Science.gov

Sample records for dna direct chemical

  1. Template-directed Chemical Ligation to Obtain 3'-3' and 5'-5' Phosphodiester DNA Linkages

    NASA Astrophysics Data System (ADS)

    Chen, Haodong; Du, Feng; Chen, Gangyi; Streckenbach, Frank; Yasmeen, Afshan; Zhao, Yun; Tang, Zhuo

    2014-04-01

    Up to now, the direct ligation of two DNA fragments with opposite directions to obtain 3'-3' or 5'-5' phosphate ester bonds is still challenging. The only way to obtain DNA oligonucleotides containing a 3'-3' or 5'-5' inversion of polarity sites is based on professional DNA chemical synthesis. Herein, we demonstrate a convenient template-directed chemical ligation that enables 3'-3' and 5'-5' linkages of two DNA oligonucleotides. This method is based on the assembly of two oligonucleotides on a template in opposite directions through forming antiparallel and parallel duplexes simultaneously, followed by coupling with N-Cyanoimidazole under mild condition. Moreover, on the basis of DNA oligonucleotides with 5'-5' linkage obtained through our template-directed chemical ligation, we developed a new cDNA display technique for in vitro selection of functional polypeptides.

  2. Direct and transgenerational impact on Daphnia magna of chemicals with a known effect on DNA methylation.

    PubMed

    Vandegehuchte, Michiel B; Lemière, Filip; Vanhaecke, Lynn; Vanden Berghe, Wim; Janssen, Colin R

    2010-04-01

    The purpose of this study is to investigate (1) the induction of epigenetic effects in the crustacean Daphnia magna using DNA methylation as an epigenetic mark and (2) the potential stable transfer of such an epigenetic effect to non-exposed subsequent generations. Daphnids were exposed to chemical substances known to affect DNA methylation in mammals: vinclozolin, 5-azacytidine, 2'-deoxy-5-azacytidine, genistein and biochanin A. Effects on overall DNA cytosine methylation, body length and reproduction were evaluated in 21day experiments. Using a multi-generational experimental design these endpoints were also evaluated in the F(1) and F(2) generation of both exposed and non-exposed offspring from F(0) daphnids exposed to 5-azacytidine, genistein or vinclozolin. A reduction in DNA methylation was consistently observed in daphnids exposed to vinclozolin and 5-azacytidine. Only in organisms exposed to 5-azacytidine was this effect transferred to the two subsequent non-exposed generations. A concurrent reduction in body length at day 7 was observed in these treatments. For the first time, exposure to environmental chemicals was shown to affect DNA methylation in the parental generation of D. magna. We also demonstrated a transgenerational alteration in an epigenetic system in D. magna, which indicates the possibility of transgenerational inheritance of environment-induced epigenetic changes in non-exposed subsequent generations.

  3. Chemical adjuvants for plasmid DNA vaccines.

    PubMed

    Greenland, John R; Letvin, Norman L

    2007-05-10

    Plasmid DNA vaccines are a promising modality for immunization against a variety of human pathogens. Immunization via multiple routes with plasmid DNA can elicit potent cellular immune responses, and these immunogens can be administered repeatedly without inducing anti-vector immunity. Nonetheless, the immunogenicity of plasmid DNA vaccines has been limited by problems associated with delivery. A number of adjuvants have been designed to improve plasmid DNA immunogenicity, either by directly stimulating the immune system or by enhancing plasmid DNA expression. Chemical adjuvants for enhancing plasmid DNA expression include liposomes, polymers, and microparticles, all of which have shown promise for enhancing the expression and immunogenicity of plasmid DNA vaccines in animal models. Micro- and nanoparticles have not been shown to enhance immune responses to plasmid DNA vaccines. However, formulation of plasmid DNA with some non-particulate polymeric adjuvants has led to a statistically significant enhancement of immune responses. Further development of these technologies will significantly improve the utility of plasmid DNA vaccination.

  4. Targeting of chemical mutagens to differentiating B-lymphocytes in vivo: detection by direct DNA labeling and sister chromatid exchange induction

    SciTech Connect

    Bloom, S.E.; Nanna, U.C.; Dietert, R.R.

    1987-01-01

    In vivo systems for analyzing mutagen interactions with a specific differentiating cell population are rare. Taking advantage of the unique anatomical features of the bursa of Fabricius in the chicken, the authors explored the possibility of targeting chemical mutagens to a defined differentiating cell population in the animal, namely, the B-lymphocytes series. Such cells are known to be the targets for the oncogene-activating avian leukosis virus. Targeting of chemicals to cells of the bursa was demonstrated by application of the DNA-specific fluorochrome 4'-6-diamidino-2-phenylindole (DAPI) to the anal lips of neonatal chicks. Bright nuclear fluorescence of cells in the bursa demonstrated to occur within minutes after the application of 500..mu..l of DAPI. DAPI labeling of nuclei was detected up to several days after a single application. No nuclear labeling was exhibited in cells of neighboring tissues. Methyl methanesulfonate (MMS)(10..mu..l) was applied to the anal lips of day-old chicks to study dose-response kinetics for mutagen targeting to DNA of dividing B-lymphocytes in the bursa. Since the mitotic index was found to be quite high (25-30%) in the bursa, chromosome analysis was used to assay for genome damage. Sister chromatid exchange frequencies of 3.9, 7.3, and 9.0 (baseline 2.5) per cell were obtained at MMS dosages per animal of 50 ..mu..g, 100..mu..g, and 200..mu..g, respectively. These results indicate the rapid and quantitative localization of DNA-binding chemicals to cells of the bursa, particularly the resident B-lymphocytes. The bursa should be a useful system for studying mutagen-DNA interactions in the differentiating B-lymphocyte and subsequent influences on the development of immunity and lymphoproliferative disease.

  5. Recognition and repair of chemically heterogeneous structures at DNA ends

    PubMed Central

    Andres, Sara N.; Schellenberg, Matthew J.; Wallace, Bret D.; Tumbale, Percy; Williams, R. Scott

    2014-01-01

    Exposure to environmental toxicants and stressors, radiation, pharmaceutical drugs, inflammation, cellular respiration, and routine DNA metabolism all lead to the production of cytotoxic DNA strand breaks. Akin to splintered wood, DNA breaks are not “clean”. Rather, DNA breaks typically lack DNA 5'-phosphate and 3'-hydroxyl moieties required for DNA synthesis and DNA ligation. Failure to resolve damage at DNA ends can lead to abnormal DNA replication and repair, and is associated with genomic instability, mutagenesis, neurological disease, ageing and carcinogenesis. An array of chemically heterogeneous DNA termini arises from spontaneously generated DNA single-strand and double-strand breaks (SSBs and DSBs), and also from normal and/or inappropriate DNA metabolism by DNA polymerases, DNA ligases and topoisomerases. As a front line of defense to these genotoxic insults, eukaryotic cells have accrued an arsenal of enzymatic first responders that bind and protect damaged DNA termini, and enzymatically tailor DNA ends for DNA repair synthesis and ligation. These nucleic acid transactions employ direct damage reversal enzymes including Aprataxin (APTX), Polynucleotide kinase phosphatase (PNK), the tyrosyl DNA phosphodiesterases (TDP1 and TDP2), the Ku70/80 complex and DNA polymerase β (POLβ). Nucleolytic processing enzymes such as the MRE11/RAD50/NBS1/CtIP complex, Flap endonuclease (FEN1) and the apurinic endonucleases (APE1 and APE2) also act in the chemical "cleansing" of DNA breaks to prevent genomic instability and disease, and promote progression of DNA- and RNA-DNA damage response (DDR and RDDR) pathways. Here, we provide an overview of cellular first responders dedicated to the detection and repair of abnormal DNA termini. PMID:25111769

  6. Chemical studies on DNA damage by radiation

    NASA Astrophysics Data System (ADS)

    Kagiya, V. Tsutomu; Sakano, Koichi; Nishimoto, Sei-Ici

    The radiation chemical characteristics of DNA-related compounds, especially thymine, as the most radiosensitivity DNA base in aqueous solution, are shown to obtain correlations with the radiation inactivations of bacterial and mammalian cultured cells. Recent development of chemical sensitizers for modification of the radiosensitivity of hypoxic cells, which is closely associated with the radiation therapy of cancer, is also reviewed.

  7. On the chemical yield of base lesions, strand breaks, and clustered damage generated in plasmid DNA by the direct effect of X rays.

    PubMed

    Purkayastha, Shubhadeep; Milligan, Jamie R; Bernhard, William A

    2007-09-01

    The purpose of this study was to determine the yield of DNA base damages, deoxyribose damage, and clustered lesions due to the direct effects of ionizing radiation and to compare these with the yield of DNA trapped radicals measured previously in the same pUC18 plasmid. The plasmids were prepared as films hydrated in the range 2.5 < Gamma < 22.5 mol water/mol nucleotide. Single-strand breaks (SSBs) and double-strand breaks (DSBs) were detected by agarose gel electrophoresis. Specific types of base lesions were converted into SSBs and DSBs using the base-excision repair enzymes endonuclease III (Nth) and formamidopyrimidine-DNA glycosylase (Fpg). The yield of base damage detected by this method displayed a strikingly different dependence on the level of hydration (Gamma) compared with that for the yield of DNA trapped radicals; the former decreased by 3.2 times as Gamma was varied from 2.5 to 22.5 and the later increased by 2.4 times over the same range. To explain this divergence, we propose that SSB yields produced in plasmid DNA by the direct effect cannot be analyzed properly with a Poisson process that assumes an average of one strand break per plasmid and neglects the possibility of a single track producing multiple SSBs within a plasmid. The yields of DSBs, on the other hand, are consistent with changes in free radical trapping as a function of hydration. Consequently, the composition of these clusters could be quantified. Deoxyribose damage on each of the two opposing strands occurs with a yield of 3.5 +/- 0.5 nmol/J for fully hydrated pUC18, comparable to the yield of 4.1 +/- 0.9 nmol/J for DSBs derived from opposed damages in which at least one of the sites is a damaged base.

  8. Chemical Information: Print. Directed Study.

    ERIC Educational Resources Information Center

    Stone, Catherine C.

    This report provides a survey and evaluation of chemical information literature. Contained in this survey are an overview of the chemical literature field, comments on obtaining access to this literature and annotated bibliographies of primary, secondary, and tertiary sources as well as special topics. Primary sources include journals, patents,…

  9. Chemical Information: Print. Directed Study.

    ERIC Educational Resources Information Center

    Stone, Catherine C.

    This report provides a survey and evaluation of chemical information literature. Contained in this survey are an overview of the chemical literature field, comments on obtaining access to this literature and annotated bibliographies of primary, secondary, and tertiary sources as well as special topics. Primary sources include journals, patents,…

  10. DNA-decorated graphene chemical sensors

    NASA Astrophysics Data System (ADS)

    Goldsmith, Brett; Lu, Ye; Kybert, Nicholas; Johnson, A. T. Charlie

    2010-03-01

    We measure the sensing response of DNA functionalized graphene to various analytes. Graphene is the current flagship nanomaterial and has been actively studied as a chemical sensor since shortly after it was isolated. Increasingly sophisticated device processing has revealed that some early measurements of graphene chemical sensing have been amplified by unintentional functionalization. We start with chemically clean graphene transistors and purposefully functionalize them to allow chemical sensing responses not found using pristine graphene. By using different DNA sequences during our functionalization, we are able to change the chemical sensitivity of the graphene. The resulting devices show fast response times, complete recovery at room temperature and discrimination between several similar analytes. This work has been supported by the IC Postdoc program, REU and the Nano/Bio Interface Center.

  11. Chemically-enzymatic synthesis of photosensitive DNA.

    PubMed

    Westphal, Kinga; Zdrowowicz, Magdalena; Zylicz-Stachula, Agnieszka; Rak, Janusz

    2017-02-01

    The sensitizing propensity of radio-/photosensitizing nucleoside depends on DNA sequence surrounding a sensitizer. Therefore, in order to compare sensitizers with regard to their ability to induce a DNA damage one has to study the sequence dependence of damage yield. However, chemical synthesis of oligonucleotides labeled with sensitizing nucleosides is hindered due to the fact that a limited number of such nucleoside phosphoramidites are accessible. Here, we report on a chemically-enzymatic method, employing a DNA polymerase and ligase, that enables a modified nucleoside, in the form of its 5'-triphosphate, to be incorporated into DNA fragment in a pre-determined site. Using such a protocol two double-stranded DNA fragments - a long one, 75 base pairs (bp), and a short one, 30bp in length - were pin-point labeled with 5-bromodeoxyuridine. Four DNA polymerases together with DHPLC for the inspection of reaction progress were used to optimize the process under consideration. As an ultimate test showing that the product possessing an assumed nucleotide sequence was actually obtained, we irradiated the synthesized oligonucleotide with UVB photons and analyzed its photoreactivity with the LC-MS method. Our results prove that a general approach enabling precise labeling of DNA with any nucleoside modification processed by DNA polymerase and ligase has been worked out.

  12. Direct electrical detection of DNA synthesis

    PubMed Central

    Pourmand, Nader; Karhanek, Miloslav; Persson, Henrik H. J.; Webb, Chris D.; Lee, Thomas H.; Zahradníková, Alexandra; Davis, Ronald W.

    2006-01-01

    Rapid, sequence-specific DNA detection is essential for applications in medical diagnostics and genetic screening. Electrical biosensors that use immobilized nucleic acids are especially promising in these applications because of their potential for miniaturization and automation. Current DNA detection methods based on sequencing by synthesis rely on optical readouts; however, a direct electrical detection method for this technique is not available. We report here an approach for direct electrical detection of enzymatically catalyzed DNA synthesis by induced surface charge perturbation. We discovered that incorporation of a complementary deoxynucleotide (dNTP) into a self-primed single-stranded DNA attached to the surface of a gold electrode evokes an electrode surface charge perturbation. This event can be detected as a transient current by a voltage-clamp amplifier. Based on current understanding of polarizable interfaces, we propose that the electrode detects proton removal from the 3′-hydroxyl group of the DNA molecule during phosphodiester bond formation. PMID:16614066

  13. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    PubMed

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions.

  14. RNA-directed DNA methylation in Arabidopsis

    PubMed Central

    Aufsatz, Werner; Mette, M. Florian; van der Winden, Johannes; Matzke, Antonius J. M.; Matzke, Marjori

    2002-01-01

    In plants, double-stranded RNA that is processed to short RNAs ≈21–24 nt in length can trigger two types of epigenetic gene silencing. Posttranscriptional gene silencing, which is related to RNA interference in animals and quelling in fungi, involves targeted elimination of homologous mRNA in the cytoplasm. RNA-directed DNA methylation involves de novo methylation of almost all cytosine residues within a region of RNA–DNA sequence identity. RNA-directed DNA methylation is presumed to be responsible for the methylation observed in protein coding regions of posttranscriptionally silenced genes. Moreover, a type of transcriptional gene silencing and de novo methylation of homologous promoters in trans can occur if a double-stranded RNA contains promoter sequences. Although RNA-directed DNA methylation has been described so far only in plants, there is increasing evidence that RNA can also target genome modifications in other organisms. To understand how RNA directs methylation to identical DNA sequences and how changes in chromatin configuration contribute to initiating or maintaining DNA methylation induced by RNA, a promoter double-stranded RNA-mediated transcriptional gene silencing system has been established in Arabidopsis. A genetic analysis of this system is helping to unravel the relationships among RNA signals, DNA methylation, and chromatin structure. PMID:12169664

  15. The structure of DNA by direct imaging

    PubMed Central

    Marini, Monica; Falqui, Andrea; Moretti, Manola; Limongi, Tania; Allione, Marco; Genovese, Alessandro; Lopatin, Sergei; Tirinato, Luca; Das, Gobind; Torre, Bruno; Giugni, Andrea; Gentile, Francesco; Candeloro, Patrizio; Di Fabrizio, Enzo

    2015-01-01

    The structure of DNA was determined in 1953 by x-ray fiber diffraction. Several attempts have been made to obtain a direct image of DNA with alternative techniques. The direct image is intended to allow a quantitative evaluation of all relevant characteristic lengths present in a molecule. A direct image of DNA, which is different from diffraction in the reciprocal space, is difficult to obtain for two main reasons: the intrinsic very low contrast of the elements that form the molecule and the difficulty of preparing the sample while preserving its pristine shape and size. We show that through a preparation procedure compatible with the DNA physiological conditions, a direct image of a single suspended DNA molecule can be obtained. In the image, all relevant lengths of A-form DNA are measurable. A high-resolution transmission electron microscope that operates at 80 keV with an ultimate resolution of 1.5 Å was used for this experiment. Direct imaging of a single molecule can be used as a method to address biological problems that require knowledge at the single-molecule level, given that the average information obtained by x-ray diffraction of crystals or fibers is not sufficient for detailed structure determination, or when crystals cannot be obtained from biological molecules or are not sufficient in understanding multiple protein configurations. PMID:26601243

  16. Solid phase DNA extraction on PDMS and direct amplification.

    PubMed

    Pasquardini, Laura; Potrich, Cristina; Quaglio, Marzia; Lamberti, Andrea; Guastella, Salvatore; Lunelli, Lorenzo; Cocuzza, Matteo; Vanzetti, Lia; Pirri, Candido Fabrizio; Pederzolli, Cecilia

    2011-12-07

    In this paper we report an innovative use of Poly(DiMethyl)Siloxane (PDMS) to design a microfluidic device that combines, for the first time, in one single reaction chamber, DNA purification from a complex biological sample (blood) without elution and PCR without surface passivation agents. This result is achieved by exploiting the spontaneous chemical structure and nanomorphology of the material after casting. The observed surface organization leads to spontaneous DNA adsorption. This property allows on-chip complete protocols of purification of complex biological samples to be performed directly, starting from cells lysis. Amplification by PCR is performed directly on the adsorbed DNA, avoiding the elution process that is normally required by DNA purification protocols. The use of one single microfluidic volume for both DNA purification and amplification dramatically simplifies the structure of microfluidic devices for DNA preparation. X-Ray Photoelectron Spectroscopy (XPS) was used to analyze the surface chemical composition. Atomic Force Microscopy (AFM) and Field Emission Scanning Electron Microscopy (FESEM) were employed to assess the morphological nanostructure of the PDMS-chips. A confocal fluorescence analysis was utilized to check DNA distribution inside the chip.

  17. DNA Damage, Homology-Directed Repair, and DNA Methylation

    PubMed Central

    Angrisano, Tiziana; Morano, Annalisa; Lee, Bongyong; Pardo, Alba Di; Messina, Samantha; Iuliano, Rodolfo; Fusco, Alfredo; Santillo, Maria R; Muller, Mark T; Chiariotti, Lorenzo; Gottesman, Max E; Avvedimento, Enrico V

    2007-01-01

    To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES) cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP) genes (DR-GFP). A total of 2%–4% of the cells generated a functional GFP by homology-directed repair (HR) and gene conversion. However, ~50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2′-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments. PMID:17616978

  18. T7 replisome directly overcomes DNA damage

    NASA Astrophysics Data System (ADS)

    Sun, Bo; Pandey, Manjula; Inman, James T.; Yang, Yi; Kashlev, Mikhail; Patel, Smita S.; Wang, Michelle D.

    2015-12-01

    Cells and viruses possess several known `restart' pathways to overcome lesions during DNA replication. However, these `bypass' pathways leave a gap in replicated DNA or require recruitment of accessory proteins, resulting in significant delays to fork movement or even cell division arrest. Using single-molecule and ensemble methods, we demonstrate that the bacteriophage T7 replisome is able to directly replicate through a leading-strand cyclobutane pyrimidine dimer (CPD) lesion. We show that when a replisome encounters the lesion, a substantial fraction of DNA polymerase (DNAP) and helicase stay together at the lesion, the replisome does not dissociate and the helicase does not move forward on its own. The DNAP is able to directly replicate through the lesion by working in conjunction with helicase through specific helicase-DNAP interactions. These observations suggest that the T7 replisome is fundamentally permissive of DNA lesions via pathways that do not require fork adjustment or replisome reassembly.

  19. Small-molecule discovery from DNA-encoded chemical libraries.

    PubMed

    Kleiner, Ralph E; Dumelin, Christoph E; Liu, David R

    2011-12-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this tutorial review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity.

  20. Small-Molecule Discovery from DNA-Encoded Chemical Libraries†

    PubMed Central

    Kleiner, Ralph E.; Dumelin, Christoph E.; Liu, David R.

    2015-01-01

    Researchers seeking to improve the efficiency and cost effectiveness of the bioactive small-molecule discovery process have recently embraced selection-based approaches, which in principle offer much higher throughput and simpler infrastructure requirements compared with traditional small-molecule screening methods. Since selection methods benefit greatly from an information-encoding molecule that can be readily amplified and decoded, several academic and industrial groups have turned to DNA as the basis for library encoding and, in some cases, library synthesis. The resulting DNA-encoded synthetic small-molecule libraries, integrated with the high sensitivity of PCR and the recent development of ultra high-throughput DNA sequencing technology, can be evaluated very rapidly for binding or bond formation with a target of interest while consuming minimal quantities of material and requiring only modest investments of time and equipment. In this review we describe the development of two classes of approaches for encoding chemical structures and reactivity with DNA: DNA-recorded library synthesis, in which encoding and library synthesis take place separately, and DNA-directed library synthesis, in which DNA both encodes and templates library synthesis. We also describe in vitro selection methods used to evaluate DNA-encoded libraries and summarize successful applications of these approaches to the discovery of bioactive small molecules and novel chemical reactivity. PMID:21674077

  1. DNA dynamically directs its own transcription initiation

    SciTech Connect

    Rasmussen, K. O.; Kalosakas, G.; Bishop, A. R.; Choi, C. H.; Usheva, A.

    2004-01-01

    Initiation of DNA gene transcription requires a transient opening in the double helix at the transcriptional start site. It is generally assumed that the location of this 'transcriptional bubble' is determined by sequence-specific protein binding, and that the energy required for unwinding the double helix comes from torsional strain. Physical twisting should cause DNA to open consistently in weakly bonded A/T rich stretches, however, simple base-pairing energetics alone can not account for the variety of observed transcriptional start sites. Applying the Peyrard-Bishop nonlinear cooperativity model to DNA, we are able to predict that thermally-induced DNA bubbles, similar in size to transcription bubbles, form at specific locations on DNA promoters. These predicted openings agree remarkably well with experiment, and that they correlate exactly with known transcription start sites and important regulatory sites on three different promoters. We propose that the sequence-specific location of the transcriptional start site is predetermined by the inherent opening patterns of specific DNA sequences. As DNA bubble formation is independent of protein binding, it appears that DNA is not only a passive carrier of information, but its dynamics plays an important role in directing the transcription and regulation of the genes it contains.

  2. Programmable chemical controllers made from DNA

    PubMed Central

    Chen, Yuan-Jyue; Dalchau, Neil; Srinivas, Niranjan; Phillips, Andrew; Cardelli, Luca; Soloveichik, David; Seelig, Georg

    2014-01-01

    Biological organisms use complex molecular networks to navigate their environment and regulate their internal state. The development of synthetic systems with similar capabilities could lead to applications such as smart therapeutics or fabrication methods based on self-organization. To achieve this, molecular control circuits need to be engineered to perform integrated sensing, computation and actuation. Here we report a DNA-based technology for implementing the computational core of such controllers. We use the formalism of chemical reaction networks as a 'programming language', and our DNA architecture can, in principle, implement any behaviour that can be mathematically expressed as such. Unlike logic circuits, our formulation naturally allows complex signal processing of intrinsically analogue biological and chemical inputs. Controller components can be derived from biologically synthesized (plasmid) DNA, which reduces errors associated with chemically synthesized DNA. We implement several building-block reaction types and then combine them into a network that realizes, at the molecular level, an algorithm used in distributed control systems for achieving consensus between multiple agents. PMID:24077029

  3. Programmable chemical controllers made from DNA

    NASA Astrophysics Data System (ADS)

    Chen, Yuan-Jyue; Dalchau, Neil; Srinivas, Niranjan; Phillips, Andrew; Cardelli, Luca; Soloveichik, David; Seelig, Georg

    2013-10-01

    Biological organisms use complex molecular networks to navigate their environment and regulate their internal state. The development of synthetic systems with similar capabilities could lead to applications such as smart therapeutics or fabrication methods based on self-organization. To achieve this, molecular control circuits need to be engineered to perform integrated sensing, computation and actuation. Here we report a DNA-based technology for implementing the computational core of such controllers. We use the formalism of chemical reaction networks as a 'programming language' and our DNA architecture can, in principle, implement any behaviour that can be mathematically expressed as such. Unlike logic circuits, our formulation naturally allows complex signal processing of intrinsically analogue biological and chemical inputs. Controller components can be derived from biologically synthesized (plasmid) DNA, which reduces errors associated with chemically synthesized DNA. We implement several building-block reaction types and then combine them into a network that realizes, at the molecular level, an algorithm used in distributed control systems for achieving consensus between multiple agents.

  4. Gold nanocrystals with DNA-directed morphologies

    PubMed Central

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-01-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology. PMID:27633935

  5. Gold nanocrystals with DNA-directed morphologies

    NASA Astrophysics Data System (ADS)

    Ma, Xingyi; Huh, June; Park, Wounjhang; Lee, Luke P.; Kwon, Young Jik; Sim, Sang Jun

    2016-09-01

    Precise control over the structure of metal nanomaterials is important for developing advanced nanobiotechnology. Assembly methods of nanoparticles into structured blocks have been widely demonstrated recently. However, synthesis of nanocrystals with controlled, three-dimensional structures remains challenging. Here we show a directed crystallization of gold by a single DNA molecular regulator in a sequence-independent manner and its applications in three-dimensional topological controls of crystalline nanostructures. We anchor DNA onto gold nanoseed with various alignments to form gold nanocrystals with defined topologies. Some topologies are asymmetric including pushpin-, star- and biconcave disk-like structures, as well as more complex jellyfish- and flower-like structures. The approach of employing DNA enables the solution-based synthesis of nanocrystals with controlled, three-dimensional structures in a desired direction, and expands the current tools available for designing and synthesizing feature-rich nanomaterials for future translational biotechnology.

  6. DNA as a universal substrate for chemical kinetics.

    PubMed

    Soloveichik, David; Seelig, Georg; Winfree, Erik

    2010-03-23

    Molecular programming aims to systematically engineer molecular and chemical systems of autonomous function and ever-increasing complexity. A key goal is to develop embedded control circuitry within a chemical system to direct molecular events. Here we show that systems of DNA molecules can be constructed that closely approximate the dynamic behavior of arbitrary systems of coupled chemical reactions. By using strand displacement reactions as a primitive, we construct reaction cascades with effectively unimolecular and bimolecular kinetics. Our construction allows individual reactions to be coupled in arbitrary ways such that reactants can participate in multiple reactions simultaneously, reproducing the desired dynamical properties. Thus arbitrary systems of chemical equations can be compiled into real chemical systems. We illustrate our method on the Lotka-Volterra oscillator, a limit-cycle oscillator, a chaotic system, and systems implementing feedback digital logic and algorithmic behavior.

  7. DNA as a universal substrate for chemical kinetics

    PubMed Central

    Soloveichik, David; Seelig, Georg; Winfree, Erik

    2010-01-01

    Molecular programming aims to systematically engineer molecular and chemical systems of autonomous function and ever-increasing complexity. A key goal is to develop embedded control circuitry within a chemical system to direct molecular events. Here we show that systems of DNA molecules can be constructed that closely approximate the dynamic behavior of arbitrary systems of coupled chemical reactions. By using strand displacement reactions as a primitive, we construct reaction cascades with effectively unimolecular and bimolecular kinetics. Our construction allows individual reactions to be coupled in arbitrary ways such that reactants can participate in multiple reactions simultaneously, reproducing the desired dynamical properties. Thus arbitrary systems of chemical equations can be compiled into real chemical systems. We illustrate our method on the Lotka–Volterra oscillator, a limit-cycle oscillator, a chaotic system, and systems implementing feedback digital logic and algorithmic behavior. PMID:20203007

  8. UVA Generates Pyrimidine Dimers in DNA Directly

    PubMed Central

    Jiang, Yong; Rabbi, Mahir; Kim, Minkyu; Ke, Changhong; Lee, Whasil; Clark, Robert L.; Mieczkowski, Piotr A.; Marszalek, Piotr E.

    2009-01-01

    There is increasing evidence that UVA radiation, which makes up ∼95% of the solar UV light reaching the Earth's surface and is also commonly used for cosmetic purposes, is genotoxic. However, in contrast to UVC and UVB, the mechanisms by which UVA produces various DNA lesions are still unclear. In addition, the relative amounts of various types of UVA lesions and their mutagenic significance are also a subject of debate. Here, we exploit atomic force microscopy (AFM) imaging of individual DNA molecules, alone and in complexes with a suite of DNA repair enzymes and antibodies, to directly quantify UVA damage and reexamine its basic mechanisms at a single-molecule level. By combining the activity of endonuclease IV and T4 endonuclease V on highly purified and UVA-irradiated pUC18 plasmids, we show by direct AFM imaging that UVA produces a significant amount of abasic sites and cyclobutane pyrimidine dimers (CPDs). However, we find that only ∼60% of the T4 endonuclease V-sensitive sites, which are commonly counted as CPDs, are true CPDs; the other 40% are abasic sites. Most importantly, our results obtained by AFM imaging of highly purified native and synthetic DNA using T4 endonuclease V, photolyase, and anti-CPD antibodies strongly suggest that CPDs are produced by UVA directly. Thus, our observations contradict the predominant view that as-yet-unidentified photosensitizers are required to transfer the energy of UVA to DNA to produce CPDs. Our results may help to resolve the long-standing controversy about the origin of UVA-produced CPDs in DNA. PMID:19186150

  9. Direct Observation of Thymine Dimer Repair in DNA by Photolyase

    NASA Astrophysics Data System (ADS)

    Zhong, Dongping

    2006-03-01

    Departments of Physics, Chemistry, and Biochemistry, Programs of Biophysics, Chemical Physics, and Biochemistry, The Ohio State University, Columbus, 191 West Woodruff Avenue, OH 43210. Photolyase uses light energy to split ultraviolet-induced cyclobutane pyrimidine dimers in damaged DNA, but its molecular mechanism has never been directly revealed. We report here the direct mapping of catalytic processes through femtosecond synchronization of the enzymatic dynamics with the repair function. We observed direct electron transfer from the excited flavin cofactor to the dimer in 170 ps and back electron transfer from the repaired thymines in 560 ps. Both reactions are strongly modulated by active-site solvation to achieve maximum repair efficiency. These results show that the photocycle of DNA repair by photolyase is through a radical mechanism and completed on subnanosecond time scale at the dynamic active site with no net electron change in redox states of the flavin cofactor.

  10. Determining orientation and direction of DNA sequences

    DOEpatents

    Goodwin, Edwin H.; Meyne, Julianne

    2000-01-01

    Determining orientation and direction of DNA sequences. A method by which fluorescence in situ hybridization can be made strand specific is described. Cell cultures are grown in a medium containing a halogenated nucleotide. The analog is partially incorporated in one DNA strand of each chromatid. This substitution takes place in opposite strands of the two sister chromatids. After staining with the fluorescent DNA-binding dye Hoechst 33258, cells are exposed to long-wavelength ultraviolet light which results in numerous strand nicks. These nicks enable the substituted strand to be denatured and solubilized by heat, treatment with high or low pH aqueous solutions, or by immersing the strands in 2.times.SSC (0.3M NaCl+0.03M sodium citrate), to name three procedures. It is unnecessary to enzymatically digest the strands using Exo III or another exonuclease in order to excise and solubilize nucleotides starting at the sites of the nicks. The denaturing/solubilizing process removes most of the substituted strand while leaving the prereplication strand largely intact. Hybridization of a single-stranded probe of a tandem repeat arranged in a head-to-tail orientation will result in hybridization only to the chromatid with the complementary strand present.

  11. Direct numerical simulation of chemically reacting turbulence

    NASA Astrophysics Data System (ADS)

    Miyauchi, Toshio; Tanahashi, Mamoru

    In this paper, we present two results of direct numerical simulation of chemically reacting flows. One is direct numerical simulation of chemically reacting two-dimensional mixing layer and the other is direct numerical simulation of chemically reacting compressible isotropic turbulence. As for the mixing layer, a low Mach number approximation was used to take into account the variable density effects on the flow fields and to clarify the effects of heat release and density difference of a mean flow. In the case of density difference, expansion and baroclinic torque has a negative contribution to the local vorticity transport in the high density side and a positive contribution in the low density side which results in an asymmetric vortical structure structure. Thes density difference suppresses the growth of mixing layer and causes the overshoot of mean velocity only in the high density side which coincides with an experimental result. Coupling effects of heat release and desnity difference are also investigated. As for the homogeneous turbulence, fully compressible Navier-Stokes equations are solved to clarify the interaction between turbulence and chemical reaction in turbulent diffusion flame. The chemical reaction is suppressed by the increase of heat release because of the decrease of density and local Reynolds number. However, the decay of enstrophy with heat release is slower than that without heat release because of strong baroclinic torque which is generated near the reaction zone. Also, large amount of heat release causes increase in turbulent energy through the pressure dilatation term. The pressure dilatation term shows the periodic fluctuation which has an acoustic time scale. The fluctuation is enhanced by the heat release and travels in the turbulent field as pressure and dilatation waves.

  12. The fate of the chemical warfare agent during DNA extraction.

    PubMed

    Wilkinson, Della A; Hulst, Albert G; de Reuver, Leo P J; van Krimpen, Simon H; van Baar, Ben M L

    2007-11-01

    Forensic laboratories do not have the infrastructure to process or store contaminated DNA samples that have been recovered from a crime scene contaminated with chemical or biological warfare agents. Previous research has shown that DNA profiles can be recovered from blood exposed to several chemical warfare agents after the agent has been removed. The fate of four toxic agents, sulfur mustard, sodium 2-fluoroacetate, sarin, and diazinon, in a lysis buffer used in Promega DNA IQ extraction protocol was studied to determine if extraction would render the samples safe. Two independent analytical methods were used per agent, selected from GC-MS, 1H NMR, 19F NMR, (31)P NMR, or LC-ES MS. The methods were validated before use. Determinations were carried out in a semi-quantitative way, by direct comparison to standards. Agent levels in the elution buffer were found to be below the detectable limits for mustard, sarin, sodium 2-fluoroacetate or low (<0.02 mg/mL) for diazinon. Therefore, once extracted these DNA samples could be safely processed in a forensic laboratory.

  13. Chemical Space of DNA-Encoded Libraries.

    PubMed

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  14. Novel encoding methods for DNA-templated chemical libraries.

    PubMed

    Li, Gang; Zheng, Wenlu; Liu, Ying; Li, Xiaoyu

    2015-06-01

    Among various types of DNA-encoded chemical libraries, DNA-templated library takes advantage of the sequence-specificity of DNA hybridization, enabling not only highly effective DNA-templated chemical reactions, but also high fidelity in library encoding. This brief review summarizes recent advances that have been made on the encoding strategies for DNA-templated libraries, and it also highlights their respective advantages and limitations for the preparation of DNA-encoded libraries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Deficient repair of chemical adducts in alpha DNA of monkey cells

    SciTech Connect

    Zolan, M.E.; Cortopassi, G.A.; Smith, C.A.; Hanawalt, P.C.

    1982-03-01

    Researchers have examined excision repair of DNA damage in the highly repeated alpha DNA sequence of cultured African green monkey cells. Irradiation of cells with 254 nm ultraviolet light resulted in the same frequency of pyrimidine dimers in alpha DNA and the bulk of the DNA. The rate and extent of pyrimidine dimer removal, as judged by measurement of repair synthesis, was also similar for alpha DNA and bulk DNA. In cells treated with furocoumarins and long-wave-length ultraviolet light, however, repair synthesis in alpha DNA was only 30% of that in bulk DNA, although it followed the same time course. Researchers found that this reduced repair was not caused by different initial amounts of furocoumarin damage or by different sizes of repair patches, as researchers found these to be similar in the two DNA species. Direct quantification demonstrated that fewer furocoumarin adducts were removed from alpha DNA than from bulk DNA. In cells treated with another chemical DNA-damaging agent, N-acetoxy-2-acetylaminofluorene, repair synthesis in alpha DNA was 60% of that in bulk DNA. These results show that the repair of different kinds of DNA damage can be affected to different extents by some property of this tandemly repeated heterochromatic DNA. To our knowledge, this is the first demonstration in primate cells of differential repair of cellular DNA sequences.

  16. Extranucleosomal DNA Binding Directs Nucleosome Sliding by Chd1 ▿

    PubMed Central

    McKnight, Jeffrey N.; Jenkins, Katherine R.; Nodelman, Ilana M.; Escobar, Thelma; Bowman, Gregory D.

    2011-01-01

    Chd1- and ISWI-type chromatin remodelers can sense extranucleosomal DNA and preferentially shift nucleosomes toward longer stretches of available DNA. The DNA-binding domains of these chromatin remodelers are believed to be responsible for sensing extranucleosomal DNA and are needed for robust sliding, but it is unclear how these domains contribute to directional movement of nucleosomes. Here, we show that the DNA-binding domain of Chd1 is not essential for nucleosome sliding but is critical for centering mononucleosomes on short DNA fragments. Remarkably, nucleosome centering was achieved by replacing the native DNA-binding domain of Chd1 with foreign DNA-binding domains of Escherichia coli AraC or Drosophila melanogaster engrailed. Introducing target DNA sequences recognized by the foreign domains enabled the remodelers to rapidly shift nucleosomes toward these binding sites, demonstrating that these foreign DNA-binding domains dictated the direction of sliding. Sequence-directed sliding occluded the target DNA sequences on the nucleosome enough to promote release of the remodeler. Target DNA sequences were highly stimulatory at multiple positions flanking the nucleosome and had the strongest influence when separated from the nucleosome by 23 or fewer base pairs. These results suggest that the DNA-binding domain's affinity for extranucleosomal DNA is the key determinant for the direction that Chd1 shifts the nucleosome. PMID:21969605

  17. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  18. Concepts in Biochemistry: Chemical Synthesis of DNA.

    ERIC Educational Resources Information Center

    Caruthers, Marvin H.

    1989-01-01

    Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)

  19. Calculations of physical and chemical reactions with DNA in aqueous solution from Auger cascades

    SciTech Connect

    Wright, H.A.; Hamm, R.N.; Turner, J.E.; Howell, R.W.; Rao, D.V.; Sastry, K.S.R.

    1989-01-01

    Monte Carlo calculations are performed of the physical and chemical interactions in liquid water by electrons produced during Auger cascades resulting from the decay of various radionuclides. Estimates are also made of the number of direct physical and indirect chemical interactions that would be produced on DNA located near the decay site. 13 refs., 8 figs.

  20. Direct DNA binding by Brca1

    PubMed Central

    Paull, Tanya T.; Cortez, David; Bowers, Blair; Elledge, Stephen J.; Gellert, Martin

    2001-01-01

    The tumor suppressor Brca1 plays an important role in protecting mammalian cells against genomic instability, but little is known about its modes of action. In this work we demonstrate that recombinant human Brca1 protein binds strongly to DNA, an activity conferred by a domain in the center of the Brca1 polypeptide. As a result of this binding, Brca1 inhibits the nucleolytic activities of the Mre11/Rad50/Nbs1 complex, an enzyme implicated in numerous aspects of double-strand break repair. Brca1 displays a preference for branched DNA structures and forms protein–DNA complexes cooperatively between multiple DNA strands, but without DNA sequence specificity. This fundamental property of Brca1 may be an important part of its role in DNA repair and transcription. PMID:11353843

  1. Direct PCR Improves the Recovery of DNA from Various Substrates.

    PubMed

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Skuza, Pawel; Linacre, Adrian

    2015-11-01

    This study reports on the comparison of a standard extraction process with the direct PCR approach of processing low-level DNA swabs typical in forensic investigations. Varying concentrations of control DNA were deposited onto three commonly encountered substrates, brass, plastic, and glass, left to dry, and swabbed using premoistened DNA-free nylon FLOQswabs(™) . Swabs (n = 90) were either processed using the DNA IQ(™) kit or, for direct PCR, swab fibers (~2 mm(2) ) were added directly to the PCR with no prior extraction. A significant increase in the height of the alleles (p < 0.005) was observed when using the direct PCR approach over the extraction methodology when controlling for surface type and mass of DNA deposited. The findings indicate the potential use of direct PCR for increasing the PCR product obtained from low-template DNA samples in addition to minimizing contamination and saving resources.

  2. Chemical-induced DNA damage and human cancer risk.

    PubMed

    Poirier, Miriam C

    2012-10-01

    For more than 200 years human cancer induction has been known to be associated with a large variety of chemical exposures. Most exposures to chemical carcinogens occur as a result of occupation, pollution in the ambient environment, lifestyle choices, or pharmaceutical use. Scientific investigations have revealed that the majority of cancer causing chemicals, or chemical carcinogens, act through "genotoxic" or DNA damaging mechanisms, which involve covalent binding of the chemical to DNA (DNA adduct formation). Cancer-inducing exposures are typically frequent and/or chronic over years, and the accumulation of DNA damage or DNA adduct formation is considered to be a necessary requirement for tumor induction. Studies in animal models have indicated that the ability to reduce DNA damage will also result in reduction of tumor risk, leading to the hypothesis that individuals having the highest levels of DNA adducts may have an increased cancer risk, compared to individuals with the lowest levels of DNA adducts. Here we have reviewed twelve investigations showing 2- to 9-fold increased Relative Risks (RR) or Odds Ratios (OR) for cancer in (the 25% of) individuals having the highest DNA adduct levels, compared to (the 25% of) matched individuals with the lowest DNA adducts. These studies also provided preliminary evidence that multiple types of DNA adducts combined, or DNA adducts combined with other risk factors (such as infection or inflammation), may be associated with more than 10-fold higher cancer risks (RR = 34-60), compared to those found with a single carcinogen. Taken together the data suggest that a reduction in human DNA adduct level is likely to produce a reduction in human cancer risk.

  3. Directed Chemical Evolution with an Outsized Genetic Code

    PubMed Central

    Krusemark, Casey J.; Tilmans, Nicolas P.; Brown, Patrick O.; Harbury, Pehr B.

    2016-01-01

    The first demonstration that macromolecules could be evolved in a test tube was reported twenty-five years ago. That breakthrough meant that billions of years of chance discovery and refinement could be compressed into a few weeks, and provided a powerful tool that now dominates all aspects of protein engineering. A challenge has been to extend this scientific advance into synthetic chemical space: to enable the directed evolution of abiotic molecules. The problem has been tackled in many ways. These include expanding the natural genetic code to include unnatural amino acids, engineering polyketide and polypeptide synthases to produce novel products, and tagging combinatorial chemistry libraries with DNA. Importantly, there is still no small-molecule analog of directed protein evolution, i.e. a substantiated approach for optimizing complex (≥ 10^9 diversity) populations of synthetic small molecules over successive generations. We present a key advance towards this goal: a tool for genetically-programmed synthesis of small-molecule libraries from large chemical alphabets. The approach accommodates alphabets that are one to two orders of magnitude larger than any in Nature, and facilitates evolution within the chemical spaces they create. This is critical for small molecules, which are built up from numerous and highly varied chemical fragments. We report a proof-of-concept chemical evolution experiment utilizing an outsized genetic code, and demonstrate that fitness traits can be passed from an initial small-molecule population through to the great-grandchildren of that population. The results establish the practical feasibility of engineering synthetic small molecules through accelerated evolution. PMID:27508294

  4. Assay to detect chemically induced DNA repair in rat spermatocytes

    SciTech Connect

    Working, P.K.; Butterworth, B.E.

    1984-01-01

    An in vivo/in vitro DNA repair assay has been developed to quantitate chemically induced unscheduled DNA synthesis (UDS) in rat spermatocytes utilizing autoradiography. Male Fischer-344 rats were treated by i.p. injection or gavage with a variety of genotoxic agents dissolved in dimethyl sulfoxide, corn oil, or water. At selected times after treatment, spermatocytes were isolated by trypsin digestion of testes and cultured for 24 hr in the presence of /sup 3/H-thymidine. The direct-acting genotoxicants methyl methanesulfonate (MMS) and ethyl methanesulfonate and the chemotherapeutic agent cyclophosphamide (CPA) produced positive UDS responses in spermatocyes isolated l hr after i.p. injection. Other known genotoxicants--including dimethylnitrosamine, aflatoxin B/sub 1/, 2-acetylaminofluorene, 2, 6-dinitrotoluene, and l,6-dinitropyrene--failed to induce UDS, even with routes of administration and at times of exposure known to produce a positive response in hepatocytes. These results demonstrate that the in vivo/in vitro spermatocyte DNA repair assay may be useful as a predictive screen for germ cell mutagens.

