constants for a number of ArNH⁺. We demonstrate that the mutagenic potency of ArNH₂ correlates with the rate of formation and the chemical reactivity of the metabolically activated forms toward the C8 atom of dG. On the basis of geometric consideration of the π-TS complex made of genotoxic compounds with long aromatic systems, we propose that precovalent intercalation in DNA is not an essential step in the genotoxicity pathway of ArNH₂. The mechanism-based reasoning suggests rational design strategies to

  10. In vivo covalent binding of organic chemicals to DNA as a quantitative indicator in the process of chemical carcinogenesis.

    PubMed

    Lutz, W K

    1979-12-01

    The covalent binding of chemical carcinogens to DNA of mammalian organs is expressed per unit dose, and a 'Covalent-Binding Index', CBI, is defined. CBI for various carcinogens span over 6 orders of magnitude. A similar range is observed for the carcinogenic potency in long-term bioassays on carcinogenicity. For the assessment of a risk from exposure to a carcinogen, the total DNA dmaage can be estimated if the actual dose is also accounted for. A detailed description is given for planning and performing a DNA-binding assay. A complete literature survey on DNA binding in vivo (83 compounds) is given with a calculation of CBI, where possible, 153 compounds are listed where a covalent binding to any biological macromolecule has been shown in vivo or in vitro. Recent, so far unpublished findings with aflatoxin M1, macromolecule-bound aflatoxin B1, diethylstilbestrol, and 1,2-epithiobutyronitrile are included. A comparison of CBI for rat-liver DNA with hepatocarcinogenic potency reveals a surprisingly good quantitative correlation. Refinements for a DNA-binding assay are proposed. Possibilites and limitations in the use of DNA binding in chemical carcinogenesis are discussed extensively.

  11. Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds

    SciTech Connect

    Claridge, Shelley A.; Goh, Sarah L.; Frechet, Jean M.J.; Williams, Shara C.; Micheel, Christine M.; Alivisatos, A. Paul

    2004-09-14

    The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures with increasing numbers of hybridization events. Samples extracted from each band are analyzed by transmission electron microscopy, and statistics compiled from micrographs are used to compare assembly characteristics for each architecture. Asymmetric structures are also produced in which both 5 and 10 nm Au particles are assembled on branched scaffolds.

  12. Recent advances on the encoding and selection methods of DNA-encoded chemical library.

    PubMed

    Shi, Bingbing; Zhou, Yu; Huang, Yiran; Zhang, Jianfu; Li, Xiaoyu

    2017-02-01

    DNA-encoded chemical library (DEL) has emerged as a powerful and versatile tool for ligand discovery in chemical biology research and in drug discovery. Encoding and selection methods are two of the most important technological aspects of DEL that can dictate the performance and utilities of DELs. In this digest, we have summarized recent advances on the encoding and selection strategies of DEL and also discussed the latest developments on DNA-encoded dynamic library, a new frontier in DEL research.

  13. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  14. High-throughput sequencing for the identification of binding molecules from DNA-encoded chemical libraries.

    PubMed

    Buller, Fabian; Steiner, Martina; Scheuermann, Jörg; Mannocci, Luca; Nissen, Ina; Kohler, Manuel; Beisel, Christian; Neri, Dario

    2010-07-15

    DNA-encoded chemical libraries are large collections of small organic molecules, individually coupled to DNA fragments that serve as amplifiable identification bar codes. The isolation of specific binders requires a quantitative analysis of the distribution of DNA fragments in the library before and after capture on an immobilized target protein of interest. Here, we show how Illumina sequencing can be applied to the analysis of DNA-encoded chemical libraries, yielding over 10 million DNA sequence tags per flow-lane. The technology can be used in a multiplex format, allowing the encoding and subsequent sequencing of multiple selections in the same experiment. The sequence distributions in DNA-encoded chemical library selections were found to be similar to the ones obtained using 454 technology, thus reinforcing the concept that DNA sequencing is an appropriate avenue for the decoding of library selections. The large number of sequences obtained with the Illumina method now enables the study of very large DNA-encoded chemical libraries (>500,000 compounds) and reduces decoding costs.

  15. Cleavage enhancement of specific chemical bonds in DNA-Cisplatin complexes induced by X-rays

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Yao, Xiaobin; Luo, Xinglan; Fu, Xianzhi

    2014-04-01

    The chemical bond transformation of cisplatin-DNA complexes can be probed efficiently by XPS which provides a concomitant X-ray irradiation source as well. The presence to Pt could considerably increase formation of the SE induced by X-ray and that the further interaction of these LEE with DNA leads to the enhancement of bond cleavages.

  16. Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA.

    PubMed

    Yoshida, Hiroyuki; Nishikawa, Makiya; Yasuda, Sachiyo; Toyota, Hiroyasu; Kiyota, Tsuyoshi; Takahashi, Yuki; Takakura, Yoshinobu

    2012-10-01

    Fibronectin (FN) is known to have four DNA-binding domains although their physiological significance is unknown. Primary murine peritoneal macrophages have been shown to exhibit markedly lower responsiveness to CpG motif-replete plasmid DNA (pDNA), Toll-like receptor-9 (TLR9) ligand, compared with murine macrophage-like cell lines. The present study was conducted to examine whether FN having DNA-binding domains is involved in this phenomenon. The expression of FN was significantly higher in primary macrophages than in a macrophage-like cell line, RAW264.7, suggesting that abundant FN might suppress the responsiveness in the primary macrophages. However, electrophoretic analysis revealed that FN did not bind to pDNA in the presence of a physiological concentration of divalent cations. Surprisingly, marked tumor necrosis factor - (TNF-)α production from murine macrophages upon CpG DNA stimulation was significantly reduced by exogenously added FN in a concentration-dependent manner but not by BSA, laminin or collagen. FN did not affect apparent pDNA uptake by the cells. Moreover, FN reduced TNF-α production induced by polyI:C (TLR3 ligand), and imiquimod (TLR7 ligand), but not by LPS (TLR4 ligand), or a non-CpG pDNA/cationic liposome complex. The confocal microscopic study showed that pDNA was co-localized with FN in the same intracellular compartment in RAW264.7, suggesting that FN inhibits cytokine signal transduction in the endosomal/lysosomal compartment. Taken together, the results of the present study has revealed, for the first time, a novel effect of FN whereby the glycoprotein modulates cytokine signal transduction via CpG-DNA/TLR9 interaction in macrophages without direct binding to DNA through its putative DNA-binding domains.

  17. Direct observation of DNA threading in flap endonuclease complexes

    PubMed Central

    AlMalki, Faizah A; Flemming, Claudia S; Zhang, Jing; Feng, Min; Sedelnikova, Svetlana E; Ceska, Tom; Rafferty, John B; Sayers, Jon R; Artymiuk, Peter J

    2016-01-01

    Maintenance of genome integrity requires that branched nucleic acid molecules are accurately processed to produce double-helical DNA. Flap endonucleases are essential enzymes that trim such branched molecules generated by Okazaki fragment synthesis during replication. Here, we report crystal structures of bacteriophage T5 flap endonuclease in complexes with intact DNA substrates, and products, at resolutions of 1.9–2.2 Å. They reveal single-stranded DNA threading through a hole in the enzyme enclosed by an inverted V-shaped helical arch straddling the active site. Residues lining the hole induce an unusual barb-like conformation in the DNA substrate juxtaposing the scissile phosphate and essential catalytic metal ions. A series of complexes and biochemical analyses show how the substrate’s single-stranded branch approaches, threads through, and finally emerges on the far side of the enzyme. Our studies suggest that substrate recognition involves an unusual “fly-casting, thread, bend and barb” mechanism. PMID:27273516

  18. Synthesis of Sindbis virus complementary DNA by avian myeloblastosis virus RNA-directed DNA polymerase.

    PubMed

    Yuferov, V; Grandgenett, D P; Bondurant, M; Riggin, C; Tigges, M

    1978-07-24

    Sindbis virus 42 S RNA was efficiently transcribed into complementary DNA (CDNA) by avian myeloblastosis virus alphabeta DNA polymerase using oligo- (dT) or single-stranded calf thymus DNA as primers. Both of the Sindbis virus cDNA products were able to protect 60% of 125I-labeled Sindbis virus RNA, at near equal weight ratios, from RNAase A and T1 digestion. Using hybridization kinetics, the Crt 1/2 value for hybridization of the calf thymus-primed cDNA product with excess Sindbis RNA was determined to be 1.8 9 10-2 mol . s . 1-1. Thes data demonstrate that the Sindbis virus cDNA products are relatively uniform representations of Sindbis virus RNA sequences.

  19. Mechano-chemical kinetics of DNA replication: identification of the translocation step of a replicative DNA polymerase

    PubMed Central

    Morin, José A.; Cao, Francisco J.; Lázaro, José M.; Arias-Gonzalez, J. Ricardo; Valpuesta, José M.; Carrascosa, José L.; Salas, Margarita; Ibarra, Borja

    2015-01-01

    During DNA replication replicative polymerases move in discrete mechanical steps along the DNA template. To address how the chemical cycle is coupled to mechanical motion of the enzyme, here we use optical tweezers to study the translocation mechanism of individual bacteriophage Phi29 DNA polymerases during processive DNA replication. We determine the main kinetic parameters of the nucleotide incorporation cycle and their dependence on external load and nucleotide (dNTP) concentration. The data is inconsistent with power stroke models for translocation, instead supports a loose-coupling mechanism between chemical catalysis and mechanical translocation during DNA replication. According to this mechanism the DNA polymerase works by alternating between a dNTP/PPi-free state, which diffuses thermally between pre- and post-translocated states, and a dNTP/PPi-bound state where dNTP binding stabilizes the post-translocated state. We show how this thermal ratchet mechanism is used by the polymerase to generate work against large opposing loads (∼50 pN). PMID:25800740

  20. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... chemical test. 95.035 Section 95.035 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer or a marine employer may direct an individual operating a vessel to undergo a chemical test...

  1. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.

    PubMed

    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J

    2015-06-15

    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  2. Short direct repeats flank the T-DNA on a nopaline Ti plasmid

    PubMed Central

    Yadav, Narendra S.; Vanderleyden, Jos; Bennett, Donald R.; Barnes, Wayne M.; Chilton, Mary-Dell

    1982-01-01

    Crown gall disease results from the insertion of a segment of the Agrobacterium Ti plasmid, called T-DNA, into host plant nuclear DNA. We have subjected to sequence analysis the border regions of pTi T37 (ends of T-DNA) and one left T-DNA/plant DNA border fragment isolated from BT37 tobacco teratoma by molecular cloning. These sequence studies, taken together with published sequence of a right T-DNA/plant DNA border fragment, allowed us to identify the positions of left and right borders at the DNA sequence level. Comparison of left and right border regions of the Ti plasmid revealed a “core” direct repeat of 13 of 14 bases (12 contiguous) precisely at the borders of T-DNA. An extended repeat of 21 of 25 bases overlaps this core repeat. T-DNA on the Ti plasmid exhibits no longer direct or inverted repeats in the border regions, based on Southern hybridization studies. The physical structure of T-DNA differs from that of known prokaryotic and eukaryotic transposable elements but bears a structural resemblance to the prophage of bacteriophage λ. Images PMID:16593241

  3. Physisorption of DNA molecules on chemically modified single-walled carbon nanotubes with and without sonication.

    PubMed

    Umemura, Kazuo; Ishibashi, Yu; Oura, Shusuke

    2016-09-01

    We investigated the physisorption phenomenon of single-stranded DNA (ssDNA) molecules onto two types of commercially available chemically functionalized single-walled carbon nanotubes (SWNTs) by atomic force microscopy (AFM) and agarose gel electrophoresis. We found that DNA molecules can adsorb on the water-soluble SWNT surfaces without sonication, although sonication treatment has been used for hybridization of DNA and SWNTs in many previous studies. Using our method, damage of DNA molecules by sonication can be avoided. On the other hand, the amount of DNA molecules adsorbed on SWNT surfaces increased when the samples were sonicated. This fact suggests that the sonication is effective not only at debundling of SWNTs, but also at assisting DNA adsorption. Furthermore, DNA adsorption was affected by the types of functionalized SWNTs. In the case of SWNTs functionalized with polyethylene glycol (PEG-SWNT), physisorption of ssDNA molecules was confirmed only by agarose-gel electrophoresis. In contrast, amino-terminated SWNTs (NH2-SWNTs) showed a change in the height distribution profile based on AFM observations. These results suggest that DNA molecules tended to adsorb to NH2-SWNT surfaces, although DNA molecules can also adsorb on PEG-SWNT surfaces. Our results revealed fundamental information for developing nanobiodevices using hybrids of DNA and SWNTs.

  4. GADD45α inhibition of DNMT1 dependent DNA methylation during homology directed DNA repair

    PubMed Central

    Lee, Bongyong; Morano, Annalisa; Porcellini, Antonio; Muller, Mark T.

    2012-01-01

    In this work, we examine regulation of DNA methyltransferase 1 (DNMT1) by the DNA damage inducible protein, GADD45α. We used a system to induce homologous recombination (HR) at a unique double-strand DNA break in a GFP reporter in mammalian cells. After HR, the repaired DNA is hypermethylated in recombinant clones showing low GFP expression (HR-L expressor class), while in high expressor recombinants (HR-H clones) previous methylation patterns are erased. GADD45α, which is transiently induced by double-strand breaks, binds to chromatin undergoing HR repair. Ectopic overexpression of GADD45α during repair increases the HR-H fraction of cells (hypomethylated repaired DNA), without altering the recombination frequency. Conversely, silencing of GADD45α increases methylation of the recombined segment and amplifies the HR-L expressor (hypermethylated) population. GADD45α specifically interacts with the catalytic site of DNMT1 and inhibits methylation activity in vitro. We propose that double-strand DNA damage and the resulting HR process involves precise, strand selected DNA methylation by DNMT1 that is regulated by GADD45α. Since GADD45α binds with high avidity to hemimethylated DNA intermediates, it may also provide a barrier to spreading of methylation during or after HR repair. PMID:22135303

  5. Photo-Induced Click Chemistry for DNA Surface Structuring by Direct Laser Writing.

    PubMed

    Kerbs, Antonina; Mueller, Patrick; Kaupp, Michael; Ahmed, Ishtiaq; Quick, Alexander S; Abt, Doris; Wegener, Martin; Niemeyer, Christof M; Barner-Kowollik, Christopher; Fruk, Ljiljana

    2017-02-15

    Oligonucleotides containing photo-caged dienes were prepared and shown to react quantitatively in a light-induced Diels-Alder cycloaddition with functional maleimides in aqueous solution within minutes. Due to its high yield and fast rate, the reaction was exploited for DNA surface patterning with sub-micrometer resolution employing direct laser writing (DLW). Functional DNA arrays were written by direct laser writing (DLW) in variable patterns, which were further encoded with fluorophores and proteins through DNA directed immobilization. This mild and efficient light-driven platform technology holds promise for the fabrication of complex bioarrays with sub-micron resolution.

  6. DNA-directed aniline mustards based on 9-aminoacridine: interaction with DNA.

    PubMed

    O'Connor, C J; Denny, W A; Fan, J Y; Gamage, R S

    1992-11-30

    A series of 4-substituted aniline mustards ArNH(CH2)nOpC6H4N(CH2CH2Cl)2, where Ar is an acridine and n varies from 2 to 5, interact with DNA. Scatchard analysis shows the compounds bind tightly, with a binding site size similar to that of 9-aminoacridine. The rate of hydrolysis of the mustards, measured by HPLC, is essentially constant across the series. With increasing length of the polymethylene linker, non-covalent binding becomes less strong, but the rate of DNA alkylation increases. Viscometric helix extension measurements and electrophoretic analyses using closed circular supercoiled DNA show that all the compounds are DNA intercalating ligands. Despite these similarities, the compounds are known to have quite different patterns of DNA alkylation, switching from guanine to adenine alkylation as the chain length is extended.

  7. New directions: Atmospheric chemical mechanisms for the future

    EPA Science Inventory

    The chemical reaction scheme or mechanism used to represent atmospheric chemical reactions is at the heart of each air quality model used in research and policy applications to predict and analyse the complex air pollutants: ozone, air toxics and PM2.5. This is necessarily only a...

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA

    PubMed Central

    Hayner, Jaclyn N.; Douma, Lauren G.; Bloom, Linda B.

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3′OH (3′DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3′DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5′phosphate (5′P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5′DNA). The 5′P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3′DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5′DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3′DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. PMID:25159615

  9. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    PubMed Central

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  10. DNA interstrand cross-links of an antitumor trinuclear platinum(II) complex: thermodynamic analysis and chemical probing.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2011-06-06

    The trinuclear platinum compound [{trans-PtCl(NH(3))(2)}(2)(μ-trans-Pt(NH(3))(2){NH(2)(CH(2))(6)NH(2)}(2))](4+) (BBR3464) belongs to the polynuclear class of platinum-based anticancer agents. These agents form in DNA long-range (Pt,Pt) interstrand cross-links, whose role in the antitumor effects of BBR3464 predominates. Our results show for the first time that the interstrand cross-links formed by BBR3464 between two guanine bases in opposite strands separated by two base pairs (1,4-interstrand cross-links) exist as two distinct conformers, which are not interconvertible, not only if these cross-links are formed in the 5'-5', but also in the less-usual 3'-3' direction. Analysis of the conformers by differential scanning calorimetry, chemical probes of DNA conformation, and minor groove binder Hoechst 33258 demonstrate that each of the four conformers affects DNA in a distinctly different way and adopts a different conformation. The results also support the thesis that the molecule of antitumor BBR3464 when forming DNA interstrand cross-links may adopt different global structures, including different configurations of the linker chain of BBR3464 in the minor groove of DNA. Our findings suggest that the multiple DNA interstrand cross-links available to BBR3464 may all contribute substantially to its cytotoxicity.

  11. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    PubMed

    Azeroglu, Benura; Mawer, Julia S P; Cockram, Charlotte A; White, Martin A; Hasan, A M Mahedi; Filatenkova, Milana; Leach, David R F

    2016-02-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  12. Unravelling Microbial Communities with DNA-Microarrays: Challengesand Future Directions.

    SciTech Connect

    Wagner, Michael; Smidt, Hauke; Loy, Alexander; Zhou, Jizhong

    2007-03-08

    High-throughput technologies are urgently needed formonitoring the formidable biodiversity and functional capabilities ofmicroorganisms in the environment. Ten years ago, DNA microarrays,miniaturized platforms for highly parallel hybridization reactions, foundtheir way into environmental microbiology and raised great expectationsamong researchers in the field. In this article, we briefly summarize thestate-of-the-art of microarray approaches in microbial ecology researchand discuss in more detail crucial problems and promising solutions.Finally, we outline scenarios for an innovative combination ofmicroarrays with other molecular tools for structure-function analysis ofcomplex microbial communities.

  13. Cleavage enhancement of specific chemical bonds in DNA by cisplatin radiosensitization.

    PubMed

    Xiao, Fangxing; Luo, Xinglan; Fu, Xianzhi; Zheng, Yi

    2013-05-02

    X-ray photoelectron spectroscopy (XPS) is harnessed as an in situ efficient characterization technique for monitoring chemical bond transformation in DNA and cisplatin-DNA complexes under synergic X-ray irradiation. By analyzing the variation of relative peak area of core elements of DNA as a function of irradiation time, we find that the most vulnerable scission sites in DNA are those containing phosphate and glycosidic bonds. Compared to DNA, the effective rate constants of the corresponding phosphodiester and glycosidic bond cleavages for cisplatin-DNA complexes are 1.8 and 1.9 folds larger. These damages and their enhancements are similar to those induced by low energy electrons (LEE). Consistently, the magnitude of the secondary electron distribution produced by the X-rays on the cisplatin-DNA complexes is considerably increased compared to that of pristine DNA. The data suggest that DNA radiosensization by cisplatin results not only from the sensitization of DNA to the action of LEE, but also from an increase the production of LEE at the site of binding of the cisplatin. The results provide new insights into the mechanisms of cisplatin-induced sensitization of DNA under X-ray irradiation, which could be helpful in the design of new cisplatin-based antitumor drugs.

  14. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    PubMed

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  15. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    NASA Astrophysics Data System (ADS)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  16. DNA variant databases: current state and future directions.

    PubMed

    Plazzer, John-Paul; Macrae, Finlay

    2014-01-01

    In this chapter we aim to provide an overview of DNA variant databases, commonly known as Locus-Specific Databases (LSDBs), or Gene-Disease Specific Databases (GDSDBs), but the term variant database will be used for simplicity. We restrict this overview to germ-line variants, particularly as related to Mendelian diseases, which are diseases caused by a variant in a single gene. Common difficulties associated with variant databases and some proposed solutions are reviewed. Finally, systems where technical solutions have been implemented are discussed. This work will be useful for anyone wishing to establish their own variant database, or to learn about the global picture of variant databases, and the technical challenges to be overcome.

  17. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism.

  18. 'Direct PCR' optimization yields a rapid, cost-effective, nondestructive and efficient method for obtaining DNA barcodes without DNA extraction.

    PubMed

    Wong, Wing Hing; Tay, Ywee Chieh; Puniamoorthy, Jayanthi; Balke, Michael; Cranston, Peter S; Meier, Rudolf

    2014-11-01

    Macroinvertebrates that are collected in large numbers pose major problems in basic and applied biodiversity research: identification to species via morphology is often difficult, slow and/or expensive. DNA barcodes are an attractive alternative or complementary source of information. Unfortunately, obtaining DNA barcodes from specimens requires many steps and thus time and money. Here, we promote a short cut to DNA barcoding, that is, a nondestructive PCR method that skips DNA extraction ('direct PCR') and that can be used for a broad range of invertebrate taxa. We demonstrate how direct PCR can be optimized for the larvae and adults of nonbiting midges (Diptera: Chironomidae), a typical invertebrate group that is abundant, contains important bioindicator species, but is difficult to identify based on morphological features. After optimization, direct PCR yields high PCR success rates (>90%), preserves delicate morphological features (e.g. details of genitalia, and larval head capsules) while allowing for the recovery of genomic DNA. We also document that direct PCR can be successfully optimized for a wide range of other invertebrate taxa that need routine barcoding (flies: Culicidae, Drosophilidae, Dolichopodidae, Sepsidae; sea stars: Oreasteridae). Key for obtaining high PCR success rates is optimizing (i) tissue quantity, (ii) body part, (iii) primer pair and (iv) type of Taq polymerase. Unfortunately, not all invertebrates appear suitable because direct PCR has low success rates for other taxa that were tested (e.g. Coleoptera: Dytiscidae, Copepoda, Hymenoptera: Formicidae and Odonata). It appears that the technique is less successful for heavily sclerotized insects and/or those with many exocrine glands.

  19. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer... directed to undergo a test as soon as is practicable. (c) When practicable, a marine employer should base...

  20. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer... directed to undergo a test as soon as is practicable. (c) When practicable, a marine employer should base...

  1. Programming macro-materials from DNA-directed self-assembly.

    PubMed

    Zhang, Xuena; Wang, Rong; Xue, Gi

    2015-03-14

    DNA is a powerful tool that can be attached to nano- and micro-objects and direct the self-assembly through base pairing. Since the strategy of DNA programmable nanoparticle self-assembly was first introduced in 1996, it has remained challenging to use DNA to make powerful diagnostic tools and to make designed materials with novel properties and highly ordered crystal structures. In this review, we summarize recent experimental and theoretical developments of DNA-programmable self-assembly into three-dimensional (3D) materials. Various types of aggregates and 3D crystal structures obtained from an experimental DNA-driven assembly are introduced. Furthermore, theoretical calculations and simulations for DNA-mediated assembly systems are described and we highlight some typical theoretical models for Monte Carlo and Molecular Dynamics simulations.

  2. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    NASA Astrophysics Data System (ADS)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  3. Structural, conformational and thermodynamic aspects of groove-directed-intercalation of flavopiridol into DNA.

    PubMed

    Ray, Bhumika; Agarwal, Shweta; Lohani, Neelam; Rajeswari, Moganty R; Mehrotra, Ranjana

    2016-11-01

    Certain plant-derived alkaloids and flavonoids have shown propitious cytotoxic acitvity against different types of cancer, having deoxyribose nucleic acid (DNA) as their main cellular target. Flavopiridol, a semi-synthetic derivative of rohitukine (a natural compound isolated from Dysoxylum binectariferum plant), has attained much attention owing to its anticancer potential against various haematological malignancies and solid tumours. This work focuses on investigating interaction between flavopiridol and DNA at molecular level in order to decipher its underlying mechanism of action, which is not well understood. To define direct influence of flavopiridol on the structural, conformational and thermodynamic aspects of DNA, various spectroscopic and calorimetric techniques have been used. ATR-FTIR and SERS spectral outcomes indicate a novel insight into groove-directed-intercalation of flavopiridol into DNA via direct binding with nitrogenous bases guanine (C6=O6) and thymine (C2=O2) in DNA groove together with slight external binding to its sugar-phosphate backbone. Circular dichroism spectral analysis of flavopiridol-DNA complexes suggests perturbation in native B-conformation of DNA and its transition into C-form, which may be localized up to a few base pairs of DNA. UV-visible spectroscopic results illustrate dual binding mode of flavopiridol when interacts with DNA having association constant, Ka = 1.18 × 10(4) M(-1). This suggests moderate type of interaction between flavopiridol and DNA. Further, UV melting analysis also supports spectroscopic outcomes. Thermodynamically, flavopiridol-DNA complexation is an enthalpy-driven exothermic process. These conclusions drawn from this study could be helpful in unveiling mechanism of cytoxicity induced by flavopiridol that can be further applied in the development of flavonoid-based new chemotherapeutics with more specificity and better efficacy.

  4. Differentiation of complex vapor mixtures using versatile DNA-carbon nanotube chemical sensor arrays.

    PubMed

    Kybert, Nicholas J; Lerner, Mitchell B; Yodh, Jeremy S; Preti, George; Johnson, A T Charlie

    2013-03-26

    Vapor sensors based on functionalized carbon nanotubes (NTs) have shown great promise, with high sensitivity conferred by the reduced dimensionality and exceptional electronic properties of the NT. Critical challenges in the development of NT-based sensor arrays for chemical detection include the demonstration of reproducible fabrication methods and functionalization schemes that provide high chemical diversity to the resulting sensors. Here, we outline a scalable approach to fabricating arrays of vapor sensors consisting of NT field effect transistors functionalized with single-stranded DNA (DNA-NT). DNA-NT sensors were highly reproducible, with responses that could be described through equilibrium thermodynamics. Target analytes were detected even in large backgrounds of volatile interferents. DNA-NT sensors were able to discriminate between highly similar molecules, including structural isomers and enantiomers. The sensors were also able to detect subtle variations in complex vapors, including mixtures of structural isomers and mixtures of many volatile organic compounds characteristic of humans.

  5. Incorporation of viral DNA packaging motor channel in lipid bilayers for real-time, single-molecule sensing of chemicals and double-stranded DNA

    PubMed Central

    Haque, Farzin; Geng, Jia; Montemagno, Carlo; Guo, Peixuan

    2013-01-01

    Over the past decade, nanopores have rapidly emerged as stochastic biosensors. This protocol describes the cloning, expression, and purification of the channel of bacteriophage phi29 DNA packaging nanomotor and its subsequent incorporation into lipid membranes for single-pore sensing of dsDNA and chemicals. The membrane-embedded phi29 nanochannels remain functional and structurally intact under a range of conditions. When ions and macromolecules translocate through these nanochannels, reliable fingerprint changes in conductance are observed. Compared with other well studied biological pores, the phi29 nanochannel has a larger cross-sectional area, which enables the translocation of dsDNA. Furthermore, specific amino acids can be introduced by site-directed mutagenesis within the large cavity of the channel to conjugate receptors that are able to bind specific ligands or analytes for desired applications. The lipid membrane embedded nanochannel system has immense potential nanotechnological and biomedical applications in bioreactors, environmental sensing, drug monitoring, controlled drug delivery, early disease diagnosis, and high-throughput DNA sequencing. The total time required for completing one round of this protocol is around one month. PMID:23348364

  6. New directions: Atmospheric chemical mechanisms for the future

    NASA Astrophysics Data System (ADS)

    Kaduwela, Ajith; Luecken, Deborah; Carter, William; Derwent, Richard

    2015-12-01

    The atmospheric chemical reaction scheme, commonly referred to as the chemical mechanism, is the portion of an air quality model that represents the atmospheric chemistry of the pollutants. It is at the heart of every air quality model used in research and policy applications to predict and analyse the complex air pollutants: ozone, air toxics and PM2.5. The chemical mechanism should incorporate available information on chemical kinetics and reaction pathways and be the conduit through which the fundamental science of atmospheric chemistry is applied to solve real-world problems. The efficiency and effectiveness of policies developed to reduce exposure to harmful pollutants depend on how well the mechanisms reflect the actual chemistry. If the mechanism has reaction pathways that are incorrectly characterised or completely missing, the resulting predictions may underestimate emission reduction requirements needed to meet public health and ecosystem protection targets, or may overstate the emission reductions needed and cause unnecessary implementation costs. It is therefore essential that mechanisms utilise the best, most up-to-date atmospheric chemistry information available so that policy development is based on air quality model predictions that are robust, transparent and free from scientific challenge. We are concerned that this may not continue to be the case.

  7. Chemical Reaction Engineering: Current Status and Future Directions.

    ERIC Educational Resources Information Center

    Dudukovic, M. P.

    1987-01-01

    Describes Chemical Reaction Engineering (CRE) as the discipline that quantifies the interplay of transport phenomena and kinetics in relating reactor performance to operating conditions and input variables. Addresses the current status of CRE in both academic and industrial settings and outlines future trends. (TW)

  8. Effects of seven chemicals on DNA damage in the rat urinary bladder: a comet assay study.

    PubMed

    Wada, Kunio; Yoshida, Toshinori; Takahashi, Naofumi; Matsumoto, Kyomu

    2014-07-15

    The in vivo comet assay has been used for the evaluation of DNA damage and repair in various tissues of rodents. However, it can give false-positive results due to non-specific DNA damage associated with cell death. In this study, we examined whether the in vivo comet assay can distinguish between genotoxic and non-genotoxic DNA damage in urinary bladder cells, by using the following seven chemicals related to urinary bladder carcinogenesis in rodents: N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN), glycidol, 2,2-bis(bromomethyl)-1,3-propanediol (BMP), 2-nitroanisole (2-NA), benzyl isothiocyanate (BITC), uracil, and melamine. BBN, glycidol, BMP, and 2-NA are known to be Ames test-positive and they are expected to produce DNA damage in the absence of cytotoxicity. BITC, uracil, and melamine are Ames test-negative with metabolic activation but have the potential to induce non-specific DNA damage due to cytotoxicity. The test chemicals were administered orally to male Sprague-Dawley rats (five per group) for each of two consecutive days. Urinary bladders were sampled 3h after the second administration and urothelial cells were analyzed by the comet assay and subjected to histopathological examination to evaluate cytotoxicity. In the urinary bladders of rats treated with BBN, glycidol, and BMP, DNA damage was detected. In contrast, 2-NA induced neither DNA damage nor cytotoxicity. The non-genotoxic chemicals (BITC, uracil, and melamine) did not induce DNA damage in the urinary bladders under conditions where some histopathological changes were observed. The results indicate that the comet assay could distinguish between genotoxic and non-genotoxic chemicals and that no false-positive responses were obtained.

  9. Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

    NASA Astrophysics Data System (ADS)

    Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

    We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

  10. New Modeling Approaches to Study DNA Damage by the Direct and Indirect Effects of Ionizing Radiation

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.

    2012-01-01

    DNA is damaged both by the direct and indirect effects of radiation. In the direct effect, the DNA itself is ionized, whereas the indirect effect involves the radiolysis of the water molecules surrounding the DNA and the subsequent reaction of the DNA with radical products. While this problem has been studied for many years, many unknowns still exist. To study this problem, we have developed the computer code RITRACKS [1], which simulates the radiation track structure for heavy ions and electrons, calculating all energy deposition events and the coordinates of all species produced by the water radiolysis. In this work, we plan to simulate DNA damage by using the crystal structure of a nucleosome and calculations performed by RITRACKS. The energy deposition events are used to calculate the dose deposited in nanovolumes [2] and therefore can be used to simulate the direct effect of the radiation. Using the positions of the radiolytic species with a radiation chemistry code [3] it will be possible to simulate DNA damage by indirect effect. The simulation results can be compared with results from previous calculations such as the frequencies of simple and complex strand breaks [4] and with newer experimental data using surrogate markers of DNA double ]strand breaks such as . ]H2AX foci [5].

  11. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    PubMed Central

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-01-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA–DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA–DNA interactions that we report here may play a role in the chromosome organization and gene regulation. PMID:27001929

  12. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    PubMed

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  13. Stainless steel and silicon direct interface synthesis: Chemical bonding effects

    NASA Astrophysics Data System (ADS)

    Cox, Michael J.

    Planar stainless steel/stainless steel interfaces, with and without a titanium interlayer and silicon/silicon interfaces have been produced in an ultra high vacuum (UHV) diffusion bonding/deposition instrument. Interface synthesis was accomplished by diffusion bonding two substrates after subjecting the substrate surfaces to a variety of pre-bonding treatments including heat treating, ion-beam sputter cleaning and thin film deposition. Chemical characterization was performed in situ by Auger electron spectroscopy (AES) prior to deposition and/or bonding and ex situ by energy dispersive X-ray spectroscopy (EDS) and electron energy loss spectroscopy (EELS). Additionally, transmission electron microscopy (TEM), scanning electron microscopy (SEM) and atomic force microscopy (AFM) were used to study interfaces before and after bonding. Diffusion bonding behavior of stainless steel depends strongly on the chemistry of the surfaces to be bonded. Very smooth, mechanically polished and lapped substrates would bond completely in UHV in 1 hour at 1000°C under 3.5 MPa uniaxial pressure, if the native oxide on the substrates was removed by ion beam cleaning. No voids were observed in these bonded interfaces as studied by TEM and the strength was equal to the unbonded bare material. When an electron beam deposited, 200 A titanium interlayer was added to the stainless steel interface, while bonding under the same conditions, mechanical tensile testing resulted in very low strength when compared with that of chemically clean stainless steel interfaces. Analytical inspection of the interfaces, performed with EELS, EDS, and convergent beam electron diffraction (CBED) coupled with images from TEM and SEM, showed the reason for the significantly reduced strength is a result of limited contact area and delamination between titanium carbide particles precipitated in the interface. Silicon wafers bicrystals were synthesized by bonding two single-crystal substrates. Silicon wafers were

  14. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  15. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  16. DNA methylation: a mechanism linking environmental chemical exposures to risk of autism spectrum disorders?

    PubMed Central

    Keil, Kimberly P.; Lein, Pamela J.

    2016-01-01

    There is now compelling evidence that gene by environment interactions are important in the etiology of autism spectrum disorders (ASDs). However, the mechanisms by which environmental factors interact with genetic susceptibilities to confer individual risk for ASD remain a significant knowledge gap in the field. The epigenome, and in particular DNA methylation, is a critical gene expression regulatory mechanism in normal and pathogenic brain development. DNA methylation can be influenced by environmental factors such as diet, hormones, stress, drugs, or exposure to environmental chemicals, suggesting that environmental factors may contribute to adverse neurodevelopmental outcomes of relevance to ASD via effects on DNA methylation in the developing brain. In this review, we describe epidemiological and experimental evidence implicating altered DNA methylation as a potential mechanism by which environmental chemicals confer risk for ASD, using polychlorinated biphenyls (PCBs), lead, and bisphenol A (BPA) as examples. Understanding how environmental chemical exposures influence DNA methylation and how these epigenetic changes modulate the risk and/or severity of ASD will not only provide mechanistic insight regarding gene-environment interactions of relevance to ASD but may also suggest potential intervention strategies for these and potentially other neurodevelopmental disorders. PMID:27158529

  17. Direct participation of DNA in the formation of singlet oxygen and base damage under UVA irradiation.

    PubMed

    Yagura, Teiti; Schuch, André Passaglia; Garcia, Camila Carrião Machado; Rocha, Clarissa Ribeiro Reily; Moreno, Natália Cestari; Angeli, José Pedro Friedmann; Mendes, Davi; Severino, Divinomar; Bianchini Sanchez, Angelica; Di Mascio, Paolo; de Medeiros, Marisa Helena Gennari; Menck, Carlos Frederico Martins

    2017-03-18

    UVA light is hardly absorbed by the DNA molecule, but recent works point to a direct mechanism of DNA lesion by these wavelengths. UVA light also excite endogenous chromophores, which causes DNA damage through ROS. In this study, DNA samples were irradiated with UVA light in different conditions to investigate possible mechanisms involved in the induction of DNA damage. The different types of DNA lesions formed after irradiation were determined through the use of endonucleases, which recognize and cleave sites containing oxidized bases and cyclobutane pyrimidine dimers (CPDs), as well as through antibody recognition. The formation of 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxodG) was also studied in more detail using electrochemical detection. The results show that high NaCl concentration and concentrated DNA are capable of reducing the induction of CPDs. Moreover, concerning damage caused by oxidative stress, the presence of sodium azide and metal chelators reduce their induction, while deuterated water increases the amounts of oxidized bases, confirming the involvement of singlet oxygen in the generation of these lesions. Curiously, however, high concentrations of DNA also enhanced the formation of oxidized bases, in a reaction that paralleled the increase in the formation of singlet oxygen in the solution. This was interpreted as being due to an intrinsic photosensitization mechanism, depending directly on the DNA molecule to absorb UVA and generate singlet oxygen. Therefore, the DNA molecule itself may act as a chromophore for UVA light, locally producing a damaging agent, which may lead to even greater concerns about the deleterious impact of sunlight.

  18. A New Direct Single-Molecule Observation Method for DNA Synthesis Reaction Using Fluorescent Replication Protein A

    PubMed Central

    Takahashi, Shunsuke; Kawasaki, Shohei; Miyata, Hidefumi; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-ichi; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2014-01-01

    Using a single-stranded region tracing system, single-molecule DNA synthesis reactions were directly observed in microflow channels. The direct single-molecule observations of DNA synthesis were labeled with a fusion protein consisting of the ssDNA-binding domain of a 70-kDa subunit of replication protein A and enhanced yellow fluorescent protein (RPA-YFP). Our method was suitable for measurement of DNA synthesis reaction rates with control of the ssλDNA form as stretched ssλDNA (+flow) and random coiled ssλDNA (−flow) via buffer flow. Sequentially captured photographs demonstrated that the synthesized region of an ssλDNA molecule monotonously increased with the reaction time. The DNA synthesis reaction rate of random coiled ssλDNA (−flow) was nearly the same as that measured in a previous ensemble molecule experiment (52 vs. 50 bases/s). This suggested that the random coiled form of DNA (−flow) reflected the DNA form in the bulk experiment in the case of DNA synthesis reactions. In addition, the DNA synthesis reaction rate of stretched ssλDNA (+flow) was approximately 75% higher than that of random coiled ssλDNA (−flow) (91 vs. 52 bases/s). The DNA synthesis reaction rate of the Klenow fragment (3′-5′exo–) was promoted by DNA stretching with buffer flow. PMID:24625741

  19. Identification of structure-activity relationships from screening a structurally compact DNA-encoded chemical library.

    PubMed

    Franzini, Raphael M; Ekblad, Torun; Zhong, Nan; Wichert, Moreno; Decurtins, Willy; Nauer, Angela; Zimmermann, Mauro; Samain, Florent; Scheuermann, Jörg; Brown, Peter J; Hall, Jonathan; Gräslund, Susanne; Schüler, Herwig; Neri, Dario

    2015-03-23

    Methods for the rapid and inexpensive discovery of hit compounds are essential for pharmaceutical research and DNA-encoded chemical libraries represent promising tools for this purpose. We here report on the design and synthesis of DAL-100K, a DNA-encoded chemical library containing 103 200 structurally compact compounds. Affinity screening experiments and DNA-sequencing analysis provided ligands with nanomolar affinities to several proteins, including prostate-specific membrane antigen and tankyrase 1. Correlations of sequence counts with binding affinities and potencies of enzyme inhibition were observed and enabled the identification of structural features critical for activity. These results indicate that libraries of this type represent a useful source of small-molecule binders for target proteins of pharmaceutical interest and information on structural features important for binding.

  20. Direct electrochemical stripping detection of cystic-fibrosis-related DNA linked through cadmium sulfide quantum dots

    NASA Astrophysics Data System (ADS)

    Marin, Sergio; Merkoçi, Arben

    2009-02-01

    Electrochemical detection of a cadmium sulfide quantum dots (CdS QDs)-DNA complex connected to paramagnetic microbeads (MB) was performed without the need for chemical dissolving. The method is based on dropping 20 µl of CdS QD-DNA-MB suspension on the surface of a screen-printed electrode. It is followed by magnetic collection on the surface of the working electrode and electrochemical detection using square-wave voltammetry (SWV), giving a well-shaped and sensitive analytical signal. A cystic-fibrosis-related DNA sequence was sandwiched between the two DNA probes. One DNA probe is linked via biotin-streptavidin bonding with MB and the other one via thiol groups with the CdS QD used as tags. Nonspecific signals of DNA were minimized using a blocking agent and the results obtained were successfully employed in a model DNA sensor with an interest in future applications in the clinical field. The developed nanoparticle biosensing system may offer numerous opportunities in other fields where fast, low cost and efficient detection of small volume samples is required.

  1. Direct electrochemical stripping detection of cystic-fibrosis-related DNA linked through cadmium sulfide quantum dots.

    PubMed

    Marin, Sergio; Merkoçi, Arben

    2009-02-04

    Electrochemical detection of a cadmium sulfide quantum dots (CdS QDs)-DNA complex connected to paramagnetic microbeads (MB) was performed without the need for chemical dissolving. The method is based on dropping 20 microl of CdS QD-DNA-MB suspension on the surface of a screen-printed electrode. It is followed by magnetic collection on the surface of the working electrode and electrochemical detection using square-wave voltammetry (SWV), giving a well-shaped and sensitive analytical signal. A cystic-fibrosis-related DNA sequence was sandwiched between the two DNA probes. One DNA probe is linked via biotin-streptavidin bonding with MB and the other one via thiol groups with the CdS QD used as tags. Nonspecific signals of DNA were minimized using a blocking agent and the results obtained were successfully employed in a model DNA sensor with an interest in future applications in the clinical field. The developed nanoparticle biosensing system may offer numerous opportunities in other fields where fast, low cost and efficient detection of small volume samples is required.

  2. Dissociative Electron Attachment to Phosphoric Acid Esters: The Direct Mechanism for Single Strand Breaks in DNA

    SciTech Connect

    Koenig, Constanze; Kopyra, Janina; Bald, Ilko; Illenberger, Eugen

    2006-07-07

    We use dibutyl phosphate to simulate the behavior of the phosphate group in DNA towards the attack of low energy electrons. We find that the compound undergoes effective dissociative electron attachment within a low energy resonant feature at 1 eV and a further resonance peaking at 8 eV. The dissociative electron attachment (DEA) reactions are associated with the direct cleavage of the C-O and the P-O bond but also the excision of the PO{sup -}, PO{sub 3}{sup -}, H{sub 2}PO{sub 3}{sup -} units. For the phosphate group coupled in the DNA network these reactions represent single strand breaks. We hence propose that the most direct mechanism of single strand breaks occurring in DNA at subexcitation energies (<4 eV) is due to DEA directly to the phosphate group.

  3. Direct non transcriptional role of NF-Y in DNA replication.

    PubMed

    Benatti, Paolo; Belluti, Silvia; Miotto, Benoit; Neusiedler, Julia; Dolfini, Diletta; Drac, Marjorie; Basile, Valentina; Schwob, Etienne; Mantovani, Roberto; Blow, J Julian; Imbriano, Carol

    2016-04-01

    NF-Y is a heterotrimeric transcription factor, which plays a pioneer role in the transcriptional control of promoters containing the CCAAT-box, among which genes involved in cell cycle regulation, apoptosis and DNA damage response. The knock-down of the sequence-specific subunit NF-YA triggers defects in S-phase progression, which lead to apoptotic cell death. Here, we report that NF-Y has a critical function in DNA replication progression, independent from its transcriptional activity. NF-YA colocalizes with early DNA replication factories, its depletion affects the loading of replisome proteins to DNA, among which Cdc45, and delays the passage from early to middle-late S phase. Molecular combing experiments are consistent with a role for NF-Y in the control of fork progression. Finally, we unambiguously demonstrate a direct non-transcriptional role of NF-Y in the overall efficiency of DNA replication, specifically in the DNA elongation process, using a Xenopus cell-free system. Our findings broaden the activity of NF-Y on a DNA metabolism other than transcription, supporting the existence of specific TFs required for proper and efficient DNA replication.

  4. Having a direct look: analysis of DNA damage and repair mechanisms by next generation sequencing.

    PubMed

    Meier, Bettina; Gartner, Anton

    2014-11-15

    Genetic information is under constant attack from endogenous and exogenous sources, and the use of model organisms has provided important frameworks to understand how genome stability is maintained and how various DNA lesions are repaired. The advance of high throughput next generation sequencing (NGS) provides new inroads for investigating mechanisms needed for genome maintenance. These emerging studies, which aim to link genetic toxicology and mechanistic analyses of DNA repair processes in vivo, rely on defining mutational signatures caused by faulty replication, endogenous DNA damaging metabolites, or exogenously applied genotoxins; the analysis of their nature, their frequency and distribution. In contrast to classical studies, where DNA repair deficiency is assessed by reduced cellular survival, the localization of DNA repair factors and their interdependence as well as limited analysis of single locus reporter assays, NGS based approaches reveal the direct, quantal imprint of mutagenesis genome-wide, at the DNA sequence level. As we will show, such investigations require the analysis of DNA derived from single genotoxin treated cells, or DNA from cell populations regularly passaged through single cell bottlenecks when naturally occurring mutation accumulation is investigated. We will argue that the life cycle of the nematode Caenorhabditis elegans, its genetic malleability combined with whole genome sequencing provides an exciting model system to conduct such analysis.

  5. Having a direct look: Analysis of DNA damage and repair mechanisms by next generation sequencing

    PubMed Central

    Meier, Bettina; Gartner, Anton

    2014-01-01

    Genetic information is under constant attack from endogenous and exogenous sources, and the use of model organisms has provided important frameworks to understand how genome stability is maintained and how various DNA lesions are repaired. The advance of high throughput next generation sequencing (NGS) provides new inroads for investigating mechanisms needed for genome maintenance. These emerging studies, which aim to link genetic toxicology and mechanistic analyses of DNA repair processes in vivo, rely on defining mutational signatures caused by faulty replication, endogenous DNA damaging metabolites, or exogenously applied genotoxins; the analysis of their nature, their frequency and distribution. In contrast to classical studies, where DNA repair deficiency is assessed by reduced cellular survival, the localization of DNA repair factors and their interdependence as well as limited analysis of single locus reporter assays, NGS based approaches reveal the direct, quantal imprint of mutagenesis genome-wide, at the DNA sequence level. As we will show, such investigations require the analysis of DNA derived from single genotoxin treated cells, or DNA from cell populations regularly passaged through single cell bottlenecks when naturally occurring mutation accumulation is investigated. We will argue that the life cycle of the nematode Caenorhabditis elegans, its genetic malleability combined with whole genome sequencing provides an exciting model system to conduct such analysis. PMID:25131498

  6. Direct observation of DNA knots using a solid-state nanopore

    NASA Astrophysics Data System (ADS)

    Plesa, Calin; Verschueren, Daniel; Pud, Sergii; van der Torre, Jaco; Ruitenberg, Justus W.; Witteveen, Menno J.; Jonsson, Magnus P.; Grosberg, Alexander Y.; Rabin, Yitzhak; Dekker, Cees

    2016-12-01

    Long DNA molecules can self-entangle into knots. Experimental techniques for observing such DNA knots (primarily gel electrophoresis) are limited to bulk methods and circular molecules below 10 kilobase pairs in length. Here, we show that solid-state nanopores can be used to directly observe individual knots in both linear and circular single DNA molecules of arbitrary length. The DNA knots are observed as short spikes in the nanopore current traces of the traversing DNA molecules and their detection is dependent on a sufficiently high measurement resolution, which can be achieved using high-concentration LiCl buffers. We study the percentage of molecules with knots for DNA molecules of up to 166 kilobase pairs in length and find that the knotting occurrence rises with the length of the DNA molecule, consistent with a constant knotting probability per unit length. Our experimental data compare favourably with previous simulation-based predictions for long polymers. From the translocation time of the knot through the nanopore, we estimate that the majority of the DNA knots are tight, with remarkably small sizes below 100 nm. In the case of linear molecules, we also observe that knots are able to slide out on application of high driving forces (voltage).

  7. Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains

    SciTech Connect

    Lee, James Weifu; Meller, Amit

    2007-01-01

    Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, which looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.

  8. DNA-directed alkylating agents. 4. 4-anilinoquinoline-based minor groove directed aniline mustards.

    PubMed

    Gravatt, G L; Baguley, B C; Wilson, W R; Denny, W A

    1991-05-01

    A series of 4-anilinoquinoline-linked aniline mustards of widely varying mustard reactivity were prepared and evaluated for their antitumor activity. The compounds were designed as minor grove binding agents, where the aniline mustard ring is itself part of the DNA-binding ligand. While there was a general trend for cytotoxicity to correlate with mustard reactivity, this was much less pronounced than with untargeted mustards. The compounds were much more cytotoxic than the parent diols, and were also at least 10-fold more cytotoxic than the corresponding aniline mustards themselves. Comparative cell line studies suggested that the mechanism of cytotoxicity varied with mustard reactivity. The most reactive mustards cross-linked DNA, while cell killing by the less reactive compounds appeared to be by the formation of bulky monoadducts. The compounds were active but not particularly dose-potent against P388 leukemia in vivo. The modest potency may be related to their poor aqueous solubility, since the more soluble methyl quaternary salts were equally active at much lower doses.

  9. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology.

    PubMed

    Cheung-Ong, Kahlin; Giaever, Guri; Nislow, Corey

    2013-05-23

    DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action. This review covers the current DNA-damaging agents used in the clinic, discusses their limitations, and describes the use of chemical genomics to uncover new information about the DNA damage response network and to evaluate novel DNA-damaging compounds.