  5. Enhancing DNA Crystal Durability through Chemical Crosslinking.

    PubMed

    Zhang, Diana; Paukstelis, Paul J

    2016-06-16

    Three-dimensional (3D) DNA crystals have been envisioned as a powerful tool for the positional control of biological and non-biological arrays on the nanoscale. However, most DNA crystals contain short duplex regions that can result in low thermal stability. Additionally, because DNA is a polyanion, DNA crystals often require high cation concentrations to maintain their integrity. Here, we demonstrate that a DNA alkylating mustard, bis(2-chloroethyl)amine, can form interstrand crosslinks within a model 3D DNA crystal. The crosslinking procedure did not alter crystal X-ray diffraction properties, but it did significantly improve the overall stability of the crystals under a variety of conditions. Crosslinked crystals showed enhanced stability at elevated temperature and were stable at Mg(2+) concentrations as low as 1 mm. Remarkably, the crosslinked crystals showed significant resistance to DNase I treatment, while also having improved longevity in tissue culture mediums. Characterization of the crosslinked species suggest that there are multiple crosslinking sites, but that the most prevalent interstrand crosslink involves an unpaired 3'-terminal guanosine residue. The improved stability of these DNA crystals suggests that simple treatment with alkylating reagents might be sufficient to stabilize crystals and other DNA constructs for improved functionality in biological and non-biological applications. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Guanine tracts enhance sequence directed DNA bends.

    PubMed Central

    Milton, D L; Casper, M L; Wills, N M; Gesteland, R F

    1990-01-01

    Synthetic DNA fragments were constructed to determine the effect of G tracts, in conjunction with periodically spaced A tracts, on DNA bends. Relative length measurements showed that the G tracts spaced at the half helical turn enhanced the DNA bend. When the G tract was interrupted with a thymine or shortened to one or two guanines, the relative lengths decreased. If the G tract was replaced with either an A tract or a T tract, the bend was cancelled. Replacement with a C tract decreased the relative length to that of a thymine interruption suggesting that bend enhancement due to G tracts requires A tracts on the same strand. PMID:2315040

  7. Preparation of yeast mitochondrial DNA for direct sequence analysis.

    PubMed

    Valach, Matus; Tomaska, Lubomir; Nosek, Jozef

    2008-08-01

    We describe two simple protocols for preparation of templates for direct sequencing of yeast mitochondrial DNA (mtDNA) by automatic DNA analyzers. The protocols work with a range of yeast species and yield a sufficient quantity and quality of the template DNA. In combination with primer-walking strategy, they can be used either as an alternative or a complementary approach to shot-gun sequencing of random fragment DNA libraries. We demonstrate that the templates are suitable for re-sequencing of the mtDNA for comparative analyses of intraspecific variability of yeast strains as well as for primary determination of the complete mitochondrial genome sequence.

  8. Melting transition of directly linked gold nanoparticle DNA assembly

    NASA Astrophysics Data System (ADS)

    Sun, Y.; Harris, N. C.; Kiang, C.-H.

    2005-05-01

    DNA melting and hybridization is a fundamental biological process as well as a crucial step in many modern biotechnology applications. DNA confined on surfaces exhibits a behavior different from that in free solutions. The system of DNA-capped gold nanoparticles exhibits unique phase transitions and represents a new class of complex fluids. Depending on the sequence of the DNA, particles can be linked to each other through direct complementary DNA sequences or via a ‘linker’ DNA, whose sequence is complementary to the sequence attached to the gold nanoparticles. We observed different melting transitions for these two distinct systems.

  9. DNA-encoded chemistry: enabling the deeper sampling of chemical space.

    PubMed

    Goodnow, Robert A; Dumelin, Christoph E; Keefe, Anthony D

    2017-02-01

    DNA-encoded chemical library technologies are increasingly being adopted in drug discovery for hit and lead generation. DNA-encoded chemistry enables the exploration of chemical spaces four to five orders of magnitude more deeply than is achievable by traditional high-throughput screening methods. Operation of this technology requires developing a range of capabilities including aqueous synthetic chemistry, building block acquisition, oligonucleotide conjugation, large-scale molecular biological transformations, selection methodologies, PCR, sequencing, sequence data analysis and the analysis of large chemistry spaces. This Review provides an overview of the development and applications of DNA-encoded chemistry, highlighting the challenges and future directions for the use of this technology.

  10. Turn-on DNA Damage Sensors for the Direct Detection of 8-Oxoguanine and Photoproducts in Native DNA

    PubMed Central

    Furman, Jennifer L.; Mok, Pui-Wing; Badran, Ahmed H.; Ghosh, Indraneel

    2011-01-01

    The integrity of the genetic information in all living organisms is constantly threatened by a variety of endogenous and environmental insults. To counter this risk, the DNA-damage response is employed for repairing lesions and maintaining genomic integrity. However, an aberrant DNA-damage response can potentially lead to genetic instability and mutagenesis, carcinogenesis, or cell death. To directly monitor DNA damage events in the context of native DNA, we have designed two new sensors utilizing genetically fragmented firefly luciferase (split luciferase). The sensors are comprised of a methyl-CpG binding domain (MBD) attached to one fragment of split luciferase for localizing the sensor to DNA (50–80% of the CpG dinucleotide sites in the genome are symmetrically methylated at cytosines), while a damage-recognition domain is attached to the complementary fragment of luciferase to probe adjacent nucleotides for lesions. Specifically, we utilized oxoguanine glycosylase 1 (OGG1) to detect 8-oxoguanine caused by exposure to reactive oxygen species and employed the damaged-DNA binding protein 2 (DDB2) for detection of pyrimidine dimer photoproducts induced by UVC light. These two sensors were optimized and validated using oligonucleotides, plasmids, and mammalian genomic DNA, as well as HeLa cells that were systematically exposed to a variety of environmental insults, demonstrating that this methodology utilizing MBD-directed DNA localization provides a simple, sensitive, and potentially general approach for the rapid profiling of specific chemical modifications associated with DNA damage and repair. PMID:21520929

  11. Detecting Chemically Modified DNA Bases Using Surface Enhanced Raman Spectroscopy.

    PubMed

    Barhoumi, Aoune; Halas, Naomi J

    2011-12-15

    Post-translational modifications of DNA- changes in the chemical structure of individual bases that occur without changes in the DNA sequence- are known to alter gene expression. They are believed to result in frequently deleterious phenotypic changes, such as cancer. Methylation of adenine, methylation and hydroxymethylation of cytosine, and guanine oxidation are the primary DNA base modifications identified to date. Here we show it is possible to use surface enhanced Raman spectroscopy (SERS) to detect these primary DNA base modifications. SERS detection of modified DNA bases is label-free and requires minimal additional sample preparation, reducing the possibility of additional chemical modifications induced prior to measurement. This approach shows the feasibility of DNA base modification assessment as a potentially routine analysis that may be further developed for clinical diagnostics.

  12. Label-free and selective photoelectrochemical detection of chemical DNA methylation damage using DNA repair enzymes.

    PubMed

    Wu, Yiping; Zhang, Bintian; Guo, Liang-Hong

    2013-07-16

    Exogenous chemicals may produce DNA methylation that is potentially toxic to living systems. Methylated DNA bases are difficult to detect with biosensors because the methyl group is small and chemically inert. In this report, a label-free photoelectrochemical sensor was developed for the selective detection of chemically methylated bases in DNA films. The sensor employed two DNA repair enzymes, human alkyladenine DNA glycosylase and human apurinic/apyrimidinic endonuclease, to convert DNA methylation sites in DNA films on indium tin oxide electrodes into strand breaks. A DNA intercalator, Ru(bpy)2(dppz)(2+) (bpy=2,2'-bipyridine, dppz = dipyrido[3,2-a:2',3'-c]phenazine) was then used as the photoelectrochemical signal indicator to detect the DNA strand breaks. Its photocurrent signal was found to correlate inversely with the amount of 3-methyladenines (metAde) produced with a methylating agent, methylmethane sulfonate (MMS). The sensor detected the methylated bases produced with as low as 1 mM MMS, at which concentration the amount of metAde on the sensor surface was estimated to be 0.5 pg, or 1 metAde in 1.6 × 10(5) normal bases. Other DNA base modification products, such as 5-methylcytosine and DNA adducts with ethyl and styrene groups did not attenuate the photocurrent, demonstrating good selectivity of the sensor. This strategy can be utilized to develop sensors for the detection of other modified DNA bases with specific DNA repair enzymes.

  13. How Can Plant DNA Viruses Evade siRNA-Directed DNA Methylation and Silencing?

    PubMed Central

    Pooggin, Mikhail M.

    2013-01-01

    Plants infected with DNA viruses produce massive quantities of virus-derived, 24-nucleotide short interfering RNAs (siRNAs), which can potentially direct viral DNA methylation and transcriptional silencing. However, growing evidence indicates that the circular double-stranded DNA accumulating in the nucleus for Pol II-mediated transcription of viral genes is not methylated. Hence, DNA viruses most likely evade or suppress RNA-directed DNA methylation. This review describes the specialized mechanisms of replication and silencing evasion evolved by geminiviruses and pararetoviruses, which rescue viral DNA from repressive methylation and interfere with transcriptional and post-transcriptional silencing of viral genes. PMID:23887650

  14. Chemically modified diamondoids as biosensors for DNA

    NASA Astrophysics Data System (ADS)

    Sivaraman, Ganesh; Fyta, Maria

    2014-03-01

    Understanding the interaction of biological molecules with materials is essential in view of the novel potential applications arising when these two are combined. To this end, we investigate the interaction of DNA with diamondoids, a broad family of tiny hydrogen-terminated diamond clusters with high technological potential. We model this interaction through quantum-mechanical computer simulations and focus on the hydrogen bonding possibilities of the different DNA nucleobases to the lower amine-modified diamondoids with respect to their relative distance and orientation. Our aim is to promote the binding between these two units, and probe this through the association energy, the electronic structure of the nucleobase-diamondoid system, and the specific role of their frontier orbitals. We discuss the relevance of our results in view of biosensing applications and specifically nanopore sequencing of DNA.

  15. Chemically driven traveling waves in DNA

    NASA Astrophysics Data System (ADS)

    Lipniacki, Tomasz

    1999-12-01

    The nonlinear mechanical model constructed in a previous paper [Nuovo Cimento D 20, 833 (1998)] is developed in order to study the dynamics of the DNA double helix. It is assumed that the hydrophobic interaction between subsequent base pairs may be influenced by a RNA polymerase. The Lagrangian, constructed on the basis of ``geometrical'' properties of the DNA molecule, depends on time and contains first and second derivatives of the twist angle. The energy dissipation term is added to the dynamical equations resulting from the Lagrange formalism. It is proved that the system has pulselike solitary wave solutions for which the dissipated energy is balanced by the energy pumped by the advancing RNA polymerase. The physical interpretation of our solution is the local untwisting of the DNA molecule during transcription of messenger RNA.

  16. Analytical Devices Based on Direct Synthesis of DNA on Paper.

    PubMed

    Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M

    2016-01-05

    This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.

  17. Typing DNA profiles from previously enhanced fingerprints using direct PCR.

    PubMed

    Templeton, Jennifer E L; Taylor, Duncan; Handt, Oliva; Linacre, Adrian

    2017-07-01

    Fingermarks are a source of human identification both through the ridge patterns and DNA profiling. Typing nuclear STR DNA markers from previously enhanced fingermarks provides an alternative method of utilising the limited fingermark deposit that can be left behind during a criminal act. Dusting with fingerprint powders is a standard method used in classical fingermark enhancement and can affect DNA data. The ability to generate informative DNA profiles from powdered fingerprints using direct PCR swabs was investigated. Direct PCR was used as the opportunity to generate usable DNA profiles after performing any of the standard DNA extraction processes is minimal. Omitting the extraction step will, for many samples, be the key to success if there is limited sample DNA. DNA profiles were generated by direct PCR from 160 fingermarks after treatment with one of the following dactyloscopic fingerprint powders: white hadonite; silver aluminium; HiFi Volcano silk black; or black magnetic fingerprint powder. This was achieved by a combination of an optimised double-swabbing technique and swab media, omission of the extraction step to minimise loss of critical low-template DNA, and additional AmpliTaq Gold(®) DNA polymerase to boost the PCR. Ninety eight out of 160 samples (61%) were considered 'up-loadable' to the Australian National Criminal Investigation DNA Database (NCIDD). The method described required a minimum of working steps, equipment and reagents, and was completed within 4h. Direct PCR allows the generation of DNA profiles from enhanced prints without the need to increase PCR cycle numbers beyond manufacturer's recommendations. Particular emphasis was placed on preventing contamination by applying strict protocols and avoiding the use of previously used fingerprint brushes. Based on this extensive survey, the data provided indicate minimal effects of any of these four powders on the chance of obtaining DNA profiles from enhanced fingermarks. Copyright © 2017

  18. Directional sliding of histone octamers caused by DNA bending

    NASA Astrophysics Data System (ADS)

    Wang, Peng-Ye; Li, Wei; Dou, Shuo-Xing; Xie, Ping

    2006-03-01

    Chromatin-remodeling complexes such as SWI/SNF and RSC of yeast can perturb the structure of nucleosomes in an ATP-dependent manner. Experimental results prove that this chromatin remodeling process involves DNA bending. We simulate the effect of DNA bending, caused by chromatin-remodeling complexes, on directional sliding of histone octamers by Brownian dynamics simulation. The simulation results show that, after a DNA loop being generated at the side of a nucleosome, the histone octamer slides towards this DNA loop until the loop disappears. The DNA loop size is an important factor affecting the process of directional sliding of the histone octamer. A model for directional sliding of histone octamers induced by chromatin-remodeling complexes is suggested. (This research was supported by National Natural Science Foundation of China, and the Innovation Project of the Chinese Academy of Sciences.) (Email: pywang@aphy.iphy.ac.cn)

  19. Metagenomic comparison of direct and indirect soil DNA extraction approaches.

    PubMed

    Delmont, Tom O; Robe, Patrick; Clark, Ian; Simonet, Pascal; Vogel, Timothy M

    2011-09-01

    Full pyrosequencing runs of both direct-extracted (high yield, low DNA size) and indirect-extracted DNA (low yield, high DNA size) from the same prairie soil show that the sequence distribution of the majority of the metabolic functions and species detected were statistically similar. Although some microbial functions differed at the 95% confidence interval in bootstrap analyses, the overall functional diversity was the same. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. DNA Charge Transport: From Chemical Principles to the Cell

    PubMed Central

    Arnold, Anna R.; Grodick, Michael A.; Barton, Jacqueline K.

    2016-01-01

    The DNA double helix has captured the imagination of many, bringing it to the forefront of biological research. DNA has unique features that extend our interest into areas of chemistry, physics, material science and engineering. Our laboratory has focused on studies of DNA charge transport (CT), wherein charges can efficiently travel long molecular distances through the DNA helix while maintaining an exquisite sensitivity to base pair π-stacking. Because DNA CT chemistry reports on the integrity of the DNA duplex, this property may be exploited to develop electrochemical devices to detect DNA lesions and DNA-binding proteins. Furthermore, studies now indicate that DNA CT may also be used in the cell by, for example, DNA repair proteins, as a cellular diagnostic, in order to scan the genome to localize efficiently to damage sites. In this review, we describe this evolution of DNA CT chemistry from the discovery of fundamental chemical principles to applications in diagnostic strategies and possible roles in biology. PMID:26933744

  1. A DNA-based assay for toxic chemicals in wastewater.

    PubMed

    Foreman, Amy L; Phillips, Leo; Kanellis, Vangelis G; Hammoudeh, Daoud; Naumann, Christoph; Wong, Henri; Chisari, Robert; Hibbert, D Brynn; Lee, Garry S H; Patra, Ronald; Julli, Moreno; Chapman, John; Cooke, A Roger; dos Remedios, Cristobal G

    2011-08-01

    Chemical toxicants, particularly metal ions, are a major contaminant in global waterways. Live-organism bioassays used to monitor chemical toxicants commonly involve measurements of activity or survival of a freshwater cladoceran (Ceriodaphnia dubia) or light emitted by the marine bacterium Vibrio fischeri, used in the commercial Microtox® bioassay. Here we describe a novel molecule-based assay system employing DNA as the chemical biosensor. Metals bind to DNA, causing structural changes that expel a bound (intercalated) fluorescent reporter dye. Analyses of test data using 48 wastewater samples potentially contaminated by metal ions show that the DNA-dye assay results correlate with those from C. dubia and Microtox bioassays. All three assays exhibit additive, antagonistic, and synergistic responses that cannot be predicted by knowing individual metal concentrations. Analyses of metals in these samples imply the presence of chemical toxicants other than metal ions. The DNA-dye assay is robust, has a 12-month shelf life, and is only slightly affected by sample pH in the range 4 to 9. The assay is completed in a matter of minutes, and its portability makes it well suited as a screening assay for use in the field. We conclude that the DNA-dye test is a surrogate bioassay suitable for screening chemical toxicity.

  2. Perturbation of DNA tertiary structure by physical and chemical carcinogens: effects on DNA repair processes.

    PubMed

    Pedrini, A M; Tornaletti, S; Barabino, S; Menichini, P; Fronza, G; Abbondandolo, A

    1989-01-01

    DNA within the cell is organized into higher-order structures characterized by negative supercoiling. Supercoiling is a property of any DNA molecule lacking ends capable of rotation. Parameters defining the properties of supercoiled DNA are significant for the description of the reactive state of DNA molecules. We have investigated whether physical and chemical DNA modifying agents alter the parameters describing the DNA tertiary structure. The variations in DNA tertiary structure of partially relaxed topoisomers obtained from plasmid DNA have been studied by one dimensional agarose gel electrophoresis, a technique allowing the measurement of alterations in the degree of supercoiling equivalent to fractions of superhelical turns. Unwinding angles of 8.5 degrees for pyrimidine dimers and of 8.5 degrees for acetyl-4-hydroxyaminoquinoline-I-oxide (Ac-4-HAQO) adducts have been determined by titrating for each topoisomers the number of damaged sites necessary to reduce the superhelical turns by one. Analogous unwinding was observed for topoisomers obtained from in vivo irradiated plasmid DNA. We have also shown that local alterations in DNA structure caused by UV irradiation inhibit bacterial type I DNA topoisomerases. In addition, we have demonstrated that E. coli mutants lacking DNA topoisomerase I are sensitive to UV light. The pronounced inhibition of DNA synthesis as well as the chromosome instability observed after UV irradiation of this strain, suggest that DNA topoisomerase I might be involved in those cellular responses elicited by the proximity of damaged bases to sites of active replication.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry

    PubMed Central

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve; Stakenborg, Tim; Dehaen, Wim; Leen, Volker; Hofkens, Johan; Neely, Robert K.

    2014-01-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes transalkylate DNA with the cofactor we tested (a readily prepared s-adenosyl-l-methionine analogue). PMID:24452797

  4. Super-resolution optical DNA Mapping via DNA methyltransferase-directed click chemistry.

    PubMed

    Vranken, Charlotte; Deen, Jochem; Dirix, Lieve; Stakenborg, Tim; Dehaen, Wim; Leen, Volker; Hofkens, Johan; Neely, Robert K

    2014-04-01

    We demonstrate an approach to optical DNA mapping, which enables near single-molecule characterization of whole bacteriophage genomes. Our approach uses a DNA methyltransferase enzyme to target labelling to specific sites and copper-catalysed azide-alkyne cycloaddition to couple a fluorophore to the DNA. We achieve a labelling efficiency of ∼70% with an average labelling density approaching one site every 500 bp. Such labelling density bridges the gap between the output of a typical DNA sequencing experiment and the long-range information derived from traditional optical DNA mapping. We lay the foundations for a wider-scale adoption of DNA mapping by screening 11 methyltransferases for their ability to direct sequence-specific DNA transalkylation; the first step of the DNA labelling process and by optimizing reaction conditions for fluorophore coupling via a click reaction. Three of 11 enzymes transalkylate DNA with the cofactor we tested (a readily prepared s-adenosyl-l-methionine analogue).

  5. Novel selection methods for DNA-encoded chemical libraries.

    PubMed

    Chan, Alix I; McGregor, Lynn M; Liu, David R

    2015-06-01

    Driven by the need for new compounds to serve as biological probes and leads for therapeutic development and the growing accessibility of DNA technologies including high-throughput sequencing, many academic and industrial groups have begun to use DNA-encoded chemical libraries as a source of bioactive small molecules. In this review, we describe the technologies that have enabled the selection of compounds with desired activities from these libraries. These methods exploit the sensitivity of in vitro selection coupled with DNA amplification to overcome some of the limitations and costs associated with conventional screening methods. In addition, we highlight newer techniques with the potential to be applied to the high-throughput evaluation of DNA-encoded chemical libraries.

  6. Noncanonical views of homology-directed DNA repair

    PubMed Central

    Verma, Priyanka; Greenberg, Roger A.

    2016-01-01

    DNA repair is essential to maintain genomic integrity and initiate genetic diversity. While gene conversion and classical nonhomologous end-joining are the most physiologically predominant forms of DNA repair mechanisms, emerging lines of evidence suggest the usage of several noncanonical homology-directed repair (HDR) pathways in both prokaryotes and eukaryotes in different contexts. Here we review how these alternative HDR pathways are executed, specifically focusing on the determinants that dictate competition between them and their relevance to cancers that display complex genomic rearrangements or maintain their telomeres by homology-directed DNA synthesis. PMID:27222516

  7. Chemical reactions directed Peptide self-assembly.

    PubMed

    Rasale, Dnyaneshwar B; Das, Apurba K

    2015-05-13

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly.

  8. Chemical Reactions Directed Peptide Self-Assembly

    PubMed Central

    Rasale, Dnyaneshwar B.; Das, Apurba K.

    2015-01-01

    Fabrication of self-assembled nanostructures is one of the important aspects in nanoscience and nanotechnology. The study of self-assembled soft materials remains an area of interest due to their potential applications in biomedicine. The versatile properties of soft materials can be tuned using a bottom up approach of small molecules. Peptide based self-assembly has significant impact in biology because of its unique features such as biocompatibility, straight peptide chain and the presence of different side chain functionality. These unique features explore peptides in various self-assembly process. In this review, we briefly introduce chemical reaction-mediated peptide self-assembly. Herein, we have emphasised enzymes, native chemical ligation and photochemical reactions in the exploration of peptide self-assembly. PMID:25984603

  9. Direct and indirect chemical exposure in children

    SciTech Connect

    Garrettson, L.K.

    1984-09-01

    Like adults, children are at risk from chemicals in the environment; unlike adults, the cause of their risk is due to developmental factors. Because organs such as the brain are developmentally incomplete in children, there is the potential for effects on maturation that are not seen in the adult. Environmental and occupational safety considerations need to include children because of the potential for toxins to be transported--for example, via clothing and the air we breathe.

  10. Direct surface-enhanced Raman scattering analysis of DNA duplexes.

    PubMed

    Guerrini, Luca; Krpetić, Željka; van Lierop, Danny; Alvarez-Puebla, Ramon A; Graham, Duncan

    2015-01-19

    The exploration of the genetic information carried by DNA has become a major scientific challenge. Routine DNA analysis, such as PCR, still suffers from important intrinsic limitations. Surface-enhanced Raman spectroscopy (SERS) has emerged as an outstanding opportunity for the development of DNA analysis, but its application to duplexes (dsDNA) has been largely hampered by reproducibility and/or sensitivity issues. A simple strategy is presented to perform ultrasensitive direct label-free analysis of unmodified dsDNA with the means of SERS by using positively charged silver colloids. Electrostatic adhesion of DNA promotes nanoparticle aggregation into stable clusters yielding intense and reproducible SERS spectra at nanogram level. As potential applications, we report the quantitative recognition of hybridization events as well as the first examples of SERS recognition of single base mismatches and base methylations (5-methylated cytosine and N6-methylated Adenine) in duplexes.

  11. A novel DNA selection and direct extraction process and its application in DNA recombination.

    PubMed

    Wang, An-Bang; Cheng, Chia-Wei; Lin, I-Chun; Lu, Fei-Yau; Tsai, Huai-Jen; Lin, Chiu-Chun; Yang, Chun-Hui; Pan, Po-Ting; Kuan, Chen-Chi; Chen, Yen-Chih; Lin, Yi-Wei; Chang, Chih-Ning; Wu, Yi-Hung; Kurniawan, Tetuko; Lin, Chii-Wann; Wo, Andrew M; Chen, Lin-Chi

    2011-02-01

    In the conventional bench-top approach, the DNA recombination process is time- and effort-consuming due to laborious procedures lasting from several hours to a day. A novel DNA selection and direct extraction process has been proposed, integrated and tested on chip. The integrative microfluidic chip can perform the whole procedure of DNA recombination, including DNA digestion, gel electrophoresis, DNA extraction and insert-vector ligation within 1 h. In this high-throughput design, the manual gel cutting was replaced by an automatic processing system that performed high-quality and high-recovery efficiency in DNA extraction process. With no need of gel-dissolving reagents and manipulation, the application of selection and direct extraction process could significantly eliminate the risks from UV and EtBr and also facilitate DNA recombination. Reliable output with high success rate of cloning has been achieved with a significant reduction in operational hazards, required materials, efforts and time.

  12. The p53 Protein is an Unusually Shaped Tetramer that Binds Directly to DNA

    NASA Astrophysics Data System (ADS)

    Friedman, Paula N.; Chen, Xinbin; Bargonetti, Jill; Prives, Carol

    1993-04-01

    We have analyzed the size and structure of native immunopurified human p53 protein. By using a combination of chemical crosslinking, gel filtration chromatography, and zonal velocity gradient centrifugation, we have determined that the predominant form of p53 in such preparations is a tetramer. The behavior of purified p53 in gels and sucrose gradients implies that the protein has an extended shape. Wild-type p53 has been shown to bind specifically to sites in cellular and viral DNA. We show in this study by Southwestern ligand blotting and by analysis of DNA-bound crosslinked p53 that p53 monomers, dimers, and tetramers can bind directly to DNA.

  13. Drug discovery with DNA-encoded chemical libraries.

    PubMed

    Buller, Fabian; Mannocci, Luca; Scheuermann, Jörg; Neri, Dario

    2010-09-15

    DNA-encoded chemical libraries represent a novel avenue for the facile discovery of small molecule ligands against target proteins of biological or pharmaceutical importance. Library members consist of small molecules covalently attached to unique DNA fragments that serve as amplifiable identification barcodes. This encoding allows the in vitro selection of ligands at subpicomolar concentrations from large library populations by affinity capture on a target protein of interest, in analogy to established technologies for the selection of binding polypeptides (e.g., antibodies). Different library formats have been explored by various groups, allowing the construction of chemical libraries comprising up to millions of DNA-encoded compounds. Libraries before and after selection have been characterized by PCR amplification of the DNA codes and subsequent relative quantification of library members using high-throughput sequencing. The most enriched compounds have then been further analyzed in biological assays, in the presence or in the absence of linked DNA. This article reviews experimental strategies used for the construction of DNA-encoded chemical libraries, revealing how selection, decoding, and hit validation technologies have been used for drug discovery programs.

  14. Mesoporous silica nanoparticles deliver DNA and chemicals into plants

    NASA Astrophysics Data System (ADS)

    Torney, François; Trewyn, Brian G.; Lin, Victor S.-Y.; Wang, Kan

    2007-05-01

    Surface-functionalized silica nanoparticles can deliver DNA and drugs into animal cells and tissues. However, their use in plants is limited by the cell wall present in plant cells. Here we show a honeycomb mesoporous silica nanoparticle (MSN) system with 3-nm pores that can transport DNA and chemicals into isolated plant cells and intact leaves. We loaded the MSN with the gene and its chemical inducer and capped the ends with gold nanoparticles to keep the molecules from leaching out. Uncapping the gold nanoparticles released the chemicals and triggered gene expression in the plants under controlled-release conditions. Further developments such as pore enlargement and multifunctionalization of these MSNs may offer new possibilities in target-specific delivery of proteins, nucleotides and chemicals in plant biotechnology.

  15. DNA-directed mutations. Leading and lagging strand specificity

    NASA Technical Reports Server (NTRS)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  16. DNA-directed mutations. Leading and lagging strand specificity

    NASA Technical Reports Server (NTRS)

    Sinden, R. R.; Hashem, V. I.; Rosche, W. A.

    1999-01-01

    The fidelity of replication has evolved to reproduce B-form DNA accurately, while allowing a low frequency of mutation. The fidelity of replication can be compromised, however, by defined order sequence DNA (dosDNA) that can adopt unusual or non B-DNA conformations. These alternative DNA conformations, including hairpins, cruciforms, triplex DNAs, and slipped-strand structures, may affect enzyme-template interactions that potentially lead to mutations. To analyze the effect of dosDNA elements on spontaneous mutagenesis, various mutational inserts containing inverted repeats or direct repeats were cloned in a plasmid containing a unidirectional origin of replication and a selectable marker for the mutation. This system allows for analysis of mutational events that are specific for the leading or lagging strands during DNA replication in Escherichia coli. Deletions between direct repeats, involving misalignment stabilized by DNA secondary structure, occurred preferentially on the lagging strand. Intermolecular strand switch events, correcting quasipalindromes to perfect inverted repeats, occurred preferentially during replication of the leading strand.

  17. RNA Splicing Factors and RNA-Directed DNA Methylation.

    PubMed

    Huang, Chao-Feng; Zhu, Jian-Kang

    2014-03-26

    RNA-directed histone and/or DNA modification is a conserved mechanism for the establishment of epigenetic marks from yeasts and plants to mammals. The heterochromation formation in yeast is mediated by RNAi-directed silencing mechanism, while the establishment of DNA methylation in plants is through the RNA-directed DNA methylation (RdDM) pathway. Recently, splicing factors are reported to be involved in both RNAi-directed heterochromatin formation in yeast and the RdDM pathway in plants. In yeast, splicing factors may provide a platform for facilitating the siRNA generation through an interaction with RDRC and thereby affect the heterochromatin formation, whereas in plants, various splicing factors seem to act at different steps in the RdDM pathway.

  18. Depurinating acylfulvene-DNA adducts: characterizing cellular chemical reactions of a selective antitumor agent.

    PubMed

    Gong, Jiachang; Vaidyanathan, V G; Yu, Xiang; Kensler, Thomas W; Peterson, Lisa A; Sturla, Shana J

    2007-02-21

    Acylfulvenes (AFs) are a class of semisynthetic agents with high toxicity toward certain tumor cells, and for one analogue, hydroxymethylacylfulvene (HMAF), clinical trials are in progress. DNA alkylation by AFs, mediated by bioreductive activation, is believed to contribute to cytotoxicity, but the structures and chemical properties of corresponding DNA adducts are unknown. This study provides the first structural characterization of AF-specific DNA adducts. In the presence of a reductive enzyme, alkenal/one oxidoreductase (AOR), AF selectively alkylates dAdo and dGuo in reactions with a monomeric nucleoside, as well as in reactions with naked or cellular DNA, with 3-alkyl-dAdo as the apparently most abundant AF-DNA adduct. Characterization of this adduct was facilitated by independent chemical synthesis of the corresponding 3-alkyl-Ade adduct. In addition, in naked or cellular DNA, evidence was obtained for the formation of an additional type of adduct resulting from direct conjugate addition of Ade to AF followed by hydrolytic cyclopropane ring-opening, indicating the potential for a competing reaction pathway involving direct DNA alkylation. The major AF-dAdo and AF-dGuo adducts are unstable under physiologically relevant conditions and depurinate to release an alkylated nucleobase in a process that has a half-life of 8.5 h for 3-alkyladenine and less than approximately 2 h for dGuo adducts. DNA alkylation further leads to single-stranded DNA cleavage, occurring exclusively at dGuo and dAdo sites, in a nonsequence-specific manner. In AF-treated cells that were transfected with either AOR or control vectors, the DNA adducts identified match those from in vitro studies. Moreover, a positive correlation was observed between DNA adduct levels and cell sensitivity to AF. The potential contributing roles of AOR-mediated bioactivation and adduct stability to the cytotoxicity of AF are discussed.

  19. Direct Visualization of DNA Replication Dynamics in Zebrafish Cells.

    PubMed

    Kuriya, Kenji; Higashiyama, Eriko; Avşar-Ban, Eriko; Tamaru, Yutaka; Ogata, Shin; Takebayashi, Shin-ichiro; Ogata, Masato; Okumura, Katsuzumi

    2015-12-01

    Spatiotemporal regulation of DNA replication in the S-phase nucleus has been extensively studied in mammalian cells because it is tightly coupled with the regulation of other nuclear processes such as transcription. However, little is known about the replication dynamics in nonmammalian cells. Here, we analyzed the DNA replication processes of zebrafish (Danio rerio) cells through the direct visualization of replicating DNA in the nucleus and on DNA fiber molecules isolated from the nucleus. We found that zebrafish chromosomal DNA at the nuclear interior was replicated first, followed by replication of DNA at the nuclear periphery, which is reminiscent of the spatiotemporal regulation of mammalian DNA replication. However, the relative duration of interior DNA replication in zebrafish cells was longer compared to mammalian cells, possibly reflecting zebrafish-specific genomic organization. The rate of replication fork progression and ori-to-ori distance measured by the DNA combing technique were ∼ 1.4 kb/min and 100 kb, respectively, which are comparable to those in mammalian cells. To our knowledge, this is a first report that measures replication dynamics in zebrafish cells.

  20. Twenty-five Years of DNA-Encoded Chemical Libraries.

    PubMed

    Neri, Dario

    2017-05-04

    Reference library: The availability of DNA-encoded chemical libraries containing billions of compounds facilitates the discovery of binding molecules for pharmaceutical applications and for investigating biological processes. This Special Issue highlights the use of this library technology and some of the latest developments in the field. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Coarse-grained molecular dynamics simulation of DNA translocation in chemically modified nanopores.

    PubMed

    Ramachandran, Abhijit; Guo, Qingjiang; Iqbal, Samir M; Liu, Yaling

    2011-05-19

    Solid-state nanopores provide a direct means to detect and analyze DNA and proteins. In a typical setup, the DNA molecules travel through a nanopore under electrophoretic voltage bias. The nanopore is sandwiched between two chambers that are filled with ionic solution. A major challenge in using solid-state nanopores for DNA sequencing and gene detection is to improve their selectivity and detection sensitivity. To achieve these goals, one solution is to functionalize the nanopores by chemically modifying the pore walls with silanes or nucleic acids. However, little is known about molecular interactions in functionalized nanopores. This paper presents DNA translocation dynamics and the mechanism of DNA sequencing in a functionalized nanopore through a coarse-grained molecular dynamics model. The DNA nucleotide is coarse-grained into two interaction sites: one site corresponds to the base group and the other encompasses the phosphate and sugar groups. The water molecules are included in the model implicitly through Langevin dynamics. The coarse-grained model immensely improves the computational efficiency while still capturing the essential translocation dynamics. The model characterizes important physical properties of functionalized nanopores such as the effective pore diameter and effect of biasing voltage on the DNA translocation dynamics. The model reveals a nonlinear relationship between translocation speed of DNA and applied voltage. Moreover, DNA translocation in nanopores functionalized with hairpin-loop (HPL) DNA and single-stranded DNA (ss-DNA) shows significant differences: a target DNA is found to translocate through a ss-DNA coated nanopore 9 times faster than through an HPL coated one at a bias of 100 mV, putatively from lower stiffness of ss-DNA than that for HPL. The DNA translocation speed is also largely influenced by interaction potential between the DNA and surface-tethered molecules. The results reveal that such selective translocation

  2. NTA directed protein nanopatterning on DNA Origami nanoconstructs.

    PubMed

    Shen, Wanqiu; Zhong, Hong; Neff, David; Norton, Michael L

    2009-05-20

    Precisely patterning proteins and other molecules at the nanoscale is crucial to future biosensing and optoelectronic applications. One- and two-dimensional DNA nanoconstructs have proven to be useful scaffolds for nanopatterning. This paper demonstrates the application of nitrilotriacetic acid (NTA) forming chelate complexes to localize histidine (His) tagged proteins via Ni(2+) ions onto DNA based structures. Particularly, enhanced green fluorescent protein (EGFP) was directed to specific surface locations on a designed DNA Origami nanoconstruct, and the resulting EGFP nanopattern was visualized using atomic force microscopy (AFM).

  3. DNA damage response pathway and replication fork stress during oligonucleotide directed gene editing.

    PubMed

    Bonner, Melissa; Strouse, Bryan; Applegate, Mindy; Livingston, Paula; Kmiec, Eric B

    2012-04-03

    Single-stranded DNA oligonucleotides (ODNs) can be used to direct the exchange of nucleotides in the genome of mammalian cells in a process known as gene editing. Once refined, gene editing should become a viable option for gene therapy and molecular medicine. Gene editing is regulated by a number of DNA recombination and repair pathways whose natural activities often lead to single- and double-stranded DNA breaks. It has been previously shown that introduction of a phosphorotioated ODN, designed to direct a gene-editing event, into cells results in the activation of γH2AX, a well-recognized protein biomarker for double-stranded DNA breakage. Using a single copy, integrated mutant enhanced green fluorescent protein (eGFP) gene as our target, we now demonstrate that several types of ODNs, capable of directing gene editing, also activate the DNA damage response and the post-translational modification of proliferating cell nuclear antigen (PCNA), a signature modification of replication stress. We find that the gene editing reaction itself leads to transient DNA breakage, perhaps through replication fork collapse. Unmodified specific ODNs elicit a lesser degree of replication stress than their chemically modified counterparts, but are also less active in gene editing. Modified phosphothioate oligonucleotides (PTOs) are detrimental irrespective of the DNA sequence. Such collateral damage may prove problematic for proliferation of human cells genetically modified by gene editing.

  4. Direct-to-PCR tissue preservation for DNA profiling.

    PubMed

    Sorensen, Amy; Berry, Clare; Bruce, David; Gahan, Michelle Elizabeth; Hughes-Stamm, Sheree; McNevin, Dennis

    2016-05-01

    Disaster victim identification (DVI) often occurs in remote locations with extremes of temperatures and humidities. Access to mortuary facilities and refrigeration are not always available. An effective and robust DNA sampling and preservation procedure would increase the probability of successful DNA profiling and allow faster repatriation of bodies and body parts. If the act of tissue preservation also released DNA into solution, ready for polymerase chain reaction (PCR), the DVI process could be further streamlined. In this study, we explored the possibility of obtaining DNA profiles without DNA extraction, by adding aliquots of preservative solutions surrounding fresh human muscle and decomposing human muscle and skin tissue samples directly to PCR. The preservatives consisted of two custom preparations and two proprietary solutions. The custom preparations were a salt-saturated solution of dimethyl sulfoxide (DMSO) with ethylenediaminetetraacetic (EDTA) and TENT buffer (Tris, EDTA, NaCl, Tween 20). The proprietary preservatives were DNAgard (Biomatrica(®)) and Tissue Stabilising Kit (DNA Genotek). We obtained full PowerPlex(®) 21 (Promega) and GlobalFiler(®) (Life Technologies) DNA profiles from fresh and decomposed tissue preserved at 35 °C for up to 28 days for all four preservatives. The preservative aliquots removed from the fresh muscle tissue samples had been stored at -80 °C for 4 years, indicating that long-term archival does not diminish the probability of successful DNA typing. Rather, storage at -80 °C seems to reduce PCR inhibition.

  5. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning

    PubMed Central

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L.

    2016-01-01

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  6. DNA Origami Reorganizes upon Interaction with Graphite: Implications for High-Resolution DNA Directed Protein Patterning.

    PubMed

    Rahman, Masudur; Neff, David; Green, Nathaniel; Norton, Michael L

    2016-10-31

    Although there is a long history of the study of the interaction of DNA with carbon surfaces, limited information exists regarding the interaction of complex DNA-based nanostructures with the important material graphite, which is closely related to graphene. In view of the capacity of DNA to direct the assembly of proteins and optical and electronic nanoparticles, the potential for combining DNA-based materials with graphite, which is an ultra-flat, conductive carbon substrate, requires evaluation. A series of imaging studies utilizing Atomic Force Microscopy has been applied in order to provide a unified picture of this important interaction of structured DNA and graphite. For the test structure examined, we observe a rapid destabilization of the complex DNA origami structure, consistent with a strong interaction of single-stranded DNA with the carbon surface. This destabilizing interaction can be obscured by an intentional or unintentional primary intervening layer of single-stranded DNA. Because the interaction of origami with graphite is not completely dissociative, and because the frustrated, expanded structure is relatively stable over time in solution, it is demonstrated that organized structures of pairs of the model protein streptavidin can be produced on carbon surfaces using DNA origami as the directing material.

  7. Chemical reagents for investigating the major groove of DNA.

    PubMed

    Rokita, S E

    2001-08-01

    Chemical modification provides an inexpensive and rapid method for characterizing the structure of DNA and its association with drugs and proteins. Numerous conformation-specific probes are available, but most investigations rely on only the most common and readily available of these. The major groove of DNA is typically characterized by reaction with dimethyl sulfate, diethyl pyrocarbonate, potassium permanganate, osmium tetroxide, and, quite recently, bromide with monoperoxysulfate. This commentary discusses the specificity of these reagents and their applications in protection, interference, and missing contact experiments.

  8. Direct Extraction and Amplification of DNA from Soil.

    ERIC Educational Resources Information Center

    Trevors, Jack T.; Leung, K.

    1998-01-01

    Presents an exercise that describes the direct extraction and purification of DNA from a small soil sample. Also discusses the subsequent amplification of a 343-bp Tn7 transposate A gene fragment (tnsA) from a strain of Pseudomonas aureofaciens 3732RNL11. Contains 21 references. (DDR)

  9. Direct Extraction and Amplification of DNA from Soil.

    ERIC Educational Resources Information Center

    Trevors, Jack T.; Leung, K.

    1998-01-01

    Presents an exercise that describes the direct extraction and purification of DNA from a small soil sample. Also discusses the subsequent amplification of a 343-bp Tn7 transposate A gene fragment (tnsA) from a strain of Pseudomonas aureofaciens 3732RNL11. Contains 21 references. (DDR)

  10. Chemically amplified laser direct-writing of aluminum

    NASA Astrophysics Data System (ADS)

    Tsao, J. Y.; Ehrlich, D. J.

    Laser microchemical direct writing has important advantages over other techniques for the deposition of thin-film patterns. Disadvantages, however, are lower throughput and the need to suppress competing processes such as gas phase nucleation of particles or substrate damage. Methods for increasing the overall speed of laser direct writing by microchemistry were investigated. A class of laser deposition techniques has emerged in which laser radiation is used only to enhance or to impede the initial nucleation of a thin film. In general, it is convenient to draw a distinction between nucleation barriers due to physical effects and those due to chemical effects. The first type of barrier is derived from surface tension. The laser deposits a pattern of heterogeneous catalyst to initiate a subsequent transformation that is chemically self-sustaining or autocatalytic. Experiments, in which the laser direct writing of patterned thin films of Al is chemically amplified by subsequent selective pyrolytic chemical vapor deposition are summarized.

  11. DNA micropatterning on polycrystalline diamond via one-step direct amination.

    PubMed

    Zhang, Guo-Jun; Song, Kwang-Soup; Nakamura, Yusuke; Ueno, Taro; Funatsu, Takashi; Ohdomari, Iwao; Kawarada, Hiroshi

    2006-04-11

    We report a novel method of one-step direct amination on polycrystalline diamond to produce functionalized surfaces for DNA micropatterning by photolithography. Polycrystalline diamond was exposed to UV irradiation in ammonia gas to generate amine groups directly. After patterning, optical microscopy confirmed that micropatterns covered with an Au mask were regular in size and shape. The regions outside the micropatterns were passivated with fluorine termination by C3F8 plasma, and the chemical changes on the two different surfaces--the amine groups inside the patterned regions by one-step direct amination and fluorine termination outside the patterned regions--were characterized by spatially resolved X-ray photoelectron spectroscopy (XPS). The patterned areas terminated with active amine groups were then immobilized with probe DNA via a bifunctional molecule. The sequence specificity was conducted by hybridizing fluorescently labeled target DNA to both complementary and noncomplementary probe DNA attached inside the micropatterns. The fluorescence micropatterns observed by epifluorescence microscopy corresponded to those imaged by optical microscopy. DNA hybridization and denaturation experiments on a DNA-modified diamond show that the diamond surfaces reveal superior stability. The influence of a different amination time on fluorescence intensity was compared. Different terminations as passivated layers were investigated, and as a result, fluorine termination points to the greatest signal-to-noise ratio.