  10. Automated screening for small organic ligands using DNA-encoded chemical libraries.

    PubMed

    Decurtins, Willy; Wichert, Moreno; Franzini, Raphael M; Buller, Fabian; Stravs, Michael A; Zhang, Yixin; Neri, Dario; Scheuermann, Jörg

    2016-04-01

    DNA-encoded chemical libraries (DECLs) are collections of organic compounds that are individually linked to different oligonucleotides, serving as amplifiable identification barcodes. As all compounds in the library can be identified by their DNA tags, they can be mixed and used in affinity-capture experiments on target proteins of interest. In this protocol, we describe the screening process that allows the identification of the few binding molecules within the multiplicity of library members. First, the automated affinity selection process physically isolates binding library members. Second, the DNA codes of the isolated binders are PCR-amplified and subjected to high-throughput DNA sequencing. Third, the obtained sequencing data are evaluated using a C++ program and the results are displayed using MATLAB software. The resulting selection fingerprints facilitate the discrimination of binding from nonbinding library members. The described procedures allow the identification of small organic ligands to biological targets from a DECL within 10 d.

  11. Quantitative Field Testing Heterodera glycines from Metagenomic DNA Samples Isolated Directly from Soil under Agronomic Production

    PubMed Central

    Li, Yan; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil. PMID:24587100

  12. Synergistic effects of multiple treatments, and both DNA and RNA direct bindings on, green tea catechins.

    PubMed

    Kuzuhara, Takashi; Tanabe, Akitoshi; Sei, Yoshihisa; Yamaguchi, Kentaro; Suganuma, Masami; Fujiki, Hirota

    2007-08-01

    This article reviews two main topics: (1) the synergistic effects of multiple treatments with green tea catechin and (2) the direct binding of (-)-epigallocatechin gallate (EGCG) to both DNA and RNA molecules. Japanese drink green tea throughout the day, so we studied whether multiple treatments of cells with EGCG would enhance the expression of apoptosis-related genes, such as growth arrest and DNA damage-inducible gene (GADD153) and cyclin-dependent kinase inhibitor gene (p21(waf1)): The results suggest that the synergistic enhancement of both GADD153 and p21(waf1) gene expressions by multiple treatments plays a significant role in human cancer prevention with green tea beverage. Our previous observation-that nucleic acids extracted from catechin-treated cells are colored-allowed us to speculate that catechins directly interact with nucleic acids. Surface plasmon resonance assay (Biacore) indicated that four catechins, EGCG, (-)-epicatechin gallate (ECG), (+)-gallocatechin gallate (GCG), and (+)-catechin gallate (CG), bound to DNA oligomers. Cold spray ionization mass spectrometry (CSI-MS) analysis showed that one to three EGCG molecules bound to single-stranded 18 mers of DNA and RNA. Moreover, one or two molecules of EGCG bound to double-stranded AG:CT oligomers of various nucleotide lengths. Double-stranded DNA (dsDNA) oligomers were detected only as EGCG-bound forms at high temperature, whereas at low temperature both the free and bound forms were detected, suggesting that EGCG protects double-stranded DNA oligomers from double-stranded melting into single-stranded DNA. We assume that catechins accumulate in both double-stranded DNA and RNA molecules through multiple administrations of green tea beverage in in vivo, and that the accumulated green tea catechins play a significant role for human cancer prevention.

  13. Residual DNA analysis in biologics development: review of measurement and quantitation technologies and future directions.

    PubMed

    Wang, Xing; Morgan, Donna M; Wang, Gan; Mozier, Ned M

    2012-02-01

    Residual DNA (rDNA) is comprised of deoxyribonucleic acid (DNA) fragments and longer length molecules originating from the host organism that may be present in samples from recombinant biological processes. Although similar in basic structural base pair units, rDNA may exist in different sizes and physical forms. Interest in measuring rDNA in recombinant products is based primarily on demonstration of effective purification during manufacturing, but also on some hypothetical concerns that, in rare cases, depending on the host expression system, some DNA sequences may be potentially infectious or oncogenic (e.g., HIV virus and the Ras oncogene, respectively). Recent studies suggest that a sequence known as long interspersed nucleotide element-1 (LINE-1), widely distributed in the mammalian genome, is active as a retrotransposon that can be transcribed to RNA, reverse-transcribed into DNA and inserts into a new site in genome. This integration process could potentially disrupt critical gene functions or induce tumorigenesis in mammals. Genomic DNA from microbial sources, on the other hand, could add to risk of immunogenicity to the target recombinant protein being expressed, due to the high CpG content and unmethylated DNA sequence. For these and other reasons, it is necessary for manufacturers to show clearance of DNA throughout production processes and to confirm low levels in the final drug substance using an appropriately specific and quantitative analytical method. The heterogeneity of potential rDNA sequences that might be makes the testing of all potential analytes challenging. The most common methodology for rDNA quantitation used currently is real-time polymerase chain reaction (RT-PCR), a robust and proven technology. Like most rDNA quantitation methods, the specificity of RT-PCR is limited by the sequences to which the primers are directed. To address this, primase-based whole genome amplification is introduced herein. This paper will review the recent

  14. A Binary-Encounter-Bethe Approach to Simulate DNA Damage by the Direct Effect

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.

    2013-01-01

    The DNA damage is of crucial importance in the understanding of the effects of ionizing radiation. The main mechanisms of DNA damage are by the direct effect of radiation (e.g. direct ionization) and by indirect effect (e.g. damage by.OH radicals created by the radiolysis of water). Despite years of research in this area, many questions on the formation of DNA damage remains. To refine existing DNA damage models, an approach based on the Binary-Encounter-Bethe (BEB) model was developed[1]. This model calculates differential cross sections for ionization of the molecular orbitals of the DNA bases, sugars and phosphates using the electron binding energy, the mean kinetic energy and the occupancy number of the orbital. This cross section has an analytic form which is quite convenient to use and allows the sampling of the energy loss occurring during an ionization event. To simulate the radiation track structure, the code RITRACKS developed at the NASA Johnson Space Center is used[2]. This code calculates all the energy deposition events and the formation of the radiolytic species by the ion and the secondary electrons as well. We have also developed a technique to use the integrated BEB cross section for the bases, sugar and phosphates in the radiation transport code RITRACKS. These techniques should allow the simulation of DNA damage by ionizing radiation, and understanding of the formation of double-strand breaks caused by clustered damage in different conditions.

  15. Understanding of DNA directed nanoparticle superlattices in bulk and thin film

    NASA Astrophysics Data System (ADS)

    Lee, Byeongdu

    Over the years, there have been significant advances in assembling nanoparticles with DNA into superlattices. Since the first reports on DNA directed FCC and BCC superlattices consisting of single type of spherical nanoparticles, building blocks for the DNA-nanoparticle superlattices have been extended from a spherical gold nanoparticle to various types of other particles including quantum dots, magnetic, hollow, or polyhedral particles. Not only single component, but superlattices of binary and ternary components have also been synthesized. Although still many details are unclear, now there is a general consensus about thermodynamics of this type of assembly, which led us to fabricate thin films of DNA directed nanoparticle superlattices on substrate for applications such as optical materials. Since the structures are formed in aqueous condition, small angle x-ray scattering (SAXS) that does not disturb the system has been a critical tool to determine structural and thermodynamic characteristics of the assemblies. Thus, we have also been improving SAXS instrumentations and computational methods to calculate scattering profiles for the nanoparticle superlattices. In this talk, we will summarize our works with a focus on some structural details of these superlattices and DNA and understanding about the role of DNA in the crystallization processes in bulk and thin film.

  16. Quantitative PCR is a valuable tool to monitor performance of DNA-encoded chemical library selections.

    PubMed

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-02-21

    Phage-display libraries and DNA-encoded chemical libraries (DECL) represent useful tools for the isolation of specific binding molecules out of large combinatorial sets of compounds. In both methods, specific binders are recovered at the end of affinity capture procedures, using target proteins of interest immobilized on a solid support. However, while the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DNA-encoded chemical library selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency, using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provides rapid information about the performance of selections, thus facilitating the optimization of experimental conditions.

  17. Forensic animal DNA analysis using economical two-step direct PCR.

    PubMed

    Kitpipit, Thitika; Chotigeat, Wilaiwan; Linacre, Adrian; Thanakiatkrai, Phuvadol

    2014-03-01

    Wildlife forensic DNA analysis by amplification of a mitochondrial locus followed by DNA sequencing is routine, yet suffers from being costly and time-consuming. To address these disadvantages we report on a low-cost two-step direct PCR assay to efficiently analyze 12 forensically relevant mammalian sample types without DNA extraction. A cytochrome oxidase I degenerate-universal primer pair was designed and validated for the developed assay. The 12 sample types, which included bone, horn, feces, and urine, were amplified successfully by the assay using a pre-direct PCR dilution protocol. The average amplification success rate was as high as 92.5 % (n = 350), with an average PCR product concentration of 220.71 ± 180.84 ng/μL. Differences in amplification success rate and PCR product quantity between sample types were observed; however, most samples provided high quality sequences, permitting a 100 % nucleotide similarity to their respective species via BLAST database queries. The combination of PBS and Phire(®) Hot Start II DNA polymerase gave comparable amplification success rate and amplicon quantity with the proprietary commercial kits (P > 0.05, n = 350) but at considerably lower cost. The stability of the assay was tested by successfully amplifying samples that had been stored for up to 12 months. Our data indicate that this low-cost two-step direct amplification assay has the potential to be a valuable tool for the forensic DNA community.

  18. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  19. p21 Expression and DNA ploidy in chemically-induced transitional cell carcinoma

    SciTech Connect

    Rhodes, S.W.

    1987-01-01

    Occupational and environmental exposure to chemical carcinogens and the incidence of bladder carcinoma suggest that biochemical indicators for individual risk, and early detection would be beneficial in facilitating timely intervention and cancer management. Further, such objective measures may provide a quantitative basis for determination of the biological potential of tumors and the development of end point markers in chemical risk assessment. In this study quantitative measures for biochemical alterations were developed for in situ measurement of the ras oncoprotein, p21, and DNA ploidy in tissue sections. These assays were then applied to an animal model in which transitional cell carcinoma was induced with N-butyl-N-(4-hydroxybutyl) nitrosamine, which primarily induced low grade tumors. Three measures of DNA ploidy were utilized: (A) 95th percentile of cellular DNA content (C value), (B) percent of cells with a DNA complement greater than 5.0C, and (C) mode. The 95th percentile C value was able to delineate normal and hyperplastic tissues from tumor tissues. The percent of cells with a DNA content greater than 5.0C was capable of differentiating invasive lesions from noninvasive lesions.

  20. Direction- and Salt-Dependent Ionic Current Signatures for DNA Sensing with Asymmetric Nanopores.

    PubMed

    Chen, Kaikai; Bell, Nicholas A W; Kong, Jinglin; Tian, Yu; Keyser, Ulrich F

    2017-02-28

    Solid-state nanopores are promising tools for single-molecule detection of both DNA and proteins. In this study, we investigated the patterns of ionic current blockades as DNA translocates into or out of the geometric confinement of conically shaped pores across a wide range of salt conditions. We studied how the geometry of a nanopore affects the detected ionic current signal of a translocating DNA molecule over a wide range of salt concentration. The blockade level in the ionic current depends on the translocation direction at a high salt concentration, and at lower salt concentrations we find a nonintuitive ionic current decrease and increase within each single event for the DNA translocations exiting from confinement. We use a recently developed method for synthesizing DNA molecules with multiple position markers, which provides further experimental characterization by matching the position of the DNA in the pore with the observed ionic current signal. Finally, we employ finite element calculations to explain the shapes of the signals observed at all salt concentrations and show that the unexpected current decrease and increase are due to the competing effects of ion concentration polarization and geometric exclusion of ions. Our analysis shows that over a wide range of geometries, voltages, and salt concentrations, we are able to understand the ionic current signals of DNA in asymmetric nanopores, enabling signal optimization in molecular sensing applications.

  1. B lymphocytes as direct antigen-presenting cells for anti-tumor DNA vaccines

    PubMed Central

    Colluru, Viswa Teja; McNeel, Douglas G.

    2016-01-01

    In spite of remarkable preclinical efficacy, DNA vaccination has demonstrated low immunogenicity in humans. While efforts have focused on increasing cross-presentation of DNA-encoded antigens, efforts to increase DNA vaccine immunogenicity by targeting direct presentation have remained mostly unexplored. In these studies, we compared the ability of different APCs to present antigen to T cells after simple co-culture with plasmid DNA. We found that human primary peripheral B lymphocytes, and not monocytes or in vitro derived dendritic cells (DCs), were able to efficiently encode antigen mRNA and expand cognate tumor antigen-specific CD8 T cells ex vivo. Similarly, murine B lymphocytes co-cultured with plasmid DNA, and not DCs, were able to prime antigen-specific T cells in vivo. Moreover, B lymphocyte-mediated presentation of plasmid antigen led to greater Th1-biased immunity and was sufficient to elicit an anti-tumor effect in vivo. Surprisingly, increasing plasmid presentation by B cells, and not cross presentation of peptides by DCs, further augmented traditional plasmid vaccination. Together, these data suggest that targeting plasmid DNA to B lymphocytes, for example through transfer of ex vivo plasmidloaded B cells, may be novel means to achieve greater T cell immunity from DNA vaccines. PMID:27661128

  2. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  3. Direct chemical evidence for widespread dairying in prehistoric Britain

    PubMed Central

    Copley, M. S.; Berstan, R.; Dudd, S. N.; Docherty, G.; Mukherjee, A. J.; Straker, V.; Payne, S.; Evershed, R. P.

    2003-01-01

    Domesticated animals formed an important element of farming practices in prehistoric Britain, a fact revealed through the quantity and variety of animal bone typically found at archaeological sites. However, it is not known whether the ruminant animals were raised purely for their tissues (e.g., meat) or alternatively were exploited principally for their milk. Absorbed organic residues from pottery from 14 British prehistoric sites were investigated for evidence of the processing of dairy products. Our ability to detect dairy fats rests on the observation that the δ13C values of the C18:0 fatty acids in ruminant dairy fats are ≈2.3‰ lower than in ruminant adipose fats. This difference can be ascribed to (i) the inability of the mammary gland to biosynthesize C18:0; (ii) the biohydrogenation of dietary unsaturated fatty acids in the rumen; and (iii) differences (i.e., 8.1‰) in the δ13C values of the plant dietary fatty acids and carbohydrates. The lipids from a total of 958 archaeological pottery vessels were extracted, and the compound-specific δ13C values of preserved fatty acids (C16:0 and C18:0) were determined via gas chromatography-combustion-isotope ratio mass spectrometry. The results provide direct evidence for the exploitation of domesticated ruminant animals for dairy products at all Neolithic, Bronze Age, and Iron Age settlements in Britain. Most significantly, studies of pottery from a range of key early Neolithic sites confirmed that dairying was a widespread activity in this period and therefore probably well developed when farming was introduced into Britain in the fifth millennium B.C. PMID:12574520

  4. Reversible self-assembly and directed assembly of DNA-linked micrometer-sized colloids.

    PubMed

    Valignat, Marie-Pierre; Theodoly, Olivier; Crocker, John C; Russel, William B; Chaikin, Paul M

    2005-03-22

    We present a technique for the directed assembly and self-assembly of micrometer-scale structures based on the control of specific DNA linkages between colloidal particles. The use of DNA links combined with polymer brushes provides an effective way to regulate the range and magnitude of addressable forces between pairs (and further combinations) of different particles. We demonstrate that the autoassembly of alternate microbeads as well as their directed assembly, by using laser tweezers, is reversible. The key to reversibility is preventing the particles from falling into their van der Waals well at close distances. This goal is achieved by the use of adsorbed polymers that limit the number of DNA bridges to one to three between adjacent particles.

  5. Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

    PubMed

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

    2015-03-20

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

  6. One-Directional Fluidic Flow Induced by Chemical Wave Propagation in a Microchannel.

    PubMed

    Arai, Miyu; Takahashi, Kazuhiro; Hattori, Mika; Hasegawa, Takahiko; Sato, Mami; Unoura, Kei; Nabika, Hideki

    2016-05-26

    A one-directional flow induced by chemical wave propagation was investigated to understand the origin of its dynamic flow. A cylindrical injection port was connected with a straight propagation channel; the chemical wave was initiated at the injection port. Chemical waves propagated with a constant velocity irrespective of the channel width, indicating that the dynamics of the chemical waves were governed by a geometry-independent interplay between the chemical reaction and diffusion. In contrast, the velocity of the one-directional flow was dependent on the channel width. Furthermore, enlargement of the injection port volume increased the flow velocity and volume flux. These results imply that the one-directional flow in the microchannel is due to a hydrodynamic effect induced in the injection port. Spectroscopic analysis of a pH indicator revealed the simultaneous behavior between the pH increase near the injection port and the one-directional flow. Hence, we can conclude that the one-directional flow in the microchannel with chemical wave propagation was caused by a proton consumption reaction in the injection port, probably through liquid volume expansion by the reaction products and the reaction heat. It is a characteristic feature of the present system that the hydrodynamic flow started from the chemical wave initiation point and not the propagation wavefront, as observed for previous systems.

  7. DNA-protein cross-links produced by various chemicals in cultured human lymphoma cells.

    PubMed

    Costa, M; Zhitkovich, A; Harris, M; Paustenbach, D; Gargas, M

    1997-04-11

    Chemicals such as cis-platinum, formaldehyde, chromate, copper, and certain arsenic compounds have been shown to produce DNA-protein cross-links in human in vitro cell systems at high doses, such as those in the cytotoxic range. Thus far there have only been a limited number of other chemicals evaluated for their ability to produce cross-links. The purpose of the work described here was to evaluate whether select industrial chemicals can form DNA-protein cross-links in human cells in vitro. We evaluated acetaldehyde, acrolein, diepoxybutane, paraformaldehyde, 2-furaldehyde, propionaldehyde, chloroacetaldehyde, sodium arsenite, and a deodorant tablet [Mega Blue; hazardous component listed as tris(hydroxymethyl)nitromethane]. Short- and long-term cytotoxicity was evaluated and used to select appropriate doses for in vitro testing. DNA-protein cross-linking was evaluated at no fewer than three doses and two cell lysate washing temperatures (45 and 65 degrees C) in Epstein-Barr virus (EBV) human Burkitt's lymphoma cells. The two washing temperatures were used to assess the heat stability of the DNA-protein cross-link, 2-Furaldehyde, acetaldehyde, and propionaldehyde produced statistically significant increases in DNA-protein cross-links at washing temperatures of 45 degrees C, but not 65 degrees C, and at or above concentrations of 5, 17.5, and 75 mM, respectively. Acrolein, diepoxybutane, paraformaldehyde, and Mega Blue produced statistically significant increases in DNA-protein cross-links washed at 45 and 65 degrees C at or above concentrations of 0.15 mM, 12.5 mM, 0.003%, and 0.1%, respectively. Sodium arsenite and chloroacetaldehyde did not produce significantly increased DNA-protein cross-links at either temperature nor at any dose tested. Excluding paraformaldehyde and 2-furaldehyde treatments, significant increases in DNA-protein cross-links were observed only at doses that resulted in complete cell death within 4 d following dosing. This work demonstrates that

  8. Mechanisms of direct radiation damage to DNA: the effect of base sequence on base end products.

    PubMed

    Sharma, Kiran K K; Swarts, Steven G; Bernhard, William A

    2011-04-28

    It has been generally assumed that product formation in DNA damaged by ionizing radiation is relatively independent of base sequence, i.e., that the yield of a given product depends primarily on the chemical properties of each DNA constituent and not on its base sequence context. We examined this assumption by comparing direct-type end products produced in films of d(CTCTCGAGAG)(2) with those produced in films of d(GCACGCGTGC)(2). Here we report the product yields in d(CTCTCGAGAG)(2) hydrated to Γ = 2.5 and 15, where Γ is the hydration level given in moles of H(2)O/mole of nucleotide. Of the 17 products monitored by GC/MS, seven exhibited statistically significant yields: 8-oxoGua, 8-oxoAde, 5-OHMeUra, 5,6-diHUra, 5,6-diHThy, 5-OHCyt, and 5-OHUra. These yields at Γ = 2.5 are compared with the yields from our previously reported study of d(GCACGCGTGC)(2) (after projecting the yields to a CG/AT ratio of 1). The ratio of projected yields, d(CTCTCGAGAG)(2) divided by d(GCACGCGTGC)(2), are 1.3 ± 0.9, 1.8 ± 0.3, 1.6 ± 0.6, 11.4 ± 4.7, 0.2 ± 0.1, >28, and 0.8 ± 1.1, respectively. Considering just d(CTCTCGAGAG)(2), the ratios of yields at Γ = 2.5 divided by yields at Γ = 15 are 0.7 ± 0.2, 0.5 ± 0.1, 2.3 ± 4.0, 3.4 ± 1.2, 3.5 ± 3.3, 1.2 ± 0.2, and 0.4 ± 0.2, respectively. The effects of sequence and hydration on base product yields are explained by a working model emphasizing the difference between two distinctly different types of reaction: (i) radical reactions that progress to nonradical intermediates and product prior to dissolution and (ii) reactions that stem from radicals trapped in the solid state at room temperature that go on to yield nonradical product after sample dissolution. Based on these findings, insights into rates of hole and excess electron-transfer relative to rates of proton transfer are discussed.

  9. Dissection of the DNA mimicry of the bacteriophage T7 Ocr protein using chemical modification.

    PubMed

    Stephanou, Augoustinos S; Roberts, Gareth A; Cooper, Laurie P; Clarke, David J; Thomson, Andrew R; MacKay, C Logan; Nutley, Margaret; Cooper, Alan; Dryden, David T F

    2009-08-21

    The homodimeric Ocr (overcome classical restriction) protein of bacteriophage T7 is a molecular mimic of double-stranded DNA and a highly effective competitive inhibitor of the bacterial type I restriction/modification system. The surface of Ocr is replete with acidic residues that mimic the phosphate backbone of DNA. In addition, Ocr also mimics the overall dimensions of a bent 24-bp DNA molecule. In this study, we attempted to delineate these two mechanisms of DNA mimicry by chemically modifying the negative charges on the Ocr surface. Our analysis reveals that removal of about 46% of the carboxylate groups per Ocr monomer results in an approximately 50-fold reduction in binding affinity for a methyltransferase from a model type I restriction/modification system. The reduced affinity between Ocr with this degree of modification and the methyltransferase is comparable with the affinity of DNA for the methyltransferase. Additional modification to remove approximately 86% of the carboxylate groups further reduces its binding affinity, although the modified Ocr still binds to the methyltransferase via a mechanism attributable to the shape mimicry of a bent DNA molecule. Our results show that the electrostatic mimicry of Ocr increases the binding affinity for its target enzyme by up to approximately 800-fold.

  10. Direct and residual effects of manure on soil chemical properties

    NASA Astrophysics Data System (ADS)

    Nastri, A.; Triberti, L.; Giordani, G.; Comellini, F.; Baldoni, G.

    2009-04-01

    ha-1 (+ 29%) and + 166 kg ha-1 (+107%), respectively, compared to the control. These significant increments were obtained linearly, at mean annual rates of: 0.15 t ha-1 year-1 for SOC, 20 kg ha-1 for TN and 4.18 kg ha-1 for P2O5. During the first 18 years, doubling the manure supply (M2) caused further increments (72%, 76% and 112% increases for SOC, TN and P2O5, respectively, compared to M1). The complete interruption of M2 application, from 1984 onward, gradually decreased the positive effects. In the 1990-93 period, no differences between M1 and M2 were detected. After 18 years all the amounts were lower in M2 than in M1. However, a residual effect of the double manuring was still evident: M2 plots had higher SOC, TN and P2O5, contents compared to the unfertilized control (+3.1 t ha-1, +0.21 t ha-1 and +88 kg ha-1, respectively). Inorganic fertilization, in the absence of manure, did not affect SOC dynamic, whereas it had significant cumulative effects on TN (+0.94 t ha-1 (+26%) increase in the '99-02 period compared to the initial contents) and P2O5, with 223 kg ha-1 (+160%) increment. Treatments slightly influenced pH (6.43, on average): compared to the unfertilized control, manure increased it a little (+2.7%), while mineral fertilization had an opposite effect (-2.7%). In conclusion, the direct influences of manure on main components of soil fertility appeared cumulative with time and proportional to the application rates, at least up to 40 t ha-1 year-1 of fresh material. Residual effects gradually disappeared, but at low speed, thus their study requires really long experiments, lasting more than 20-years. Inorganic fertilization could increase nitrogen and, even more, available phosphorus content in the soil, but, in our research where crop residues are always removed, it had a null effect on SOC.

  11. Calculation of direct effects of 60Co gamma rays on the different DNA structural levels: A simulation study using the Geant4-DNA toolkit

    NASA Astrophysics Data System (ADS)

    Tajik, Marjan; Rozatian, Amir S. H.; Semsarha, Farid

    2015-03-01

    In this study, simple single strand breaks (SSB) and double strand breaks (DSB) due to direct effects of the secondary electron spectrum of 60Co gamma rays on different organizational levels of a volume model of the B-DNA conformation have been calculated using the Geant4-DNA toolkit. Result of this study for the direct DSB yield shows a good agreement with other theoretical and experimental results obtained by both photons and their secondary electrons; however, in the case of SSB a noticeable difference can be observed. Moreover, regarding the almost constant yields of the direct strand breaks in the different structural levels of the DNA, calculated in this work, and compared with some theoretical studies, it can be deduced that the direct strand breaks yields depend mainly on the primary double helix structure of the DNA and the higher-order structures cannot have a noticeable effect on the direct DNA damage inductions by 60Co gamma rays. In contrast, a direct dependency between the direct SSB and DSB yields and the volume of the DNA structure has been found. Also, a further study on the histone proteins showed that they can play an important role in the trapping of low energy electrons without any significant effect on the direct DNA strand breaks inductions, at least in the range of energies used in the current study.

  12. Regular Nanoscale Protein Patterns via Directed Adsorption through Self-Assembled DNA Origami Masks.

    PubMed

    Ramakrishnan, Saminathan; Subramaniam, Sivaraman; Stewart, A Francis; Grundmeier, Guido; Keller, Adrian

    2016-11-16

    DNA origami has become a widely used method for synthesizing well-defined nanostructures with promising applications in various areas of nanotechnology, biophysics, and medicine. Recently, the possibility to transfer the shape of single DNA origami nanostructures into different materials via molecular lithography approaches has received growing interest due to the great structural control provided by the DNA origami technique. Here, we use ordered monolayers of DNA origami nanostructures with internal cavities on mica surfaces as molecular lithography masks for the fabrication of regular protein patterns over large surface areas. Exposure of the masked sample surface to negatively charged proteins results in the directed adsorption of the proteins onto the exposed surface areas in the holes of the mask. By controlling the buffer and adsorption conditions, the protein coverage of the exposed areas can be varied from single proteins to densely packed monolayers. To demonstrate the versatility of this approach, regular nanopatterns of four different proteins are fabricated: the single-strand annealing proteins Redβ and Sak, the iron-storage protein ferritin, and the blood protein bovine serum albumin (BSA). We furthermore demonstrate the desorption of the DNA origami mask after directed protein adsorption, which may enable the fabrication of hierarchical patterns composed of different protein species. Because selectivity in adsorption is achieved by electrostatic interactions between the proteins and the exposed surface areas, this approach may enable also the large-scale patterning of other charged molecular species or even nanoparticles.

  13. Chemical enhancement techniques of bloodstain patterns and DNA recovery after fire exposure.

    PubMed

    Tontarski, Karolyn L; Hoskins, Kyle A; Watkins, Tani G; Brun-Conti, Leanora; Michaud, Amy L

    2009-01-01

    It is common in forensic casework to encounter situations where the suspect has set a fire to cover up or destroy possible evidence. While bloodstain pattern interpretation, chemical enhancement of blood, and recovery of deoxyribonucleic acid (DNA) from bloodstains is well documented in the literature, very little information is known about the effects of heat or fire on these types of examinations. In this study, a variety of known types of bloodstain patterns were created in a four-room structure containing typical household objects and furnishings. The structure was allowed to burn to flashover and then it was extinguished by firefighters using water. Once the structure cooled over night, the interior was examined using a bright light. The bloodstains were evaluated to see if the heat or fire had caused any changes to the patterns that would inhibit interpretation. Bloodstain patterns remained visible and intact inside the structure and on furnishings unless the surface that held the blood was totally burned away. Additionally, a variety of chemical techniques were utilized to better visualize the patterns and determine the possible presence of blood after the fire. The soot from the fire formed a physical barrier that initially interfered with chemical enhancement of blood. However, when the soot was removed using water or alcohol, the chemicals used, fluorescein, luminol, Bluestar, and Hemastix, performed adequately in most of the tests. Prior to DNA testing, the combined phenolphthalein/tetramethyl benzidine presumptive test for the presence of blood was conducted in the laboratory on samples recovered from the structure in an effort to assess the effectiveness of using this type of testing as a screening tool. Test results demonstrated that reliance on obtaining a positive presumptive result for blood before proceeding with DNA testing could result in the failure to obtain useful typing results. Finally, two DNA recovery methods (swabbing the stain plus

  14. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.

    PubMed

    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S

    1996-01-01

    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  15. A simplified mathematical model of directional DNA site-specific recombination by serine integrases

    PubMed Central

    Zhao, Jia; Stark, W. Marshall; Colloms, Sean D.; Ebenhöh, Oliver

    2017-01-01

    Serine integrases catalyse site-specific recombination to integrate and excise bacteriophage genomes into and out of their host's genome. These enzymes exhibit remarkable directionality; in the presence of the integrase alone, recombination between attP and attB DNA sites is efficient and irreversible, giving attL and attR products which do not recombine further. However, in the presence of the bacteriophage-encoded recombination directionality factor (RDF), integrase efficiently promotes recombination between attL and attR to re-form attP and attB. The DNA substrates and products of both reactions are approximately isoenergetic, and no cofactors (such as adenosine triphosphate) are required for recombination. The thermodynamic driving force for directionality of these reactions is thus enigmatic. Here, we present a minimal mathematical model which can explain the directionality and regulation of both ‘forward’ and ‘reverse’ reactions. In this model, the substrates of the ‘forbidden’ reactions (between attL and attR in the absence of RDF, attP and attB in the presence of RDF) are trapped as inactive protein–DNA complexes, ensuring that these ‘forbidden’ reactions are extremely slow. The model is in good agreement with the observed in vitro kinetics of recombination by ϕC31 integrase, and defines core features of the system necessary and sufficient for directionality. PMID:28077763

  16. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-01-09

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis.

  17. The Chemical Synthesis of DNA/RNA: Our Gift to Science

    PubMed Central

    Caruthers, Marvin H.

    2013-01-01

    It is a great privilege to contribute to the Reflections essays. In my particular case, this essay has allowed me to weave some of my major scientific contributions into a tapestry held together by what I have learned from three colleagues (Robert Letsinger, Gobind Khorana, and George Rathmann) who molded my career at every important junction. To these individuals, I remain eternally grateful, as they always led by example and showed many of us how to break new ground in both science and biotechnology. Relative to my scientific career, I have focused primarily on two related areas. The first is methodologies we developed for chemically synthesizing DNA and RNA. Synthetic DNA and RNA continue to be an essential research tool for biologists, biochemists, and molecular biologists. The second is developing new approaches for solving important biological problems using synthetic DNA, RNA, and their analogs. PMID:23223445

  18. Direct Fluorescent Imaging of Translocation and Unwinding by Individual DNA Helicases.

    PubMed

    Pavankumar, T L; Exell, J C; Kowalczykowski, S C

    2016-01-01

    The unique translocation and DNA unwinding properties of DNA helicases can be concealed by the stochastic behavior of enzyme molecules within the necessarily large populations used in ensemble experiments. With recent technological advances, the direct visualization of helicases acting on individual DNA molecules has contributed significantly to the current understanding of their mechanisms of action and biological functions. The combination of single-molecule techniques that enable both manipulation of individual protein or DNA molecules and visualization of their actions has made it possible to literally see novel and unique biochemical characteristics that were previously masked. Here, we describe the execution and use of single-molecule fluorescence imaging techniques, focusing on methods that include optical trapping in conjunction with epifluorescent imaging, and also surface immobilization in conjunction with total internal reflection fluorescence visualization. Combined with microchannel flow cells and microfluidic control, these methods allow individual fluorescently labeled protein and DNA molecules to be imaged and tracked, affording measurement of DNA unwinding and translocation at single-molecule resolution.

  19. Multilayered polyelectrolyte films promote the direct and localized delivery of DNA to cells.

    PubMed

    Jewell, Christopher M; Zhang, Jingtao; Fredin, Nathaniel J; Lynn, David M

    2005-08-18

    Multilayered polyelectrolyte films fabricated from plasmid DNA and a hydrolytically degradable synthetic polycation can be used to direct the localized transfection of cells without the aid of a secondary transfection agent. Multilayered assemblies 100 nm thick consisting of alternating layers of synthetic polymer and plasmid DNA encoding for enhanced green fluorescent protein (EGFP) were deposited on quartz substrates using a layer-by-layer fabrication procedure. The placement of film-coated slides in contact with COS-7 cells growing in serum-containing culture medium resulted in gene expression in cells localized under the film-coated portion of the slides. The average percentage of cells expressing EGFP relative to the total number of cells ranged from 4.6% to 37.9%, with an average of 18.6%+/-8.2%, as determined by fluorescence microscopy. In addition to providing a mechanism for the immobilization of DNA at the cell/surface interface, a preliminary analysis of film topography by atomic force microscopy (AFM) demonstrated that polymer /DNA films undergo significant structural rearrangements upon incubation to present surface bound condensed plasmid DNA nanoparticles. These data suggest that the presence of the cationic polymer in these materials may also contribute to the internalization and expression of plasmid. The materials and design principles reported here present an attractive framework for the local or non-invasive delivery of DNA from the surfaces of implantable materials or biomedical devices.

  20. Direct design of an energy landscape with bistable DNA origami mechanisms.

    PubMed

    Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E

    2015-03-11

    Structural DNA nanotechnology provides a feasible technique for the design and fabrication of complex geometries even exhibiting controllable dynamic behavior. Recently we have demonstrated the possibility of implementing macroscopic engineering design approaches to construct DNA origami mechanisms (DOM) with programmable motion and tunable flexibility. Here, we implement the design of compliant DNA origami mechanisms to extend from prescribing motion to prescribing an energy landscape. Compliant mechanisms facilitate motion via deformation of components with tunable stiffness resulting in well-defined mechanical energy stored in the structure. We design, fabricate, and characterize a DNA origami nanostructure with an energy landscape defined by two stable states (local energy minima) separated by a designed energy barrier. This nanostructure is a four-bar bistable mechanism with two undeformed states. Traversing between those states requires deformation, and hence mechanical energy storage, in a compliant arm of the linkage. The energy barrier for switching between two states was obtained from the conformational distribution based on a Boltzmann probability function and closely follows a predictive mechanical model. Furthermore, we demonstrated the ability to actuate the mechanism into one stable state via additional DNA inputs and then release the actuation via DNA strand displacement. This controllable multistate system establishes a foundation for direct design of energy landscapes that regulate conformational dynamics similar to biomolecular complexes.

  1. Capture and Direct Amplification of DNA on Chitosan Microparticles in a Single PCR-Optimal Solution.

    PubMed

    Pandit, Kunal R; Nanayakkara, Imaly A; Cao, Weidong; Raghavan, Srinivasa R; White, Ian M

    2015-11-03

    While nucleic acid amplification tests have great potential as tools for rapid diagnostics, complicated sample preparation requirements inhibit their use in near-patient diagnostics and low-resource-setting applications. Recent advancements in nucleic acid purification have leveraged pH-modulated charge switching polymers to reduce the number of steps required for sample preparation. The polycation chitosan (pKa 6.4) has been used to efficiently purify DNA by binding nucleic acids in acidic buffers and then eluting them at a pH higher than 8.0. Though it is an improvement over conventional methods, this multistep procedure has not transformed the application of nucleic acid amplification assays. Here we describe a simpler approach using magnetic chitosan microparticles that interact with DNA in a manner that has not been reported before. The microparticles capture DNA at a pH optimal for PCR (8.5) just as efficiently as at low pH. Importantly, the captured DNA is still accessible by polymerase, enabling direct amplification from the microparticles. We demonstrate quantitative PCR from DNA captured on the microparticles, thus eliminating nearly all of the sample preparation steps. We anticipate that this new streamlined method for preparing DNA for amplification will greatly expand the diagnostic applications of nucleic acid amplification tests.

  2. DNA manipulation by means of insulator-based dielectrophoresis employing direct current electric fields.

    PubMed

    Gallo-Villanueva, Roberto C; Rodríguez-López, Carlos E; Díaz-de-la-Garza, Rocío I; Reyes-Betanzo, Claudia; Lapizco-Encinas, Blanca H

    2009-12-01

    Electrokinetic techniques offer a great potential for biological particle manipulation. Among these, dielectrophoresis (DEP) has been successfully utilized for the concentration of bioparticles. Traditionally, DEP is performed employing microelectrodes, an approach with attractive characteristics but expensive due to microelectrode fabrication costs. An alternative is insulator-based DEP, a method where non-uniform electric fields are created with arrays of insulating structures. This study presents the concentration of linear DNA particles (pET28b) employing a microchannel, with an array of cylindrical insulating structures and direct current electric fields. Results showed manipulation of DNA particles with a combination of electroosmotic, electrophoretic, and dielectrophoretic forces. Employing suspending media with conductivity of 104 muS/cm and pH of 11.15, under applied fields between 500 and 1500 V/cm, DNA particles were observed to be immobilized due to negative dielectrophoretic trapping. The observation of DNA aggregates that occurred at higher applied fields, and dispersed once the field was removed is also included. Finally, concentration factors varying from 8 to 24 times the feed concentration were measured at 2000 V/cm after concentration time-periods of 20-40 s. The results presented here demonstrate the potential of insulator-based DEP for DNA concentration, and open the possibility for fast DNA manipulation for laboratory and large-scale applications.

  3. INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis

    SciTech Connect

    Ausin, Israel; Greenberg, Maxim V.C.; Simanshu, Dhirendra K.; Hale, Christopher J.; Vashisht, Ajay A.; Simon, Stacey A.; Lee, Tzuu-fen; Feng, Suhua; Española, Sophia D.; Meyers, Blake C.; Wohlschlegel, James A.; Patel, Dinshaw J.; Jacobsen, Steven E.

    2012-10-23

    At least three pathways control maintenance of DNA cytosine methylation in Arabidopsis thaliana. However, the RNA-directed DNA methylation (RdDM) pathway is solely responsible for establishment of this silencing mark. We previously described INVOLVED IN DE NOVO 2 (IDN2) as being an RNA-binding RdDM component that is required for DNA methylation establishment. In this study, we describe the discovery of two partially redundant proteins that are paralogous to IDN2 and that form a stable complex with IDN2 in vivo. Null mutations in both genes, termed IDN2-LIKE 1 and IDN2-LIKE 2 (IDNL1 and IDNL2), result in a phenotype that mirrors, but does not further enhance, the idn2 mutant phenotype. Genetic analysis suggests that this complex acts in a step in the downstream portion of the RdDM pathway. We also have performed structural analysis showing that the IDN2 XS domain adopts an RNA recognition motif (RRM) fold. Finally, genome-wide DNA methylation and expression analysis confirms the placement of the IDN proteins in an RdDM pathway that affects DNA methylation and transcriptional control at many sites in the genome. Results from this study identify and describe two unique components of the RdDM machinery, adding to our understanding of DNA methylation control in the Arabidopsis genome.

  4. Directly observing the motion of DNA molecules near solid-state nanopores.

    PubMed

    Ando, Genki; Hyun, Changbae; Li, Jiali; Mitsui, Toshiyuki

    2012-11-27

    We investigate the diffusion and the drift motion of λ DNA molecules near solid-state nanopores prior to their translocation through the nanopores using fluorescence microscopy. The radial dependence of the electric field near a nanopore generated by an applied voltage in ionic solution can be estimated quantitatively in 3D by analyzing the motion of negatively charged DNA molecules. We find that the electric field is approximately spherically symmetric around the nanopore under the conditions investigated. In addition, DNA clogging at the nanopore was directly observed. Surprisingly, the probability of the clogging event increases with increasing external bias voltage. We also find that DNA molecules clogging the nanopore reduce the electric field amplitude at the nanopore membrane surface. To better understand these experimental results, analytical method with Ohm's law and computer simulation with Poisson and Nernst-Planck (PNP) equations are used to calculate the electric field near the nanopore. These results are of great interest in both experimental and theoretical considerations of the motion of DNA molecules near voltage-biased nanopores. These findings will also contribute to the development of solid-state nanopore-based DNA sensing devices.

  5. Chemical mapping of DNA and counter-ion content inside phage by energy-filtered TEM.

    PubMed

    Nevsten, Pernilla; Evilevitch, Alex; Wallenberg, Reine

    2012-03-01

    Double-stranded DNA in many bacterial viruses (phage) is strongly confined, which results in internal genome pressures of tens of atmospheres. This pressure is strongly dependent on local ion concentration and distribution within the viral capsid. Here, we have used electron energy loss spectroscopy (EELS), energy-filtered TEM (EFTEM) and X-ray energy dispersive spectroscopy to provide such chemical information from the capsid and the phage tail through which DNA is injected into the cell. To achieve this, we have developed a method to prepare thin monolayers of self-supporting virus/buffer films, suitable for EELS and EFTEM analysis. The method is based on entrapment of virus particles at air-liquid interfaces; thus, the commonly used method of staining by heavy metal salts can be avoided, eliminating the risk for chemical artifacts. We found that Mg(2 + ) concentration was approximately 2-4 times higher in the DNA-filled capsid than in the surrounding TM buffer (containing 10 mM Mg(2 + )). Furthermore, we also analyzed the DNA content inside the phage tail by mapping phosphorus and magnesium.

  6. DNA-directed gold nanodimers with tailored ensemble surface-enhanced Raman scattering properties.

    PubMed

    Lan, Xiang; Chen, Zhong; Lu, Xuxing; Dai, Gaole; Ni, Weihai; Wang, Qiangbin

    2013-11-13

    Gold nanodimers (GNDs) are assembled with high uniformity as ideal surface-enhanced Raman scattering (SERS) substrates through DNA-directed self-assembly of gold nanoparticles. The interparticle distance within GNDs is precisely tailored on the order of a few nanometers with changing the molecule length of DNA bridge. The ensemble SERS activity of monodispersed GNDs is then rationally engineered by modifying the structural parameters of GNDs including the particle size and interparticle distance. Theoretical studies on the level of single GND evidence the particle size- and interparticle-distance-dependent SERS effects, consistent with the ensemble averaged measurements.

  7. Synthesis of RNA probes by the direct in vitro transcription of PCR-generated DNA templates.

    PubMed

    Urrutia, R; McNiven, M A; Kachar, B

    1993-05-01

    We describe a novel method for the generation of RNA probes based on the direct in vitro transcription of DNA templates amplified by polymerase chain reaction (PCR) using primers with sequence hybrids between the target gene and those of the T7 and T3 RNA polymerases promoters. This method circumvents the need for cloning and allows rapid generation of strand-specific RNA molecules that can be used for the identification of genes in hybridization experiments. We have successfully applied this method to the identification of DNA sequences by Southern blot analysis and library screening.

  8. Directionality of replication fork movement determined by two-dimensional native-native DNA agarose gel electrophoresis.

    PubMed

    Ivessa, Andreas S

    2013-01-01

    The analysis of replication intermediates by the neutral-neutral two-dimensional agarose gel technique allows determining the chromosomal positions where DNA replication initiates, whether replication forks pause or stall at specific sites, or whether two DNA molecules undergo DNA recombination events. This technique does not, however, immediately tell in which direction replication forks migrate through the DNA region under investigation. Here, we describe the procedure to determine the direction of replication fork progression by carrying out a restriction enzyme digest of DNA imbedded in agarose after the completion of the first dimension of a 2D gel.

  9. Gamma and ion-beam irradiation of DNA: Free radical mechanisms, electron effects, and radiation chemical track structure

    NASA Astrophysics Data System (ADS)

    Sevilla, Michael D.; Becker, David; Kumar, Anil; Adhikary, Amitava

    2016-11-01

    The focus of our laboratory's investigation is to study the direct-type DNA damage mechanisms resulting from γ-ray and ion-beam radiation-induced free radical processes in DNA which lead to molecular damage important to cellular survival. This work compares the results of low LET (γ-) and high LET (ion-beam) radiation to develop a chemical track structure model for ion-beam radiation damage to DNA. Recent studies on protonation states of cytosine cation radicals in the N1-substituted cytosine derivatives in their ground state and 5-methylcytosine cation radicals in ground as well as in excited state are described. Our results exhibit a radical signature of excitations in 5-methylcytosine cation radical. Moreover, our recent theoretical studies elucidate the role of electron-induced reactions (low energy electrons (LEE), presolvated electrons (epre-), and aqueous (or, solvated) electrons (eaq-)). Finally DFT calculations of the ionization potentials of various sugar radicals show the relative reactivity of these species.

  10. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

    PubMed

    Bauer, Amy L; Hlavacek, William S; Unkefer, Pat J; Mu, Fangping

    2010-11-18

    An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF). Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  11. Fluorescence Enhancement at Docking Sites of DNA-Directed Self-Assembled Nanoantennas

    NASA Astrophysics Data System (ADS)

    Acuna, G. P.; Möller, F. M.; Holzmeister, P.; Beater, S.; Lalkens, B.; Tinnefeld, P.

    2012-10-01

    We introduce self-assembled nanoantennas to enhance the fluorescence intensity in a plasmonic hotspot of zeptoliter volume. The nanoantennas are prepared by attaching one or two gold nanoparticles (NPs) to DNA origami structures, which also incorporated docking sites for a single fluorescent dye next to one NP or in the gap between two NPs. We measured the dependence of the fluorescence enhancement on NP size and number and compare it to numerical simulations. A maximum of 117-fold fluorescence enhancement was obtained for a dye molecule positioned in the 23-nanometer gap between 100-nanometer gold NPs. Direct visualization of the binding and unbinding of short DNA strands, as well as the conformational dynamics of a DNA Holliday junction in the hotspot of the nanoantenna, show the compatibility with single-molecule assays.

  12. Direct Oxidative Damage of Naked DNA Generated upon Absorption of UV Radiation by Nucleobases.

    PubMed

    Gomez-Mendoza, Miguel; Banyasz, Akos; Douki, Thierry; Markovitsi, Dimitra; Ravanat, Jean-Luc

    2016-10-06

    It has been shown that in addition to formation of pyrimidine dimers, UV irradiation of DNA in the absence of photosensitizer also induces formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine, but the mechanism of formation of that oxidized base has not been clearly established. In the present study, we provide an unambiguous demonstration that absorption of UVC and UVB radiation by the nucleobases induces DNA oxidation via a direct process (one-electron oxidation) and not singlet oxygen. Evidence arose from the fact that polyamine-guanine adducts that are specifically produced through the transient formation of guanine radical cation are generated following UV irradiation of DNA in the presence of a polyamine even in the absence of any photosensitizer.

  13. DIRECT-ACTING, DNA-DAMAGING AS (III)-METHYLATED SPECIES: IMPLICATIONS FOR A CARCINOGENIC MECHANISM OF ACTION OF ARSENICALS

    EPA Science Inventory

    Direct-acting, DNA-damaging As (III)-methylated species: implications for a carcinogenic . mechanism of action of arsenicals

    Inorganic arsenic (iAs, arsenite and arsenate) has been thought to act as a carcinogen without reacting directly with DNA; neither iAs nor the As(...

  14. Mechanism of human methyl-directed DNA methyltransferase and the fidelity of cytosine methylation.

    PubMed Central

    Smith, S S; Kaplan, B E; Sowers, L C; Newman, E M

    1992-01-01

    The properties of the methyl-directed DNA (cytosine-5-)-methyltransferase (EC 2.1.1.37) suggest that it is the enzyme that maintains patterns of methylation in the human genome. Proposals for the enzyme's mechanism of action suggest that 5-methyldeoxycytidine is produced from deoxycytidine via a dihydrocytosine intermediate. We have used an oligodeoxynucleotide containing 5-fluorodeoxycytidine as a suicide substrate to capture the enzyme and the dihydrocytosine intermediate. Gel retardation experiments demonstrate the formation of the expected covalent complex between duplex DNA containing 5-fluorodeoxycytidine and the human enzyme. Formation of the complex was dependent upon the presence of the methyl donor S-adenosylmethionine, suggesting that it comprises an enzyme-linked 5-substituted dihydrocytosine moiety in DNA. Dihydrocytosine derivatives are extremely labile toward hydrolytic deamination in aqueous solution. Because C-to-T transition mutations are especially prevalent at CG sites in human DNA, we have used high-performance liquid chromatography to search for thymidine that might be generated by hydrolysis during the methyl transfer reaction. Despite the potential for deamination inherent in the formation of the intermediate, the methyltransferase did not produce detectable amounts of thymidine. The data suggest that the ability of the human methyltransferase to preserve genetic information when copying a methylation pattern (i.e., its fidelity) is comparable to the ability of a mammalian DNA polymerase to preserve genetic information when copying a DNA sequence. Thus the high frequency of C-to-T transitions at CG sites in human DNA does not appear to be due to the normal enzymatic maintenance of methylation patterns. Images PMID:1584813

  15. Direct ultrasensitive electrochemical biosensing of pathogenic DNA using homogeneous target-initiated transcription amplification

    NASA Astrophysics Data System (ADS)

    Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei

    2016-01-01

    Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification.

  16. Direct ultrasensitive electrochemical biosensing of pathogenic DNA using homogeneous target-initiated transcription amplification

    PubMed Central

    Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei

    2016-01-01

    Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification. PMID:26729209

  17. Specific and reversible DNA-directed self-assembly of oil-in-water emulsion droplets.

    PubMed

    Hadorn, Maik; Boenzli, Eva; Sørensen, Kristian T; Fellermann, Harold; Eggenberger Hotz, Peter; Hanczyc, Martin M

    2012-12-11

    Higher-order structures that originate from the specific and reversible DNA-directed self-assembly of microscopic building blocks hold great promise for future technologies. Here, we functionalized biotinylated soft colloid oil-in-water emulsion droplets with biotinylated single-stranded DNA oligonucleotides using streptavidin as an intermediary linker. We show the components of this modular linking system to be stable and to induce sequence-specific aggregation of binary mixtures of emulsion droplets. Three length scales were thereby involved: nanoscale DNA base pairing linking microscopic building blocks resulted in macroscopic aggregates visible to the naked eye. The aggregation process was reversible by changing the temperature and electrolyte concentration and by the addition of competing oligonucleotides. The system was reset and reused by subsequent refunctionalization of the emulsion droplets. DNA-directed self-assembly of oil-in-water emulsion droplets, therefore, offers a solid basis for programmable and recyclable soft materials that undergo structural rearrangements on demand and that range in application from information technology to medicine.