  12. Selective Chemical Labeling of Natural T Modifications in DNA

    PubMed Central

    2015-01-01

    We present a chemical method to selectively tag and enrich thymine modifications, 5-formyluracil (5-fU) and 5-hydroxymethyluracil (5-hmU), found naturally in DNA. Inherent reactivity differences have enabled us to tag 5-fU chemoselectively over its C modification counterpart, 5-formylcytosine (5-fC). We rationalized the enhanced reactivity of 5-fU compared to 5-fC via ab initio quantum mechanical calculations. We exploited this chemical tagging reaction to provide proof of concept for the enrichment of 5-fU containing DNA from a pool that contains 5-fC or no modification. We further demonstrate that 5-hmU can be chemically oxidized to 5-fU, providing a strategy for the enrichment of 5-hmU. These methods will enable the mapping of 5-fU and 5-hmU in genomic DNA, to provide insights into their functional role and dynamics in biology. PMID:25946119

  13. Laccaic Acid A Is a Direct, DNA-competitive Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Fagan, Rebecca L.; Cryderman, Diane E.; Kopelovich, Levy; Wallrath, Lori L.; Brenner, Charles

    2013-01-01

    Methylation of cytosines in CpG dinucleotides is the predominant epigenetic mark on vertebrate DNA. DNA methylation is associated with transcriptional repression. The pattern of DNA methylation changes during development and with disease. Human DNA methyltransferase 1 (Dnmt1), a 1616-amino acid multidomain enzyme, is essential for maintenance of DNA methylation in proliferating cells and is considered an important cancer drug target. Using a fluorogenic, endonuclease-coupled DNA methylation assay with an activated form of Dnmt1 engineered to lack the replication foci targeting sequence domain, we discovered that laccaic acid A (LCA), a highly substituted anthraquinone natural product, is a direct inhibitor with a 310 nm Ki. LCA is competitive with the DNA substrate in in vitro methylation assays and alters the expression of methylated genes in MCF-7 breast cancer cells synergistically with 5-aza-2′-deoxycytidine. LCA represents a novel class of Dnmt-targeted molecular probes, with biochemical properties that allow it to distinguish between non DNA-bound and DNA-bound Dnmt1. PMID:23839987

  14. Direct visualization of supercoiled DNA molecules in solution.

    PubMed Central

    Adrian, M; ten Heggeler-Bordier, B; Wahli, W; Stasiak, A Z; Stasiak, A; Dubochet, J

    1990-01-01

    The shape of supercoiled DNA molecules in solution is directly visualized by cryo-electron microscopy of vitrified samples. We observe that: (i) supercoiled DNA molecules in solution adopt an interwound rather than a toroidal form, (ii) the diameter of the interwound superhelix changes from about 12 nm to 4 nm upon addition of magnesium salt to the solution and (iii) the partition of the linking deficit between twist and writhe can be quantitatively determined for individual molecules. Images Fig. 1. Fig. 2. Fig. 3. PMID:2265618

  15. Acanthamoeba DNA can be directly amplified from corneal scrapings.

    PubMed

    El-Sayed, Nagwa Mostafa; Younis, Mohamed Saad; Elhamshary, Azza Mohamed; Abd-Elmaboud, Amina Ibrahim; Kishik, Shereen Magdy

    2014-09-01

    This study evaluated the performance of direct amplification of Acanthamoeba-DNA bypassing DNA extraction in the diagnosis of Acanthamoeba keratitis in clinically suspected cases in comparison to direct microscopic examination and in vitro culture. Corneal scrapings were collected from 110 patients who were clinically suspected to have Acanthamoeba keratitis, 63 contact lens wearers (CLW), and 47 non-contact lens wearers (NCLW). Taken samples were subjected to direct microscopic examination, cultivation onto the non-nutrient agar plate surface seeded with Escherichia coli, and PCR amplification. The diagnostic performance of these methods was statistically compared. The results showed that Acanthamoeba infection was detected in 21 (19.1%) of clinically suspected cases (110); 17 (81%) of them were CLW and the remaining 4 (19%) positive cases were NCLW. Regarding the used diagnostic methods, it was found that direct amplification of Acanthamoeba DNA bypassing nucleic acid extraction was superior to microscopy and culture in which 21 cases (19.1%) were positive for Acanthamoeba by PCR compared to 19 positive cases by culture (17.3%) and one case (0.9%) by direct smear. The difference in detection rates between culture and direct smear was highly statistically significant (P = 0.001). On the other hand, there was no significant difference in detection rates between culture and PCR (P = 0.86). On using culture as the gold standard, PCR showed three false-positive samples that were negative by culture and one false-negative sample that was positive by culture. At the same time, direct smear showed 18 false-negative samples. The sensitivity, specificity, positive predictive value, negative predictive value, and diagnostic accuracy of PCR were 94.7, 96.7, 85.7, 98.9, and 96.4, respectively, while those of direct smear were 5.3, 100, 100, 83.5, and 83.6, respectively. In conclusion, direct amplification of Acanthamoeba-DNA bypassing DNA extraction is a reliable

  16. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior.

    PubMed

    Kearney, Cathal J; Lucas, Christopher R; O'Brien, Fergal J; Castro, Carlos E

    2016-07-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2D and 3D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargoes including drugs, antibodies, nucleic acid sequences, small molecules, and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing, and synthetic nanopore formation. Here, the advances in the DNA-origami field since its inception several years ago are reviewed with a focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior.

  17. DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

    PubMed Central

    Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

    2016-01-01

    DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

  18. The chemical stability of abasic RNA compared to abasic DNA.

    PubMed

    Küpfer, Pascal A; Leumann, Christian J

    2007-01-01

    We describe the synthesis of an abasic RNA phosphoramidite carrying a photocleavable 1-(2-nitrophenyl)ethyl (NPE) group at the anomeric center and a triisopropylsilyloxymethyl (TOM) group as 2'-O-protecting group together with the analogous DNA and the 2'-OMe RNA abasic building blocks. These units were incorporated into RNA-, 2'-OMe-RNA- and DNA for the purpose of studying their chemical stabilities towards backbone cleavage in a comparative way. Stability measurements were performed under basic conditions (0.1 M NaOH) and in the presence of aniline (pH 4.6) at 37 degrees C. The kinetics and mechanisms of strand cleavage were followed by High pressure liquid chromotography and ESI-MS. Under basic conditions, strand cleavage at abasic RNA sites can occur via beta,delta-elimination and 2',3'-cyclophosphate formation. We found that beta,delta-elimination was 154-fold slower compared to the same mechanism in abasic DNA. Overall strand cleavage of abasic RNA (including cyclophosphate formation) was still 16.8 times slower compared to abasic DNA. In the presence of aniline at pH 4.6, where only beta,delta-elimination contributes to strand cleavage, a 15-fold reduced cleavage rate at the RNA abasic site was observed. Thus abasic RNA is significantly more stable than abasic DNA. The higher stability of abasic RNA is discussed in the context of its potential biological role.

  19. The chemical stability of abasic RNA compared to abasic DNA

    PubMed Central

    Küpfer, Pascal A.; Leumann, Christian J.

    2007-01-01

    We describe the synthesis of an abasic RNA phosphoramidite carrying a photocleavable 1-(2-nitrophenyl)ethyl (NPE) group at the anomeric center and a triisopropylsilyloxymethyl (TOM) group as 2′-O-protecting group together with the analogous DNA and the 2′-OMe RNA abasic building blocks. These units were incorporated into RNA-, 2′-OMe-RNA- and DNA for the purpose of studying their chemical stabilities towards backbone cleavage in a comparative way. Stability measurements were performed under basic conditions (0.1 M NaOH) and in the presence of aniline (pH 4.6) at 37°C. The kinetics and mechanisms of strand cleavage were followed by High pressure liquid chromotography and ESI-MS. Under basic conditions, strand cleavage at abasic RNA sites can occur via β,δ-elimination and 2′,3′-cyclophosphate formation. We found that β,δ-elimination was 154-fold slower compared to the same mechanism in abasic DNA. Overall strand cleavage of abasic RNA (including cyclophosphate formation) was still 16.8 times slower compared to abasic DNA. In the presence of aniline at pH 4.6, where only β,δ-elimination contributes to strand cleavage, a 15-fold reduced cleavage rate at the RNA abasic site was observed. Thus abasic RNA is significantly more stable than abasic DNA. The higher stability of abasic RNA is discussed in the context of its potential biological role. PMID:17151071

  20. DNA Conjugation and DNA Directed Self-Assembly of Quantum Dots for Nanophotonic Applications

    NASA Astrophysics Data System (ADS)

    Samanta, Anirban

    Colloidal quantum dots (QDs) or semiconductor nanocrystals are often used to describe 2--20 nm solution processed nanoparticles of various semiconductor materials that display quantum confinement effects. Compared to traditional fluorescent organic dyes, QDs provide many advantages. For biological applications it is necessary to develop reliable methods to functionalize QDs with hydrophilic biomolecules so that they may maintain their stability and functionality in physiological conditions. DNA, a molecule that encodes genetic information, is arguably the smartest molecule that nature has ever produced and one of the most explored bio-macromolecules. QDs that are functionalized with DNA can potentially be organized with nanometer precision by DNA directed self-assembly, and the resulting arrangements may facilitate the display of novel optical properties. The goal of this dissertation was to achieve a robust reliable yet simple strategy to link DNA to QDs so that they can be used for DNA directed self assembly by which we can engineer their optical properties. Presented here is a series of studies to achieve this goal. First we demonstrate the aqueous synthesis of colloidal nanocrystal heterostructures consisting of the CdTe core encapsulated by CdS/ZnS or CdSe/ZnS shells using glutathione (GSH), a tripeptide, as the capping ligand. We next employed this shell synthesis strategy to conjugate PS-PO chimeric DNA to QDs at the time of shell synthesis. We synthesized a library of DNA linked QDs emitting from UV to near IR that are very stable in high salt concentrations. These DNA functionalized QDs were further site-specifically organized on DNA origami in desired patterns directed by DNA self-assembly. We further extended our capability to functionalize DNA to real IR emitting CdxPb 1-xTe alloyed QDs, and demonstrated their stability by self-assembling them on DNA origami. The photo-physical properties of the QDs were further engineered by attaching a QD and a gold

  1. Direct chemical evidence for eumelanin pigment from the Jurassic period.

    PubMed

    Glass, Keely; Ito, Shosuke; Wilby, Philip R; Sota, Takayuki; Nakamura, Atsushi; Bowers, C Russell; Vinther, Jakob; Dutta, Suryendu; Summons, Roger; Briggs, Derek E G; Wakamatsu, Kazumasa; Simon, John D

    2012-06-26

    Melanin is a ubiquitous biological pigment found in bacteria, fungi, plants, and animals. It has a diverse range of ecological and biochemical functions, including display, evasion, photoprotection, detoxification, and metal scavenging. To date, evidence of melanin in fossil organisms has relied entirely on indirect morphological and chemical analyses. Here, we apply direct chemical techniques to categorically demonstrate the preservation of eumelanin in two > 160 Ma Jurassic cephalopod ink sacs and to confirm its chemical similarity to the ink of the modern cephalopod, Sepia officinalis. Identification and characterization of degradation-resistant melanin may provide insights into its diverse roles in ancient organisms.

  2. Direct chemical evidence for eumelanin pigment from the Jurassic period

    PubMed Central

    Glass, Keely; Ito, Shosuke; Wilby, Philip R.; Sota, Takayuki; Nakamura, Atsushi; Bowers, C. Russell; Vinther, Jakob; Dutta, Suryendu; Summons, Roger; Briggs, Derek E. G.; Wakamatsu, Kazumasa; Simon, John D.

    2012-01-01

    Melanin is a ubiquitous biological pigment found in bacteria, fungi, plants, and animals. It has a diverse range of ecological and biochemical functions, including display, evasion, photoprotection, detoxification, and metal scavenging. To date, evidence of melanin in fossil organisms has relied entirely on indirect morphological and chemical analyses. Here, we apply direct chemical techniques to categorically demonstrate the preservation of eumelanin in two > 160 Ma Jurassic cephalopod ink sacs and to confirm its chemical similarity to the ink of the modern cephalopod, Sepia officinalis. Identification and characterization of degradation-resistant melanin may provide insights into its diverse roles in ancient organisms. PMID:22615359

  3. Directional emission from dye-functionalized plasmonic DNA superlattice microcavities.

    PubMed

    Park, Daniel J; Ku, Jessie C; Sun, Lin; Lethiec, Clotilde M; Stern, Nathaniel P; Schatz, George C; Mirkin, Chad A

    2017-01-17

    Three-dimensional plasmonic superlattice microcavities, made from programmable atom equivalents comprising gold nanoparticles functionalized with DNA, are used as a testbed to study directional light emission. DNA-guided nanoparticle colloidal crystallization allows for the formation of micrometer-scale single-crystal body-centered cubic gold nanoparticle superlattices, with dye molecules coupled to the DNA strands that link the particles together, in the form of a rhombic dodecahedron. Encapsulation in silica allows one to create robust architectures with the plasmonically active particles and dye molecules fixed in space. At the micrometer scale, the anisotropic rhombic dodecahedron crystal habit couples with photonic modes to give directional light emission. At the nanoscale, the interaction between the dye dipoles and surface plasmons can be finely tuned by coupling the dye molecules to specific sites of the DNA particle-linker strands, thereby modulating dye-nanoparticle distance (three different positions are studied). The ability to control dye position with subnanometer precision allows one to systematically tune plasmon-excition interaction strength and decay lifetime, the results of which have been supported by electrodynamics calculations that span length scales from nanometers to micrometers. The unique ability to control surface plasmon/exciton interactions within such superlattice microcavities will catalyze studies involving quantum optics, plasmon laser physics, strong coupling, and nonlinear phenomena.

  4. Directional emission from dye-functionalized plasmonic DNA superlattice microcavities

    PubMed Central

    Park, Daniel J.; Ku, Jessie C.; Sun, Lin; Lethiec, Clotilde M.; Stern, Nathaniel P.; Schatz, George C.; Mirkin, Chad A.

    2017-01-01

    Three-dimensional plasmonic superlattice microcavities, made from programmable atom equivalents comprising gold nanoparticles functionalized with DNA, are used as a testbed to study directional light emission. DNA-guided nanoparticle colloidal crystallization allows for the formation of micrometer-scale single-crystal body-centered cubic gold nanoparticle superlattices, with dye molecules coupled to the DNA strands that link the particles together, in the form of a rhombic dodecahedron. Encapsulation in silica allows one to create robust architectures with the plasmonically active particles and dye molecules fixed in space. At the micrometer scale, the anisotropic rhombic dodecahedron crystal habit couples with photonic modes to give directional light emission. At the nanoscale, the interaction between the dye dipoles and surface plasmons can be finely tuned by coupling the dye molecules to specific sites of the DNA particle-linker strands, thereby modulating dye–nanoparticle distance (three different positions are studied). The ability to control dye position with subnanometer precision allows one to systematically tune plasmon–excition interaction strength and decay lifetime, the results of which have been supported by electrodynamics calculations that span length scales from nanometers to micrometers. The unique ability to control surface plasmon/exciton interactions within such superlattice microcavities will catalyze studies involving quantum optics, plasmon laser physics, strong coupling, and nonlinear phenomena. PMID:28053232

  5. Transcriptional IL-15-Directed in vivo DC Targeting DNA Vaccine

    PubMed Central

    Tian, S; Liu, Z; Donahue, C; Noh, HS; Falo, LD; You, Z

    2009-01-01

    DC engineered in vitro by DNA encoding OVAhsp70 and IL-15 up-regulated their expressions of CD80, CD86, CCR7 and IL-15Rα and promoted their productions of IL-6, IL-12 and TNF-α. Transcriptional IL-15-directed in vivo DC targeting DNA vaccine encoding OVAhsp70 elicited long-lasting Th1 and CTL responses and anti-B16OVA activity. CD8 T cell-mediated primary tumor protection was abrogated by DC or CD4 T cell depletion during the induction phase of immune responses. However, CD4 T cell depletion during immunization did not impair CD8 T cell-dependent long-lasting tumor protection. Furthermore, in vivo DC-derived IL-15 exerted the enhancements of cellular and humoral immune responses and antitumor immunity elicited by OVAhsp70 DNA vaccine. Importantly, the potency of this novel DNA vaccine strategy was proven using a self/tumor Ag (TRP2) in a clinically relevant B16 melanoma model. These findings have implications for developing next generation DNA vaccines against cancers and infectious diseases in both healthy and CD4 deficient individuals. PMID:19727134

  6. DNA hybridization and ligation for directed colloidal assembly

    NASA Astrophysics Data System (ADS)

    Shyr, Margaret

    Colloidal assembly using DNA hybridization has been pursued as a means assemble non-conventional ordered colloidal structures. However, to date it is undetermined whether DNA hybridization can be used to achieve non-FCC colloidal crystals. Using microcontact printing techniques, we have fabricated covalently bound single stranded DNA (ssDNA) two-dimensional arrays on glass surfaces, which were used to direct the assembly of complementary DNA functionalized polystyrene colloids. Two of the hallmarks of DNA hybridization, sequence specificity and thermal reversibility, were demonstrated. Due to the periodicity of these arrays, laser diffraction was used to directly monitor these structures during assembly. To demonstrate the versatility of the 2D colloidal array assembled via DNA hybridization, a catalytic DNA sequence or DNAzyme was incorporated into the colloidal array system. By tethering the enzymatic strand to the patterned glass surface and the substrate strand to polystyrene colloids, we showed that the DNAzyme could prevent the assembly of the arrays when the required Pb2+ cofactor was provided. Attempts to assemble the colloid arrays and disassemble via the Pb2+-DNAzyme induced cleavage were unsuccessful, likely due to the incomplete cleavage of the multitude of hybridized linkages between each colloid and the surface. Since DNA is not only capable of catalyzing reactions, but also capable of being reacted upon by a variety of biological enzymes, we examined the use of DNA ligase as a means to control the assembly of DNA-functionalized colloids. A three-sequence linker system was used for the hybridization mediated assembly of colloids: one sequence was tethered to the surface of the glass slide or colloids, one was tethered to another colloid surface, and the linker sequence hybridizes simultaneously to both tethered sequences. Once hybridized, the two tethered fragments can be ligated using DNA ligase, resulting in a continuous sequence tethered on one end

  7. DNA-osmium complexes: recent developments in the operative chemical analysis of DNA epigenetic modifications.

    PubMed

    Okamoto, Akimitsu

    2014-09-01

    The development of a reaction for the detection of one epigenetic modification in a long DNA strand is a chemically and biologically challenging research subject. Herein, we report and discuss the formation of 5-methylcytosine-osmium complexes that are used as the basis for a bisulfite-free chemical assay for DNA methylation analysis. Osmium in the oxidized state reacts with C5-methylated pyrimidines in the presence of a bipyridine ligand to give a stable ternary complex. On the basis of this reaction, an adenine derivative with a tethered bipyridine moiety has been designed for sequence-specific osmium complex formation. Osmium complexation is then achieved by hybridization of a short DNA molecule containing this functional nucleotide to a target DNA sequence and results in the formation of a cross-linked structure. This novel concept of methylation-specific reaction, based on a straightforward chemical process, expands the range of methods available for the analysis of epigenetic modifications. Advantages of the described method include amplification-insensitive detection, 5-hydroxymethylcytosine complexation, and visualization through methylation-specific in situ hybridization.

  8. ESR study of the direct radiolysis of DNA, DNA-histones and DNA-intercalators complexes

    NASA Astrophysics Data System (ADS)

    Faucitano, A.; Buttafava, A.; Martinotti, F.; Pedraly-Noy, G.

    The nature of the radicals contributing to the room temperature spectrum of irradiated "dry" DNA, with special reference to the central structure, is discussed, and the thesis of their ionic origin tested by irradiation experiments with intercalators. The mechanism of spin transfer protein→DNA has been investigated through a comparative ESR study on the DNA-histones complex, the structureless random molecular mixture of the DNA-histones and the neat components. The yield of spin transfer is enhanced in the random mixture, presumably because of the greater efficiency of molecular contacts. Evidence of the scavenging of electrons by the thymine and cytosine bases, as a key mechanism for the spin transfer, has been obtained.

  9. Artificial Specific Binders Directly Recovered from Chemically Modified Nucleic Acid Libraries

    PubMed Central

    Kasahara, Yuuya; Kuwahara, Masayasu

    2012-01-01

    Specific binders comprised of nucleic acids, that is, RNA/DNA aptamers, are attractive functional biopolymers owing to their potential broad application in medicine, food hygiene, environmental analysis, and biological research. Despite the large number of reports on selection of natural DNA/RNA aptamers, there are not many examples of direct screening of chemically modified nucleic acid aptamers. This is because of (i) the inferior efficiency and accuracy of polymerase reactions involving transcription/reverse-transcription of modified nucleotides compared with those of natural nucleotides, (ii) technical difficulties and additional time and effort required when using modified nucleic acid libraries, and (iii) ambiguous efficacies of chemical modifications in binding properties until recently; in contrast, the effects of chemical modifications on biostability are well studied using various nucleotide analogs. Although reports on the direct screening of a modified nucleic acid library remain in the minority, chemical modifications would be essential when further functional expansion of nucleic acid aptamers, in particular for medical and biological uses, is considered. This paper focuses on enzymatic production of chemically modified nucleic acids and their application to random screenings. In addition, recent advances and possible future research are also described. PMID:23094139

  10. The direct peptide reactivity assay: selectivity of chemical respiratory allergens.

    PubMed

    Lalko, Jon F; Kimber, Ian; Gerberick, G Frank; Foertsch, Leslie M; Api, Anne Marie; Dearman, Rebecca J

    2012-10-01

    It is well known that some chemicals are capable of causing allergic diseases of the skin and respiratory tract. Commonly, though not exclusively, chemical allergens are associated with the selective development of skin or respiratory sensitization. The reason for this divergence is unclear, although it is hypothesized that the nature of interactions between the chemical hapten and proteins is influential. The direct peptide reactivity assay (DPRA) has been developed as a screen for the identification of skin-sensitizing chemicals, and here we describe the use of this method to explore whether differences exist between skin and respiratory allergens with respect to their peptide-binding properties. Known skin and respiratory sensitizers were reacted with synthetic peptides containing either lysine (Lys) or cysteine (Cys) for 24 h. The samples were analyzed by HPLC/UV, and the loss of peptide from the reaction mixture was expressed as the percent depletion compared with the control. The potential for preferential reactivity was evaluated by comparing the ratio of Lys to Cys depletion (Lys:Cys ratio). The results demonstrate that the majority of respiratory allergens are reactive in the DPRA, and that in contrast to most skin-sensitizing chemicals, preferentially react with the Lys peptide. These data suggest that skin and respiratory chemical allergens can result in different protein conjugates, which may in turn influence the quality of induced immune responses. Overall, these investigations reveal that the DPRA has considerable potential to be incorporated into tiered testing approaches for the identification and characterization of chemical respiratory allergens.

  11. Direct simulation of electron transfer reactions in DNA radical cations

    PubMed Central

    Steinbrecher, Thomas; Koslowski, Thorsten; Case, David A.

    2009-01-01

    The electron transfer properties of DNA radical cations are important in DNA damage and repair processes. Fast long-range charge transfer has been demonstrated experimentally, but the subtle influences that experimental conditions as well as DNA sequences and geometries have on the details of electron transfer parameters are still poorly understood. In this work, we employ an atomistic QM/MM approach, based on a one-electron tight binding Hamiltonian and a classical molecular mechanics forcefield, to conduct nanosecond length MD simulations of electron holes in DNA oligomers. Multiple spontaneous electron transfer events were observed in 100 ns simulations with neighbouring adenine or guanine bases. Marcus parameters of charge transfer could be extracted directly from the simulations. The reorganisation energy λ for hopping between neighbouring bases was found to be ca. 25 kcal/mol and charge transfer rates of 4.1×109 s−1 for AA hopping and 1.3×109 s−1 for GG hopping were obtained. PMID:19049302

  12. Chemical physics of DNA packaging in a nucleosome core particle

    NASA Astrophysics Data System (ADS)

    Spakowitz, Andrew; Sudhanshu, Bariz

    2008-03-01

    The fundamental unit of packaged DNA, the nucleosome core particle, contains 146 base pairs of DNA wrapped 1.7 times around a cationic protein complex called the histone octamer. A string of nucleosomes is organized into higher-order structures at several hierarchical levels to form chromatin, a remarkable complex that is compact yet maintains accessibility for gene expression. We develop a theoretical model of the nucleosome core particle in order to extract detailed quantitative information from single-molecule measurements of a single nucleosome under tension. We employ the wormlike chain model to describe the DNA strand as a thermally fluctuating polymer chain. The chain adsorbs on a spool that represents the histone octamer. This model is directly compared to single-molecule experiments conducted in Carlos Bustamante's lab; we find good agreement between our theory and the experimental data. Our model reveals the mechanism that underlies structural transitions that are apparent in the experimental measurements and predicts the conditions where these transitions occur. We proceed to construct a free energy surface to predict the dynamic response in a single-molecule experiment with a time-dependent rate of unwinding the nucleosome. The combination of single-molecule experiments and our theoretical modeling gives detailed information about the specific interactions between DNA and histone proteins.

  13. Transformations and Reconstructions of DNA-directed colloidal crystals

    NASA Astrophysics Data System (ADS)

    Crocker, John; Wang, Yifan; Jenkins, Ian; Sinno, Talid

    DNA is a versatile tool for directing the equilibrium self-assembly of nanoscopic and microscopic objects, but also for subsequently transforming them into new structures. In experiment, at high densities of long grafted DNA strands, and temperatures where the binding is reversible, these systems readily form colloidal crystals and colloidal clusters having a range of symmetries. For interactions that favor alloying between two differently-sized colloidal species, our experimental observations compare favorably to a simulation framework that predicts the equilibrium phase behavior, growth kinetics and solid-solid transitions. Overall, we find that this system recapitulates both ionic crystals and noble-metal alloys. We will discuss the crystallography of the alloy structures formed as well as the interesting Martensitic-type transformations and super-lattice reconstructions they undergo.

  14. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  15. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE INDUCED BY TOXIC INDUSTRIAL CHEMICALS

    EPA Science Inventory

    One of the reported effects for exposure to many of the toxic industrial chemicals is DNA damage. The present study describes a simple, rapid and innovative assay to detect DNA damage resulting from exposure of surrogate DNA to toxic industrial chemicals (acrolein, allylamine, ch...

  16. Direct facile screening of recombinant DNA vector constructs.

    PubMed

    Winnard, Paul T; Challa, Rushi; Bhujwalla, Zaver M; Raman, Venu

    2014-04-01

    Direct efficient facile screening of bacterial transformants with the goal of selecting, retrieving, and using recombinant DNA is exemplified by simple visual-based colorimetric inspections or fluorescent protein-based assays. We describe pRedScript, which introduces the constitutive expression of a very bright red fluorescent protein into transformants. On agar plates, red colonies are simply visualized in ambient white light in stark contrast to recombinant transformants that are white. In addition, the bright red fluorescence of the reporter protein can also be harnessed as a sensitive signal for screening bacterial promoters during the development of optimized fermentation conditions.

  17. Label free colorimetric and fluorimetric direct detection of methylated DNA based on silver nanoclusters for cancer early diagnosis.

    PubMed

    Dadmehr, Mehdi; Hosseini, Morteza; Hosseinkhani, Saman; Ganjali, Mohammad Reza; Sheikhnejad, Reza

    2015-11-15

    Epigenetic changes such as DNA methylation of CpG islands located in the promoter region of some tumor suppressor genes are very common in human diseases such as cancer. Detection of aberrant methylation pattern could serve as an excellent diagnostic approach. Recently, the direct detection of methylated DNA sequences without using chemical and enzymatic treatments or antibodies has received great deal of attentions. In this study, we report a colorimetric and fluorimetric technique for direct detection of DNA methylation. Here, the DNA is being used as an effective template for fluorescent silver nanoclusters formation without any chemical modification or DNA labeling. The sensitivity test showed that upon the addition of target methylated DNA, the fluorescence intensity is decreased in a linear range when the concentration of methylated DNA has increased from 2.0×10(-9) to 6.3 ×10(-7) M with the detection limit of 9.4×10(-10) M. The optical and fluorescence spectral behaviors were highly reproducible and clearly discriminated between unmethylated, methylated and even partially methylated DNA in CpG rich sequences. The results were also reproducible when the human plasma was present in our assay system.

  18. Multimodal plasmonic biosensing nanostructures prepared by DNA-directed immobilization of multifunctional DNA-gold nanoparticles.

    PubMed

    Tort, Nuria; Salvador, J-Pablo; Marco, M-Pilar

    2017-04-15

    Biofunctional multimodal plasmonic nanostructures suitable for multiplexed localized surface plasmon resonance (LSPR) biosensing have been created by DNA-directed immobilization (DDI) of two distinct multifunctional biohybrid gold nanoparticles. Gold nanoparticles (AuNP) of distinct sizes, and therefore showing distinct plasmon resonant peaks (RP), have been biofunctionalized and codified with two different single stranded-DNA (ssDNA) chains. One of these oligonucleotide chains has been specifically designed to direct each AuNP to a distinct location of the surface of a DNA microarray chip through specific hybridization with complementary oligonucleotide strands. Scanning Electron Microscopy (SEM) has been used to demonstrate selective immobilization of each AuNP on distinct spots. The second ssDNA chain of the AuNPs provides the possibility to introduce by hybridization distinct types of bioactive molecules or bioreceptors, on a reversible manner. In this work, hapten-oligonucleotide bioconjugate probes, with sequences complementary to the second ssDNA linked to the AuNP, have been synthesized and used to create multiplexed hapten-biofuncionalized plasmonic nanostructures. The oligonucleotide probes consist on anabolic androgenic steroid haptens (AAS) covalently linked to specifically designed oligonucleotide sequences. The biofunctionality of these plasmonic nanostructures has been demonstrated by fluorescent microarray immunoassay and LSPR measurements, recording the shift of the RP produced after the antibody binding to the corresponding hapten-oligonucleotide probes immobilized on the nanostructured surface. Preliminary data show that this approach could allow manufacturing multifunctional multimodal LSPR chips for multiplexed analysis of different substances reaching very good detectability. Thus, small molecular weigh, analytes such as stanozolol (ST,) could be detected at concentrations in the low nM range. The results here presented open the door for an

  19. Plasmid DNA Manufacturing for Indirect and Direct Clinical Applications.

    PubMed

    Schmeer, Marco; Buchholz, Tatjana; Schleef, Martin

    2017-10-01

    Plasmid DNA is currently gaining increasing importance for clinical research applications in gene therapy and genetic vaccination. For direct gene transfer into humans, good manufacturing practice (GMP)-grade plasmid DNA is mandatory. The same holds true if the drug substance contains a genetically modified cell, for example chimeric antigen receptor (CAR) T cells, where these cells as well as the contained plasmids are used. According to the responsible regulatory agencies, they have to be produced under full GMP. On the other hand, for GMP production of, for example, mRNA or viral vectors (lentiviral vectors, adeno-associated virus vectors, etc.), in many cases, High Quality Grade plasmid DNA is accepted as a starting material. The manufacturing process passes through different production steps. To ensure the right conditions are used for the plasmid, a pilot run must be conducted at the beginning. In this step, a followed upscaling with respect to reproducibility and influences on product quality is performed. Subsequently, a cell bank of the transformed productions strain is established and characterized. This cell bank is used for the cultivation process. After cell harvesting and lysis, several chromatography steps are conducted to receive a pure plasmid product. Depending on the respective required quality grade, the plasmid product is subject to several quality controls. The last step consists of formulation and filling of the product.

  20. Extracting evidence from forensic DNA analyses: future molecular biology directions.

    PubMed

    Budowle, Bruce; van Daal, Angela

    2009-04-01

    Molecular biology tools have enhanced the capability of the forensic scientist to characterize biological evidence to the point where it is feasible to analyze minute samples and achieve high levels of individualization. Even with the forensic DNA field's maturity, there still are a number of areas where improvements can be made. These include: enabling the typing of samples of limited quantity and quality; using genetic information and novel markers to provide investigative leads; enhancing automation with robotics, different chemistries, and better software tools; employing alternate platforms for typing DNA samples; developing integrated microfluidic/microfabrication devices to process DNA samples with higher throughput, faster turnaround times, lower risk of contamination, reduced labor, and less consumption of evidentiary samples; and exploiting high-throughput sequencing, particularly for attribution in microbial forensics cases. Knowledge gaps and new directions have been identified where molecular biology will likely guide the field of forensics. This review aims to provide a roadmap to guide those interested in contributing to the further development of forensic genetics.

  1. Direct quantification of mitochondria and mitochondrial DNA dynamics.

    PubMed

    Nomura, Yasutomo

    2012-11-01

    Mitochondria are known to be one of major organelles within a cell and to play a crucial role in many cellular functions. These organelles show the dynamic behaviors such as fusion, fission and the movement along cytoskeletal tracks. Besides mitochondria, mitochondrial DNA is also highly motile. Molecular analysis revealed that several proteins are involved in mitochondria and mitochondrial DNA dynamics. In addition to the degeneration of specific nerves with high energy requirement, mutation of genes coding these proteins results in metabolic diseases. During the last few years, a significant amount of relevant data has been obtained on molecular basis of these diseases but mitochondrial dynamics in cells derived from the patients is poorly understood. So far time-lapse fluorescence microscopy, fluorescence recovery after photo bleaching and image correlation methods have been used to study organellar motion. Especially, image correlation method has possibility to evaluate diffusion coefficient of mitochondria and mitochondrial DNA simultaneously and directly. When we search candidates for compounds that modulate mitochondrial dynamics by high throughput screening, image correlation method may be useful although the careful interpretation is required for crowded and heterogeneous environment within a cell.

  2. Direct attachment of DNA to semiconducting surfaces for biosensor applications.

    PubMed

    Fahrenkopf, Nicholas M; Shahedipour-Sandvik, Fatemeh; Tokranova, Natalya; Bergkvist, Magnus; Cady, Nathaniel C

    2010-11-01

    In this work we propose a novel method of immobilizing nucleic acids for field effect or high electron mobility transistor-based biosensors. The naturally occurring 5' terminal phosphate group on nucleic acids was used to coordinate with semiconductor and metal oxide surfaces. We demonstrate that DNA can be directly immobilized onto ZrO(2), AlGaN, GaN, and HfO(2) while retaining its ability to hybridize to target sequences with high specificity. By directly immobilizing the probe molecule to the sensor surface, as opposed to conventional crosslinking strategies, the number of steps in device fabrication is reduced. Furthermore, hybridization to target strands occurs closer to the sensor surface, which has the potential to increase device sensitivity by reducing the impact of the Debye screening length. Copyright © 2010 Elsevier B.V. All rights reserved.

  3. Chemical Mutagenesis of Vaccinia DNA Topoisomerase Lysine-167 Provides Insights to Catalysis of DNA Transesterification

    PubMed Central

    Yakovleva, Lyudmila; Shuman, Stewart

    2013-01-01

    Vaccinia DNA topoisomerase IB (TopIB) relaxes supercoils by forming and resealing a covalent DNA-(3′-phosphotyrosyl274)-enzyme intermediate. Conserved active site side chains promote the attack of Tyr274 on the scissile phosphodiester via transition state stabilization and general acid catalysis. Two essential side chains, Lys167 and Arg130, act in concert to protonate and expel the 5′-O leaving group. Here we gained new insights to catalysis through chemical mutagenesis of Lys167. Changing Lys167 to cysteine crippled the DNA cleavage and religation transesterification steps (kcl = 4.3 × 10−4 s−1; krel = 9 × 10−4 s−1). The transesterification activities of the K167C enzyme were revived by in vitro alkylation with 2-bromoethylamine (kcl = 0.031 s−1; krel ≥ 0.4 s−1) and 3-bromopropylamine (kcl = 0.013 s−1; krel = 0.22 s−1), which convert the cysteine to γ-thialysine and γ-thiahomolysine, respectively. These chemically installed lysine analogs were more effective than a genetically programmed arginine-167 substitution characterized previously. The modest differences in the transesterification rates of the 2-bromoethylamine and 3-bromopropylamine-treated enzymes highlights that TopIB is tolerant of a longer homolysine side chain for assembly of the active site and formation of the transition state. PMID:23317114

  4. DNA oxidation profiles of copper phenanthrene chemical nucleases

    PubMed Central

    Molphy, Zara; Slator, Creina; Chatgilialoglu, Chryssostomos; Kellett, Andrew

    2015-01-01

    The deleterious effects of metal-catalyzed reactive oxygen species (ROS) in biological systems can be seen in a wide variety of pathological conditions including cancer, cardiovascular disease, aging, and neurodegenerative disorder. On the other hand however, targeted ROS production in the vicinity of nucleic acids—as demonstrated by metal-activated bleomycin—has paved the way for ROS-active chemotherapeutic drug development. Herein we report mechanistic investigations into the oxidative nuclease activity and redox properties of copper(II) developmental therapeutics [Cu(DPQ)(phen)]2+ (Cu-DPQ-Phen), [Cu(DPPZ)(phen)]2+ (Cu-DPPZ-Phen), and [{Cu(phen)2}2(μ-terph)](terph) (Cu-Terph), with results being compared directly to Sigman's reagent [Cu(phen)2]2+ throughout (phen = 1,10-phenanthroline; DPQ = dipyridoquinoxaline; DPPZ = dipyridophenazine; Terph = terephthalate). Oxidative DNA damage was identified at the minor groove through use of surface bound recognition elements of methyl green, netropsin, and [Co(NH3)6]Cl3 that functioned to control complex accessibility at selected regions. ROS-specific scavengers and stabilizers were employed to identify the cleavage process, the results of which infer hydrogen peroxide produced metal-hydroxo or free hydroxyl radicals (•OH) as the predominant species. The extent of DNA damage owing to these radicals was then quantified through 8-oxo-2′-deoxyguanosine (8-oxo-dG) lesion detection under ELISA protocol with the overall trend following Cu-DPQ-Phen > Cu-Terph > Cu-Phen > Cu-DPPZ. Finally, the effects of oxidative damage on DNA replication processes were investigated using the polymerase chain reaction (PCR) where amplification of 120 base pair DNA sequences of varying base content were inhibited—particularly along A-T rich chains—through oxidative damage of template strands. PMID:25954741

  5. DNA Oxidation Profiles of Copper Phenanthrene Chemical Nucleases

    NASA Astrophysics Data System (ADS)

    Molphy, Zara; Slator, Creina; Chatgilialoglu, Chryssostomos; Kellett, Andrew

    2015-04-01

    The deleterious effects of metal-catalyzed reactive oxygen species (ROS) in biological systems can be seen in a wide variety of pathological conditions including cancer, cardiovascular disease, ageing, and neurodegenerative disorder. On the other hand however, targeted ROS production in the vicinity of nucleic acids - as demonstrated by metal-activated bleomycin - has paved the way for ROS-active chemotherapeutic drug development. Herein we report mechanistic investigations into the oxidative nuclease activity and redox properties of copper(II) developmental therapeutics [Cu(DPQ)(phen)]2+ (Cu-DPQ-Phen), [Cu(DPPZ)(phen)]2+ (Cu-DPPZ-Phen), and [{Cu(phen)2}2(μ-terph)](terph) (Cu-Terph), with results being compared directly to Sigman’s reagent [Cu(phen)2]2+ throughout (phen = 1,10-phenanthroline; DPQ = dipyridoquinoxaline; DPPZ = dipyridophenazine). Oxidative DNA damage was identified at the minor groove through use of surface bound recognition elements of methyl green, netropsin, and [Co(NH3)6]Cl3 that functioned to control complex accessibility at selected regions. ROS-specific scavengers and stabilisers were employed to identify the cleavage process, the results of which infer hydrogen peroxide produced metal-hydroxo or free hydroxyl radicals (•OH) as the predominant species. The extent of DNA damage owing to these radicals was then quantified through 8-oxo-2'-deoxyguanosine (8-oxo-dG) lesion detection under ELISA protocol with the overall trend following Cu-DPQ-Phen > Cu-Terph > Cu-Phen > Cu-DPPZ. Finally, the effects of oxidative damage on DNA replication processes were investigated using the polymerase chain reaction (PCR) where amplification of 120 base pair DNA sequences of varying base content were inhibited - particularly along A-T rich chains - through oxidative damage of the template strands.

  6. DNA profiles from clothing fibers using direct PCR.

    PubMed

    Blackie, Renée; Taylor, Duncan; Linacre, Adrian

    2016-09-01

    We report on the successful use of direct PCR amplification of single fibers from items of worn clothing. Items of clothing were worn throughout the course of a day, with the individual commencing regular activities. Single fibers were taken from the cuff of the clothing at regular intervals and amplified directly. The same areas were subjected to tape-lifting, and also amplified directly for comparison. The NGM™ kit that amplifies 15 STR loci plus amelogenin was used. A total of 35 single fiber samples were processed and analyzed from five items of clothing, with 81 % of samples returning a profile of 14 alleles or more. All tape-lift samples amplified directly produced DNA profiles of 15 alleles or more. The aim was to develop a simple, operational method that could be used routinely in forensic science casework and that has the potential to generate more complete profiles, which would not be detected using standard extraction methods on this type of sample. For ease of implementation, the process also adheres to standard methods with no increase in the cycle number.

  7. Direct Electrochemical Sensor for Fast Reagent-Free DNA Detection

    DTIC Science & Technology

    2004-11-17

    solution or in dry state. Background One of the fastest growing areas in DNA/RNA analysis technology is the development of DNA biosensors ...Typically, the biosensor employs immobilized oligonucleotides as the recognition element and measures specific binding processes of complementary DNA or...RNA at the biosensor interface. Figure 1 shows a schematic of a typical DNA biosensor with target DNA already bound to the probe/recognition DNA

  8. A DNA minor groove electronegative potential genome map based on photo-chemical probing.

    PubMed

    Lindemose, Søren; Nielsen, Peter Eigil; Hansen, Morten; Møllegaard, Niels Erik

    2011-08-01

    The double-stranded DNA of the genome contains both sequence information directly relating to the protein and RNA coding as well as functional and structural information relating to protein recognition. Only recently is the importance of DNA shape in this recognition process being fully appreciated, and it also appears that minor groove electronegative potential may contribute significantly in guiding proteins to their cognate binding sites in the genome. Based on the photo-chemical probing results, we have derived an algorithm that predicts the minor groove electronegative potential in a DNA helix of any given sequence. We have validated this model on a series of protein-DNA binding sites known to involve minor groove electrostatic recognition as well as on stable nucleosome core complexes. The algorithm allows for the first time a full minor groove electrostatic description at the nucleotide resolution of any genome, and it is illustrated how such detailed studies of this sequence dependent, inherent property of the DNA may reflect on genome organization, gene expression and chromosomal condensation.

  9. Direct reprogramming of mouse fibroblasts into cardiomyocytes with chemical cocktails.

    PubMed

    Fu, Yanbin; Huang, Chenwen; Xu, Xinxiu; Gu, Haifeng; Ye, Youqiong; Jiang, Cizhong; Qiu, Zilong; Xie, Xin

    2015-09-01

    The direct conversion, or transdifferentiation, of non-cardiac cells into cardiomyocytes by forced expression of transcription factors and microRNAs provides promising approaches for cardiac regeneration. However, genetic manipulations raise safety concerns and are thus not desirable in most clinical applications. The discovery of full chemically induced pluripotent stem cells suggest the possibility of replacing transcription factors with chemical cocktails. Here, we report the generation of automatically beating cardiomyocyte-like cells from mouse fibroblasts using only chemical cocktails. These chemical-induced cardiomyocyte-like cells (CiCMs) express cardiomyocyte-specific markers, exhibit sarcomeric organization, and possess typical cardiac calcium flux and electrophysiological features. Genetic lineage tracing confirms the fibroblast origin of these CiCMs. Further studies show the generation of CiCMs passes through a cardiac progenitor stage instead of a pluripotent stage. Bypassing the use of viral-derived factors, this proof of concept study lays a foundation for in vivo cardiac transdifferentiation with pharmacological agents and possibly safer treatment of heart failure.