  18. A clickable psoralen to directly quantify DNA interstrand crosslinking and repair.

    PubMed

    Evison, Benjamin J; Actis, Marcelo L; Fujii, Naoaki

    2016-03-01

    DNA interstrand crosslinks (ICLs) represent physical obstacles to advancing replication forks and transcription complexes. A range of ICL-inducing agents have successfully been incorporated into cancer therapeutics. While studies have adopted UVA-activated psoralens as model ICL-inducing agents for investigating ICL repair, direct detection of the lesion has often been tempered by tagging the psoralen scaffold with a relatively large reporter group that may perturb the biological activity of the parent psoralen. Here a minimally-modified psoralen probe was prepared featuring a small alkyne handle suitable for click chemistry. The psoralen probe, designated 8-propargyloxypsoralen (8-POP), can be activated by UVA in vitro to generate ICLs that are susceptible to post-labeling with an azide-tagged fluorescent reporter via a copper-catalyzed reaction. A modified alkaline comet assay demonstrated that UVA-activated 8-POP proficiently generated ICLs in cells. Cellular 8-POP-DNA lesions were amenable to click-mediated ligation to fluorescent reporters in situ, which permitted their detection and quantitation by fluorescence microscopy and flow cytometry. Small molecule DNA repair inhibitors to 8-POP-treated cells attenuated the removal of 8-POP-DNA lesions, validating 8-POP as an appropriate probe for investigating cellular ICL repair. The post-labeling strategy applied in this study is inexpensive, rapid and highly modular in nature with the potential for multiple applications in DNA repair studies.

  19. Chase the direct impact of rainfall into groundwater in Mt. Fuji from multiple analyses including microbial DNA

    NASA Astrophysics Data System (ADS)

    Kato, Kenji; Sugiyama, Ayumi; Nagaosa, Kazuyo; Tsujimura, Maki

    2016-04-01

    A huge amount of groundwater is stored in subsurface environment of Mt. Fuji, the largest volcanic mountain in Japan. Based on the concept of piston flow transport of groundwater an apparent residence time was estimated to ca. 30 years by 36Cl/Cl ratio (Tosaki et al., 2011). However, this number represents an averaged value of the residence time of groundwater which had been mixed before it flushes out. We chased signatures of direct impact of rainfall into groundwater to elucidate the routes of groundwater, employing three different tracers; stable isotopic analysis (delta 18O), chemical analysis (concentration of silica) and microbial DNA analysis. Though chemical analysis of groundwater shows an averaged value of the examined water which was blended by various water with different sources and routes in subsurface environment, microbial DNA analysis may suggest the place where they originated, which may give information of the source and transport routes of the water examined. Throughout the in situ observation of four rainfall events showed that stable oxygen isotopic ratio of spring water and shallow groundwater obtained from 726m a.s.l. where the average recharge height of rainfall was between 1500 and 1800 m became higher than the values before a torrential rainfall, and the concentration of silica decreased after this event when rainfall exceeded 300 mm in precipitation of an event. In addition, the density of Prokaryotes in spring water apparently increased. Those changes did not appear when rainfall did not exceed 100 mm per event. Thus, findings shown above indicated a direct impact of rainfall into shallow groundwater, which appeared within a few weeks of torrential rainfall in the studied geological setting. In addition, increase in the density of Archaea observed at deep groundwater after the torrential rainfall suggested an enlargement of the strength of piston flow transport through the penetration of rainfall into deep groundwater. This finding was

  20. Stream grazers determine their crawling direction on the basis of chemical and particulate microalgal cues.

    PubMed

    Katano, Izumi; Doi, Hideyuki

    2014-01-01

    This study aimed to determine the association between herbivore behavior and cues from producers. We used stream grazer Glossosoma larvae and determined their crawling direction in relation to chemical and visual cues from microalgae. The experimental treatments included control (no cue), particulate (chemical and particulate cues), and dissolved (chemical cue) cues from microalgae. The experimental water samples were randomly placed into either arm of a Y-shaped channel, and the crawling direction of the grazers was determined. Although the grazers crawled toward the arm containing either particulate or dissolved cues, they preferred the arm with particulate cues. This suggested that grazers responded well to both particulate (i.e., drifting algal cells) and chemical (algal smell) cues, and that particulate cues were more important for foraging. In natural habitats, grazers detect cues from producers and change their behaviors to maintain a balance between top-down and bottom-up cues.

  1. DNA polymerases engineered by directed evolution to incorporate non-standard nucleotides

    PubMed Central

    Laos, Roberto; Thomson, J. Michael; Benner, Steven A.

    2014-01-01

    DNA polymerases have evolved for billions of years to accept natural nucleoside triphosphate substrates with high fidelity and to exclude closely related structures, such as the analogous ribonucleoside triphosphates. However, polymerases that can accept unnatural nucleoside triphosphates are desired for many applications in biotechnology. The focus of this review is on non-standard nucleotides that expand the genetic “alphabet.” This review focuses on experiments that, by directed evolution, have created variants of DNA polymerases that are better able to accept unnatural nucleotides. In many cases, an analysis of past evolution of these polymerases (as inferred by examining multiple sequence alignments) can help explain some of the mutations delivered by directed evolution. PMID:25400626

  2. Deep UV generation and direct DNA photo-interaction by harmonic nanoparticles in labelled samples

    NASA Astrophysics Data System (ADS)

    Staedler, Davide; Magouroux, Thibaud; Passemard, Solène; Schwung, Sebastian; Dubled, Marc; Schneiter, Guillaume Stéphane; Rytz, Daniel; Gerber-Lemaire, Sandrine; Bonacina, Luigi; Wolf, Jean-Pierre

    2014-02-01

    A biophotonics approach based on the nonlinear optical process of second harmonic generation is presented and demonstrated on malignant human cell lines labelled by harmonic nanoparticles. The method enables independent imaging and therapeutic action, selecting each modality by simply tuning the excitation laser wavelength from infrared to visible. In particular, the generation of deep ultraviolet radiation at 270 nm allows direct interaction with nuclear DNA in the absence of photosensitizing molecules.

  3. Simple and efficient oligonucleotide-directed mutagenesis using one primer and circular plasmid DNA template.

    PubMed

    Marotti, K R; Tomich, C S

    1989-01-01

    A rapid and simple procedure for site-directed mutagenesis is described. This method uses only a single oligonucleotide primer with the double-stranded circular plasmid DNA as the template for mutagenesis. The phage T4 gene 32 product is included during primer extension in vitro to increase efficiency. Single and multiple changes as well as deletions have been obtained at an efficiency of 1-2%.

  4. The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

    PubMed

    Rubinovich, Leonid; Polak, Micha

    2013-05-08

    Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

  5. PE-Swab Direct STR Amplification of Forensic Touch DNA Samples.

    PubMed

    Liu, Jason Y

    2015-05-01

    The PE-Swab direct STR amplification workflow was developed to process low-level "touch DNA" samples. In this workflow, a forensic sample is first collected on a 4-mm PE-Swab (a novel sample collection device); two 2-mm punches containing collected samples are then generated from the PE-Swab and directly amplified for STR typing. Compared to the conventional STR workflow, which involves DNA extraction, purification, and elution volume reduction, the PE-Swab direct STR amplification workflow does not require sample preparation and takes <60 sec before a touch sample is ready for STR amplification. Because there is no DNA loss due to sample preparation, the PE-Swab workflow is more sensitive than the conventional STR workflow. The average peak height per sample obtained by the PE-swab workflow is 3 times higher than that from the conventional workflow with both low-level single source and two-contributor mixture samples tested in this study.

  6. Directed self-assembly of block copolymer films on atomically-thin graphene chemical patterns

    NASA Astrophysics Data System (ADS)

    Chang, Tzu-Hsuan; Xiong, Shisheng; Jacobberger, Robert M.; Mikael, Solomon; Suh, Hyo Seon; Liu, Chi-Chun; Geng, Dalong; Wang, Xudong; Arnold, Michael S.; Ma, Zhenqiang; Nealey, Paul F.

    2016-08-01

    Directed self-assembly of block copolymers is a scalable method to fabricate well-ordered patterns over the wafer scale with feature sizes below the resolution of conventional lithography. Typically, lithographically-defined prepatterns with varying chemical contrast are used to rationally guide the assembly of block copolymers. The directed self-assembly to obtain accurate registration and alignment is largely influenced by the assembly kinetics. Furthermore, a considerably broad processing window is favored for industrial manufacturing. Using an atomically-thin layer of graphene on germanium, after two simple processing steps, we create a novel chemical pattern to direct the assembly of polystyrene-block-poly(methyl methacrylate). Faster assembly kinetics are observed on graphene/germanium chemical patterns than on conventional chemical patterns based on polymer mats and brushes. This new chemical pattern allows for assembly on a wide range of guiding periods and along designed 90° bending structures. We also achieve density multiplication by a factor of 10, greatly enhancing the pattern resolution. The rapid assembly kinetics, minimal topography, and broad processing window demonstrate the advantages of inorganic chemical patterns composed of hard surfaces.

  7. Directed self-assembly of block copolymer films on atomically-thin graphene chemical patterns

    PubMed Central

    Chang, Tzu-Hsuan; Xiong, Shisheng; Jacobberger, Robert M.; Mikael, Solomon; Suh, Hyo Seon; Liu, Chi-Chun; Geng, Dalong; Wang, Xudong; Arnold, Michael S.; Ma, Zhenqiang; Nealey, Paul F.

    2016-01-01

    Directed self-assembly of block copolymers is a scalable method to fabricate well-ordered patterns over the wafer scale with feature sizes below the resolution of conventional lithography. Typically, lithographically-defined prepatterns with varying chemical contrast are used to rationally guide the assembly of block copolymers. The directed self-assembly to obtain accurate registration and alignment is largely influenced by the assembly kinetics. Furthermore, a considerably broad processing window is favored for industrial manufacturing. Using an atomically-thin layer of graphene on germanium, after two simple processing steps, we create a novel chemical pattern to direct the assembly of polystyrene-block-poly(methyl methacrylate). Faster assembly kinetics are observed on graphene/germanium chemical patterns than on conventional chemical patterns based on polymer mats and brushes. This new chemical pattern allows for assembly on a wide range of guiding periods and along designed 90° bending structures. We also achieve density multiplication by a factor of 10, greatly enhancing the pattern resolution. The rapid assembly kinetics, minimal topography, and broad processing window demonstrate the advantages of inorganic chemical patterns composed of hard surfaces. PMID:27528258

  8. Chemical synthesis, DNA incorporation and biological study of a new photocleavable 2′-deoxyadenosine mimic

    PubMed Central

    Berthet, Nathalie; Crey-Desbiolles, Caroline; Kotera, Mitsuharu; Dumy, Pascal

    2009-01-01

    The phototriggered cleavage of chemical bonds has found numerous applications in biology, particularly in the field of gene sequencing through photoinduced DNA strand scission. However, only a small number of modified nucleosides that are able to cleave DNA at selected positions have been reported in the literature. Herein, we show that a new photoactivable deoxyadenosine analogue, 3-nitro-3-deaza-2′-deoxyadenosine (d(3-NiA)), was able to induce DNA backbone breakage upon irradiation (λ > 320 nm). The d(3-NiA) nucleoside was chemically incorporated at desired positions into 40-mer oligonucleotides as a phosphoramidite monomer and subsequent hybridization studies confirmed that the resulting modified duplexes display a behaviour that is close to that of the related natural sequence. Enzymatic action of the Klenow fragment exonuclease free revealed the preferential incorporation of dAMP opposite the 3-NiA base. On the other hand, incorporation of the analogous 3-NiA triphosphate to a primer revealed high enzyme efficiency and selectivity for insertion opposite thymine. Furthermore, only the enzymatically synthesized base pair 3-NiA:T was a substrate for further extension by the enzyme. All the hybridization and enzymatic data indicate that this new photoactivable 3-NiA triphosphate can be considered as a photochemically cleavable dATP analogue. PMID:19586934

  9. The role of reactivity in DNA templated native chemical PNA ligation during PCR.

    PubMed

    Roloff, Alexander; Seitz, Oliver

    2013-06-15

    DNA templated fluorogenic reactions have been used as a diagnostic tool for the sequence specific detection of nucleic acids; and it has been shown that the native chemical ligation between thioester- and 1,2-aminothiol-modified PNA probes is amongst the most selective DNA detection methods reported. We explored whether a DNA templated reaction can be interfaced with the polymerase chain reaction (PCR). This endeavor posed a significant challenge. The reactive groups involved must be sufficiently stable to tolerate the high temperature applied in the PCR process. Nevertheless, the ligation reaction must proceed very rapidly and sequence specifically within the short time available in the annealing and primer extension steps before denaturation is used after approx. 1 min to commence the next PCR cycle. This required a careful optimization of the ternary complex architecture as well as adjustments of probe length and probe reactivities. Our results point to the prime importance of the ligation architecture. We show that once suitable annealing sites have been identified less reactive probe sets may be preferable if sequence specificity is of major concern. The reactivity tuning enabled the development of an in-PCR ligation, which was used for the single nucleotide specific typing of the V600E (T1799A) point mutation in the human BRaf gene. Showcasing the efficiency and sequence specificity of native chemical PNA ligation, attomolar template proofed sufficient to trigger signal while a 1000-fold higher load of single mismatched template failed to induce appreciable signal.

  10. Initiation of simian virus 40 DNA replication in vitro: aphidicolin causes accumulation of early-replicating intermediates and allows determination of the initial direction of DNA synthesis.

    PubMed Central

    Decker, R S; Yamaguchi, M; Possenti, R; DePamphilis, M L

    1986-01-01

    Aphidicolin, a specific inhibitor of DNA polymerase alpha, provided a novel method for distinguishing between initiation of DNA synthesis at the simian virus 40 (SV40) origin of replication (ori) and continuation of replication beyond ori. In the presence of sufficient aphidicolin to inhibit total DNA synthesis by 50%, initiation of DNA replication in SV40 chromosomes or ori-containing plasmids continued in vitro, whereas DNA synthesis in the bulk of SV40 replicative intermediate DNA (RI) that had initiated replication in vivo was rapidly inhibited. This resulted in accumulation of early RI in which most nascent DNA was localized within a 600- to 700-base-pair region centered at ori. Accumulation of early RI was observed only under conditions that permitted initiation of SV40 ori-dependent, T-antigen-dependent DNA replication and only when aphidicolin was added to the in vitro system. Increasing aphidicolin concentrations revealed that DNA synthesis in the ori region was not completely resistant to aphidicolin but simply less sensitive than DNA synthesis at forks that were farther away. Since DNA synthesized in the presence of aphidicolin was concentrated in the 300 base pairs on the early gene side of ori, we conclude that the initial direction of DNA synthesis was the same as that of early mRNA synthesis, consistent with the model proposed by Hay and DePamphilis (Cell 28:767-779, 1982). The data were also consistent with initiation of the first DNA chains in ori by CV-1 cell DNA primase-DNA polymerase alpha. Synthesis of pppA/G(pN)6-8(pdN)21-23 chains on a single-stranded DNA template by a purified preparation of this enzyme was completely resistant to aphidicolin, and further incorporation of deoxynucleotide monophosphates was inhibited. Therefore, in the presence of aphidicolin, this enzyme could initiate RNA-primed DNA synthesis at ori first in the early gene direction and then in the late gene direction, but could not continue DNA synthesis for an extended

  11. Surface plasmon resonance technique for directly probing the interaction of DNA and graphene oxide and ultra-sensitive biosensing.

    PubMed

    Xue, Tianyu; Cui, Xiaoqiang; Guan, Weiming; Wang, Qiyu; Liu, Chang; Wang, Haitao; Qi, Kun; Singh, D J; Zheng, Weitao

    2014-08-15

    The binding of DNA with graphene oxide (GO) is important for applications in disease diagnosis, genetic screening, and drug discovery. The standard assay methods are mainly limited to indirect observation via fluorescence labeling. Here we report the use of surface plasmon resonance for direct sensing of DNA/GO binding. We show that this can be used for ultra-sensitive detection of single-stranded DNA (ssDNA). Furthermore, the results provide a more direct probe of DNA/GO binding abilities and confirm that hydrogen bonding plays a key role in the interaction between GO and ssDNA. This enables to a novel biosensor for highly sensitive and selective detection of ssDNA based on indirect competitive inhibition assay (ICIA). We report development of such a sensor with a linear dynamic range of 10(-14)-10(-6)M, a detection limit of 10fM and a high level of stability during repeated regeneration.

  12. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  13. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  14. Direct DNA isolation from solid biological sources without pretreatments with proteinase-K and/or homogenization through automated DNA extraction.

    PubMed

    Ki, Jang-Seu; Chang, Ki Byum; Roh, Hee June; Lee, Bong Youb; Yoon, Joon Yong; Jang, Gi Young

    2007-03-01

    Genomic DNA from solid biomaterials was directly isolated with an automated DNA extractor, which was based on magnetic bead technology with a bore-mediated grinding (BMG) system. The movement of the bore broke down the solid biomaterials, mixed crude lysates thoroughly with reagents to isolate the DNA, and carried the beads to the next step. The BMG system was suitable for the mechanical homogenization of the solid biomaterials and valid as an automated system for purifying the DNA from the solid biomaterials without the need for pretreatment or disruption procedures prior to the application of the solid biomaterials.

  15. Direct chemical profiling of olive (Olea europaea) fruit epicuticular waxes by direct electrospray-ultrahigh resolution mass spectrometry.

    PubMed

    Vichi, Stefania; Cortés-Francisco, Nuria; Romero, Agustí; Caixach, Josep

    2015-03-01

    In the present paper, an electrospray ionization (ESI)-Orbitrap method is proposed for the direct chemical profiling of epicuticular wax (EW) from Olea europaea fruit. It constitutes a rapid and efficient tool suitable for a wide-ranging screening of a large number of samples. In a few minutes, the method provides a comprehensive characterization of total EW extracts, based on the molecular formula of their components. Accurate mass measurements are obtained by ultrahigh resolution mass spectrometry, and compositional restrictions are set on the basis of the information available from previous studies of olive EW. By alternating positive and negative ESI modes within the same analysis, complementary results are obtained and a wide range of chemical species is covered. This provides a detailed compositional overview that otherwise would only be available by applying multiple analytical techniques.

  16. Monitoring DNA contamination in handled vs. directly excavated ancient human skeletal remains.

    PubMed

    Pilli, Elena; Modi, Alessandra; Serpico, Ciro; Achilli, Alessandro; Lancioni, Hovirag; Lippi, Barbara; Bertoldi, Francesca; Gelichi, Sauro; Lari, Martina; Caramelli, David

    2013-01-01

    Bones, teeth and hair are often the only physical evidence of human or animal presence at an archaeological site; they are also the most widely used sources of samples for ancient DNA (aDNA) analysis. Unfortunately, the DNA extracted from ancient samples, already scarce and highly degraded, is widely susceptible to exogenous contaminations that can affect the reliability of aDNA studies. We evaluated the molecular effects of sample handling on five human skeletons freshly excavated from a cemetery dated between the 11 to the 14(th) century. We collected specimens from several skeletal areas (teeth, ribs, femurs and ulnas) from each individual burial. We then divided the samples into two different sets: one labeled as "virgin samples" (i.e. samples that were taken by archaeologists under contamination-controlled conditions and then immediately sent to the laboratory for genetic analyses), and the second called "lab samples"(i.e. samples that were handled without any particular precautions and subject to normal washing, handling and measuring procedures in the osteological lab). Our results show that genetic profiles from "lab samples" are incomplete or ambiguous in the different skeletal areas while a different outcome is observed in the "virgin samples" set. Generally, all specimens from different skeletal areas in the exception of teeth present incongruent results between "lab" and "virgin" samples. Therefore teeth are less prone to contamination than the other skeletal areas we analyzed and may be considered a material of choice for classical aDNA studies. In addition, we showed that bones can also be a good candidate for human aDNA analysis if they come directly from the excavation site and are accompanied by a clear taphonomic history.

  17. UVA-induced cyclobutane pyrimidine dimers in DNA: a direct photochemical mechanism?

    PubMed

    Mouret, Stéphane; Philippe, Coralie; Gracia-Chantegrel, Jocelyne; Banyasz, Akos; Karpati, Szilvia; Markovitsi, Dimitra; Douki, Thierry

    2010-04-07

    The carcinogenic action of UVA radiation is commonly attributed to DNA oxidation mediated by endogenous photosensitisers. Yet, it was recently shown that cyclobutane pyrimidine dimers (CPD), well known for their involvement in UVB genotoxicity, are produced in larger yield than oxidative lesions in UVA-irradiated cells and skin. In the present work, we gathered mechanistic information on this photoreaction by comparing formation of all possible bipyrimidine photoproducts upon UVA irradiation of cells, purified genomic DNA and dA(20):dT(20) oligonucleotide duplex. We observed that the distribution of photoproducts, characterized by the sole formation of CPD and the absence of (6-4) photoproducts was similar in the three types of samples. The CPD involving two thymines represented 90% of the amount of photoproducts. Moreover, the yields of formation of the DNA lesions were similar in cells and isolated DNA. In addition, the effect of the wavelength of the incident photons was found to be the same in isolated DNA and cells. This set of data shows that UVA-induced cyclobutane pyrimidine dimers are formed via a direct photochemical mechanism, without mediation of a cellular photosensitiser. This is possible because the double-stranded structure increases the capacity of DNA bases to absorb UVA photons, as evidenced in the case of the oligomer dA(20):dT(20). These results emphasize the need to consider UVA in the carcinogenic effects of sunlight. An efficient photoprotection is needed that can only be complete by completely blocking incident photons, rather than by systemic approaches such as antioxidant supplementation.

  18. Functionalized 2′-Amino-α-L-LNA - Directed Positioning of Intercalators for DNA Targeting

    PubMed Central

    Kumar, T. Santhosh; Madsen, Andreas S.; Østergaard, Michael E.; Sau, Sujay P.; Wengel, Jesper; Hrdlicka, Patrick J.

    2010-01-01

    Chemically modified oligonucleotides are increasingly applied in nucleic acid based therapeutics and diagnostics. LNA (Locked Nucleic Acid) and its diastereomer α-L-LNA are two promising examples hereof that exhibit increased thermal and enzymatic stability. Herein, the synthesis, biophysical characterization and molecular modeling of N2′-functionalized 2′-amino-α-L-LNA is described. Chemoselective N2′-functionalization of protected amino alcohol 1 followed by phosphitylation afforded a structurally varied set of target phosphoramidites, which were incorporated into oligodeoxyribonucleotides. Incorporation of pyrene-functionalized building blocks such as 2′-N-(pyren-1-yl)carbonyl-2′-amino-α-L-LNA (monomer X) led to extraordinary increases in thermal affinity of up to +19.5 °C per modification against DNA targets in particular. In contrast, incorporation of building blocks with small non-aromatic N2′-functionalities such as 2′-N-acetyl-2′-amino-α-L-LNA (monomer V) had detrimental effects on thermal affinity toward DNA/RNA complements with decreases of as much as −16.5 °C per modification. Extensive thermal DNA selectivity, favorable entropic contributions upon duplex formation, hybridization-induced bathochromic shifts of pyrene absorption maxima and increases of circular dichroism signals, and molecular modeling studies suggest that pyrene functionalized 2′-amino-α-L-LNA monomers W-Y having short linkers between the bicyclic skeleton and the pyrene moiety, allow high-affinity hybridization with DNA complements and precise positioning of intercalators in nucleic acid duplexes. This rigorous positional control has been utilized for the development probes for emerging therapeutic and diagnostic applications focusing on DNA-targeting. PMID:19108636

  19. [DNA and chemical analyses of commercial fly agaric-related products].

    PubMed

    Maruyama, Takuro; Kawahara, Nobuo; Fukiharu, Toshimitsu; Yokoyama, Kazumasa; Makino, Yukiko; Goda, Yukihiro

    2005-04-01

    Since June 6, 2002, psilocin and psilocybin-containing fungi (commonly called "magic mushrooms") have been regulated by the Narcotics and Psychotropics Control Law in Japan. However, various fly agaric-related products are now entering the Japanese market via the internet. In this study, fly agaric-related products available in this way were investigated for raw materials by DNA analysis and for additives by chemical analysis. Nucleotide sequence analysis of the mitochondrial 12S rDNA region suggested that these fly agaric-related products originate from A. muscaria or A. muscaria var. persicina. Furthermore, they were classified into three strains based on the ITS2-LSU nucleotide sequence. Harmine derivatives and/or tryptamine derivatives were detected in some of these products by LC/MS analysis. In accordance with this, the matK gene of Peganum harmala was found in all of the harmine derivative-containing samples.

  20. The role of hydration in the distribution of free radical trapping in directly ionized DNA.

    PubMed

    Purkayastha, Shubhadeep; Milligan, Jamie R; Bernhard, William A

    2006-07-01

    The purpose of this study was to elucidate the role of hydration (Gamma) in the distribution of free radical trapping in directly ionized DNA. Solid-state films of pUC18 (2686 bp) plasmids were hydrated to Gamma in the range 2.5 < or = Gamma < or = 22.5 mol water/mol nucleotide. Free radical yields, G(Sigmafr), measured by EPR at 4 K are seen to increase from 0.28 +/- 0.01 micromol/J at Gamma = 2.5 to 0.63 +/- 0.01 micromol/J at Gamma= 22.5, respectively. Based on a semi-empirical model of the free radical trapping events that follow the initial ionizations of the DNA components, we conclude that two-thirds of the holes formed on the inner solvation shell (Gamma < 10) transfer to the sugar-phosphate backbone. Likewise, of the holes produced by direct ionization of the sugar-phosphate, about one-third are trapped by deprotonation as neutral sugar-phosphate radical species, while the remaining two-thirds are found to transfer to the bases. This analysis provides the best measure to date for the probability of hole transfer (approximately 67%) into the base stack. It can thus be predicted that the distribution of holes formed in fully hydrated DNA at 4 K will be 78% on the bases and 22% on the sugar-phosphate. Adding the radicals due to electron attachment (confined to the pyrimidine bases), the distribution of all trapped radicals will be 89% on the bases and 11% on the sugar-phosphate backbone. This prediction is supported by partitioning results obtained from the high dose-response curves fitted to the two-component model. These results not only add to our understanding of how the holes redistribute after ionization but are also central to predicting the yield and location of strand breaks in DNA exposed to the direct effects of ionizing radiation.

  1. Chemical sensing of in situ extracted organics by direct detection of mode-filtered light

    NASA Astrophysics Data System (ADS)

    Synovec, Robert E.; Bruckner, Carsten A.; Burgess, Lloyd W.; Foster, M. D.

    1994-10-01

    A novel chemical analyzer is described in which an optical fiber is inserted into a transparent capillary tube, such that the inner diameter of the tube is only a few microns larger than the outer diameter of the fiber cladding. This configuration is referred to as a torus column. When a sample volume is introduced to the torus column at a low flow rate, propagated light is mode-filtered due to a change in the critical angle at the core/clad interface, as a result of in-situ extracted chemical species. Conventionally, chemical species extracted into the cladding are sensed as a change in the transmitted light at the end of the fiber. An alternative approach, measuring this mode-filtered light directly along the side of the fiber, is reported. The new approach has a signal-to-noise advantage over the conventional approach. The result is a low volume sensor that temporally separates, as well as detects, chemical species that partition into the fiber cladding. The temporal information enhances sensor performance, providing first order information for subsequent data analysis. We have examined the modulation of the critical angle by chemical species of interest at steady-state concentrations, and as transient concentration profiles that were shifted in time. In summary, the analyzer has chemical selectivity provided by differences in the refractive index, distribution coefficient, and transient time of the concentration profile of each chemical species in a sample. The chemical analyzer should be a promising tool for process and environmental monitoring.

  2. Closed-Loop Control of Chemical Injection Rate for a Direct Nozzle Injection System.

    PubMed

    Cai, Xiang; Walgenbach, Martin; Doerpmond, Malte; Schulze Lammers, Peter; Sun, Yurui

    2016-01-20

    To realize site-specific and variable-rate application of agricultural pesticides, accurately metering and controlling the chemical injection rate is necessary. This study presents a prototype of a direct nozzle injection system (DNIS) by which chemical concentration transport lag was greatly reduced. In this system, a rapid-reacting solenoid valve (RRV) was utilized for injecting chemicals, driven by a pulse-width modulation (PWM) signal at 100 Hz, so with varying pulse width the chemical injection rate could be adjusted. Meanwhile, a closed-loop control strategy, proportional-integral-derivative (PID) method, was applied for metering and stabilizing the chemical injection rate. In order to measure chemical flow rates and input them into the controller as a feedback in real-time, a thermodynamic flowmeter that was independent of chemical viscosity was used. Laboratory tests were conducted to assess the performance of DNIS and PID control strategy. Due to the nonlinear input-output characteristics of the RRV, a two-phase PID control process obtained better effects as compared with single PID control strategy. Test results also indicated that the set-point chemical flow rate could be achieved within less than 4 s, and the output stability was improved compared to the case without control strategy.

  3. Closed-Loop Control of Chemical Injection Rate for a Direct Nozzle Injection System

    PubMed Central

    Cai, Xiang; Walgenbach, Martin; Doerpmond, Malte; Schulze Lammers, Peter; Sun, Yurui

    2016-01-01

    To realize site-specific and variable-rate application of agricultural pesticides, accurately metering and controlling the chemical injection rate is necessary. This study presents a prototype of a direct nozzle injection system (DNIS) by which chemical concentration transport lag was greatly reduced. In this system, a rapid-reacting solenoid valve (RRV) was utilized for injecting chemicals, driven by a pulse-width modulation (PWM) signal at 100 Hz, so with varying pulse width the chemical injection rate could be adjusted. Meanwhile, a closed-loop control strategy, proportional-integral-derivative (PID) method, was applied for metering and stabilizing the chemical injection rate. In order to measure chemical flow rates and input them into the controller as a feedback in real-time, a thermodynamic flowmeter that was independent of chemical viscosity was used. Laboratory tests were conducted to assess the performance of DNIS and PID control strategy. Due to the nonlinear input–output characteristics of the RRV, a two-phase PID control process obtained better effects as compared with single PID control strategy. Test results also indicated that the set-point chemical flow rate could be achieved within less than 4 s, and the output stability was improved compared to the case without control strategy. PMID:26805833

  4. Direct recognition of homology between double helices of DNA in Neurospora crassa

    PubMed Central

    Gladyshev, Eugene; Kleckner, Nancy

    2014-01-01

    Chromosomal regions of identical or nearly identical DNA sequence can preferentially associate with one another in the apparent absence of DNA breakage. Molecular mechanism(s) underlying such homology-dependent pairing phenomena remain(s) unknown. Using Neurospora crassa repeat-induced point mutation (RIP) as a model system, we show that a pair of DNA segments can be recognized as homologous if they share triplets of base pairs arrayed with the matching periodicity of 11 or 12 base pairs. This pattern suggests direct interactions between slightly underwound co-aligned DNA duplexes engaging once per turn and over many consecutive turns. The process occurs in the absence of MEI3, the only RAD51/DMC1 protein in N. crassa, demonstrating independence from the canonical homology recognition pathway. A new perspective is thus provided for further analysis of the breakage-independent recognition of homology that underlies RIP and, potentially, other processes where sequence-specific pairing of intact chromosomes is involved. PMID:24699390

  5. Directing folding pathways for multi-component DNA origami nanostructures with complex topology

    NASA Astrophysics Data System (ADS)

    Marras, A. E.; Zhou, L.; Kolliopoulos, V.; Su, H.-J.; Castro, C. E.

    2016-05-01

    Molecular self-assembly has become a well-established technique to design complex nanostructures and hierarchical mesoscale assemblies. The typical approach is to design binding complementarity into nucleotide or amino acid sequences to achieve the desired final geometry. However, with an increasing interest in dynamic nanodevices, the need to design structures with motion has necessitated the development of multi-component structures. While this has been achieved through hierarchical assembly of similar structural units, here we focus on the assembly of topologically complex structures, specifically with concentric components, where post-folding assembly is not feasible. We exploit the ability to direct folding pathways to program the sequence of assembly and present a novel approach of designing the strand topology of intermediate folding states to program the topology of the final structure, in this case a DNA origami slider structure that functions much like a piston-cylinder assembly in an engine. The ability to program the sequence and control orientation and topology of multi-component DNA origami nanostructures provides a foundation for a new class of structures with internal and external moving parts and complex scaffold topology. Furthermore, this work provides critical insight to guide the design of intermediate states along a DNA origami folding pathway and to further understand the details of DNA origami self-assembly to more broadly control folding states and landscapes.

  6. Induction of RNA-directed DNA methylation upon decondensation of constitutive heterochromatin.

    PubMed

    Schoft, Vera K; Chumak, Nina; Mosiolek, Magdalena; Slusarz, Lucyna; Komnenovic, Vukoslav; Brownfield, Lynette; Twell, David; Kakutani, Tetsuji; Tamaru, Hisashi

    2009-09-01

    Centromeric constitutive heterochromatin is marked by DNA methylation and dimethylated histone H3 Lys 9 (H3K9me2) in Arabidopsis. RNA-directed DNA methylation (RdDM) is a process that uses 24-nucleotide (nt) small interfering RNAs (siRNAs) to induce de novo methylation to its homologous DNA sequences. Despite the presence of centromeric 24-nt siRNAs, mutations in genes required for RdDM do not appreciably influence the methylation of centromeric repeats. The mechanism by which constitutive heterochromatin is protected from RdDM remains puzzling. Here, we report that the vegetative cell nuclei (VN) of the male gametophyte (pollen) invariably undergo extensive decondensation of centromeric heterochromatin and lose centromere identity. VN show greatly reduced H3K9me2, phenocopying nuclei carrying a mutation in the chromatin remodeller DECREASE IN DNA METHYLATION 1 (DDM1). However, unlike the situation in ddm1 nuclei, the decondensed heterochromatin retains dense CG methylation and transcriptional silencing, and, unexpectedly, is subjected to RdDM-dependent hypermethylation in non-CG contexts. These findings reveal two assembly orders of silent heterochromatin and implicate the condensed form in blocking the RdDM machinery.

  7. Phosphorylated Rad18 directs DNA Polymerase η to sites of stalled replication

    PubMed Central

    Day, Tovah A.; Palle, Komariah; Barkley, Laura R.; Kakusho, Naoko; Zou, Ying; Tateishi, Satoshi; Verreault, Alain; Masai, Hisao

    2010-01-01

    The E3 ubiquitin ligase Rad18 guides DNA Polymerase eta (Polη) to sites of replication fork stalling and mono-ubiquitinates proliferating cell nuclear antigen (PCNA) to facilitate binding of Y family trans-lesion synthesis (TLS) DNA polymerases during TLS. However, it is unclear exactly how Rad18 is regulated in response to DNA damage and how Rad18 activity is coordinated with progression through different phases of the cell cycle. Here we identify Rad18 as a novel substrate of the essential protein kinase Cdc7 (also termed Dbf4/Drf1-dependent Cdc7 kinase [DDK]). A serine cluster in the Polη-binding motif of Rad18 is phosphorylated by DDK. Efficient association of Rad18 with Polη is dependent on DDK and is necessary for redistribution of Polη to sites of replication fork stalling. This is the first demonstration of Rad18 regulation by direct phosphorylation and provides a novel mechanism for integration of S phase progression with postreplication DNA repair to maintain genome stability. PMID:21098111

  8. High-throughput sequencing allows the identification of binding molecules isolated from DNA-encoded chemical libraries.

    PubMed

    Mannocci, Luca; Zhang, Yixin; Scheuermann, Jörg; Leimbacher, Markus; De Bellis, Gianluca; Rizzi, Ermanno; Dumelin, Christoph; Melkko, Samu; Neri, Dario

    2008-11-18

    DNA encoding facilitates the construction and screening of large chemical libraries. Here, we describe general strategies for the stepwise coupling of coding DNA fragments to nascent organic molecules throughout individual reaction steps as well as the first implementation of high-throughput sequencing for the identification and relative quantification of the library members. The methodology was exemplified in the construction of a DNA-encoded chemical library containing 4,000 compounds and in the discovery of binders to streptavidin, matrix metalloproteinase 3, and polyclonal human IgG.

  9. Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples.

    PubMed

    Schmidt, M; Hoffmann, G; Wissler, M; Lemke, N; Müssig, A; Glimm, H; Williams, D A; Ragg, S; Hesemann, C U; von Kalle, C

    2001-05-01

    By identifying the sequence of retro- and lentiviral integration sites in peripheral blood leukocytes, the clonal composition and fate of genetically modified hematopoietic progenitor and stem cells could be mapped in vitro and in vivo. Previously available methods have been limited to the analysis of mono- or oligoclonal integration sites present in high copy numbers. Here, we perform characterization of multiple rare retroviral and lentiviral integration sites in highly complex DNA samples. The reliability of this method results from nontarget DNA removal via magnetic extension primer tag selection (EPTS) preceding solid-phase ligation-mediated PCR. EPTS/LM-PCR allowed the simultaneous direct genomic sequencing of multiple proviral LTR-flanking sequences of retro- and lentiviral vectors even if only 1 per 100 to 1000 cells contained the provirus. A primer walking "around" the integration locus demonstrated the adaptability of EPTS/LM-PCR to study unknown flanking DNA regions unrelated to proviruses. The technique is fast, inexpensive, and sensitive in minimal samples. It enables studies of retro- and lentiviral integration, viral vector tracking in gene therapy, insertional mutagenesis, transgene integration, and direct genomic sequencing that until now have been difficult or impossible to perform.

  10. Chemical Methylation of RNA and DNA Viral Genomes as a Probe of In Situ Structure

    PubMed Central

    Yamakawa, Minoru; Shatkin, Aaron J.; Furuichi, Yasuhiro

    1981-01-01

    We used [methyl-3H] dimethyl sulfate to probe the genome structures of several RNA and DNA viruses. We compared sites of modification in nucleic acids that were methylated chemically before and after extraction from purified virions. With both single-stranded and double-stranded substrates alkylation occurred mainly at the N7 position of guanine. However, adenine N1 atoms were differentially accessible in single-stranded RNA and DNA. For example, the ratios of 1-methyladenosine to 7-methylguanosine for reovirus mRNA and deproteinized genome RNA were 0.43 and 0.03, respectively. Members of the Reoviridae methylated in situ yielded RNAs with ratios of 0.04 to 0.08, indicating that the intravirion genomes were double stranded. We obtained ratios of 0.26 and 0.35 for the RNAs of dimethyl sulfate-treated brome mosaic and avian sarcoma virions, respectively, which was consistent with partial protection of adenine N1 sites by structural proteins or genome conformation or both. The ratios of 1-methyladenosine to 7-methylguanosine for vaccinia virus DNAs methylated in situ (0.10) and after phenol extraction (0.14) were less than the ratios for φX174 and M13 DNAs (0.39 to 0.64) but considerably greater than the ratio observed with adenovirus DNA (0.002 to 0.02). The presence of a single-stranded region(s) in the vaccinia virus genome was confirmed by S1 nuclease digestion of [methyl-3H] DNA; the released radiolabeled fraction had a ratio of 0.41, compared with 0.025 for the residual duplex DNA. In addition to the structure-dependent accessibility of adenine N1, methylation of adenine N3 was severalfold lower in the intravirion genomes of vaccinia virus, φX174, and adenovirus than in the corresponding extracted DNAs. Chemical methylation of virions and subviral particles should be useful for in situ analyses of specific regions of RNA and DNA genomes, such as the sites of protein binding during virus maturation. PMID:6172596

  11. Direct Conversion of Chemically De-Ashed Coal in Fuel Cells (II)

    SciTech Connect

    Cooper, J F

    2005-07-25

    We review the technical challenges associated with the production and use of various coal chars in a direct carbon conversion fuel cell. Existing chemical and physical deashing processes remove material below levels impacting performance at minimal cost. At equilibrium, sulfur entrained is rejected from the melt as COS in the offgas.

  12. Highly efficient direct conversion of human fibroblasts to neuronal cells by chemical compounds.

    PubMed

    Dai, Ping; Harada, Yoshinori; Takamatsu, Tetsuro

    2015-05-01

    Direct conversion of mammalian fibroblasts into induced neuronal (iN) cells has been attained by forced expression of pro-neural transcriptional factors, or by combining defined factors with either microRNAs or small molecules. Here, we show that neuronal cells can be converted from postnatal human fibroblasts into cell populations with neuronal purities of up to >80% using a combination of six chemical compounds. The chemical compound-induced neuronal cells (CiNCs) express neuron-specific proteins and functional neuron markers. The efficiency of CiNCs is unaffected by either the donor's age or cellular senescence (passage number). We propose this chemical direct converting strategy as a potential approach for highly efficient generation of neuronal cells from human fibroblasts for such uses as in neural disease modeling and regenerative medicine.

  13. Characterization of chemically modified oligonucleotides targeting a pathogenic mutation in human mitochondrial DNA.

    PubMed

    Tonin, Yann; Heckel, Anne-Marie; Dovydenko, Ilya; Meschaninova, Mariya; Comte, Caroline; Venyaminova, Alya; Pyshnyi, Dmitrii; Tarassov, Ivan; Entelis, Nina

    2014-05-01

    Defects in mitochondrial genome can cause a wide range of clinical disorders, mainly neuromuscular diseases. Most of the deleterious mitochondrial mutations are heteroplasmic, meaning that wild type and mutated forms of mtDNA coexist in the same cell. Therefore, a shift in the proportion between mutant and wild type molecules could restore mitochondrial functions. The anti-replicative strategy aims to induce such a shift in heteroplasmy by mitochondrial targeting specifically designed molecules in order to inhibit replication of mutant mtDNA. Recently, we developed mitochondrial RNA vectors that can be used to address anti-replicative oligoribonucleotides into human mitochondria and impact heteroplasmy level, however, the effect was mainly transient, probably due to a rapid degradation of RNA molecules. In the present study, we introduced various chemically modified oligonucleotides in anti-replicative RNAs. We show that the most important increase of anti-replicative molecules' lifetime can be achieved by using synthetic RNA-DNA chimerical molecules or by ribose 2'-O-methylation in nuclease-sensitive sites. The presence of inverted thymidine at 3' terminus and modifications of 2'-OH ribose group did not prevent the mitochondrial uptake of the recombinant molecules. All the modified oligonucleotides were able to anneal specifically with the mutant mtDNA fragment, but not with the wild-type one. Nevertheless, the modified oligonucleotides did not cause a significant effect on the heteroplasmy level in transfected transmitochondrial cybrid cells bearing a pathogenic mtDNA deletion, proving to be less efficient than non-modified RNA molecules.

  14. Direct Monte Carlo simulation of the chemical equilibrium composition of detonation products

    SciTech Connect

    Shaw, M.S.

    1993-06-01

    A new Monte Carlo simulation method has been developed by the author which gives the equilibrium chemical composition of a molecular fluid directly. The usual NPT ensemble (isothermal-isobaric) is implemented with N being the number of atoms instead of molecules. Changes in chemical composition are treated as correlated spatial moves of atoms. Given the interaction potentials between molecular products, ``exact`` EOS points including the equilibrium chemical composition can be determined from the simulations. This method is applied to detonation products at conditions in the region near the Chapman- Jouget state. For the example of NO, it is shown that the CJ detonation velocity can be determined to a few meters per second. A rather small change in cross potentials is shown to shift the chemical equilibrium and the CJ conditions significantly.

  15. Analysis of weblike network structures of directed graphs for chemical reactions in methane plasmas

    SciTech Connect

    Sakai, Osamu Nobuto, Kyosuke; Miyagi, Shigeyuki; Tachibana, Kunihide

    2015-10-15

    Chemical reactions of molecular gases like methane are so complicated that a chart of decomposed and/or synthesized species originating from molecules in plasma resembles a weblike network in which we write down species and reactions among them. Here we consider properties of the network structures of chemical reactions in methane plasmas. In the network, atoms/molecules/radical species are assumed to form nodes and chemical reactions correspond to directed edges in the terminology of graph theory. Investigation of the centrality index reveals importance of CH{sub 3} in the global chemical reaction, and difference of an index for each radical species between cases with and without electrons clarifies that the electrons are at an influential position to tighten the network structure.

  16. Trace DNA evidence dynamics: An investigation into the deposition and persistence of directly- and indirectly-transferred DNA on regularly-used knives.

    PubMed

    Meakin, Georgina E; Butcher, Emma V; van Oorschot, Roland A H; Morgan, Ruth M

    2017-03-21

    Empirical data on the transfer and persistence of trace DNA are crucial to the evaluation of forensic DNA evidence. This evaluation can be complicated by the occurrence of indirect DNA transfer; the possibility of which is well established, but research into such transfer is often focussed on unrealistic situations, e.g. handling of DNA-free items after participants have shaken hands for 1-2min. To simulate more realistic scenarios, this study investigated the deposition and persistence of both directly- and indirectly-transferred DNA on knives that had been artificially set up as 'regularly-used'. Each knife was handled in a prescribed manner by a specific participant over two consecutive days to simulate regular use. Each participant then shook hands for 10s with a fellow volunteer and immediately stabbed one of their knives into a foam block repeatedly for 60s. DNA was recovered by mini-taping from triplicate sets of knife handles from four pairings of volunteers after regular use, and at one hour, one day and one week after the handshaking and stabbing events. Total amounts of DNA recovered from the knives, regularly used by a single person, varied among individuals; one volunteer consistently deposited significantly greater amounts than the others, whilst another volunteer did not always leave complete profiles. DNA attributed to the regular user persisted for at least a week, declining with increasing time between DNA deposition and recovery. Non-donor DNA was co-deposited at <5% of the profiles recovered, except for one volunteer, who consistently left DNA from their romantic partner on their knives at ∼25% and ∼11% of the profiles before and after the handshaking and stabbing events, respectively. In three pairings of volunteers, after the handshaking and stabbing events, alleles that could be attributed to the respective handshakers' profiles were detected as partial minor profiles, equating to ∼10% of the profiles recovered. For the fourth pairing

  17. Directional DNA methylation changes and complex intermediate states accompany lineage specificity in the adult hematopoietic compartment.

    PubMed

    Hodges, Emily; Molaro, Antoine; Dos Santos, Camila O; Thekkat, Pramod; Song, Qiang; Uren, Philip J; Park, Jin; Butler, Jason; Rafii, Shahin; McCombie, W Richard; Smith, Andrew D; Hannon, Gregory J

    2011-10-07

    DNA methylation has been implicated as an epigenetic component of mechanisms that stabilize cell-fate decisions. Here, we have characterized the methylomes of human female hematopoietic stem/progenitor cells (HSPCs) and mature cells from the myeloid and lymphoid lineages. Hypomethylated regions (HMRs) associated with lineage-specific genes were often methylated in the opposing lineage. In HSPCs, these sites tended to show intermediate, complex patterns that resolve to uniformity upon differentiation, by increased or decreased methylation. Promoter HMRs shared across diverse cell types typically display a constitutive core that expands and contracts in a lineage-specific manner to fine-tune the expression of associated genes. Many newly identified intergenic HMRs, both constitutive and lineage specific, were enriched for factor binding sites with an implied role in genome organization and regulation of gene expression, respectively. Overall, our studies represent an important reference data set and provide insights into directional changes in DNA methylation as cells adopt terminal fates.

  18. RecA stimulates AlkB-mediated direct repair of DNA adducts

    PubMed Central

    Shivange, Gururaj; Monisha, Mohan; Nigam, Richa; Kodipelli, Naveena; Anindya, Roy

    2016-01-01

    The Escherichia coli AlkB protein is a 2-oxoglutarate/Fe(II)-dependent demethylase that repairs alkylated single stranded and double stranded DNA. Immunoaffinity chromatography coupled with mass spectrometry identified RecA, a key factor in homologous recombination, as an AlkB-associated protein. The interaction between AlkB and RecA was validated by yeast two-hybrid assay; size-exclusion chromatography and standard pull down experiment and was shown to be direct and mediated by the N-terminal domain of RecA. RecA binding results AlkB–RecA heterodimer formation and RecA–AlkB repairs alkylated DNA with higher efficiency than AlkB alone. PMID:27378775

  19. Evaluating legacy contaminants and emerging chemicals in marine environments using adverse outcome pathways and biological effects-directed analysis.

    PubMed

    Hutchinson, Thomas H; Lyons, Brett P; Thain, John E; Law, Robin J

    2013-09-30

    Natural and synthetic chemicals are essential to our daily lives, food supplies, health care, industries and safe sanitation. At the same time protecting marine ecosystems and seafood resources from the adverse effects of chemical contaminants remains an important issue. Since the 1970s, monitoring of persistent, bioaccumulative and toxic (PBT) chemicals using analytical chemistry has provided important spatial and temporal trend data in three important contexts; relating to human health protection from seafood contamination, addressing threats to marine top predators and finally providing essential evidence to better protect the biodiversity of commercial and non-commercial marine species. A number of regional conventions have led to controls on certain PBT chemicals over several years (termed 'legacy contaminants'; e.g. cadmium, lindane, polycyclic aromatic hydrocarbons [PAHs] and polychlorinated biphenyls [PCBs]). Analytical chemistry plays a key role in evaluating to what extent such regulatory steps have been effective in leading to reduced emissions of these legacy contaminants into marine environments. In parallel, the application of biomarkers (e.g. DNA adducts, CYP1A-EROD, vitellogenin) and bioassays integrated with analytical chemistry has strengthened the evidence base to support an ecosystem approach to manage marine pollution problems. In recent years, however,the increased sensitivity of analytical chemistry, toxicity alerts and wider environmental awareness has led to a focus on emerging chemical contaminants (defined as chemicals that have been detected in the environment, but which are currently not included in regulatory monitoring programmes and whose fate and biological impacts are poorly understood). It is also known that natural chemicals (e.g. algal biotoxins) may also pose a threat to marine species and seafood quality. Hence complex mixtures of legacy contaminants, emerging chemicals and natural biotoxins in marine ecosystems represent

  20. Direct-push geochemical profiling for assessment of inorganic chemical heterogeneity in aquifers

    USGS Publications Warehouse

    Schulmeister, M.K.; Healey, J.M.; Butler, J.J.; McCall, G.W.