  10. Direct chemical oxidation of hazardous and mixed wastes

    SciTech Connect

    Cooper, J.F.; Wang, F.; Farmer, J.

    1995-04-11

    Direct Chemical Oxidation (DCO) refers to the use of continuously-regenerated peroxydisulfate (with possible hydrogen peroxide supplements) to effect total destruction of organic wastes in aqueous media. The process does not involve toxic catalysts or the cogeneration of secondary wastes. Peroxydisulfate (S{sub 2}O{sub 8}{sup -2}) is one the strongest known chemical oxidants. It is routinely used in laboratory total carbon analyzers--uncatalyzed at 100{degrees}C, or catalyzed by UV, platinum or dissolved transition metal ions--and detects by oxidative destruction to 0.01 ppm levels. We report: (1) development of a waste treatment approach grounded in industrial electrolysis practice and in reaction rate data for Pt-initiated S{sub 2}O{sub 8}{sup -2} oxidation at 100{degrees}C; (2) tests of an electrochemical cell generating 1.5 N peroxydisulfate solutions; (3) lower-limit rate data for destruction of surrogates for chemical warfare agents and compounds with functional groups resisting oxidation; and (4) destruction of a Dowex{reg_sign} ion exchange resin, such as used in nuclear processing. This technique is particularly suited for applications in analytical laboratories or in manufacturing industries where the waste generation is low in volume, highly toxic or fugitive, or changing. The process may be tailored for destruction of very small to bulk quantities of chemical warfare agents.

  11. The invariance of the total direct DNA strand break yield

    SciTech Connect

    Bernal, M. A.; Almeida, C. E. de; Sampaio, C.; Incerti, S.; Champion, C.; Nieminen, P.

    2011-07-15

    Purpose: The invariance of the total direct strand break yield when DNA is irradiated by different types of particles and energies has been reported by previous works. This study is intended to explain the physical causes of this behavior. Methods: The geant4-dna extension of the geant4 general purpose Monte Carlo simulation toolkit has been used to determine direct strand break yields induced by protons and alpha particles impacting on a B-DNA geometrical model, including five organization levels of the human genetic material. The linear energy transfer (LET) of such particles ranges from 4.8 keV/{mu}m (10 MeV protons) to about 235 keV/{mu}m (2 MeV alpha particles), at 5.225 {mu}m depth (near the center of the region of interest). Direct total, single and double strand break probabilities have been determined in a liquid water homogeneous medium with a 1.06 g/cm {sup 3} density. The energetic spectra of single strand breaks (SSB), the number of energy deposition events, and the SSB/event ratio were determined. Results: The target-hit probability was found to be independent of both the type and the energy of the incident particle, even if this latter is a secondary electron. This probability is determined by the geometrical properties of the system. The total strand break yield and the number of energy deposition events required to reach a certain absorbed dose were found nearly independent of the type and energy of the incident ion (proton or alpha). In contrast, the double strand break (DSB) yield was found strongly dependent on the LET of the incident radiation. Conclusions: The SSB generation process is homogeneous and independent of the LET of the particles involved, at least within the proton and alpha particle energy range here studied. The target-hit probability is only determined by the ratio between the total volume occupied by targets and that of the ROI where the radiation deposits its energy. The maximum separation distance between two adjacent SSBs to

  12. Chemical Bonding Technology: Direct Investigation of Interfacial Bonds

    NASA Technical Reports Server (NTRS)

    Koenig, J. L.; Boerio, F. J.; Plueddemann, E. P.; Miller, J.; Willis, P. B.; Cuddihy, E. F.

    1986-01-01

    This is the third Flat-Plate Solar Array (FSA) Project document reporting on chemical bonding technology for terrestrial photovoltaic (PV) modules. The impetus for this work originated in the late 1970s when PV modules employing silicone encapsulation materials were undergoing delamination during outdoor exposure. At that time, manufacturers were not employing adhesion promoters and, hence, module interfaces in common with the silicone materials were only in physical contact and therefore easily prone to separation if, for example, water were to penetrate to the interfaces. Delamination with silicone materials virtually vanished when adhesion promoters, recommended by silicone manufacturers, were used. The activities related to the direct investigation of chemically bonded interfaces are described.

  13. Directly repeated sequences associated with pathogenic mitochondrial DNA deletions.

    PubMed Central

    Johns, D R; Rutledge, S L; Stine, O C; Hurko, O

    1989-01-01

    We determined the nucleotide sequences of junctional regions associated with large deletions of mitochondrial DNA found in four unrelated individuals with a phenotype of chronic progressive external ophthalmoplegia. In each patient, the deletion breakpoint occurred within a directly repeated sequence of 13-18 base pairs, present in different regions of the normal mitochondrial genome-separated by 4.5-7.7 kilobases. In two patients, the deletions were identical. When all four repeated sequences are compared, a consensus sequence of 11 nucleotides emerges, similar to putative recombination signals, suggesting the involvement of a recombinational event. Partially deleted and normal mitochondrial DNAs were found in all tissues examined, but in very different proportions, indicating that these mutations originated before the primary cell layers diverged. Images PMID:2813377

  14. Direct simulations of chemically reacting turbulent mixing layers, part 2

    NASA Technical Reports Server (NTRS)

    Metcalfe, Ralph W.; Mcmurtry, Patrick A.; Jou, Wen-Huei; Riley, James J.; Givi, Peyman

    1988-01-01

    The results of direct numerical simulations of chemically reacting turbulent mixing layers are presented. This is an extension of earlier work to a more detailed study of previous three dimensional simulations of cold reacting flows plus the development, validation, and use of codes to simulate chemically reacting shear layers with heat release. Additional analysis of earlier simulations showed good agreement with self similarity theory and laboratory data. Simulations with a two dimensional code including the effects of heat release showed that the rate of chemical product formation, the thickness of the mixing layer, and the amount of mass entrained into the layer all decrease with increasing rates of heat release. Subsequent three dimensional simulations showed similar behavior, in agreement with laboratory observations. Baroclinic torques and thermal expansion in the mixing layer were found to produce changes in the flame vortex structure that act to diffuse the pairing vortices, resulting in a net reduction in vorticity. Previously unexplained anomalies observed in the mean velocity profiles of reacting jets and mixing layers were shown to result from vorticity generation by baroclinic torques.

  15. Direct chemical oxidation of mixed or toxic wastes

    SciTech Connect

    Balazs, G B; Cooper, J F; Farmer, J C; Lewis, P

    1999-05-01

    Direct Chemical Oxidation (DCO) is an ambient-pressure, low-temperature (<100 C), and aqueous-based process for general-purpose destruction of the organic fraction of hazardous or mixed waste. It uses the peroxydisulfate anion (S{sub 2}O{sub 8}{sup 2{minus}}) in acid or base solutions. The byproduct of the oxidation reaction, typically sodium or ammonium hydrogen sulfate, may be recycled electrolytically to produce the oxidant. The oxidation kinetic reaction is first order with respect to the peroxydisulfate concentration, expressed in equivalents. The rate constant is constant for nearly all dissolved organic compounds: k{sub a} = 0.01 {+-} 0.005 min{sup {minus}1}. This reflects a common rate-determining step, which is the decomposition of the peroxydisulfate anion into the chemically active derivative, the sulfate radical anion, SO{sub 4}{sup {minus}}. This decomposition is promoted in DCO by raising the operating temperature into the range of 80-100 C. Rates are given for approximately 30 substances with diverse functional groups at low concentrations, and for a number of solid and liquid wastes typical of nuclear and chemical industries. The process has been scale up for treatment studies on chlorinated hydrocarbons, in which the hydrolysis of solvent mixtures was followed by oxidation of products in a series of stirred tank reactors. Cost estimates, safety considerations, and a comprehensive bibliography are given.

  16. Chemical Probes to Directly Profile Palmitoleoylation of Proteins.

    PubMed

    Zheng, Baohui; Jarugumilli, Gopala K; Chen, Baoen; Wu, Xu

    2016-11-03

    Palmitoleoylation is a unique fatty acylation of proteins in which a monounsaturated fatty acid, palmitoleic acid (C16:1), is covalently attached to a protein. Wnt proteins are known to be palmitoleoylated by cis-Δ9 palmitoleate at conserved serine residues. O-palmitoleoylation plays a critical role in regulating Wnt secretion, binding to the receptors, and in the dynamics of Wnt signaling. Therefore, protein palmitoleoylation is important in tissue homeostasis and tumorigenesis. Chemical probes based on saturated fatty acids, such as ω-alkynyl palmitic acid (Alk-14 or Alk-C16 ), have been used to study Wnt palmitoleoylation. However, such probes require prior conversion to the unsaturated fatty acid by stearoyl-CoA desaturase (SCD) in cells, significantly decreasing their selectivity and efficiency for studying protein palmitoleoylation. We synthesized and characterized ω-alkynyl cis- and trans-palmitoleic acids (cis- and trans-Alk-14:1) as chemical probes to directly study protein palmitoleoylation. We found that cis-Alk-14:1 could more efficiently label Wnt proteins in cells. Interestingly, the DHHC family of palmitoyl acyltransferases can charge both saturated and unsaturated fatty acids, potentially using both as acyl donors in protein palmitoylation and palmitoleoylation. Furthermore, proteomic analysis of targets labeled by these probes revealed new cis- and trans-palmitoleoylated proteins. Our studies provided new chemical tools and revealed new insights into palmitoleoylation in cell signaling.

  17. Metal ion-directed dynamic splicing of DNA through global conformational change by intramolecular complexation.

    PubMed

    Ihara, Toshihiro; Ohura, Hiroyuki; Shirahama, Chisato; Furuzono, Tomohiro; Shimada, Hiroshi; Matsuura, Hirotaka; Kitamura, Yusuke

    2015-04-07

    Chemically engineered DNAs—in which global conformation can be modulated in response to specific stimuli—could be allosteric functional DNAs themselves or work as a modulator of the functional nucleic acids such as DNAzymes and aptamers. Here, we show that two terpyridines built in the DNA backbone form a stable intramolecular 1:2 complex, [M(terpy)2](2+), with divalent transition metal ions. Upon complexation, the DNA conjugates adopt a Ω-shape structure, in which two distal sequences located outside the terpyridines connect with each other to form a continuous segment with a specific structure or sequence. Such a DNA structure is globally controlled by local metal complexation events that can be rationally designed based on general coordination chemistry. This method is regarded as metal ion-directed dynamic sequence edition or DNA splicing. DNAzymes with peroxidase-like activity can thus be regulated by several transition metal ions through sequence edition techniques based on the Ω-motif.

  18. A Multiprotein DNA Translocation Complex Directs Intramycelial Plasmid Spreading during Streptomyces Conjugation

    PubMed Central

    Thoma, Lina; Dobrowinski, Hyazinth; Finger, Constanze; Guezguez, Jamil; Linke, Dirk

    2015-01-01

    ABSTRACT Conjugative DNA transfer in mycelial Streptomyces is a unique process involving the transfer of a double-stranded plasmid from the donor into the recipient and the subsequent spreading of the transferred plasmid within the recipient mycelium. This process is associated with growth retardation of the recipient and manifested by the formation of circular inhibition zones, named pocks. To characterize the unique Streptomyces DNA transfer machinery, we replaced each gene of the conjugative 12.1-kbp Streptomyces venezuelae plasmid pSVH1, with the exception of the rep gene required for plasmid replication, with a hexanucleotide sequence. Only deletion of traB, encoding the FtsK-like DNA translocase, affected efficiency of the transfer dramatically and abolished pock formation. Deletion of spdB3, spd79, or spdB2 had a minor effect on transfer but prevented pock formation and intramycelial plasmid spreading. Biochemical characterization of the encoded proteins revealed that the GntR-type regulator TraR recognizes a specific sequence upstream of spdB3, while Orf108, SpdB2, and TraR bind to peptidoglycan. SpdB2 promoted spheroplast formation by T7 lysozyme and formed pores in artificial membranes. Bacterial two-hybrid analyses and chemical cross-linking revealed that most of the pSVH1-encoded proteins interacted with each other, suggesting a multiprotein DNA translocation complex of TraB and Spd proteins which directs intramycelial plasmid spreading. PMID:26015502

  19. Aptamer-Binding Directed DNA Origami Pattern for Logic Gates.

    PubMed

    Yang, Jing; Jiang, Shuoxing; Liu, Xiangrong; Pan, Linqiang; Zhang, Cheng

    2016-12-14

    In this study, an aptamer-substrate strategy is introduced to control programmable DNA origami pattern. Combined with DNA aptamer-substrate binding and DNAzyme-cutting, small DNA tiles were specifically controlled to fill into the predesigned DNA origami frame. Here, a set of DNA logic gates (OR, YES, and AND) are performed in response to the stimuli of adenosine triphosphate (ATP) and cocaine. The experimental results are confirmed by AFM imaging and time-dependent fluorescence changes, demonstrating that the geometric patterns are regulated in a controllable and programmable manner. Our approach provides a new platform for engineering programmable origami nanopatterns and constructing complex DNA nanodevices.

  20. Subfemtosecond directional control of chemical processes in molecules

    NASA Astrophysics Data System (ADS)

    Alnaser, Ali S.; Litvinyuk, Igor V.

    2017-02-01

    Laser pulses with a waveform-controlled electric field and broken inversion symmetry establish the opportunity to achieve directional control of molecular processes on a subfemtosecond timescale. Several techniques could be used to break the inversion symmetry of an electric field. The most common ones include combining a fundamental laser frequency with its second harmonic or with higher -frequency pulses (or pulse trains) as well as using few-cycle pulses with known carrier-envelope phase (CEP). In the case of CEP, control over chemical transformations, typically occurring on a timescale of many femtoseconds, is driven by much faster sub-cycle processes of subfemtosecond to few-femtosecond duration. This is possible because electrons are much lighter than nuclei and fast electron motion is coupled to the much slower nuclear motion. The control originates from populating coherent superpositions of different electronic or vibrational states with relative phases that are dependent on the CEP or phase offset between components of a two-color pulse. In this paper, we review the recent progress made in the directional control over chemical processes, driven by intense few-cycle laser pulses a of waveform-tailored electric field, in different molecules.

  1. Effects of Tilt Angle, DNA Concentration, and Surface Potential on Directed Alignment of DNA Molecule for the Application to Nanodevices

    NASA Astrophysics Data System (ADS)

    Kim, Hyung Jin; Hong, Byungyou

    2013-03-01

    This paper reports an efficient approach to control both the density and direction of highly aligned DNA molecules and thus DNA-templated gold nanowires (AuNWs) on Si chips. We utilized tilting method to prepare stretched DNA structures on SiO2/Si substrate and found important parameters in the alignment process that tilt angle, DNA concentration, and surface potential are controlled the density and structure of DNA aligned on the surface. In additional, we also can be directly connected DNA-templated AuNWs between two terminal electrodes on Si chips. This method also describes a simple way to form singled, bundled and networked DNA arrays on Si substrates.

  2. DNA-encoded chemical libraries: foundations and applications in lead discovery.

    PubMed

    Zimmermann, Gunther; Neri, Dario

    2016-11-01

    DNA-encoded chemical libraries have emerged as a powerful tool for hit identification in the pharmaceutical industry and in academia. Similar to biological display techniques (such as phage display technology), DNA-encoded chemical libraries contain a link between the displayed chemical building block and an amplifiable genetic barcode on DNA. Using routine procedures, libraries containing millions to billions of compounds can be easily produced within a few weeks. The resulting compound libraries are screened in a single test tube against proteins of pharmaceutical interest and hits can be identified by PCR amplification of DNA barcodes and subsequent high-throughput sequencing.

  3. DNA nanomechanics allows direct digital detection of complementary DNA and microRNA targets.

    PubMed

    Husale, Sudhir; Persson, Henrik H J; Sahin, Ozgur

    2009-12-24

    Techniques to detect and quantify DNA and RNA molecules in biological samples have had a central role in genomics research. Over the past decade, several techniques have been developed to improve detection performance and reduce the cost of genetic analysis. In particular, significant advances in label-free methods have been reported. Yet detection of DNA molecules at concentrations below the femtomolar level requires amplified detection schemes. Here we report a unique nanomechanical response of hybridized DNA and RNA molecules that serves as an intrinsic molecular label. Nanomechanical measurements on a microarray surface have sufficient background signal rejection to allow direct detection and counting of hybridized molecules. The digital response of the sensor provides a large dynamic range that is critical for gene expression profiling. We have measured differential expressions of microRNAs in tumour samples; such measurements have been shown to help discriminate between the tissue origins of metastatic tumours. Two hundred picograms of total RNA is found to be sufficient for this analysis. In addition, the limit of detection in pure samples is found to be one attomolar. These results suggest that nanomechanical read-out of microarrays promises attomolar-level sensitivity and large dynamic range for the analysis of gene expression, while eliminating biochemical manipulations, amplification and labelling.

  4. Direct qPCR quantification using the Quantifiler(®) Trio DNA quantification kit.

    PubMed

    Liu, Jason Yingjie

    2014-11-01

    The effectiveness of a direct quantification assay is essential to the adoption of the combined direct quantification/direct STR workflow. In this paper, the feasibility of using the Quantifiler(®) Trio DNA quantification kit for the direct quantification of forensic casework samples was investigated. Both low-level touch DNA samples and blood samples were collected on PE swabs and quantified directly. The increased sensitivity of the Quantifiler(®) Trio kit enabled the detection of less than 10pg of DNA in unprocessed touch samples and also minimizes the stochastic effect experienced by different targets in the same sample. The DNA quantity information obtained from a direct quantification assay using the Quantifiler(®) Trio kit can also be used to accurately estimate the optimal input DNA quantity for a direct STR amplification reaction. The correlation between the direct quantification results (Quantifiler(®) Trio kit) and the direct STR results (GlobalFiler™ PCR amplification kit(*)) for low-level touch DNA samples indicates that direct quantification using the Quantifiler(®) Trio DNA quantification kit is more reliable than the Quantifiler(®) Duo DNA quantification kit for predicting the STR results of unprocessed touch DNA samples containing less than 10pg of DNA.

  5. Surface invasive cleavage assay on a maskless light-directed diamond DNA microarray for genome-wide human SNP mapping.

    PubMed

    Nie, Bei; Yang, Min; Fu, Weiling; Liang, Zhiqing

    2015-07-07

    The surface invasive cleavage assay, because of its innate accuracy and ability for self-signal amplification, provides a potential route for the mapping of hundreds of thousands of human SNP sites. However, its performance on a high density DNA array has not yet been established, due to the unusual "hairpin" probe design on the microarray and the lack of chemical stability of commercially available substrates. Here we present an applicable method to implement a nanocrystalline diamond thin film as an alternative substrate for fabricating an addressable DNA array using maskless light-directed photochemistry, producing the most chemically stable and biocompatible system for genetic analysis and enzymatic reactions. The surface invasive cleavage reaction, followed by degenerated primer ligation and post-rolling circle amplification is consecutively performed on the addressable diamond DNA array, accurately mapping SNP sites from PCR-amplified human genomic target DNA. Furthermore, a specially-designed DNA array containing dual probes in the same pixel is fabricated by following a reverse light-directed DNA synthesis protocol. This essentially enables us to decipher thousands of SNP alleles in a single-pot reaction by the simple addition of enzyme, target and reaction buffers.

  6. Direct single-molecule observations of DNA unwinding by SV40 large tumor antigen under a negative DNA supercoil state.

    PubMed

    Takahashi, Shunsuke; Motooka, Shinya; Kawasaki, Shohei; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-Ichi; Hanaoka, Fumio; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2017-01-05

    Superhelices, which are induced by the twisting and coiling of double-helical DNA in chromosomes, are thought to affect transcription, replication, and other DNA metabolic processes. In this study, we report the effects of negative supercoiling on the unwinding activity of simian virus 40 large tumor antigen (SV40 TAg) at a single-molecular level. The supercoiling density of linear DNA templates was controlled using magnetic tweezers and monitored using a fluorescent microscope in a flow cell. SV40 TAg-mediated DNA unwinding under relaxed and negative supercoil states was analyzed by the direct observation of both single- and double-stranded regions of single DNA molecules. Increased negative superhelicity stimulated SV40 TAg-mediated DNA unwinding more strongly than a relaxed state; furthermore, negative superhelicity was associated with an increased probability of SV40 TAg-mediated DNA unwinding. These results suggest that negative superhelicity helps to regulate the initiation of DNA replication.

  7. New approach for direct chemical synthesis of hexagonal Co nanoparticles

    NASA Astrophysics Data System (ADS)

    Abel, Frank M.; Tzitzios, Vasilis; Hadjipanayis, George C.

    2016-02-01

    In this paper, we explore the possibility of producing hexagonal Cobalt nanoparticles, with high saturation magnetization by direct chemical synthesis. The nanoparticles were synthesized by reduction of anhydrous cobalt (II) chloride by NaBH4 in tetraglyme at temperatures in the range of 200-270 °C under a nitrogen-hydrogen atmosphere. The reactions were done at high temperatures to allow for the formation of as-made hexagonal cobalt. The size of the particles was controlled by the addition of different surfactants. The best magnetic properties so far were obtained on spherical hexagonal Co nanoparticles with an average size of 45 nm, a saturation magnetization of 143 emu/g and coercivity of 500 Oe. the saturation magnetization and coercivity were further improved by annealing the Co nanoparticles leading to saturation magnetization of 160 emu/g and coercivity of 540 Oe.

  8. DNA as a Versatile Chemical Component for Catalysis, Encoding, and Stereocontrol**

    PubMed Central

    Silverman, Scott K.

    2012-01-01

    DNA (deoxyribonucleic acid) is the genetic material common to all of Earth's organisms. Our biological understanding of DNA is extensive and well-exploited. In recent years, chemists have begun to develop DNA for nonbiological applications in catalysis, encoding, and stereochemical control. This Review summarizes key advances in these three exciting research areas, each of which takes advantage of a different subset of DNA's useful chemical properties. PMID:20669202

  9. Direct simulations of chemically reacting turbulent mixing layers

    NASA Technical Reports Server (NTRS)

    Riley, J. J.; Metcalfe, R. W.

    1984-01-01

    The report presents the results of direct numerical simulations of chemically reacting turbulent mixing layers. The work consists of two parts: (1) the development and testing of a spectral numerical computer code that treats the diffusion reaction equations; and (2) the simulation of a series of cases of chemical reactions occurring on mixing layers. The reaction considered is a binary, irreversible reaction with no heat release. The reacting species are nonpremixed. The results of the numerical tests indicate that the high accuracy of the spectral methods observed for rigid body rotation are also obtained when diffusion, reaction, and more complex flows are considered. In the simulations, the effects of vortex rollup and smaller scale turbulence on the overall reaction rates are investigated. The simulation results are found to be in approximate agreement with similarity theory. Comparisons of simulation results with certain modeling hypotheses indicate limitations in these hypotheses. The nondimensional product thickness computed from the simulations is compared with laboratory values and is found to be in reasonable agreement, especially since there are no adjustable constants in the method.

  10. Delay chemical master equation: direct and closed-form solutions.

    PubMed

    Leier, Andre; Marquez-Lago, Tatiana T

    2015-07-08

    The stochastic simulation algorithm (SSA) describes the time evolution of a discrete nonlinear Markov process. This stochastic process has a probability density function that is the solution of a differential equation, commonly known as the chemical master equation (CME) or forward-Kolmogorov equation. In the same way that the CME gives rise to the SSA, and trajectories of the latter are exact with respect to the former, trajectories obtained from a delay SSA are exact representations of the underlying delay CME (DCME). However, in contrast to the CME, no closed-form solutions have so far been derived for any kind of DCME. In this paper, we describe for the first time direct and closed solutions of the DCME for simple reaction schemes, such as a single-delayed unimolecular reaction as well as chemical reactions for transcription and translation with delayed mRNA maturation. We also discuss the conditions that have to be met such that such solutions can be derived.

  11. RNA-directed DNA methylation induces transcriptional activation in plants

    PubMed Central

    Shibuya, Kenichi; Fukushima, Setsuko; Takatsuji, Hiroshi

    2009-01-01

    A class-C floral homeotic gene of Petunia, pMADS3, is specifically expressed in the stamen and carpels of developing flowers. We had previously reported the ect-pMADS3 phenomenon in which introduction of a part of the pMADS3 genomic sequence, including intron 2, induces ectopic expression of endogenous pMADS3. Unlike transcriptional or posttranscriptional gene silencing triggered by the introduction of homologous sequences, this observation is unique in that the gene expression is up-regulated. In this study, we demonstrated that the ect-pMADS3 phenomenon is due to transcriptional activation based on RNA-directed DNA methylation (RdDM) occurring in a particular CG in a putative cis-element in pMADS3 intron 2. The CG methylation was maintained over generations, along with pMADS3 ectopic expression, even in the absence of RNA triggers. These results demonstrate a previously undescribed transcriptional regulatory mechanism that could lead to the generation of a transcriptionally active epiallele, thereby contributing to plant evolution. Our results also reveal a putative negative cis-element for organ-specific transcriptional regulation of class-C floral homeotic genes, which could be difficult to identify by other approaches. PMID:19164525

  12. Analysis of DNA-protein complexes induced by chemical carcinogens

    SciTech Connect

    Costa, M. )

    1990-11-01

    DNA-protein complexes induced in intact cells by chromate have been isolated and compared with those formed by other agents such as cis-platinum. Actin has been identified as one of the major proteins that is complexed to the DNA by chromate based upon a number of criteria including, a molecular weight and isoelectric point identical to actin, positive reaction with actin polyclonal antibody, and proteolytic mapping. Chromate and cis-platinum both complex proteins of very similar molecular weight and isoelectric points and these complexes can be disrupted by exposure to chelating or reducing agents. These results suggest that the metal itself is participating in rather than catalyzing the formation of a DNA-protein complex. An antiserum which was raised to chromate-induced DNA-protein complexes reacted primarily with a 97,000 protein that could not be detected by silver staining. Western blots and slot blots were utilized to detect p97 DNA-protein complexes formed by cis-platinum, UV, formaldehyde, and chromate. Other work in this area, involving studying whether DNA-protein complexes are formed in actively transcribed DNA compared with genetically inactive DNA, is discussed. Methods to detect DNA-protein complexes, the stability and repair of these lesions, and characterization of DNA-protein complexes are reviewed. Nuclear matrix proteins have been identified as a major substrate for the formation of DNA-protein complexes and these findings are also reviewed.

  13. Ku antigen-DNA conformation determines the activation of DNA-dependent protein kinase and DNA sequence-directed repression of mouse mammary tumor virus transcription.

    PubMed

    Giffin, W; Gong, W; Schild-Poulter, C; Haché, R J

    1999-06-01

    Mouse mammary tumor virus (MMTV) transcription is repressed by DNA-dependent protein kinase (DNA-PK) through a DNA sequence element, NRE1, in the viral long terminal repeat that is a sequence-specific DNA binding site for the Ku antigen subunit of the kinase. While Ku is an essential component of the active kinase, how the catalytic subunit of DNA-PK (DNA-PKcs) is regulated through its association with Ku is only beginning to be understood. We report that activation of DNA-PKcs and the repression of MMTV transcription from NRE1 are dependent upon Ku conformation, the manipulation of DNA structure by Ku, and the contact of Ku80 with DNA. Truncation of one copy of the overlapping direct repeat that comprises NRE1 abrogated the repression of MMTV transcription by Ku-DNA-PKcs. Remarkably, the truncated element was recognized by Ku-DNA-PKcs with affinity similar to that of the full-length element but was unable to promote the activation of DNA-PKcs. Analysis of Ku-DNA-PKcs interactions with DNA ends, double- and single-stranded forms of NRE1, and the truncated NRE1 element revealed striking differences in Ku conformation that differentially affected the recruitment of DNA-PKcs and the activation of kinase activity.

  14. PNA Directed Sequence Addressed Self-Assembly of DNA Nanostructures

    NASA Astrophysics Data System (ADS)

    Nielsen, Peter E.

    2008-10-01

    Peptide nucleic acids (PNA) can be designed to target duplex DNA with very high sequence specificity and efficiency via various binding modes. We have designed three domain PNA clamps, that bind stably to predefined decameric homopurine targets in large dsDNA molecules and via a third PNA domain sequence specifically recognize another PNA oligomer. We describe how such three domain PNAs have utility for assembling dsDNA grid and clover leaf structures, and in combination with SNAP-tag technology of protein dsDNA structures.

  15. Chemically directed assembly of nanoparticles for material and biological applications

    NASA Astrophysics Data System (ADS)

    Park, Myoung-Hwan

    The unique electronic, magnetic, and optical properties of nanoparticles (NPs) make them useful building blocks for nanodevices and biofabrication. Site-selective immobilization/deposition of NPs on surfaces at desired positions is an important fabrication step in realizing the potential of nanomaterials in these applications. In this thesis, my research has focused on developing new strategies for mono- and multilayered-NP deposition on surfaces, increasing the stability of NP-assembles upon various surfaces for practical use of NP-based devices. Chemically directed dithiocarbamate binding of amine groups to NPs in the presence of CS2 was used for enhancing the robustness of NP assembles. Such patterning methodologies have allowed me to use site-directed NP immobilization in applications as diverse as microcontact printing, nanomolding in capillaries, nanoimprint lithography, and photolithography. Also, I have developed a simple and reliable one-step technique to form robust dendrimer-NP nanocomposites using dithiocarbamate-based chemistry. These composites are able to encapsulate and release various therapeutics, providing controllable sustained release and to separate small molecules and biomacromolecules.

  16. Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles.

    PubMed

    Liandris, Emmanouil; Gazouli, Maria; Andreadou, Margarita; Comor, Mirjana; Abazovic, Nadica; Sechi, Leonardo A; Ikonomopoulos, John

    2009-09-01

    Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 microl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples.

  17. DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

    PubMed

    Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

    2017-01-01

    Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. Direct Evidence for the Formation of Precatenanes during DNA Replication.

    PubMed

    Cebrián, Jorge; Castán, Alicia; Martínez, Víctor; Kadomatsu-Hermosa, Maridian J; Parra, Cristina; Fernández-Nestosa, María José; Schaerer, Christian; Hernández, Pablo; Krimer, Dora B; Schvartzman, Jorge B

    2015-05-29

    The dynamics of DNA topology during replication are still poorly understood. Bacterial plasmids are negatively supercoiled. This underwinding facilitates strand separation of the DNA duplex during replication. Leading the replisome, a DNA helicase separates the parental strands that are to be used as templates. This strand separation causes overwinding of the duplex ahead. If this overwinding persists, it would eventually impede fork progression. In bacteria, DNA gyrase and topoisomerase IV act ahead of the fork to keep DNA underwound. However, the processivity of the DNA helicase might overcome DNA gyrase and topoisomerase IV. It was proposed that the overwinding that builds up ahead of the fork could force it to swivel and diffuse this positive supercoiling behind the fork where topoisomerase IV would also act to maintain replicating the DNA underwound. Putative intertwining of sister duplexes in the replicated region are called precatenanes. Fork swiveling and the formation of precatenanes, however, are still questioned. Here, we used classical genetics and high resolution two-dimensional agarose gel electrophoresis to examine the torsional tension of replication intermediates of three bacterial plasmids with the fork stalled at different sites before termination. The results obtained indicated that precatenanes do form as replication progresses before termination.

  19. An Overview of Chemical Processes That Damage Cellular DNA: Spontaneous Hydrolysis, Alkylation, and Reactions with Radicals

    PubMed Central

    Gates, Kent S.

    2009-01-01

    The sequence of heterocyclic bases on the interior of the DNA double helix constitutes the genetic code that drives the operation of all living organisms. With this said, it is not surprising that chemical modification of cellular DNA can have profound biological consequences. Therefore, the organic chemistry of DNA damage is fundamentally important to diverse fields including medicinal chemistry, toxicology, and biotechnology. This review is designed to provide a brief overview of the common types of chemical reactions that lead to DNA damage under physiological conditions. PMID:19757819

  20. Mechano-chemical selections of two competitive unfolding pathways of a single DNA i-motif

    NASA Astrophysics Data System (ADS)

    Xu, Yue; Chen, Hu; Qu, Yu-Jie; Artem, K. Efremov; Li, Ming; Ouyang, Zhong-Can; Liu, Dong-Sheng; Yan, Jie

    2014-06-01

    The DNA i-motif is a quadruplex structure formed in tandem cytosine-rich sequences in slightly acidic conditions. Besides being considered as a building block of DNA nano-devices, it may also play potential roles in regulating chromosome stability and gene transcriptions. The stability of i-motif is crucial for these functions. In this work, we investigated the mechanical stability of a single i-motif formed in the human telomeric sequence 5'-(CCCTAA)3CCC, which revealed a novel pH and loading rate-dependent bimodal unfolding force distribution. Although the cause of the bimodal unfolding force species is not clear, we proposed a phenomenological model involving a direct unfolding favored at lower loading rate or higher pH value, which is subject to competition with another unfolding pathway through a mechanically stable intermediate state whose nature is yet to be determined. Overall, the unique mechano—chemical responses of i-motif-provide a new perspective to its stability, which may be useful to guide designing new i-motif-based DNA mechanical nano-devices.

  1. Brownian dynamics simulation of directional sliding of histone octamers caused by DNA bending

    NASA Astrophysics Data System (ADS)

    Li, Wei; Dou, Shuo-Xing; Xie, Ping; Wang, Peng-Ye

    2006-05-01

    Chromatin-remodeling complexes such as SWI/SNF and RSC of yeast can perturb the structure of nucleosomes in an ATP-dependent manner. Experimental results prove that this chromatin remodeling process involves DNA bending. We simulate the effect of DNA bending, caused by chromatin-remodeling complexes, on directional sliding of histone octamers by Brownian dynamics simulation. The simulation results show that, after a DNA loop being generated at the side of a nucleosome, the histone octamer slides towards this DNA loop until the loop disappears. The DNA loop size is an important factor affecting the process of directional sliding of the histone octamer.

  2. Bisulfite sequencing of chromatin immunoprecipitated DNA (BisChIP-seq) directly informs methylation status of histone-modified DNA

    PubMed Central

    Statham, Aaron L.; Robinson, Mark D.; Song, Jenny Z.; Coolen, Marcel W.; Stirzaker, Clare; Clark, Susan J.

    2012-01-01

    The complex relationship between DNA methylation, chromatin modification, and underlying DNA sequence is often difficult to unravel with existing technologies. Here, we describe a novel technique based on high-throughput sequencing of bisulfite-treated chromatin immunoprecipitated DNA (BisChIP-seq), which can directly interrogate genetic and epigenetic processes that occur in normal and diseased cells. Unlike most previous reports based on correlative techniques, we found using direct bisulfite sequencing of Polycomb H3K27me3-enriched DNA from normal and prostate cancer cells that DNA methylation and H3K27me3-marked histones are not always mutually exclusive, but can co-occur in a genomic region-dependent manner. Notably, in cancer, the co-dependency of marks is largely redistributed with an increase of the dual repressive marks at CpG islands and transcription start sites of silent genes. In contrast, there is a loss of DNA methylation in intergenic H3K27me3-marked regions. Allele-specific methylation status derived from the BisChIP-seq data clearly showed that both methylated and unmethylated alleles can simultaneously be associated with H3K27me3 histones, highlighting that DNA methylation status in these regions is not dependent on Polycomb chromatin status. BisChIP-seq is a novel approach that can be widely applied to directly interrogate the genomic relationship between allele-specific DNA methylation, histone modification, or other important epigenetic regulators. PMID:22466171

  3. Retroviral DNA Integration Directed by HIV Integration Protein in Vitro

    NASA Astrophysics Data System (ADS)

    Bushman, Frederic D.; Fujiwara, Tamio; Craigie, Robert

    1990-09-01

    Efficient retroviral growth requires integration of a DNA copy of the viral RNA genome into a chromosome of the host. As a first step in analyzing the mechanism of integration of human immunodeficiency virus (HIV) DNA, a cell-free system was established that models the integration reaction. The in vitro system depends on the HIV integration (IN) protein, which was partially purified from insect cells engineered to express IN protein in large quantities. Integration was detected in a biological assay that scores the insertion of a linear DNA containing HIV terminal sequences into a λ DNA target. Some integration products generated in this assay contained five-base pair duplications of the target DNA at the recombination junctions, a characteristic of HIV integration in vivo; the remaining products contained aberrant junctional sequences that may have been produced in a variation of the normal reaction. These results indicate that HIV IN protein is the only viral protein required to insert model HIV DNA sequences into a target DNA in vitro.

  4. Direct Observation of Translocation in Individual DNA Polymerase Complexes*

    PubMed Central

    Dahl, Joseph M.; Mai, Ai H.; Cherf, Gerald M.; Jetha, Nahid N.; Garalde, Daniel R.; Marziali, Andre; Akeson, Mark; Wang, Hongyun; Lieberman, Kate R.

    2012-01-01

    Complexes of phi29 DNA polymerase and DNA fluctuate on the millisecond time scale between two ionic current amplitude states when captured atop the α-hemolysin nanopore in an applied field. The lower amplitude state is stabilized by complementary dNTP and thus corresponds to complexes in the post-translocation state. We have demonstrated that in the upper amplitude state, the DNA is displaced by a distance of one nucleotide from the post-translocation state. We propose that the upper amplitude state corresponds to complexes in the pre-translocation state. Force exerted on the template strand biases the complexes toward the pre-translocation state. Based on the results of voltage and dNTP titrations, we concluded through mathematical modeling that complementary dNTP binds only to the post-translocation state, and we estimated the binding affinity. The equilibrium between the two states is influenced by active site-proximal DNA sequences. Consistent with the assignment of the upper amplitude state as the pre-translocation state, a DNA substrate that favors the pre-translocation state in complexes on the nanopore is a superior substrate in bulk phase for pyrophosphorolysis. There is also a correlation between DNA sequences that bias complexes toward the pre-translocation state and the rate of exonucleolysis in bulk phase, suggesting that during DNA synthesis the pathway for transfer of the primer strand from the polymerase to exonuclease active site initiates in the pre-translocation state. PMID:22378784

  5. Direct observation of DNA overwinding by reverse gyrase

    PubMed Central

    Ogawa, Taisaku; Yogo, Katsunori; Furuike, Shou; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

    2015-01-01

    Reverse gyrase, found in hyperthermophiles, is the only enzyme known to overwind (introduce positive supercoils into) DNA. The ATP-dependent activity, detected at >70 °C, has so far been studied solely by gel electrophoresis; thus, the reaction dynamics remain obscure. Here, we image the overwinding reaction at 71 °C under a microscope, using DNA containing consecutive 30 mismatched base pairs that serve as a well-defined substrate site. A single reverse gyrase molecule processively winds the DNA for >100 turns. Bound enzyme shows moderate temperature dependence, retaining significant activity down to 50 °C. The unloaded reaction rate at 71 °C exceeds five turns per second, which is >102-fold higher than hitherto indicated but lower than the measured ATPase rate of 20 s−1, indicating loose coupling. The overwinding reaction sharply slows down as the torsional stress accumulates in DNA and ceases at stress of mere ∼5 pN⋅nm, where one more turn would cost only sixfold the thermal energy. The enzyme would thus keep DNA in a slightly overwound state to protect, but not overprotect, the genome of hyperthermophiles against thermal melting. Overwinding activity is also highly sensitive to DNA tension, with an effective interaction length exceeding the size of reverse gyrase, implying requirement for slack DNA. All results point to the mechanism where strand passage relying on thermal motions, as in topoisomerase IA, is actively but loosely biased toward overwinding. PMID:26023188

  6. Obstacles may facilitate and direct DNA search by proteins.

    PubMed

    Marcovitz, Amir; Levy, Yaakov

    2013-05-07

    DNA recognition by DNA-binding proteins (DBPs), which is a pivotal event in most gene regulatory processes, is often preceded by an extensive search for the correct site. A facilitated diffusion process in which a DBP combines three-dimensional diffusion in solution with one-dimensional sliding along DNA has been suggested to explain how proteins can locate their target sites on DNA much faster than predicted by three-dimensional diffusion alone. Although experimental and theoretical studies have recently advanced understanding of the biophysical principles underlying the search mechanism, the process under in vivo cellular conditions is poorly understood. In this study, we used various computational approaches to explore how the presence of obstacle proteins on the DNA influences search efficiency. At a low obstacle occupancy (i.e., when few obstacles occupy sites on the DNA), sliding by the searching DBP may be confined, which may impair search efficiency. The obstacles, however, can be bypassed during hopping events, and the number of bypasses is larger for higher obstacle occupancies. Dynamism on the part of the obstacles may even further facilitate search kinetics. Our study shows that the nature and efficiency of the search process may be governed not only by the intrinsic properties of the DBP and the salt concentration of the medium, but also by the in vivo association of DNA with other macromolecular obstacles, their location, and occupancy.

  7. {beta}-carboline derivatives: Novel photosensitizers that intercalate into DNA to cause direct DNA damage in photodynamic therapy

    SciTech Connect

    Guan Huaji; Liu Xiaodong; Peng Wenlie; Cao Rihui; Ma Yan; Chen Hongsheng; Xu Anlong . E-mail: ls36@zsu.edu.cn

    2006-04-14

    Novel 1,3,9-trisubstituted {beta}-carboline derivatives were found to exhibit DNA photocleavage properties under visible light irradiation in a cell-free system, which could be reduced by antioxidant vitamin E. Their photo-cytotoxicity to human tumor cell line HeLa was confirmed, in which apoptosis only contributed a small part to the cell death, and necrosis was the dominating outcome of HeLa cells in photodynamic therapy (PDT) using {beta}-carboline derivatives. Different from other clinical PDT drugs, {beta}-carboline derivatives were demonstrated to be able to distribute in the nucleus and intercalate into DNA, and consequently cause direct DNA damage by photochemical reaction products in PDT, which was proved by the distinct DNA tails in the comet assay and the considerable amount of DNA damaged cells quantified by flow cytometry. This mechanism could be the explanation for the delay of cell proliferation at DNA synthesis and mitosis.

  8. Direct visual detection of DNA based on the light scattering of silica nanoparticles on a human papillomavirus DNA chip.

    PubMed

    Piao, Jing Yu; Park, Eun Hee; Choi, Kihwan; Quan, Bo; Kang, Dong Ho; Park, Pan Yun; Kim, Dai Sik; Chung, Doo Soo

    2009-12-15

    A detection system for a human papillomavirus (HPV) DNA chip based on the light scattering of aggregated silica nanoparticle probes is presented. In the assay, a target HPV DNA is sandwiched between the capture DNA immobilized on the chip and the probe DNA immobilized on the plain silica nanoparticle. The spot where the sandwich reaction occurs appears bright white and is readily distinguishable to the naked eye. Scanning electron microscopy images clearly show the aggregation of the silica nanoparticle probes. When three different sized (55 nm, 137 nm, 286 nm) plain silica nanoparticles were compared, probes of the larger silica nanoparticles showed a higher scattering intensity. Using 286-nm silica nanoparticles, the spots obtained with 200 pM of target DNA were visually detectable. The demonstrated capability to detect a disease related target DNA with direct visualization without using a complex detection instrument provides the prerequisite for the development of portable testing kits for genotyping.

  9. High-throughput STR analysis for DNA database using direct PCR.

    PubMed

    Sim, Jeong Eun; Park, Su Jeong; Lee, Han Chul; Kim, Se-Yong; Kim, Jong Yeol; Lee, Seung Hwan

    2013-07-01

    Since the Korean criminal DNA database was launched in 2010, we have focused on establishing an automated DNA database profiling system that analyzes short tandem repeat loci in a high-throughput and cost-effective manner. We established a DNA database profiling system without DNA purification using a direct PCR buffer system. The quality of direct PCR procedures was compared with that of conventional PCR system under their respective optimized conditions. The results revealed not only perfect concordance but also an excellent PCR success rate, good electropherogram quality, and an optimal intra/inter-loci peak height ratio. In particular, the proportion of DNA extraction required due to direct PCR failure could be minimized to <3%. In conclusion, the newly developed direct PCR system can be adopted for automated DNA database profiling systems to replace or supplement conventional PCR system in a time- and cost-saving manner.

  10. Direct chemical oxidation: applications to demilitarization and decontamination

    SciTech Connect

    Cooper, J.F.; Balazs, B.; Lewis, P.

    1998-04-01

    The applicability of using aqueous solutions of sodium peroxydisulfate in the destruction of mustard gas surrogates has been demonstrated. This technique, known as Direct Chemical Oxidation (DCO), resulted in oxidative destruction of these surrogates, and a refinement was added to prevent the formation of slow-to-oxidize intermediates. Specifically, it was shown that `one-armed mustard` gas could be hydrolyzed to thiodiethanol and free chloride ion, and this species could then be partially oxidized to either the sulfoxide or sulfone depending on oxidant stoichiometry. Hydrolysis was accomplished on a mild basic solution at ambient temperature over a number of hours; oxidation was carried out at 90{degrees}C using peroxydisulfate solutions, Partial oxidation of thiodiethanol in the presence of chloride under basic conditions resulted in a a substantially pure mixture of the corresponding sulfone and sulfoxide, with no formation of chlorine gas. Analogous experiments in acid solutions produced a more complex mix of products and some oxidant was consumed in the evolution of chlorine. Complete destruction of the surrogates (to ppm level of detection) was achieved in either acid or base solution with less than a 7-fold excess of oxidant.

  11. Physical controls on directed virus assembly at nanoscale chemical templates

    SciTech Connect

    Cheung, C L; Chung, S; Chatterji, A; Lin, T; Johnson, J E; Hok, S; Perkins, J; De Yoreo, J

    2006-05-10

    Viruses are attractive building blocks for nanoscale heterostructures, but little is understood about the physical principles governing their directed assembly. In-situ force microscopy was used to investigate organization of Cowpea Mosaic Virus engineered to bind specifically and reversibly at nanoscale chemical templates with sub-30nm features. Morphological evolution and assembly kinetics were measured as virus flux and inter-viral potential were varied. The resulting morphologies were similar to those of atomic-scale epitaxial systems, but the underlying thermodynamics was analogous to that of colloidal systems in confined geometries. The 1D templates biased the location of initial cluster formation, introduced asymmetric sticking probabilities, and drove 1D and 2D condensation at subcritical volume fractions. The growth kinetics followed a t{sup 1/2} law controlled by the slow diffusion of viruses. The lateral expansion of virus clusters that initially form on the 1D templates following introduction of polyethylene glycol (PEG) into the solution suggests a significant role for weak interaction.

  12. Direct optical visualization of DNA-DNA interaction by nanoparticle-capture on resonant PET-films.

    PubMed

    Bauer, Maria; Haglmüller, Jakob; Pittner, Fritz; Schalkhammer, Thomas

    2006-12-01

    Based on the understanding of the absorption behavior of metal nanoparticles we aimed at the direct detection of sub-monomolecular layers of DNA with the naked eye. This extremely sensitive detection needs optical amplification techniques to be used in replacement of nanoparticle-aggregates applied e.g., in agglutination assays. We focus on the nanolayer-coated metallized-PET-chip setup and on the synthesis of DNA-nanoparticle conjugates suitable for 'resonance enhanced absorption'-point of care-tests and the application of those particles in the direct visualization of DNA-DNA binding events. Stabilization of nanoparticles and their sequence specific binding was proven with direct optical visibility of sub-monolayers of colored nanoclusters. Synthetic routes leading to suitable conjugates as well as stability tests and a biorecognition test are described in detail adding to the repertoire of tools that contribute to the application of nanoparticles in novel nano-enhanced devices.

  13. Cell specificity in DNA binding and repair of chemical carcinogens.

    PubMed Central

    Swenberg, J A; Rickert, D E; Baranyi, B L; Goodman, J I

    1983-01-01

    Many animal models for organ specific neoplasia have been developed and used to study the pathogenesis of cancer. Morphologic studies have usually concentrated on the response of target cells, whereas biochemical investigations have usually employed whole organ homogenates. Since hepatocytes comprise nearly 90% of the liver's mass and 70-80% of its DNA, alterations in DNA replication, covalent binding and DNA repair of nonparenchymal cells are usually obscured when whole organ homogenates are used. By utilizing cell separation methods, we have been able to demonstrate differences between hepatocyte and nonparenchymal cell replication. DNA damage and repair following exposure to a variety of hepatocarcinogen. Differences in removal of simple O6-alkylguanine and DNA replication correlate with cell specific carcinogenesis of simply alkylating agents. For several other procarcinogens, including 2-acetylaminofluorene and dinitroluene, cell specificity appears to reside primarily in the differential metabolic competence of hepatocytes and nonparenchymal cells. This results in greater covalent binding of the carcinogen to hepatocyte DNA, although the DNA adducts are removed at a similar rate in both cell types. Images FIGURE 1. PMID:6832089

  14. Construction of a DNA Nano-Object Directly Demonstrates Computation

    PubMed Central

    Wu, Gang; Jonoska, Natasha; Seeman, Nadrian C.

    2009-01-01

    We demonstrate a computing method in which a DNA nano-object representing the solution of a problem emerges as a result of self-assembly. We report an experiment in which three-vertex colorability for a 6-vertex graph with 9 edges is solved by constructing a DNA molecule representing the colored graph itself. Our findings show that computation based on “shape processing” is a viable alternative to symbol processing when computing by molecular self-assembly. PMID:19607875

  15. Direct measurement of the dielectric polarization properties of DNA

    PubMed Central

    Cuervo, Ana; Dans, Pablo D.; Carrascosa, José L.; Orozco, Modesto; Gomila, Gabriel; Fumagalli, Laura

    2014-01-01

    The electric polarizability of DNA, represented by the dielectric constant, is a key intrinsic property that modulates DNA interaction with effector proteins. Surprisingly, it has so far remained unknown owing to the lack of experimental tools able to access it. Here, we experimentally resolved it by detecting the ultraweak polarization forces of DNA inside single T7 bacteriophages particles using electrostatic force microscopy. In contrast to the common assumption of low-polarizable behavior like proteins (εr ∼ 2–4), we found that the DNA dielectric constant is ∼8, considerably higher than the value of ∼3 found for capsid proteins. State-of-the-art molecular dynamic simulations confirm the experimental findings, which result in sensibly decreased DNA interaction free energy than normally predicted by Poisson–Boltzmann methods. Our findings reveal a property at the basis of DNA structure and functions that is needed for realistic theoretical descriptions, and illustrate the synergetic power of scanning probe microscopy and theoretical computation techniques. PMID:25136104

  16. Fabrication of Ultrasensitive Field-Effect Transistor DNA Biosensors by a Directional Transfer Technique Based on CVD-Grown Graphene.

    PubMed

    Zheng, Chao; Huang, Le; Zhang, Hong; Sun, Zhongyue; Zhang, Zhiyong; Zhang, Guo-Jun

    2015-08-12

    Most graphene field-effect transistor (G-FET) biosensors are fabricated through a routine process, in which graphene is transferred onto a Si/SiO2 substrate and then devices are subsequently produced by micromanufacture processes. However, such a fabrication approach can introduce contamination onto the graphene surface during the lithographic process, resulting in interference for the subsequent biosensing. In this work, we have developed a novel directional transfer technique to fabricate G-FET biosensors based on chemical-vapor-deposition- (CVD-) grown single-layer graphene (SLG) and applied this biosensor for the sensitive detection of DNA. A FET device with six individual array sensors was first fabricated, and SLG obtained by the CVD-growth method was transferred onto the sensor surface in a directional manner. Afterward, peptide nucleic acid (PNA) was covalently immobilized on the graphene surface, and DNA detection was realized by applying specific target DNA to the PNA-functionalized G-FET biosensor. The developed G-FET biosensor was able to detect target DNA at concentrations as low as 10 fM, which is 1 order of magnitude lower than those reported in a previous work. In addition, the biosensor was capable of distinguishing the complementary DNA from one-base-mismatched DNA and noncomplementary DNA. The directional transfer technique for the fabrication of G-FET biosensors is simple, and the as-constructed G-FET DNA biosensor shows ultrasensitivity and high specificity, indicating its potential application in disease diagnostics as a point-of-care tool.

  17. Chemical proteomics reveals a γH2AX-53BP1 interaction in the DNA damage response

    PubMed Central

    Kleiner, Ralph E.; Verma, Priyanka; Molloy, Kelly R.; Chait, Brian T.; Kapoor, Tarun M.

    2015-01-01

    DNA double-strand break repair involves phosphorylation of histone variant H2AX (‘γH2AX’), which accumulates in foci at sites of damage. In current models, the recruitment of multiple DNA repair proteins to γH2AX foci depends mainly on recognition of this ‘mark’ by a single protein, MDC1. However, DNA repair proteins accumulate at γH2AX sites without MDC1, suggesting that other ‘readers’ exist. Here, we use a quantitative chemical proteomics approach to profile direct, phospho-selective γH2AX binders in native proteomes. We identify γH2AX binders, including the DNA repair mediator, 53BP1, which we show recognizes γH2AX through its BRCT domains. Furthermore, we investigate targeting of wild-type 53BP1 or a mutant form deficient in γH2AX binding, to chromosomal breaks resulting from endogenous and exogenous DNA damage. Our results show how direct recognition of γH2AX modulates protein localization at DNA damage sites, and suggest how specific chromatin ‘mark’-‘reader’ interactions contribute to essential mechanisms ensuring genome stability. PMID:26344695

  18. MALS: an efficient strategy for multiple site-directed mutagenesis employing a combination of DNA amplification, ligation and suppression PCR

    PubMed Central

    Fushan, Alexey A; Drayna, Dennis T

    2009-01-01

    Background Multiple approaches for the site-directed mutagenesis (SDM) have been developed. However, only several of them are designed for simultaneous introduction of multiple nucleotide alterations, and these are time consuming. In addition, many of the existing multiple SDM methods have technical limitations associated with type and number of mutations that can be introduced, or are technically demanding and require special chemical reagents. Results In this study we developed a quick and efficient strategy for introduction of multiple complex mutations in a target DNA without intermediate subcloning by using a combination of connecting SDM and suppression PCR. The procedure consists of sequential rounds, with each individual round including PCR amplification of target DNA with two non-overlapping pairs of oligonucleotides. The desired mutation is incorporated at the 5' end of one or both internal oligonucleotides. DNA fragments obtained during amplification are mixed and ligated. The resulting DNA mixture is amplified with external oligonucleotides that act as suppression adapters. Suppression PCR limits amplification to DNA molecules representing full length target DNA, while amplification of other types of molecules formed during ligation is suppressed. To create additional mutations, an aliquot of the ligation mixture is then used directly for the next round of mutagenesis employing internal oligonucleotides specific for another region of target DNA. Conclusion A wide variety of complex multiple mutations can be generated in a short period of time. The procedure is rapid, highly efficient and does not require special chemical reagents. Thus, MALS represents a powerful alternative to the existing methods for multiple SDM. PMID:19778447

  19. DNA-directed capture of primary cells from a complex mixture and controlled orthogonal release monitored by SPR imaging.

    PubMed

    Bombera, Radoslaw; Leroy, Loïc; Livache, Thierry; Roupioz, Yoann

    2012-03-15

    Many biological samples are composed of several cell types. Qualitative and quantitative analysis of these complex mixtures is of major interest for both diagnostic and biomedical applications. Because large amounts of biological material are often challenging to collect, tremendous efforts have been made for a decade to design miniaturized platforms-such as lab-on-a-chip or microarrays-to run sensitive and reliable analysis from tiny quantities of starting material. Although barely explored so far, the release of resolved cellular samples constitutes an exciting strategy for further cell analysis. Herein, we propose a DNA-based biochip suitable for cell-type analysis in a label-free manner. The DNA-array is firstly converted into antibody-array using antibody-DNA conjugates. These protein-DNA hybrid molecules are chemically synthesized by covalent coupling of short oligonucleotides to antibodies directed against cell-type specific markers. We show not only specific capture of primary spleen cells on protein-DNA microarray spots but also their fast and specific orthogonal release according to the antibody-DNA combinations by incorporating restriction sites in DNA. Both molecular and cellular interactions occurring on the biochip are monitored by surface plasmon resonance (SPR) imaging. This optical technique turns out to be a powerful way to monitor, in real-time, biological interactions occurring on the microarrayed features. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. In vivo covalent binding of organic chemicals to DNA as a quantitative indicator in the process of chemical carcinogenesis.

    PubMed

    Lutz, W K

    1979-12-01

    The covalent binding of chemical carcinogens to DNA of mammalian organs is expressed per unit dose, and a 'Covalent-Binding Index', CBI, is defined. CBI for various carcinogens span over 6 orders of magnitude. A similar range is observed for the carcinogenic potency in long-term bioassays on carcinogenicity. For the assessment of a risk from exposure to a carcinogen, the total DNA dmaage can be estimated if the actual dose is also accounted for. A detailed description is given for planning and performing a DNA-binding assay. A complete literature survey on DNA binding in vivo (83 compounds) is given with a calculation of CBI, where possible, 153 compounds are listed where a covalent binding to any biological macromolecule has been shown in vivo or in vitro. Recent, so far unpublished findings with aflatoxin M1, macromolecule-bound aflatoxin B1, diethylstilbestrol, and 1,2-epithiobutyronitrile are included. A comparison of CBI for rat-liver DNA with hepatocarcinogenic potency reveals a surprisingly good quantitative correlation. Refinements for a DNA-binding assay are proposed. Possibilites and limitations in the use of DNA binding in chemical carcinogenesis are discussed extensively.

  1. Theoretical studies of chemical reactivity of metabolically activated forms of aromatic amines toward DNA.

    PubMed

    Shamovsky, Igor; Ripa, Lena; Blomberg, Niklas; Eriksson, Leif A; Hansen, Peter; Mee, Christine; Tyrchan, Christian; O'Donovan, Mike; Sjö, Peter

    2012-10-15

    The metabolism of aromatic and heteroaromatic amines (ArNH₂) results in nitrenium ions (ArNH⁺) that modify nucleobases of DNA, primarily deoxyguanosine (dG), by forming dG-C8 adducts. The activated amine nitrogen in ArNH⁺ reacts with the C8 of dG, which gives rise to mutations in DNA. For the most mutagenic ArNH₂, including the majority of known genotoxic carcinogens, the stability of ArNH⁺ is of intermediate magnitude. To understand the origin of this observation as well as the specificity of reactions of ArNH⁺ with guanines in DNA, we investigated the chemical reactivity of the metabolically activated forms of ArNH₂, that is, ArNHOH and ArNHOAc, toward 9-methylguanine by DFT calculations. The chemical reactivity of these forms is determined by the rate constants of two consecutive reactions leading to cationic guanine intermediates. The formation of ArNH⁺ accelerates with resonance stabilization of ArNH⁺, whereas the formed ArNH⁺ reacts with guanine derivatives with the constant diffusion-limited rate until the reaction slows down when ArNH⁺ is about 20 kcal/mol more stable than PhNH⁺. At this point, ArNHOH and ArNHOAc show maximum reactivity. The lowest activation energy of the reaction of ArNH⁺ with 9-methylguanine corresponds to the charge-transfer π-stacked transition state (π-TS) that leads to the direct formation of the C8 intermediate. The predicted activation barriers of this reaction match the observed absolute rate constants for a number of ArNH⁺. We demonstrate that the mutagenic potency of ArNH₂ correlates with the rate of formation and the chemical reactivity of the metabolically activated forms toward the C8 atom of dG. On the basis of geometric consideration of the π-TS complex made of genotoxic compounds with long aromatic systems, we propose that precovalent intercalation in DNA is not an essential step in the genotoxicity pathway of ArNH₂. The mechanism-based reasoning suggests rational design strategies to

  2. Recent advances on the encoding and selection methods of DNA-encoded chemical library.

    PubMed

    Shi, Bingbing; Zhou, Yu; Huang, Yiran; Zhang, Jianfu; Li, Xiaoyu

    2017-02-01

    DNA-encoded chemical library (DEL) has emerged as a powerful and versatile tool for ligand discovery in chemical biology research and in drug discovery. Encoding and selection methods are two of the most important technological aspects of DEL that can dictate the performance and utilities of DELs. In this digest, we have summarized recent advances on the encoding and selection strategies of DEL and also discussed the latest developments on DNA-encoded dynamic library, a new frontier in DEL research.

  3. Cleavage enhancement of specific chemical bonds in DNA-Cisplatin complexes induced by X-rays

    NASA Astrophysics Data System (ADS)

    Zheng, Yi; Yao, Xiaobin; Luo, Xinglan; Fu, Xianzhi

    2014-04-01

    The chemical bond transformation of cisplatin-DNA complexes can be probed efficiently by XPS which provides a concomitant X-ray irradiation source as well. The presence to Pt could considerably increase formation of the SE induced by X-ray and that the further interaction of these LEE with DNA leads to the enhancement of bond cleavages.

  4. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  5. A FLUORESCENCE BASED ASSAY FOR DNA DAMAGE: INDUCED BY RADIATION, CHEMICALS AND ENZYMES

    EPA Science Inventory

    A simple and rapid assay to detect DNA damage is reported. This assay is based on the ability of certain dyes to fluoresce upon intercalation with dsDNA. Damage caused by ultraviolet (UV) radiation, chemicals or restriction enzymes is detected using this assay. UV radiation at...

  6. The shape of the DNA minor groove directs binding by the DNA-bending protein Fis

    SciTech Connect

    Stella, Stefano; Cascio, Duilio; Johnson, Reid C.

    2010-06-21

    The bacterial nucleoid-associated protein Fis regulates diverse reactions by bending DNA and through DNA-dependent interactions with other control proteins and enzymes. In addition to dynamic nonspecific binding to DNA, Fis forms stable complexes with DNA segments that share little sequence conservation. Here we report the first crystal structures of Fis bound to high- and low-affinity 27-base-pair DNA sites. These 11 structures reveal that Fis selects targets primarily through indirect recognition mechanisms involving the shape of the minor groove and sequence-dependent induced fits over adjacent major groove interfaces. The DNA shows an overall curvature of {approx}65{sup o}, and the unprecedented close spacing between helix-turn-helix motifs present in the apodimer is accommodated by severe compression of the central minor groove. In silico DNA structure models show that only the roll, twist, and slide parameters are sufficient to reproduce the changes in minor groove widths and recreate the curved Fis-bound DNA structure. Models based on naked DNA structures suggest that Fis initially selects DNA targets with intrinsically narrow minor grooves using the separation between helix-turn-helix motifs in the Fis dimer as a ruler. Then Fis further compresses the minor groove and bends the DNA to generate the bound structure.

  7. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... chemical test. 95.035 Section 95.035 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer or a marine employer may direct an individual operating a vessel to undergo a chemical test...

  8. Directed assembly of discrete gold nanoparticle groupings usingbranched DNA scaffolds

    SciTech Connect

    Claridge, Shelley A.; Goh, Sarah L.; Frechet, Jean M.J.; Williams, Shara C.; Micheel, Christine M.; Alivisatos, A. Paul

    2004-09-14

    The concept of self-assembled dendrimers is explored for the creation of discrete nanoparticle assemblies. Hybridization of branched DNA trimers and nanoparticle-DNA conjugates results in the synthesis of nanoparticle trimer and tetramer complexes. Multiple tetramer architectures are investigated, utilizing Au-DNA conjugates with varying secondary structural motifs. Hybridization products are analyzed by gel electrophoresis, and discrete bands are observed corresponding to structures with increasing numbers of hybridization events. Samples extracted from each band are analyzed by transmission electron microscopy, and statistics compiled from micrographs are used to compare assembly characteristics for each architecture. Asymmetric structures are also produced in which both 5 and 10 nm Au particles are assembled on branched scaffolds.

  9. Fibronectin inhibits cytokine production induced by CpG DNA in macrophages without direct binding to DNA.

    PubMed

    Yoshida, Hiroyuki; Nishikawa, Makiya; Yasuda, Sachiyo; Toyota, Hiroyasu; Kiyota, Tsuyoshi; Takahashi, Yuki; Takakura, Yoshinobu

    2012-10-01

    Fibronectin (FN) is known to have four DNA-binding domains although their physiological significance is unknown. Primary murine peritoneal macrophages have been shown to exhibit markedly lower responsiveness to CpG motif-replete plasmid DNA (pDNA), Toll-like receptor-9 (TLR9) ligand, compared with murine macrophage-like cell lines. The present study was conducted to examine whether FN having DNA-binding domains is involved in this phenomenon. The expression of FN was significantly higher in primary macrophages than in a macrophage-like cell line, RAW264.7, suggesting that abundant FN might suppress the responsiveness in the primary macrophages. However, electrophoretic analysis revealed that FN did not bind to pDNA in the presence of a physiological concentration of divalent cations. Surprisingly, marked tumor necrosis factor - (TNF-)α production from murine macrophages upon CpG DNA stimulation was significantly reduced by exogenously added FN in a concentration-dependent manner but not by BSA, laminin or collagen. FN did not affect apparent pDNA uptake by the cells. Moreover, FN reduced TNF-α production induced by polyI:C (TLR3 ligand), and imiquimod (TLR7 ligand), but not by LPS (TLR4 ligand), or a non-CpG pDNA/cationic liposome complex. The confocal microscopic study showed that pDNA was co-localized with FN in the same intracellular compartment in RAW264.7, suggesting that FN inhibits cytokine signal transduction in the endosomal/lysosomal compartment. Taken together, the results of the present study has revealed, for the first time, a novel effect of FN whereby the glycoprotein modulates cytokine signal transduction via CpG-DNA/TLR9 interaction in macrophages without direct binding to DNA through its putative DNA-binding domains.

  10. Mechano-chemical kinetics of DNA replication: identification of the translocation step of a replicative DNA polymerase

    PubMed Central

    Morin, José A.; Cao, Francisco J.; Lázaro, José M.; Arias-Gonzalez, J. Ricardo; Valpuesta, José M.; Carrascosa, José L.; Salas, Margarita; Ibarra, Borja

    2015-01-01

    During DNA replication replicative polymerases move in discrete mechanical steps along the DNA template. To address how the chemical cycle is coupled to mechanical motion of the enzyme, here we use optical tweezers to study the translocation mechanism of individual bacteriophage Phi29 DNA polymerases during processive DNA replication. We determine the main kinetic parameters of the nucleotide incorporation cycle and their dependence on external load and nucleotide (dNTP) concentration. The data is inconsistent with power stroke models for translocation, instead supports a loose-coupling mechanism between chemical catalysis and mechanical translocation during DNA replication. According to this mechanism the DNA polymerase works by alternating between a dNTP/PPi-free state, which diffuses thermally between pre- and post-translocated states, and a dNTP/PPi-bound state where dNTP binding stabilizes the post-translocated state. We show how this thermal ratchet mechanism is used by the polymerase to generate work against large opposing loads (∼50 pN). PMID:25800740

  11. Direct Quantification of Cell-Free, Circulating DNA from Unpurified Plasma

    PubMed Central

    Breitbach, Sarah; Tug, Suzan; Helmig, Susanne; Zahn, Daniela; Kubiak, Thomas; Michal, Matthias; Gori, Tommaso; Ehlert, Tobias; Beiter, Thomas; Simon, Perikles

    2014-01-01

    Cell-free DNA (cfDNA) in body tissues or fluids is extensively investigated in clinical medicine and other research fields. In this article we provide a direct quantitative real-time PCR (qPCR) as a sensitive tool for the measurement of cfDNA from plasma without previous DNA extraction, which is known to be accompanied by a reduction of DNA yield. The primer sets were designed to amplify a 90 and 222 bp multi-locus L1PA2 sequence. In the first module, cfDNA concentrations in unpurified plasma were compared to cfDNA concentrations in the eluate and the flow-through of the QIAamp DNA Blood Mini Kit and in the eluate of a phenol-chloroform isoamyl (PCI) based DNA extraction, to elucidate the DNA losses during extraction. The analyses revealed 2.79-fold higher cfDNA concentrations in unpurified plasma compared to the eluate of the QIAamp DNA Blood Mini Kit, while 36.7% of the total cfDNA were found in the flow-through. The PCI procedure only performed well on samples with high cfDNA concentrations, showing 87.4% of the concentrations measured in plasma. The DNA integrity strongly depended on the sample treatment. Further qualitative analyses indicated differing fractions of cfDNA fragment lengths in the eluate of both extraction methods. In the second module, cfDNA concentrations in the plasma of 74 coronary heart disease patients were compared to cfDNA concentrations of 74 healthy controls, using the direct L1PA2 qPCR for cfDNA quantification. The patient collective showed significantly higher cfDNA levels (mean (SD) 20.1 (23.8) ng/ml; range 5.1–183.0 ng/ml) compared to the healthy controls (9.7 (4.2) ng/ml; range 1.6–23.7 ng/ml). With our direct qPCR, we recommend a simple, economic and sensitive procedure for the quantification of cfDNA concentrations from plasma that might find broad applicability, if cfDNA became an established marker in the assessment of pathophysiological conditions. PMID:24595313

  12. DNA-Pairing and Annealing Processes in Homologous Recombination and Homology-Directed Repair

    PubMed Central

    Morrical, Scott W.

    2015-01-01

    The formation of heteroduplex DNA is a central step in the exchange of DNA sequences via homologous recombination, and in the accurate repair of broken chromosomes via homology-directed repair pathways. In cells, heteroduplex DNA largely arises through the activities of recombination proteins that promote DNA-pairing and annealing reactions. Classes of proteins involved in pairing and annealing include RecA-family DNA-pairing proteins, single-stranded DNA (ssDNA)-binding proteins, recombination mediator proteins, annealing proteins, and nucleases. This review explores the properties of these pairing and annealing proteins, and highlights their roles in complex recombination processes including the double Holliday junction (DhJ) formation, synthesis-dependent strand annealing, and single-strand annealing pathways—DNA transactions that are critical both for genome stability in individual organisms and for the evolution of species. PMID:25646379

  13. New directions: Atmospheric chemical mechanisms for the future

    EPA Science Inventory

    The chemical reaction scheme or mechanism used to represent atmospheric chemical reactions is at the heart of each air quality model used in research and policy applications to predict and analyse the complex air pollutants: ozone, air toxics and PM2.5. This is necessarily only a...

  14. New directions: Atmospheric chemical mechanisms for the future

    EPA Science Inventory

    The chemical reaction scheme or mechanism used to represent atmospheric chemical reactions is at the heart of each air quality model used in research and policy applications to predict and analyse the complex air pollutants: ozone, air toxics and PM2.5. This is necessarily only a...

  15. Direct observation of DNA threading in flap endonuclease complexes

    PubMed Central

    AlMalki, Faizah A; Flemming, Claudia S; Zhang, Jing; Feng, Min; Sedelnikova, Svetlana E; Ceska, Tom; Rafferty, John B; Sayers, Jon R; Artymiuk, Peter J

    2016-01-01

    Maintenance of genome integrity requires that branched nucleic acid molecules are accurately processed to produce double-helical DNA. Flap endonucleases are essential enzymes that trim such branched molecules generated by Okazaki fragment synthesis during replication. Here, we report crystal structures of bacteriophage T5 flap endonuclease in complexes with intact DNA substrates, and products, at resolutions of 1.9–2.2 Å. They reveal single-stranded DNA threading through a hole in the enzyme enclosed by an inverted V-shaped helical arch straddling the active site. Residues lining the hole induce an unusual barb-like conformation in the DNA substrate juxtaposing the scissile phosphate and essential catalytic metal ions. A series of complexes and biochemical analyses show how the substrate’s single-stranded branch approaches, threads through, and finally emerges on the far side of the enzyme. Our studies suggest that substrate recognition involves an unusual “fly-casting, thread, bend and barb” mechanism. PMID:27273516

  16. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.

    PubMed

    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J

    2015-06-15

    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  17. Rates of Chemical Cleavage of DNA and RNA Oligomers Containing Guanine Oxidation Products

    PubMed Central

    2016-01-01

    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design. PMID:25853314

  18. Synthesis of Sindbis virus complementary DNA by avian myeloblastosis virus RNA-directed DNA polymerase.

    PubMed

    Yuferov, V; Grandgenett, D P; Bondurant, M; Riggin, C; Tigges, M

    1978-07-24

    Sindbis virus 42 S RNA was efficiently transcribed into complementary DNA (CDNA) by avian myeloblastosis virus alphabeta DNA polymerase using oligo- (dT) or single-stranded calf thymus DNA as primers. Both of the Sindbis virus cDNA products were able to protect 60% of 125I-labeled Sindbis virus RNA, at near equal weight ratios, from RNAase A and T1 digestion. Using hybridization kinetics, the Crt 1/2 value for hybridization of the calf thymus-primed cDNA product with excess Sindbis RNA was determined to be 1.8 9 10-2 mol . s . 1-1. Thes data demonstrate that the Sindbis virus cDNA products are relatively uniform representations of Sindbis virus RNA sequences.

  19. Direct sequencing of genomic DNA for characterization of a satellite DNA in five species of eastern Pacific abalone.

    PubMed

    Muchmore, M E; Moy, G W; Swanson, W J; Vacquier, V D

    1998-03-01

    A tandemly repeated satellite DNA of 290-291 base pairs (bp) was identified by SalI digestion of genomic DNA of five species of Eastern Pacific (California) abalone (genus, Haliotis). Following cloning and sequencing of one repeat unit from one species, the consensus sequences of this satellite were determined for five species by directly sequencing genomic DNA using satellite-specific primers. Phylogenetic trees of the consensus satellite sequences had the same topology as trees constructed for two abalone sperm acrosomal proteins. In 12 randomly picked clones of the Red abalone (H. rufescens) SalI satellite, 16 positions varied, the variation being spread throughout the sequence. GenBank database searches found no significant similarities between this satellite and known sequences. Southern analysis showed that all 290-bp SalI repeats were excised from genomic DNA by Sau3A1 digestion. The tandem arrangement of satellite repeats was confirmed by sequencing through the SalI site into the next repeat using genomic DNA as template, time-dependent appearance of DNA ladders with an approximate 300-bp spacing in SalI digests of genomic DNA, and ladders of bands with an approximate 300-bp spacing generated by polymerase chain reaction (PCR) using genomic DNA as template. In the Red abalone, the 290-bp SalI satellite represents approximately 0.5% of total DNA, equivalent to approximately 28,000 copies per haploid genome. The species-specific consensus sequence of this satellite, obtained directly using genomic DNA as the sequencing template, provides a molecular marker that could be used for identification of hybrid parentage, taxonomy, population identification, and forensic studies.

  20. Physisorption of DNA molecules on chemically modified single-walled carbon nanotubes with and without sonication.

    PubMed

    Umemura, Kazuo; Ishibashi, Yu; Oura, Shusuke

    2016-09-01

    We investigated the physisorption phenomenon of single-stranded DNA (ssDNA) molecules onto two types of commercially available chemically functionalized single-walled carbon nanotubes (SWNTs) by atomic force microscopy (AFM) and agarose gel electrophoresis. We found that DNA molecules can adsorb on the water-soluble SWNT surfaces without sonication, although sonication treatment has been used for hybridization of DNA and SWNTs in many previous studies. Using our method, damage of DNA molecules by sonication can be avoided. On the other hand, the amount of DNA molecules adsorbed on SWNT surfaces increased when the samples were sonicated. This fact suggests that the sonication is effective not only at debundling of SWNTs, but also at assisting DNA adsorption. Furthermore, DNA adsorption was affected by the types of functionalized SWNTs. In the case of SWNTs functionalized with polyethylene glycol (PEG-SWNT), physisorption of ssDNA molecules was confirmed only by agarose-gel electrophoresis. In contrast, amino-terminated SWNTs (NH2-SWNTs) showed a change in the height distribution profile based on AFM observations. These results suggest that DNA molecules tended to adsorb to NH2-SWNT surfaces, although DNA molecules can also adsorb on PEG-SWNT surfaces. Our results revealed fundamental information for developing nanobiodevices using hybrids of DNA and SWNTs.

  1. Electronic structure of DNA polynucleotides under the chemical-doping condition investigated by PES and NEXAFS

    NASA Astrophysics Data System (ADS)

    Furukawa, Masashi; Kato, H. S.; Taniguchi, M.; Hatsui, T.; Kosugi, N.; Komeda, T.; Kawai, Maki; Kawai, T.

    2003-03-01

    During the last several years, the carrier transport through DNA between nm- spaced electrodes has been discussed without the understanding of their intrinsic electronic structures. As a result, its 'scattered' results in the controversial magnitude of conductivity, from a good conductor to an insulator, which is also assumed to be dependent on the chemical species surrounding DNA (H^+, counterion, etc.)@[ref.]. In this talk, we show electronic structures of the occupied- and unoccupied-states near the Fermi level. Systems exhibited here are well-defined sequence of DNA polynucleotides, Poly(dG)-poly(dC) and Poly(dA)-poly(dT), with- and without- chemical-doping (carrier-doping), in order to evaluate such an effect into DNA and also to propose the carrier conduction mechanism through DNA. [ref.] M. Taniguchi et al., submitted to JACS.

  2. Short direct repeats flank the T-DNA on a nopaline Ti plasmid

    PubMed Central

    Yadav, Narendra S.; Vanderleyden, Jos; Bennett, Donald R.; Barnes, Wayne M.; Chilton, Mary-Dell

    1982-01-01

    Crown gall disease results from the insertion of a segment of the Agrobacterium Ti plasmid, called T-DNA, into host plant nuclear DNA. We have subjected to sequence analysis the border regions of pTi T37 (ends of T-DNA) and one left T-DNA/plant DNA border fragment isolated from BT37 tobacco teratoma by molecular cloning. These sequence studies, taken together with published sequence of a right T-DNA/plant DNA border fragment, allowed us to identify the positions of left and right borders at the DNA sequence level. Comparison of left and right border regions of the Ti plasmid revealed a “core” direct repeat of 13 of 14 bases (12 contiguous) precisely at the borders of T-DNA. An extended repeat of 21 of 25 bases overlaps this core repeat. T-DNA on the Ti plasmid exhibits no longer direct or inverted repeats in the border regions, based on Southern hybridization studies. The physical structure of T-DNA differs from that of known prokaryotic and eukaryotic transposable elements but bears a structural resemblance to the prophage of bacteriophage λ. Images PMID:16593241

  3. GADD45α inhibition of DNMT1 dependent DNA methylation during homology directed DNA repair

    PubMed Central

    Lee, Bongyong; Morano, Annalisa; Porcellini, Antonio; Muller, Mark T.

    2012-01-01

    In this work, we examine regulation of DNA methyltransferase 1 (DNMT1) by the DNA damage inducible protein, GADD45α. We used a system to induce homologous recombination (HR) at a unique double-strand DNA break in a GFP reporter in mammalian cells. After HR, the repaired DNA is hypermethylated in recombinant clones showing low GFP expression (HR-L expressor class), while in high expressor recombinants (HR-H clones) previous methylation patterns are erased. GADD45α, which is transiently induced by double-strand breaks, binds to chromatin undergoing HR repair. Ectopic overexpression of GADD45α during repair increases the HR-H fraction of cells (hypomethylated repaired DNA), without altering the recombination frequency. Conversely, silencing of GADD45α increases methylation of the recombined segment and amplifies the HR-L expressor (hypermethylated) population. GADD45α specifically interacts with the catalytic site of DNMT1 and inhibits methylation activity in vitro. We propose that double-strand DNA damage and the resulting HR process involves precise, strand selected DNA methylation by DNMT1 that is regulated by GADD45α. Since GADD45α binds with high avidity to hemimethylated DNA intermediates, it may also provide a barrier to spreading of methylation during or after HR repair. PMID:22135303

  4. Photo-Induced Click Chemistry for DNA Surface Structuring by Direct Laser Writing.

    PubMed

    Kerbs, Antonina; Mueller, Patrick; Kaupp, Michael; Ahmed, Ishtiaq; Quick, Alexander S; Abt, Doris; Wegener, Martin; Niemeyer, Christof M; Barner-Kowollik, Christopher; Fruk, Ljiljana

    2017-02-15

    Oligonucleotides containing photo-caged dienes were prepared and shown to react quantitatively in a light-induced Diels-Alder cycloaddition with functional maleimides in aqueous solution within minutes. Due to its high yield and fast rate, the reaction was exploited for DNA surface patterning with sub-micrometer resolution employing direct laser writing (DLW). Functional DNA arrays were written by direct laser writing (DLW) in variable patterns, which were further encoded with fluorophores and proteins through DNA directed immobilization. This mild and efficient light-driven platform technology holds promise for the fabrication of complex bioarrays with sub-micron resolution.

  5. DNA-directed aniline mustards based on 9-aminoacridine: interaction with DNA.

    PubMed

    O'Connor, C J; Denny, W A; Fan, J Y; Gamage, R S

    1992-11-30

    A series of 4-substituted aniline mustards ArNH(CH2)nOpC6H4N(CH2CH2Cl)2, where Ar is an acridine and n varies from 2 to 5, interact with DNA. Scatchard analysis shows the compounds bind tightly, with a binding site size similar to that of 9-aminoacridine. The rate of hydrolysis of the mustards, measured by HPLC, is essentially constant across the series. With increasing length of the polymethylene linker, non-covalent binding becomes less strong, but the rate of DNA alkylation increases. Viscometric helix extension measurements and electrophoretic analyses using closed circular supercoiled DNA show that all the compounds are DNA intercalating ligands. Despite these similarities, the compounds are known to have quite different patterns of DNA alkylation, switching from guanine to adenine alkylation as the chain length is extended.

  6. DNA interstrand cross-links of an antitumor trinuclear platinum(II) complex: thermodynamic analysis and chemical probing.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2011-06-06

    The trinuclear platinum compound [{trans-PtCl(NH(3))(2)}(2)(μ-trans-Pt(NH(3))(2){NH(2)(CH(2))(6)NH(2)}(2))](4+) (BBR3464) belongs to the polynuclear class of platinum-based anticancer agents. These agents form in DNA long-range (Pt,Pt) interstrand cross-links, whose role in the antitumor effects of BBR3464 predominates. Our results show for the first time that the interstrand cross-links formed by BBR3464 between two guanine bases in opposite strands separated by two base pairs (1,4-interstrand cross-links) exist as two distinct conformers, which are not interconvertible, not only if these cross-links are formed in the 5'-5', but also in the less-usual 3'-3' direction. Analysis of the conformers by differential scanning calorimetry, chemical probes of DNA conformation, and minor groove binder Hoechst 33258 demonstrate that each of the four conformers affects DNA in a distinctly different way and adopts a different conformation. The results also support the thesis that the molecule of antitumor BBR3464 when forming DNA interstrand cross-links may adopt different global structures, including different configurations of the linker chain of BBR3464 in the minor groove of DNA. Our findings suggest that the multiple DNA interstrand cross-links available to BBR3464 may all contribute substantially to its cytotoxicity.

  7. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA.

    PubMed

    Hayner, Jaclyn N; Douma, Lauren G; Bloom, Linda B

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3'OH (3'DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3'DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5'phosphate (5'P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5'DNA). The 5'P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3'DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5'DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3'DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. The interplay of primer-template DNA phosphorylation status and single-stranded DNA binding proteins in directing clamp loaders to the appropriate polarity of DNA

    PubMed Central

    Hayner, Jaclyn N.; Douma, Lauren G.; Bloom, Linda B.

    2014-01-01

    Sliding clamps are loaded onto DNA by clamp loaders to serve the critical role of coordinating various enzymes on DNA. Clamp loaders must quickly and efficiently load clamps at primer/template (p/t) junctions containing a duplex region with a free 3′OH (3′DNA), but it is unclear how clamp loaders target these sites. To measure the Escherichia coli and Saccharomyces cerevisiae clamp loader specificity toward 3′DNA, fluorescent β and PCNA clamps were used to measure clamp closing triggered by DNA substrates of differing polarity, testing the role of both the 5′phosphate (5′P) and the presence of single-stranded binding proteins (SSBs). SSBs inhibit clamp loading by both clamp loaders on the incorrect polarity of DNA (5′DNA). The 5′P groups contribute selectivity to differing degrees for the two clamp loaders, suggesting variations in the mechanism by which clamp loaders target 3′DNA. Interestingly, the χ subunit of the E. coli clamp loader is not required for SSB to inhibit clamp loading on phosphorylated 5′DNA, showing that χ·SSB interactions are dispensable. These studies highlight a common role for SSBs in directing clamp loaders to 3′DNA, as well as uncover nuances in the mechanisms by which SSBs perform this vital role. PMID:25159615

  9. Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

    PubMed Central

    Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

    2011-01-01

    DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

  10. Cleavage enhancement of specific chemical bonds in DNA by cisplatin radiosensitization.

    PubMed

    Xiao, Fangxing; Luo, Xinglan; Fu, Xianzhi; Zheng, Yi

    2013-05-02

    X-ray photoelectron spectroscopy (XPS) is harnessed as an in situ efficient characterization technique for monitoring chemical bond transformation in DNA and cisplatin-DNA complexes under synergic X-ray irradiation. By analyzing the variation of relative peak area of core elements of DNA as a function of irradiation time, we find that the most vulnerable scission sites in DNA are those containing phosphate and glycosidic bonds. Compared to DNA, the effective rate constants of the corresponding phosphodiester and glycosidic bond cleavages for cisplatin-DNA complexes are 1.8 and 1.9 folds larger. These damages and their enhancements are similar to those induced by low energy electrons (LEE). Consistently, the magnitude of the secondary electron distribution produced by the X-rays on the cisplatin-DNA complexes is considerably increased compared to that of pristine DNA. The data suggest that DNA radiosensization by cisplatin results not only from the sensitization of DNA to the action of LEE, but also from an increase the production of LEE at the site of binding of the cisplatin. The results provide new insights into the mechanisms of cisplatin-induced sensitization of DNA under X-ray irradiation, which could be helpful in the design of new cisplatin-based antitumor drugs.

  11. Unravelling Microbial Communities with DNA-Microarrays: Challengesand Future Directions.

    SciTech Connect

    Wagner, Michael; Smidt, Hauke; Loy, Alexander; Zhou, Jizhong

    2007-03-08

    High-throughput technologies are urgently needed formonitoring the formidable biodiversity and functional capabilities ofmicroorganisms in the environment. Ten years ago, DNA microarrays,miniaturized platforms for highly parallel hybridization reactions, foundtheir way into environmental microbiology and raised great expectationsamong researchers in the field. In this article, we briefly summarize thestate-of-the-art of microarray approaches in microbial ecology researchand discuss in more detail crucial problems and promising solutions.Finally, we outline scenarios for an innovative combination ofmicroarrays with other molecular tools for structure-function analysis ofcomplex microbial communities.

  12. RecG Directs DNA Synthesis during Double-Strand Break Repair.

    PubMed

    Azeroglu, Benura; Mawer, Julia S P; Cockram, Charlotte A; White, Martin A; Hasan, A M Mahedi; Filatenkova, Milana; Leach, David R F

    2016-02-01

    Homologous recombination provides a mechanism of DNA double-strand break repair (DSBR) that requires an intact, homologous template for DNA synthesis. When DNA synthesis associated with DSBR is convergent, the broken DNA strands are replaced and repair is accurate. However, if divergent DNA synthesis is established, over-replication of flanking DNA may occur with deleterious consequences. The RecG protein of Escherichia coli is a helicase and translocase that can re-model 3-way and 4-way DNA structures such as replication forks and Holliday junctions. However, the primary role of RecG in live cells has remained elusive. Here we show that, in the absence of RecG, attempted DSBR is accompanied by divergent DNA replication at the site of an induced chromosomal DNA double-strand break. Furthermore, DNA double-stand ends are generated in a recG mutant at sites known to block replication forks. These double-strand ends, also trigger DSBR and the divergent DNA replication characteristic of this mutant, which can explain over-replication of the terminus region of the chromosome. The loss of DNA associated with unwinding joint molecules previously observed in the absence of RuvAB and RecG, is suppressed by a helicase deficient PriA mutation (priA300), arguing that the action of RecG ensures that PriA is bound correctly on D-loops to direct DNA replication rather than to unwind joint molecules. This has led us to put forward a revised model of homologous recombination in which the re-modelling of branched intermediates by RecG plays a fundamental role in directing DNA synthesis and thus maintaining genomic stability.

  13. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer... directed to undergo a test as soon as is practicable. (c) When practicable, a marine employer should base...

  14. 33 CFR 95.035 - Reasonable cause for directing a chemical test.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... DANGEROUS DRUG § 95.035 Reasonable cause for directing a chemical test. (a) Only a law enforcement officer... directed to undergo a test as soon as is practicable. (c) When practicable, a marine employer should base...