    2004-01-01

    Discrete-depth sampling of inorganic groundwater chemistry is essential for a variety of site characterization activities. Although the mobility and rapid sampling capabilities of direct-push techniques have led to their widespread use for evaluating the distribution of organic contaminants, complementary methods for the characterization of spatial variations in geochemical conditions have not been developed. In this study, a direct-push-based approach for high-resolution inorganic chemical profiling was developed at a site where sharp chemical contrasts and iron-reducing conditions had previously been observed. Existing multilevel samplers (MLSs) that span a fining-upward alluvial sequence were used for comparison with the direct-push profiling. Chemical profiles obtained with a conventional direct-push exposed-screen sampler differed from those obtained with an adjacent MLS because of sampler reactivity and mixing with water from previous sampling levels. The sampler was modified by replacing steel sampling components with stainless-steel and heat-treated parts, and adding an adapter that prevents mixing. Profiles obtained with the modified approach were in excellent agreement with those obtained from an adjacent MLS for all constituents and parameters monitored (Cl, NO3, Fe, Mn, DO, ORP, specific conductance and pH). Interpretations of site redox conditions based on field-measured parameters were supported by laboratory analysis of dissolved Fe. The discrete-depth capability of this approach allows inorganic chemical variations to be described at a level of detail that has rarely been possible. When combined with the mobility afforded by direct-push rigs and on-site methods of chemical analysis, the new approach is well suited for a variety of interactive site-characterization endeavors. ?? 2003 Elsevier B.V. All rights reserved.

  1. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome.

    PubMed

    Li, Qing; Gent, Jonathan I; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D; Hirsch, Candice N; Dawe, R Kelly; Madzima, Thelma F; McGinnis, Karen M; Lisch, Damon; Schmitz, Robert J; Vaughn, Matthew W; Springer, Nathan M

    2015-11-24

    The maize genome is relatively large (∼ 2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼ 100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes.

  2. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome

    PubMed Central

    Li, Qing; Gent, Jonathan I.; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D.; Hirsch, Candice N.; Dawe, R. Kelly; Madzima, Thelma F.; McGinnis, Karen M.; Lisch, Damon; Schmitz, Robert J.; Vaughn, Matthew W.; Springer, Nathan M.

    2015-01-01

    The maize genome is relatively large (∼2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes. PMID:26553984

  3. Kinetics of directed self-assembly of block copolymers on chemically patterned substrates

    NASA Astrophysics Data System (ADS)

    Müller, Marcus; Li, Weihua; Orozco Rey, Juan Carlos; Welling, Ulrich

    2015-09-01

    Chemically patterned surfaces have been successfully employed to direct the kinetics of self-assembly of block copolymers into dense, periodic morphologies (”chemoepitaxy”). Significant efforts have been directed towards understanding the kinetics of structure formation and, particularly, the formation and annihilation of defects. In the present manuscript we use computer simulations of a soft, coarse-grained polymer model to study the kinetics of structure formation of lamellar-forming block copolymer thin films on a chemical pattern of lines and spaces. The case where the copolymer material replicates the surface pattern and the more subtle scenario of sparse guiding patterns are considered. Our simulation results highlight (1) the importance of the early stages of pattern-directed self-assembly that template the subsequent morphology and (2) the dependence of the free-energy landscape on the incompatibility between the two blocks of the copolymer.

  4. A chemical enucleation method for the transfer of mitochondrial DNA to rho(o) cells.

    PubMed

    Bayona-Bafaluy, Maria Pilar; Manfredi, Giovanni; Moraes, Carlos T

    2003-08-15

    The study of pathogenic mitochondrial DNA mutations has, in most cases, relied on the production of transmitochondrial cybrids. Although the procedure to produce such cybrids is well established, it is laborious and cumbersome. Moreover, the mechanical enucleation procedure is inefficient and different techniques have to be used depending on the adherence properties of the cell. To circumvent these difficulties, we developed a chemical enucleation method that can have wide applicability for the production of transmitochondrial cybrids. The method is based on the use of actinomycin D to render the nuclear genome transcription/replication inactive and unable to recover after treatment. Such treated cells are fused to cells devoid of mitochondrial DNA and selected for the presence of a functional oxidative phosphorylation system. Our results showed that 95% of the clones recovered by this procedure are true transmitochondrial cybrids. This method greatly facilitates the production of transmitochondrial cybrids, thereby increasing the number of mtDNA mutations and the recipient cell types that can be studied by this system.

  5. Chemically-modified graphenes for oxidation of DNA bases: analytical parameters.

    PubMed

    Goh, Madeline Shuhua; Bonanni, Alessandra; Ambrosi, Adriano; Sofer, Zdeněk; Pumera, Martin

    2011-11-21

    We studied the electroanalytical performances of chemically-modified graphenes (CMGs) containing different defect densities and amounts of oxygen-containing groups, namely graphite oxide (GPO), graphene oxide (GO), thermally reduced graphene oxide (TR-GO) and electrochemically reduced graphene oxide (ER-GO) by comparing the sensitivity, selectivity, linearity and repeatability towards the oxidation of DNA bases. We have observed that for differential pulse voltammetric (DPV) detection of adenine and cytosine, all CMGs showed enhanced sensitivity to oxidation, while for guanine and thymine, ER-GO and TR-GO exhibited much improved sensitivity over bare glassy carbon (GC) as well as over GPO and GO. There is also significant selectivity enhancement when using GPO for adenine and TR-GO for thymine. Our results have uncovered that the differences in surface functionalities, structure and defects of various CMGs largely influence their electrochemical behaviour in detecting the oxidation of DNA bases. The findings in this report will provide a useful guide for the future development of label-free electrochemical devices for DNA analysis.

  6. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  7. Programming chemical kinetics: engineering dynamic reaction networks with DNA strand displacement

    NASA Astrophysics Data System (ADS)

    Srinivas, Niranjan

    Over the last century, the silicon revolution has enabled us to build faster, smaller and more sophisticated computers. Today, these computers control phones, cars, satellites, assembly lines, and other electromechanical devices. Just as electrical wiring controls electromechanical devices, living organisms employ "chemical wiring" to make decisions about their environment and control physical processes. Currently, the big difference between these two substrates is that while we have the abstractions, design principles, verification and fabrication techniques in place for programming with silicon, we have no comparable understanding or expertise for programming chemistry. In this thesis we take a small step towards the goal of learning how to systematically engineer prescribed non-equilibrium dynamical behaviors in chemical systems. We use the formalism of chemical reaction networks (CRNs), combined with mass-action kinetics, as our programming language for specifying dynamical behaviors. Leveraging the tools of nucleic acid nanotechnology (introduced in Chapter 1), we employ synthetic DNA molecules as our molecular architecture and toehold-mediated DNA strand displacement as our reaction primitive. Abstraction, modular design and systematic fabrication can work only with well-understood and quantitatively characterized tools. Therefore, we embark on a detailed study of the "device physics" of DNA strand displacement (Chapter 2). We present a unified view of strand displacement biophysics and kinetics by studying the process at multiple levels of detail, using an intuitive model of a random walk on a 1-dimensional energy landscape, a secondary structure kinetics model with single base-pair steps, and a coarse-grained molecular model that incorporates three-dimensional geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Our findings are consistent with previously measured or inferred rates for

  8. Peptide-Metal Organic Framework Swimmers that Direct the Motion toward Chemical Targets.

    PubMed

    Ikezoe, Yasuhiro; Fang, Justin; Wasik, Tomasz L; Shi, Menglu; Uemura, Takashi; Kitagawa, Susumu; Matsui, Hiroshi

    2015-06-10

    Highly efficient and robust chemical motors are expected for the application in microbots that can selectively swim toward targets and accomplish their tasks in sensing, labeling, and delivering. However, one of major issues for such development is that current artificial swimmers have difficulty controlling their directional motion toward targets like bacterial chemotaxis. To program synthetic motors with sensing capability for the target-directed motion, we need to develop swimmers whose motions are sensitive to chemical gradients in environments. Here we create a new intelligent biochemical swimmer by integrating metal organic frameworks (MOFs) and peptides that can sense toxic heavy metals in solution and swim toward the targets. With the aid of Pb-binding enzymes, the peptide-MOF motor can directionally swim toward PbSe quantum dots (QD) by sensing pH gradient and eventually complete the motion as the swimmer reaches the highest gradient point at the target position in solution. This type of technology could be evolved to miniaturize chemical robotic systems that sense target chemicals and swim toward target locations.

  9. ARSENIC (III) METHYLATED SPECIES REACT WITH DNA DIRECTLY AND COULD BE PROXIMATED/ULTIMATE GENOTOXIC FORMS OF ARSENIC

    EPA Science Inventory


    ARSENIC(III) METHYLATED SPECIES REACT WITH DNA DIRECTL Y AND COULD BE PROXIMATE/ULTIMATE GENOTOXIC FORMS OF ARSENIC


    Arsenite and arsenate (iAs, inorganic arsenic) have been thought to act as genotoxicants without reacting directly with DNA; neither iAs nor As(V) m...

  10. Directed Molecular Evolution Improves the Immunogenicity and Protective Efficacy of a Venezuelan Equine Encephalitis Virus DNA Vaccine

    DTIC Science & Technology

    2009-05-01

    VEEV IA/B challenge. Our results indicate that it is pos- sible to improve the immunogenicity and protective efficacy of alphavirus DNA vaccines using... alphaviruses that ause periodic epizootics in the Americas [1]. These New World lphaviruses cause diseases in humans characterized by fever, eadache...equine encephalitis virus, VEE, alphavirus , DNA vaccine, envelope glycoproteins, directed molecular evolution, efficacy, immunogenicity, laboratory

  11. DNA-directed immobilization of horseradish peroxidase onto porous SiO2 optical transducers

    NASA Astrophysics Data System (ADS)

    Shtenberg, Giorgi; Massad-Ivanir, Naama; Engin, Sinem; Sharon, Michal; Fruk, Ljiljana; Segal, Ester

    2012-08-01

    Multifunctional porous Si nanostructure is designed to optically monitor enzymatic activity of horseradish peroxidase. First, an oxidized PSi optical nanostructure, a Fabry-Pérot thin film, is synthesized and is used as the optical transducer element. Immobilization of the enzyme onto the nanostructure is performed through DNA-directed immobilization. Preliminary studies demonstrate high enzymatic activity levels of the immobilized horseradish peroxidase, while maintaining its specificity. The catalytic activity of the enzymes immobilized within the porous nanostructure is monitored in real time by reflective interferometric Fourier transform spectroscopy. We show that we can easily regenerate the surface for consecutive biosensing analysis by mild dehybridization conditions.

  12. Topoisomerase I-Mediated DNA Cleavage Induced by the Minor Groove-Directed Binding of Bibenzimidazoles to a Distal Site

    PubMed Central

    Khan, Qasim A.; Pilch, Daniel S.

    2007-01-01

    Summary Many agents (e.g., camptothecins, indolocarbazoles, indenoisoquinolines, and dibenzonaphthyridines) stimulate topoisomerase I-mediated DNA cleavage (a behavior termed topoisomerase I poisoning) by interacting with both the DNA and the enzyme at the site of cleavage (typically by intercalation between the −1 and +1 base pairs). The bibenzimidazoles, which include Hoechst 33258 and 33342, are a family of DNA minor groove-directed agents that also stimulate topoisomerase I-mediated DNA cleavage. However, the molecular mechanism by which these ligands poison TOP1 is poorly understood. Toward this goal, we have used a combination of mutational, footprinting, and DNA binding affinity analyses to define the DNA binding site for Hoechst 33258 and a related derivative that results in optimal induction of TOP1-mediated DNA cleavage. We show that this DNA binding site is located downstream from the site of DNA cleavage, encompassing the base pairs from position +4 to +8. The distal nature of this binding site relative to the site of DNA cleavage suggests that minor groove-directed agents like the bibenzimidazoles poison TOP1 via a mechanism distinct from compounds like the camptothecins, which interact at the site of cleavage. PMID:17095016

  13. Polycationic ligands of different chemical classes stimulate DNA strand displacement between short oligonucleotides in a protein-free system.

    PubMed

    Volodin, Alexander A; Bocharova, Tatiana N; Smirnova, Elena A

    2016-09-01

    The ability of polycationic ligands to stimulate DNA strand displacement between short oligonucleotides in a protein-free system is demonstrated. We show that two ligands, tetracationic aliphatic amine (spermine) and a dicationic intercalating drug (chloroquine), promote strand displacement in a concentration-dependent manner. At low concentrations both ligands decelerate spontaneous strand displacement because of their impact on the stability of the DNA duplex. At elevated concentrations they accelerate strand displacement via formation of intermediate structures containing three DNA strands. The rate of the last process does not correlate with the thermal dissociation rate of the entire DNA duplex. It indicates that, possibly, the action of these agents cannot be explained by their influence on the stability of the DNA duplex. In general, our results suggest that the ability to stimulate DNA strand displacement appears to be a common feature of polycations of different chemical and structural classes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 633-641, 2016.

  14. Chemical kinetic behavior of chlorogenic acid in protecting erythrocyte and DNA against radical-induced oxidation.

    PubMed

    Tang, You-Zhi; Liu, Zai-Qun

    2008-11-26

    As an abundant ingredient in coffee, chlorogenic acid (CGA) is a well-known antioxidant. Although some works have dealt with its radical-scavenging property, the present work investigated the protective effects of CGA on the oxidation of DNA and on the hemolysis of human erythrocytes induced by 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH) by means of chemical kinetics. The inhibition period (t(inh)) derived from the protective effect of CGA on erythrocyte and DNA was proportional to its concentration, t(inh) = (n/R(i))[CGA], where R(i) refers to the radical-initiation rate, and n indicates the number of radical-propagation chains terminated by CGA. It was found that the n of CGA to protect erythrocytes was 0.77, lower than that of vitamin E (2.0), but higher than that of vitamin C (0.19). Furthermore, CGA facilitated a mutual protective effect with VE and VC on AAPH-induced hemolysis by increasing n of VE and VC. CGA was also found to be a membrane-stabilizer to protect erythrocytes against hemin-induced hemolysis. Moreover, the n of CGA was only 0.41 in the process of protecting DNA. This fact revealed that CGA served as an efficient antioxidant to protect erythrocytes more than to protect DNA. Finally, the reaction between CGA and 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) radical cation (ABTS(+*)) or 2,2'-diphenyl-1-picrylhydrazyl (DPPH) revealed that CGA was able to trap radicals by reducing radicals more than by donating its hydrogen atoms to radicals.

  15. The effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and X-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to X rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between X-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I-, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  16. Effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and x-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to x rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between x-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I/sup -/, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  17. DNA damage induced by occupational and environmental exposure to miscellaneous chemicals.

    PubMed

    da Silva, Juliana

    Epidemiological studies for hazardous situations resulting from the risk of environmental and/or occupational exposure to miscellaneous chemicals present several difficulties. Biomonitoring of human populations can provide an early detection system for the initiation of cell dysregulation in the development of cancer, which would help develop an efficient prevention program. Recently, the cytokinesis-block micronucleus (CBMN) assay in lymphocyte cells has become an important tool for assessing DNA damage in exposed populations. This is the method of choice for population-based studies of occupational and/or environmental exposure to different agents. In this review, human populations exposed to coal, dyes, paints, organic solvents in a complex mixture, and others miscellaneous chemicals were analyzed. Data from 28 studies was evaluated in relation to the effect of complex mixture exposition on micronucleus (MN) frequency. Other biomarkers and the background factors were evaluated as well, such as gender, age, or smoking habit. Most of these studies (75%) showed a significant increase of micronucleated cells to exposed groups in relation to the control groups, besides chromosomal aberrations (CA), sister chromatid exchanging (SCE) and comet cells (comet assay). The studies from this review about miscellaneous chemicals exposures using CBMN assay have indicated some time and dose-dependent effects. Overall, the findings suggest that the responses resulting from exposure to complex mixtures are varied and complicated. However, they are also an important mechanism of DNA damage concerning disruption of metal ion homeostasis that may lead to oxidative stress, a state where increased formation of reactive oxygen species (ROS) overwhelms body antioxidant protection and subsequently could induce cancer.

  18. A contamination assessment of the CI carbonaceous meteorite Orgueil using a DNA-directed approach

    NASA Astrophysics Data System (ADS)

    Aerts, J. W.; Elsaesser, A.; RöLing, W. F. M.; Ehrenfreund, P.

    2016-05-01

    The Orgueil meteorite has become one of the most well-studied carbonaceous meteorites, after it fell in France 150 yr ago. Extraterrestrial organic compounds such as amino acids and nucleobases in the parts per billion ranges were identified in Orgueil samples with supporting isotopic analyses. However, speculations of terrestrial contamination such as organic inclusions in the form of microbes and seeds accompanied the analyses of the Orgueil meteorite ever since its fall. By using molecular analysis, we performed DNA extractions and spiking experiments combined with 16S and 18S rRNA gene targeted PCR amplification to quantify the level of terrestrial biocontamination. Our results indicate that terrestrial contamination with DNA was insignificant in the investigated meteorite fraction. We also remeasured and confirmed concentrations of amino acids found in previous studies and conclude that their rather high concentrations and distribution cannot be explained by terrestrial contamination with microorganisms alone. These results represent the first analysis using DNA-directed tools in the analysis of the Orgueil meteorite to determine trace levels of biomarkers.

  19. DNA microstructural requirements for neocarzinostatin chromophore-induced direct strand cleavage.

    PubMed Central

    Lee, S H; Thivierge, J O; Goldberg, I H

    1989-01-01

    The microstructural requirements for optimal interaction of neocarzinostatin chromophore (NCS-C) with DNA have been investigated using a series of hexadeoxyribonucleotides with modified bases such as O6-methyl G (MeG), I, 5-methyl C (MeC), U, or 5-Bromo U (BrU) at specific sites in its preferred trinucleotide 5'GNaNb3':5'Na,Nb,C3' (Na = A, C, or T). Results show that MeG:C and G:MeC in place of G:C improve direct strand cleavage at the target Nb (Nb = T greater than A much greater than C greater than G), whereas MeC:G and C:MeG in place of Na:Nb, hinder cleavage. The optimal base target at Nb appears to be determined by its ability to form T:A type base pairing instead of C:G type. The observed differences in DNA strand cleavage patterns can be rationalized by induced changes in target site structure and are compatible with a model for NCS-C:DNA interaction in which the naphthoate moiety intercalates between 5'GNa3', and the activated tetrahydro-s-indacene, lying in the minor groove, abstracts a hydrogen atom from C-5' of Nb. PMID:2527356

  20. Sub-wavelength plasmonic readout for direct linear analysis of optically tagged DNA

    NASA Astrophysics Data System (ADS)

    Varsanik, Jonathan; Teynor, William; LeBlanc, John; Clark, Heather; Krogmeier, Jeffrey; Yang, Tian; Crozier, Kenneth; Bernstein, Jonathan

    2010-02-01

    This work describes the development and fabrication of a novel nanofluidic flow-through sensing chip that utilizes a plasmonic resonator to excite fluorescent tags with sub-wavelength resolution. We cover the design of the microfluidic chip and simulation of the plasmonic resonator using Finite Difference Time Domain (FDTD) software. The fabrication methods are presented, with testing procedures and preliminary results. This research is aimed at improving the resolution limits of the Direct Linear Analysis (DLA) technique developed by US Genomics [1]. In DLA, intercalating dyes which tag a specific 8 base-pair sequence are inserted in a DNA sample. This sample is pumped though a nano-fluidic channel, where it is stretched into a linear geometry and interrogated with light which excites the fluorescent tags. The resulting sequence of optical pulses produces a characteristic "fingerprint" of the sample which uniquely identifies any sample of DNA. Plasmonic confinement of light to a 100 nm wide metallic nano-stripe enables resolution of a higher tag density compared to free space optics. Prototype devices have been fabricated and are being tested with fluorophore solutions and tagged DNA. Preliminary results show evanescent coupling to the plasmonic resonator is occurring with 0.1 micron resolution, however light scattering limits the S/N of the detector. Two methods to reduce scattered light are presented: index matching and curved waveguides.

  1. Self-assembly of molecule-like nanoparticle clusters directed by DNA nanocages.

    PubMed

    Li, Yulin; Liu, Zhiyu; Yu, Guimei; Jiang, Wen; Mao, Chengde

    2015-04-08

    Analogous to the atom-molecule relationship, nanoparticle (NP) clusters (or NP-molecules) with defined compositions and directional bonds could potentially integrate the properties of the component individual NPs, leading to emergent properties. Despite extensive efforts in this direction, no general approach is available for assembly of such NP-molecules. Here we report a general method for building this type of structures by encapsulating NPs into self-assembled DNA polyhedral wireframe nanocages, which serve as guiding agents for further assembly. As a demonstration, a series of NP-molecules have been assembled and validated. Such NP-molecules will, we believe, pave a way to explore new nanomaterials with emergent functions/properties that are related to, but do not belong to the individual component nanoparticles.

  2. Kinetic analysis of oligodeoxyribonucleotide-directed triple-helix formation on DNA.

    PubMed

    Maher, L J; Dervan, P B; Wold, B J

    1990-09-18

    Pyrimidine oligonucleotides recognize extended purine sequences in the major groove of double-helical DNA by triple-helix formation. The resulting local triple helices are relatively stable and can block DNA recognition by sequence-specific DNA binding proteins such as restriction endonucleases. Association and dissociation kinetics for the oligodeoxyribonucleotide 5'-CTCTTTCCTCTCTTTTTCCCC (bold C's indicate 5-methylcytosine residues) are now measured with a restriction endonuclease protection assay. When oligonucleotides are present in greater than 10-fold excess over the DNA target site, the binding reaction kinetics are pseudo first order in oligonucleotide concentration. Under our standard conditions (37 degrees C, 25 mM Tris-acetate, pH 6.8, 70 mM sodium chloride, 20 mM magnesium chloride, 0.4 mM spermine tetrahydrochloride, 10 mM beta-mercaptoethanol, 0.1 mg/mL bovine serum albumin) the value of the observed pseudo-first-order association rate constant, k2obs, is 1.8 x 10(3) +/- 1.9 x 10(2) L.(mol of oligomer-1.s-1. Measurement of the dissociation rate constant yields an equilibrium dissociation constant of approximately 10 nM. Increasing sodium ion concentration slightly decreased the association rate, substantially increased the dissociation rate, and thereby reduced the equilibrium binding constant. This effect was reversible by increasing multivalent cation concentration, confirming the significant role of multivalent cations in oligonucleotide-directed triple-helix formation under these conditions. Finally, a small reduction in association rate, a large increase in dissociation rate, and a resulting reduction in the equilibrium binding constant were observed upon increasing the pH between 6.8 and 7.2.

  3. Trace DNA from insect skins: a comparison of five extraction protocols and direct PCR on chironomid pupal exuviae.

    PubMed

    Kranzfelder, Petra; Ekrem, Torbjørn; Stur, Elisabeth

    2016-01-01

    Insect skins (exuviae) are of extracellular origin and shed during moulting. The skins do not contain cells or DNA themselves, but epithelial cells and other cell-based structures might accidentally attach as they are shed. This source of trace DNA can be sufficient for PCR amplification and sequencing of target genes and aid in species identification through DNA barcoding or association of unknown life stages. Species identification is essential for biomonitoring programs, as species vary in sensitivities to environmental factors. However, it requires a DNA isolation protocol that optimizes the output of target DNA. Here, we compare the relative effectiveness of five different DNA extraction protocols and direct PCR in isolation of DNA from chironomid pupal exuviae. Chironomidae (Diptera) is a species-rich group of aquatic macroinvertebrates widely distributed in freshwater environments and considered a valuable bioindicator of water quality. Genomic DNA was extracted from 61.2% of 570 sampled pupal exuviae. There were significant differences in the methods with regard to cost, handling time, DNA quantity, PCR success, sequence success and the ability to sequence target taxa. The NucleoSpin(®) Tissue XS Kit, DNeasy(®) Blood and Tissue kit, and QuickExtract(™) DNA Extraction Solution provided the best results in isolating DNA from single pupal exuviae. Direct PCR and DTAB/CTAB methods gave poor results. While the observed differences in DNA isolation methods on trace DNA will be relevant to research that focuses on aquatic macroinvertebrate ecology, taxonomy and systematics, they should also be of interest for studies using environmental barcoding and metabarcoding of aquatic environments.

  4. Hybrid Magnetic-DNA Directed Immobilisation Approach for Efficient Protein Capture and Detection on Microfluidic Platforms.

    PubMed

    Esmaeili, Elaheh; Ghiass, Mohammad Adel; Vossoughi, Manouchehr; Soleimani, Masoud

    2017-03-15

    In this study, a hybrid magnetic-DNA directed immobilisation approach is presented to enhance protein capture and detection on a microfluidic platform. DNA-modified magnetic nanoparticles are added in a solution to capture fluorescently labelled immunocomplexes to be detected optically. A magnetic set-up composed of cubic permanent magnets and a microchannel was designed and implemented based on finite element analysis results to efficiently concentrate the nanoparticles only over a defined area of the microchannel as the sensing zone. This in turn, led to the fluorescence emission localisation and the searching area reduction. Also, compared to processes in which the immunocomplex is formed directly on the surface, the proposed approach provides a lower steric hindrance, higher mass transfer, lower equilibrium time, and more surface concentration of the captured targets leading to a faster and more sensitive detection. As a proof-of-concept, the set-up is capable of detecting prostate-specific membrane antigen with concentrations down to 0.7 nM. Our findings suggest that the approach holds a great promise for applications in clinical assays and disease diagnosis.

  5. RNA-directed DNA methylation and plant development require an IWR1-type transcription factor.

    PubMed

    Kanno, Tatsuo; Bucher, Etienne; Daxinger, Lucia; Huettel, Bruno; Kreil, David P; Breinig, Frank; Lind, Marc; Schmitt, Manfred J; Simon, Stacey A; Gurazada, Sai Guna Ranjan; Meyers, Blake C; Lorkovic, Zdravko J; Matzke, Antonius J M; Matzke, Marjori

    2010-01-01

    RNA-directed DNA methylation (RdDM) in plants requires two RNA polymerase (Pol) II-related RNA polymerases, namely Pol IV and Pol V. A genetic screen designed to reveal factors that are important for RdDM in a developmental context in Arabidopsis identified DEFECTIVE IN MERISTEM SILENCING 4 (DMS4). Unlike other mutants defective in RdDM, dms4 mutants have a pleiotropic developmental phenotype. The DMS4 protein is similar to yeast IWR1 (interacts with RNA polymerase II), a conserved putative transcription factor that interacts with Pol II subunits. The DMS4 complementary DNA partly complements the K1 killer toxin hypersensitivity of a yeast iwr1 mutant, suggesting some functional conservation. In the transgenic system studied, mutations in DMS4 directly or indirectly affect Pol IV-dependent secondary short interfering RNAs, Pol V-mediated RdDM, Pol V-dependent synthesis of intergenic non-coding RNA and expression of many Pol II-driven genes. These data suggest that DMS4 might be a regulatory factor for several RNA polymerases, thus explaining its diverse roles in the plant.

  6. DNA-directed in vitro synthesis of proteins involved in bacterial transcription and translation.

    PubMed Central

    Zarucki-Schulz, T; Jerez, C; Goldberg, G; Kung, H F; Huang, K H; Brot, N; Weissbach, H

    1979-01-01

    The in vitro synthesis of elongation factor (EF)-Tu (tufB), the beta beta' subunits of RNA polymerase, ribosomal proteins L10 and L12 directed by DNA from the transducing phage lambda rifd 18, EF-Tu (tufA), EF-G, and the alpha subunit of RNA polymerase directed by DNA from the transducing phage lambda fus3 has been investigated in a crude and a partially defined protein-synthesizing system. Proteins L10 and L12 are synthesized in the partially defined system almost as well as in the crude system. However, the synthesis of EF-Tu, EF-G, and the alpha and beta beta' subunits of RNA polymerase is far less efficient in the partially defined system. An active fraction that stimulates the synthesis of these latter proteins has been obtained by fractionation of a high-speed supernatant on DEAE-cellulose. Because previous studies showed that this fraction (1 M DEAE salt eluate) contains a protein, called L factor, that stimulates beta-galactosidase synthesis in vitro, L factor was tested for activity. Although L factor stimulates the synthesis of the beta beta' subunits, it has little or no effect on the in vitro synthesis of the other products studied. In the present experiments, the ratio of L12/L10 and of EF-Tu (tufA)/EF-G formed is 4-6. These values are consistent with in vivo results. Images PMID:160561

  7. Chemical extraction versus direct smear for MALDI-TOF mass spectrometry identification of anaerobic bacteria.

    PubMed

    Fournier, Rémi; Wallet, Frédéric; Grandbastien, Bruno; Dubreuil, Luc; Courcol, René; Neut, Christel; Dessein, Rodrigue

    2012-06-01

    In the present study, two pre-analytic processes for mass spectrometric bacterial identification were compared: the time-consuming reference method, chemical extraction, and the direct smear technique directly using cultured colonies without any further preparation. These pre-analytic processes were compared in the identification of a total of 238 strains of anaerobic bacteria representing 34 species. The results showed that 218/238 strains were identified following chemical extraction, 185 identifications (77.7%) were secured to both genus and species [log(score) > 2.0] whereas 33 identifications (14%) were secured to genus only [log(score) between 1.7 and 2.0]. Following direct smear, 207/238 anaerobic bacteria were identified, 158 identifications (66.4%) were secured to both genus and species [log(score) > 2.0] whereas 49 identifications were secured to genus only [log(score) between 1.7 and 2.0]. Twenty strains were not identified [log(score) < 1.7] by MALDI-TOF MS following chemical extraction whereas 31 strains were not identified with the direct smear technique. Although direct smear led to a significant decrease of the log(score) values for the Clostridium genus and the Gram positive anaerobic bacteria (GPAC) group (p < 0.0001, Wilcoxon test), identification to both species and genus were not changed. However these differences were not statistically significant (p = 0.1, Chi square). Therefore, MALDI-TOF MS identification following the direct smear technique appears to both non-inferior to the reference method and relevant for anaerobic bacteria identification.

  8. Direct numerical simulations of a reacting mixing layer with chemical heat release

    NASA Technical Reports Server (NTRS)

    Mcmurtry, P. A.; Jou, W.-H.; Metcalfe, R. W.; Riley, J. J.

    1985-01-01

    In order to study the coupling between chemical heat release and fluid dynamics, direct numerical simulations of a chemically reacting mixing layer with heat release are performed. The fully compressible equations as well as an approximate set of equations that is asymptotically valid for low-Mach-number flows are treated. These latter equations have the computational advantage that high-frequency acoustic waves have been filtered out, allowing much larger time steps to be taken in the numerical solution procedure. A detailed derivation of these equations along with an outline of the numerical solution technique is given. Simulation results indicate that the rate of chemical product formed, the thickness of the mixing layer, and the amount of mass entrained into the layer all decrease with increasing rates of heat release.

  9. Directed In Situ Shaping of Complex Nano- and Microstructures during Chemical Synthesis.

    PubMed

    Artus, Georg R J; Olveira, Sandro; Patra, Debabrata; Seeger, Stefan

    2017-02-01

    Chemical composition and shape determine the basic properties of any object. Commonly, chemical synthesis and shaping follow each other in a sequence, although their combination into a single process would be an elegant simplification. Here, a pathway of simultaneous synthesis and shaping as applied to polysiloxanes on the micro- and nanoscale is presented. Complex structures such as stars, chalices, helices, volcanoes, rods, or combinations thereof are obtained. Varying the shape-controlling reaction parameters including temperature, water saturation, and the type of substrate allows to direct the reaction toward specific structures. A general mechanism of growth is suggested and analytical evidence and thermodynamic calculations to support it are provided. An aqueous droplet in either gaseous atmosphere or in a liquid organic solvent serves as a spatially confined polymerization volume. By substituting the starting materials, germanium-based nanostructures are also obtained. This transferability marks this approach as a major step toward a generally applicable method of chemical synthesis including in situ shaping.

  10. Ultrasensitive detection of DNA and RNA based on enzyme-free click chemical ligation chain reaction on dispersed gold nanoparticles.

    PubMed

    Kato, Daiki; Oishi, Motoi

    2014-10-28

    An ultrasensitive colorimetric DNA and RNA assay using a combination of enzyme-free click chemical ligation chain reaction (CCLCR) on dispersed gold nanoparticles (GNPs) and a magnetic separation process has been developed. The click chemical ligation between an azide-containing probe DNA-modified GNP and a dibenzocyclooctyne-containing probe biotinyl DNA occurred through hybridization with target DNA (RNA) to form the biotinyl-ligated GNPs (ligated products). Eventually, both the biotinyl-ligated GNPs and target DNA (RNA) were amplified exponentially using thermal cycling. After separation of the biotinyl-ligated GNPs using streptavidin-modified magnetic beads, the change in intensity of the surface plasmon band at 525 nm in the supernatants was observed by UV/vis measurement and was also evident visually. The CCLCR assay provides ultrasensitive detection (50 zM: several copies) of target DNA that is comparable to PCR-based approaches. Note that target RNA could also be detected with similar sensitivity without the need for reverse transcription to the corresponding cDNA. The amplification efficiency of the CCLCR assay was as high as 82% due to the pseudohomogeneous reaction behavior of CCLCR on dispersed GNPs. In addition, the CCLCR assay was able to discriminate differences in single-base mismatches and to specifically detect target DNA and target RNA from the cell lysate.

  11. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags.

    PubMed

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method "relay primer-dependent bypass" utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3'-terminus prior to ligation to adjacent oligonucleotides. The second reading method "repeat-dependent bypass" utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3'-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries.

  12. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

    PubMed Central

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

  13. Isolation of SMA candidate genes from a YAC contig by direct selection of cDNA clones from normalized cDNA libraries

    SciTech Connect

    Ross, B.M.; Bonaldo, M.F.; Vitale, E.

    1994-09-01

    A YAC contig has been constructed across the spinal muscular atrophy (SMA) region of chromosome 5 (5q11-13). Further definition by pedigree analysis has yielded a minimal genetic region of 400 kb. For isolation of candidate genes in this region, the following cDNA selection method was hybridized to directionally cloned normalized (Cot 1 DNA-preannealed) cDNA libraries in the form of single-stranded circles. The libraries used were constructed from SMA infant brain and normal fetal liver+spleen. Hybridizing circles were eluted off the filter, partially converted into duplexes and electroporated into bacteria. The selected clones were then sequentially hybridized with a human Cot 1 DNA probe (BRL), and a probe made from the corresponding YAC DNA. Clones that hybridized only to the YAC DNA probe were verified to map to the critical region by genomic Southern analyses. Ten different cDNA clones have been isolated by this procedure so far. Three of them have been definitively mapped back to the region. Four of the ten clones are now completely sequenced. One clone shows sequence homology to a transcriptional initiation factor; another has homology to a prokaryotic attachment site sequence for the lipid moiety of membrane lipoproteins. Two clones show no homology to sequences represented in the public databases. We are continuing the full characterization of the cDNA clones as candidates for the SMA gene.

  14. Low molecular weight chemicals, hypersensitivity, and direct toxicity: the acid anhydrides.

    PubMed Central

    Venables, K M

    1989-01-01

    The acid anhydrides are a group of reactive chemicals used widely in alkyd and epoxy resins. The major hazards to health are mucosal and skin irritation and sensitisation of the respiratory tract. Most occupational asthma caused by acid anhydrides appears to be immunologically mediated. Immunological mechanisms have been proposed to explain an influenza-like syndrome and pulmonary haemorrhage, but direct toxicity may also be important in the aetiology of these conditions. PMID:2653411

  15. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay.

    PubMed

    Sun, Yi; Perch-Nielsen, Ivan; Dufva, Martin; Sabourin, David; Bang, Dang Duong; Høgberg, Jonas; Wolff, Anders

    2012-01-01

    DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface-modified slides with aminated DNA probes. Moreover, the TC tag only costs 30% of the commonly used amino group modifications. Using this microarray fabrication technique, a portable cyclic olefin copolymer biochip containing eight individually addressable microfluidic channels was developed and used for rapid and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate microarrays into plastic microfluidic systems.

  16. Evaluation of microbial community in hydrothermal field by direct DNA sequencing

    NASA Astrophysics Data System (ADS)

    Kawarabayasi, Y.; Maruyama, A.

    2002-12-01

    Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the

  17. Development of Procedures for Direct Extraction of Cryptosporidium DNA from Water Concentrates and for Relief of PCR Inhibitors

    PubMed Central

    Jiang, Jianlin; Alderisio, Kerri A.; Singh, Ajaib; Xiao, Lihua

    2005-01-01

    Extraction of high-quality DNA is a key step in PCR detection of Cryptosporidium and other pathogens in environmental samples. Currently, Cryptosporidium oocysts in water samples have to be purified from water concentrates before DNA is extracted. This study compared the effectiveness of six DNA extraction methods (DNA extraction with the QIAamp DNA minikit after oocyst purification with immunomagnetic separation and direct DNA extraction methods using the FastDNA SPIN kit for soil, QIAamp DNA stool minikit, UltraClean soil kit, or QIAamp DNA minikit and the traditional phenol-chloroform technique) for the detection of Cryptosporidium with oocyst-seeded samples, DNA-spiked samples, and field water samples. The study also evaluated the effects of different PCR facilitators (nonacetylated bovine serum albumin, the T4 gene 32 protein, and polyvinylpyrrolidone) and treatments (the use of GeneReleaser or ultrafiltration) for the relief from or removal of inhibitors of PCR amplification. The results of seeding and spiking studies showed that PCR inhibitors were presented in all DNA solutions extracted by the six methods. However, the effect of PCR inhibitors could be relieved significantly by the addition of 400 ng of bovine serum albumin/μl or 25 ng of T4 gene 32 protein/μl to the PCR mixture. With the inclusion of bovine serum albumin in the PCR mixture, DNA extracted with the FastDNA SPIN kit for soil without oocyst isolation resulted in PCR performance similar to that produced by the QIAamp DNA minikit after oocysts were purified by immunomagnetic separation. PMID:15746310

  18. Tuning the strength of chemical patterns for directed self-assembly of block copolymers

    NASA Astrophysics Data System (ADS)

    Williamson, Lance; Lin, Guanyang; Cao, Yi; Gronheid, Roel; Nealey, Paul

    2014-03-01

    Directed self-assembly (DSA) of block copolymers (BCP) via chemo-epitaxy is a potential lithographic solution to patterns of dense features. The LiNe (Liu-Nealey) flow was used to fabricate the chemical pattern, which guides the BCP due to the different wetting behavior of the materials. Fine control of both the chemical pattern chemistry and geometry are important for DSA of BCP. Furthermore, wetting behavior considerations for DSA extend beyond pattern design and include the surrounding region. BCP DSA would be easier to integrate into device design if the patterned region were isolated with a featureless region (horizontal lamellar BCP assembly) rather than undirected BCP fingerprint structures. This paper addresses two processing steps found to be modifying the guide material. For one, the backfill brush grafts to the cross-linked polystyrene (XPS), albeit at a lower rate than the brush grafts to the exposed substrate. Undersaturating the backfill brush only moderately improves the XPS wetting behavior, but also negatively impacts the background region of the chemical pattern. Replacing the brush grafting functionality so that the brush grafts at lower annealing conditions also did not avoid the side reaction between the brush and the XPS. The other step modifying the XPS is the trim etch. Replacing the trim etch process was effective at generating a chemical pattern that can orient the BCP horizontally on a stripe 11 L0 wide passing through a field of chemical pattern.

  19. Small targeted cytotoxics: current state and promises from DNA-encoded chemical libraries.

    PubMed

    Krall, Nikolaus; Scheuermann, Jörg; Neri, Dario

    2013-01-28

    The targeted delivery of potent cytotoxic agents has emerged as a promising strategy for the treatment of cancer and other serious conditions. Traditionally, antibodies against markers of disease have been used as drug-delivery vehicles. More recently, lower molecular weight ligands have been proposed for the generation of a novel class of targeted cytotoxics with improved properties. Advances in this field crucially rely on efficient methods for the identification and optimization of organic molecules capable of high-affinity binding and selective recognition of target proteins. The advent of DNA-encoded chemical libraries allows the construction and screening of compound collections of unprecedented size. In this Review, we survey developments in the field of small ligand-based targeted cytotoxics and show how innovative library technologies will help develop the drugs of the future.

  20. Radical Formation and Chemical Track Structure in Ion-Beam Irradiated DNA

    NASA Astrophysics Data System (ADS)

    Becker, David; Adhikary, Amitava; Khanduri, Deepti; Sevilla, Michael D.

    2009-12-01

    Ion-beam irradiation of hydrated DNA at 77 K results in formation of at least three base radicals and a variety of radicals on the sugar phosphate backbone that can be observed using Electron Spin Resonance (ESR) spectroscopy. From dose-response curves for these radicals, we have formulated a radiation-chemical model of the track structure for ion-beam irradiated DNA. The model for chemical behavior posits that the base radicals trapped at 77 K are formed almost entirely in the track penumbra. The lower yields observed in ion-beam irradiated samples results from the fact that only a portion of the energy deposited by the ion beam ends up in this γ-like region. The remainder of the energy is deposited in the core in which the proximity of ion-radical formation results in the fast recombination of oppositely charged radicals, so few survive in the core at 77 K. However, a second group of radicals, neutral sugar radicals, are not as susceptible to recombination as are ion radicals, and can survive after formation in the core; these are presumed to form predominantly in the core. They include the sugar radicals, C1'ṡC3'ṡC5'ṡ, formed from oxidative processes, and C3'ṡdephos and phosphorous radicals which are formed after immediate strand breaks. The later species are thought to result from reductive cleavage by low energy electrons (LEE.) The high energy density in the core results in excited state processes that produce additional sugar radicals. The spatial characteristics of the radicals, deduced from PELDOR experiments, indicates that multiply damaged cluster sites (MDS) are formed in the core; these would be biologically significant, if formed in cells.

  1. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea

    2011-01-01

    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  2. Gener: a minimal programming module for chemical controllers based on DNA strand displacement

    PubMed Central

    Kahramanoğulları, Ozan; Cardelli, Luca

    2015-01-01

    Summary: Gener is a development module for programming chemical controllers based on DNA strand displacement. Gener is developed with the aim of providing a simple interface that minimizes the opportunities for programming errors: Gener allows the user to test the computations of the DNA programs based on a simple two-domain strand displacement algebra, the minimal available so far. The tool allows the user to perform stepwise computations with respect to the rules of the algebra as well as exhaustive search of the computation space with different options for exploration and visualization. Gener can be used in combination with existing tools, and in particular, its programs can be exported to Microsoft Research’s DSD tool as well as to LaTeX. Availability and implementation: Gener is available for download at the Cosbi website at http://www.cosbi.eu/research/prototypes/gener as a windows executable that can be run on Mac OS X and Linux by using Mono. Contact: ozan@cosbi.eu PMID:25957353

  3. DNA aptamers for selective identification and separation of flame retardant chemicals.

    PubMed

    Kim, Un-Jung; Kim, Byoung Chan

    2016-09-14

    Polybrominated diphenyl ethers (PBDEs) are group of chemicals which are representative persistent organic pollutants (POPs) and used as brominated flame retardants for many consumer products. PBDEs were phased out since 2009 but are still frequently observed in various environmental matrices and human body. Here, we report ssDNA aptamers which bind to BDE47, one of the PBDE congeners commonly found in various environmental matrices, and show affinity to other major tri-to hepta- BDE congeners. The PBDE specific aptamers were isolated from random library of ssDNA using Mag-SELEX. Two out of 15 sequences, based on their alignment and hairpin loop structures, were chosen to determine dissociation constant with BDE47 and showed from picomolar to nanomolar affinities (200 pM and 1.53 nM). The aptamers displayed high selectivity to the original target, BDE47, and implying general specificity to PBDE backbone with varying affinities to other congeners. Further, we showed that the use of two aptamers together could enhance the separation efficiency of BDE47 and other BDE congeners when dissolved in a solvent compared to use of single aptamer. These aptamers are expected to provide a tool for preliminary screening or quick separation of PBDEs in environmental samples prior to trace quantitative analysis.

  4. Noninvasive Facial Rejuvenation. Part 3: Physician-Directed-Lasers, Chemical Peels, and Other Noninvasive Modalities.

    PubMed

    Meaike, Jesse D; Agrawal, Nikhil; Chang, Daniel; Lee, Edward I; Nigro, Marjory G

    2016-08-01

    A proper knowledge of noninvasive facial rejuvenation is integral to the practice of a cosmetic surgeon. Noninvasive facial rejuvenation can be divided into patient- versus physician-directed modalities. Patient-directed facial rejuvenation combines the use of facial products such as sunscreen, moisturizers, retinoids, α-hydroxy acids, and various antioxidants to both maintain youthful skin and rejuvenate damaged skin. Physicians may recommend and often prescribe certain products, but patients are in control with this type of facial rejuvenation. On the other hand, physician-directed facial rejuvenation entails modalities that require direct physician involvement, such as neuromodulators, filler injections, laser resurfacing, microdermabrasion, and chemical peels. With the successful integration of each of these modalities, a complete facial regimen can be established and patient satisfaction can be maximized. This article is the last in a three-part series describing noninvasive facial rejuvenation. Here the authors review the mechanism, indications, and possible complications of lasers, chemical peels, and other commonly used noninvasive modalities.

  5. One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy

    PubMed Central

    Casini, Arturo; MacDonald, James T.; Jonghe, Joachim De; Christodoulou, Georgia; Freemont, Paul S.; Baldwin, Geoff S.; Ellis, Tom

    2014-01-01

    Overlap-directed DNA assembly methods allow multiple DNA parts to be assembled together in one reaction. These methods, which rely on sequence homology between the ends of DNA parts, have become widely adopted in synthetic biology, despite being incompatible with a key principle of engineering: modularity. To answer this, we present MODAL: a Modular Overlap-Directed Assembly with Linkers strategy that brings modularity to overlap-directed methods, allowing assembly of an initial set of DNA parts into a variety of arrangements in one-pot reactions. MODAL is accompanied by a custom software tool that designs overlap linkers to guide assembly, allowing parts to be assembled in any specified order and orientation. The in silico design of synthetic orthogonal overlapping junctions allows for much greater efficiency in DNA assembly for a variety of different methods compared with using non-designed sequence. In tests with three different assembly technologies, the MODAL strategy gives assembly of both yeast and bacterial plasmids, composed of up to five DNA parts in the kilobase range with efficiencies of between 75 and 100%. It also seamlessly allows mutagenesis to be performed on any specified DNA parts during the process, allowing the one-step creation of construct libraries valuable for synthetic biology applications. PMID:24153110

  6. The importance of Guthrie cards and other medical samples for the direct matching of disaster victims using DNA profiling.

    PubMed

    Hartman, D; Benton, L; Morenos, L; Beyer, J; Spiden, M; Stock, A

    2011-02-25

    The identification of disaster victims through the use of DNA analysis is an integral part of any Disaster Victim Identification (DVI) response, regardless of the scale and nature of the disaster. As part of the DVI response to the 2009 Victorian Bushfires Disaster, DNA analysis was performed to assist in the identification of victims through kinship (familial matching to relatives) or direct (self source sample) matching of DNA profiles. Although most of the DNA identifications achieved were to reference samples from relatives, there were a number of DNA identifications (12) made through direct matching. Guthrie cards, which have been collected in Australia over the past 30 years, were used to provide direct reference samples. Of the 236 ante-mortem (AM) samples received, 21 were Guthrie cards and one was a biopsy specimen; all yielding complete DNA profiles when genotyped. This publication describes the use of such Biobanks and medical specimens as a sample source for the recovery of good quality DNA for comparisons to post-mortem (PM) samples.

  7. Direct immobilization of DNA oligomers onto the amine-functionalized glass surface for DNA microarray fabrication through the activation-free reaction of oxanine

    PubMed Central

    Pack, Seung Pil; Kamisetty, Nagendra Kumar; Nonogawa, Mitsuru; Devarayapalli, Kamakshaiah Charyulu; Ohtani, Kairi; Yamada, Kazunari; Yoshida, Yasuko; Kodaki, Tsutomu; Makino, Keisuke

    2007-01-01

    Oxanine having an O-acylisourea structure was explored to see if its reactivity with amino group is useful in DNA microarray fabrication. By the chemical synthesis, a nucleotide unit of oxanine (Oxa-N) was incorporated into the 5′-end of probe DNA with or without the -(CH2)n- spacers (n = 3 and 12) and found to immobilize the probe DNA covalently onto the NH2-functionalized glass slide by one-pot reaction, producing the high efficiency of the target hybridization. The methylene spacer, particularly the longer one, generated higher efficiency of the target recognition although there was little effect on the amount of the immobilized DNA oligomers. The post-spotting treatment was also carried out under the mild conditions (at 25 or 42°C) and the efficiencies of the immobilization and the target recognition were evaluated similarly, and analogous trends were obtained. It has also been determined under the mild conditions that the humidity and time of the post-spotting treatment, pH of the spotting solution and the synergistic effects with UV-irradiation largely contribute to the desired immobilization and resulting target recognition. Immobilization of DNA oligomer by use of Oxa-N on the NH2-functionalized surface without any activation step would be employed as one of the advanced methods for generating DNA-conjugated solid surface. PMID:17715142

  8. The a2 Mating-Type Locus Genes lga2 and rga2 Direct Uniparental Mitochondrial DNA (mtDNA) Inheritance and Constrain mtDNA Recombination During Sexual Development of Ustilago maydis

    PubMed Central

    Fedler, Michael; Luh, Kai-Stephen; Stelter, Kathrin; Nieto-Jacobo, Fernanda; Basse, Christoph W.