  15. Development of a Daphnia magna DNA microarray for evaluating the toxicity of environmental chemicals.

    PubMed

    Watanabe, Hajime; Takahashi, Eri; Nakamura, Yuko; Oda, Shigeto; Tatarazako, Norihisa; Iguchi, Taisen

    2007-04-01

    Toxic chemical contaminants have a variety of detrimental effects on various species, and the impact of pollutants on ecosystems has become an urgent issue. However, the majority of studies regarding the effects of chemical contaminants have focused on vertebrates. Among aquatic organisms, Daphnia magna has been used extensively to evaluate organism- and population-level responses of invertebrates to pollutants in acute toxicity or reproductive toxicity tests. Although these types of tests can provide information concerning hazardous concentrations of chemicals, they provide no information about their mode of action. Recent advances in molecular genetic techniques have provided tools to better understand the responses of aquatic organisms to pollutants. In the present study, we adapted some of the techniques of molecular genetics to develop new tools, which form the basis for an ecotoxicogenomic assessment of D. magna. Based on a Daphnia expressed sequence tag database, we developed an oligonucleotide-based DNA microarray with high reproducibility. The DNA microarray was used to evaluate gene expression profiles of neonatal daphnids exposed to several different chemicals: Copper sulfate, hydrogen peroxide, pentachlorophenol, or beta-naphthoflavone. Exposure to these chemicals resulted in characteristic patterns of gene expression that were chemical-specific, indicating that the Daphnia DNA microarray can be used for classification of toxic chemicals and for development of a mechanistic understanding of chemical toxicity on a common freshwater organism.

  16. Chemical Reaction Engineering: Current Status and Future Directions.

    ERIC Educational Resources Information Center

    Dudukovic, M. P.

    1987-01-01

    Describes Chemical Reaction Engineering (CRE) as the discipline that quantifies the interplay of transport phenomena and kinetics in relating reactor performance to operating conditions and input variables. Addresses the current status of CRE in both academic and industrial settings and outlines future trends. (TW)

  17. New directions: Atmospheric chemical mechanisms for the future

    NASA Astrophysics Data System (ADS)

    Kaduwela, Ajith; Luecken, Deborah; Carter, William; Derwent, Richard

    2015-12-01

    The atmospheric chemical reaction scheme, commonly referred to as the chemical mechanism, is the portion of an air quality model that represents the atmospheric chemistry of the pollutants. It is at the heart of every air quality model used in research and policy applications to predict and analyse the complex air pollutants: ozone, air toxics and PM2.5. The chemical mechanism should incorporate available information on chemical kinetics and reaction pathways and be the conduit through which the fundamental science of atmospheric chemistry is applied to solve real-world problems. The efficiency and effectiveness of policies developed to reduce exposure to harmful pollutants depend on how well the mechanisms reflect the actual chemistry. If the mechanism has reaction pathways that are incorrectly characterised or completely missing, the resulting predictions may underestimate emission reduction requirements needed to meet public health and ecosystem protection targets, or may overstate the emission reductions needed and cause unnecessary implementation costs. It is therefore essential that mechanisms utilise the best, most up-to-date atmospheric chemistry information available so that policy development is based on air quality model predictions that are robust, transparent and free from scientific challenge. We are concerned that this may not continue to be the case.

  18. Chemical Reaction Engineering: Current Status and Future Directions.

    ERIC Educational Resources Information Center

    Dudukovic, M. P.

    1987-01-01

    Describes Chemical Reaction Engineering (CRE) as the discipline that quantifies the interplay of transport phenomena and kinetics in relating reactor performance to operating conditions and input variables. Addresses the current status of CRE in both academic and industrial settings and outlines future trends. (TW)

  19. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    NASA Astrophysics Data System (ADS)

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  20. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation.

    PubMed

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-03-22

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA-DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA-DNA interactions that we report here may play a role in the chromosome organization and gene regulation.

  1. DNA variant databases: current state and future directions.

    PubMed

    Plazzer, John-Paul; Macrae, Finlay

    2014-01-01

    In this chapter we aim to provide an overview of DNA variant databases, commonly known as Locus-Specific Databases (LSDBs), or Gene-Disease Specific Databases (GDSDBs), but the term variant database will be used for simplicity. We restrict this overview to germ-line variants, particularly as related to Mendelian diseases, which are diseases caused by a variant in a single gene. Common difficulties associated with variant databases and some proposed solutions are reviewed. Finally, systems where technical solutions have been implemented are discussed. This work will be useful for anyone wishing to establish their own variant database, or to learn about the global picture of variant databases, and the technical challenges to be overcome.

  2. Electrochemically directed synthesis of oligonucleotides for DNA microarray fabrication

    PubMed Central

    Egeland, Ryan D.; Southern, Edwin M.

    2005-01-01

    We demonstrate a new method for making oligonucleotide microarrays by synthesis in situ. The method uses conventional DNA synthesis chemistry with an electrochemical deblocking step. Acid is delivered to specific regions on a glass slide, thus allowing nucleotide addition only at chosen sites. The acid is produced by electrochemical oxidation controlled by an array of independent microelectrodes. Deblocking is complete in a few seconds, when competing side-product reactions are minimal. We demonstrate the successful synthesis of 17mers and discrimination of single base pair mismatched hybrids. Features generated in this study are 40 μm wide, with sharply defined edges. The synthetic technique may be applicable to fabrication of other molecular arrays. PMID:16085751

  3. Super-resolution fluorescence imaging of directly labelled DNA: from microscopy standards to living cells.

    PubMed

    Flors, C

    2013-07-01

    Super-resolution fluorescence microscopy is ideally suited to study the complex organization of cell DNA in the 10-100 nm range. Novel methods to image directly labelled DNA, instead of DNA-associated proteins, are being developed and refined. This minireview provides an update of recent progress in super-resolution fluorescence imaging methods for DNA. These developments should allow a deeper understanding of chromatin structure and widen the scope of biological processes that may be investigated with super-resolution fluorescence microscopy. © 2013 The Author Journal of Microscopy © 2013 Royal Microscopical Society.

  4. Differentiation of complex vapor mixtures using versatile DNA-carbon nanotube chemical sensor arrays.

    PubMed

    Kybert, Nicholas J; Lerner, Mitchell B; Yodh, Jeremy S; Preti, George; Johnson, A T Charlie

    2013-03-26

    Vapor sensors based on functionalized carbon nanotubes (NTs) have shown great promise, with high sensitivity conferred by the reduced dimensionality and exceptional electronic properties of the NT. Critical challenges in the development of NT-based sensor arrays for chemical detection include the demonstration of reproducible fabrication methods and functionalization schemes that provide high chemical diversity to the resulting sensors. Here, we outline a scalable approach to fabricating arrays of vapor sensors consisting of NT field effect transistors functionalized with single-stranded DNA (DNA-NT). DNA-NT sensors were highly reproducible, with responses that could be described through equilibrium thermodynamics. Target analytes were detected even in large backgrounds of volatile interferents. DNA-NT sensors were able to discriminate between highly similar molecules, including structural isomers and enantiomers. The sensors were also able to detect subtle variations in complex vapors, including mixtures of structural isomers and mixtures of many volatile organic compounds characteristic of humans.

  5. Controlled DNA Patterning by Chemical Lift-Off Lithography: Matrix Matters.

    PubMed

    Cao, Huan H; Nakatsuka, Nako; Serino, Andrew C; Liao, Wei-Ssu; Cheunkar, Sarawut; Yang, Hongyan; Weiss, Paul S; Andrews, Anne M

    2015-11-24

    Nucleotide arrays require controlled surface densities and minimal nucleotide-substrate interactions to enable highly specific and efficient recognition by corresponding targets. We investigated chemical lift-off lithography with hydroxyl- and oligo(ethylene glycol)-terminated alkanethiol self-assembled monolayers as a means to produce substrates optimized for tethered DNA insertion into post-lift-off regions. Residual alkanethiols in the patterned regions after lift-off lithography enabled the formation of patterned DNA monolayers that favored hybridization with target DNA. Nucleotide densities were tunable by altering surface chemistries and alkanethiol ratios prior to lift-off. Lithography-induced conformational changes in oligo(ethylene glycol)-terminated monolayers hindered nucleotide insertion but could be used to advantage via mixed monolayers or double-lift-off lithography. Compared to thiolated DNA self-assembly alone or with alkanethiol backfilling, preparation of functional nucleotide arrays by chemical lift-off lithography enables superior hybridization efficiency and tunability.

  6. DNA-decorated carbon-nanotube-based chemical sensors on complementary metal oxide semiconductor circuitry.

    PubMed

    Chen, Chia-Ling; Yang, Chih-Feng; Agarwal, Vinay; Kim, Taehoon; Sonkusale, Sameer; Busnaina, Ahmed; Chen, Michelle; Dokmeci, Mehmet R

    2010-03-05

    We present integration of single-stranded DNA (ss-DNA)-decorated single-walled carbon nanotubes (SWNTs) onto complementary metal oxide semiconductor (CMOS) circuitry as nanoscale chemical sensors. SWNTs were assembled onto CMOS circuitry via a low voltage dielectrophoretic (DEP) process. Besides, bare SWNTs are reported to be sensitive to various chemicals, and functionalization of SWNTs with biomolecular complexes further enhances the sensing specificity and sensitivity. After decorating ss-DNA on SWNTs, we have found that the sensing response of the gas sensor was enhanced (up to approximately 300% and approximately 250% for methanol vapor and isopropanol alcohol vapor, respectively) compared with bare SWNTs. The SWNTs coupled with ss-DNA and their integration on CMOS circuitry demonstrates a step towards realizing ultra-sensitive electronic nose applications.

  7. Dynamic and Progressive Control of DNA Origami Conformation by Modulating DNA Helicity with Chemical Adducts.

    PubMed

    Chen, Haorong; Zhang, Hanyu; Pan, Jing; Cha, Tae-Gon; Li, Shiming; Andréasson, Joakim; Choi, Jong Hyun

    2016-05-24

    DNA origami has received enormous attention for its ability to program complex nanostructures with a few nanometer precision. Dynamic origami structures that change conformation in response to environmental cues or external signals hold great promises in sensing and actuation at the nanoscale. The reconfiguration mechanism of existing dynamic origami structures is mostly limited to single-stranded hinges and relies almost exclusively on DNA hybridization or strand displacement. Here, we show an alternative approach by demonstrating on-demand conformation changes with DNA-binding molecules, which intercalate between base pairs and unwind DNA double helices. The unwinding effect modulates the helicity mismatch in DNA origami, which significantly influences the internal stress and the global conformation of the origami structure. We demonstrate the switching of a polymerized origami nanoribbon between different twisting states and a well-constrained torsional deformation in a monomeric origami shaft. The structural transformation is shown to be reversible, and binding isotherms confirm the reconfiguration mechanism. This approach provides a rapid and reversible means to change DNA origami conformation, which can be used for dynamic and progressive control at the nanoscale.

  8. 'Direct PCR' optimization yields a rapid, cost-effective, nondestructive and efficient method for obtaining DNA barcodes without DNA extraction.

    PubMed

    Wong, Wing Hing; Tay, Ywee Chieh; Puniamoorthy, Jayanthi; Balke, Michael; Cranston, Peter S; Meier, Rudolf

    2014-11-01

    Macroinvertebrates that are collected in large numbers pose major problems in basic and applied biodiversity research: identification to species via morphology is often difficult, slow and/or expensive. DNA barcodes are an attractive alternative or complementary source of information. Unfortunately, obtaining DNA barcodes from specimens requires many steps and thus time and money. Here, we promote a short cut to DNA barcoding, that is, a nondestructive PCR method that skips DNA extraction ('direct PCR') and that can be used for a broad range of invertebrate taxa. We demonstrate how direct PCR can be optimized for the larvae and adults of nonbiting midges (Diptera: Chironomidae), a typical invertebrate group that is abundant, contains important bioindicator species, but is difficult to identify based on morphological features. After optimization, direct PCR yields high PCR success rates (>90%), preserves delicate morphological features (e.g. details of genitalia, and larval head capsules) while allowing for the recovery of genomic DNA. We also document that direct PCR can be successfully optimized for a wide range of other invertebrate taxa that need routine barcoding (flies: Culicidae, Drosophilidae, Dolichopodidae, Sepsidae; sea stars: Oreasteridae). Key for obtaining high PCR success rates is optimizing (i) tissue quantity, (ii) body part, (iii) primer pair and (iv) type of Taq polymerase. Unfortunately, not all invertebrates appear suitable because direct PCR has low success rates for other taxa that were tested (e.g. Coleoptera: Dytiscidae, Copepoda, Hymenoptera: Formicidae and Odonata). It appears that the technique is less successful for heavily sclerotized insects and/or those with many exocrine glands.

  9. Effects of seven chemicals on DNA damage in the rat urinary bladder: a comet assay study.

    PubMed

    Wada, Kunio; Yoshida, Toshinori; Takahashi, Naofumi; Matsumoto, Kyomu

    2014-07-15

    The in vivo comet assay has been used for the evaluation of DNA damage and repair in various tissues of rodents. However, it can give false-positive results due to non-specific DNA damage associated with cell death. In this study, we examined whether the in vivo comet assay can distinguish between genotoxic and non-genotoxic DNA damage in urinary bladder cells, by using the following seven chemicals related to urinary bladder carcinogenesis in rodents: N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN), glycidol, 2,2-bis(bromomethyl)-1,3-propanediol (BMP), 2-nitroanisole (2-NA), benzyl isothiocyanate (BITC), uracil, and melamine. BBN, glycidol, BMP, and 2-NA are known to be Ames test-positive and they are expected to produce DNA damage in the absence of cytotoxicity. BITC, uracil, and melamine are Ames test-negative with metabolic activation but have the potential to induce non-specific DNA damage due to cytotoxicity. The test chemicals were administered orally to male Sprague-Dawley rats (five per group) for each of two consecutive days. Urinary bladders were sampled 3h after the second administration and urothelial cells were analyzed by the comet assay and subjected to histopathological examination to evaluate cytotoxicity. In the urinary bladders of rats treated with BBN, glycidol, and BMP, DNA damage was detected. In contrast, 2-NA induced neither DNA damage nor cytotoxicity. The non-genotoxic chemicals (BITC, uracil, and melamine) did not induce DNA damage in the urinary bladders under conditions where some histopathological changes were observed. The results indicate that the comet assay could distinguish between genotoxic and non-genotoxic chemicals and that no false-positive responses were obtained.

  10. Incorporation of viral DNA packaging motor channel in lipid bilayers for real-time, single-molecule sensing of chemicals and double-stranded DNA

    PubMed Central

    Haque, Farzin; Geng, Jia; Montemagno, Carlo; Guo, Peixuan

    2013-01-01

    Over the past decade, nanopores have rapidly emerged as stochastic biosensors. This protocol describes the cloning, expression, and purification of the channel of bacteriophage phi29 DNA packaging nanomotor and its subsequent incorporation into lipid membranes for single-pore sensing of dsDNA and chemicals. The membrane-embedded phi29 nanochannels remain functional and structurally intact under a range of conditions. When ions and macromolecules translocate through these nanochannels, reliable fingerprint changes in conductance are observed. Compared with other well studied biological pores, the phi29 nanochannel has a larger cross-sectional area, which enables the translocation of dsDNA. Furthermore, specific amino acids can be introduced by site-directed mutagenesis within the large cavity of the channel to conjugate receptors that are able to bind specific ligands or analytes for desired applications. The lipid membrane embedded nanochannel system has immense potential nanotechnological and biomedical applications in bioreactors, environmental sensing, drug monitoring, controlled drug delivery, early disease diagnosis, and high-throughput DNA sequencing. The total time required for completing one round of this protocol is around one month. PMID:23348364

  11. Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

    NASA Astrophysics Data System (ADS)

    Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

    We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

  12. Discovery of small-molecule interleukin-2 inhibitors from a DNA-encoded chemical library.

    PubMed

    Leimbacher, Markus; Zhang, Yixin; Mannocci, Luca; Stravs, Michael; Geppert, Tim; Scheuermann, Jörg; Schneider, Gisbert; Neri, Dario

    2012-06-18

    Libraries of chemical compounds individually coupled to encoding DNA tags (DNA-encoded chemical libraries) hold promise to facilitate exceptionally efficient ligand discovery. We constructed a high-quality DNA-encoded chemical library comprising 30,000 drug-like compounds; this was screened in 170 different affinity capture experiments. High-throughput sequencing allowed the evaluation of 120 million DNA codes for a systematic analysis of selection strategies and statistically robust identification of binding molecules. Selections performed against the tumor-associated antigen carbonic anhydrase IX (CA IX) and the pro-inflammatory cytokine interleukin-2 (IL-2) yielded potent inhibitors with exquisite target specificity. The binding mode of the revealed pharmacophore against IL-2 was confirmed by molecular docking. Our findings suggest that DNA-encoded chemical libraries allow the facile identification of drug-like ligands principally to any protein of choice, including molecules capable of disrupting high-affinity protein-protein interactions. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Programming macro-materials from DNA-directed self-assembly.

    PubMed

    Zhang, Xuena; Wang, Rong; Xue, Gi

    2015-03-14

    DNA is a powerful tool that can be attached to nano- and micro-objects and direct the self-assembly through base pairing. Since the strategy of DNA programmable nanoparticle self-assembly was first introduced in 1996, it has remained challenging to use DNA to make powerful diagnostic tools and to make designed materials with novel properties and highly ordered crystal structures. In this review, we summarize recent experimental and theoretical developments of DNA-programmable self-assembly into three-dimensional (3D) materials. Various types of aggregates and 3D crystal structures obtained from an experimental DNA-driven assembly are introduced. Furthermore, theoretical calculations and simulations for DNA-mediated assembly systems are described and we highlight some typical theoretical models for Monte Carlo and Molecular Dynamics simulations.

  14. Electrochemical direct immobilization of DNA sequences for label-free herpes virus detection

    NASA Astrophysics Data System (ADS)

    Tam, Phuong Dinh; Trung, Tran; Tuan, Mai Anh; Chien, Nguyen Duc

    2009-09-01

    DNA sequences/bio-macromolecules of herpes virus (5'-AT CAC CGA CCC GGA GAG GGA C-3') were directly immobilized into polypyrrole matrix by using the cyclic voltammetry method, and grafted onto arrays of interdigitated platinum microelectrodes. The morphology surface of the obtained PPy/DNA of herpes virus composite films was investigated by a FESEM Hitachi-S 4800. Fourier transform infrared spectroscopy (FTIR) was used to characterize the PPy/DNA film and to study the specific interactions that may exist between DNA biomacromolecules and PPy chains. Attempts are made to use these PPy/DNA composite films for label-free herpes virus detection revealed a response time of 60 s in solutions containing as low as 2 nM DNA concentration, and self life of six months when immerged in double distilled water and kept refrigerated.

  15. Structural, conformational and thermodynamic aspects of groove-directed-intercalation of flavopiridol into DNA.

    PubMed

    Ray, Bhumika; Agarwal, Shweta; Lohani, Neelam; Rajeswari, Moganty R; Mehrotra, Ranjana

    2016-11-01

    Certain plant-derived alkaloids and flavonoids have shown propitious cytotoxic acitvity against different types of cancer, having deoxyribose nucleic acid (DNA) as their main cellular target. Flavopiridol, a semi-synthetic derivative of rohitukine (a natural compound isolated from Dysoxylum binectariferum plant), has attained much attention owing to its anticancer potential against various haematological malignancies and solid tumours. This work focuses on investigating interaction between flavopiridol and DNA at molecular level in order to decipher its underlying mechanism of action, which is not well understood. To define direct influence of flavopiridol on the structural, conformational and thermodynamic aspects of DNA, various spectroscopic and calorimetric techniques have been used. ATR-FTIR and SERS spectral outcomes indicate a novel insight into groove-directed-intercalation of flavopiridol into DNA via direct binding with nitrogenous bases guanine (C6=O6) and thymine (C2=O2) in DNA groove together with slight external binding to its sugar-phosphate backbone. Circular dichroism spectral analysis of flavopiridol-DNA complexes suggests perturbation in native B-conformation of DNA and its transition into C-form, which may be localized up to a few base pairs of DNA. UV-visible spectroscopic results illustrate dual binding mode of flavopiridol when interacts with DNA having association constant, Ka = 1.18 × 10(4) M(-1). This suggests moderate type of interaction between flavopiridol and DNA. Further, UV melting analysis also supports spectroscopic outcomes. Thermodynamically, flavopiridol-DNA complexation is an enthalpy-driven exothermic process. These conclusions drawn from this study could be helpful in unveiling mechanism of cytoxicity induced by flavopiridol that can be further applied in the development of flavonoid-based new chemotherapeutics with more specificity and better efficacy.

  16. Use of Chemicals to Inhibit DNA Replication, Transcription, and Protein Synthesis to Study Zygotic Genome Activation.

    PubMed

    Uh, Kyungjun; Lee, Kiho

    2017-01-01

    Maternal-to-zygotic transition is an event that developmental control of early embryos is switched from oocyte-derived factors to the zygotic genome. Ability to inhibit DNA replication, transcription, and translation is an important tool in studying events, such as zygotic genome activation, during embyogenesis. Here, we describe approaches to block DNA replication, transcription, and translation using chemical inhibitors. Then we also demonstrate how the transcript level of a maternally inherited gene, ten-eleven translocation methylcytosine dioxygenase 3, responses to the chemical treatments.

  17. Bending the rules of transcriptional repression: tightly looped DNA directly represses T7 RNA polymerase.

    PubMed

    Lionberger, Troy A; Meyhöfer, Edgar

    2010-08-09

    From supercoiled DNA to the tight loops of DNA formed by some gene repressors, DNA in cells is often highly bent. Despite evidence that transcription by RNA polymerase (RNAP) is affected in systems where DNA is deformed significantly, the mechanistic details underlying the relationship between polymerase function and mechanically stressed DNA remain unclear. Seeking to gain additional insight into the regulatory consequences of highly bent DNA, we hypothesize that tightly looping DNA is alone sufficient to repress transcription. To test this hypothesis, we have developed an assay to quantify transcription elongation by bacteriophage T7 RNAP on small, circular DNA templates approximately 100 bp in size. From these highly bent transcription templates, we observe that the elongation velocity and processivity can be repressed by at least two orders of magnitude. Further, we show that minicircle templates sustaining variable levels of twist yield only moderate differences in repression efficiency. We therefore conclude that the bending mechanics within the minicircle templates dominate the observed repression. Our results support a model in which RNAP function is highly dependent on the bending mechanics of DNA and are suggestive of a direct, regulatory role played by the template itself in regulatory systems where DNA is known to be highly bent. 2010 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  18. Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase

    PubMed Central

    Lionberger, Troy A.; Meyhöfer, Edgar

    2010-01-01

    From supercoiled DNA to the tight loops of DNA formed by some gene repressors, DNA in cells is often highly bent. Despite evidence that transcription by RNA polymerase (RNAP) is affected in systems where DNA is deformed significantly, the mechanistic details underlying the relationship between polymerase function and mechanically stressed DNA remain unclear. Seeking to gain additional insight into the regulatory consequences of highly bent DNA, we hypothesize that tightly looping DNA is alone sufficient to repress transcription. To test this hypothesis, we have developed an assay to quantify transcription elongation by bacteriophage T7 RNAP on small, circular DNA templates ∼100 bp in size. From these highly bent transcription templates, we observe that the elongation velocity and processivity can be repressed by at least two orders of magnitude. Further, we show that minicircle templates sustaining variable levels of twist yield only moderate differences in repression efficiency. We therefore conclude that the bending mechanics within the minicircle templates dominate the observed repression. Our results support a model in which RNAP function is highly dependent on the bending mechanics of DNA and are suggestive of a direct, regulatory role played by the template itself in regulatory systems where DNA is known to be highly bent. PMID:20712997

  19. Stainless steel and silicon direct interface synthesis: Chemical bonding effects

    NASA Astrophysics Data System (ADS)

    Cox, Michael J.

    Planar stainless steel/stainless steel interfaces, with and without a titanium interlayer and silicon/silicon interfaces have been produced in an ultra high vacuum (UHV) diffusion bonding/deposition instrument. Interface synthesis was accomplished by diffusion bonding two substrates after subjecting the substrate surfaces to a variety of pre-bonding treatments including heat treating, ion-beam sputter cleaning and thin film deposition. Chemical characterization was performed in situ by Auger electron spectroscopy (AES) prior to deposition and/or bonding and ex situ by energy dispersive X-ray spectroscopy (EDS) and electron energy loss spectroscopy (EELS). Additionally, transmission electron microscopy (TEM), scanning electron microscopy (SEM) and atomic force microscopy (AFM) were used to study interfaces before and after bonding. Diffusion bonding behavior of stainless steel depends strongly on the chemistry of the surfaces to be bonded. Very smooth, mechanically polished and lapped substrates would bond completely in UHV in 1 hour at 1000°C under 3.5 MPa uniaxial pressure, if the native oxide on the substrates was removed by ion beam cleaning. No voids were observed in these bonded interfaces as studied by TEM and the strength was equal to the unbonded bare material. When an electron beam deposited, 200 A titanium interlayer was added to the stainless steel interface, while bonding under the same conditions, mechanical tensile testing resulted in very low strength when compared with that of chemically clean stainless steel interfaces. Analytical inspection of the interfaces, performed with EELS, EDS, and convergent beam electron diffraction (CBED) coupled with images from TEM and SEM, showed the reason for the significantly reduced strength is a result of limited contact area and delamination between titanium carbide particles precipitated in the interface. Silicon wafers bicrystals were synthesized by bonding two single-crystal substrates. Silicon wafers were

  20. Tankyrase 1 Inhibitors with Drug-like Properties Identified by Screening a DNA-Encoded Chemical Library.

    PubMed

    Samain, Florent; Ekblad, Torun; Mikutis, Gediminas; Zhong, Nan; Zimmermann, Mauro; Nauer, Angela; Bajic, Davor; Decurtins, Willy; Scheuermann, Jörg; Brown, Peter J; Hall, Jonathan; Gräslund, Susanne; Schüler, Herwig; Neri, Dario; Franzini, Raphael M

    2015-06-25

    We describe the synthesis and screening of a DNA-encoded chemical library containing 76230 compounds. In this library, sets of amines and carboxylic acids are directly linked producing encoded compounds with compact structures and drug-like properties. Affinity screening of this library yielded inhibitors of the potential pharmaceutical target tankyrase 1, a poly(ADP-ribose) polymerase. These compounds have drug-like characteristics, and the most potent hit compound (X066/Y469) inhibited tankyrase 1 with an IC50 value of 250 nM.

  1. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    PubMed

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  2. New Modeling Approaches to Study DNA Damage by the Direct and Indirect Effects of Ionizing Radiation

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.

    2012-01-01

    DNA is damaged both by the direct and indirect effects of radiation. In the direct effect, the DNA itself is ionized, whereas the indirect effect involves the radiolysis of the water molecules surrounding the DNA and the subsequent reaction of the DNA with radical products. While this problem has been studied for many years, many unknowns still exist. To study this problem, we have developed the computer code RITRACKS [1], which simulates the radiation track structure for heavy ions and electrons, calculating all energy deposition events and the coordinates of all species produced by the water radiolysis. In this work, we plan to simulate DNA damage by using the crystal structure of a nucleosome and calculations performed by RITRACKS. The energy deposition events are used to calculate the dose deposited in nanovolumes [2] and therefore can be used to simulate the direct effect of the radiation. Using the positions of the radiolytic species with a radiation chemistry code [3] it will be possible to simulate DNA damage by indirect effect. The simulation results can be compared with results from previous calculations such as the frequencies of simple and complex strand breaks [4] and with newer experimental data using surrogate markers of DNA double ]strand breaks such as . ]H2AX foci [5].

  3. Direct Sequencing from the Minimal Number of DNA Molecules Needed to Fill a 454 Picotiterplate

    PubMed Central

    Martínez-Priego, Llúcia; D’Auria, Giussepe; Calafell, Francesc; Moya, Andrés

    2014-01-01

    The large amount of DNA needed to prepare a library in next generation sequencing protocols hinders direct sequencing of small DNA samples. This limitation is usually overcome by the enrichment of such samples with whole genome amplification (WGA), mostly by multiple displacement amplification (MDA) based on φ29 polymerase. However, this technique can be biased by the GC content of the sample and is prone to the development of chimeras as well as contamination during enrichment, which contributes to undesired noise during sequence data analysis, and also hampers the proper functional and/or taxonomic assignments. An alternative to MDA is direct DNA sequencing (DS), which represents the theoretical gold standard in genome sequencing. In this work, we explore the possibility of sequencing the genome of Escherichia coli from the minimum number of DNA molecules required for pyrosequencing, according to the notion of one-bead-one-molecule. Using an optimized protocol for DS, we constructed a shotgun library containing the minimum number of DNA molecules needed to fill a selected region of a picotiterplate. We gathered most of the reference genome extension with uniform coverage. We compared the DS method with MDA applied to the same amount of starting DNA. As expected, MDA yielded a sparse and biased read distribution, with a very high amount of unassigned and unspecific DNA amplifications. The optimized DS protocol allows unbiased sequencing to be performed from samples with a very small amount of DNA. PMID:24887077

  4. Development of (19)F-NMR chemical shift detection of DNA B-Z equilibrium using (19)F-NMR.

    PubMed

    Nakamura, S; Yang, H; Hirata, C; Kersaudy, F; Fujimoto, K

    2017-06-28

    Various DNA conformational changes are in correlation with biological events. In particular, DNA B-Z equilibrium showed a high correlation with translation and transcription. In this study, we developed a DNA probe containing 5-trifluoromethylcytidine or 5-trifluoromethylthymidine to detect DNA B-Z equilibrium using (19)F-NMR. Its probe enabled the quantitative detection of B-, Z-, and ss-DNA based on (19)F-NMR chemical shift change.

  5. Direct measurement of torque in an optical trap and its application to double-strand DNA.

    PubMed

    Oroszi, László; Galajda, Péter; Kirei, Huba; Bottka, Sándor; Ormos, Pál

    2006-08-04

    We present a method that offers the possibility to directly apply and measure torque on particles in an optical trap. It can be used to rotationally manipulate biopolymers attached to appropriate particles. A flat object is trapped and oriented in the focus of a linearly polarized laser light. The direction and power of the orientational trap are controlled by the polarization state of the light. As a demonstration of the capabilities of the method, we examined the torsional stiffness of dsDNA (lambda-DNA) in its linear torsional regime by directly measuring the torque generated by the molecule.

  6. A Strategy for Direct Chemical Activation of the Retinoblastoma Protein.

    PubMed

    Pye, Cameron R; Bray, Walter M; Brown, Elise R; Burke, Jason R; Lokey, R Scott; Rubin, Seth M

    2016-05-20

    The retinoblastoma (Rb) tumor suppressor protein negatively regulates cell proliferation by binding and inhibiting E2F transcription factors. Rb inactivation occurs in cancer cells upon cyclin-dependent kinase (Cdk) phosphorylation, which induces E2F release and activation of cell cycle genes. We present a strategy for activating phosphorylated Rb with molecules that bind Rb directly and enhance affinity for E2F. We developed a fluorescence polarization assay that can detect the effect of exogenous compounds on modulating affinity of Rb for the E2F transactivation domain. We found that a peptide capable of disrupting the compact inactive Rb conformation increases affinity of the repressive Rb-E2F complex. Our results demonstrate the feasibility of discovering novel molecules that target the cell cycle and proliferation through directly targeting Rb rather than upstream kinase activity.

  7. A Strategy for Direct Chemical Activation of the Retinoblastoma Protein

    PubMed Central

    Pye, Cameron R.; Bray, Walter M.; Brown, Elise R.; Burke, Jason R.; Lokey, R. Scott; Rubin, Seth M.

    2016-01-01

    The retinoblastoma (Rb) tumor suppressor protein negatively regulates cell proliferation by binding and inhibiting E2F transcription factors. Rb inactivation occurs in cancer cells upon cyclin-dependent kinase (Cdk) phosphorylation, which induces E2F release and activation of cell cycle genes. We present a strategy for activating phosphorylated Rb with molecules that bind Rb directly and enhance affinity for E2F. We developed a fluorescence polarization assay that can detect the effect of exogenous compounds on modulating affinity of Rb for the E2F transactivation domain. We found that a peptide capable of disrupting the compact inactive Rb conformation increases affinity of the repressive Rb–E2F complex. Our results demonstrate the feasibility of discovering novel molecules that target the cell cycle and proliferation through directly targeting Rb rather than upstream kinase activity. PMID:26845289

  8. Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays

    PubMed Central

    2011-01-01

    Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062

  9. Direct evidence for sequence-dependent attraction between double-stranded DNA controlled by methylation

    PubMed Central

    Yoo, Jejoong; Kim, Hajin; Aksimentiev, Aleksei; Ha, Taekjip

    2016-01-01

    Although proteins mediate highly ordered DNA organization in vivo, theoretical studies suggest that homologous DNA duplexes can preferentially associate with one another even in the absence of proteins. Here we combine molecular dynamics simulations with single-molecule fluorescence resonance energy transfer experiments to examine the interactions between duplex DNA in the presence of spermine, a biological polycation. We find that AT-rich DNA duplexes associate more strongly than GC-rich duplexes, regardless of the sequence homology. Methyl groups of thymine acts as a steric block, relocating spermine from major grooves to interhelical regions, thereby increasing DNA–DNA attraction. Indeed, methylation of cytosines makes attraction between GC-rich DNA as strong as that between AT-rich DNA. Recent genome-wide chromosome organization studies showed that remote contact frequencies are higher for AT-rich and methylated DNA, suggesting that direct DNA–DNA interactions that we report here may play a role in the chromosome organization and gene regulation. PMID:27001929

  10. DNA methylation: a mechanism linking environmental chemical exposures to risk of autism spectrum disorders?

    PubMed Central

    Keil, Kimberly P.; Lein, Pamela J.

    2016-01-01

    There is now compelling evidence that gene by environment interactions are important in the etiology of autism spectrum disorders (ASDs). However, the mechanisms by which environmental factors interact with genetic susceptibilities to confer individual risk for ASD remain a significant knowledge gap in the field. The epigenome, and in particular DNA methylation, is a critical gene expression regulatory mechanism in normal and pathogenic brain development. DNA methylation can be influenced by environmental factors such as diet, hormones, stress, drugs, or exposure to environmental chemicals, suggesting that environmental factors may contribute to adverse neurodevelopmental outcomes of relevance to ASD via effects on DNA methylation in the developing brain. In this review, we describe epidemiological and experimental evidence implicating altered DNA methylation as a potential mechanism by which environmental chemicals confer risk for ASD, using polychlorinated biphenyls (PCBs), lead, and bisphenol A (BPA) as examples. Understanding how environmental chemical exposures influence DNA methylation and how these epigenetic changes modulate the risk and/or severity of ASD will not only provide mechanistic insight regarding gene-environment interactions of relevance to ASD but may also suggest potential intervention strategies for these and potentially other neurodevelopmental disorders. PMID:27158529

  11. Identification of structure-activity relationships from screening a structurally compact DNA-encoded chemical library.

    PubMed

    Franzini, Raphael M; Ekblad, Torun; Zhong, Nan; Wichert, Moreno; Decurtins, Willy; Nauer, Angela; Zimmermann, Mauro; Samain, Florent; Scheuermann, Jörg; Brown, Peter J; Hall, Jonathan; Gräslund, Susanne; Schüler, Herwig; Neri, Dario

    2015-03-23

    Methods for the rapid and inexpensive discovery of hit compounds are essential for pharmaceutical research and DNA-encoded chemical libraries represent promising tools for this purpose. We here report on the design and synthesis of DAL-100K, a DNA-encoded chemical library containing 103 200 structurally compact compounds. Affinity screening experiments and DNA-sequencing analysis provided ligands with nanomolar affinities to several proteins, including prostate-specific membrane antigen and tankyrase 1. Correlations of sequence counts with binding affinities and potencies of enzyme inhibition were observed and enabled the identification of structural features critical for activity. These results indicate that libraries of this type represent a useful source of small-molecule binders for target proteins of pharmaceutical interest and information on structural features important for binding.

  12. DNA binding properties of a chemically synthesized DNA binding domain of hRFX1.

    PubMed

    Cornille, F; Emery, P; Schüler, W; Lenoir, C; Mach, B; Roques, B P; Reith, W

    1998-05-01

    The RFX DNA binding domain (DBD) is a novel highly conserved motif belonging to a large number of dimeric DNA binding proteins which have diverse regulatory functions in eukaryotic organisms, ranging from yeasts to human. To characterize this novel motif, solid phase synthesis of a 76mer polypeptide corresponding to the DBD of human hRFX1 (hRFX1/DBD), a prototypical member of the RFX family, has been optimized to yield large quantities (approximately 90 mg) of pure compound. Preliminary two-dimensional1H NMR experiments suggested the presence of helical regions in this sequence in agreement with previously reported secondary structure predictions. In gel mobility shift assays, this synthetic peptide was shown to bind in a cooperative manner the 23mer duplex oligodeoxynucleotide corresponding to the binding site of hRFX1, with a 2:1 stoichoimetry due to an inverse repeat present in the 23mer. The stoichiometry of this complex was reduced to 1:1 by decreasing the length of the DNA sequence to a 13mer oligonucleotide containing a single half-site. Surface plasmon resonance measurements were achieved using this 5'-biotylinated 13mer oligonucleotide immobilized on an avidin-coated sensor chip. Using this method an association constant (K a = 4 x 10(5)/M/s), a dissociation constant (K d = 6 x 10(-2)/s) and an equilibrium dissociation constant (K D = 153 nM) were determined for binding of hRFX1/DBD to the double-stranded 13mer oligonucleotide. In the presence of hRFX1/DBD the melting temperature of the 13mer DNA was increased by 16 degreesC, illustrating stabilization of the double-stranded conformation induced by the peptide.

  13. DNA binding properties of a chemically synthesized DNA binding domain of hRFX1.

    PubMed Central

    Cornille, F; Emery, P; Schüler, W; Lenoir, C; Mach, B; Roques, B P; Reith, W

    1998-01-01

    The RFX DNA binding domain (DBD) is a novel highly conserved motif belonging to a large number of dimeric DNA binding proteins which have diverse regulatory functions in eukaryotic organisms, ranging from yeasts to human. To characterize this novel motif, solid phase synthesis of a 76mer polypeptide corresponding to the DBD of human hRFX1 (hRFX1/DBD), a prototypical member of the RFX family, has been optimized to yield large quantities (approximately 90 mg) of pure compound. Preliminary two-dimensional1H NMR experiments suggested the presence of helical regions in this sequence in agreement with previously reported secondary structure predictions. In gel mobility shift assays, this synthetic peptide was shown to bind in a cooperative manner the 23mer duplex oligodeoxynucleotide corresponding to the binding site of hRFX1, with a 2:1 stoichoimetry due to an inverse repeat present in the 23mer. The stoichiometry of this complex was reduced to 1:1 by decreasing the length of the DNA sequence to a 13mer oligonucleotide containing a single half-site. Surface plasmon resonance measurements were achieved using this 5'-biotylinated 13mer oligonucleotide immobilized on an avidin-coated sensor chip. Using this method an association constant (K a = 4 x 10(5)/M/s), a dissociation constant (K d = 6 x 10(-2)/s) and an equilibrium dissociation constant (K D = 153 nM) were determined for binding of hRFX1/DBD to the double-stranded 13mer oligonucleotide. In the presence of hRFX1/DBD the melting temperature of the 13mer DNA was increased by 16 degreesC, illustrating stabilization of the double-stranded conformation induced by the peptide. PMID:9547272

  14. A comparison of RNA with DNA in template-directed synthesis

    NASA Technical Reports Server (NTRS)

    Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.

  15. Quantitative field testing Rotylenchulus reniformis DNA from metagenomic samples isolated directly from soil.

    PubMed

    Showmaker, Kurt; Lawrence, Gary W; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P

    2011-01-01

    A quantitative PCR procedure targeting the β-tubulin gene determined the number of Rotylenchulus reniformis Linford & Oliveira 1940 in metagenomic DNA samples isolated from soil. Of note, this outcome was in the presence of other soil-dwelling plant parasitic nematodes including its sister genus Helicotylenchus Steiner, 1945. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from soil.

  16. Direct participation of DNA in the formation of singlet oxygen and base damage under UVA irradiation.

    PubMed

    Yagura, Teiti; Schuch, André Passaglia; Garcia, Camila Carrião Machado; Rocha, Clarissa Ribeiro Reily; Moreno, Natália Cestari; Angeli, José Pedro Friedmann; Mendes, Davi; Severino, Divinomar; Bianchini Sanchez, Angelica; Di Mascio, Paolo; de Medeiros, Marisa Helena Gennari; Menck, Carlos Frederico Martins

    2017-07-01

    UVA light is hardly absorbed by the DNA molecule, but recent works point to a direct mechanism of DNA lesion by these wavelengths. UVA light also excite endogenous chromophores, which causes DNA damage through ROS. In this study, DNA samples were irradiated with UVA light in different conditions to investigate possible mechanisms involved in the induction of DNA damage. The different types of DNA lesions formed after irradiation were determined through the use of endonucleases, which recognize and cleave sites containing oxidized bases and cyclobutane pyrimidine dimers (CPDs), as well as through antibody recognition. The formation of 8-oxo-7,8-dihydro-2'-deoxyguanine (8-oxodG) was also studied in more detail using electrochemical detection. The results show that high NaCl concentration and concentrated DNA are capable of reducing the induction of CPDs. Moreover, concerning damage caused by oxidative stress, the presence of sodium azide and metal chelators reduce their induction, while deuterated water increases the amounts of oxidized bases, confirming the involvement of singlet oxygen in the generation of these lesions. Curiously, however, high concentrations of DNA also enhanced the formation of oxidized bases, in a reaction that paralleled the increase in the formation of singlet oxygen in the solution. This was interpreted as being due to an intrinsic photosensitization mechanism, depending directly on the DNA molecule to absorb UVA and generate singlet oxygen. Therefore, the DNA molecule itself may act as a chromophore for UVA light, locally producing a damaging agent, which may lead to even greater concerns about the deleterious impact of sunlight. Copyright © 2017 Elsevier Inc. All rights reserved.

  17. Geant4-DNA simulation of DNA damage caused by direct and indirect radiation effects and comparison with biological data.

    NASA Astrophysics Data System (ADS)

    Villagrasa, Carmen; Meylan, Sylvain; Gonon, Geraldine; Gruel, Gaëtan; Giesen, Ulrich; Bueno, Marta; Rabus, Hans

    2017-09-01

    In this work we present results obtained in the frame of the BioQuaRT project. The objective of the study was the correlation between the number of radiation-induced double strand breaks (DSB) of the DNA molecule and the probability of detecting nuclear foci after targeted microbeam irradiation of cells with protons and alpha particles of different LET. The former were obtained by simulation with new methods integrated into Geant4-DNA that permit calculating the number of DSB in a DNA target model induced by direct and indirect radiation effects. A particular focus was laid in this work on evaluating the influence of different criteria applied to the simulated results for predicting the formation of a direct SSB. Indeed, these criteria have an important impact on the predicted number of DSB per particle track and its dependence with LET. Among the criteria tested in this work, the case that a direct radiation interaction leads to a strand break if the cumulative energy deposited in the backbone part of one nucleotide exceeds a threshold of 17.5 eV leads to the best agreement with the relative LET dependence of number of radiation induced foci. Further calculations and experimental data are nevertheless needed in order to fix the simulation parameters and to help interpreting the biological experimental data observed by immunofluorescence in terms of the DSB complexity.