    2009-01-01

    Uniparental inheritance of mitochondria dominates among sexual eukaryotes. However, little is known about the mechanisms and genetic determinants. We have investigated the role of the plant pathogen Ustilago maydis genes lga2 and rga2 in uniparental mitochondrial DNA (mtDNA) inheritance during sexual development. The lga2 and rga2 genes are specific to the a2 mating-type locus and encode small mitochondrial proteins. On the basis of identified sequence polymorphisms due to variable intron numbers in mitochondrial genotypes, we could demonstrate that lga2 and rga2 decisively influence mtDNA inheritance in matings between a1 and a2 strains. Deletion of lga2 favored biparental inheritance and generation of recombinant mtDNA molecules in combinations in which inheritance of mtDNA of the a2 partner dominated. Conversely, deletion of rga2 resulted in predominant loss of a2-specific mtDNA and favored inheritance of the a1 mtDNA. Furthermore, expression of rga2 in the a1 partner protected the associated mtDNA from elimination. Our results indicate that Lga2 in conjunction with Rga2 directs uniparental mtDNA inheritance by mediating loss of the a1-associated mtDNA. This study shows for the first time an interplay of mitochondrial proteins in regulating uniparental mtDNA inheritance. PMID:19104076

  9. The a2 mating-type locus genes lga2 and rga2 direct uniparental mitochondrial DNA (mtDNA) inheritance and constrain mtDNA recombination during sexual development of Ustilago maydis.

    PubMed

    Fedler, Michael; Luh, Kai-Stephen; Stelter, Kathrin; Nieto-Jacobo, Fernanda; Basse, Christoph W

    2009-03-01

    Uniparental inheritance of mitochondria dominates among sexual eukaryotes. However, little is known about the mechanisms and genetic determinants. We have investigated the role of the plant pathogen Ustilago maydis genes lga2 and rga2 in uniparental mitochondrial DNA (mtDNA) inheritance during sexual development. The lga2 and rga2 genes are specific to the a2 mating-type locus and encode small mitochondrial proteins. On the basis of identified sequence polymorphisms due to variable intron numbers in mitochondrial genotypes, we could demonstrate that lga2 and rga2 decisively influence mtDNA inheritance in matings between a1 and a2 strains. Deletion of lga2 favored biparental inheritance and generation of recombinant mtDNA molecules in combinations in which inheritance of mtDNA of the a2 partner dominated. Conversely, deletion of rga2 resulted in predominant loss of a2-specific mtDNA and favored inheritance of the a1 mtDNA. Furthermore, expression of rga2 in the a1 partner protected the associated mtDNA from elimination. Our results indicate that Lga2 in conjunction with Rga2 directs uniparental mtDNA inheritance by mediating loss of the a1-associated mtDNA. This study shows for the first time an interplay of mitochondrial proteins in regulating uniparental mtDNA inheritance.

  10. Fiber optic chemical sensors: The evolution of high- density fiber-optic DNA microarrays

    NASA Astrophysics Data System (ADS)

    Ferguson, Jane A.

    2001-06-01

    Sensors were developed for multianalyte monitoring, fermentation monitoring, lactate analysis, remote oxygen detection for use in bioremediation monitoring and in a fuel spill clean-up project, heavy metal analysis, and high density DNA microarrays. The major focus of this thesis involved creating and improving high-density DNA gene arrays. Fiber optic sensors are created using fluorescent indicators, polymeric supports, and optical fiber substrates. The fluorescent indicator is entrapped in a polymer layer and attached to the tip of the optical fiber. The tip of the fiber bearing the sensing layer (the distal end) is placed in the sample of interest while the other end of the fiber (the proximal end) is connected to an analysis system. Any length of fiber can be used without compromising the integrity or sensitivity of the system. A fiber optic oxygen sensor was designed incorporating an oxygen sensitive fluorescent dye and a gas permeable polymer attached to an optical fiber. The construction simplicity and ruggedness of the sensor enabled its deployment for in situ chemical oxidation and bioremediation studies. Optical fibers were also used as the substrate to detect biomolecules in solution. To monitor bioprocesses, the production of the analyte of interest must be coupled with a species that is optically measurable. For example, oxygen is consumed in many metabolic functions. The fiber optic oxygen sensor is equipped with an additional sensing layer. Upon contact with a specific biochemical in the sample, a reaction occurs in the additional sensing layer that either consumes or produces oxygen. This dual layer system was used to monitor the presence of lactate, an important metabolite for clinical and bioprocess analysis. In many biological and environmental systems, the generation of one species occurs coincidentally with the generation or consumption of another species. A multianalyte sensor was prepared that can monitor the simultaneous activity of pH, CO2

  11. Characterization of environmental chemicals with potential for DNA damage using isogenic DNA repair-deficient chicken DT40 cell lines.

    PubMed

    Yamamoto, Kimiyo N; Hirota, Kouji; Kono, Koichi; Takeda, Shunichi; Sakamuru, Srilatha; Xia, Menghang; Huang, Ruili; Austin, Christopher P; Witt, Kristine L; Tice, Raymond R

    2011-08-01

    Included among the quantitative high throughput screens (qHTS) conducted in support of the US Tox21 program are those being evaluated for the detection of genotoxic compounds. One such screen is based on the induction of increased cytotoxicity in seven isogenic chicken DT40 cell lines deficient in DNA repair pathways compared to the parental DNA repair-proficient cell line. To characterize the utility of this approach for detecting genotoxic compounds and identifying the type(s) of DNA damage induced, we evaluated nine of 42 compounds identified as positive for differential cytotoxicity in qHTS (actinomycin D, adriamycin, alachlor, benzotrichloride, diglycidyl resorcinol ether, lovastatin, melphalan, trans-1,4-dichloro-2-butene, tris(2,3-epoxypropyl)isocyanurate) and one non-cytotoxic genotoxic compound (2-aminothiamine) for (1) clastogenicity in mutant and wild-type cells; (2) the comparative induction of γH2AX positive foci by melphalan; (3) the extent to which a 72-hr exposure duration increased assay sensitivity or specificity; (4) the use of 10 additional DT40 DNA repair-deficient cell lines to better analyze the type(s) of DNA damage induced; and (5) the involvement of reactive oxygen species in the induction of DNA damage. All compounds but lovastatin and 2-aminothiamine were more clastogenic in at least one DNA repair-deficient cell line than the wild-type cells. The differential responses across the various DNA repair-deficient cell lines provided information on the type(s) of DNA damage induced. The results demonstrate the utility of this DT40 screen for detecting genotoxic compounds, for characterizing the nature of the DNA damage, and potentially for analyzing mechanisms of mutagenesis.

  12. Directly incorporating fluorochromes into DNA probes by PCR increases the efficience of fluorescence in situ hybridization

    SciTech Connect

    Dittmer, Joy

    1996-05-01

    The object of this study was to produce a directly labeled whole chromosome probe in a Degenerative Oligonucleotide Primed-Polymerase Chain Reaction (DOP-PCR) that will identify chromosome breaks, deletions, inversions and translocations caused by radiation damage. In this study we amplified flow sorted chromosome 19 using DOP-PCR. The product was then subjected to a secondary DOP PCR amplification, After the secondary amplification the DOP-PCR product was directly labeled in a tertiary PCR reaction with rhodamine conjugated with dUTP (FluoroRed) to produce a DNA fluorescent probe. The probe was then hybridized to human metaphase lymphocytes on slides, washed and counterstained with 4{prime},6-diamino-2-phenylindole (DAPI). The signal of the FluoroRed probe was then compared to a signal of a probe labeled with biotin and stained with avidin fluorescein isothio cynate (FITC) and anti-avidin FITC. The results show that the probe labeled with FluoroRed gave signals as bright as the probe with biotin labeling. The FluoroRed probe had less noise than the biotin labeled probe. Therefore, a directly labeled probe has been successfully produced in a DOP-PCR reaction. In future a probe labeled with FluoroRed will be produced instead of a probe labeled with biotin to increase efficiency.

  13. Ultraviolet light photobiology of the protozoan Tetrahymena pyriformis and chemical reactivation of DNA damage

    SciTech Connect

    Wheeler, J.S.

    1988-01-01

    The tunable dye laser was developed in order to perform UV-B and UV-C (254-320 nm) action spectra studies on several different organisms. Using the laser, action spectra studies have been performed for Escherichia coli, Saccharomyces, Chlamydomonas, Caenorhabditis elegans, Paramecium, and Tetrahymena pyriformis. Studies generally indicate increasing LD{sub 50} values with increasing wavelength. Two notable findings were made: (1) The action spectra does not follow the DNA absorption spectra at 280, 290 and 295 nm; (2) The repair competent/repair defective sensitization factor does not remain constant throughout the wavelength region. In addition it was found that the repair defective strain of E. coli, Bs-1, showed an increase in survival with increasing UV irradiation, at certain dose levels. Further experiments were designed to better characterize the reactivation. Tetrahymena were exposed to UV-C and reactivated with methyl methanesulfonate (MMS) and 4-nitro quinoline oxide (4-NQO). In both cases survival was seen to increase after chemical exposure. Likewise, UV-C was found to reactivate chemical damage (MMS).

  14. Chemical characterization and DNA tracking of Sardinian botargo by Mugil cephalus from different geographical origins.

    PubMed

    Barra, Andrea; Garau, Vincenzo Luigi; Dessi, Sandro; Sarais, Giorgia; Cereti, Elisabetta; Arlorio, Marco; Coisson, Jean Daniel; Cabras, Paolo

    2008-11-26

    The chemical composition of the Sardinian botargo by Mugil cephalus from different geographical origins was investigated. Fat ( approximately 20%), proteins ( approximately 50%), moisture ( approximately 22%), and salt ( approximately 7%) were measured in ground (G) and whole (W) commercial products. Among the nutritional compounds, omega-3 fatty acids were approximately 8%, squalene was approximately 15 mg/100 g, vitamin E was approximately 8.5 mg/kg, and cholesterol was approximately 300 mg/100 g, on average in both products. Antioxidant properties, assessed by the 1,1-diphenyl-2-picryl-hydrazyl (DPPH) test and expressed as Trolox equivalent antioxidant capacity (TEAC), showed quite good activity in extracted oil (0.8-1.1 mmol of Tolox/L). Major constituents in the samples varied noticeably, but only few statistical differences were evidenced between G or W products or between samples from different origins. Principal component analysis (PCA) of random amplified polymorphic DNA (RAPD) and proteins, coupled with both, did not differentiate samples from different origins. On the basis of our results, chemical and molecular data exclude the differentiation of samples from diverse origins.

  15. An unusual case of Streptococcus anginosus group pyomyositis diagnosed using direct 16S ribosomal DNA sequencing.

    PubMed

    Walkty, Andrew; Embil, John M; Nichol, Kim; Karlowsky, James

    2014-01-01

    Bacteria belonging to the Streptococcus anginosus group (Streptococcus intermedius, Streptococcus constellatus and Streptococcus anginosus) are capable of causing serious pyogenic infections, with a tendency for abscess formation. The present article reports a case of S anginosus group pyomyositis in a 47-year-old man. The pathogen was recovered from one of two blood cultures obtained from the patient, but speciation was initially not performed because the organism was considered to be a contaminant (viridans streptococci group). The diagnosis was ultimately confirmed using 16S ribosomal DNA sequencing of purulent fluid obtained from a muscle abscess aspirate. The present case serves to emphasize that finding even a single positive blood culture of an organism belonging to the S anginosus group should prompt careful evaluation of the patient for a pyogenic focus of infection. It also highlights the potential utility of 16S ribosomal DNA amplification and sequencing in direct pathogen detection from aspirated fluid in cases of pyomyositis in which antimicrobial therapy was initiated before specimen collection.

  16. 53BP1 fosters fidelity of homology-directed DNA repair.

    PubMed

    Ochs, Fena; Somyajit, Kumar; Altmeyer, Matthias; Rask, Maj-Britt; Lukas, Jiri; Lukas, Claudia

    2016-08-01

    Repair of DNA double-strand breaks (DSBs) in mammals is coordinated by the ubiquitin-dependent accumulation of 53BP1 at DSB-flanking chromatin. Owing to its ability to limit DNA-end processing, 53BP1 is thought to promote nonhomologous end-joining (NHEJ) and to suppress homology-directed repair (HDR). Here, we show that silencing 53BP1 or exhausting its capacity to bind damaged chromatin changes limited DSB resection to hyper-resection and results in a switch from error-free gene conversion by RAD51 to mutagenic single-strand annealing by RAD52. Thus, rather than suppressing HDR, 53BP1 fosters its fidelity. These findings illuminate causes and consequences of synthetic viability acquired through 53BP1 silencing in cells lacking the BRCA1 tumor suppressor. We show that such cells survive DSB assaults at the cost of increasing reliance on RAD52-mediated HDR, which may fuel genome instability. However, our findings suggest that when challenged by DSBs, BRCA1- and 53BP1-deficient cells may become hypersensitive to, and be eliminated by, RAD52 inhibition.

  17. Marking of specific sequences in double-stranded DNA molecules—SNP detection and direct observation

    PubMed Central

    Shigemori, Yasushi; Haruta, Hirotaka; Okada, Takao; Oishi, Michio

    2004-01-01

    In this study, we describe a simple method to mark specific sequences in double-stranded DNA molecules. For the marking, we used two specifically designed oligonucleotides, one of which is complementary to the sequence to be marked and the other, serving as a splint, to make the marking stable and detectable by subsequent various analytical means. In the presence of the two deoxyoligonucleotides, whereas RecA protein-mediated reaction converts the sequence to be marked to a regional triple-stranded structure with the complementary (probing) oligonucleotide, DNA ligase transforms it to a stable multi- (possibly quintuple) stranded structure with the splint oligonucleotide. The whole marking process is simple and completed in a single reaction mixture. Because RecA protein makes the marking to proceed with high fidelity, we were able to mark (detect) SNPs in complex genomes like human's. Furthermore, the structure of the marked sequence is stable and quite distinct enough to be readily detectable by biochemical means or direct observation by scanning probe microscopy. PMID:15574826

  18. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    PubMed

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  19. Direct Measurement and Chemical Speciation of Top Ring Zone Liquid During Engine Operation

    SciTech Connect

    Splitter, Derek A; Burrows, Barry Clay; Lewis Sr, Samuel Arthur

    2015-01-01

    The present manuscript consists of proof of concept experiments involving direct measurements and detailed chemical speciation from the top ring zone of a running engine. The work uses a naturally aspirated single cylinder utility engine that has been modified to allow direct liquid sample acquisition from behind the top ring. Samples were analyzed and spectated using gas chromatographic techniques. Results show that the liquid mixture in the top ring zone is neither neat lubricant nor fuel but a combination of the two with unique chemical properties. At the tested steady state no-load operating condition, the chemical species of the top ring zone liquid were found to be highly dependent on boiling point, where both low reactivity higher boiling point fuel species and lubricant are observed to be the dominant constituents. The results show that at least for the tested condition, approximately 25% of the top ring zone is comprised of gasoline fuel like molecules, which are dominated by high octane number aromatic species, while the remainder of the liquid is comprised of lubricant like species.

  20. Efficient incorporation of positively charged 2', 3'-dideoxynucleoside-5'-triphosphates by DNA polymerases and their application in 'direct-load' DNA sequencing.

    PubMed

    Finn, Patrick J; Bull, Matthew G; Xiao, Haiguang; Phillips, Paula D; Nelson, John R; Grossmann, Greg; Nampalli, Satyam; McArdle, Bernard F; Mamone, J Anthony; Flick, Parke K; Fuller, Carl W; Kumar, Shiv

    2003-08-15

    A series of charge-modified, dye-labeled 2', 3'-dideoxynucleoside-5'-triphosphates have been synthesized and evaluated as reagents for dye-terminator DNA sequencing. Unlike the commonly used dye-labeled terminators, these terminators possess a net positive charge and migrate in the opposite direction to dye-labeled Sanger fragments during electrophoresis. Post-sequencing reaction purification is not required to remove unreacted nucleotide or associated breakdown products prior to electrophoresis. Thus, DNA sequencing reaction mixtures can be loaded directly onto a separating medium such as a sequencing gel. The charge-modified nucleotides have also been shown to be more efficiently incorporated by a number of DNA polymerases than regular dye-labeled dideoxynucleotide terminators or indeed normal dideoxynucleoside-5'-triphosphates.

  1. Phylogenetic relationships of annual and perennial wild rice: probing by direct DNA sequencing.

    PubMed

    Barbier, P; Morishima, H; Ishihama, A

    1991-05-01

    The phylogenetic relationships between Asian wild rice strains were analyzed by direct sequencing of PCR-amplified DNA fragments. The sequence of three introns located in the phytochrome gene was determined for eight strains of the Asian wild rice, Oryza rufipogon, and one strain of the related African species, Oryza longistaminata. The number of nucleotide substitutions per site between various strains within a single species, O. rufipogon, ranged between 0.0017 and 0.0050, while those between two related species, O. rufipogon and O. longistaminate, were 0.043-0.049 (23-26 within 532 bp). Taken together with the sequence differences of the 10-kDa prolamin gene, a model is proposed for the phylogenetic relationships and evolutionary history of annuals and perennials within O. rufipogon.

  2. Anodized aluminum oxide-based capacitance sensors for the direct detection of DNA hybridization.

    PubMed

    Kang, Bongkeun; Yeo, Unjin; Yoo, Kyung-Hwa

    2010-03-15

    We fabricated a capacitance sensor based on an anodized aluminum oxide (AAO) nanoporous structure to detect DNA hybridization. We utilized Au film deposited on the surface of the AAO membrane and Au nanowires infiltrating the nanopores as the top and bottom electrodes, respectively. When completely complementary target DNA molecules were added to the sensor-immobilized DNA molecule probes, the capacitance was reduced; with a concentration of 1pM, the capacitance decreased by approximately 10%. We measured the capacitance change for different concentrations of the target DNA solution. A linear relationship was found between the capacitance change and DNA concentration on a semi-logarithmic scale. We also investigated the possibility of detecting DNA molecules with a single-base mismatch to the probe DNA molecule. In contrast to complementary target DNA molecules, the addition of one-base mismatch DNA molecules caused no significant change in capacitance, demonstrating that DNA hybridization was detected with single nucleotide polymorphism sensitivity.

  3. Vaccinia topoisomerase and Cre recombinase catalyze direct ligation of activated DNA substrates containing a 3'-para-nitrophenyl phosphate ester.

    PubMed

    Woodfield, G; Cheng, C; Shuman, S; Burgin, A B

    2000-09-01

    DNA topoisomerases and DNA site-specific recombinases are involved in a diverse set of cellular processes but both function by making transient breaks in DNA. Type IB topoisomerases and tyrosine recombinases cleave DNA by transesterification of an active site tyrosine to generate a DNA-3'-phosphotyrosyl-enzyme adduct and a free 5'-hydroxyl (5'-OH). Strand ligation results when the 5'-OH attacks the covalent complex and displaces the enzyme. We describe the synthesis of 3'-phospho-(para-nitrophenyl) oligonucleotides (3'-pNP DNAs), which mimic the natural 3'-phosphotyrosyl intermediate, and demonstrate that such pre-activated strands are substrates for DNA ligation by vaccinia topoisomerase and Cre recombinase. Ligation occurs by direct attack of a 5'-OH strand on the 3'-pNP DNA (i.e., without a covalent protein-DNA intermediate) and generates free para-nitrophenol as a product. The chromogenic DNA substrate allows ligation to be studied in real-time and in the absence of competing cleavage reactions and can be exploited for high-throughput screening of topoisomerase/recombinase inhibitors.

  4. Medicinal plants recommended by the world health organization: DNA barcode identification associated with chemical analyses guarantees their quality.

    PubMed

    Palhares, Rafael Melo; Gonçalves Drummond, Marcela; Dos Santos Alves Figueiredo Brasil, Bruno; Pereira Cosenza, Gustavo; das Graças Lins Brandão, Maria; Oliveira, Guilherme

    2015-01-01

    Medicinal plants are used throughout the world, and the regulations defining their proper use, such as identification of the correct species and verification of the presence, purity and concentration of the required chemical compounds, are widely recognized. Herbal medicines are made from vegetal drugs, the processed products of medicinal species. These processed materials present a number of challenges in terms of botanical identification, and according to the World Health Organization (WHO), the use of incorrect species is a threat to consumer safety. The samples used in this study consisted of the dried leaves, flowers and roots of 257 samples from 8 distinct species approved by the WHO for the production of medicinal herbs and sold in Brazilian markets. Identification of the samples in this study using DNA barcoding (matK, rbcL and ITS2 regions) revealed that the level of substitutions may be as high as 71%. Using qualitative and quantitative chemical analyses, this study identified situations in which the correct species was being sold, but the chemical compounds were not present. Even more troubling, some samples identified as substitutions using DNA barcoding contained the chemical compounds from the correct species at the minimum required concentration. This last situation may lead to the use of unknown species or species whose safety for human consumption remains unknown. This study concludes that DNA barcoding should be used in a complementary manner for species identification with chemical analyses to detect and quantify the required chemical compounds, thus improving the quality of this class of medicines.

  5. TANK VAPOR CHEMICALS OF POTENTIAL CONCERN & EXISTING DIRECT READING INSTRUMENTION & PERSONAL PROTECTIVE EQUIPMENT CONSIDERATIONS

    SciTech Connect

    BUTLER, N.K.

    2004-11-01

    This document takes the newly released Industrial Hygiene Chemical Vapor Technical Basis (RPP-22491) and evaluates the chemicals of potential concern (COPC) identified for selected implementation actions by the industrial hygiene organization. This document is not intended as a hazard analysis with recommended controls for all tank farm activities. Not all of the chemicals listed are present in all tanks; therefore, hazard analyses can and should be tailored as appropriate. Detection of each chemical by current industrial hygiene non-specific instrumentation in use at the tank farms is evaluated. Information gaps are identified and recommendations are made to resolve these needs. Of the 52 COPC, 34 can be detected with existing instrumentation. Three additional chemicals could be detected with a photoionization detector (PID) equipped with a different lamp. Discussion with specific instrument manufacturers is warranted. Consideration should be given to having the SapphIRe XL customized for tank farm applications. Other instruments, sampling or modeling techniques should be evaluated to estimate concentrations of chemicals not detected by direct reading instruments. In addition, relative instrument response needs to be factored in to action levels used for direct reading instruments. These action levels should be correlated to exposures to the COPC and corresponding occupational exposure limits (OELs). The minimum respiratory protection for each of the COPC is evaluated against current options. Recommendations are made for respiratory protection based on each chemical. Until exposures are sufficiently quantified and analyzed, the current use of supplied air respiratory protection is appropriate and protective for the COPC. Use of supplied air respiratory protection should be evaluated once a detailed exposure assessment for the COPC is completed. The established tank farm OELs should be documented in the TFC-PLN-34. For chemicals without an established tank farm OEL

  6. A Structural Insight into Major Groove Directed Binding of Nitrosourea Derivative Nimustine with DNA: A Spectroscopic Study

    PubMed Central

    Agarwal, Shweta; Jangir, Deepak Kumar; Mehrotra, Ranjana; Lohani, Neelam; Rajeswari, M. R.

    2014-01-01

    Nitrosourea therapeutics occupies a definite place in cancer therapy but its exact mechanism of action has yet to be established. Nimustine, a chloroethyl nitrosourea derivative, is used to treat various types of malignancy including gliomas. The present work focuses on the understanding of nimustine interaction with DNA to delineate its mechanism at molecular level. Attenuated total reflection-Fourier transform infrared (ATR-FTIR) has been used to determine the binding sites of nimustine on DNA. Circular dichroism (CD) spectroscopy has been used to confirm conformational variations in DNA molecule upon nimustine-DNA interaction. Thermodynamic parameters of nimustine-DNA reaction have been calculated by isothermal titration calorimetry. Results of the present study demonstrate that nimustine is not a simple alkylating agent rather it causes major grove-directed-alkylation. Spectroscopic data suggest binding of nimustine with nitrogenous bases guanine (C6 = O6) and thymine (C4 = O4) in DNA major groove. CD spectra of nimustine-DNA complexes point toward the perturbation of native B-conformation of DNA and its partial transition into C-form. Thermodynamically, nimustine-DNA interaction is an entropy driven endothermic reaction, which suggests hydrophobic interaction of nimustine in DNA-major groove pocket. Spectral results suggest base binding and local conformational changes in DNA upon nimustine interaction. Investigation of drug-DNA interaction is an essential part of rational drug designing that also provides information about the drug’s action at molecular level. Results, demonstrated here, may contribute in the development of new nitrosourea therapeutics with better efficacy and fewer side effects. PMID:25101667

  7. Post-irradiation chemical processing of DNA damage generates double-strand breaks in cells already engaged in repair

    PubMed Central

    Singh, Satyendra K.; Wang, Minli; Staudt, Christian; Iliakis, George

    2011-01-01

    In cells exposed to ionizing radiation (IR), double-strand breaks (DSBs) form within clustered-damage sites from lesions disrupting the DNA sugar–phosphate backbone. It is commonly assumed that these DSBs form promptly and are immediately detected and processed by the cellular DNA damage response (DDR) apparatus. This assumption is questioned by the observation that after irradiation of naked DNA, a fraction of DSBs forms minutes to hours after exposure as a result of temperature dependent, chemical processing of labile sugar lesions. Excess DSBs also form when IR-exposed cells are processed at 50°C, but have been hitherto considered method-related artifact. Thus, it remains unknown whether DSBs actually develop in cells after IR exposure from chemically labile damage. Here, we show that irradiation of ‘naked’ or chromatin-organized mammalian DNA produces lesions, which evolve to DSBs and add to those promptly induced, after 8–24 h in vitro incubation at 37°C or 50°C. The conversion is more efficient in chromatin-associated DNA, completed within 1 h in cells and delayed in a reducing environment. We conclude that IR generates sugar lesions within clustered-damage sites contributing to DSB formation only after chemical processing, which occurs efficiently at 37°C. This subset of delayed DSBs may challenge DDR, may affect the perceived repair kinetics and requires further characterization. PMID:21745815

  8. As fast and selective as enzymatic ligations: unpaired nucleobases increase the selectivity of DNA-controlled native chemical PNA ligation.

    PubMed

    Ficht, Simon; Dose, Christian; Seitz, Oliver

    2005-11-01

    DNA-controlled reactions offer interesting opportunities in biological, chemical, and nanosciences. In practical applications, such as in DNA sequence analysis, the sequence fidelity of the chemical-ligation reaction is of central importance. We present a ligation reaction that is as fast as and much more selective than enzymatic T4 ligase-mediated oligonucleotide ligations. The selectivity was higher than 3000-fold in discriminating matched from singly mismatched DNA templates. It is demonstrated that this enormous selectivity is the hallmark of the particular ligation architecture, which is distinct from previous ligation architectures designed as "nick ligations". Interestingly, the fidelity of the native chemical ligation of peptide nucleic acids was increased by more than one order of magnitude when performing the ligation in such a way that an abasic-site mimic was formed opposite an unpaired template base. It is shown that the high sequence fidelity of the abasic ligation could facilitate the MALDI-TOF mass-spectrometric analysis of early cancer onset by allowing the detection of as little as 0.2 % of single-base mutant DNA in the presence of 99.8 % wild-type DNA.

  9. Fast DNA-based identification of the black truffle Tuber melanosporum with direct PCR and species-specific primers.

    PubMed

    Bonito, Gregory

    2009-12-01

    Abstract A quick and sensitive DNA-based assay for identifying the black truffle species Tuber melanosporum is presented. Both direct PCR and species-specific primers are used to amplify a phylogenetically informative region of T. melanosporum rDNA. This method was successfully used to screen fresh and frozen T. melanosporum fruitbodies, and could be modified for the molecular detection of other truffle and mushroom species.

  10. A direct qPCR method for residual DNA quantification in monoclonal antibody drugs produced in CHO cells.

    PubMed

    Hussain, Musaddeq

    2015-11-10

    Chinese hamster ovary (CHO) cells are the host cell of choice for manufacturing of monoclonal antibody (mAb) drugs in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and must be controlled and monitored in order to ensure drug purity and safety. A conventional method for quantification of host residual DNA in drug requires extraction of DNA from the mAb drug substance with subsequent quantification of the extracted DNA using real-time PCR (qPCR). Here we report a method where the DNA extraction step is eliminated prior to qPCR. In this method, which we have named 'direct resDNA qPCR', the mAb drug substance is digested with a protease called KAPA in a 96-well PCR plate, the protease in the digest is then denatured at high temperature, qPCR reagents are added to the resultant reaction wells in the plate along with standards and controls in other wells of the same plate, and the plate subjected to qPCR for analysis of residual host DNA in the samples. This direct resDNA qPCR method for CHO is sensitive to 5.0fg of DNA with high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with four mAbs drug, two IgG1 and two IgG4. Both the purified drug substance as well as a number of process intermediate samples, e.g., bioreactor harvest, Protein A column eluate and ion-exchange column eluates were tested. This method simplifies the residual DNA quantification protocol, reduces time of analysis and leads to increased assay sensitivity and development of automated high-throughput methods.

  11. A direct droplet digital PCR method for quantification of residual DNA in protein drugs produced in yeast cells.

    PubMed

    Hussain, Musaddeq; Fantuzzo, Rebecca; Mercorelli, Suzanne; Cullen, Constance

    2016-05-10

    Yeast cells, in particular Pichia pastoris, are the host cell of choice for manufacturing several protein therapeutic agents in the biopharmaceutical industry. Host cell DNA is an impurity of such manufacturing process and the residual DNA after the purification process of the drug must be monitored to ensure drug purity and safety. Currently, real-time PCR (qPCR) based methods are widely employed for quantification of host residual DNA. At the same time the digital PCR technology is coming into prominence with promise of higher sensitivity. Here we report a method where the protein drug is directly added to the droplet digital PCR (ddPCR) reaction including yeast-specific primers and fluorescent-tagged probe and nanoliter-sized droplets are generated. The droplets are then subjected to PCR followed by analysis for fluorescence. This Pichia residual DNA direct ddPCR method for yeast can be used to test higher amount of drug compared to the corresponding qPCR method thereby increasing sensitivity, retaining high precision and accuracy and has a wide linear range of determination. The method has been successfully tested with three batches of a recombinant human IgG1-Fc-based drug (RP-1) and with commercially available human insulin, both manufactured in yeast cells. This method simplifies the residual DNA quantification protocol by eliminating DNA extraction or protease digestion and eliminates use of DNA standards in day-to-day running of the method.

  12. Distinct kinetics of human DNA ligases I, IIIalpha, IIIbeta, and IV reveal direct DNA sensing ability and differential physiological functions in DNA repair

    SciTech Connect

    Chen, Xi; Ballin, Jeff D.; Della-Maria, Julie; Tsai, Miaw-Sheue; White, Elizabeth J.; Tomkinson, Alan E.; Wilson, Gerald M.

    2009-05-11

    The three human LIG genes encode polypeptides that catalyze phosphodiester bond formation during DNA replication, recombination and repair. While numerous studies have identified protein partners of the human DNA ligases (hLigs), there has been little characterization of the catalytic properties of these enzymes. In this study, we developed and optimized a fluorescence-based DNA ligation assay to characterize the activities of purified hLigs. Although hLigI joins DNA nicks, it has no detectable activity on linear duplex DNA substrates with short, cohesive single-strand ends. By contrast, hLigIII{beta} and the hLigIII{alpha}/XRCC1 and hLigIV/XRCC4 complexes are active on both nicked and linear duplex DNA substrates. Surprisingly, hLigIV/XRCC4, which is a key component of the major non-homologous end joining (NHEJ) pathway, is significantly less active than hLigIII on a linear duplex DNA substrate. Notably, hLigIV/XRCC4 molecules only catalyze a single ligation event in the absence or presence of ATP. The failure to catalyze subsequent ligation events reflects a defect in the enzyme-adenylation step of the next ligation reaction and suggests that, unless there is an in vivo mechanism to reactivate DNA ligase IV/XRCC4 following phosphodiester bond formation, the cellular NHEJ capacity will be determined by the number of adenylated DNA ligaseIV/XRCC4 molecules.

  13. Transduction of RNA-directed DNA methylation signals to repressive histone marks in Arabidopsis thaliana.

    PubMed

    Numa, Hisataka; Kim, Jong-Myong; Matsui, Akihiro; Kurihara, Yukio; Morosawa, Taeko; Ishida, Junko; Mochizuki, Yoshiki; Kimura, Hiroshi; Shinozaki, Kazuo; Toyoda, Tetsuro; Seki, Motoaki; Yoshikawa, Manabu; Habu, Yoshiki

    2010-01-20

    RNA-directed modification of histones is essential for the maintenance of heterochromatin in higher eukaryotes. In plants, cytosine methylation is an additional factor regulating inactive chromatin, but the mechanisms regulating the coexistence of cytosine methylation and repressive histone modification remain obscure. In this study, we analysed the mechanism of gene silencing mediated by MORPHEUS' MOLECULE1 (MOM1) of Arabidopsis thaliana. Transcript profiling revealed that the majority of up-regulated loci in mom1 carry sequences related to transposons and homologous to the 24-nt siRNAs accumulated in wild-type plants that are the hallmarks of RNA-directed DNA methylation (RdDM). Analysis of a single-copy gene, SUPPRESSOR OF drm1 drm2 cmt3 (SDC), revealed that mom1 activates SDC with concomitant reduction of di-methylated histone H3 lysine 9 (H3K9me2) at the tandem repeats in the promoter region without changes in siRNA accumulation and cytosine methylation. The reduction of H3K9me2 is not observed in regions flanking the tandem repeats. The results suggest that MOM1 transduces RdDM signals to repressive histone modification in the core region of RdDM.

  14. NMR chemical shift perturbation mapping of DNA binding by a zinc-finger domain from the yeast transcription factor ADR1.

    PubMed Central

    Schmiedeskamp, M.; Rajagopal, P.; Klevit, R. E.

    1997-01-01

    Mutagenesis studies have revealed that the minimal DNA-binding domain of the yeast transcription factor ADR1 consists of two Cys2-His2 zinc fingers plus an additional 20 residues proximal and N-terminal to the fingers. We have assigned NMR 1H, 15N, and 13C chemical shifts for the entire minimal DNA-binding domain of ADR1 both free and bound to specific DNA. 1H chemical shift values suggest little structural difference between the zinc fingers in this construct and in single-finger constructs, and 13C alpha chemical shift index analysis indicates little change in finger structure upon DNA binding. 1H chemical shift perturbations upon DNA binding are observed, however, and these are mapped to define the protein-DNA interface. The two zinc fingers appear to bind DNA with different orientations, as the entire helix of finger 1 is perturbed, while only the extreme N-terminus of the finger 2 helix is affected. Furthermore, residues N-terminal to the first finger undergo large chemical shift changes upon DNA binding suggesting a role at the protein-DNA interface. A striking correspondence is observed between the protein-DNA interface mapped by chemical shift changes and that previously mapped by mutagenesis. PMID:9300483

  15. Controllable g5p-Protein-Directed Aggregation of ssDNA-Gold Nanoparticles

    SciTech Connect

    Lee, S.; Maye, M; Zhang, Y; Gang, O; van der Lelie, D

    2009-01-01

    We assembled single-stranded DNA (ssDNA) conjugated nanoparticles using the phage M13 gene 5 protein (g5p) as the molecular glue to bind two antiparallel noncomplementary ssDNA strands. The entire process was controlled tightly by the concentration of the g5p protein and the presence of double-stranded DNA. The g5p-ssDNA aggregate was disintegrated by hybridization with complementary ssDNA (C-ssDNA) that triggers the dissociation of the complex. Polyhistidine-tagged g5p was bound to nickel nitrilotriacetic acid (Ni2+-NTA) conjugated nanoparticles and subsequently used to coassemble the ssDNA-conjugated nanoparticles into multiparticle-type aggregates. Our approach offers great promise for designing biologically functional, controllable protein/nanoparticle composites.

  16. Discovery of TNF inhibitors from a DNA-encoded chemical library based on diels-alder cycloaddition.

    PubMed

    Buller, Fabian; Zhang, Yixin; Scheuermann, Jörg; Schäfer, Juliane; Bühlmann, Peter; Neri, Dario

    2009-10-30

    DNA-encoded chemical libraries are promising tools for the discovery of ligands toward protein targets of pharmaceutical relevance. DNA-encoded small molecules can be enriched in affinity-based selections and their unique DNA "barcode" allows the amplification and identification by high-throughput sequencing. We describe selection experiments using a DNA-encoded 4000-compound library generated by Diels-Alder cycloadditions. High-throughput sequencing enabled the identification and relative quantification of library members before and after selection. Sequence enrichment profiles corresponding to the "bar-coded" library members were validated by affinity measurements of single compounds. We were able to affinity mature trypsin inhibitors and identify a series of albumin binders for the conjugation of pharmaceuticals. Furthermore, we discovered a ligand for the antiapoptotic Bcl-xL protein and a class of tumor necrosis factor (TNF) binders that completely inhibited TNF-mediated killing of L-M fibroblasts in vitro.

  17. Direct chemical oxidation: a non-thermal technology for the destruction of organic wastes

    SciTech Connect

    Balazs, G.B.; Cooper, J. F.; Lewis, P. R.; Adamson, M. G.

    1998-02-01

    Direct Chemical Oxidation (DCO) is a non-thermal, ambient pressure, aqueous-based technology for the oxidative destruction of the organic components of hazardous or mixed waste streams. The process has been developed for applications in waste treatment and chemical demilitarization and decontamination at LLNL since 1992, and is applicable to the destruction of virtually all solid or liquid organics, including: chlorosolvents, oils and greases, detergents, organic-contaminated soils or sludges, explosives, chemical and biological warfare agents, and PCB's. [1-15] The process normally operates at 80-100 C, a heating requirement which increases the difficulty of surface decontamination of large objects or, for example, treatment of a wide area contaminated soil site. The driver for DCO work in FY98 was thus to investigate the use of catalysts to demonstrate the effectiveness of the technology for organics destruction at temperatures closer to ambient. In addition, DCO is at a sufficiently mature stage of development that technology transfer to a commercial entity was a logical next step, and was thus included in FY98 tasks.

  18. Network structural analysis using directed graph for chemical reaction analysis in weakly-ionized plasmas

    NASA Astrophysics Data System (ADS)

    Nobuto, Kyosuke; Mizui, Yasutaka; Miyagi, Shigeyuki; Sakai, Osamu; Murakami, Tomoyuki

    2016-09-01

    We visualize complicated chemical reaction systems in weakly-ionized plasmas by analysing network structure for chemical processes, and calculate some indexes by assuming interspecies relationships to be a network to clarify them. With the current social evolution, the mean size of general data which we can use in computers grows huge, and significance of the data analysis increases. The methods of the network analysis which we focus on in this study do not depend on a specific analysis target, but the field where it has been already applied is still limited. In this study, we analyse chemical reaction systems in plasmas for configuring the network structure. We visualize them by expressing a reaction system in a specific plasma by a directed graph and examine the indexes and the relations with the characteristic of the species in the reaction system. For example, in the methane plasma network, the centrality index reveals importance of CH3 in an influential position of species in the reaction. In addition, silane and atmospheric pressure plasmas can be also visualized in reaction networks, suggesting other characteristics in the centrality indexes.

  19. Site-Directed Chemical Probing to map transient RNA/protein interactions.

    PubMed

    Duval, Mélodie; Marenna, Alessandra; Chevalier, Clément; Marzi, Stefano

    2017-03-15

    RNA-protein interactions are at the bases of many biological processes, forming either tight and stable functional ribonucleoprotein (RNP) complexes (i.e. the ribosome) or transitory ones, such as the complexes involving RNA chaperone proteins. To localize the sites where a protein interacts on an RNA molecule, a common simple and inexpensive biochemical method is the footprinting technique. The protein leaves its footprint on the RNA acting as a shield to protect the regions of interaction from chemical modification or cleavages obtained with chemical or enzymatic nucleases. This method has proven its efficiency to study in vitro the organization of stable RNA-protein complexes. Nevertheless, when the protein binds the RNA very dynamically, with high off-rates, protections are very often difficult to observe. For the analysis of these transient complexes, we describe an alternative strategy adapted from the Site Directed Chemical Probing (SDCP) approach and we compare it with classical footprinting. SDCP relies on the modification of the RNA binding protein to tether an RNA probe (usually Fe-EDTA) to specific protein positions. Local cleavages on the regions of interaction can be used to localize the protein and position its domains on the RNA molecule. This method has been used in the past to monitor stable complexes; we provide here a detailed protocol and a practical example of its application to the study of Escherichia coli RNA chaperone protein S1 and its transitory complexes with mRNAs.

  20. Synthesis of Bulk BC8 Silicon Allotrope by Direct Transformation and Reduced-Pressure Chemical Pathways.

    PubMed

    Kurakevych, Oleksandr O; Le Godec, Yann; Crichton, Wilson A; Guignard, Jérémy; Strobel, Timothy A; Zhang, Haidong; Liu, Hanyu; Coelho Diogo, Cristina; Polian, Alain; Menguy, Nicolas; Juhl, Stephen J; Gervais, Christel

    2016-09-06

    Phase-pure samples of a metastable allotrope of silicon, Si-III or BC8, were synthesized by direct elemental transformation at 14 GPa and ∼900 K and also at significantly reduced pressure in the Na-Si system at 9.5 GPa by quenching from high temperatures ∼1000 K. Pure sintered polycrystalline ingots with dimensions ranging from 0.5 to 2 mm can be easily recovered at ambient conditions. The chemical route also allowed us to decrease the synthetic pressures to as low as 7 GPa, while pressures required for direct phase transition in elemental silicon are significantly higher. In situ control of the synthetic protocol, using synchrotron radiation, allowed us to observe the underlying mechanism of chemical interactions and phase transformations in the Na-Si system. Detailed characterization of Si-III using X-ray diffraction, Raman spectroscopy, (29)Si NMR spectroscopy, and transmission electron microscopy are discussed. These large-volume syntheses at significantly reduced pressures extend the range of possible future bulk characterization methods and applications.

  1. Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

    NASA Astrophysics Data System (ADS)

    Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

    2016-07-01

    The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

  2. The SV40 large T-antigen origin binding domain directly participates in DNA unwinding.

    PubMed

    Foster, Erin C; Simmons, Daniel T

    2010-03-16

    The origin binding domain (OBD) of SV40 large T-ag serves a critical role during initiation of DNA replication to position T-ag on the origin. After origin recognition, T-ag forms a double hexamer over the origin. Within each hexamer, the OBD adopts a lock washer structure where the origin recognizing A1 and B2 loops face toward the helicase domain and likely become unavailable for binding DNA. In this study, we investigated the role of the central channel of the OBD hexamer in DNA replication by analyzing the effects of mutations of residues lining the channel. All mutants showed binding defects with origin DNA and ssDNA especially at low protein concentrations, but only half were defective at supporting DNA replication in vitro. All mutants were normal in unwinding linear origin DNA fragments. However, replication defective mutants failed to unwind a small origin containing circular DNA whereas replication competent mutants did so normally. The presence of RPA and/or pol/prim restored circular DNA unwinding activity of compromised mutants probably by interacting with the separated DNA strands on the T-ag surface. We interpret these results to indicate a role for the OBD central channel in binding and threading ssDNA during unwinding of circular SV40 DNA. Mixing experiments suggested that only one monomer in an OBD hexamer was necessary for DNA unwinding. We present a model of DNA threading through the T-ag complex illustrating how single-stranded DNA could pass close to a trough generated by key residues in one monomer of the OBD hexamer.

  3. Chemical Shifts to Metabolic Pathways: Identifying Metabolic Pathways Directly from a Single 2D NMR Spectrum.

    PubMed

    Dubey, Abhinav; Rangarajan, Annapoorni; Pal, Debnath; Atreya, Hanudatta S

    2015-12-15

    Identifying cellular processes in terms of metabolic pathways is one of the avowed goals of metabolomics studies. Currently, this is done after relevant metabolites are identified to allow their mapping onto specific pathways. This task is daunting due to the complex nature of cellular processes and the difficulty in establishing the identity of individual metabolites. We propose here a new method: ChemSMP (Chemical Shifts to Metabolic Pathways), which facilitates rapid analysis by identifying the active metabolic pathways directly from chemical shifts obtained from a single two-dimensional (2D) [(13)C-(1)H] correlation NMR spectrum without the need for identification and assignment of individual metabolites. ChemSMP uses a novel indexing and scoring system comprised of a "uniqueness score" and a "coverage score". Our method is demonstrated on metabolic pathways data from the Small Molecule Pathway Database (SMPDB) and chemical shifts from the Human Metabolome Database (HMDB). Benchmarks show that ChemSMP has a positive prediction rate of >90% in the presence of decluttered data and can sustain the same at 60-70% even in the presence of noise, such as deletions of peaks and chemical shift deviations. The method tested on NMR data acquired for a mixture of 20 amino acids shows a success rate of 93% in correct recovery of pathways. When used on data obtained from the cell lysate of an unexplored oncogenic cell line, it revealed active metabolic pathways responsible for regulating energy homeostasis of cancer cells. Our unique tool is thus expected to significantly enhance analysis of NMR-based metabolomics data by reducing existing impediments.

  4. Influence of major-groove chemical modifications of DNA on transcription by bacterial RNA polymerases

    PubMed Central

    Raindlová, Veronika; Janoušková, Martina; Slavíčková, Michaela; Perlíková, Pavla; Boháčová, Soňa; Milisavljevič, Nemanja; Šanderová, Hana; Benda, Martin; Barvík, Ivan; Krásný, Libor; Hocek, Michal

    2016-01-01

    DNA templates containing a set of base modifications in the major groove (5-substituted pyrimidines or 7-substituted 7-deazapurines bearing H, methyl, vinyl, ethynyl or phenyl groups) were prepared by PCR using the corresponding base-modified 2′-deoxyribonucleoside triphosphates (dNTPs). The modified templates were used in an in vitro transcription assay using RNA polymerase from Bacillus subtilis and Escherichia coli. Some modified nucleobases bearing smaller modifications (H, Me in 7-deazapurines) were perfectly tolerated by both enzymes, whereas bulky modifications (Ph at any nucleobase) and, surprisingly, uracil blocked transcription. Some middle-sized modifications (vinyl or ethynyl) were partly tolerated mostly by the E. coli enzyme. In all cases where the transcription proceeded, full length RNA product with correct sequence was obtained indicating that the modifications of the template are not mutagenic and the inhibition is probably at the stage of initiation. The results are promising for the development of bioorthogonal reactions for artificial chemical switching of the transcription. PMID:27001521

  5. Carbon-13 chemical shift anisotropy in DNA bases from field dependence of solution NMR relaxation rates.

    PubMed

    Ying, Jinfa; Grishaev, Alexander; Bax, Ad

    2006-03-01

    Knowledge of (13)C chemical shift anisotropy (CSA) in nucleotide bases is important for the interpretation of solution-state NMR relaxation data in terms of local dynamic properties of DNA and RNA. Accurate knowledge of the CSA becomes particularly important at high magnetic fields, prerequisite for adequate spectral resolution in larger oligonucleotides. Measurement of (13)C relaxation rates of protonated carbons in the bases of the so-called Dickerson dodecamer, d(CGCGAATTCGCG)(2), at 500 and 800 MHz (1)H frequency, together with the previously characterized structure and diffusion tensor yields CSA values for C5 in C, C6 in C and T, C8 in A and G, and C2 in A that are closest to values previously reported on the basis of solid-state FIREMAT NMR measurements, and mostly larger than values obtained by in vacuo DFT calculations. Owing to the noncollinearity of dipolar and CSA interactions, interpretation of the NMR relaxation rates is particularly sensitive to anisotropy of rotational diffusion, and use of isotropic diffusion models can result in considerable errors.

  6. DNA structure directs positioning of the mitochondrial genome packaging protein Abf2p

    PubMed Central

    Chakraborty, Arka; Lyonnais, Sébastien; Battistini, Federica; Hospital, Adam; Medici, Giorgio; Prohens, Rafel; Orozco, Modesto; Vilardell, Josep; Solà, Maria

    2017-01-01

    The mitochondrial genome (mtDNA) is assembled into nucleo-protein structures termed nucleoids and maintained differently compared to nuclear DNA, the involved molecular basis remaining poorly understood. In yeast (Saccharomyces cerevisiae), mtDNA is a ∼80 kbp linear molecule and Abf2p, a double HMG-box protein, packages and maintains it. The protein binds DNA in a non-sequence-specific manner, but displays a distinct ‘phased-binding’ at specific DNA sequences containing poly-adenine tracts (A-tracts). We present here two crystal structures of Abf2p in complex with mtDNA-derived fragments bearing A-tracts. Each HMG-box of Abf2p induces a 90° bend in the contacted DNA, causing an overall U-turn. Together with previous data, this suggests that U-turn formation is the universal mechanism underlying mtDNA compaction induced by HMG-box proteins. Combining this structural information with mutational, biophysical and computational analyses, we reveal a unique DNA binding mechanism for Abf2p where a characteristic N-terminal flag and helix are crucial for mtDNA maintenance. Additionally, we provide the molecular basis for A-tract mediated exclusion of Abf2p binding. Due to high prevalence of A-tracts in yeast mtDNA, this has critical relevance for nucleoid architecture. Therefore, an unprecedented A-tract mediated protein positioning mechanism regulates DNA packaging proteins in the mitochondria, and in combination with DNA-bending and U-turn formation, governs mtDNA compaction. PMID:27899643

  7. A novel mechanism for direct real-time polymerase chain reaction that does not require DNA isolation from prokaryotic cells.

    PubMed

    Soejima, Takashi; Xiao, Jin-Zhong; Abe, Fumiaki

    2016-06-23

    Typically, polymerase chain reaction (PCR) is performed after DNA isolation. Real-time PCR (qPCR), also known as direct qPCR in mammalian cells with weak membranes, is a common technique using crude samples subjected to preliminary boiling to elute DNA. However, applying this methodology to prokaryotic cells, which have solid cell walls, in contrast to mammalian cells which immediately burst in water, can result in poor detection. We successfully achieved PCR elongation with the addition of 1.3 cfu of Cronobacter muytjensii to a newly developed direct qPCR master mix without performing any crude DNA extraction (detection limit of 1.6 × 10(0) cfu/ml for the test sample compared with a detection limit of 1.6 × 10(3) cfu/ml primarily for crude (boiling) or classical DNA isolation). We revealed that the chromosomal DNA retained in prokaryotic cells can function as a PCR template, similarly to the mechanism in in situ PCR. Elucidating this reaction mechanism may contribute to the development of an innovative master mix for direct qPCR to detect genes in a single bacterium with solid cell walls and might lead to numerous novel findings in prokaryotic genomics research.

  8. Repair of DNA treated with. gamma. -irradiation and chemical carcinogens. Progress report, 1980-1983

    SciTech Connect

    Goldthwait, D.A.