  18. The splicing machinery promotes RNA-directed DNA methylation and transcriptional silencing in Arabidopsis

    PubMed Central

    Zhang, Cui-Jun; Zhou, Jin-Xing; Liu, Jun; Ma, Ze-Yang; Zhang, Su-Wei; Dou, Kun; Huang, Huan-Wei; Cai, Tao; Liu, Renyi; Zhu, Jian-Kang; He, Xin-Jian

    2013-01-01

    DNA methylation in transposons and other DNA repeats is conserved in plants as well as in animals. In Arabidopsis thaliana, an RNA-directed DNA methylation (RdDM) pathway directs de novo DNA methylation. We performed a forward genetic screen for suppressors of the DNA demethylase mutant ros1 and identified a novel Zinc-finger and OCRE domain-containing Protein 1 (ZOP1) that promotes Pol IV-dependent siRNA accumulation, DNA methylation, and transcriptional silencing. Whole-genome methods disclosed the genome-wide effects of zop1 on Pol IV-dependent siRNA accumulation and DNA methylation, suggesting that ZOP1 has both RdDM-dependent and -independent roles in transcriptional silencing. We demonstrated that ZOP1 is a pre-mRNA splicing factor that associates with several typical components of the splicing machinery as well as with Pol II. Immunofluorescence assay revealed that ZOP1 overlaps with Cajal body and is partially colocalized with NRPE1 and DRM2. Moreover, we found that the other development-defective splicing mutants tested including mac3a3b, mos4, mos12 and mos14 show defects in RdDM and transcriptional silencing. We propose that the splicing machinery rather than specific splicing factors is involved in promoting RdDM and transcriptional silencing. PMID:23524848

  19. Direct electrochemical stripping detection of cystic-fibrosis-related DNA linked through cadmium sulfide quantum dots.

    PubMed

    Marin, Sergio; Merkoçi, Arben

    2009-02-04

    Electrochemical detection of a cadmium sulfide quantum dots (CdS QDs)-DNA complex connected to paramagnetic microbeads (MB) was performed without the need for chemical dissolving. The method is based on dropping 20 microl of CdS QD-DNA-MB suspension on the surface of a screen-printed electrode. It is followed by magnetic collection on the surface of the working electrode and electrochemical detection using square-wave voltammetry (SWV), giving a well-shaped and sensitive analytical signal. A cystic-fibrosis-related DNA sequence was sandwiched between the two DNA probes. One DNA probe is linked via biotin-streptavidin bonding with MB and the other one via thiol groups with the CdS QD used as tags. Nonspecific signals of DNA were minimized using a blocking agent and the results obtained were successfully employed in a model DNA sensor with an interest in future applications in the clinical field. The developed nanoparticle biosensing system may offer numerous opportunities in other fields where fast, low cost and efficient detection of small volume samples is required.

  20. Direct electrochemical stripping detection of cystic-fibrosis-related DNA linked through cadmium sulfide quantum dots

    NASA Astrophysics Data System (ADS)

    Marin, Sergio; Merkoçi, Arben

    2009-02-01

    Electrochemical detection of a cadmium sulfide quantum dots (CdS QDs)-DNA complex connected to paramagnetic microbeads (MB) was performed without the need for chemical dissolving. The method is based on dropping 20 µl of CdS QD-DNA-MB suspension on the surface of a screen-printed electrode. It is followed by magnetic collection on the surface of the working electrode and electrochemical detection using square-wave voltammetry (SWV), giving a well-shaped and sensitive analytical signal. A cystic-fibrosis-related DNA sequence was sandwiched between the two DNA probes. One DNA probe is linked via biotin-streptavidin bonding with MB and the other one via thiol groups with the CdS QD used as tags. Nonspecific signals of DNA were minimized using a blocking agent and the results obtained were successfully employed in a model DNA sensor with an interest in future applications in the clinical field. The developed nanoparticle biosensing system may offer numerous opportunities in other fields where fast, low cost and efficient detection of small volume samples is required.

  1. Automated screening for small organic ligands using DNA-encoded chemical libraries.

    PubMed

    Decurtins, Willy; Wichert, Moreno; Franzini, Raphael M; Buller, Fabian; Stravs, Michael A; Zhang, Yixin; Neri, Dario; Scheuermann, Jörg

    2016-04-01

    DNA-encoded chemical libraries (DECLs) are collections of organic compounds that are individually linked to different oligonucleotides, serving as amplifiable identification barcodes. As all compounds in the library can be identified by their DNA tags, they can be mixed and used in affinity-capture experiments on target proteins of interest. In this protocol, we describe the screening process that allows the identification of the few binding molecules within the multiplicity of library members. First, the automated affinity selection process physically isolates binding library members. Second, the DNA codes of the isolated binders are PCR-amplified and subjected to high-throughput DNA sequencing. Third, the obtained sequencing data are evaluated using a C++ program and the results are displayed using MATLAB software. The resulting selection fingerprints facilitate the discrimination of binding from nonbinding library members. The described procedures allow the identification of small organic ligands to biological targets from a DECL within 10 d.

  2. DNA-damaging agents in cancer chemotherapy: serendipity and chemical biology.

    PubMed

    Cheung-Ong, Kahlin; Giaever, Guri; Nislow, Corey

    2013-05-23

    DNA-damaging agents have a long history of use in cancer chemotherapy. The full extent of their cellular mechanisms, which is essential to balance efficacy and toxicity, is often unclear. In addition, the use of many anticancer drugs is limited by dose-limiting toxicities as well as the development of drug resistance. Novel anticancer compounds are continually being developed in the hopes of addressing these limitations; however, it is essential to be able to evaluate these compounds for their mechanisms of action. This review covers the current DNA-damaging agents used in the clinic, discusses their limitations, and describes the use of chemical genomics to uncover new information about the DNA damage response network and to evaluate novel DNA-damaging compounds.

  3. A New Direct Single-Molecule Observation Method for DNA Synthesis Reaction Using Fluorescent Replication Protein A

    PubMed Central

    Takahashi, Shunsuke; Kawasaki, Shohei; Miyata, Hidefumi; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-ichi; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2014-01-01

    Using a single-stranded region tracing system, single-molecule DNA synthesis reactions were directly observed in microflow channels. The direct single-molecule observations of DNA synthesis were labeled with a fusion protein consisting of the ssDNA-binding domain of a 70-kDa subunit of replication protein A and enhanced yellow fluorescent protein (RPA-YFP). Our method was suitable for measurement of DNA synthesis reaction rates with control of the ssλDNA form as stretched ssλDNA (+flow) and random coiled ssλDNA (−flow) via buffer flow. Sequentially captured photographs demonstrated that the synthesized region of an ssλDNA molecule monotonously increased with the reaction time. The DNA synthesis reaction rate of random coiled ssλDNA (−flow) was nearly the same as that measured in a previous ensemble molecule experiment (52 vs. 50 bases/s). This suggested that the random coiled form of DNA (−flow) reflected the DNA form in the bulk experiment in the case of DNA synthesis reactions. In addition, the DNA synthesis reaction rate of stretched ssλDNA (+flow) was approximately 75% higher than that of random coiled ssλDNA (−flow) (91 vs. 52 bases/s). The DNA synthesis reaction rate of the Klenow fragment (3′-5′exo–) was promoted by DNA stretching with buffer flow. PMID:24625741

  4. Dissociative Electron Attachment to Phosphoric Acid Esters: The Direct Mechanism for Single Strand Breaks in DNA

    SciTech Connect

    Koenig, Constanze; Kopyra, Janina; Bald, Ilko; Illenberger, Eugen

    2006-07-07

    We use dibutyl phosphate to simulate the behavior of the phosphate group in DNA towards the attack of low energy electrons. We find that the compound undergoes effective dissociative electron attachment within a low energy resonant feature at 1 eV and a further resonance peaking at 8 eV. The dissociative electron attachment (DEA) reactions are associated with the direct cleavage of the C-O and the P-O bond but also the excision of the PO{sup -}, PO{sub 3}{sup -}, H{sub 2}PO{sub 3}{sup -} units. For the phosphate group coupled in the DNA network these reactions represent single strand breaks. We hence propose that the most direct mechanism of single strand breaks occurring in DNA at subexcitation energies (<4 eV) is due to DEA directly to the phosphate group.

  5. Rapid DNA Sequencing by Direct Nanoscale Reading of Nucleotide Bases on Individual DNA Chains

    SciTech Connect

    Lee, James Weifu; Meller, Amit

    2007-01-01

    Since the independent invention of DNA sequencing by Sanger and by Gilbert 30 years ago, it has grown from a small scale technique capable of reading several kilobase-pair of sequence per day into today's multibillion dollar industry. This growth has spurred the development of new sequencing technologies that do not involve either electrophoresis or Sanger sequencing chemistries. Sequencing by Synthesis (SBS) involves multiple parallel micro-sequencing addition events occurring on a surface, where data from each round is detected by imaging. New High Throughput Technologies for DNA Sequencing and Genomics is the second volume in the Perspectives in Bioanalysis series, which looks at the electroanalytical chemistry of nucleic acids and proteins, development of electrochemical sensors and their application in biomedicine and in the new fields of genomics and proteomics. The authors have expertly formatted the information for a wide variety of readers, including new developments that will inspire students and young scientists to create new tools for science and medicine in the 21st century. Reviews of complementary developments in Sanger and SBS sequencing chemistries, capillary electrophoresis and microdevice integration, MS sequencing and applications set the framework for the book.

  6. Direct non transcriptional role of NF-Y in DNA replication.

    PubMed

    Benatti, Paolo; Belluti, Silvia; Miotto, Benoit; Neusiedler, Julia; Dolfini, Diletta; Drac, Marjorie; Basile, Valentina; Schwob, Etienne; Mantovani, Roberto; Blow, J Julian; Imbriano, Carol

    2016-04-01

    NF-Y is a heterotrimeric transcription factor, which plays a pioneer role in the transcriptional control of promoters containing the CCAAT-box, among which genes involved in cell cycle regulation, apoptosis and DNA damage response. The knock-down of the sequence-specific subunit NF-YA triggers defects in S-phase progression, which lead to apoptotic cell death. Here, we report that NF-Y has a critical function in DNA replication progression, independent from its transcriptional activity. NF-YA colocalizes with early DNA replication factories, its depletion affects the loading of replisome proteins to DNA, among which Cdc45, and delays the passage from early to middle-late S phase. Molecular combing experiments are consistent with a role for NF-Y in the control of fork progression. Finally, we unambiguously demonstrate a direct non-transcriptional role of NF-Y in the overall efficiency of DNA replication, specifically in the DNA elongation process, using a Xenopus cell-free system. Our findings broaden the activity of NF-Y on a DNA metabolism other than transcription, supporting the existence of specific TFs required for proper and efficient DNA replication. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Having a direct look: analysis of DNA damage and repair mechanisms by next generation sequencing.

    PubMed

    Meier, Bettina; Gartner, Anton

    2014-11-15

    Genetic information is under constant attack from endogenous and exogenous sources, and the use of model organisms has provided important frameworks to understand how genome stability is maintained and how various DNA lesions are repaired. The advance of high throughput next generation sequencing (NGS) provides new inroads for investigating mechanisms needed for genome maintenance. These emerging studies, which aim to link genetic toxicology and mechanistic analyses of DNA repair processes in vivo, rely on defining mutational signatures caused by faulty replication, endogenous DNA damaging metabolites, or exogenously applied genotoxins; the analysis of their nature, their frequency and distribution. In contrast to classical studies, where DNA repair deficiency is assessed by reduced cellular survival, the localization of DNA repair factors and their interdependence as well as limited analysis of single locus reporter assays, NGS based approaches reveal the direct, quantal imprint of mutagenesis genome-wide, at the DNA sequence level. As we will show, such investigations require the analysis of DNA derived from single genotoxin treated cells, or DNA from cell populations regularly passaged through single cell bottlenecks when naturally occurring mutation accumulation is investigated. We will argue that the life cycle of the nematode Caenorhabditis elegans, its genetic malleability combined with whole genome sequencing provides an exciting model system to conduct such analysis. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Having a direct look: Analysis of DNA damage and repair mechanisms by next generation sequencing

    PubMed Central

    Meier, Bettina; Gartner, Anton

    2014-01-01

    Genetic information is under constant attack from endogenous and exogenous sources, and the use of model organisms has provided important frameworks to understand how genome stability is maintained and how various DNA lesions are repaired. The advance of high throughput next generation sequencing (NGS) provides new inroads for investigating mechanisms needed for genome maintenance. These emerging studies, which aim to link genetic toxicology and mechanistic analyses of DNA repair processes in vivo, rely on defining mutational signatures caused by faulty replication, endogenous DNA damaging metabolites, or exogenously applied genotoxins; the analysis of their nature, their frequency and distribution. In contrast to classical studies, where DNA repair deficiency is assessed by reduced cellular survival, the localization of DNA repair factors and their interdependence as well as limited analysis of single locus reporter assays, NGS based approaches reveal the direct, quantal imprint of mutagenesis genome-wide, at the DNA sequence level. As we will show, such investigations require the analysis of DNA derived from single genotoxin treated cells, or DNA from cell populations regularly passaged through single cell bottlenecks when naturally occurring mutation accumulation is investigated. We will argue that the life cycle of the nematode Caenorhabditis elegans, its genetic malleability combined with whole genome sequencing provides an exciting model system to conduct such analysis. PMID:25131498

  9. Direct observation of DNA knots using a solid-state nanopore

    NASA Astrophysics Data System (ADS)

    Plesa, Calin; Verschueren, Daniel; Pud, Sergii; van der Torre, Jaco; Ruitenberg, Justus W.; Witteveen, Menno J.; Jonsson, Magnus P.; Grosberg, Alexander Y.; Rabin, Yitzhak; Dekker, Cees

    2016-12-01

    Long DNA molecules can self-entangle into knots. Experimental techniques for observing such DNA knots (primarily gel electrophoresis) are limited to bulk methods and circular molecules below 10 kilobase pairs in length. Here, we show that solid-state nanopores can be used to directly observe individual knots in both linear and circular single DNA molecules of arbitrary length. The DNA knots are observed as short spikes in the nanopore current traces of the traversing DNA molecules and their detection is dependent on a sufficiently high measurement resolution, which can be achieved using high-concentration LiCl buffers. We study the percentage of molecules with knots for DNA molecules of up to 166 kilobase pairs in length and find that the knotting occurrence rises with the length of the DNA molecule, consistent with a constant knotting probability per unit length. Our experimental data compare favourably with previous simulation-based predictions for long polymers. From the translocation time of the knot through the nanopore, we estimate that the majority of the DNA knots are tight, with remarkably small sizes below 100 nm. In the case of linear molecules, we also observe that knots are able to slide out on application of high driving forces (voltage).

  10. Direct correlation of DNA binding and single protein domain motion via dual illumination fluorescence microscopy.

    PubMed

    Ghoneim, Mohamed; Spies, Maria

    2014-10-08

    We report a dual illumination, single-molecule imaging strategy to dissect directly and in real-time the correlation between nanometer-scale domain motion of a DNA repair protein and its interaction with individual DNA substrates. The strategy was applied to XPD, an FeS cluster-containing DNA repair helicase. Conformational dynamics was assessed via FeS-mediated quenching of a fluorophore site-specifically incorporated into XPD. Simultaneously, binding of DNA molecules labeled with a spectrally distinct fluorophore was detected by colocalization of the DNA- and protein-derived signals. We show that XPD undergoes thermally driven conformational transitions that manifest in spatial separation of its two auxiliary domains. DNA binding does not strictly enforce a specific conformation. Interaction with a cognate DNA damage, however, stabilizes the compact conformation of XPD by increasing the weighted average lifetime of this state by 140% relative to an undamaged DNA. Our imaging strategy will be a valuable tool to study other FeS-containing nucleic acid processing enzymes.

  11. The TGx-28.65 biomarker online application for analysis of transcriptomics data to identify DNA damage-inducing chemicals in human cell cultures.

    PubMed

    Jackson, Marcus A; Yang, Longlong; Lea, Isabel; Rashid, Asif; Kuo, Byron; Williams, Andrew; Lyn Yauk, Carole; Fostel, Jennifer

    2017-08-01

    The TGx-28.65 biomarker is a 65-gene expression profile generated from testing 28 model chemicals (13 that cause DNA damage and 15 that do not) in human TK6 cells. It is used to predict whether a chemical induces DNA damage or not. We expanded availability to the biomarker by developing the online TGx-28.65 biomarker application for predicting the DNA damage inducing (DDI) potential of suspect toxicants tested in p53-proficient human cells and assessing putative mode(s) of action (MOA). Applications like this that analyse gene expression data to predict the hazard potential of test chemicals hold great promise for risk assessment paradigms. The TGx-28.65 biomarker interfaces with an analytical tool to predict the probability that a test chemical can directly or indirectly induce DNA damage. User submitted in vitro microarray data are compared to the 28-chemical x 65-gene signature profile and the probability that the data fit the profile for a DDI or a non-DDI (NDDI) chemical is calculated. The results are displayed in the Results Table, which includes the classification probability and hyperlinks to view heatmaps, hierarchical clustering, and principal component analyses of user-input data in the context of the reference profile. The heatmaps and cluster plots, along with the corresponding text data files of fold changes in gene expression and Euclidean distances can be downloaded. Review of the test chemical data in relationship to the biomarker allows rapid identification of key gene alterations associated with DNA damage as well as chemicals in the reference set that produced a similar response. Environ. Mol. Mutagen. 58:529-535, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  12. DNA-directed alkylating agents. 4. 4-anilinoquinoline-based minor groove directed aniline mustards.

    PubMed

    Gravatt, G L; Baguley, B C; Wilson, W R; Denny, W A

    1991-05-01

    A series of 4-anilinoquinoline-linked aniline mustards of widely varying mustard reactivity were prepared and evaluated for their antitumor activity. The compounds were designed as minor grove binding agents, where the aniline mustard ring is itself part of the DNA-binding ligand. While there was a general trend for cytotoxicity to correlate with mustard reactivity, this was much less pronounced than with untargeted mustards. The compounds were much more cytotoxic than the parent diols, and were also at least 10-fold more cytotoxic than the corresponding aniline mustards themselves. Comparative cell line studies suggested that the mechanism of cytotoxicity varied with mustard reactivity. The most reactive mustards cross-linked DNA, while cell killing by the less reactive compounds appeared to be by the formation of bulky monoadducts. The compounds were active but not particularly dose-potent against P388 leukemia in vivo. The modest potency may be related to their poor aqueous solubility, since the more soluble methyl quaternary salts were equally active at much lower doses.

  13. Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

    PubMed

    Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

    2017-07-01

    In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical

  14. Direct chemical evidence for widespread dairying in prehistoric Britain

    PubMed Central

    Copley, M. S.; Berstan, R.; Dudd, S. N.; Docherty, G.; Mukherjee, A. J.; Straker, V.; Payne, S.; Evershed, R. P.

    2003-01-01

    Domesticated animals formed an important element of farming practices in prehistoric Britain, a fact revealed through the quantity and variety of animal bone typically found at archaeological sites. However, it is not known whether the ruminant animals were raised purely for their tissues (e.g., meat) or alternatively were exploited principally for their milk. Absorbed organic residues from pottery from 14 British prehistoric sites were investigated for evidence of the processing of dairy products. Our ability to detect dairy fats rests on the observation that the δ13C values of the C18:0 fatty acids in ruminant dairy fats are ≈2.3‰ lower than in ruminant adipose fats. This difference can be ascribed to (i) the inability of the mammary gland to biosynthesize C18:0; (ii) the biohydrogenation of dietary unsaturated fatty acids in the rumen; and (iii) differences (i.e., 8.1‰) in the δ13C values of the plant dietary fatty acids and carbohydrates. The lipids from a total of 958 archaeological pottery vessels were extracted, and the compound-specific δ13C values of preserved fatty acids (C16:0 and C18:0) were determined via gas chromatography-combustion-isotope ratio mass spectrometry. The results provide direct evidence for the exploitation of domesticated ruminant animals for dairy products at all Neolithic, Bronze Age, and Iron Age settlements in Britain. Most significantly, studies of pottery from a range of key early Neolithic sites confirmed that dairying was a widespread activity in this period and therefore probably well developed when farming was introduced into Britain in the fifth millennium B.C. PMID:12574520

  15. Quantitative Field Testing Heterodera glycines from Metagenomic DNA Samples Isolated Directly from Soil under Agronomic Production

    PubMed Central

    Li, Yan; Lawrence, Gary W.; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P.

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil. PMID:24587100

  16. Quantitative field testing Heterodera glycines from metagenomic DNA samples isolated directly from soil under agronomic production.

    PubMed

    Li, Yan; Lawrence, Gary W; Lu, Shien; Balbalian, Clarissa; Klink, Vincent P

    2014-01-01

    A quantitative PCR procedure targeting the Heterodera glycines ortholog of the Caenorhabditis elegans uncoordinated-78 gene was developed. The procedure estimated the quantity of H. glycines from metagenomic DNA samples isolated directly from field soil under agronomic production. The estimation of H. glycines quantity was determined in soil samples having other soil dwelling plant parasitic nematodes including Hoplolaimus, predatory nematodes including Mononchus, free-living nematodes and biomass. The methodology provides a framework for molecular diagnostics of nematodes from metagenomic DNA isolated directly from field soil.

  17. Synergistic effects of multiple treatments, and both DNA and RNA direct bindings on, green tea catechins.

    PubMed

    Kuzuhara, Takashi; Tanabe, Akitoshi; Sei, Yoshihisa; Yamaguchi, Kentaro; Suganuma, Masami; Fujiki, Hirota

    2007-08-01

    This article reviews two main topics: (1) the synergistic effects of multiple treatments with green tea catechin and (2) the direct binding of (-)-epigallocatechin gallate (EGCG) to both DNA and RNA molecules. Japanese drink green tea throughout the day, so we studied whether multiple treatments of cells with EGCG would enhance the expression of apoptosis-related genes, such as growth arrest and DNA damage-inducible gene (GADD153) and cyclin-dependent kinase inhibitor gene (p21(waf1)): The results suggest that the synergistic enhancement of both GADD153 and p21(waf1) gene expressions by multiple treatments plays a significant role in human cancer prevention with green tea beverage. Our previous observation-that nucleic acids extracted from catechin-treated cells are colored-allowed us to speculate that catechins directly interact with nucleic acids. Surface plasmon resonance assay (Biacore) indicated that four catechins, EGCG, (-)-epicatechin gallate (ECG), (+)-gallocatechin gallate (GCG), and (+)-catechin gallate (CG), bound to DNA oligomers. Cold spray ionization mass spectrometry (CSI-MS) analysis showed that one to three EGCG molecules bound to single-stranded 18 mers of DNA and RNA. Moreover, one or two molecules of EGCG bound to double-stranded AG:CT oligomers of various nucleotide lengths. Double-stranded DNA (dsDNA) oligomers were detected only as EGCG-bound forms at high temperature, whereas at low temperature both the free and bound forms were detected, suggesting that EGCG protects double-stranded DNA oligomers from double-stranded melting into single-stranded DNA. We assume that catechins accumulate in both double-stranded DNA and RNA molecules through multiple administrations of green tea beverage in in vivo, and that the accumulated green tea catechins play a significant role for human cancer prevention.

  18. One-Directional Fluidic Flow Induced by Chemical Wave Propagation in a Microchannel.

    PubMed

    Arai, Miyu; Takahashi, Kazuhiro; Hattori, Mika; Hasegawa, Takahiko; Sato, Mami; Unoura, Kei; Nabika, Hideki

    2016-05-26

    A one-directional flow induced by chemical wave propagation was investigated to understand the origin of its dynamic flow. A cylindrical injection port was connected with a straight propagation channel; the chemical wave was initiated at the injection port. Chemical waves propagated with a constant velocity irrespective of the channel width, indicating that the dynamics of the chemical waves were governed by a geometry-independent interplay between the chemical reaction and diffusion. In contrast, the velocity of the one-directional flow was dependent on the channel width. Furthermore, enlargement of the injection port volume increased the flow velocity and volume flux. These results imply that the one-directional flow in the microchannel is due to a hydrodynamic effect induced in the injection port. Spectroscopic analysis of a pH indicator revealed the simultaneous behavior between the pH increase near the injection port and the one-directional flow. Hence, we can conclude that the one-directional flow in the microchannel with chemical wave propagation was caused by a proton consumption reaction in the injection port, probably through liquid volume expansion by the reaction products and the reaction heat. It is a characteristic feature of the present system that the hydrodynamic flow started from the chemical wave initiation point and not the propagation wavefront, as observed for previous systems.

  19. Residual DNA analysis in biologics development: review of measurement and quantitation technologies and future directions.

    PubMed

    Wang, Xing; Morgan, Donna M; Wang, Gan; Mozier, Ned M

    2012-02-01

    Residual DNA (rDNA) is comprised of deoxyribonucleic acid (DNA) fragments and longer length molecules originating from the host organism that may be present in samples from recombinant biological processes. Although similar in basic structural base pair units, rDNA may exist in different sizes and physical forms. Interest in measuring rDNA in recombinant products is based primarily on demonstration of effective purification during manufacturing, but also on some hypothetical concerns that, in rare cases, depending on the host expression system, some DNA sequences may be potentially infectious or oncogenic (e.g., HIV virus and the Ras oncogene, respectively). Recent studies suggest that a sequence known as long interspersed nucleotide element-1 (LINE-1), widely distributed in the mammalian genome, is active as a retrotransposon that can be transcribed to RNA, reverse-transcribed into DNA and inserts into a new site in genome. This integration process could potentially disrupt critical gene functions or induce tumorigenesis in mammals. Genomic DNA from microbial sources, on the other hand, could add to risk of immunogenicity to the target recombinant protein being expressed, due to the high CpG content and unmethylated DNA sequence. For these and other reasons, it is necessary for manufacturers to show clearance of DNA throughout production processes and to confirm low levels in the final drug substance using an appropriately specific and quantitative analytical method. The heterogeneity of potential rDNA sequences that might be makes the testing of all potential analytes challenging. The most common methodology for rDNA quantitation used currently is real-time polymerase chain reaction (RT-PCR), a robust and proven technology. Like most rDNA quantitation methods, the specificity of RT-PCR is limited by the sequences to which the primers are directed. To address this, primase-based whole genome amplification is introduced herein. This paper will review the recent

  20. p21 Expression and DNA ploidy in chemically-induced transitional cell carcinoma

    SciTech Connect

    Rhodes, S.W.

    1987-01-01

    Occupational and environmental exposure to chemical carcinogens and the incidence of bladder carcinoma suggest that biochemical indicators for individual risk, and early detection would be beneficial in facilitating timely intervention and cancer management. Further, such objective measures may provide a quantitative basis for determination of the biological potential of tumors and the development of end point markers in chemical risk assessment. In this study quantitative measures for biochemical alterations were developed for in situ measurement of the ras oncoprotein, p21, and DNA ploidy in tissue sections. These assays were then applied to an animal model in which transitional cell carcinoma was induced with N-butyl-N-(4-hydroxybutyl) nitrosamine, which primarily induced low grade tumors. Three measures of DNA ploidy were utilized: (A) 95th percentile of cellular DNA content (C value), (B) percent of cells with a DNA complement greater than 5.0C, and (C) mode. The 95th percentile C value was able to delineate normal and hyperplastic tissues from tumor tissues. The percent of cells with a DNA content greater than 5.0C was capable of differentiating invasive lesions from noninvasive lesions.

  1. Silver-mediated base pairings: towards dynamic DNA nanostructures with enhanced chemical and thermal stability

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Gwinn, Elisabeth G.

    2016-04-01

    The thermal and chemical fragility of DNA nanomaterials assembled by Watson-Crick (WC) pairing constrain the settings in which these materials can be used and how they can be functionalized. Here we investigate use of the silver cation, Ag+, as an agent for more robust, metal-mediated self-assembly, focusing on the simplest duplex building blocks that would be required for more elaborate Ag+-DNA nanostructures. Our studies of Ag+-induced assembly of non-complementary DNA oligomers employ strands of 2-24 bases, with varied base compositions, and use electrospray ionization mass spectrometry to determine product compositions. High yields of duplex products containing narrowly distributed numbers of Ag+ can be achieved by optimizing solution conditions. These Ag+-mediated duplexes are stable to at least 60 mM Mg2+, higher than is necessary for WC nanotechnology schemes such as tile assemblies and DNA origami, indicating that sequential stages of Ag+-mediated and WC-mediated assembly may be feasible. Circular dichroism spectroscopy suggests simple helical structures for Ag+-mediated duplexes with lengths to at least 20 base pairs, and further indicates that the structure of cytosine-rich duplexes is preserved at high urea concentrations. We therefore propose an approach towards dynamic DNA nanomaterials with enhanced thermal and chemical stability through designs that combine sturdy silver-mediated ‘frames’ with WC paired ‘pictures’.

  2. A Binary-Encounter-Bethe Approach to Simulate DNA Damage by the Direct Effect

    NASA Technical Reports Server (NTRS)

    Plante, Ianik; Cucinotta, Francis A.

    2013-01-01

    The DNA damage is of crucial importance in the understanding of the effects of ionizing radiation. The main mechanisms of DNA damage are by the direct effect of radiation (e.g. direct ionization) and by indirect effect (e.g. damage by.OH radicals created by the radiolysis of water). Despite years of research in this area, many questions on the formation of DNA damage remains. To refine existing DNA damage models, an approach based on the Binary-Encounter-Bethe (BEB) model was developed[1]. This model calculates differential cross sections for ionization of the molecular orbitals of the DNA bases, sugars and phosphates using the electron binding energy, the mean kinetic energy and the occupancy number of the orbital. This cross section has an analytic form which is quite convenient to use and allows the sampling of the energy loss occurring during an ionization event. To simulate the radiation track structure, the code RITRACKS developed at the NASA Johnson Space Center is used[2]. This code calculates all the energy deposition events and the formation of the radiolytic species by the ion and the secondary electrons as well. We have also developed a technique to use the integrated BEB cross section for the bases, sugar and phosphates in the radiation transport code RITRACKS. These techniques should allow the simulation of DNA damage by ionizing radiation, and understanding of the formation of double-strand breaks caused by clustered damage in different conditions.

  3. Technical note: Improved method for rapid DNA extraction of mastitis pathogens directly from milk.

    PubMed

    Cremonesi, P; Castiglioni, B; Malferrari, G; Biunno, I; Vimercati, C; Moroni, P; Morandi, S; Luzzana, M

    2006-01-01

    Efficient control against bovine mastitis requires sensitive, rapid, and specific tests to detect and identify the main bacteria that cause heavy losses to the dairy industry. Molecular detection of pathogenic microorganisms is based on DNA amplification of the target pathogen. Therefore, efficient extraction of DNA from pathogenic bacteria is a major step. In this study, we aimed to develop a specific, sensitive, and rapid method to extract DNA directly from the main gram-positive bacteria known to cause bovine mastitis (Staphylococcus aureus, Streptococcus agalactiae, Streptococcus dysgalactiae, and Streptococcus uberis) found in milk samples. The DNA extraction method is based on the lysing and nuclease-inactivating properties of the chaotropic agent, guanidinium thiocyanate, together with the nucleic acid-binding properties of the silica particles. An efficient protocol consisting of 6 basic steps (3 of which were done twice) was developed and applied directly to milk samples. Absence of PCR inhibitors and DNA quality were evaluated by PCR amplification of the species-specific DNA sequences of the target bacteria. The level of sensitivity achieved in our experiments is applicable to milk sample analysis without sample enrichment.

  4. Understanding of DNA directed nanoparticle superlattices in bulk and thin film

    NASA Astrophysics Data System (ADS)

    Lee, Byeongdu

    Over the years, there have been significant advances in assembling nanoparticles with DNA into superlattices. Since the first reports on DNA directed FCC and BCC superlattices consisting of single type of spherical nanoparticles, building blocks for the DNA-nanoparticle superlattices have been extended from a spherical gold nanoparticle to various types of other particles including quantum dots, magnetic, hollow, or polyhedral particles. Not only single component, but superlattices of binary and ternary components have also been synthesized. Although still many details are unclear, now there is a general consensus about thermodynamics of this type of assembly, which led us to fabricate thin films of DNA directed nanoparticle superlattices on substrate for applications such as optical materials. Since the structures are formed in aqueous condition, small angle x-ray scattering (SAXS) that does not disturb the system has been a critical tool to determine structural and thermodynamic characteristics of the assemblies. Thus, we have also been improving SAXS instrumentations and computational methods to calculate scattering profiles for the nanoparticle superlattices. In this talk, we will summarize our works with a focus on some structural details of these superlattices and DNA and understanding about the role of DNA in the crystallization processes in bulk and thin film.

  5. Direct and residual effects of manure on soil chemical properties

    NASA Astrophysics Data System (ADS)

    Nastri, A.; Triberti, L.; Giordani, G.; Comellini, F.; Baldoni, G.

    2009-04-01

    ha-1 (+ 29%) and + 166 kg ha-1 (+107%), respectively, compared to the control. These significant increments were obtained linearly, at mean annual rates of: 0.15 t ha-1 year-1 for SOC, 20 kg ha-1 for TN and 4.18 kg ha-1 for P2O5. During the first 18 years, doubling the manure supply (M2) caused further increments (72%, 76% and 112% increases for SOC, TN and P2O5, respectively, compared to M1). The complete interruption of M2 application, from 1984 onward, gradually decreased the positive effects. In the 1990-93 period, no differences between M1 and M2 were detected. After 18 years all the amounts were lower in M2 than in M1. However, a residual effect of the double manuring was still evident: M2 plots had higher SOC, TN and P2O5, contents compared to the unfertilized control (+3.1 t ha-1, +0.21 t ha-1 and +88 kg ha-1, respectively). Inorganic fertilization, in the absence of manure, did not affect SOC dynamic, whereas it had significant cumulative effects on TN (+0.94 t ha-1 (+26%) increase in the '99-02 period compared to the initial contents) and P2O5, with 223 kg ha-1 (+160%) increment. Treatments slightly influenced pH (6.43, on average): compared to the unfertilized control, manure increased it a little (+2.7%), while mineral fertilization had an opposite effect (-2.7%). In conclusion, the direct influences of manure on main components of soil fertility appeared cumulative with time and proportional to the application rates, at least up to 40 t ha-1 year-1 of fresh material. Residual effects gradually disappeared, but at low speed, thus their study requires really long experiments, lasting more than 20-years. Inorganic fertilization could increase nitrogen and, even more, available phosphorus content in the soil, but, in our research where crop residues are always removed, it had a null effect on SOC.

  6. Forensic animal DNA analysis using economical two-step direct PCR.

    PubMed

    Kitpipit, Thitika; Chotigeat, Wilaiwan; Linacre, Adrian; Thanakiatkrai, Phuvadol

    2014-03-01

    Wildlife forensic DNA analysis by amplification of a mitochondrial locus followed by DNA sequencing is routine, yet suffers from being costly and time-consuming. To address these disadvantages we report on a low-cost two-step direct PCR assay to efficiently analyze 12 forensically relevant mammalian sample types without DNA extraction. A cytochrome oxidase I degenerate-universal primer pair was designed and validated for the developed assay. The 12 sample types, which included bone, horn, feces, and urine, were amplified successfully by the assay using a pre-direct PCR dilution protocol. The average amplification success rate was as high as 92.5 % (n = 350), with an average PCR product concentration of 220.71 ± 180.84 ng/μL. Differences in amplification success rate and PCR product quantity between sample types were observed; however, most samples provided high quality sequences, permitting a 100 % nucleotide similarity to their respective species via BLAST database queries. The combination of PBS and Phire(®) Hot Start II DNA polymerase gave comparable amplification success rate and amplicon quantity with the proprietary commercial kits (P > 0.05, n = 350) but at considerably lower cost. The stability of the assay was tested by successfully amplifying samples that had been stored for up to 12 months. Our data indicate that this low-cost two-step direct amplification assay has the potential to be a valuable tool for the forensic DNA community.

  7. Determination of formylated DNA and RNA by chemical labeling combined with mass spectrometry analysis.

    PubMed

    Jiang, Han-Peng; Liu, Ting; Guo, Ning; Yu, Lei; Yuan, Bi-Feng; Feng, Yu-Qi

    2017-08-15

    Nucleic acids carry diverse chemical modifications that exert critical influences in a variety of cellular processes in living organisms. In addition to methylation, the emerging DNA and RNA formylation has been reported to play functional roles in various physiological processes. However, the amounts of formylated DNA and RNA are extremely low and detection of DNA and RNA formylation is therefore a challenging task. To address this issue, we developed a strategy by chemical labeling combined with in-tube solid-phase microextraction - ultra high performance liquid chromatography - electrospray ionization - tandem mass spectrometry (in-tube SPME-UPLC-ESI-MS/MS) analysis for the sensitive determination of DNA and RNA formylation. Using the developed method, we were able to simultaneously measure six formylated nucleosides, including 5-formyl-2'-deoxycytidine (5-fodC), 5-formylcytidine (5-forC), 5-formyl-2'-deoxyuridine (5-fodU), 5-formyluridine (5-forU), 2'-O-methyl-5-formylcytidine (5-forCm) and 2'-O-methyl-5- formyluridine (5-forUm), from DNA and RNA of cultured human cells and multiple mammalian tissues. The detection limits of these formylated nucleosides improved by 307-884 folds using Girard's P (GirP) labeling coupled with in-tube SPME-UPLC-ESI-MS/MS analysis. It was worth noting that 5-forU, 5-forCm and 5-forUm which have not been detected in human sample before, were discovered in cultured human cells and tissues in the current study. In addition, we observed significant increase of 5-forC and 5-forU in RNA (p = 0.027 for 5-forC; p = 0.028 for 5-forU) and 5-fodU in DNA (p = 0.002) in human thyroid carcinoma tissues compared to normal tissues adjacent to the tumor using synthesized stable isotope GirP (d5-GirP)-assisted quantification. Our results indicated that aberrant DNA and RNA formylation may contribute to the tumor formation and development. In addition, monitoring of DNA and RNA formylation may also serve as indicator for cancer diagnostics

  8. DNA-protein cross-links produced by various chemicals in cultured human lymphoma cells.

    PubMed

    Costa, M; Zhitkovich, A; Harris, M; Paustenbach, D; Gargas, M

    1997-04-11

    Chemicals such as cis-platinum, formaldehyde, chromate, copper, and certain arsenic compounds have been shown to produce DNA-protein cross-links in human in vitro cell systems at high doses, such as those in the cytotoxic range. Thus far there have only been a limited number of other chemicals evaluated for their ability to produce cross-links. The purpose of the work described here was to evaluate whether select industrial chemicals can form DNA-protein cross-links in human cells in vitro. We evaluated acetaldehyde, acrolein, diepoxybutane, paraformaldehyde, 2-furaldehyde, propionaldehyde, chloroacetaldehyde, sodium arsenite, and a deodorant tablet [Mega Blue; hazardous component listed as tris(hydroxymethyl)nitromethane]. Short- and long-term cytotoxicity was evaluated and used to select appropriate doses for in vitro testing. DNA-protein cross-linking was evaluated at no fewer than three doses and two cell lysate washing temperatures (45 and 65 degrees C) in Epstein-Barr virus (EBV) human Burkitt's lymphoma cells. The two washing temperatures were used to assess the heat stability of the DNA-protein cross-link, 2-Furaldehyde, acetaldehyde, and propionaldehyde produced statistically significant increases in DNA-protein cross-links at washing temperatures of 45 degrees C, but not 65 degrees C, and at or above concentrations of 5, 17.5, and 75 mM, respectively. Acrolein, diepoxybutane, paraformaldehyde, and Mega Blue produced statistically significant increases in DNA-protein cross-links washed at 45 and 65 degrees C at or above concentrations of 0.15 mM, 12.5 mM, 0.003%, and 0.1%, respectively. Sodium arsenite and chloroacetaldehyde did not produce significantly increased DNA-protein cross-links at either temperature nor at any dose tested. Excluding paraformaldehyde and 2-furaldehyde treatments, significant increases in DNA-protein cross-links were observed only at doses that resulted in complete cell death within 4 d following dosing. This work demonstrates that

  9. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  10. Patterns of nucleotide misincorporations during enzymatic amplification and direct large-scale sequencing of ancient DNA.

    PubMed

    Stiller, M; Green, R E; Ronan, M; Simons, J F; Du, L; He, W; Egholm, M; Rothberg, J M; Keates, S G; Keats, S G; Ovodov, N D; Antipina, E E; Baryshnikov, G F; Kuzmin, Y V; Vasilevski, A A; Wuenschell, G E; Termini, J; Hofreiter, M; Jaenicke-Després, V; Pääbo, S

    2006-09-12

    Whereas evolutionary inferences derived from present-day DNA sequences are by necessity indirect, ancient DNA sequences provide a direct view of past genetic variants. However, base lesions that accumulate in DNA over time may cause nucleotide misincorporations when ancient DNA sequences are replicated. By repeated amplifications of mitochondrial DNA sequences from a large number of ancient wolf remains, we show that C/G-to-T/A transitions are the predominant type of such misincorporations. Using a massively parallel sequencing method that allows large numbers of single DNA strands to be sequenced, we show that modifications of C, as well as to a lesser extent of G, residues cause such misincorporations. Experiments where oligonucleotides containing modified bases are used as templates in amplification reactions suggest that both of these types of misincorporations can be caused by deamination of the template bases. New DNA sequencing methods in conjunction with knowledge of misincorporation processes have now, in principle, opened the way for the determination of complete genomes from organisms that became extinct during and after the last glaciation.

  11. Direction- and Salt-Dependent Ionic Current Signatures for DNA Sensing with Asymmetric Nanopores.

    PubMed

    Chen, Kaikai; Bell, Nicholas A W; Kong, Jinglin; Tian, Yu; Keyser, Ulrich F

    2017-02-28

    Solid-state nanopores are promising tools for single-molecule detection of both DNA and proteins. In this study, we investigated the patterns of ionic current blockades as DNA translocates into or out of the geometric confinement of conically shaped pores across a wide range of salt conditions. We studied how the geometry of a nanopore affects the detected ionic current signal of a translocating DNA molecule over a wide range of salt concentration. The blockade level in the ionic current depends on the translocation direction at a high salt concentration, and at lower salt concentrations we find a nonintuitive ionic current decrease and increase within each single event for the DNA translocations exiting from confinement. We use a recently developed method for synthesizing DNA molecules with multiple position markers, which provides further experimental characterization by matching the position of the DNA in the pore with the observed ionic current signal. Finally, we employ finite element calculations to explain the shapes of the signals observed at all salt concentrations and show that the unexpected current decrease and increase are due to the competing effects of ion concentration polarization and geometric exclusion of ions. Our analysis shows that over a wide range of geometries, voltages, and salt concentrations, we are able to understand the ionic current signals of DNA in asymmetric nanopores, enabling signal optimization in molecular sensing applications. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  12. B lymphocytes as direct antigen-presenting cells for anti-tumor DNA vaccines

    PubMed Central

    Colluru, Viswa Teja; McNeel, Douglas G.

    2016-01-01

    In spite of remarkable preclinical efficacy, DNA vaccination has demonstrated low immunogenicity in humans. While efforts have focused on increasing cross-presentation of DNA-encoded antigens, efforts to increase DNA vaccine immunogenicity by targeting direct presentation have remained mostly unexplored. In these studies, we compared the ability of different APCs to present antigen to T cells after simple co-culture with plasmid DNA. We found that human primary peripheral B lymphocytes, and not monocytes or in vitro derived dendritic cells (DCs), were able to efficiently encode antigen mRNA and expand cognate tumor antigen-specific CD8 T cells ex vivo. Similarly, murine B lymphocytes co-cultured with plasmid DNA, and not DCs, were able to prime antigen-specific T cells in vivo. Moreover, B lymphocyte-mediated presentation of plasmid antigen led to greater Th1-biased immunity and was sufficient to elicit an anti-tumor effect in vivo. Surprisingly, increasing plasmid presentation by B cells, and not cross presentation of peptides by DCs, further augmented traditional plasmid vaccination. Together, these data suggest that targeting plasmid DNA to B lymphocytes, for example through transfer of ex vivo plasmidloaded B cells, may be novel means to achieve greater T cell immunity from DNA vaccines. PMID:27661128

  13. Minor contribution of direct ionization to DNA base damage inducedby heavy ions.

    PubMed

    Douki, Thierry; Ravanat, Jean-Luc; Pouget, Jean-Pierre; Testard, Isabelle; Cadet, Jean

    2006-02-01

    The deleterious processes triggered by heavy ions on DNA were studied through the determination of the yield of a series of oxidized bases. Emphasis was placed on the estimation of the respective contribution of direct ionization and indirect effects, mostly by comparison with low linear energy transfer (LET) gamma-rays. DNA samples and human monocytes were exposed either to gamma-rays emitted by a (60)Co source or to (12)C(6+) or (36)Ar(18+) ions. The levels of thymidine and 2'-deoxyguanosine oxidation products were determined by liquid chromatography coupled to tandem mass spectrometry subsequently to DNA digestion into nucleosides. The yields of thymidine lesions were similar to those of 8-oxo-7,8-dihydro-2'-deoxyguanosine within isolated DNA exposed either to gamma-rays or argon ions. Addition of spermine and Tris aimed at minimizing the indirect effect modified this ratio to the same extent with both types of radiation. In cells, the level of radiation-induced base damage was found to be correlated with the radiolytic yield of degrees OH that depends on the LET of the particle. In addition, radiation-induced thymidine and 2'-deoxyguanosine lesions were produced in similar amounts. In contrast, oxidation of 2'-deoxyguanosine was the main process when ionization was triggered in cellular DNA by ultraviolet laser-induced biphotonic processes. Predominant oxidation of 2'-deoxyguanosine is expected to be the hallmark of direct DNA ionization. The observation that thymidine and 2'-deoxyguanosine are equally damaged rules out a major contribution of the direct ionization in radiation-induced base damage to both isolated and cellular DNA by heavy ions. Dependence of the yield of lesions on the LET provides further support for this conclusion.

  14. Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.

    PubMed

    Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn

    2015-03-20

    USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.

  15. Reversible self-assembly and directed assembly of DNA-linked micrometer-sized colloids.

    PubMed

    Valignat, Marie-Pierre; Theodoly, Olivier; Crocker, John C; Russel, William B; Chaikin, Paul M

    2005-03-22

    We present a technique for the directed assembly and self-assembly of micrometer-scale structures based on the control of specific DNA linkages between colloidal particles. The use of DNA links combined with polymer brushes provides an effective way to regulate the range and magnitude of addressable forces between pairs (and further combinations) of different particles. We demonstrate that the autoassembly of alternate microbeads as well as their directed assembly, by using laser tweezers, is reversible. The key to reversibility is preventing the particles from falling into their van der Waals well at close distances. This goal is achieved by the use of adsorbed polymers that limit the number of DNA bridges to one to three between adjacent particles.

  16. Dissection of the DNA Mimicry of the Bacteriophage T7 Ocr Protein using Chemical Modification

    PubMed Central

    Stephanou, Augoustinos S.; Roberts, Gareth A.; Cooper, Laurie P.; Clarke, David J.; Thomson, Andrew R.; MacKay, C. Logan; Nutley, Margaret; Cooper, Alan; Dryden, David T.F.

    2009-01-01

    The homodimeric Ocr (overcome classical restriction) protein of bacteriophage T7 is a molecular mimic of double-stranded DNA and a highly effective competitive inhibitor of the bacterial type I restriction/modification system. The surface of Ocr is replete with acidic residues that mimic the phosphate backbone of DNA. In addition, Ocr also mimics the overall dimensions of a bent 24-bp DNA molecule. In this study, we attempted to delineate these two mechanisms of DNA mimicry by chemically modifying the negative charges on the Ocr surface. Our analysis reveals that removal of about 46% of the carboxylate groups per Ocr monomer results in an ∼ 50-fold reduction in binding affinity for a methyltransferase from a model type I restriction/modification system. The reduced affinity between Ocr with this degree of modification and the methyltransferase is comparable with the affinity of DNA for the methyltransferase. Additional modification to remove ∼ 86% of the carboxylate groups further reduces its binding affinity, although the modified Ocr still binds to the methyltransferase via a mechanism attributable to the shape mimicry of a bent DNA molecule. Our results show that the electrostatic mimicry of Ocr increases the binding affinity for its target enzyme by up to ∼ 800-fold. PMID:19523474

  17. Dissection of the DNA mimicry of the bacteriophage T7 Ocr protein using chemical modification.

    PubMed

    Stephanou, Augoustinos S; Roberts, Gareth A; Cooper, Laurie P; Clarke, David J; Thomson, Andrew R; MacKay, C Logan; Nutley, Margaret; Cooper, Alan; Dryden, David T F

    2009-08-21

    The homodimeric Ocr (overcome classical restriction) protein of bacteriophage T7 is a molecular mimic of double-stranded DNA and a highly effective competitive inhibitor of the bacterial type I restriction/modification system. The surface of Ocr is replete with acidic residues that mimic the phosphate backbone of DNA. In addition, Ocr also mimics the overall dimensions of a bent 24-bp DNA molecule. In this study, we attempted to delineate these two mechanisms of DNA mimicry by chemically modifying the negative charges on the Ocr surface. Our analysis reveals that removal of about 46% of the carboxylate groups per Ocr monomer results in an approximately 50-fold reduction in binding affinity for a methyltransferase from a model type I restriction/modification system. The reduced affinity between Ocr with this degree of modification and the methyltransferase is comparable with the affinity of DNA for the methyltransferase. Additional modification to remove approximately 86% of the carboxylate groups further reduces its binding affinity, although the modified Ocr still binds to the methyltransferase via a mechanism attributable to the shape mimicry of a bent DNA molecule. Our results show that the electrostatic mimicry of Ocr increases the binding affinity for its target enzyme by up to approximately 800-fold.

  18. Direct amplification of DNA from fresh and preserved ectomycorrhizal root tips

    Treesearch

    Elizabeth Bent; D. Lee Taylor

    2009-01-01

    Methods are described by which DNA can be amplified directly from ectomycorrhizal root tip homogenates of a variety of plant species (Picea mariana (black spruce), Betula papyrifera (paper birch), Populus tremuloides (trembling aspen) and Alnus sp.(alder)), including root tips that have...

  19. Mechanisms of direct radiation damage to DNA: the effect of base sequence on base end products.

    PubMed

    Sharma, Kiran K K; Swarts, Steven G; Bernhard, William A

    2011-04-28

    It has been generally assumed that product formation in DNA damaged by ionizing radiation is relatively independent of base sequence, i.e., that the yield of a given product depends primarily on the chemical properties of each DNA constituent and not on its base sequence context. We examined this assumption by comparing direct-type end products produced in films of d(CTCTCGAGAG)(2) with those produced in films of d(GCACGCGTGC)(2). Here we report the product yields in d(CTCTCGAGAG)(2) hydrated to Γ = 2.5 and 15, where Γ is the hydration level given in moles of H(2)O/mole of nucleotide. Of the 17 products monitored by GC/MS, seven exhibited statistically significant yields: 8-oxoGua, 8-oxoAde, 5-OHMeUra, 5,6-diHUra, 5,6-diHThy, 5-OHCyt, and 5-OHUra. These yields at Γ = 2.5 are compared with the yields from our previously reported study of d(GCACGCGTGC)(2) (after projecting the yields to a CG/AT ratio of 1). The ratio of projected yields, d(CTCTCGAGAG)(2) divided by d(GCACGCGTGC)(2), are 1.3 ± 0.9, 1.8 ± 0.3, 1.6 ± 0.6, 11.4 ± 4.7, 0.2 ± 0.1, >28, and 0.8 ± 1.1, respectively. Considering just d(CTCTCGAGAG)(2), the ratios of yields at Γ = 2.5 divided by yields at Γ = 15 are 0.7 ± 0.2, 0.5 ± 0.1, 2.3 ± 4.0, 3.4 ± 1.2, 3.5 ± 3.3, 1.2 ± 0.2, and 0.4 ± 0.2, respectively. The effects of sequence and hydration on base product yields are explained by a working model emphasizing the difference between two distinctly different types of reaction: (i) radical reactions that progress to nonradical intermediates and product prior to dissolution and (ii) reactions that stem from radicals trapped in the solid state at room temperature that go on to yield nonradical product after sample dissolution. Based on these findings, insights into rates of hole and excess electron-transfer relative to rates of proton transfer are discussed.

  20. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.

    PubMed

    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S

    1996-01-01

    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  1. Chemical enhancement techniques of bloodstain patterns and DNA recovery after fire exposure.

    PubMed

    Tontarski, Karolyn L; Hoskins, Kyle A; Watkins, Tani G; Brun-Conti, Leanora; Michaud, Amy L

    2009-01-01

    It is common in forensic casework to encounter situations where the suspect has set a fire to cover up or destroy possible evidence. While bloodstain pattern interpretation, chemical enhancement of blood, and recovery of deoxyribonucleic acid (DNA) from bloodstains is well documented in the literature, very little information is known about the effects of heat or fire on these types of examinations. In this study, a variety of known types of bloodstain patterns were created in a four-room structure containing typical household objects and furnishings. The structure was allowed to burn to flashover and then it was extinguished by firefighters using water. Once the structure cooled over night, the interior was examined using a bright light. The bloodstains were evaluated to see if the heat or fire had caused any changes to the patterns that would inhibit interpretation. Bloodstain patterns remained visible and intact inside the structure and on furnishings unless the surface that held the blood was totally burned away. Additionally, a variety of chemical techniques were utilized to better visualize the patterns and determine the possible presence of blood after the fire. The soot from the fire formed a physical barrier that initially interfered with chemical enhancement of blood. However, when the soot was removed using water or alcohol, the chemicals used, fluorescein, luminol, Bluestar, and Hemastix, performed adequately in most of the tests. Prior to DNA testing, the combined phenolphthalein/tetramethyl benzidine presumptive test for the presence of blood was conducted in the laboratory on samples recovered from the structure in an effort to assess the effectiveness of using this type of testing as a screening tool. Test results demonstrated that reliance on obtaining a positive presumptive result for blood before proceeding with DNA testing could result in the failure to obtain useful typing results. Finally, two DNA recovery methods (swabbing the stain plus

  2. The Chemical Synthesis of DNA/RNA: Our Gift to Science

    PubMed Central

    Caruthers, Marvin H.

    2013-01-01

    It is a great privilege to contribute to the Reflections essays. In my particular case, this essay has allowed me to weave some of my major scientific contributions into a tapestry held together by what I have learned from three colleagues (Robert Letsinger, Gobind Khorana, and George Rathmann) who molded my career at every important junction. To these individuals, I remain eternally grateful, as they always led by example and showed many of us how to break new ground in both science and biotechnology. Relative to my scientific career, I have focused primarily on two related areas. The first is methodologies we developed for chemically synthesizing DNA and RNA. Synthetic DNA and RNA continue to be an essential research tool for biologists, biochemists, and molecular biologists. The second is developing new approaches for solving important biological problems using synthetic DNA, RNA, and their analogs. PMID:23223445

  3. Hit-Validation Methodologies for Ligands Isolated from DNA-Encoded Chemical Libraries.

    PubMed

    Zimmermann, Gunther; Li, Yizhou; Rieder, Ulrike; Mattarella, Martin; Neri, Dario; Scheuermann, Jörg

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are large collections of compounds linked to DNA fragments, serving as amplifiable barcodes, which can be screened on target proteins of interest. In typical DECL selections, preferential binders are identified by high-throughput DNA sequencing, by comparing their frequency before and after the affinity capture step. Hits identified in this procedure need to be confirmed, by resynthesis and by performing affinity measurements. In this article we present new methods based on hybridization of oligonucleotide conjugates with fluorescently labeled complementary oligonucleotides; these facilitate the determination of affinity constants and kinetic dissociation constants. The experimental procedures were demonstrated with acetazolamide, a binder to carbonic anhydrase IX with a dissociation constant in the nanomolar range. The detection of binding events was compatible not only with fluorescence polarization methodologies, but also with Alphascreen technology and with microscale thermophoresis. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. The chemical synthesis of DNA/RNA: our gift to science.

    PubMed

    Caruthers, Marvin H

    2013-01-11

    It is a great privilege to contribute to the Reflections essays. In my particular case, this essay has allowed me to weave some of my major scientific contributions into a tapestry held together by what I have learned from three colleagues (Robert Letsinger, Gobind Khorana, and George Rathmann) who molded my career at every important junction. To these individuals, I remain eternally grateful, as they always led by example and showed many of us how to break new ground in both science and biotechnology. Relative to my scientific career, I have focused primarily on two related areas. The first is methodologies we developed for chemically synthesizing DNA and RNA. Synthetic DNA and RNA continue to be an essential research tool for biologists, biochemists, and molecular biologists. The second is developing new approaches for solving important biological problems using synthetic DNA, RNA, and their analogs.

  5. Chemical mapping of DNA and counter-ion content inside phage by energy-filtered TEM.

    PubMed

    Nevsten, Pernilla; Evilevitch, Alex; Wallenberg, Reine

    2012-03-01

    Double-stranded DNA in many bacterial viruses (phage) is strongly confined, which results in internal genome pressures of tens of atmospheres. This pressure is strongly dependent on local ion concentration and distribution within the viral capsid. Here, we have used electron energy loss spectroscopy (EELS), energy-filtered TEM (EFTEM) and X-ray energy dispersive spectroscopy to provide such chemical information from the capsid and the phage tail through which DNA is injected into the cell. To achieve this, we have developed a method to prepare thin monolayers of self-supporting virus/buffer films, suitable for EELS and EFTEM analysis. The method is based on entrapment of virus particles at air-liquid interfaces; thus, the commonly used method of staining by heavy metal salts can be avoided, eliminating the risk for chemical artifacts. We found that Mg(2 + ) concentration was approximately 2-4 times higher in the DNA-filled capsid than in the surrounding TM buffer (containing 10 mM Mg(2 + )). Furthermore, we also analyzed the DNA content inside the phage tail by mapping phosphorus and magnesium.

  6. Calculation of direct effects of 60Co gamma rays on the different DNA structural levels: A simulation study using the Geant4-DNA toolkit

    NASA Astrophysics Data System (ADS)

    Tajik, Marjan; Rozatian, Amir S. H.; Semsarha, Farid

    2015-03-01

    In this study, simple single strand breaks (SSB) and double strand breaks (DSB) due to direct effects of the secondary electron spectrum of 60Co gamma rays on different organizational levels of a volume model of the B-DNA conformation have been calculated using the Geant4-DNA toolkit. Result of this study for the direct DSB yield shows a good agreement with other theoretical and experimental results obtained by both photons and their secondary electrons; however, in the case of SSB a noticeable difference can be observed. Moreover, regarding the almost constant yields of the direct strand breaks in the different structural levels of the DNA, calculated in this work, and compared with some theoretical studies, it can be deduced that the direct strand breaks yields depend mainly on the primary double helix structure of the DNA and the higher-order structures cannot have a noticeable effect on the direct DNA damage inductions by 60Co gamma rays. In contrast, a direct dependency between the direct SSB and DSB yields and the volume of the DNA structure has been found. Also, a further study on the histone proteins showed that they can play an important role in the trapping of low energy electrons without any significant effect on the direct DNA strand breaks inductions, at least in the range of energies used in the current study.

  7. Regular Nanoscale Protein Patterns via Directed Adsorption through Self-Assembled DNA Origami Masks.

    PubMed

    Ramakrishnan, Saminathan; Subramaniam, Sivaraman; Stewart, A Francis; Grundmeier, Guido; Keller, Adrian

    2016-11-16

    DNA origami has become a widely used method for synthesizing well-defined nanostructures with promising applications in various areas of nanotechnology, biophysics, and medicine. Recently, the possibility to transfer the shape of single DNA origami nanostructures into different materials via molecular lithography approaches has received growing interest due to the great structural control provided by the DNA origami technique. Here, we use ordered monolayers of DNA origami nanostructures with internal cavities on mica surfaces as molecular lithography masks for the fabrication of regular protein patterns over large surface areas. Exposure of the masked sample surface to negatively charged proteins results in the directed adsorption of the proteins onto the exposed surface areas in the holes of the mask. By controlling the buffer and adsorption conditions, the protein coverage of the exposed areas can be varied from single proteins to densely packed monolayers. To demonstrate the versatility of this approach, regular nanopatterns of four different proteins are fabricated: the single-strand annealing proteins Redβ and Sak, the iron-storage protein ferritin, and the blood protein bovine serum albumin (BSA). We furthermore demonstrate the desorption of the DNA origami mask after directed protein adsorption, which may enable the fabrication of hierarchical patterns composed of different protein species. Because selectivity in adsorption is achieved by electrostatic interactions between the proteins and the exposed surface areas, this approach may enable also the large-scale patterning of other charged molecular species or even nanoparticles.

  8. A simplified mathematical model of directional DNA site-specific recombination by serine integrases

    PubMed Central

    Zhao, Jia; Stark, W. Marshall; Colloms, Sean D.; Ebenhöh, Oliver

    2017-01-01

    Serine integrases catalyse site-specific recombination to integrate and excise bacteriophage genomes into and out of their host's genome. These enzymes exhibit remarkable directionality; in the presence of the integrase alone, recombination between attP and attB DNA sites is efficient and irreversible, giving attL and attR products which do not recombine further. However, in the presence of the bacteriophage-encoded recombination directionality factor (RDF), integrase efficiently promotes recombination between attL and attR to re-form attP and attB. The DNA substrates and products of both reactions are approximately isoenergetic, and no cofactors (such as adenosine triphosphate) are required for recombination. The thermodynamic driving force for directionality of these reactions is thus enigmatic. Here, we present a minimal mathematical model which can explain the directionality and regulation of both ‘forward’ and ‘reverse’ reactions. In this model, the substrates of the ‘forbidden’ reactions (between attL and attR in the absence of RDF, attP and attB in the presence of RDF) are trapped as inactive protein–DNA complexes, ensuring that these ‘forbidden’ reactions are extremely slow. The model is in good agreement with the observed in vitro kinetics of recombination by ϕC31 integrase, and defines core features of the system necessary and sufficient for directionality. PMID:28077763

  9. Direct design of an energy landscape with bistable DNA origami mechanisms.

    PubMed

    Zhou, Lifeng; Marras, Alexander E; Su, Hai-Jun; Castro, Carlos E

    2015-03-11

    Structural DNA nanotechnology provides a feasible technique for the design and fabrication of complex geometries even exhibiting controllable dynamic behavior. Recently we have demonstrated the possibility of implementing macroscopic engineering design approaches to construct DNA origami mechanisms (DOM) with programmable motion and tunable flexibility. Here, we implement the design of compliant DNA origami mechanisms to extend from prescribing motion to prescribing an energy landscape. Compliant mechanisms facilitate motion via deformation of components with tunable stiffness resulting in well-defined mechanical energy stored in the structure. We design, fabricate, and characterize a DNA origami nanostructure with an energy landscape defined by two stable states (local energy minima) separated by a designed energy barrier. This nanostructure is a four-bar bistable mechanism with two undeformed states. Traversing between those states requires deformation, and hence mechanical energy storage, in a compliant arm of the linkage. The energy barrier for switching between two states was obtained from the conformational distribution based on a Boltzmann probability function and closely follows a predictive mechanical model. Furthermore, we demonstrated the ability to actuate the mechanism into one stable state via additional DNA inputs and then release the actuation via DNA strand displacement. This controllable multistate system establishes a foundation for direct design of energy landscapes that regulate conformational dynamics similar to biomolecular complexes.

  10. Capture and Direct Amplification of DNA on Chitosan Microparticles in a Single PCR-Optimal Solution.

    PubMed

    Pandit, Kunal R; Nanayakkara, Imaly A; Cao, Weidong; Raghavan, Srinivasa R; White, Ian M

    2015-11-03

    While nucleic acid amplification tests have great potential as tools for rapid diagnostics, complicated sample preparation requirements inhibit their use in near-patient diagnostics and low-resource-setting applications. Recent advancements in nucleic acid purification have leveraged pH-modulated charge switching polymers to reduce the number of steps required for sample preparation. The polycation chitosan (pKa 6.4) has been used to efficiently purify DNA by binding nucleic acids in acidic buffers and then eluting them at a pH higher than 8.0. Though it is an improvement over conventional methods, this multistep procedure has not transformed the application of nucleic acid amplification assays. Here we describe a simpler approach using magnetic chitosan microparticles that interact with DNA in a manner that has not been reported before. The microparticles capture DNA at a pH optimal for PCR (8.5) just as efficiently as at low pH. Importantly, the captured DNA is still accessible by polymerase, enabling direct amplification from the microparticles. We demonstrate quantitative PCR from DNA captured on the microparticles, thus eliminating nearly all of the sample preparation steps. We anticipate that this new streamlined method for preparing DNA for amplification will greatly expand the diagnostic applications of nucleic acid amplification tests.

  11. DNA manipulation by means of insulator-based dielectrophoresis employing direct current electric fields.

    PubMed

    Gallo-Villanueva, Roberto C; Rodríguez-López, Carlos E; Díaz-de-la-Garza, Rocío I; Reyes-Betanzo, Claudia; Lapizco-Encinas, Blanca H

    2009-12-01

    Electrokinetic techniques offer a great potential for biological particle manipulation. Among these, dielectrophoresis (DEP) has been successfully utilized for the concentration of bioparticles. Traditionally, DEP is performed employing microelectrodes, an approach with attractive characteristics but expensive due to microelectrode fabrication costs. An alternative is insulator-based DEP, a method where non-uniform electric fields are created with arrays of insulating structures. This study presents the concentration of linear DNA particles (pET28b) employing a microchannel, with an array of cylindrical insulating structures and direct current electric fields. Results showed manipulation of DNA particles with a combination of electroosmotic, electrophoretic, and dielectrophoretic forces. Employing suspending media with conductivity of 104 muS/cm and pH of 11.15, under applied fields between 500 and 1500 V/cm, DNA particles were observed to be immobilized due to negative dielectrophoretic trapping. The observation of DNA aggregates that occurred at higher applied fields, and dispersed once the field was removed is also included. Finally, concentration factors varying from 8 to 24 times the feed concentration were measured at 2000 V/cm after concentration time-periods of 20-40 s. The results presented here demonstrate the potential of insulator-based DEP for DNA concentration, and open the possibility for fast DNA manipulation for laboratory and large-scale applications.

  12. Direct radiocarbon dating and DNA analysis of the Darra-i-Kur (Afghanistan) human temporal bone.

    PubMed

    Douka, Katerina; Slon, Viviane; Stringer, Chris; Potts, Richard; Hübner, Alexander; Meyer, Matthias; Spoor, Fred; Pääbo, Svante; Higham, Tom

    2017-06-01

    The temporal bone discovered in the 1960s from the Darra-i-Kur cave in Afghanistan is often cited as one of the very few Pleistocene human fossils from Central Asia. Here we report the first direct radiocarbon date for the specimen and the genetic analyses of DNA extracted and sequenced from two areas of the bone. The new radiocarbon determination places the find to ∼4500 cal BP (∼2500 BCE) contradicting an assumed Palaeolithic age of ∼30,000 years, as originally suggested. The DNA retrieved from the specimen originates from a male individual who carried mitochondrial DNA of the modern human type. The petrous part yielded more endogenous ancient DNA molecules than the squamous part of the same bone. Molecular dating of the Darra-i-Kur mitochondrial DNA sequence corroborates the radiocarbon date and suggests that the specimen is younger than previously thought. Taken together, the results consolidate the fact that the human bone is not associated with the Pleistocene-age deposits of Darra-i-Kur; instead it is intrusive, possibly re-deposited from upper levels dating to much later periods (Neolithic). Despite its Holocene age, the Darra-i-Kur specimen is, so far, the first and only ancient human from Afghanistan whose DNA has been sequenced. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Directly observing the motion of DNA molecules near solid-state nanopores.

    PubMed

    Ando, Genki; Hyun, Changbae; Li, Jiali; Mitsui, Toshiyuki

    2012-11-27

    We investigate the diffusion and the drift motion of λ DNA molecules near solid-state nanopores prior to their translocation through the nanopores using fluorescence microscopy. The radial dependence of the electric field near a nanopore generated by an applied voltage in ionic solution can be estimated quantitatively in 3D by analyzing the motion of negatively charged DNA molecules. We find that the electric field is approximately spherically symmetric around the nanopore under the conditions investigated. In addition, DNA clogging at the nanopore was directly observed. Surprisingly, the probability of the clogging event increases with increasing external bias voltage. We also find that DNA molecules clogging the nanopore reduce the electric field amplitude at the nanopore membrane surface. To better understand these experimental results, analytical method with Ohm's law and computer simulation with Poisson and Nernst-Planck (PNP) equations are used to calculate the electric field near the nanopore. These results are of great interest in both experimental and theoretical considerations of the motion of DNA molecules near voltage-biased nanopores. These findings will also contribute to the development of solid-state nanopore-based DNA sensing devices.

  14. INVOLVED IN DE NOVO 2-containing complex involved in RNA-directed DNA methylation in Arabidopsis

    SciTech Connect

    Ausin, Israel; Greenberg, Maxim V.C.; Simanshu, Dhirendra K.; Hale, Christopher J.; Vashisht, Ajay A.; Simon, Stacey A.; Lee, Tzuu-fen; Feng, Suhua; Española, Sophia D.; Meyers, Blake C.; Wohlschlegel, James A.; Patel, Dinshaw J.; Jacobsen, Steven E.

    2012-10-23

    At least three pathways control maintenance of DNA cytosine methylation in Arabidopsis thaliana. However, the RNA-directed DNA methylation (RdDM) pathway is solely responsible for establishment of this silencing mark. We previously described INVOLVED IN DE NOVO 2 (IDN2) as being an RNA-binding RdDM component that is required for DNA methylation establishment. In this study, we describe the discovery of two partially redundant proteins that are paralogous to IDN2 and that form a stable complex with IDN2 in vivo. Null mutations in both genes, termed IDN2-LIKE 1 and IDN2-LIKE 2 (IDNL1 and IDNL2), result in a phenotype that mirrors, but does not further enhance, the idn2 mutant phenotype. Genetic analysis suggests that this complex acts in a step in the downstream portion of the RdDM pathway. We also have performed structural analysis showing that the IDN2 XS domain adopts an RNA recognition motif (RRM) fold. Finally, genome-wide DNA methylation and expression analysis confirms the placement of the IDN proteins in an RdDM pathway that affects DNA methylation and transcriptional control at many sites in the genome. Results from this study identify and describe two unique components of the RdDM machinery, adding to our understanding of DNA methylation control in the Arabidopsis genome.

  15. Multilayered polyelectrolyte films promote the direct and localized delivery of DNA to cells.

    PubMed

    Jewell, Christopher M; Zhang, Jingtao; Fredin, Nathaniel J; Lynn, David M

    2005-08-18

    Multilayered polyelectrolyte films fabricated from plasmid DNA and a hydrolytically degradable synthetic polycation can be used to direct the localized transfection of cells without the aid of a secondary transfection agent. Multilayered assemblies 100 nm thick consisting of alternating layers of synthetic polymer and plasmid DNA encoding for enhanced green fluorescent protein (EGFP) were deposited on quartz substrates using a layer-by-layer fabrication procedure. The placement of film-coated slides in contact with COS-7 cells growing in serum-containing culture medium resulted in gene expression in cells localized under the film-coated portion of the slides. The average percentage of cells expressing EGFP relative to the total number of cells ranged from 4.6% to 37.9%, with an average of 18.6%+/-8.2%, as determined by fluorescence microscopy. In addition to providing a mechanism for the immobilization of DNA at the cell/surface interface, a preliminary analysis of film topography by atomic force microscopy (AFM) demonstrated that polymer /DNA films undergo significant structural rearrangements upon incubation to present surface bound condensed plasmid DNA nanoparticles. These data suggest that the presence of the cationic polymer in these materials may also contribute to the internalization and expression of plasmid. The materials and design principles reported here present an attractive framework for the local or non-invasive delivery of DNA from the surfaces of implantable materials or biomedical devices.

  16. Direction- and Salt-Dependent Ionic Current Signatures for DNA Sensing with Asymmetric Nanopores

    NASA Astrophysics Data System (ADS)

    Chen, Kaikai; Bell, Nicholas A. W.; Kong, Jinglin; Tian, Yu; Keyser, Ulrich F.

    2017-02-01

    Solid-state nanopores are promising tools for single molecule detection of both DNA and proteins. In this study, we investigate the patterns of ionic current blockades as DNA translocates into or out of the geometric confinement of such conically shaped pores. We studied how the geometry of a nanopore affects the detected ionic current signal of a translocating DNA molecule over a wide range of salt concentration. The blockade level in the ionic current depends on the translocation direction at a high salt concentration, and at lower salt concentrations we find a non-intuitive ionic current decrease and increase within each single event for the DNA translocations exiting from confinement. We use recently developed DNA rulers with markers and finite element calculations to explain our observations. Our calculations explain the shapes of the signals observed at all salt concentrations and show that the unexpected current decrease and increase are due to the competing effects of ion concentration polarization and geometric exclusion of ions. Our analysis shows that over a wide range of geometry, voltage and salt concentrations we are able to understand the ionic current signals of DNA in asymmetric nanopores enabling signal optimization in molecular sensing applications.

  17. Direct Fluorescent Imaging of Translocation and Unwinding by Individual DNA Helicases.

    PubMed

    Pavankumar, T L; Exell, J C; Kowalczykowski, S C

    2016-01-01

    The unique translocation and DNA unwinding properties of DNA helicases can be concealed by the stochastic behavior of enzyme molecules within the necessarily large populations used in ensemble experiments. With recent technological advances, the direct visualization of helicases acting on individual DNA molecules has contributed significantly to the current understanding of their mechanisms of action and biological functions. The combination of single-molecule techniques that enable both manipulation of individual protein or DNA molecules and visualization of their actions has made it possible to literally see novel and unique biochemical characteristics that were previously masked. Here, we describe the execution and use of single-molecule fluorescence imaging techniques, focusing on methods that include optical trapping in conjunction with epifluorescent imaging, and also surface immobilization in conjunction with total internal reflection fluorescence visualization. Combined with microchannel flow cells and microfluidic control, these methods allow individual fluorescently labeled protein and DNA molecules to be imaged and tracked, affording measurement of DNA unwinding and translocation at single-molecule resolution.

  18. Gamma and ion-beam irradiation of DNA: Free radical mechanisms, electron effects, and radiation chemical track structure

    NASA Astrophysics Data System (ADS)

    Sevilla, Michael D.; Becker, David; Kumar, Anil; Adhikary, Amitava

    2016-11-01

    The focus of our laboratory's investigation is to study the direct-type DNA damage mechanisms resulting from γ-ray and ion-beam radiation-induced free radical processes in DNA which lead to molecular damage important to cellular survival. This work compares the results of low LET (γ-) and high LET (ion-beam) radiation to develop a chemical track structure model for ion-beam radiation damage to DNA. Recent studies on protonation states of cytosine cation radicals in the N1-substituted cytosine derivatives in their ground state and 5-methylcytosine cation radicals in ground as well as in excited state are described. Our results exhibit a radical signature of excitations in 5-methylcytosine cation radical. Moreover, our recent theoretical studies elucidate the role of electron-induced reactions (low energy electrons (LEE), presolvated electrons (epre-), and aqueous (or, solvated) electrons (eaq-)). Finally DFT calculations of the ionization potentials of various sugar radicals show the relative reactivity of these species.

  19. DNA-directed gold nanodimers with tailored ensemble surface-enhanced Raman scattering properties.

    PubMed

    Lan, Xiang; Chen, Zhong; Lu, Xuxing; Dai, Gaole; Ni, Weihai; Wang, Qiangbin

    2013-11-13

    Gold nanodimers (GNDs) are assembled with high uniformity as ideal surface-enhanced Raman scattering (SERS) substrates through DNA-directed self-assembly of gold nanoparticles. The interparticle distance within GNDs is precisely tailored on the order of a few nanometers with changing the molecule length of DNA bridge. The ensemble SERS activity of monodispersed GNDs is then rationally engineered by modifying the structural parameters of GNDs including the particle size and interparticle distance. Theoretical studies on the level of single GND evidence the particle size- and interparticle-distance-dependent SERS effects, consistent with the ensemble averaged measurements.

  20. Synthesis of RNA probes by the direct in vitro transcription of PCR-generated DNA templates.

    PubMed

    Urrutia, R; McNiven, M A; Kachar, B

    1993-05-01

    We describe a novel method for the generation of RNA probes based on the direct in vitro transcription of DNA templates amplified by polymerase chain reaction (PCR) using primers with sequence hybrids between the target gene and those of the T7 and T3 RNA polymerases promoters. This method circumvents the need for cloning and allows rapid generation of strand-specific RNA molecules that can be used for the identification of genes in hybridization experiments. We have successfully applied this method to the identification of DNA sequences by Southern blot analysis and library screening.

  1. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.

    PubMed

    Bauer, Amy L; Hlavacek, William S; Unkefer, Pat J; Mu, Fangping

    2010-11-18

    An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF). Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  2. Directionality of replication fork movement determined by two-dimensional native-native DNA agarose gel electrophoresis.

    PubMed

    Ivessa, Andreas S

    2013-01-01

    The analysis of replication intermediates by the neutral-neutral two-dimensional agarose gel technique allows determining the chromosomal positions where DNA replication initiates, whether replication forks pause or stall at specific sites, or whether two DNA molecules undergo DNA recombination events. This technique does not, however, immediately tell in which direction replication forks migrate through the DNA region under investigation. Here, we describe the procedure to determine the direction of replication fork progression by carrying out a restriction enzyme digest of DNA imbedded in agarose after the completion of the first dimension of a 2D gel.

  3. Stream grazers determine their crawling direction on the basis of chemical and particulate microalgal cues.

    PubMed

    Katano, Izumi; Doi, Hideyuki

    2014-01-01

    This study aimed to determine the association between herbivore behavior and cues from producers. We used stream grazer Glossosoma larvae and determined their crawling direction in relation to chemical and visual cues from microalgae. The experimental treatments included control (no cue), particulate (chemical and particulate cues), and dissolved (chemical cue) cues from microalgae. The experimental water samples were randomly placed into either arm of a Y-shaped channel, and the crawling direction of the grazers was determined. Although the grazers crawled toward the arm containing either particulate or dissolved cues, they preferred the arm with particulate cues. This suggested that grazers responded well to both particulate (i.e., drifting algal cells) and chemical (algal smell) cues, and that particulate cues were more important for foraging. In natural habitats, grazers detect cues from producers and change their behaviors to maintain a balance between top-down and bottom-up cues.

  4. A direct detection of Escherichia coli genomic DNA using gold nanoprobes.

    PubMed

    Padmavathy, Bakthavathsalam; Vinoth Kumar, Rajendran; Jaffar Ali, Baquir Mohammed

    2012-02-06

    In situation like diagnosis of clinical and forensic samples there exists a need for highly sensitive, rapid and specific DNA detection methods. Though conventional DNA amplification using PCR can provide fast results, it is not widely practised in diagnostic laboratories partially because it requires skilled personnel and expensive equipment. To overcome these limitations nanoparticles have been explored as signalling probes for ultrasensitive DNA detection that can be used in field applications. Among the nanomaterials, gold nanoparticles (AuNPs) have been extensively used mainly because of its optical property and ability to get functionalized with a variety of biomolecules. We report a protocol for the use of gold nanoparticles functionalized with single stranded oligonucleotide (AuNP- oligo probe) as visual detection probes for rapid and specific detection of Escherichia coli. The AuNP- oligo probe on hybridization with target DNA containing complementary sequences remains red whereas test samples without complementary DNA sequences to the probe turns purple due to acid induced aggregation of AuNP- oligo probes. The color change of the solution is observed visually by naked eye demonstrating direct and rapid detection of the pathogenic Escherichia coli from its genomic DNA without the need for PCR amplification. The limit of detection was ~54 ng for unamplified genomic DNA. The method requires less than 30 minutes to complete after genomic DNA extraction. However, by using unamplified enzymatic digested genomic DNA, the detection limit of 11.4 ng was attained. Results of UV-Vis spectroscopic measurement and AFM imaging further support the hypothesis of aggregation based visual discrimination. To elucidate its utility in medical diagnostic, the assay was validated on clinical strains of pathogenic Escherichia coli obtained from local hospitals and spiked urine samples. It was found to be 100% sensitive and proves to be highly specific without any cross reaction

  5. Direct exfoliation of graphite to graphene by a facile chemical approach.

    PubMed

    Feng, Hongbin; Wu, Yongmin; Li, Jinghong

    2014-06-12

    Facile exfoliation of graphite: High-quality graphene sheets are produced directly from graphite by a facile chemical approach. The new strategy for non-oxidized chemical exfoliation of graphite is based on a pre-intercalated process with oleum and a further strong reaction with sodium in the graphite layers under grinding conditions. This method is facile, low cost, and high throughput. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  6. Direct Measurement of Single-Molecule DNA Hybridization Dynamics with Single-Base Resolution.

    PubMed

    He, Gen; Li, Jie; Ci, Haina; Qi, Chuanmin; Guo, Xuefeng

    2016-07-25

    Herein, we report label-free detection of single-molecule DNA hybridization dynamics with single-base resolution. By using an electronic circuit based on point-decorated silicon nanowires as electrical probes, we directly record the folding/unfolding process of individual hairpin DNAs with sufficiently high signal-to-noise ratio and bandwidth. These measurements reveal two-level current oscillations with strong temperature dependence, enabling us to determine the thermodynamic and kinetic properties of hairpin DNA hybridization. More importantly, successive, stepwise increases and decreases in device conductance at low temperature on a microsecond timescale are successfully observed, indicating a base-by-base unfolding/folding process. The process demonstrates a kinetic zipper model for DNA hybridization/dehybridization at the single base-pair level. This measurement capability promises a label-free single-molecule approach to probe biomolecular interactions with fast dynamics.

  7. Fluorescence Enhancement at Docking Sites of DNA-Directed Self-Assembled Nanoantennas

    NASA Astrophysics Data System (ADS)

    Acuna, G. P.; Möller, F. M.; Holzmeister, P.; Beater, S.; Lalkens, B.; Tinnefeld, P.

    2012-10-01

    We introduce self-assembled nanoantennas to enhance the fluorescence intensity in a plasmonic hotspot of zeptoliter volume. The nanoantennas are prepared by attaching one or two gold nanoparticles (NPs) to DNA origami structures, which also incorporated docking sites for a single fluorescent dye next to one NP or in the gap between two NPs. We measured the dependence of the fluorescence enhancement on NP size and number and compare it to numerical simulations. A maximum of 117-fold fluorescence enhancement was obtained for a dye molecule positioned in the 23-nanometer gap between 100-nanometer gold NPs. Direct visualization of the binding and unbinding of short DNA strands, as well as the conformational dynamics of a DNA Holliday junction in the hotspot of the nanoantenna, show the compatibility with single-molecule assays.

  8. Direct Oxidative Damage of Naked DNA Generated upon Absorption of UV Radiation by Nucleobases.

    PubMed

    Gomez-Mendoza, Miguel; Banyasz, Akos; Douki, Thierry; Markovitsi, Dimitra; Ravanat, Jean-Luc

    2016-10-06

    It has been shown that in addition to formation of pyrimidine dimers, UV irradiation of DNA in the absence of photosensitizer also induces formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine, but the mechanism of formation of that oxidized base has not been clearly established. In the present study, we provide an unambiguous demonstration that absorption of UVC and UVB radiation by the nucleobases induces DNA oxidation via a direct process (one-electron oxidation) and not singlet oxygen. Evidence arose from the fact that polyamine-guanine adducts that are specifically produced through the transient formation of guanine radical cation are generated following UV irradiation of DNA in the presence of a polyamine even in the absence of any photosensitizer.

  9. Chemical grafting of a DNA intercalator probe onto functional iron oxide nanoparticles: a physicochemical study.

    PubMed

    Bouffier, Laurent; Yiu, Humphrey H P; Rosseinsky, Matthew J

    2011-05-17

    Spherical magnetite nanoparticles (MNPs, ∼ 24 nm in diameter) were sequentially functionalized with trimethoxysilylpropyldiethylenetriamine (TMSPDT) and a synthetic DNA intercalator, namely, 9-chloro-4H-pyrido[4,3,2-kl]acridin-4-one (PyAcr), in order to promote DNA interaction. The designed synthetic pathway allowed control of the chemical grafting efficiency to access MNPs either partially or fully functionalized with the intercalator moiety. The newly prepared nanomaterials were characterized by a range of physicochemical techniques: FTIR, TEM, PXRD, and TGA. The data were consistent with a full surface coverage by immobilized silylpropyldiethylenetriamine (SPDT) molecules, which corresponds to ∼22,300 SPDT molecules per MNP and a subsequent (4740-2940) PyAcr after the chemical grafting step (i.e., ∼ 2.4 PyAcr/nm(2)). A greater amount of PyAcr (30,600) was immobilized by the alternative strategy of binding a fully prefunctionalized shell to the MNPs with up to 16.1 PyAcr/nm(2). We found that the extent of PyAcr functionalization strongly affects the resulting properties and, particularly, the colloidal stability as well as the surface charge estimated by ζ-potential measurement. The intercalator grafting generates a negative charge contribution which counterbalances the positive charge of the single SPDT shell. The DNA binding capability was measured by titration assay and increases from 15 to 21.5 μg of DNA per mg of MNPs after PyAcr grafting (14-20% yield) but then drops to only ∼2 μg for the fully functionalized MNPs. This highlights that even if the size of the MNPs is obviously a determining factor to promote surface DNA interaction, it is not the only limiting parameter, as the mode of binding and the interfacial charge density are essential to improve loading capability.

  10. Directed self-assembly of block copolymer films on atomically-thin graphene chemical patterns

    NASA Astrophysics Data System (ADS)

    Chang, Tzu-Hsuan; Xiong, Shisheng; Jacobberger, Robert M.; Mikael, Solomon; Suh, Hyo Seon; Liu, Chi-Chun; Geng, Dalong; Wang, Xudong; Arnold, Michael S.; Ma, Zhenqiang; Nealey, Paul F.

    2016-08-01

    Directed self-assembly of block copolymers is a scalable method to fabricate well-ordered patterns over the wafer scale with feature sizes below the resolution of conventional lithography. Typically, lithographically-defined prepatterns with varying chemical contrast are used to rationally guide the assembly of block copolymers. The directed self-assembly to obtain accurate registration and alignment is largely influenced by the assembly kinetics. Furthermore, a considerably broad processing window is favored for industrial manufacturing. Using an atomically-thin layer of graphene on germanium, after two simple processing steps, we create a novel chemical pattern to direct the assembly of polystyrene-block-poly(methyl methacrylate). Faster assembly kinetics are observed on graphene/germanium chemical patterns than on conventional chemical patterns based on polymer mats and brushes. This new chemical pattern allows for assembly on a wide range of guiding periods and along designed 90° bending structures. We also achieve density multiplication by a factor of 10, greatly enhancing the pattern resolution. The rapid assembly kinetics, minimal topography, and broad processing window demonstrate the advantages of inorganic chemical patterns composed of hard surfaces.

  11. Directed self-assembly of block copolymer films on atomically-thin graphene chemical patterns

    PubMed Central

    Chang, Tzu-Hsuan; Xiong, Shisheng; Jacobberger, Robert M.; Mikael, Solomon; Suh, Hyo Seon; Liu, Chi-Chun; Geng, Dalong; Wang, Xudong; Arnold, Michael S.; Ma, Zhenqiang; Nealey, Paul F.

    2016-01-01

    Directed self-assembly of block copolymers is a scalable method to fabricate well-ordered patterns over the wafer scale with feature sizes below the resolution of conventional lithography. Typically, lithographically-defined prepatterns with varying chemical contrast are used to rationally guide the assembly of block copolymers. The directed self-assembly to obtain accurate registration and alignment is largely influenced by the assembly kinetics. Furthermore, a considerably broad processing window is favored for industrial manufacturing. Using an atomically-thin layer of graphene on germanium, after two simple processing steps, we create a novel chemical pattern to direct the assembly of polystyrene-block-poly(methyl methacrylate). Faster assembly kinetics are observed on graphene/germanium chemical patterns than on conventional chemical patterns based on polymer mats and brushes. This new chemical pattern allows for assembly on a wide range of guiding periods and along designed 90° bending structures. We also achieve density multiplication by a factor of 10, greatly enhancing the pattern resolution. The rapid assembly kinetics, minimal topography, and broad processing window demonstrate the advantages of inorganic chemical patterns composed of hard surfaces. PMID:27528258

  12. DIRECT-ACTING, DNA-DAMAGING AS (III)-METHYLATED SPECIES: IMPLICATIONS FOR A CARCINOGENIC MECHANISM OF ACTION OF ARSENICALS

    EPA Science Inventory

    Direct-acting, DNA-damaging As (III)-methylated species: implications for a carcinogenic . mechanism of action of arsenicals

    Inorganic arsenic (iAs, arsenite and arsenate) has been thought to act as a carcinogen without reacting directly with DNA; neither iAs nor the As(...

  13. DIRECT-ACTING, DNA-DAMAGING AS (III)-METHYLATED SPECIES: IMPLICATIONS FOR A CARCINOGENIC MECHANISM OF ACTION OF ARSENICALS

    EPA Science Inventory

    Direct-acting, DNA-damaging As (III)-methylated species: implications for a carcinogenic . mechanism of action of arsenicals

    