    1984-02-01

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with ..beta..-propiolactone was done to define potential new substrates useful in a search for new glycosylases.

  9. Synthesis and application of charge-modified dye-labeled dideoxynucleoside-5'-triphosphates to 'direct-load' DNA sequencing.

    PubMed

    Finn, Patrick J; Sun, Lei; Nampalli, Satyam; Xiao, Haiguang; Nelson, John R; Mamone, J Anthony; Grossmann, Greg; Flick, Parke K; Fuller, Carl W; Kumar, Shiv

    2002-07-01

    A novel series of charge-modified, dye-labeled 2',3'-dideoxynucleoside-triphosphate terminators were synthesized and evaluated as reagents for DNA sequencing. These terminators possess an advantage over existing reagents in that no purification is required to remove unreacted nucleotide or associated breakdown products prior to electrophoretic separation of the sequencing fragments. This obviates the need for a time consuming post-reaction work up, allowing direct loading of DNA sequencing reaction mixtures onto a slab gel. Thermo Sequenase II DNA polymerase poorly incorporates the charge-modified terminators compared with regular dye-labeled terminators. However, extending the linker arm between dye and nucleotide and using a mutant form of a related DNA polymerase can in part mitigate the decrease in substrate efficiency. We also present evidence that these charge-modified terminators can relieve gel compression artefacts when used with dGTP in sequencing reactions.

  10. Biomolecular Damage Induced by Ionizing Radiation: The Direct and Indirect Effects of Low-Energy Electrons on DNA

    NASA Astrophysics Data System (ADS)

    Alizadeh, Elahe; Orlando, Thomas M.; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  11. Biomolecular damage induced by ionizing radiation: the direct and indirect effects of low-energy electrons on DNA.

    PubMed

    Alizadeh, Elahe; Orlando, Thomas M; Sanche, Léon

    2015-04-01

    Many experimental and theoretical advances have recently allowed the study of direct and indirect effects of low-energy electrons (LEEs) on DNA damage. In an effort to explain how LEEs damage the human genome, researchers have focused efforts on LEE interactions with bacterial plasmids, DNA bases, sugar analogs, phosphate groups, and longer DNA moieties. Here, we summarize the current understanding of the fundamental mechanisms involved in LEE-induced damage of DNA and complex biomolecule films. Results obtained by several laboratories on films prepared and analyzed by different methods and irradiated with different electron-beam current densities and fluencies are presented. Despite varied conditions (e.g., film thicknesses and morphologies, intrinsic water content, substrate interactions, and extrinsic atmospheric compositions), comparisons show a striking resemblance in the types of damage produced and their yield functions. The potential of controlling this damage using molecular and nanoparticle targets with high LEE yields in targeted radiation-based cancer therapies is also discussed.

  12. Nanotechnology in plant disease management: DNA-directed silver nanoparticles on graphene oxide as an antibacterial against Xanthomonas perforans.

    PubMed

    Ocsoy, Ismail; Paret, Mathews L; Ocsoy, Muserref Arslan; Kunwar, Sanju; Chen, Tao; You, Mingxu; Tan, Weihong

    2013-10-22

    Bacterial spot caused by Xanthomonas perforans is a major disease of tomatoes, leading to reduction in production by 10-50%. While copper (Cu)-based bactericides have been used for disease management, most of the X. perforans strains isolated from tomatoes in Florida and other locations worldwide are Cu-resistant. We have developed DNA-directed silver (Ag) nanoparticles (NPs) grown on graphene oxide (GO). These Ag@dsDNA@GO composites effectively decrease X. perforans cell viability in culture and on plants. At the very low concentration of 16 ppm of Ag@dsDNA@GO, composites show excellent antibacterial capability in culture with significant advantages in improved stability, enhanced antibacterial activity, and stronger adsorption properties. Application of Ag@dsDNA@GO at 100 ppm on tomato transplants in a greenhouse experiment significantly reduced the severity of bacterial spot disease compared to untreated plants, giving results similar to those of the current grower standard treatment, with no phytotoxicity.

  13. Directional mapping of DNA nicking in ejaculated and cauda epididymidal spermatozoa of the short-beaked echidna (Tachyglossus aculeatus: Monotremata).

    PubMed

    Johnston, S D; López-Fernández, C; Gosálbez, A; Holt, W V; Gosálvez, J

    2009-01-01

    Prototherian spermatozoa are unique amongst the Mammalia in terms of their filiform morphology, tandem arrangement of chromosomes and formation of sperm bundles. In the present study, we provide observations of echidna spermatozoa and note that the superstructure of the bundle is engineered around the shape of the individual sperm head and that this in turn may be a consequence of the unusual circumferential and helicoidal condensation of the DNA during spermiogenesis. Frozen-thawed ejaculated echidna spermatozoa were incubated and examined for the presence of non-typical DNA conformation by means of in situ labelling of DNA breaks using Klenow polymerase and via alkaline single-cell comet assays for detection of fragmented DNA. Both techniques successfully revealed the presence of what appeared to be directional DNA nicking, co-localised with the presence of highly sensitive alkali sites along the length of the sperm nucleus. It was not possible to define whether these alternative DNA configurations were associated with a failure of the sperm nucleus to condense appropriately during spermiogenesis or were evidence of DNA fragmentation following post-thaw incubation or a sequential structural chromatin rearrangement necessary for fertilisation.

  14. Targeted DNA methylation by homology-directed repair in mammalian cells. Transcription reshapes methylation on the repaired gene.

    PubMed

    Morano, Annalisa; Angrisano, Tiziana; Russo, Giusi; Landi, Rosaria; Pezone, Antonio; Bartollino, Silvia; Zuchegna, Candida; Babbio, Federica; Bonapace, Ian Marc; Allen, Brittany; Muller, Mark T; Chiariotti, Lorenzo; Gottesman, Max E; Porcellini, Antonio; Avvedimento, Enrico V

    2014-01-01

    We report that homology-directed repair of a DNA double-strand break within a single copy Green Fluorescent Protein (GFP) gene in HeLa cells alters the methylation pattern at the site of recombination. DNA methyl transferase (DNMT)1, DNMT3a and two proteins that regulate methylation, Np95 and GADD45A, are recruited to the site of repair and are responsible for selective methylation of the promoter-distal segment of the repaired DNA. The initial methylation pattern of the locus is modified in a transcription-dependent fashion during the 15-20 days following repair, at which time no further changes in the methylation pattern occur. The variation in DNA modification generates stable clones with wide ranges of GFP expression. Collectively, our data indicate that somatic DNA methylation follows homologous repair and is subjected to remodeling by local transcription in a discrete time window during and after the damage. We propose that DNA methylation of repaired genes represents a DNA damage code and is source of variation of gene expression.

  15. Template-directed covalent conjugation of DNA to native antibodies, transferrin and other metal-binding proteins

    NASA Astrophysics Data System (ADS)

    Rosen, Christian B.; Kodal, Anne L. B.; Nielsen, Jesper S.; Schaffert, David H.; Scavenius, Carsten; Okholm, Anders H.; Voigt, Niels V.; Enghild, Jan J.; Kjems, Jørgen; Tørring, Thomas; Gothelf, Kurt V.

    2014-09-01

    DNA-protein conjugates are important in bioanalytical chemistry, molecular diagnostics and bionanotechnology, as the DNA provides a unique handle to identify, functionalize or otherwise manipulate proteins. To maintain protein activity, conjugation of a single DNA handle to a specific location on the protein is often needed. However, preparing such high-quality site-specific conjugates often requires genetically engineered proteins, which is a laborious and technically challenging approach. Here we demonstrate a simpler method to create site-selective DNA-protein conjugates. Using a guiding DNA strand modified with a metal-binding functionality, we directed a second DNA strand to the vicinity of a metal-binding site of His6-tagged or wild-type metal-binding proteins, such as serotransferrin, where it subsequently reacted with lysine residues at that site. This method, DNA-templated protein conjugation, facilitates the production of site-selective protein conjugates, and also conjugation to IgG1 antibodies via a histidine cluster in the constant domain.

  16. Triple helix-forming oligonucleotides conjugated to indolocarbazole poisons direct topoisomerase I-mediated DNA cleavage to a specific site.

    PubMed

    Arimondo, P B; Bailly, C; Boutorine, A S; Moreau, P; Prudhomme, M; Sun, J S; Garestier, T; Hélène, C

    2001-01-01

    Topoisomerase I is an ubiquitous DNA-cleaving enzyme and an important therapeutic target in cancer chemotherapy for camptothecins as well as for indolocarbazole antibiotics such as rebeccamycin. To achieve a sequence-specific cleavage of DNA by topoisomerase I, a triple helix-forming oligonucleotide was covalently linked to indolocarbazole-type topoisomerase I poisons. The three indolocarbazole-oligonucleotide conjugates investigated were able to direct topoisomerase I cleavage at a specific site based upon sequence recognition by triplex formation. The efficacy of topoisomerase I-mediated DNA cleavage depends markedly on the intrinsic potency of the drug. We show that DNA cleavage depends also upon the length of the linker arm between the triplex-forming oligonucleotide and the drug. Based on a known structure of the DNA-topoisomerase I complex, a molecular model of the oligonucleotide conjugates bound to the DNA-topoisomerase I complex was elaborated to facilitate the design of a potent topoisomerase I inhibitor-oligonucleotide conjugate with an optimized linker between the two moieties. The resulting oligonucleotide-indolocarbazole conjugate at 10 nM induced cleavage at the triple helix site 2-fold more efficiently than 5 microM of free indolocarbazole, while the other drug-sensitive sites were not cleaved. The rational design of drug-oligonucleotide conjugates carrying a DNA topoisomerase poison may be exploited to improve the efficacy and selectivity of chemotherapeutic cancer treatments by targeting specific genes and reducing drug toxicity.

  17. Graphene oxide directed in-situ deposition of electroactive silver nanoparticles and its electrochemical sensing application for DNA analysis.

    PubMed

    Gao, Ningning; Gao, Feng; He, Suyu; Zhu, Qionghua; Huang, Jiafu; Tanaka, Hidekazu; Wang, Qingxiang

    2017-01-25

    The development of high-performance biosensing platform is heavily dependent on the recognition property of the sensing layer and the output intensity of the signal probe. Herein, we present a simple and highly sensitive biosensing interface for DNA detection on the basis of graphene oxide nanosheets (GONs) directed in-situ deposition of silver nanoparticles (AgNPs). The fabrication process and electrochemical properties of the biosensing interface were probed by electrochemical techniques and scanning electron microscopy. The results indicate that GONs can specifically adsorb at the single-stranded DNA probe surface, and induces the deposition of highly electroactive AgNPs. Upon hybridization with complementary oligonucleotides to generate the duplex DNA on the electrode surface, the GONs with the deposited AgNPs will be liberated from the sensing interface due to the inferior affinity of GONs and duplex DNA, resulting in the reduction of the electrochemical signal. Such a strategy combines the superior recognition of GONs toward single-stranded DNA and double-stranded DNA, and the strong electrochemical response of in-situ deposited AgNPs. Under optimal conditions, the biosensor can detect target DNA over a wide range from 10 fM to 10 nM with a detection limit of 7.6 fM. Also, the developed biosensor shows outstanding discriminating ability toward oligonucleotides with different mismatching degrees.

  18. A 3D Model of Double-Helical DNA Showing Variable Chemical Details

    ERIC Educational Resources Information Center

    Cady, Susan G.

    2005-01-01

    Since the first DNA model was created approximately 50 years ago using molecular models, students and teachers have been building simplified DNA models from various practical materials. A 3D double-helical DNA model, made by placing beads on a wire and stringing beads through holes in plastic canvas, is described. Suggestions are given to enhance…

  19. Microdosimetry of DNA conformations: relation between direct effect of (60)Co gamma rays and topology of DNA geometrical models in the calculation of A-, B- and Z-DNA radiation-induced damage yields.

    PubMed

    Semsarha, Farid; Raisali, Gholamreza; Goliaei, Bahram; Khalafi, Hossein

    2016-05-01

    In order to obtain the energy deposition pattern of ionizing radiation in the nanometric scale of genetic material and to investigate the different sensitivities of the DNA conformations, direct effects of (60)Co gamma rays on the three A, B and Z conformations of DNA have been studied. For this purpose, single-strand breaks (SSB), double-strand breaks (DSB), base damage (BD), hit probabilities and three microdosimetry quantities (imparted energy, mean chord length and lineal energy) in the mentioned DNA conformations have been calculated and compared by using GEometry ANd Tracking 4 (Geant4) toolkit. The results show that A-, B- and Z-DNA conformations have the highest yields of DSB (1.2 Gy(-1) Gbp(-1)), SSB (25.2 Gy(-1) Gbp(-1)) and BD (4.81 Gy(-1) Gbp(-1)), respectively. Based on the investigation of direct effects of radiation, it can be concluded that the DSB yield is largely correlated to the topological characteristics of DNA models, although the SSB yield is not. Moreover, according to the comparative results of the present study, a reliable candidate parameter for describing the relationship between DNA damage yields and geometry of DNA models in the theoretical radiation biology research studies would be the mean chord length (4 V/S) of the models.

  20. Mechanisms of neurotoxicity induced in the developing brain of mice and rats by DNA-damaging chemicals.

    PubMed

    Doi, Kunio

    2011-01-01

    It is not widely known how the developing brain responds to extrinsic damage, although the developing brain is considered to be sensitive to diverse environmental factors including DNA-damaging agents. This paper reviews the mechanisms of neurotoxicity induced in the developing brain of mice and rats by six chemicals (ethylnitrosourea, hydroxyurea, 5-azacytidine, cytosine arabinoside, 6-mercaptopurine and etoposide), which cause DNA damage in different ways, especially from the viewpoints of apoptosis and cell cycle arrest in neural progenitor cells. In addition, this paper also reviews the repair process following damage in the developing brain.

  1. Direct Visualization of Conformation and Dense Packing of DNA-Based Soft Colloids

    NASA Astrophysics Data System (ADS)

    Zhang, Jing; Lettinga, Paul M.; Dhont, Jan K. G.; Stiakakis, Emmanuel

    2014-12-01

    Soft colloids—such as polymer-coated particles, star polymers, block-copolymer micelles, microgels—constitute a broad class of materials where microscopic properties such as deformability and penetrability of the particle play a key role in tailoring their macroscopic properties which is of interest in many technological areas. The ability to access these microscopic properties is not yet demonstrated despite its great importance. Here we introduce novel DNA-coated colloids with star-shaped architecture that allows accessing the above local structural information by directly visualizing their intramolecular monomer density profile and arm's free-end locations with confocal fluorescent microscopy. Compression experiments on a two-dimensional hexagonal lattice formed by these macromolecular assemblies reveal an exceptional resistance to mutual interpenetration of their charged corona at pressures approaching the MPa range. Furthermore, we find that this lattice, in a close packing configuration, is surprisingly tolerant to particle size variation. We anticipate that these stimuli-responsive materials could aid to get deeper insight in a wide range of problems in soft matter, including the study and design of biomimetic lubricated surfaces.

  2. RNA-Directed DNA Methylation: The Evolution of a Complex Epigenetic Pathway in Flowering Plants.

    PubMed

    Matzke, Marjori A; Kanno, Tatsuo; Matzke, Antonius J M

    2015-01-01

    RNA-directed DNA methylation (RdDM) is an epigenetic process in plants that involves both short and long noncoding RNAs. The generation of these RNAs and the induction of RdDM rely on complex transcriptional machineries comprising two plant-specific, RNA polymerase II (Pol II)-related RNA polymerases known as Pol IV and Pol V, as well as a host of auxiliary factors that include both novel and refashioned proteins. We present current views on the mechanism of RdDM with a focus on evolutionary innovations that occurred during the transition from a Pol II transcriptional pathway, which produces mRNA precursors and numerous noncoding RNAs, to the Pol IV and Pol V pathways, which are specialized for RdDM and gene silencing. We describe recently recognized deviations from the canonical RdDM pathway, discuss unresolved issues, and speculate on the biological significance of RdDM for flowering plants, which have a highly developed Pol V pathway.

  3. Mitochondrial DNA is a direct target of anti-cancer anthracycline drugs

    SciTech Connect

    Ashley, Neil Poulton, Joanna

    2009-01-16

    The anthracyclines, such as doxorubicin (DXR), are potent anti-cancer drugs but they are limited by their clinical toxicity. The mechanisms involved remain poorly understood partly because of the difficulty in determining sub-cellular drug localisation. Using a novel method utilising the fluorescent DNA dye PicoGreen, we found that anthracyclines intercalated not only into nuclear DNA but also mitochondrial DNA (mtDNA). Intercalation of mtDNA by anthracyclines may thus contribute to the marked mitochondrial toxicity associated with these drugs. By contrast, ethidium bromide intercalated exclusively into mtDNA, without interacting with nuclear DNA, thereby explaining why mtDNA is the main target for ethidium. By exploiting PicoGreen quenching we also developed a novel assay for quantification of mtDNA levels by flow-cytometry, an approach which should be useful for studies of mitochondrial dysfunction. In summary our PicoGreen assay should be useful to study drug/DNA interactions within live cells, and facilitate therapeutic drug monitoring and kinetic studies in cancer patients.

  4. The Ability to Form Homodimers Is Essential for RDM1 to Function in RNA-Directed DNA Methylation

    PubMed Central

    Sasaki, Taku; Lorković, Zdravko J.; Liang, Shih-Chieh; Matzke, Antonius J. M.; Matzke, Marjori

    2014-01-01

    RDM1 (RNA-DIRECTED DNA METHYLATION1) is a small plant-specific protein required for RNA-directed DNA methylation (RdDM). RDM1 interacts with RNA polymerase II (Pol II), ARGONAUTE4 (AGO4), and the de novo DNA methyltransferase DOMAINS REARRANGED METHYLTRANSFERASE2 (DRM2) and binds to methylated single stranded DNA. As the only protein identified so far that interacts directly with DRM2, RDM1 plays a pivotal role in the RdDM mechanism by linking the de novo DNA methyltransferase activity to AGO4, which binds short interfering RNAs (siRNAs) that presumably base-pair with Pol II or Pol V scaffold transcripts synthesized at target loci. RDM1 also acts together with the chromatin remodeler DEFECTIVE IN RNA-DIRECTED DNA METHYLATION1 (DRD1) and the structural-maintenance-of-chromosomes solo hinge protein DEFECTIVE IN MERISTEM SILENCING3 (DMS3) to form the DDR complex, which facilitates synthesis of Pol V scaffold transcripts. The manner in which RDM1 acts in both the DDR complex and as a factor bridging DRM2 and AGO4 remains unclear. RDM1 contains no known protein domains but a prior structural analysis suggested distinct regions that create a hydrophobic pocket and promote homodimer formation, respectively. We have tested several mutated forms of RDM1 altered in the predicted pocket and dimerization regions for their ability to complement defects in RdDM and transcriptional gene silencing, support synthesis of Pol V transcripts, form homodimers, and interact with DMS3. Our results indicate that the ability to form homodimers is essential for RDM1 to function fully in the RdDM pathway and may be particularly important during the de novo methylation step. PMID:24498436

  5. Bifunctional rhodium intercalator conjugates as mismatch-directing DNA alkylating agents.

    PubMed

    Schatzschneider, Ulrich; Barton, Jacqueline K

    2004-07-21

    A conjugate of a DNA mismatch-specific rhodium intercalator, containing the bulky chrysenediimine ligand, and an aniline mustard has been prepared, and targeting of mismatches in DNA by this conjugate has been examined. The preferential alkylation of mismatched over fully matched DNA is found by a mobility shift assay at concentrations where untethered organic mustards show little reaction. The binding site of the Rh intercalator was determined by DNA photocleavage, and the position of covalent modification was established on the basis of the enhanced depurination associated with N-alkylation. The site-selective alkylation at mismatched DNA renders these conjugates useful tools for the covalent tagging of DNA base pair mismatches and new chemotherapeutic design.

  6. DNA strand breaks detected in embryos of the adult snails, Potamopyrgus antipodarum, and in neonates exposed to genotoxic chemicals.

    PubMed

    Vincent-Hubert, Françoise; Revel, Messika; Garric, Jeanne

    2012-10-15

    We tested the freshwater mudsnail Potamopyrgus antipodarum, which is a species that has already been used for endocrine-disrupting compounds (EDCs) to determine whether early life stages of aquatic organisms are sensitive to genotoxic chemicals. For this purpose, we first developed the alkaline comet assay on adults, embryos, and neonates. The comet assay protocol was validated on both embryonic cells exposed in vitro to hydrogen peroxide and adult snails in the reproducing stage exposed to methyl methane sulfonate. During the latter experiment, DNA strand breaks were investigated on both embryonic cells and on adult gill cells. The second part of this study investigated the stability of DNA strand breaks in adult reproducing snails and neonates exposed to cadmium (Cd) and bisphenol A for 8 days. Hydrogen peroxide-induced DNA strand breaks in vitro in isolated embryonic cells. Exposure of adult reproducing snails to methyl methane sulfonate for 24h induced DNA strand breaks in embryos. Bisphenol A induced a significant increase in the DNA strand-break level in whole embryonic cells and whole neonate cells. Cd was genotoxic for both embryos and neonates during the exposure time and also after 7 days of depuration, suggesting that Cd could inhibit DNA repair enzymes. These preliminary results on this original model have encouraged us to consider the impact of genotoxic environmental contaminants on the F1 generation.

  7. What fraction of DNA double-strand breaks produced by the direct effect is accounted for by radical pairs?

    PubMed

    Peoples, Anita R; Mercer, Kermit R; Bernhard, William A

    2010-07-22

    The purpose of this investigation was to determine what fraction of double strand breaks (dsb's), generated by the direct effect of ionizing radiation on DNA, can be accounted for by radical pairs. A radical pair is defined as two radicals trapped within a separation distance of <3 nm. Q-band EPR was used to measure the yield of radical pairs in calf thymus DNA films X-irradiated at 4 K. The EPR spectrum of DNA showed no evidence of radical pairs. To determine the relative sensitivity for radical pair detection via Q-band EPR, we measured the yield of radical pairs in single crystals of thymine, G(rp-Thy). Under the same conditions employed for DNA, G(rp-Thy) was approximately 8 nmol/J. The value of G(rp-Thy), in conjunction with the measured signal-to-noise, was used to calculate an upper limit for the yield of radical pairs in DNA, G(max)(rp-DNA) < 0.7-1.4 nmol/J. The upper limit, G(max)(rp-DNA), was compared with the yield of dsb's, G(total)(dsb) = 10 nmol/J, previously measured in pUC18 DNA films by Purkayastha, S.; Milligan, J. R.; Bernhard, W. A. Radiat. Res. 2007, 168, 357. We found that G(total)(dsb) > 2 x G(max)(rp-DNA), implying that a significant fraction of dsb's were not derived from a pair of trappable radicals. At least one of the two precursors needed to form a dsb was a diamagnetic (molecular) product. The hypothesis is that EPR silent lesions are formed through a molecular pathway. For example, a two-electron oxidation of deoxyribose would result in a deoxyribose carbocation intermediate that ultimately leads to a strand break.

  8. A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3'-->5' direction.

    PubMed

    Phan, Tuan-Nghia; Ehtesham, Nasreen Z; Tuteja, Renu; Tuteja, Narendra

    2003-04-01

    A novel ATP-dependent nuclear DNA unwinding enzyme from pea has been purified to apparent homogeneity and characterized. This enzyme is present at extremely low abundance and has the highest specific activity among plant helicases. It is a heterodimer of 54 and 66 kDa polypeptides as determined by SDS/PAGE. On gel filtration chromatography and glycerol gradient centrifugation it gives a native molecular mass of 120 kDa and is named as pea DNA helicase 120 (PDH120). The enzyme can unwind 17-bp partial duplex substrates with equal efficiency whether or not they contain a fork. It translocates unidirectionally along the bound strand in the 3'-->5' direction. The enzyme also exhibits intrinsic single-stranded DNA- and Mg2+-dependent ATPase activity. ATP is the most favoured cofactor but other NTPs and dNTPs can also support the helicase activity with lower efficiency (ATP > GTP = dCTP > UTP > dTTP > CTP > dATP > dGTP) for which divalent cation (Mg2+ > Mn2+) is required. The DNA intercalating agents actinomycin C1, ethidium bromide, daunorubicin and nogalamycin inhibit the DNA unwinding activity of PDH120 with Ki values of 5.6, 5.2, 4.0 and 0.71 micro Ms, respectively. This inhibition might be due to the intercalation of the inhibitors into duplex DNA, which results in the formation of DNA-inhibitor complexes that impede the translocation of PDH120. Isolation of this new DNA helicase should make an important contribution to our better understanding of DNA transaction in plants.

  9. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  10. Chemical Reactions and Mechanical Properties of the Directly Bonded Ge-Si Interface

    NASA Astrophysics Data System (ADS)

    Byun, Ki Yeol; Ferain, Isabelle; Yu, Ran; Colinge, Cindy

    2011-12-01

    In this study, chemical reactions and mechanical properties of directly bonded Ge-Si interfaces are investigated. The Ge-Si bonded interface has been systematically characterized as a function of the thermal budget (200 °C and 300 °C), which demonstrated that the formation of a thin GeO2 cap layer by radical pre-treatment can reduce the generation rate of voids at the bonded interface significantly. Patterning of one of the wafers prior to bonding can help to achieve high bonding quality thanks to enhanced out-diffusion of reaction by-products and stress reduction at the bonded interface. Both numerical modeling and structural analysis show that the presence of diffusion path (channels) at the bonded interfaces result in a maximum bond strength and minimum stress at the bonded interface.

  11. Antireflective silica nanoparticle array directly deposited on flexible polymer substrates by chemical vapor deposition.

    PubMed

    Yun, Jungheum; Bae, Tae-Sung; Kwon, Jung-Dae; Lee, Sunghun; Lee, Gun-Hwan

    2012-11-21

    We report the direct coating of a novel antireflective (AR) nanoarray structure of silica nanoparticles on highly flexible polymer substrates by a conventional vacuum coating method using plasma-enhanced chemical vapor deposition. Globular-shaped silica nanoparticles are found to be self-arranged in a periodic pattern on subwavelength scales without the use of artificial assemblies that typically require complicated nanolithography or solution-based nanoparticle fabrication approaches. Highly efficient AR characteristics in the visible spectral range are obtained at optimized refractive indices by controlling the dimensions and average distances of the silica nanoparticle arrays in a level accuracy of tens of nanometers. The AR nanoarrays exhibit sufficient structural durability against the very high strain levels that arise from the flexibility of polymer substrates. This simple coating process provides a cost-effective, high-throughput, room-temperature fabrication solution for producing large-area polymer substrates with AR characteristics.

  12. Direct measurement of DNA bending by type IIA topoisomerases: implications for non-equilibrium topology simplification

    PubMed Central

    Hardin, Ashley H.; Sarkar, Susanta K.; Seol, Yeonee; Liou, Grace F.; Osheroff, Neil; Neuman, Keir C.

    2011-01-01

    Type IIA topoisomerases modify DNA topology by passing one segment of duplex DNA (transfer or T–segment) through a transient double-strand break in a second segment of DNA (gate or G–segment) in an ATP-dependent reaction. Type IIA topoisomerases decatenate, unknot and relax supercoiled DNA to levels below equilibrium, resulting in global topology simplification. The mechanism underlying this non-equilibrium topology simplification remains speculative. The bend angle model postulates that non-equilibrium topology simplification scales with the bend angle imposed on the G–segment DNA by the binding of a type IIA topoisomerase. To test this bend angle model, we used atomic force microscopy and single-molecule Förster resonance energy transfer to measure the extent of bending imposed on DNA by three type IIA topoisomerases that span the range of topology simplification activity. We found that Escherichia coli topoisomerase IV, yeast topoisomerase II and human topoisomerase IIα each bend DNA to a similar degree. These data suggest that DNA bending is not the sole determinant of non-equilibrium topology simplification. Rather, they suggest a fundamental and conserved role for DNA bending in the enzymatic cycle of type IIA topoisomerases. PMID:21421557

  13. Medicinal Plants Recommended by the World Health Organization: DNA Barcode Identification Associated with Chemical Analyses Guarantees Their Quality

    PubMed Central

    Palhares, Rafael Melo; Gonçalves Drummond, Marcela; dos Santos Alves Figueiredo Brasil, Bruno; Pereira Cosenza, Gustavo; das Graças Lins Brandão, Maria; Oliveira, Guilherme

    2015-01-01

    Medicinal plants are used throughout the world, and the regulations defining their proper use, such as identification of the correct species and verification of the presence, purity and concentration of the required chemical compounds, are widely recognized. Herbal medicines are made from vegetal drugs, the processed products of medicinal species. These processed materials present a number of challenges in terms of botanical identification, and according to the World Health Organization (WHO), the use of incorrect species is a threat to consumer safety. The samples used in this study consisted of the dried leaves, flowers and roots of 257 samples from 8 distinct species approved by the WHO for the production of medicinal herbs and sold in Brazilian markets. Identification of the samples in this study using DNA barcoding (matK, rbcL and ITS2 regions) revealed that the level of substitutions may be as high as 71%. Using qualitative and quantitative chemical analyses, this study identified situations in which the correct species was being sold, but the chemical compounds were not present. Even more troubling, some samples identified as substitutions using DNA barcoding contained the chemical compounds from the correct species at the minimum required concentration. This last situation may lead to the use of unknown species or species whose safety for human consumption remains unknown. This study concludes that DNA barcoding should be used in a complementary manner for species identification with chemical analyses to detect and quantify the required chemical compounds, thus improving the quality of this class of medicines. PMID:25978064

  14. Direct chemical grafted curcumin on halloysite nanotubes as dual-responsive prodrug for pharmacological applications.

    PubMed

    Massaro, M; Amorati, R; Cavallaro, G; Guernelli, S; Lazzara, G; Milioto, S; Noto, R; Poma, P; Riela, S

    2016-04-01

    Covalently functionalized halloysite nanotubes (HNTs) were successfully employed as dual-responsive nanocarriers for curcumin (Cur). Particularly, we synthesized HNT-Cur prodrug with a controlled curcumin release on dependence of both intracellular glutathione (GSH) and pH conditions. In order to obtain HNT-Cur produgs, halloysite was firstly functionalized with cysteamine through disulphide linkage. Afterwards, curcumin molecules were chemically conjugated to the amino end groups of halloysite via Schiff's base formation. The successful functionalization of halloysite was proved by thermogravimetric analysis, FT-IR spectroscopy, dynamic light scattering and scanning electron microscopy. Experimental data confirmed the presence of curcumin on HNT external surface. Moreover, we investigated the kinetics of curcumin release by UV-vis spectroscopy, which highlighted that HNT-Cur prodrug possesses dual stimuli-responsive ability upon exposure to GSH-rich or acidic environment. In vitro antiproliferative and antioxidant properties of HNT-Cur prodrug were studied with the aim to explore their potential applications in pharmaceutics. This work puts forward an efficient strategy to prepare halloysite based nanocarriers with controlled drug delivery capacity through direct chemical grafting with stimuli-responsive linkage.

  15. Bio- chemical and physical characterizations of mesenchymal stromal cells along the time course of directed differentiation

    PubMed Central

    Chen, Yin-Quan; Liu, Yi-Shiuan; Liu, Yu-An; Wu, Yi-Chang; del Álamo, Juan C.; Chiou, Arthur; Lee, Oscar K.

    2016-01-01

    Cellular biophysical properties are novel biomarkers of cell phenotypes which may reflect the status of differentiating stem cells. Accurate characterizations of cellular biophysical properties, in conjunction with the corresponding biochemical properties could help to distinguish stem cells from primary cells, cancer cells, and differentiated cells. However, the correlated evolution of these properties in the course of directed stem cells differentiation has not been well characterized. In this study, we applied video particle tracking microrheology (VPTM) to measure intracellular viscoelasticity of differentiating human mesenchymal stromal/stem cells (hMSCs). Our results showed that osteogenesis not only increased both elastic and viscous moduli, but also converted the intracellular viscoelasticity of differentiating hMSCs from viscous-like to elastic-like. In contrast, adipogenesis decreased both elastic and viscous moduli while hMSCs remained viscous-like during the differentiation. In conjunction with bio- chemical and physical parameters, such as gene expression profiles, cell morphology, and cytoskeleton arrangement, we demonstrated that VPTM is a unique approach to quantify, with high data throughput, the maturation level of differentiating hMSCs and to anticipate their fate decisions. This approach is well suited for time-lapsed study of the mechanobiology of differentiating stem cells especially in three dimensional physico-chemical biomimetic environments including porous scaffolds. PMID:27526936

  16. Multifunctional polymer-metal nanocomposites via direct chemical reduction by conjugated polymers.

    PubMed

    Xu, Ping; Han, Xijiang; Zhang, Bin; Du, Yunchen; Wang, Hsing-Lin

    2014-03-07

    Noble metal nanoparticles (MNPs) have attracted continuous attention due to their promising applications in chemistry, physics, bioscience, medicine and materials science. As an alternative to conventional solution chemistry routes, MNPs can be directly synthesized through a conjugated polymer (CP) mediated technique utilizing the redox chemistry of CPs to chemically reduce the metal ions and modulate the size, morphology, and structure of the MNPs. The as-prepared multifunctional CP-MNP nanocomposites have shown application potentials as highly sensitive surface enhanced Raman spectroscopy (SERS) substrates, effective heterogeneous catalysts for organic synthesis and electrochemistry, and key components for electronic and sensing devices. In this tutorial review, we begin with a brief introduction to the chemical nature and redox properties of CPs that enable the spontaneous reduction of noble metal ions to form MNPs. We then focus on recent progress in control over the size, morphology and structure of MNPs during the conjugated polymer mediated syntheses of CP-MNP nanocomposites. Finally, we highlight the multifunctional CP-MNP nanocomposites toward their applications in sensing, catalysis, and electronic devices.

  17. Grade 12 French Students' use of a Thermodynamic Model for Predicting the Direction of Incomplete Chemical Changes

    NASA Astrophysics Data System (ADS)

    Kermen, Isabelle; Méheut, Martine

    2011-09-01

    The authors of the current chemistry curriculum-implemented in Grade 12 in France-provided a criterion of change allowing prediction of direction of chemical changes and pointed out the difference to be made between experimental facts and models. A study analysing part of the curriculum content and the effects of teaching this content on students' reasoning was conducted. The content analysis presents the functioning of the thermodynamic model, which highlights the links to be made between the experimental situation and the model when predicting the direction of a chemical change. This functioning specifies the role of the chemical equation and that of the criterion of change (comparing the reaction quotient to the equilibrium constant) and stresses the crucial points that may lead to misunderstandings. Written tests were administered to students after teaching them to determine how they predicted the direction of a chemical change, and whether they made a relevant choice between using the chemical equation and using the criterion of change and a clear distinction between the experimental situation and the thermodynamic model. Few students had a good understanding of the respective roles of the criterion and the chemical equation. A majority used the criterion to predict the direction of chemical changes relevantly, but correct answers were not widespread. Two particular mistakes, the modification of the expression of the reaction quotient and the prediction of a change despite a missing reactant, revealed that students do not properly understand the difference and the relationship between the experimental situation and the thermodynamic model.

  18. Accurate measurement of psoralen-crosslinked DNA: direct biochemical measurements and indirect measurement by hybridization

    SciTech Connect

    Matsuo, N.; Ross, P.M.

    1988-11-01

    This paper evaluates methods to measure crosslinkage due to psoralen plus light in total DNA and in specific sequences. DNA exposed in cells or in vitro to a bifunctional psoralen and near ultraviolet light accumulates interstrand crosslinks. Crosslinkage is the DNA mass fraction that is attached in both strands to a crosslink. We show here biochemical methods to measure psoralen photocrosslinkage accurately in total DNA. We also describe methods to measure photocrosslinkage indirectly, in specific sequences, by nucleic acid hybridization. We show that a single 4,5',8-trimethylpsoralen (TMP) crosslink causes at least 50 kbp of alkali-denatured DNA contiguous in both strands with it to snap back into the duplex form when the denatured preparation is returned to neutral pH. This process was so efficient that the DNA was not nicked by the single-strand nuclease S1 at 100-fold excess after snapping back. Uncrosslinked DNA was digested to acid-soluble material by the enzyme. Crosslinkage therefore equals the fraction of S1-resistant nucleotide in this kind of experiment. We alkali-denatured DNA samples crosslinked to varying degrees by varying TMP concentration at constant light exposure. We then measured crosslinkage by ethidium bromide (EtBr) fluorometry at pH 11.8; by EtBr fluorometry at neutral pH of S1 digests of the DNA; and by the fraction of radioactivity remaining acid insoluble in S1-digests of DNA labeled uniformly with (3H)deoxythymidine. These assays measure distinct physical properties of crosslinked DNA. Numerical agreement is expected only when all three measurements are accurate. Under optimum conditions, the three methods yielded identical results over the range of measurement. Using alkaline EtBr fluorescence in crude cell lysates, we detected crosslinks at frequencies in the range of 1.6 X 10(-7) per base pair.

  19. Mutual activation of Ets-1 and AML1 DNA binding by direct interaction of their autoinhibitory domains.

    PubMed Central

    Kim, W Y; Sieweke, M; Ogawa, E; Wee, H J; Englmeier, U; Graf, T; Ito, Y

    1999-01-01

    The transcription factors Ets-1 and AML1 (the alphaBl subunit of PEBP2/CBF) play critical roles in hematopoiesis and leukemogenesis, and cooperate in the transactivation of the T cell receptor (TCR) beta chain enhancer. The DNA binding capacity of both factors is blocked intramolecularly but can be activated by the removal of negative regulatory domains. These include the exon VII domain for Ets-1 and the negative regulatory domain for DNA binding (NRDB) for alphaB1. Here we report that the direct interaction between the two factors leads to a reciprocal stimulation of their DNA binding activity and activation of their transactivation function. Detailed mapping revealed two independent contact points involving the exon VII and NRDB regions as well as the two DNA binding domains. Using deletion variants and dominant interfering mutants, we demonstrate that the interaction between exon VII and NRDB is necessary and sufficient for cooperative DNA binding. The exon VII and NRDB motifs are highly conserved in evolution yet deleted in natural variants, suggesting that the mechanism described is of biological relevance. The mutual activation of DNA binding of Ets and AML1 through the intermolecular interaction of autoinhibitory domains may represent a novel principle for the regulation of transcription factor function. PMID:10075931

  20. Light-Absorbing Carbonaceous Particles: Chemical Composition and Its Implications for Direct Climate Forcing

    NASA Astrophysics Data System (ADS)

    Hemming, B. L.; Henze, D. K.; Akhtar, F.; Pinder, R. W.; Loughlin, D. H.

    2012-12-01

    Carbonaceous particles are understood to play a substantial role in direct climate forcing, but current estimates of this effect depend on very simple assumptions concerning the light absorbing properties of the materials from these particles are formed. The practice, to date is to classify all black (graphitic, combustion-derived) carbon as having a single mass absorption coefficient, with all other carbon consider only slightly- or completely non-absorbing. The substantial literature produced by the combustion sciences, biomass energy, and paper processing research communities suggest that particle carbon comprises a wide array of light-absorbing compounds having distinct light-absorbing properties of varying degrees of extinction efficiency. These materials accumulate in the particle phase, and are emitted at all stages of solid fuel pyrolysis and combustion. Filter-based measurements of carbonaceous PM collected from various solid fuel combustion sources show substantial variability in solar wavelength-dependent light absorption, with Angstrom Exponents ranging from as high as 12, down to 1. In this presentation, the fuel and combustion variables determining the degree of light absorption by carbonaceous particle components will be discussed, followed by a presentation of the results of a study applying the adjoint of the GEOS-Chem chemical transport model to an estimation of the sensitivity of direct forcing by carbonaceous particles to variation in burning phase-specific AE values.

  1. Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

    DOE PAGES

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; ...

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

  2. Direct evidence for SIR2 modulation of chromatin structure in yeast rDNA.

    PubMed Central

    Fritze, C E; Verschueren, K; Strich, R; Easton Esposito, R

    1997-01-01

    The yeast SIR2 gene maintains inactive chromatin domains required for transcriptional repression at the silent mating-type loci and telomeres. We previously demonstrated that SIR2 also acts to repress mitotic and meiotic recombination between the tandem ribosomal RNA gene array (rDNA). Here we address whether rDNA chromatin structure is altered by loss of SIR2 function by in vitro and in vivo assays of sensitivity to micrococcal nuclease and dam methyltransferase, respectively, and present the first chromatin study that maps sites of SIR2 action within the rDNA locus. Control studies at the MAT alpha locus also revealed a previously undetected MNase-sensitive site at the a1-alpha 2 divergent promoter which is protected in sir2 mutant cells by the derepressed a1-alpha 2 regulator. In rDNA, SIR2 is required for a more closed chromatin structure in two regions: SRR1, the major SIR-Responsive Region in the non-transcribed spacer, and SRR2, in the 18S rRNA coding region. None of the changes in rDNA detected in sir2 mutants are due to the presence of the a1-alpha 2 repressor. Reduced recombination in the rDNA correlates with a small, reproducible transcriptional silencing position effect. Deletion and overexpression studies demonstrate that SIR2, but not SIR1, SIR3 or SIR4, is required for this rDNA position effect. Significantly, rDNA transcriptional silencing and rDNA chromatin accessibility respond to SIR2 dosage, indicating that SIR2 is a limiting component required for chromatin modeling in rDNA. PMID:9351831

  3. Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

    SciTech Connect

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  4. Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

    SciTech Connect

    Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; Ansong, Charles; Brewer, Heather M.; Bogomolnaya, Lydia; Adams, L. Garry; McClelland, Michael; Adkins, Joshua N.; Andrews-Polymenis, Helene L.; Fang, Ferric C.

    2015-09-14

    Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking its retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.

  5. Combination of cascade chemical reactions with graphene-DNA interaction to develop new strategy for biosensor fabrication.

    PubMed

    Zhu, Xiaoli; Sun, Liya; Chen, Yangyang; Ye, Zonghuang; Shen, Zhongming; Li, Genxi

    2013-09-15

    Graphene, a single atom thick and two dimensional carbon nano-material, has been proven to possess many unique properties, one of which is the recent discovery that it can interact with single-stranded DNA through noncovalent π-π stacking. In this work, we demonstrate that a new strategy to fabricate many kinds of biosensors can be developed by combining this property with cascade chemical reactions. Taking the fabrication of glucose sensor as an example, while the detection target, glucose, may regulate the graphene-DNA interaction through three cascade chemical reactions, electrochemical techniques are employed to detect the target-regulated graphene-DNA interaction. Experimental results show that in a range from 5μM to 20mM, the glucose concentration is in a natural logarithm with the logarithm of the amperometric response, suggesting a best detection limit and detection range. The proposed biosensor also shows favorable selectivity, and it has the advantage of no need for labeling. What is more, by controlling the cascade chemical reactions, detection of a variety of other targets may be achieved, thus the strategy proposed in this work may have a wide application potential in the future.

  6. Formation of sequence-specific telomeric DNA loops via direct effects of psoralen-photosensitization on telomeres

    NASA Astrophysics Data System (ADS)

    Cao, En-Hua; Chen, Ai; Sun, Xueguang; Zhang, Xiaoyan; Qin, Jingfen; Liu, Dage; Wang, Chen; Bai, Chunli

    2000-10-01

    DNA from HeLa cells was cleaved with Rasl and Hinf, and then purified by Bio-Gel P-2 column. Results showed that upon near-UV-irradiation, psoralen could be targeted to the repetitive sequences of telomeres. Large duplex loops with a tail were observed directly by AFM. The loop-tail junction position was assumed to be a tri- or tetra- strand DNA structure according to its apparent height, corresponding structure model was proposed. The psoralen cross-linking products increased with increase of irradiation time. The expression of p53 oncogene was significantly increased.

  7. Rapid and direct detection of clostridium chauvoei by PCR of the 16S-23S rDNA spacer region and partial 23S rDNA sequences.

    PubMed

    Sasaki, Y; Yamamoto, K; Kojima, A; Tetsuka, Y; Norimatsu, M; Tamura, Y

    2000-12-01

    Clostridium chauvoei causes blackleg, which is difficult to distinguish from the causative clostridia of malignant edema. Therefore, a single-step PCR system was developed for specific detection of C. chauvoei DNA using primers derived from the 16S-23S rDNA spacer region and partial 23S rDNA sequences. The specificity of the single-step PCR system was demonstrated by testing 37 strains of clostridia and 3 strains of other genera. A 509 bp PCR product, which is a C. choauvoei-specific PCR product, could be amplified from all of the C. chauvoei strains tested, but not from the other strains. Moreover, this single-step PCR system specifically detected C. chauvoei DNA in samples of muscle from mice 24 hr after inoculation with 100 spores of C. chauvoei, and in clinical materials from a cow affected with blackleg. These results suggest that our single-step PCR system may be useful for direct detection of C. chauvoei in culture and in clinical materials from animals affected with blackleg.

  8. An effective method to purify Plasmodium falciparum DNA directly from clinical blood samples for whole genome high-throughput sequencing.

    PubMed

    Auburn, Sarah; Campino, Susana; Clark, Taane G; Djimde, Abdoulaye A; Zongo, Issaka; Pinches, Robert; Manske, Magnus; Mangano, Valentina; Alcock, Daniel; Anastasi, Elisa; Maslen, Gareth; Macinnis, Bronwyn; Rockett, Kirk; Modiano, David; Newbold, Christopher I; Doumbo, Ogobara K; Ouédraogo, Jean Bosco; Kwiatkowski, Dominic P

    2011-01-01

    Highly parallel sequencing technologies permit cost-effective whole genome sequencing of hundreds of Plasmodium parasites. The ability to sequence clinical Plasmodium samples, extracted directly from patient blood without a culture step, presents a unique opportunity to sample the diversity of "natural" parasite populations in high resolution clinical and epidemiological studies. A major challenge to sequencing clinical Plasmodium samples is the abundance of human DNA, which may substantially reduce the yield of Plasmodium sequence. We tested a range of human white blood cell (WBC) depletion methods on P. falciparum-infected patient samples in search of a method displaying an optimal balance of WBC-removal efficacy, cost, simplicity, and applicability to low resource settings. In the first of a two-part study, combinations of three different WBC depletion methods were tested on 43 patient blood samples in Mali. A two-step combination of Lymphoprep plus Plasmodipur best fitted our requirements, although moderate variability was observed in human DNA quantity. This approach was further assessed in a larger sample of 76 patients from Burkina Faso. WBC-removal efficacy remained high (<30% human DNA in >70% samples) and lower variation was observed in human DNA quantities. In order to assess the Plasmodium sequence yield at different human DNA proportions, 59 samples with up to 60% human DNA contamination were sequenced on the Illumina Genome Analyzer platform. An average ~40-fold coverage of the genome was observed per lane for samples with ≤ 30% human DNA. Even in low resource settings, using a simple two-step combination of Lymphoprep plus Plasmodipur, over 70% of clinical sample preparations should exhibit sufficiently low human DNA quantities to enable ~40-fold sequence coverage of the P. falciparum genome using a single lane on the Illumina Genome Analyzer platform. This approach should greatly facilitate large-scale clinical and epidemiologic studies of P

  9. Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya

    PubMed Central

    Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung

    2016-01-01

    Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique—based on DNA analysis—was developed for detecting male-hermaphrodite-specific markers to examine the papaya’s sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya’s sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source. PMID:27669237

  10. Direct LAMP Assay without Prior DNA Purification for Sex Determination of Papaya.

    PubMed

    Tsai, Chi-Chu; Shih, Huei-Chuan; Ko, Ya-Zhu; Wang, Ren-Huang; Li, Shu-Ju; Chiang, Yu-Chung

    2016-09-24

    Papaya (Carica papaya L.) is an economically important tropical fruit tree with hermaphrodite, male and female sex types. Hermaphroditic plants are the major type used for papaya production because their fruits have more commercial advantages than those of female plants. Sex determination of the seedlings, or during the early growth stages, is very important for the papaya seedling industry. Thus far, the only method for determining the sex type of a papaya at the seedling stage has been DNA analysis. In this study, a molecular technique-based on DNA analysis-was developed for detecting male-hermaphrodite-specific markers to examine the papaya's sex type. This method is based on the loop-mediated isothermal amplification (LAMP) and does not require prior DNA purification. The results show that the method is an easy, efficient, and inexpensive way to determine a papaya's sex. This is the first report on the LAMP assay, using intact plant materials-without DNA purification-as samples for the analysis of sex determination of papaya. We found that using high-efficiency DNA polymerase was essential for successful DNA amplification, using trace intact plant material as a template DNA source.

  11. Mechanism and Site of Attack for Direct Damage to DNA by Low-Energy Electrons

    SciTech Connect

    Pan, X.; Sanche, L.

    2005-05-20

    We report results on the desorption of OH{sup -} induced by 0-19 eV electrons incident on self-assembled monolayer films made of single and double DNA strands of different orientations with respect to a gold substrate. Such measurements make it possible to deduce the mechanism and site of OH{sup -} formation within a biomolecule as complex as DNA. This type of damage is attributed to dissociative electron attachment to the phosphate group of DNA, when it contains the counterion H{sup +}.

  12. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY RADIATION, CHEMICAL MUTAGENS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This novel assay is based on changes in melting/annealing behavior and facilitated using certain dyes that increase their fluorescence upon association with double stranded (ds)DNA. Damage caused by ultraviolet (UV) ra...

  13. Chemical and Isotopic Tracers of Groundwater Sustainability: an Overview of New Science Directions

    NASA Astrophysics Data System (ADS)

    Bullen, T.

    2002-12-01

    Groundwater sustainability is an emerging concept that is rapidly gaining attention from both scientists and water resource managers, particularly with regard to contamination and degradation of water quality in strategic aquifers. The sustainability of a groundwater resource is a complex function of its susceptibility to factors such as intrusion of poor-quality water from diverse sources, lack of sufficient recharge and reorganization of groundwater flowpaths in response to excessive abstraction. In theory the critical limit occurs when degradation becomes irreversible, such that remediative efforts may be fruitless on a reasonable human time scale. Chemical and isotopic tracers are proving to be especially useful tools for assessment of groundwater sustainability issues such as characterization of recharge, identification of potential sources, pathways and impacts of contaminants and prediction of how hydrology will change in response to excessive abstraction. A variety of relatively cost-efficient tracers are now available with which to assess the susceptibility of groundwater reserves to contamination from both natural and anthropogenic sources, and may provide valuable monitoring and regulatory tools for water resource managers. In this overview, the results of several ongoing groundwater studies by the U.S. Geological Survey will be discussed from the perspective of implications for new science directions for groundwater sustainability research that can benefit water policy development. A fundamental concept is that chemical and isotopic tracers used individually often provide ambiguous information, and are most effective when used in a rigorous "multi-tracer" context that considers the complex linkages between the hydrology, geology and biology of groundwater systems.

  14. All-in-one nanowire-decorated multifunctional membrane for rapid cell lysis and direct DNA isolation.

    PubMed

    So, Hongyun; Lee, Kunwoo; Murthy, Niren; Pisano, Albert P

    2014-12-10

    This paper describes a handheld device that uses an all-in-one membrane for continuous mechanical cell lysis and rapid DNA isolation without the assistance of power sources, lysis reagents, and routine centrifugation. This nanowire-decorated multifunctional membrane was fabricated to isolate DNA by selective adsorption to silica surface immediately after disruption of nucleus membranes by ultrasharp tips of nanowires for a rapid cell lysis, and it can be directly assembled with commercial syringe filter holders. The membrane was fabricated by photoelectrochemical etching to create microchannel arrays followed by hydrothermal synthesis of nanowires and deposition of silica. The proposed membrane successfully purifies high-quality DNA within 5 min, whereas a commercial purification kit needs more than an hour.

  15. CENP-C directs a structural transition of CENP-A nucleosomes mainly through sliding of DNA gyres.

    PubMed

    Falk, Samantha J; Lee, Jaehyoun; Sekulic, Nikolina; Sennett, Michael A; Lee, Tae-Hee; Black, Ben E

    2016-03-01

    The histone H3 variant CENP-A is incorporated into nucleosomes that mark centromere location. We have recently reported that CENP-A nucleosomes, compared with their H3 counterparts, confer an altered nucleosome shape. Here, using a single-molecule fluorescence resonance energy transfer (FRET) approach with recombinant human histones and centromere DNA, we found that the nucleosome shape change directed by CENP-A is dominated by lateral passing of two DNA gyres (gyre sliding). A nonhistone centromere protein, CENP-C, binds and reshapes the nucleosome, sliding the DNA gyres back to positions similar to those in canonical nucleosomes containing conventional histone H3. The model that we generated to explain the CENP-A-nucleosome transition provides an example of a shape change imposed by external binding proteins and has notable implications for understanding of the epigenetic basis of the faithful inheritance of centromere location on chromosomes.

  16. Self-assembly of multiferroic core-shell particulate nanocomposites through DNA-DNA hybridization and magnetic field directed assembly of superstructures

    NASA Astrophysics Data System (ADS)

    Sreenivasulu, Gollapudi; Lochbiler, Thomas A.; Panda, Manashi; Srinivasan, Gopalan; Chavez, Ferman A.

    2016-04-01

    Multiferroic composites of ferromagnetic and ferroelectric phases are of importance for studies on mechanical strain mediated coupling between the magnetic and electric subsystems. This work is on DNA-assisted self-assembly of superstructures of such composites with nanometer periodicity. The synthesis involved oligomeric DNA-functionalized ferroelectric and ferromagnetic nanoparticles, 600 nm BaTiO3 (BTO) and 200 nm NiFe2O4 (NFO), respectively. Mixing BTO and NFO particles, possessing complementary DNA sequences, resulted in the formation of ordered core-shell heteronanocomposites held together by DNA hybridization. The composites were imaged by scanning electron microscopy and scanning microwave microscopy. The presence of heteroassemblies along with core-shell architecture is clearly observed. The reversible nature of the DNA hybridization allows for restructuring the composites into mm-long linear chains and 2D-arrays in the presence of a static magnetic field and ring-like structures in a rotating-magnetic field. Strong magneto-electric (ME) coupling in as-assembled composites is evident from static magnetic field H induced polarization and low-frequency magnetoelectric voltage coefficient measurements. Upon annealing the nanocomposites at high temperatures, evidence for the formation of bulk composites with excellent cross-coupling between the electric and magnetic subsystems is obtained by H-induced polarization and low-frequency ME voltage coefficient. The ME coupling strength in the self-assembled composites is measured to be much stronger than in bulk composites with randomly distributed NFO and BTO prepared by direct mixing and sintering.

  17. UVA-induced damage to DNA and proteins: direct versus indirect photochemical processes

    NASA Astrophysics Data System (ADS)

    Girard, P. M.; Francesconi, S.; Pozzebon, M.; Graindorge, D.; Rochette, P.; Drouin, R.; Sage, E.

    2011-01-01

    UVA has long been known for generating an oxidative stress in cells. In this paper we review the different types of DNA damage induced by UVA, i.e. strand breaks, bipyrimidine photoproducts, and oxidatively damaged bases. Emphasis is given to the mechanism of formation that is further illustrated by the presentation of new in vitro data. Examples of oxidation of proteins involved in DNA metabolism are also given.

  18. Plasmodium falciparum CRK4 directs continuous rounds of DNA replication during schizogony.

    PubMed

    Ganter, Markus; Goldberg, Jonathan M; Dvorin, Jeffrey D; Paulo, Joao A; King, Jonas G; Tripathi, Abhai K; Paul, Aditya S; Yang, Jing; Coppens, Isabelle; Jiang, Rays H Y; Elsworth, Brendan; Baker, David A; Dinglasan, Rhoel R; Gygi, Steven P; Duraisingh, Manoj T

    2017-02-17

    Plasmodium parasites, the causative agents of malaria, have evolved a unique cell division cycle in the clinically relevant asexual blood stage of infection(1). DNA replication commences approximately halfway through the intracellular development following invasion and parasite growth. The schizont stage is associated with multiple rounds of DNA replication and nuclear division without cytokinesis, resulting in a multinucleated cell. Nuclei divide asynchronously through schizogony, with only the final round of DNA replication and segregation being synchronous and coordinated with daughter cell assembly(2,3). However, the control mechanisms for this divergent mode of replication are unknown. Here, we show that the Plasmodium-specific kinase PfCRK4 is a key cell-cycle regulator that orchestrates multiple rounds of DNA replication throughout schizogony in Plasmodium falciparum. PfCRK4 depletion led to a complete block in nuclear division and profoundly inhibited DNA replication. Quantitative phosphoproteomic profiling identified a set of PfCRK4-regulated phosphoproteins with greatest functional similarity to CDK2 substrates, particularly proteins involved in the origin of replication firing. PfCRK4 was required for initial and subsequent rounds of DNA replication during schizogony and, in addition, was essential for development in the mosquito vector. Our results identified an essential S-phase promoting factor of the unconventional P. falciparum cell cycle. PfCRK4 is required for both a prolonged period of the intraerythrocytic stage of Plasmodium infection, as well as for transmission, revealing a broad window for PfCRK4-targeted chemotherapeutics.

  19. Real-time sensing and discrimination of single chemicals using the channel of phi29 DNA packaging nanomotor.

    PubMed

    Haque, Farzin; Lunn, Jennifer; Fang, Huaming; Smithrud, David; Guo, Peixuan

    2012-04-24

    A highly sensitive and reliable method to sense and identify a single chemical at extremely low concentrations and high contamination is important for environmental surveillance, homeland security, athlete drug monitoring, toxin/drug screening, and earlier disease diagnosis. This article reports a method for precise detection of single chemicals. The hub of the bacteriophage phi29 DNA packaging motor is a connector consisting of 12 protein subunits encircled into a 3.6 nm channel as a path for dsDNA to enter during packaging and to exit during infection. The connector has previously been inserted into a lipid bilayer to serve as a membrane-embedded channel. Herein we report the modification of the phi29 channel to develop a class of sensors to detect single chemicals. The lysine-234 of each protein subunit was mutated to cysteine, generating 12-SH ring lining the channel wall. Chemicals passing through this robust channel and interactions with the SH group generated extremely reliable, precise, and sensitive current signatures as revealed by single channel conductance assays. Ethane (57 Da), thymine (167 Da), and benzene (105 Da) with reactive thioester moieties were clearly discriminated upon interaction with the available set of cysteine residues. The covalent attachment of each analyte induced discrete stepwise blockage in current signature with a corresponding decrease in conductance due to the physical blocking of the channel. Transient binding of the chemicals also produced characteristic fingerprints that were deduced from the unique blockage amplitude and pattern of the signals. This study shows that the phi29 connector can be used to sense chemicals with reactive thioesters or maleimide using single channel conduction assays based on their distinct fingerprints. The results demonstrated that this channel system could be further developed into very sensitive sensing devices.

  20. Calculation on spectrum of direct DNA damage induced by low-energy electrons including dissociative electron attachment.

    PubMed

    Liu, Wei; Tan, Zhenyu; Zhang, Liming; Champion, Christophe

    2017-03-01

    In this work, direct DNA damage induced by low-energy electrons (sub-keV) is simulated using a Monte Carlo method. The characteristics of the present simulation are to consider the new mechanism of DNA damage due to dissociative electron attachment (DEA) and to allow determining damage to specific bases (i.e., adenine, thymine, guanine, or cytosine). The electron track structure in liquid water is generated, based on the dielectric response model for describing electron inelastic scattering and on a free-parameter theoretical model and the NIST database for calculating electron elastic scattering. Ionization cross sections of DNA bases are used to generate base radicals, and available DEA cross sections of DNA components are applied for determining DNA-strand breaks and base damage induced by sub-ionization electrons. The electron elastic scattering from DNA components is simulated using cross sections from different theoretical calculations. The resulting yields of various strand breaks and base damage in cellular environment are given. Especially, the contributions of sub-ionization electrons to various strand breaks and base damage are quantitatively presented, and the correlation between complex clustered DNA damage and the corresponding damaged bases is explored. This work shows that the contribution of sub-ionization electrons to strand breaks is substantial, up to about 40-70%, and this contribution is mainly focused on single-strand break. In addition, the base damage induced by sub-ionization electrons contributes to about 20-40% of the total base damage, and there is an evident correlation between single-strand break and damaged base pair A-T.

  1. A DNA damage checkpoint in Caulobacter crescentus inhibits cell division through a direct interaction with FtsW.

    PubMed

    Modell, Joshua W; Hopkins, Alexander C; Laub, Michael T

    2011-06-15

    Following DNA damage, cells typically delay cell cycle progression and inhibit cell division until their chromosomes have been repaired. The bacterial checkpoint systems responsible for these DNA damage responses are incompletely understood. Here, we show that Caulobacter crescentus responds to DNA damage by coordinately inducing an SOS regulon and inhibiting the master regulator CtrA. Included in the SOS regulon is sidA (SOS-induced inhibitor of cell division A), a membrane protein of only 29 amino acids that helps to delay cell division following DNA damage, but is dispensable in undamaged cells. SidA is sufficient, when overproduced, to block cell division. However, unlike many other regulators of bacterial cell division, SidA does not directly disrupt the assembly or stability of the cytokinetic ring protein FtsZ, nor does it affect the recruitment of other components of the cell division machinery. Instead, we provide evidence that SidA inhibits division by binding directly to FtsW to prevent the final constriction of the cytokinetic ring.

  2. Direct Solution of the Chemical Master Equation Using Quantized Tensor Trains

    PubMed Central

    Kazeev, Vladimir; Khammash, Mustafa; Nip, Michael; Schwab, Christoph

    2014-01-01

    The Chemical Master Equation (CME) is a cornerstone of stochastic analysis and simulation of models of biochemical reaction networks. Yet direct solutions of the CME have remained elusive. Although several approaches overcome the infinite dimensional nature of the CME through projections or other means, a common feature of proposed approaches is their susceptibility to the curse of dimensionality, i.e. the exponential growth in memory and computational requirements in the number of problem dimensions. We present a novel approach that has the potential to “lift” this curse of dimensionality. The approach is based on the use of the recently proposed Quantized Tensor Train (QTT) formatted numerical linear algebra for the low parametric, numerical representation of tensors. The QTT decomposition admits both, algorithms for basic tensor arithmetics with complexity scaling linearly in the dimension (number of species) and sub-linearly in the mode size (maximum copy number), and a numerical tensor rounding procedure which is stable and quasi-optimal. We show how the CME can be represented in QTT format, then use the exponentially-converging -discontinuous Galerkin discretization in time to reduce the CME evolution problem to a set of QTT-structured linear equations to be solved at each time step using an algorithm based on Density Matrix Renormalization Group (DMRG) methods from quantum chemistry. Our method automatically adapts the “basis” of the solution at every time step guaranteeing that it is large enough to capture the dynamics of interest but no larger than necessary, as this would increase the computational complexity. Our approach is demonstrated by applying it to three different examples from systems biology: independent birth-death process, an example of enzymatic futile cycle, and a stochastic switch model. The numerical results on these examples demonstrate that the proposed QTT method achieves dramatic speedups and several orders of magnitude

  3. Direct solution of the Chemical Master Equation using quantized tensor trains.

    PubMed

    Kazeev, Vladimir; Khammash, Mustafa; Nip, Michael; Schwab, Christoph

    2014-03-01

    The Chemical Master Equation (CME) is a cornerstone of stochastic analysis and simulation of models of biochemical reaction networks. Yet direct solutions of the CME have remained elusive. Although several approaches overcome the infinite dimensional nature of the CME through projections or other means, a common feature of proposed approaches is their susceptibility to the curse of dimensionality, i.e. the exponential growth in memory and computational requirements in the number of problem dimensions. We present a novel approach that has the potential to "lift" this curse of dimensionality. The approach is based on the use of the recently proposed Quantized Tensor Train (QTT) formatted numerical linear algebra for the low parametric, numerical representation of tensors. The QTT decomposition admits both, algorithms for basic tensor arithmetics with complexity scaling linearly in the dimension (number of species) and sub-linearly in the mode size (maximum copy number), and a numerical tensor rounding procedure which is stable and quasi-optimal. We show how the CME can be represented in QTT format, then use the exponentially-converging hp-discontinuous Galerkin discretization in time to reduce the CME evolution problem to a set of QTT-structured linear equations to be solved at each time step using an algorithm based on Density Matrix Renormalization Group (DMRG) methods from quantum chemistry. Our method automatically adapts the "basis" of the solution at every time step guaranteeing that it is large enough to capture the dynamics of interest but no larger than necessary, as this would increase the computational complexity. Our approach is demonstrated by applying it to three different examples from systems biology: independent birth-death process, an example of enzymatic futile cycle, and a stochastic switch model. The numerical results on these examples demonstrate that the proposed QTT method achieves dramatic speedups and several orders of magnitude storage

  4. DNA-directed alkylating ligands as potential antitumor agents: sequence specificity of alkylation by intercalating aniline mustards.

    PubMed

    Prakash, A S; Denny, W A; Gourdie, T A; Valu, K K; Woodgate, P D; Wakelin, L P

    1990-10-23

    The sequence preferences for alkylation of a series of novel parasubstituted aniline mustards linked to the DNA-intercalating chromophore 9-aminoacridine by an alkyl chain of variable length were studied by using procedures analogous to Maxam-Gilbert reactions. The compounds alkylate DNA at both guanine and adenine sites. For mustards linked to the acridine by a short alkyl chain through a para O- or S-link group, 5'-GT sequences are the most preferred sites at which N7-guanine alkylation occurs. For analogues with longer chain lengths, the preference of 5'-GT sequences diminishes in favor of N7-adenine alkylation at the complementary 5'-AC sequence. Magnesium ions are shown to selectively inhibit alkylation at the N7 of adenine (in the major groove) by these compounds but not the alkylation at the N3 of adenine (in the minor groove) by the antitumor antibiotic CC-1065. Effects of chromophore variation were also studied by using aniline mustards linked to quinazoline and sterically hindered tert-butyl-9-aminoacridine chromophores. The results demonstrate that in this series of DNA-directed mustards the noncovalent interactions of the carrier chromophores with DNA significantly modify the sequence selectivity of alkylation by the mustard. Relationships between the DNA alkylation patterns of these compounds and their biological activities are discussed.

  5. Direct DNA amplification from crude clinical samples using a PCR enhancer cocktail and novel mutants of Taq.

    PubMed

    Zhang, Zhian; Kermekchiev, Milko B; Barnes, Wayne M

    2010-03-01

    PCR-based clinical and forensic tests often have low sensitivity or even false-negative results caused by potent PCR inhibitors found in blood and soil. It is widely accepted that purification of target DNA before PCR is necessary for successful amplification. In an attempt to overcome PCR inhibition, enhance PCR amplification, and simplify the PCR protocol, we demonstrate improved PCR-enhancing cocktails containing nonionic detergent, l-carnitine, d-(+)-trehalose, and heparin. These cocktails, in combination with two inhibitor-resistant Taq mutants, OmniTaq and Omni Klentaq, enabled efficient amplification of exogenous, endogenous, and high-GC content DNA targets directly from crude samples containing human plasma, serum, and whole blood without DNA purification. In the presence of these enhancer cocktails, the mutant enzymes were able to tolerate at least 25% plasma, serum, or whole blood and as high as 80% GC content templates in PCR reactions. These enhancer cocktails also improved the performance of the novel Taq mutants in real-time PCR amplification using crude samples, both in SYBR Green fluorescence detection and TaqMan assays. The novel enhancer mixes also facilitated DNA amplification from crude samples with various commercial Taq DNA polymerases.

  6. Lsh Is Essential for Maintaining Global DNA Methylation Levels in Amphibia and Fish and Interacts Directly with Dnmt1

    PubMed Central

    Dunican, Donncha S.; Pennings, Sari; Meehan, Richard R.

    2015-01-01

    Eukaryotic genomes are methylated at cytosine bases in the context of CpG dinucleotides, a pattern which is maintained through cell division by the DNA methyltransferase Dnmt1. Dramatic methylation losses are observed in plant and mouse cells lacking Lsh (lymphoid specific helicase), predominantly at repetitive sequences and gene promoters. However, the mechanism by which Lsh contributes to the maintenance of DNA methylation is unknown. Here we show that DNA methylation is lost in Lsh depleted frog and fish embryos, both of which exhibit developmental delay. Additionally, we show that both Lsh and Dnmt1 are associated with chromatin and that Lsh knockdown leads to a decreased Dnmt1-chromatin association. Coimmunoprecipitation experiments reveal that Lsh and Dnmt1 are found in the same protein complex, and pulldowns show this interaction is direct. Our data indicate that Lsh is usually diffuse in the nucleus but can be recruited to heterochromatin in a HP1α-dependent manner. These data together (a) show that the role of Lsh in DNA methylation is conserved in plants, amphibian, fish, and mice and (b) support a model in which Lsh contributes to Dnmt1 binding to chromatin, explaining how its loss can potentially lead to perturbations in DNA methylation maintenance. PMID:26491684

  7. Estimates of DNA damage by the comet assay in the direct-developing frog Eleutherodactylus johnstonei (Anura, Eleutherodactylidae)

    PubMed Central

    Valencia, Laura Carolina; García, Adriana; Ramírez-Pinilla, Martha Patricia; Fuentes, Jorge Luis

    2011-01-01

    The aim of this study was to use the Comet assay to assess genetic damage in the direct-developing frog Eleutherodactylus johnstonei. A DNA diffusion assay was used to evaluate the effectiveness of alkaline, enzymatic and alkaline/enzymatic treatments for lysing E. johnstonei blood cells and to determine the amount of DNA strand breakage associated with apoptosis and necrosis. Cell sensitivity to the mutagens bleomycin (BLM) and 4-nitro-quinoline-1-oxide (4NQO) was also assessed using the Comet assay, as was the assay reproducibility. Alkaline treatment did not lyse the cytoplasmic and nuclear membranes of E. johnstonei blood cells, whereas enzymatic digestion with proteinase K (40 μg/mL) yielded naked nuclei. The contribution of apoptosis and necrosis (assessed by the DNA diffusion assay) to DNA damage was estimated to range from 0% to 8%. BLM and 4NQO induced DNA damage in E. johnstonei blood cells at different concentrations and exposure times. Dose-effect curves with both mutagens were highly reproducible and showed consistently low coefficients of variation (CV ≤ 10%). The results are discussed with regard to the potential use of the modified Comet assay for assessing the exposure of E. johnstonei to herbicides in ecotoxicological studies. PMID:22215974

  8. Comparative study of IDH1 mutations in gliomas by high resolution melting analysis, immunohistochemistry and direct DNA sequencing.

    PubMed

    Li, Juan; Zhang, Haiyan; Wang, Li; Yang, Chuanhong; Lai, Huangwen; Zhang, Wei; Chen, Xiaodong; Wang, Jie

    2015-09-01

    Patients with glioblastomas with a specific mutation in the isocitrate dehydrogenase 1 (IDH1) gene have a better prognosis than those with gliomas with wild‑type IDH1. IDH1 analysis has become part of the standard diagnostic procedure and a promising tool used for stratification in clinical trials. The present study aimed to compare high resolution melting (HRM) analysis, immunohistochemistry (IHC) and direct DNA sequencing for the detection of IDH mutations in gliomas. Fifty‑one formalin‑fixed paraffin‑embedded tumor samples were selected. For the HRM analysis and direct DNA sequencing, DNA was extracted from the tissues. For IHC, sections were stained with an anti‑IDH1‑R132H specific antibody. The HRM analysis method identified 33 cases of IDH1 gene mutations, and all mutations occurred at the R132H site. There were 33 cases of IDH1 gene mutations found by IHC, which was consistent with that identified using the HRM analysis method. However, only 30 IDH1 samples were confirmed by sequencing, in which mutations occurred at the IDH1 exon 4 R132H site. No mutation was detected in the other three of these 33 cases (two grade II oligodendroglioma and one grade II diffuse astrocytoma) by sequencing, while IHC was positive for IDH1‑R132H. The results showed that the mutation detection rate was not identified to be significantly different (P=0.250) when determined by the HRM analysis method or by direct DNA sequencing, as the concordant rate between the two methods was high (κ=0.866). The HRM analysis method in glioma IDH1 gene mutation detection has advantages of high sensitivity, good repeatability, simple operation and accurate results. It provides a novel method for detecting mutations of the IDH1 gene in paraffin embedded tissue samples of clinical glioma. Related to a small amount of sample, there was no evidence showing that HRM analysis method is superior to IHC. Direct DNA sequencing, HRM analysis and IHC results were consistent; however, HRM and

  9. Radiation response of chemically derived mitochondrial DNA-deficient AG01522 human primary fibroblasts.

    PubMed

    Nieri, D; Fioramonti, M; Berardinelli, F; Leone, S; Cherubini, R; De Nadal, V; Gerardi, S; Moreno, S; Nardacci, R; Tanzarella, C; Antoccia, A

    2013-08-30

    Mitochondria are the main cellular source of Reactive Oxygen Species (ROS). Alterations of mitochondrial metabolism and consequent loss of mitochondrial membrane potential may lead to redox imbalance and in turn to DNA damage, chromosomal instability and apoptosis. On the other hand, impaired mitochondrial functions may either exacerbate the detrimental effects of geno- and cytotoxic agents or may bring beneficial cellular responses. To study the role of mitochondria within this framework, AG01522 human primary fibroblasts were incubated with the mitochondrial polymerase γ inhibitor 2',3'-dideoxycytidine (ddC), leading to mitochondrial DNA (mtDNA) depletion and to mitochondrial dysfunctions. The successful treatment toward mtDNA depletion was confirmed by Complex-IV subunit I (COX-I) immunofluorescence and western blot assays. mtDNA-depleted cells and their counterparts were ultrastructurally characterized by transmission electron microscopy. mtDNA-depleted cells showed dramatic mitochondrial alterations such as fragmentation and cristae disruption along with a reduction of the mitochondrial membrane potential and elevated levels of ROS. Despite increased ROS levels, we did not find any difference in telomere length between ddC-treated and untreated cells. The spontaneous rate of DNA double-strand breaks (DSBs) and chromosome aberrations was significantly enhanced in mtDNA-depleted cells whereas the induction of DSBs by low-Linear Energy Transfer (LET) (X-rays; 7.7keV/μm protons) and high-LET radiations (28.5keV/μm protons) did not differ when compared with normal cells. However, in irradiated cells impaired mitochondrial functions seemed to bring beneficial cellular responses to the detrimental effect of radiations. In fact, after X-irradiation mtDNA-depleted cells show less remaining unrejoined DSBs than normal cells and furthermore a lower induction of cytogenetic damage. Overall, these data show that active mitochondrial functions are required for the proper

  10. Interaction of anthraquinone anti-cancer drugs with DNA:Experimental and computational quantum chemical study

    NASA Astrophysics Data System (ADS)

    Al-Otaibi, Jamelah S.; Teesdale Spittle, Paul; El Gogary, Tarek M.

    2017-01-01

    Anthraquinones form the basis of several anticancer drugs. Anthraquinones anticancer drugs carry out their cytotoxic activities through their interaction with DNA, and inhibition of topoisomerase II activity. Anthraquinones (AQ4 and AQ4H) were synthesized and studied along with 1,4-DAAQ by computational and experimental tools. The purpose of this study is to shade more light on mechanism of interaction between anthraquinone DNA affinic agents and different types of DNA. This study will lead to gain of information useful for drug design and development. Molecular structures were optimized using DFT B3LYP/6-31 + G(d). Depending on intramolecular hydrogen bonding interactions two conformers of AQ4 were detected and computed as 25.667 kcal/mol apart. Molecular reactivity of the anthraquinone compounds was explored using global and condensed descriptors (electrophilicity and Fukui functions). Molecular docking studies for the inhibition of CDK2 and DNA binding were carried out to explore the anti cancer potency of these drugs. NMR and UV-VIS electronic absorption spectra of anthraquinones/DNA were investigated at the physiological pH. The interaction of the three anthraquinones (AQ4, AQ4H and 1,4-DAAQ) were studied with three DNA (calf thymus DNA, (Poly[dA].Poly[dT]) and (Poly[dG].Poly[dC]). NMR study shows a qualitative pattern of drug/DNA interaction in terms of band shift and broadening. UV-VIS electronic absorption spectra were employed to measure the affinity constants of drug/DNA binding using Scatchard analysis.

  11. Chemical form of selenium differentially influences DNA repair pathways following exposure to lead nitrate.

    PubMed

    McKelvey, Shauna M; Horgan, Karina A; Murphy, Richard A

    2015-01-01

    Lead, an environmental toxin is known to induce a broad range of physiological and biochemical dysfunctions in humans through a number of mechanisms including the deactivation of antioxidants thus leading to generation of reactive oxygen species (ROS) and subsequent DNA damage. Selenium on the other hand has been proven to play an important role in the protection of cells from free radical damage and oxidative stress, though its effects are thought to be form and dose dependent. As the liver is the primary organ required for metabolite detoxification, HepG2 cells were chosen to assess the protective effects of various selenium compounds following exposure to the genotoxic agent lead nitrate. Initially DNA damage was quantified using a comet assay, gene expression patterns associated with DNA damage and signalling were also examined using PCR arrays and the biological pathways which were most significantly affected by selenium were identified. Interestingly, the organic type selenium compounds (selenium yeast and selenomethionine) conferred protection against lead induced DNA damage in HepG2 cells; this is evident by reduction in the quantity of DNA present in the comet tail of cells cultured in their presence with lead. This trend also followed through the gene expression changes noted in DNA damage pathways analysed. These results were in contrast with those of inorganic sodium selenite which promoted lead induced DNA damage evident in both the comet assay results and the gene expression analysis. Over all this study provided valuable insights into the effects which various selenium compounds had on the DNA damage and signalling pathway indicating the potential for using organic forms of selenium such as selenium enriched yeast to protect against DNA damaging agents.

  12. Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

    PubMed Central

    2009-01-01

    Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay

  13. Quantitation of chemical warfare agents using the direct analysis in real time (DART) technique.

    PubMed

    Nilles, J Michael; Connell, Theresa R; Durst, H Dupont

    2009-08-15

    Direct analysis in real time (DART) is an ion source that permits rapid mass spectrometric detection of gases, liquids, and solids in open air under ambient conditions. It is a unique technology in the field of chemical weapons detectors in that it does not require a vapor pressure, does not require sample preparation, and is nondestructive to the original sample. While the DART technique has had success as a first line instrument of detection, there have been lingering doubts over the technique's quantitative reliability and reproducibility. Here, we demonstrate its capability to produce linear calibration curves (R(2) = 0.99 or better) for the nerve agents GA, GB, and VX as well as the blister agent HD. Independently prepared check standards measured against these curves typically have recovery errors less than 3%. We show the DART instrument response to be linear over roughly 3 orders of magnitude. Furthermore, this study shows that averaging as few as three measurements for each data point is sufficient to produce high quality calibration curves, thus reducing data collection time and providing quicker results.

  14. MORATE: a program for direct dynamics calculations of chemical reaction rates by semiempirical molecular orbital theory

    NASA Astrophysics Data System (ADS)

    Truong, Thanh N.; Lu, Da-hong; Lynch, Gillian C.; Liu, Yi-Ping; Melissas, Vasilios S.; Stewart, James J. P.; Steckler, Rozeanne; Garrett, Bruce C.; Isaacson, Alan D.; Gonzalez-Lafont, Angels; Rai, Sachchida N.; Hancock, Gene C.; Joseph, Tomi; Truhlar, Donald G.

    1993-04-01

    We present a computer program, MORATE (Molecular Orbital RATE calculations), for direct dynamics calculations of unimolecular and bimolecular rate constants of gas-phase chemical reactions involving atoms, diatoms, or polyatomic species. The potential energies, gradients, and higher derivatives of the potential are calculated whenever needed by semiempirical molecular orbital theory without the intermediary of a global or semiglobal fit. The dynamical methods used are conventional or variational transition state theory and multidimensional semiclassical approximations for tunneling and nonclassical reflection. The computer program is conveniently interfaced package consisting of the POLYRATE program, version 4.5.1, for dynamical rate calculations, and the MOPAC program, version 5.03, for semiempirical electronic structure computations. All semiempirical methods available in MOPAC, in particular MINDO/3, MNDO, AM1, and PM3, can be called on to calculate the potential and gradient. Higher derivatives of the potential are obtained by numerical derivatives of the gradient. Variational transition states are found by a one-dimensional search of generalized-transition-state dividing surfaces perpendicular to the minimum-energy path, and tunneling probabilities are evaluated by numerical quadrature.

  15. Direct determination of chemical oxygen demand by anodic decomposition of organic compounds at a diamond electrode.

    PubMed

    Kondo, Takeshi; Tamura, Yusuke; Hoshino, Masaki; Watanabe, Takeshi; Aikawa, Tatsuo; Yuasa, Makoto; Einaga, Yasuaki

    2014-08-19

    Chemical oxygen demand (COD) was measured directly with a simple electrochemical method using a boron-doped diamond (BDD) electrode. By applying a highly positive potential (+2.5 V vs Ag/AgCl) to an aqueous electrolyte containing potassium hydrogen phthalate, glucose, and lactic acid or sodium dodecylbenzenesulfonate using a BDD electrode, an anodic current corresponding to the electrolytic decomposition of these organic compounds was observed. No such current was seen on glassy carbon or platinum electrodes due to a significant background current caused by the oxygen evolution reaction. The electric charge for the anodic current observed at the BDD electrode was found to be consistent with the theoretical charge required for the electrolytic decomposition of the organic compounds to CO2 and was used to calculate COD. This analysis was performed by a simple I-t measurement at constant potential using a BDD electrode, and no calibration was needed. This new simple indicator, "ECOD" (electrochemical oxygen demand), will be useful for continuous monitoring of industrial wastewater with low protein concentrations and on-site instant analysis of natural water with a BDD electrode-based portable ECOD meter.

  16. Photothermal laser fabrication of micro- and nanostructured chemical templates for directed protein immobilization.

    PubMed

    Schröter, Anja; Franzka, Steffen; Hartmann, Nils

    2014-12-16

    Photothermal patterning of poly(ethylene glycol) terminated organic monolayers on surface-oxidized silicon substrates is carried out using a microfocused beam of a CW laser operated at a wavelength of 532 nm. Trichlorosilane and trimethoxysilane precursors are used for coating. Monolayers from trimethoxysilane precursors show negligible unspecific protein adsorption in the background, i.e., provide platforms of superior protein repellency. Laser patterning results in decomposition of the monolayers and yields chemical templates for directed immobilization of proteins at predefined positions. Characterization is carried out via complementary analytical methods including fluorescence microscopy, atomic force microscopy, and scanning electron microscopy. Appropriate labeling techniques (fluorescent markers and gold clusters) and substrates (native and thermally oxidized silicon substrates) are chosen in order to facilitate identification of protein adsorption and ensure high sensitivity and selectivity. Variation of the laser parameters at a 1/e(2) spot diameter of 2.8 μm allows for fabrication of protein binding domains with diameters on the micrometer and nanometer length scale. Minimum domain sizes are about 300 nm. In addition to unspecific protein adsorption on as-patterned monolayers, biotin-streptavidin coupling chemistry is exploited for specific protein binding. This approach represents a novel facile laser-based means for fabrication of protein micro- and nanopatterns. The routine is readily applicable to femtosecond laser processing of glass substrates for the fabrication of transparent templates.

  17. Synthesis gas production through biomass direct chemical looping conversion with natural hematite as an oxygen carrier.

    PubMed

    Huang, Zhen; He, Fang; Feng, Yipeng; Zhao, Kun; Zheng, Anqing; Chang, Sheng; Li, Haibin

    2013-07-01

    Biomass direct chemical looping (BDCL) conversion with natural hematite as an oxygen carrier was conducted in a fluidized bed reactor under argon atmosphere focusing on investigation the cyclic performance of oxygen carrier. The presence of oxygen carrier can evidently promote the biomass conversion. The gas yield and carbon conversion increased from 0.75 Nm(3)/kg and 62.23% of biomass pyrolysis to 1.06 Nm(3)/kg and 87.63% of BDCL, respectively. The components of the gas product in BDCL were close to those in biomass pyrolysis as the cyclic number increased. The gas yield and carbon conversion decreased from 1.06 Nm(3)/kg and 87.63% at 1st cycle to 0.93 Nm(3)/kg and 77.18% at 20th cycle, respectively, due to the attrition and structural changes of oxygen carrier. X-ray diffraction (XRD) analysis showed that the reduction extent of oxygen carrier increased with the cycles. Scanning electron microscope (SEM) and pore structural analysis displayed that agglomeration was observed with the cycles.

  18. Direct-Liquid-Evaporation Chemical Vapor Deposition of Nanocrystalline Cobalt Metal for Nanoscale Copper Interconnect Encapsulation.

    PubMed

    Feng, Jun; Gong, Xian; Lou, Xiabing; Gordon, Roy G

    2017-03-29

    In advanced microelectronics, precise design of liner and capping layers become critical, especially when it comes to the fabrication of Cu interconnects with dimensions lower than its mean free path. Herein, we demonstrate that direct-liquid-evaporation chemical vapor deposition (DLE-CVD) of Co is a promising method to make liner and capping layers for nanoscale Cu interconnects. DLE-CVD makes pure, smooth, nanocrystalline, and highly conformal Co films with highly controllable growth characteristics. This process allows full Co encapsulation of nanoscale Cu interconnects, thus stabilizing Cu against diffusion and electromigration. Electrical measurements and high-resolution elemental imaging studies show that the DLE-CVD Co encapsulation layer can improve the reliability and thermal stability of Cu interconnects. Also, with the high conductivity of Co, the DLE-CVD Co encapsulation layer have the potential to further decrease the power consumption of nanoscale Cu interconnects, paving the way for Cu interconnects with higher efficiency in future high-end microelectronics.

  19. A molecular zoom into soil Humeome by a direct sequential chemical fractionation of soil.

    PubMed

    Drosos, Marios; Nebbioso, Antonio; Mazzei, Pierluigi; Vinci, Giovanni; Spaccini, Riccardo; Piccolo, Alessandro

    2017-02-14

    A Humeomics sequential chemical fractionation coupled to advanced analytical identification was applied directly to soil for the first time. Humeomics extracted ~235% more soil organic carbon (SOC) than by the total alkaline extraction traditionally employed to solubilise soil humic molecules (soil Humeome). Seven fractions of either hydro- or organo-soluble components and a final unextractable humic residue were separated from soil. These materials enabled an unprecedented structural identification of solubilised heterogeneous humic molecules by combining NMR, GC-MS, and ESI-Orbitrap-MS. Identified molecules and their relative abundance were used to build up structure-based van Krevelen plots to show the specific contribution of each fraction to SOC. The stepwise isolation of mostly hydrophobic and unsaturated molecules of progressive structural complexity suggests that humic suprastructures in soil are arranged in multi-molecular layers. These comprised molecules either hydrophobically adsorbed on soil aluminosilicate surfaces in less stable fractions, or covalently bound in amorphous organo-iron complexes in more recalcitrant fractions. Moreover, most lipid molecules of the soil Humeome appeared to derive from plant polyesters rather than bacterial metabolism. An advanced understanding of soil humic molecular composition by Humeomics may enable control of the bio-organic dynamics and reactivity in soil.

  20. Chemically related 4,5-linked aminoglycoside antibiotics drive subunit rotation in opposite directions

    PubMed Central

    Wasserman, Michael R.; Pulk, Arto; Zhou, Zhou; Altman, Roger B.; Zinder, John C.; Green, Keith D.; Garneau-Tsodikova, Sylvie; Doudna Cate, Jamie H.; Blanchard, Scott C.

    2015-01-01

    Dynamic remodelling of intersubunit bridge B2, a conserved RNA domain of the bacterial ribosome connecting helices 44 (h44) and 69 (H69) of the small and large subunit, respectively, impacts translation by controlling intersubunit rotation. Here we show that aminoglycosides chemically related to neomycin—paromomycin, ribostamycin and neamine—each bind to sites within h44 and H69 to perturb bridge B2 and affect subunit rotation. Neomycin and paromomycin, which only differ by their ring-I 6′-polar group, drive subunit rotation in opposite directions. This suggests that their distinct actions hinge on the 6′-substituent and the drug's net positive charge. By solving the crystal structure of the paromomycin–ribosome complex, we observe specific contacts between the apical tip of H69 and the 6′-hydroxyl on paromomycin from within the drug's canonical h44-binding site. These results indicate that aminoglycoside actions must be framed in the context of bridge B2 and their regulation of subunit rotation. PMID:26224058

  1. Curriculum Assessment as a Direct Tool in ABET Outcomes Assessment in a Chemical Engineering Programme

    ERIC Educational Resources Information Center

    Abu-Jdayil, Basim; Al-Attar, Hazim

    2010-01-01

    The chemical engineering programme at the United Arab Emirates University is designed to fulfil the Accreditation Board for Engineering and Technology (ABET) (A-K) EC2000 criteria. The Department of Chemical & Petroleum Engineering has established a well-defined process for outcomes assessment for the chemical engineering programme in order to…

  2. M. tuberculosis Sliding β-Clamp Does Not Interact Directly with the NAD+ -Dependent DNA Ligase

    PubMed Central

    Kukshal, Vandna; Khanam, Taran; Chopra, Deepti; Singh, Nidhi; Sanyal, Sabyasachi; Ramachandran, Ravishankar

    2012-01-01

    The sliding β-clamp, an important component of the DNA replication and repair machinery, is drawing increasing attention as a therapeutic target. We report the crystal structure of the M. tuberculosis β-clamp (Mtbβ-clamp) to 3.0 Å resolution. The protein crystallized in the space group C2221 with cell-dimensions a = 72.7, b = 234.9 & c = 125.1 Å respectively. Mtbβ-clamp is a dimer, and exhibits head-to-tail association similar to other bacterial clamps. Each monomer folds into three domains with similar structures respectively and associates with its dimeric partner through 6 salt-bridges and about 21 polar interactions. Affinity experiments involving a blunt DNA duplex, primed-DNA and nicked DNA respectively show that Mtbβ-clamp binds specifically to primed DNA about 1.8 times stronger compared to the other two substrates and with an apparent Kd of 300 nM. In bacteria like E. coli, the β-clamp is known to interact with subunits of the clamp loader, NAD+ -dependent DNA ligase (LigA) and other partners. We tested the interactions of the Mtbβ-clamp with MtbLigA and the γ-clamp loader subunit through radioactive gel shift assays, size exclusion chromatography, yeast-two hybrid experiments and also functionally. Intriguingly while Mtbβ-clamp interacts in vitro with the γ-clamp loader, it does not interact with MtbLigA unlike in bacteria like E. coli where it does. Modeling studies involving earlier peptide complexes reveal that the peptide-binding site is largely conserved despite lower sequence identity between bacterial clamps. Overall the results suggest that other as-yet-unidentified factors may mediate interactions between the clamp, LigA and DNA in mycobacteria. PMID:22545130

  3. A preparative suspension culture system permitting quantitation of anchorage-independent growth by direct radiolabeling of cellular DNA.

    PubMed

    Assoian, R K; Boardman, L A; Drosinos, S

    1989-02-15

    We have developed a hybrid methylcellulose/agar suspension culture system which permits long-term colony formation of transformed mesenchymal cells. In contrast to traditional agar suspensions, our system allows for recovery of cells and direct biochemical analysis of anchorage-independent growth. The ability to readily radiolabel cellular macromolecules in these preparative cultures permits a quantitative and objective analysis of colony formation by incorporation of [3H]thymidine into newly synthesized DNA.

  4. Theoretical study of the dynamics of multi-dimensional systems: Vibrationally excited chemical reaction and the denaturation of DNA

    NASA Astrophysics Data System (ADS)

    Wu, Guosheng

    Many chemical dynamical processes involve the behavior of a large number of coupled degrees of freedom. It has been a challenge to describe them accurately using theory. By developing practical methodologies to simplify the systems and the processes, we have studied two kinds of interesting systems: vibrationally excited chemical reaction dynamics and the denaturation of double helix DNA. First we studied the chemical reaction dynamics between an atom and a tri-atomic molecule, using a quasiclassical trajectory method. The equations of motion are solved by classical mechanics, with the potential energy surface fit from ab initio calculations, and the initial and final vibrational-rotational states of the diatomic and tri-atomic molecules quantized by a semi-classical method. We have studied the dynamics of two benchmark systems, the reactions H + H2O → H2 + OH and H + HCN → H2 + CN in detail, with focus on the enhancement of reactivity from vibrational excitation of the tri-atomic reactant. Most of our results are in very good agreement with state-of-art experimental data. For the reaction between H and H2O, we discovered that with different OH stretching excitation of H2O there is a transition in the reaction dynamics from activated to activationless behavior. The thermal denaturation (melting) of double helix DNA is one of the most important physiological processes. When DNA molecules are attached to gold nanoparticles, the melting temperature becomes higher and the melting curve becomes much sharper than with DNA in solution. In order to study this complicated process, we have developed a reduced model, with each nucleotide simplified as one backbone site and one hydrogen bonding site, and used empirical potential functions to simulate the denaturation by Langevin dynamics. Our results on the melting of some short length DNA molecules, including the melting temperature and width agree well with experimental data. In addition, we found that for the melting of

  5. Induced mutagenesis of plasmid and chromosomal genes inserted into the plasmid DNA. II. Mutagenic action of chemical factors

    SciTech Connect

    Esipova, V.V.; Vedunova, S.L.; Kriviskii, A.S.

    1986-02-01

    Following the study of the mutagenic action of UV and ..gamma..-radiation on plasmid DNA in vitro, they investigated the induction of mutations under the influence of chemical mutagens on the same DNA of plasmid RSF2124, determining the synthesis of colicine E1 and resistance to ampicillin. The inactivating action of the mutagen was assessed from the yield of transformants resistant to the antibiotic and the mutagenic effect from the loss by colonies of transformants that were capable of releasing colicine into the external medium. In these experiments they mainly used chemical compounds whose mutagenic effect if well known in other systems (transforming and transfecting DNA, microbial viruses). As a result all mutagens tested for their activity were divided into four groups: first group, those exceeding the level of mutagenesis by more than 100-fold above the spontaneous background (hydroxylamine, O-methylhydroxylamine); second group, those exceeding it by a factor of 10 (UV radiation (lambda = 254 nm), W-mutagenesis, ionizing radiation, nitrous acid, mitomycin C); third group, those exceeding it by a factor of <10 (indirect UV mutagenesis, nitrous acid, ..beta..-chloroethyldiethylamine hydrochloride, nitrosoguanidine); fourth group, no mutagenic effect (acridine orange, ethyl methane sulfonate, sodium azide, 0-..beta..-diethylaminoethylhydroxylamine).

  6. Comparison of two freshwater turtle species as monitors of radionuclide and chemical contamination: DNA damage and residue analysis

    SciTech Connect

    Meyers-Schoene, L. ); Shugart, L.R.; Beauchamp, J.J.; Walton, B.T. )

    1993-08-01

    Two species of turtles that occupy different ecological niches were compared for their usefulness as monitors of freshwater ecosystems where both low-level radioactive and nonradioactive contaminants are present. The pond slider (Trachemys scripta) and common snapping turtle (Chelydra serpentina) were analyzed for the presence of [sup 90]Sr, [sup 137]Cs, [sup 60]Co, and Hg, radionuclides and chemicals known to be present at the contaminated site, and single-strand breaks in liver DNA. The integrity of the DNA was examined by the alkaline unwinding assay, a technique that detects strand breaks as a biological marker of possible exposure to genotoxic agents. This measure of DNA damage was significantly increased in both species of turtles at the contaminated site compared with turtles of the same species at a reference site, and shows that contaminant-exposed populations were under more severe genotoxic stress than those at the reference site. The level of strand breaks observed at the contaminated site was high and in the range reported for other aquatic species exposed to deleterious concentrations of genotoxic agents such as chemicals and ionizing radiation. Statistically significantly higher concentrations of radionuclides and Hg were detected in the turtles from the contaminated area. Mercury concentrations were significantly higher in the more carnivorous snapping turtle compared with the slider; however, both species were effective monitors of the contaminants.

  7. The effect of chemical carcinogens on DNA bypass replication and the development of in vitro and in vivo models for chemical mutagenesis

    SciTech Connect

    Yamanishi, D.T.

    1989-01-01

    This study with the testing of a hypothetical mechanism whereby mammalian cells are able to replicate their DNA past polycyclic aromatic hydrocarbon DNA adducts. The second objective of this thesis work was to develop both in vivo and in vitro models to study the induction of mutations in a target human gene by chemical carcinogens from two different classes, polycyclic aromatic hydrocarbons and nitrosamines. To approach the hypothetical mechanism of bypass replication in mammalian cells, synchronized Chinese hamster ovary cells were treated with benzo(a)pyrene, 7{beta}, 8{alpha}-dihydroxy-9{alpha}, 10{alpha}-epoxy-7,8,9,10-tetrahydrobenzo(a)pyrene (BPDEI). Using the pH step alkaline elution assay, it was found that the reduced rate of S phase progression was due to a delay in the appearance of multiple replicon size nascent DNA. It was determined using agarose gel electrophoresis that the ligation of Okazaki size replication intermediates was blocked in BPDE I-treated, synchronized CHO cells. To study mutagenesis of a specific sequence induced by chemical carcinogens, the human c-Ha-ras proto-oncogene was transfected into the mouse fibroblast cell line, NIH 3T3. Transfected NIH 3T3 cell lines (HHRN 1-4) were isolated that had a low copy number of the human c-Ha-ras proto-oncogene and a non-transformed phenotype. Treatment of the HHRN cell lines with the nitrosamine, N-methyl-nitroso-N{prime}-nitroguanidine (MNNG) resulted in transformed NIH 3T3 foci. In vitro MNNG treatment of the plasmid, z-6, and transfection into NIH 3T3 cells led to the isolation of transformed cell lines.

  8. Dub3 controls DNA damage signalling by direct deubiquitination of H2AX.

    PubMed

    Delgado-Díaz, M Rocío; Martín, Yusé; Berg, Anna; Freire, Raimundo; Smits, Veronique A J

    2014-07-01

    A crucial event in the DNA damage response is the phosphorylation and subsequent ubiquitination of H2AX, required for the recruitment of proteins involved in DNA repair. Here we identify a novel regulator of this process, the ubiquitin hydrolase Dub3. Overexpression of wild type, but not catalytic inactive, Dub3 decreases the DNA damage-induced mono-ubiquitination of H2A(X) whereas downregulation of Dub3 has the opposite effect. Dub3 overexpression abrogates focus formation of 53BP1 and BRCA1 in response to genotoxic stress. However, focus formation of MDC1 and γH2AX, earlier events in this response, are unaffected by Dub3 overexpression. We show that Dub3 counteracts H2AX E3 ligases RNF8 and RNF168. Moreover, Dub3 and H2AX interact and Dub3 deubiquitinates H2AX in vitro. Importantly, overexpression of Dub3 delays H2AX dephosphorylation and recovery of MDC1 focus formation at later time points after DNA damage, whereas H2AX dephosphorylation at later time points is faster after Dub3 depletion. Altogether these results show that Dub3 regulates a correct DNA damage response by controlling H2AX ubiquitination.

  9. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  10. Antisense sequence-directed cross-linking of DNA oligonucleotides by mitomycin C.

    PubMed

    Maruenda, H; Tomasz, M

    1996-01-01

    Oligodeoxyribonucleotides (ODNs) conjugated with mitomycin C (MC) via (-CH2-)n tethers of different lengths (n = 6, 12) to their terminal 5'-phosphate were synthesized, and their interaction with target complementary single-stranded DNA oligonucleotides was investigated. MC, a clinically used natural anticancer drug, is known to act as a bioreductive alkylating agent of duplex DNA with a remarkable preference for 5'-d(CG) sequences. The usual enzymatic bioreductive techniques known to trigger MC to alkylate DNA were employed in the reaction between the MC-oligonucleotide conjugates and their targets radiolabeled by 32P at their 5'-phosphate. A slow-moving radiolabeled product, detected by polyacrylamide gel electrophoresis using phosphorimaging techniques, was obtained in 15-25% yield with complementary DNA as target. Formation of these products was dependent upon complementary duplex formation. Evidence is presented that the DNA target is alkylated by the mitomycin C moiety of the ODN conjugate at the 2-amino group of a guanine base. These findings suggest that the MC-ODN conjugates may be useful specific inhibitors of cellular or viral gene expression. To our knowledge this is the first report on ODN conjugates of a reductively activated drug of known therapeutic value.

  11. Polymers as directing agents for motions of chemical and biological species

    NASA Astrophysics Data System (ADS)

    Tanyeri, Nihan Yonet

    This thesis involves descriptions of solid surface modifications with various polymeric materials which were used as a guiding agent for motion of chemical and biological species. Quasi-two dimensional poly(oligoethylene glycol) acrylate polymer brush based molecular conduits have been designed with the goal of regulating and controlling the diffusive transport of molecular, e.g. organic dyes, and ionic species, e.g. AuCl4-, and Cu2+ ions, along predefined 2-D pathways. The transport of these chemical species has been examined by both fluorescence and dark field microscopy. The polymer brushes were formed through microcontact printing of an initiator, followed by surface-initiated Atom Transfer Radical Polymerization (SI-ATRP). SI-ATRP enables both 2-D patterning with a resolution of about 1 micrometer, and control over the resultant polymer brush thickness (which was varied from 10-100 nm). A hydrophilic poly(oligoethylene glycol) acrylate brushe was selected because of its potential to dissolve a wide range of hydrophilic species. The transport of fluorescent species can be directly followed. A non-lithographic fabrication method was developed for mufluidic devices used in the diffusion studies. Singular channel mufluidic device was utilized to study the directed organic dye diffusion. The AuCl4-, and Cu 2+ ion transport was studied by designing molecular devices with two mufluidic channels. We have demonstrated that the various species of interest diffuse much more rapidly along the predefined pathway than along the bare (polymer brush free) regions of the substrate, demonstrating that diffusive conduits for molecular transport can indeed be formed. The protein resistance of poly(N-isopropylacrylamide) (PNIPAM) brushes grafted from silicon wafers was investigated as a function of the chain molecular weight, grafting density, and temperature. Above the lower critical solution temperature (LCST) of 32°C, the collapse of the water swollen chains, determined by

  12. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  13. p53 represses Sp1 DNA binding and HIV-LTR directed transcription.

    PubMed

    Bargonetti, J; Chicas, A; White, D; Prives, C

    1997-11-01

    The HIV-LTR region contains binding sites for, and is regulated by, a number of transcription factors including Sp1 and NF-kB. The wild-type p53 tumor suppressor protein represses transcription from the HIV-LTR promoter while oncogenic mutant forms of p53 stimulate expression from the HIV-LTR. We have shown previously that wild-type p53 is a site specific DNA binding protein that binds to a region of the SV40 virus which contains GC-box DNA binding sites for the ubiquitously expressed transcription factor Sp1. In this study using DNase I footprinting, we have shown that purified p53 is able to protect the Sp1 binding sites and the adjacent NF-kB site of the HIV-LTR. Furthermore we have demonstrated that when p53 and Sp1 are mixed together both proteins change each other's interaction with DNA. Interestingly, we noted that oncogenic mutant p53 is also able to change the interaction of Sp1 with DNA. We confirmed p53 dependent repression of HIV-LTR driven transcription by comparing the expression from an HIV-LTR reporter construct in the presence and absence of p53. EMSA of an oligonucleotide sequence derived from the HIV-LTR sequence demonstrated a slight decrease in Sp1 DNA binding activity with nuclear extract derived from the cell line expressing a high level of wild-type p53. These data suggest that the influence of p53 on the transcription of promoters with Sp1 binding sites may be partially due to a change in the DNA binding ability of Sp1.

  14. A sensitive spectrofluorometric method for detection of berberine hydrochloride using Ag nanoclusters directed by natural fish sperm DNA.

    PubMed

    Liang, Sheng; Kuang, Yangfang; Ma, Fangfang; Chen, Shu; Long, Yunfei

    2016-11-15

    A novel DNA-directed AgNCs (DNA-AgNCs) was synthesized with economical raw material (natural fish sperm DNA) through a simple and rapid approach, and it first showed high and stable fluorescence emission as a AgNCs stabilized by natural DNA at about 635nm. Moreover, its emission intensity could be enhanced tremendously in acetic acid (HAc) medium. Whereas, when berberine hydrochloride (BRH) entered the solution system, it would interact and combine efficiently with DNA on the surface of AgNCs, which could lead to subtle change of charge distribution on its surface, and make it more lyophobic, inducing aggregation of DNA-AgNCs. As a result, fluorescence of the system was quenched visually; the process represented a color variance from yellow to hot pink under HAc medium, then back to yellowish-brown when BRH worked. Based on above phenomenon, a selective and accurate spectrofluorometric method for BRH detection was established. It can be applied to detect trace amounts of BRH in aqueous solution in the linear range from 1.0nM to 2000.0nM; and the detection limit (3σ/k) was 0.3nM, which is pretty lower compared to most reported spectral methods. Simultaneously, a semi-quantitative determination by visual evaluation from 5.0nM to 2000.0nM was also achieved. This method provided excellent selectivity for the detection of BRH in the presence of ten kinds of common natural amino acids and nine kinds of common mental ions. Furthermore, the BRH content in compound berberine tablets from drugstore was successfully investigated by this method and the results showed high accuracy.

  15. Direct Detection of Mycobacterium tuberculosis Complex DNA and Rifampin Resistance in Clinical Specimens from Tuberculosis Patients by Line Probe Assay▿

    PubMed Central

    Traore, Hamidou; van Deun, Armand; Shamputa, Isdore Chola; Rigouts, Leen; Portaels, Françoise

    2006-01-01

    The INNO-LiPA.Rif TB test (LiPA) has only been applied to a limited number of clinical specimens. To assess the utility of this test for detecting Mycobacterium tuberculosis complex DNA and rifampin (RMP) resistance, 420 sputum samples comprising specimens from untreated (n = 160) and previously treated (n = 260) patients from 11 countries in Asia, Africa, Europe, and Latin America were tested. DNA was extracted from sputum samples by using a modification of the Boom's method, while the rpoB core region was amplified by nested PCR. The results were analyzed in conjunction with those obtained by Ziehl-Neelsen (ZN) microscopy and by culture on solid media. The LiPA test was positive for M. tuberculosis complex DNA in 389 (92.9%) specimens, including 92.0% (286 of 311) ZN-positive and 94.5% (103 of 109) ZN-negative specimens. Of these, 30.6% were RMP resistant. In contrast, 74.3% of the specimens were positive for M. tuberculosis by culture, and 30.8% of them were RMP resistant. LiPA detected M. tuberculosis complex DNA in 92.4% (110 of 119) of the culture-positive and 100.0% (41 of 41) of the culture-negative specimens from untreated patients. There was a 99.6% concordance between the RMP resistance as determined by culture and by the LiPA test. With an optimal DNA extraction method, LiPA allows rapid detection of M. tuberculosis complex DNA and RMP resistance directly from sputum specimens. LiPA can still provide useful information when culture fails for various reasons. The rapid availability of this information is necessary to adjust patient treatment and avoid the risk of amplification of drug resistance. PMID:17035487

  16. Direct and adjoint sensitivity analysis of chemical kinetic systems with KPP: Part I—theory and software tools

    NASA Astrophysics Data System (ADS)

    Sandu, Adrian; Daescu, Dacian N.; Carmichael, Gregory R.

    The analysis of comprehensive chemical reactions mechanisms, parameter estimation techniques, and variational chemical data assimilation applications require the development of efficient sensitivity methods for chemical kinetics systems. The new release (KPP-1.2) of the kinetic preprocessor (KPP) contains software tools that facilitate direct and adjoint sensitivity analysis. The direct-decoupled method, built using BDF formulas, has been the method of choice for direct sensitivity studies. In this work, we extend the direct-decoupled approach to Rosenbrock stiff integration methods. The need for Jacobian derivatives prevented Rosenbrock methods to be used extensively in direct sensitivity calculations; however, the new automatic and symbolic differentiation technologies make the computation of these derivatives feasible. The direct-decoupled method is known to be efficient for computing the sensitivities of a large number of output parameters with respect to a small number of input parameters. The adjoint modeling is presented as an efficient tool to evaluate the sensitivity of a scalar response function with respect to the initial conditions and model parameters. In addition, sensitivity with respect to time-dependent model parameters may be obtained through a single backward integration of the adjoint model. KPP software may be used to completely generate the continuous and discrete adjoint models taking full advantage of the sparsity of the chemical mechanism. Flexible direct-decoupled and adjoint sensitivity code implementations are achieved with minimal user intervention. In a companion paper, we present an extensive set of numerical experiments that validate the KPP software tools for several direct/adjoint sensitivity applications, and demonstrate the efficiency of KPP-generated sensitivity code implementations.

  17. Information transfer from DNA to peptide nucleic acids by template-directed syntheses

    NASA Technical Reports Server (NTRS)

    Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    1997-01-01

    Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.

  18. DNA abasic site-directed formation of fluorescent silver nanoclusters for selective nucleobase recognition

    NASA Astrophysics Data System (ADS)

    Ma, Kun; Cui, Qinghua; Liu, Guiying; Wu, Fei; Xu, Shujuan; Shao, Yong

    2011-07-01

    DNA single-nucleotide polymorphism (SNP) detection has attracted much attention due to mutation related diseases. Various methods for SNP detection have been proposed and many are already in use. Here, we find that the abasic site (AP site) in the DNA duplex can be developed as a capping scaffold for the generation of fluorescent silver nanoclusters (Ag NCs). As a proof of concept, the DNA sequences from fragments near codon 177 of cancer supression gene p53 were used as a model for SNP detection by in situ formed Ag NCs. The formation of fluorescent Ag NCs in the AP site-containing DNA duplex is highly selective for cytosine facing the AP site and guanines flanking the site and can be employed in situ as readout for SNP detection. The fluorescent signal-on sensing for SNP based on this inorganic fluorophore is substantially advantageous over the previously reported signal-off responses using low-molecular-weight organic ligands. The strong dependence of fluorescent Ag NC formation on the sequences surrounding the AP site was successfully used to identify mutations in codon 177 of cancer supression gene p53. We anticipate that this approach will be employed to develop a practical SNP detection method by locating an AP site toward the midway cytosine in a target strand containing more than three consecutive cytosines.

  19. Chimeric peptide beacons: a direct polypeptide analog of DNA molecular beacons†

    PubMed Central

    Oh, Kenneth J.; Cash, Kevin J.; Lubin, Arica A.

    2009-01-01

    We have developed a new biosensor architecture, which is comprised of a polypeptide–peptide nucleic acid tri-block copolymer and which we have termed chimeric peptide beacons (CPB), that generates an optical output via a mechanism analogous to that employed in DNA-based molecular beacons. PMID:18361352

  20. DNA-Origami-Directed Self-Assembly of Discrete Silver-Nanoparticle Architectures

    SciTech Connect

    Pal, Suchetan; Deng, Zhengtao; Ding, Baoquan; Yan, Hao; Liu, Yan

    2010-03-16

    We report a bottom-up method for the fabrication of discrete, well-ordered AgNP nanoarchitectures on self-assembled DNA origami structures of triangular shape by using AgNPs (20 nm in diameter) conjugated with chimeric phosphorothioated DNA (ps-po DNA) as building blocks. Discrete monomeric, dimeric, and trimeric AgNP structures and a AgNP–AuNP hybrid structure could be constructed reliably in high yield. We demonstrate that the center-to-center distance between adjacent AgNPs can be precisely tuned from 94 to 29 nm, whereby the distance distribution is limited by the size distribution of the nanoparticles. The self-assembly of discrete AgNP and AgNP–AuNP nanoarchitectures by using rationally designed DNA templates enabled us to control some of the properties that are essential for hierarchical nanoparticle assembly. These properties include but are not limited to the spatial relationship between the particles and the identity of the particles. The system described herein could potentially be used to gain better insight into particle–particle interactions. Systematic studies with this objective are underway. Although more systematic investigations (e.g. spectroscopic studies combined with theoretical simulation of the assembled structures) are needed to identify the photonic properties of the spatially controlled AgNP architectures, we see no fundamental limitation now to the assembly of target structures.

  1. Epigenetic and genetic factors in the cellular response to radiations and DNA-damaging chemicals

    SciTech Connect

    Williams, J.R.; D'Arpa, P.

    1981-07-01

    DNA-damaging agents are widely used as therapeutic tools for a variety of disease states. Many such agents are considered to produce detrimental side effects. Thus, it is important to evaluate both therapeutic efficacy and potential risk. DNA-damaging agents can be so evaluated by comparison to agents whose therapeutic benefit and potential hazards are better known. We propose a framework for such comparison, demonstrating that a simple transformation of cytotoxicity-dose response patterns permits a facile comparison of variation between cells exposed to a single DNA-damaging agent or to different cytotoxic agents. Further, by transforming data from experiments which compare responses of 2 cell populations to an effects ratio, different patterns for the changes in cytotoxicity produced by epigenetic and genetic factors were compared. Using these transformations, we found that there is a wide variation (a factor of 4) between laboratories for a single agent (UVC) and only a slightly larger variation (factor of 6) between normal cell response for different types of DNA-damaging agents (x-ray, UVC, alkylating agents, crosslinking agents). Epigenetic factors such as repair and recovery appear to be a factor only at higher dose levels. Comparison in the cytotoxic effect of a spectrum of DNA-damaging agents in xeroderma pigmentosum, ataxia telangiectasia, and Fanconi's anemia cells indicates significantly different patterns, implying that the effect, and perhaps the nature, of these genetic conditions are quite different.

  2. Static and animated molecular views of a tumorigenic chemical bound to DNA

    SciTech Connect

    Broyde, S.; Xu, Rong ); Hingerty, B.E. ); O'Handley, S.F.; Krugh, T.R. . Dept. of Chemistry)

    1991-01-01

    Static and dynamic molecular views of a short segment of DNA modified by the tumorigenic aromatic amine 2-acetylaminofluorene (AAF) have been realized by a combination of high resolution nuclear magnetic resonance (NMR) studies in solution and molecular mechanics and molecular dynamics simulations carried out on supercomputers. Thus, the effect of AAF on the structure of the Watson-Crick B-DNA double helix has been elucidated, after two decades of intense interest, via a powerful synergy between state-of-the-art supercomputing NMR investigations. The AAF is situated in the minor groove of a B-DNA double helix which flexes and bends, and the carcinogen moves between positions where it is stacked with adjacent DNA base and positions where it protrudes further into the groove. The AAF modified DNA base, guanine, is displaced from its normal situation paired with partner cytosine. Also, a base pair adjacent to the modification becomes more mobile. These molecular views offer some possible insight on the early molecular events that may implicate AAF in tumor initiation. 16 refs., 3 figs.

  3. Novel reagents for chemical cleavage at abasic sites and UV photoproducts in DNA.

    PubMed Central

    McHugh, P J; Knowland, J

    1995-01-01

    Hot piperidine is often used to cleave abasic and UV-irradiated DNA at the sites of damage. It can inflict non-specific damage on DNA, probably because it is a strong base and creates significant concentrations of hydroxyl ions which can attack purines and pyrimidines. We show that several other amines can cleave abasic DNA at or near neutral pH without non-specific damage. One diamine, N,N'-dimethylethylenediamine, efficiently cleaves abasic DNA at pH 7.4 by either beta- or beta,delta-elimination, depending on temperature. Using end-labelled oligonucleotides we show that cleavage depends mainly on elimination reactions, but that 4',5'-cyclization is also significant. This reagent also cleaves at photoproducts induced by UVC and UVB, producing the same overall pattern as piperidine, but with no non-specific damage. It should prove valuable in locating low levels of photoproducts in DNA, such as those induced by natural sunlight. Images PMID:7784169

  4. Formation of Nickel Silicide from Direct-liquid-injection Chemical-vapor-deposited Nickel Nitride Films

    SciTech Connect

    Li, Z.; Gordon, R; Li, H; Shenai, D; Lavoie, C

    2010-01-01

    Smooth, continuous, and highly conformal nickel nitride (NiN{sub x}) films were deposited by direct liquid injection (DLI)-chemical vapor deposition (CVD) using a solution of bis(N,N{prime}-di-tert-butylacetamidinato)nickel(II) in tetrahydronaphthalene as the nickel (Ni) source and ammonia (NH{sub 3}) as the coreactant gas. The DLI-CVD NiNx films grown on HF-last (100) silicon and on highly doped polysilicon substrates served as the intermediate for subsequent conversion into nickel silicide (NiSi), which is a key material for source, drain, and gate contacts in microelectronic devices. Rapid thermal annealing in the forming gas of DLI-CVD NiNx films formed continuous NiSi films at temperatures above 400 C. The resistivity of the NiSi films was 15{mu}{Omega} cm, close to the value for bulk crystals. The NiSi films have remarkably smooth and sharp interfaces with underlying Si substrates, thereby producing contacts for transistors with a higher drive current and a lower junction leakage. Resistivity and synchrotron X-ray diffraction in real-time during annealing of NiNx films showed the formation of a NiSi film at about 440 C, which is morphologically stable up to about 650 C. These NiSi films could find applications in future nanoscale complementary metal oxide semiconductor devices or three-dimensional metal-oxide-semiconductor devices such as Fin-type field effect transistors for the 22 nm technology node and beyond.

  5. Peroxone mineralization of chemical oxygen demand for direct potable water reuse: Kinetics and process control.

    PubMed

    Wu, Tingting; Englehardt, James D

    2015-04-15

    Mineralization of organics in secondary effluent by the peroxone process was studied at a direct potable water reuse research treatment system serving an occupied four-bedroom, four bath university residence hall apartment. Organic concentrations were measured as chemical oxygen demand (COD) and kinetic runs were monitored at varying O3/H2O2 dosages and ratios. COD degradation could be accurately described as the parallel pseudo-1st order decay of rapidly and slowly-oxidizable fractions, and effluent COD was reduced to below the detection limit (<0.7 mg/L). At dosages ≥4.6 mg L(-1) h(-1), an O3/H2O2 mass ratio of 3.4-3.8, and initial COD <20 mg/L, a simple first order decay was indicated for both single-passed treated wastewater and recycled mineral water, and a relationship is proposed and demonstrated to estimate the pseudo-first order rate constant for design purposes. At this O3/H2O2 mass ratio, ORP and dissolved ozone were found to be useful process control indicators for monitoring COD mineralization in secondary effluent. Moreover, an average second order rate constant for OH oxidation of secondary effluent organics (measured as MCOD) was found to be 1.24 × 10(7) ± 0.64 × 10(7) M(-1) S(-1). The electric energy demand of the peroxone process is estimated at 1.73-2.49 kW h electric energy for removal of one log COD in 1 m(3) secondary effluent, comparable to the energy required for desalination of medium strength seawater. Advantages/disadvantages of the two processes for municipal wastewater reuse are discussed.

  6. Homology-directed repair of DNA nicks via pathways distinct from canonical double-strand break repair.

    PubMed

    Davis, Luther; Maizels, Nancy

    2014-03-11

    DNA nicks are the most common form of DNA damage, and if unrepaired can give rise to genomic instability. In human cells, nicks are efficiently repaired via the single-strand break repair pathway, but relatively little is known about the fate of nicks not processed by that pathway. Here we show that homology-directed repair (HDR) at nicks occurs via a mechanism distinct from HDR at double-strand breaks (DSBs). HDR at nicks, but not DSBs, is associated with transcription and is eightfold more efficient at a nick on the transcribed strand than at a nick on the nontranscribed strand. HDR at nicks can proceed by a pathway dependent upon canonical HDR factors RAD51 and BRCA2; or by an efficient alternative pathway that uses either ssDNA or nicked dsDNA donors and that is strongly inhibited by RAD51 and BRCA2. Nicks generated by either I-AniI or the CRISPR/Cas9(D10A) nickase are repaired by the alternative HDR pathway with little accompanying mutagenic end-joining, so this pathway may be usefully applied to genome engineering. These results suggest that alternative HDR at nicks may be stimulated in physiological contexts in which canonical RAD51/BRCA2-dependent HDR is compromised or down-regulated, which occurs frequently in tumors.

  7. Nanotechnology in Plant Disease Management: DNA-Directed Silver Nanoparticles on Graphene Oxide as an Antibacterial Against Xanthomonas Perforans

    PubMed Central

    Ocsoy, Ismail; Paret, Mathews L.; Ocsoy, Muserref Arslan; Kunwar, Sanju; Chen, Tao; You, Mingxu; Tan, Weihong

    2013-01-01

    Bacterial spot caused by Xanthomonas perforans is a major disease of tomatoes, leading to reduction in production by 10–50%. While copper (Cu)-based bactericides have been used for disease management, most of the X. perforans strains isolated from tomatoes in Florida and other locations worldwide are Cu-resistant. We have developed DNA-directed silver (Ag) nanoparticles (NPs) grown on graphene oxide (GO). These Ag@dsDNA@GO composites effectively decrease X. perforans cell viability in culture and on plants. At the very low concentration of 16 ppm of Ag@dsDNA@GO, composites show excellent antibacterial capability in culture with significant advantages in improved stability, enhanced antibacterial activity and stronger adsorption properties. Application of Ag@dsDNA@GO at 100 ppm on tomato transplants in a greenhouse experiment significantly reduced the severity of bacterial spot disease compared to untreated plants, giving results similar to those of the current grower standard treatment, with no phytotoxicity. PMID:24016217

  8. Direct extraction of genomic DNA from maize with aqueous ionic liquid buffer systems for applications in genetically modified organisms analysis.

    PubMed

    Gonzalez García, Eric; Ressmann, Anna K; Gaertner, Peter; Zirbs, Ronald; Mach, Robert L; Krska, Rudolf; Bica, Katharina; Brunner, Kurt

    2014-12-01

    To date, the extraction of genomic DNA is considered a bottleneck in the process of genetically modified organisms (GMOs) detection. Conventional DNA isolation methods are associated with long extraction times and multiple pipetting and centrifugation steps, which makes the entire procedure not only tedious and complicated but also prone to sample cross-contamination. In recent times, ionic liquids have emerged as innovative solvents for biomass processing, due to their outstanding properties for dissolution of biomass and biopolymers. In this study, a novel, easily applicable, and time-efficient method for the direct extraction of genomic DNA from biomass based on aqueous-ionic liquid solutions was developed. The straightforward protocol relies on extraction of maize in a 10 % solution of ionic liquids in aqueous phosphate buffer for 5 min at room temperature, followed by a denaturation step at 95 °C for 10 min and a simple filtration to remove residual biopolymers. A set of 22 ionic liquids was tested in a buffer system and 1-ethyl-3-methylimidazolium dimethylphosphate, as well as the environmentally benign choline formate, were identified as ideal candidates. With this strategy, the quality of the genomic DNA extracted was significantly improved and the extraction protocol was notably simplified compared with a well-established method.

  9. RDM16 and STA1 regulate differential usage of exon/intron in RNA directed DNA methylation pathway.

    PubMed

    Sharma, Ravi Datta; Bogaerts, Bert; Goyal, Neha

    2017-04-20

    The splicing factors RDM16 and STA1 have been reported to play a role in the RNA directed DNA Methylation (RdDM) pathway. In this pathway, small interfering RNAs guide de-novo methylation of homologous DNA sequences. DNA methylation is epigenetic marks, which can suppress transposable elements, repeat sequences and genes. It also affects the chromatin structure. Upon deletion of RDM16 and STA1, previous studies based on gene level analysis were unable to find differentially spliced events implicated in RdDM pathway. In this study, RNA-seq data from RDM16 &STA1 mutants were analyzed. Differential expression analysis was performed at exon and intron level. This analysis revealed 3474 genes with potential differential expression events in the RDM16 mutant and 3058 in the STA1 mutant. We found 17 genes that have been reported to be involved in the RdDM pathway. These results suggest involvement of RDM16 and STA1 by influencing the expression of key gene components such as MORC6 in the RdDM pathway. Therefore, this study increases the understanding of the role of RDM16 and STA1 splicing factors in DNA methylation.

  10. USE OF BIOASSAY-DIRECTED CHEMICAL ANALYSIS FOR IDENTIFYING MUTAGENIC COMPOUNDS IN URBAN AIR AND COMBUSTION EMISSIONS

    EPA Science Inventory

    Bioassay-directed chemical analysis fractionation has been used for 30 years to identify mutagenic classes of compounds in complex mixtures. Most studies have used the Salmonella (Ames) mutagenicity assay, and we have recently applied this methodology to two standard reference sa...

  11. c-Myc directly regulates the transcription of the NBS1 gene involved in DNA double-strand break repair.

    PubMed

    Chiang, Yu-Chi; Teng, Shu-Chun; Su, Yi-Ning; Hsieh, Fon-Jou; Wu, Kou-Juey

    2003-05-23

    The c-myc proto-oncogene encodes a ubiquitous transcription factor involved in the control of cell growth and implicated in inducing tumorigenesis. Understanding the function of c-Myc and its role in cancer depends upon the identification of c-Myc target genes. Nijmegen breakage syndrome (NBS) is a chromosomal-instability syndrome associated with cancer predisposition, radiosensitivity, and chromosomal instability. The NBS gene product, NBS1 (p95 or nibrin), is a part of the hMre11 complex, a central player associated with double-strand break (DSB) repair. NBS1 contains domains characteristic for proteins involved in DNA repair, recombination, and replication. Here we show that c-Myc directly activates NBS1. c-Myc-mediated induction of NBS1 gene transcription occurs in different tissues, is independent of cell proliferation, and is mediated by a c-Myc binding site in the intron 1 region of NBS1 gene. Overexpression of NBS1 in Rat1a cells increased cell proliferation. These results indicate that NBS1 is a direct transcriptional target of c-Myc and links the function of c-Myc to the regulation of DNA DSB repair pathway operating during DNA replication.

  12. DPS - a rapid method for genome sequencing of DNA-containing bacteriophages directly from a single plaque.

    PubMed

    Kot, Witold; Vogensen, Finn K; Sørensen, Søren J; Hansen, Lars H

    2014-02-01

    Bacteriophages (phages) coexist with bacteria in all environments and influence microbial diversity, evolution and industrial production processes. As a result of this major impact of phages on microbes, tools that allow rapid characterization of phages are needed. Today, one of the most powerful methods for characterization of phages is determination of the whole genome using high throughput sequencing approaches. Here a direct plaque sequencing (DPS) is described, which is a rapid method that allows easy full genome sequencing of DNA-containing phages using the Nextera XT™ kit. A combination of host-DNA removal followed by purification and concentration of the viral DNA, allowed the construction of Illumina-compatible sequencing libraries using the Nextera™ XT technology directly from single phage plaques without any whole genome amplification step. This method was tested on three Caudovirales phages; ϕ29 Podoviridae, P113g Siphoviridae and T4 Myovirdae, which are representative of >96% of all known phages, and were sequenced using the Illumina MiSeq platform. Successful de novo assembly of the viral genomes was possible.

  13. A Dicer-Independent Route for Biogenesis of siRNAs that Direct DNA Methylation in Arabidopsis

    PubMed Central

    Ye, Ruiqiang; Chen, Zulong; Lian, Bi; Rowley, M. Jordan; Xia, Ning; Chai, Jijie; Li, Yan; He, Xin-Jian; Wierzbicki, Andrzej T.; Qi, Yijun

    2016-01-01

    SUMMARY DNA methylation directed by 24-nucleotide (nt) small interfering RNAs (siRNAs) plays critical roles in gene regulation and transposon silencing in Arabidopsis. Twenty-four-nt siRNAs are known to be processed from double-stranded RNAs by Dicer-like 3 (DCL3) and loaded into the effector Argonaute 4 (AGO4). Here we report a distinct class of siRNAs independent of DCLs (sidRNAs). sidRNAs are present as ladders of ~20 to 60 nt in length, often having same 5’ ends but differing in 3’ ends by 1-nt steps. We further show that sidRNAs are associated with AGO4 and capable of directing DNA methylation. Finally we show that sidRNA production depends on distributive 3’-5’ exonucleases. Our findings suggest an alternative route for siRNA biogenesis: precursor transcripts are bound by AGO4 and subsequently subjected to 3’-5’ exonucleolytic trimming for maturation. We propose that sidRNAs generated through this route are the initial triggers of de novo DNA methylation. PMID:26711010

  14. Isolation of human minisatellite loci detected by synthetic tandem repeat probes: direct comparison with cloned DNA fingerprinting probes.

    PubMed

    Armour, J A; Vergnaud, G; Crosier, M; Jeffreys, A J

    1992-08-01

    As a direct comparison with cloned 'DNA fingerprinting' probes, we present the results of screening an ordered array Charomid library for hypervariable human loci using synthetic tandem repeat (STR) probes. By recording the coordinates of positive hybridization signals, the subset of clones within the library detected by each STR probe can be defined, and directly compared with the set of clones detected by naturally occurring (cloned) DNA fingerprinting probes. The STR probes vary in the efficiency of detection of polymorphic minisatellite loci; among the more efficient probes, there is a strong overlap with the sets of clones detected by the DNA fingerprinting probes. Four new polymorphic loci were detected by one or more of the STR probes but not by any of the naturally occurring repeats. Sequence comparisons with the probe(s) used to detect the locus suggest that a relatively poor match, for example 10 out of 14 bases in a limited region of each repeat, is sufficient for the positive detection of tandem repeats in a clone in this type of library screening by hybridization. These results not only provide a detailed evaluation of the usefulness of STR probes in the isolation of highly variable loci, but also suggest strategies for the use of these multi-locus probes in screening libraries for clones from hypervariable loci.

  15. Thermostable DNA ligase-mediated PCR production of circular plasmid (PPCP) and its application in directed evolution via in situ error-prone PCR.

    PubMed

    Le, Yilin; Chen, Huayou; Zagursky, Robert; Wu, J H David; Shao, Weilan

    2013-08-01

    Polymerase chain reaction (PCR) is a powerful method to produce linear DNA fragments. Here we describe the Tma thermostable DNA ligase-mediated PCR production of circular plasmid (PPCP) and its application in directed evolution via in situ error-prone PCR. In this thermostable DNA ligase-mediated whole-plasmid amplification method, the resultant DNA nick between the 5' end of the PCR primer and the extended newly synthesized DNA 3' end of each PCR cycle is ligated by Tma DNA ligase, resulting in circular plasmid DNA product that can be directly transformed. The template plasmid DNA is eliminated by 'selection marker swapping' upon transformation. When performed under an error-prone condition with Taq DNA polymerase, PPCP allows one-step construction of mutagenesis libraries based on in situ error-prone PCR so that random mutations are introduced into the target gene without altering the expression vector plasmid. A significant difference between PPCP and previously published methods is that PPCP allows exponential amplification of circular DNA. We used this method to create random mutagenesis libraries of a xylanase gene and two cellulase genes. Screening of these libraries resulted in mutant proteins with desired properties, demonstrating the usefulness of in situ error-prone PPCP for creating random mutagenesis libraries for directed evolution.

  16. A DNA Vaccine Formulated with Chemical Adjuvant Provides Partial Protection against Bovine Herpes Virus Infection in Cattle

    PubMed Central

    Quattrocchi, Valeria; Soria, Ivana; Langellotti, Cecilia Ana; Gnazzo, Victoria; Gammella, Mariela; Moore, Dadin P.; Zamorano, Patricia I.

    2017-01-01

    Bovine herpesvirus-1 (BoHV-1) is the causative agent of bovine infectious rhinotracheitis, an important disease worldwide. Although conventional BoHV-1 vaccines, including those based on the use of modified live virus and also inactivated vaccines, are currently used in many countries, they have several disadvantages. DNA vaccines have emerged as an attractive approach since they have the potential to induce both humoral and cellular immune response; nevertheless, it is largely known that potency of naked DNA vaccines is limited. We demonstrated previously, in the murine model, that the use of adjuvants in combination with a DNA vaccine against BoHV-1 is immunologically beneficial. In this study, we evaluate the immune response and protection against challenge elicited in bovines, by a DNA vaccine carrying the sequence of secreted version of glycoprotein D (gD) of BoHV-1 formulated with chemical adjuvants. Bovines were vaccinated with formulations containing the sequence of gD alone or in combination with adjuvants ESSAI 903110 or Montanide™ 1113101PR. After prime vaccination and two boosters, animals were challenged with infectious BoHV-1. Formulations containing adjuvants Montanide™ 1113101PR and ESSAI 903110 were both, capable of increasing humoral immune response against the virus and diminishing clinical symptoms. Nevertheless, only formulations containing adjuvant Montanide™ 1113101PR was capable of improving cellular immune response and diminishing viral excretion. To our knowledge, it is the first time that a BoHV-1 DNA vaccine is combined with adjuvants and tested in cattle. These results could be useful to design a vaccine for the control of bovine rhinotracheitis. PMID:28179907

  17. A DNA Vaccine Formulated with Chemical Adjuvant Provides Partial Protection against Bovine Herpes Virus Infection in Cattle.

    PubMed

    Quattrocchi, Valeria; Soria, Ivana; Langellotti, Cecilia Ana; Gnazzo, Victoria; Gammella, Mariela; Moore, Dadin P; Zamorano, Patricia I

    2017-01-01

    Bovine herpesvirus-1 (BoHV-1) is the causative agent of bovine infectious rhinotracheitis, an important disease worldwide. Although conventional BoHV-1 vaccines, including those based on the use of modified live virus and also inactivated vaccines, are currently used in many countries, they have several disadvantages. DNA vaccines have emerged as an attractive approach since they have the potential to induce both humoral and cellular immune response; nevertheless, it is largely known that potency of naked DNA vaccines is limited. We demonstrated previously, in the murine model, that the use of adjuvants in combination with a DNA vaccine against BoHV-1 is immunologically beneficial. In this study, we evaluate the immune response and protection against challenge elicited in bovines, by a DNA vaccine carrying the sequence of secreted version of glycoprotein D (gD) of BoHV-1 formulated with chemical adjuvants. Bovines were vaccinated with formulations containing the sequence of gD alone or in combination with adjuvants ESSAI 903110 or Montanide™ 1113101PR. After prime vaccination and two boosters, animals were challenged with infectious BoHV-1. Formulations containing adjuvants Montanide™ 1113101PR and ESSAI 903110 were both, capable of increasing humoral immune response against the virus and diminishing clinical symptoms. Nevertheless, only formulations containing adjuvant Montanide™ 1113101PR was capable of improving cellular immune response and diminishing viral excretion. To our knowledge, it is the first time that a BoHV-1 DNA vaccine is combined with adjuvants and tested in cattle. These results could be useful to design a vaccine for the control of bovine rhinotracheitis.

  18. 76 FR 12556 - Airworthiness Directives; Various Transport Category Airplanes Equipped With Chemical Oxygen...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-03-08

    ... Category Airplanes Equipped With Chemical Oxygen Generators Installed in a Lavatory AGENCY: Federal... affected airplanes identified above. This AD requires modifying the chemical oxygen generators in the lavatory. This AD was prompted by reports that the current design of these oxygen generators presents...

  19. Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure.

    PubMed

    Suzuki, Yuki; Endo, Masayuki; Cañas, Cristina; Ayora, Silvia; Alonso, Juan C; Sugiyama, Hiroshi; Takeyasu, Kunio

    2014-06-01

    Holliday junction (HJ) resolution is a fundamental step for completion of homologous recombination. HJ resolving enzymes (resolvases) distort the junction structure upon binding and prior cleavage, raising the possibility that the reactivity of the enzyme can be affected by a particular geometry and topology at the junction. Here, we employed a DNA origami nano-scaffold in which each arm of a HJ was tethered through the base-pair hybridization, allowing us to make the junction core either flexible or inflexible by adjusting the length of the DNA arms. Both flexible and inflexible junctions bound to Bacillus subtilis RecU HJ resolvase, while only the flexible junction was efficiently resolved into two duplexes by this enzyme. This result indicates the importance of the structural malleability of the junction core for the reaction to proceed. Moreover, cleavage preferences of RecU-mediated reaction were addressed by analyzing morphology of the reaction products.

  20. Direct analysis of Holliday junction resolving enzyme in a DNA origami nanostructure

    PubMed Central

    Suzuki, Yuki; Endo, Masayuki; Cañas, Cristina; Ayora, Silvia; Alonso, Juan C.; Sugiyama, Hiroshi; Takeyasu, Kunio

    2014-01-01

    Holliday junction (HJ) resolution is a fundamental step for completion of homologous recombination. HJ resolving enzymes (resolvases) distort the junction structure upon binding and prior cleavage, raising the possibility that the reactivity of the enzyme can be affected by a particular geometry and topology at the junction. Here, we employed a DNA origami nano-scaffold in which each arm of a HJ was tethered through the base-pair hybridization, allowing us to make the junction core either flexible or inflexible by adjusting the length of the DNA arms. Both flexible and inflexible junctions bound to Bacillus subtilis RecU HJ resolvase, while only the flexible junction was efficiently resolved into two duplexes by this enzyme. This result indicates the importance of the structural malleability of the junction core for the reaction to proceed. Moreover, cleavage preferences of RecU-mediated reaction were addressed by analyzing morphology of the reaction products. PMID:24792171

  1. DNA-directed assembly of supramolecular fluorescent protein energy transfer systems.

    PubMed

    Kukolka, Florian; Schoeps, Oliver; Woggon, Ulrike; Niemeyer, Christof M

    2007-01-01

    Fluorescent proteins with a wide variety of physicochemical properties have evolved in the past few years. The use of these proteins for applications in biomolecular nanosciences requires their precise positioning at the nanometer length scale. To address this challenge, we report here on the self-organization of DNA-tagged fluorescent probes to construct a set of photofunctional supramolecular complexes which include the enhanced yellow fluorescent protein (EYFP). The optical functionality is based on the strongly distance dependent fluorescence resonance energy transfer (FRET), occurring between the donor (EYFP) and an acceptor fluorophore, i.e., the fluorescent dye Atto647. The photophysical properties of four bimolecular FRET complexes, each possessing a well-defined donor-acceptor distance defined by the length of the interconnecting DNA backbone, are investigated by two-dimensional photoluminescence excitation spectroscopy (2D-PLE).

  2. Direct Amplification of Single-Stranded DNA for Pyrosequencing using Linear-After-The-Exponential (LATE)-PCR

    PubMed Central

    Salk, Jesse J.; Sanchez, J Aquiles; Pierce, Kenneth E.; Rice, John E.; Soares, Kevin C.; Wangh, Lawrence J.

    2006-01-01

    Pyrosequencing is a highly effective method for quantitatively genotyping short genetic sequences, but is currently hampered by a labor intensive sample preparation process designed to isolate single-stranded DNA from double-stranded products generated by conventional PCR. Here LATE-PCR is introduced as an efficient and potentially automatable method of directly amplifying single-stranded DNA for pyrosequencing, thus eliminating the need for solid-phase sample preparation and reducing the risk of laboratory contamination. These improvements are illustrated for SNP genotyping applications including an integrated, single cell-through-sequencing assay to detect a mutation at the globin IVS-110 site that is frequently responsible for β-Thalassemia. PMID:16540077

  3. The Stat3/GR interaction code: predictive value of direct/indirect DNA recruitment for transcription outcome.

    PubMed

    Langlais, David; Couture, Catherine; Balsalobre, Aurélio; Drouin, Jacques

    2012-07-13

    Transcription factor recruitment to genomic sites of action is primarily due to direct protein:DNA interactions. The subsequent recruitment of coregulatory complexes leads to either transcriptional activation or repression. In contrast to this canonical scheme, some transcription factors, such as the glucocorticoid receptor (GR), behave as transcriptional repressors when recruited to target genes through protein tethering. We have investigated the genome-wide prevalence of tethering between GR and Stat3 and found nonreciprocal interactions, namely that GR tethering to DNA-bound Stat3 results in transcriptional repression, whereas Stat3 tethering to GR results in synergism. Further, other schemes of GR and Stat3 corecruitment to regulatory modules result in transcriptional synergism, including neighboring and composite binding sites. The results indicate extensive transcriptional interactions between Stat3 and GR; further, they provide a genome-wide assessment of transcriptional regulation by tethering and a molecular basis for integration of signals mediated by GR and Stats in health and disease.

  4. Parole terms for a killer: directing caspase3/CAD induced DNA strand breaks to coordinate changes in gene expression.

    PubMed

    Larsen, Brian D; Megeney, Lynn A

    2010-08-01

    In a series of discoveries over the preceding decade, a number of laboratories have unequivocally established that apoptotic proteins and pathways are well conserved cell fate determinants, which act independent of a cell death response. Within this context, the role for apoptotic proteins in the induction of cell differentiation has been widely documented. Despite these discoveries, little information has been forthcoming regarding a conserved mechanism by which apoptotic proteins achieve this non-death outcome. In the following discussion, we will explore the premise that the penultimate step in apoptosis, genome wide DNA damage/strand breaks act as a conserved genomic reprogramming event necessary for cell differentiation (Larsen et al. Proc Natl Acad Sci USA 2010; 107:4230-5). Moreover, we hypothesis that directed DNA damage, as mediated by known apoptotic proteins, may participate in numerous forms of regulated gene expression.

  5. Chemical Reaction of Soybean Flavonoids with DNA: A Computational Study Using the Implicit Solvent Model

    PubMed Central

    Abdallah, Hassan H.; Mavri, Janez; Repič, Matej; Lee, Vannajan Sanghiran; Wahab, Habibah A.

    2012-01-01

    Genistein, daidzein, glycitein and quercetin are flavonoids present in soybean and other vegetables in high amounts. These flavonoids can be metabolically converted to more active forms, which may react with guanine in the DNA to form complexes and can lead to DNA depurination. We assumed two ultimate carcinogen forms of each of these flavonoids, diol epoxide form and diketone form. Density functional theory (DFT) and Hartree-Fock (HF) methods were used to study the reaction thermodynamics between active forms of flavonoids and DNA guanine. Solvent reaction field method of Tomasi and co-workers and the Langevin dipoles method of Florian and Warshel were used to calculate the hydration free energies. Activation free energy for each reaction was estimated using the linear free energy relation. Our calculations show that diol epoxide forms of flavonoids are more reactive than the corresponding diketone forms and are hence more likely flavonoid ultimate carcinogens. Genistein, daidzein and glycitein show comparable reactivity while quercetin is less reactive toward DNA. PMID:22408390

  6. Generation of Constructs for DNA-Directed RNA Interference of Venezuelan Equine Encephalitis Virus Genes

    DTIC Science & Technology

    2006-12-01

    20(Xi-237 Executive summary Introduction: Venezuelan equine encephalitis virus (VEE) is one of a number of different alphaviruses , which can cause...required for replication . It is hypothesized that targeting essential virus genes, either individually or simultaneously, will lead to knockdown or...silencing of the genes, and subsequent inhibition of virus replication . This paper describes the PCR-based approach used to generate DNA cassettes that

  7. DNA methylation directs genomic localization of Mbd2 and Mbd3 in embryonic stem cells

    PubMed Central

    Hainer, Sarah J; McCannell, Kurtis N; Yu, Jun; Ee, Ly-Sha; Zhu, Lihua J; Rando, Oliver J; Fazzio, Thomas G

    2016-01-01

    Cytosine methylation is an epigenetic and regulatory mark that functions in part through recruitment of chromatin remodeling complexes containing methyl-CpG binding domain (MBD) proteins. Two MBD proteins, Mbd2 and Mbd3, were previously shown to bind methylated or hydroxymethylated DNA, respectively; however, both of these findings have been disputed. Here, we investigated this controversy using experimental approaches and re-analysis of published data and find no evidence for methylation-independent functions of Mbd2 or Mbd3. We show that chromatin localization of Mbd2 and Mbd3 is highly overlapping and, unexpectedly, we find Mbd2 and Mbd3 are interdependent for chromatin association. Further investigation reveals that both proteins are required for normal levels of cytosine methylation and hydroxymethylation in murine embryonic stem cells. Furthermore, Mbd2 and Mbd3 regulate overlapping sets of genes that are also regulated by DNA methylation/hydroxymethylation factors. These findings reveal an interdependent regulatory mechanism mediated by the DNA methylation machinery and its readers. DOI: http://dx.doi.org/10.7554/eLife.21964.001 PMID:27849519

  8. Microcapillary reactors using solid-phase DNA sequencing for direct sample introduction into slab gels.

    PubMed

    Xu, Y; Bruch, R C; Soper, S A

    2000-05-01

    Solid-phase micro-reactors have been prepared in glass capillaries for DNA sequencing applications using slab gel electrophoresis, which consisted of a fused silica capillary (i.d. = 100 microns; o.d. = 365 microns; length = 15 cm; volume = 1.2 microL) that contained a covalently bound biotin molecule. With the addition of streptavidin to the capillary, an anchoring site was produced for the tethering of biotinylated DNA sequencing templates to the wall of the capillary. Using a four-lane, single dye primer chemistry sequencing strategy, the individual tracts were prepared in the capillaries using cycle sequencing (20 thermal cycles) on a PCR-generated lambda-bacteriophage template (about 1000 bp). The dye label in this case was a fluorescent tag that displayed emission properties in the near-IR and could be processed on an automated sequencer. The read length was found to be 589 bases, which was determined primarily by the fractionating power of the gel. It was also found that the tethering system was very stable to typical cycle sequencing conditions, with the amount of tethered DNA lost amounting to 40% after 120 thermal cycles. The ability to use dye terminator chemistry was also investigated by using a near-IR dye-labeled terminator (ddGTP). It was found that the quality of the ladder that was generated was comparable to that obtained in a conventional sample preparation format. However, ethanol precipitation was required before gel loading to remove excess terminator.

  9. Direct visualization of both DNA and RNA quadruplexes in human cells via an uncommon spectroscopic method

    PubMed Central

    Laguerre, Aurélien; Wong, Judy M. Y.; Monchaud, David

    2016-01-01

    Guanine-rich DNA or RNA sequences can fold into higher-order, four-stranded structures termed quadruplexes that are suspected to play pivotal roles in cellular mechanisms including the control of the genome integrity and gene expression. However, the biological relevance of quadruplexes is still a matter of debate owing to the paucity of unbiased evidences of their existence in cells. Recent reports on quadruplex-specific antibodies and small-molecule fluorescent probes help dispel reservations and accumulating evidences now pointing towards the cellular relevance of quadruplexes. To better assess and comprehend their biology, developing new versatile tools to detect both DNA and RNA quadruplexes in cells is essential. We report here a smart fluorescent probe that allows for the simple detection of quadruplexes thanks to an uncommon spectroscopic mechanism known as the red-edge effect (REE). We demonstrate that this effect could open avenues to greatly enhance the ability to visualize both DNA and RNA quadruplexes in human cells, using simple protocols and fluorescence detection facilities. PMID:27535322

  10. DNA methylation directs genomic localization of Mbd2 and Mbd3 in embryonic stem cells.

    PubMed

    Hainer, Sarah J; McCannell, Kurtis N; Yu, Jun; Ee, Ly-Sha; Zhu, Lihua J; Rando, Oliver J; Fazzio, Thomas G

    2016-11-16

    Cytosine methylation is an epigenetic and regulatory mark that functions in part through recruitment of chromatin remodeling complexes containing methyl-CpG binding domain (MBD) proteins. Two MBD proteins, Mbd2 and Mbd3, were previously shown to bind methylated or hydroxymethylated DNA, respectively; however, both of these findings have been disputed. Here, we investigated this controversy using experimental approaches and re-analysis of published data and find no evidence for methylation-independent functions of Mbd2 or Mbd3. We show that chromatin localization of Mbd2 and Mbd3 is highly overlapping and, unexpectedly, we find Mbd2 and Mbd3 are interdependent for chromatin association. Further investigation reveals that both proteins are required for normal levels of cytosine methylation and hydroxymethylation in murine embryonic stem cells. Furthermore, Mbd2 and Mbd3 regulate overlapping sets of genes that are also regulated by DNA methylation/hydroxymethylation factors. These findings reveal an interdependent regulatory mechanism mediated by the DNA methylation machinery and its readers.

  11. Amphotericin B and anidulafungin directly interact with DNA and induce oxidative damage in the mammalian genome.

    PubMed

    Mandal, Santi M; Chakraborty, Anirban; Hossain, Maidul; Mahata, Denial; Porto, William F; Chakraborty, Ranadhir; Mukhopadhyay, Chinmay K; Franco, Octavio L; Hazra, Tapas K; Basak, Amit

    2015-09-01

    Amphotericin B and anidulafungin are widely used antifungal drugs for the treatment of systemic and serious mycoses. Amphotericin B is a relatively toxic drug which has long been established. This study is first of its kind to systematically investigate the nature of binding to DNA, and to evaluate intercalation of AMP-B or ANIDULA with the aid of UV-Vis, ITC, and CD spectroscopy. The binding affinity of AMP-B with exclusion sites of 4.68 base pairs (1.2 × 10(5) M(-1)) was found to be higher than that of ANIDULA with exclusion sites of 6.67 base pairs (3.78 × 10(4) M(-1)); consistent with the binding affinity values obtained for AMP-B (10(5) M(-1)) and ANIDULA (10(4) M(-1)). The binding of two drugs with double-stranded DNA was favoured by negative enthalpy as well as negative entropy changes. The intercalation of drugs to duplex polynucleotide induced changes in the intrinsic CD spectra and revealed comparatively higher affinity towards AMP-B than ANIDULA. Molecular docking studies revealed that the negative binding energy was higher in the case of AMP-B reflecting more affinity towards single-stranded DNA. The results of the cytotoxicity, immunoblotting, and gene specific LA-QPCR assay have indicated that ANIDULA is less genotoxic than AMP-B. Hence, the superiority of ANIDULA over AMP-B as a systemic antifungal drug has been established beyond doubt.

  12. Sizes, locations, and directions of transcription of two genes on a cloned maize chloroplast DNA sequence

    PubMed Central

    Link, Gerhard; Bogorad, Lawrence

    1980-01-01

    mRNA for the large subunit (LS) of ribulose-1,5-bisphosphate carboxylase [3-phospho-D-glycerate carboxylase (dimerizing), EC 4.1.1.39] of Zea mays is complementary to an uninterrupted 1600-base-pair-long chloroplast DNA sequence that has been mapped precisely within the 4350-base-pair-long chloroplast DNA fragment Bam 9 to which it had been traced earlier [Bedbrook, J. R., Coen, D. M., Beaton, A. R., Bogorad, L. & Rich, A. (1979) J. Biol. Chem. 254, 905-910]. An additional 1400-base-pair-long uninterrupted region that is colinear with a chloroplast RNA has been detected on Bam 9. The transcript from this region is part of a 2200-nucleotide-long RNA. The remainder of the DNA sequence for the 2200-base-pair RNA maps outside Bam 9. The 1600-base-pair LS gene and the gene for the 2200-nucleotide transcript are close to one another. They are separated by an untranscribed intercistronic “gap” about 330 base pairs long. These two closely packed genes are inverted on the chromosome—i.e., their 3′ termini are at opposite ends of the untranscribed gap and they map on opposite strands. Images PMID:16592800

  13. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomize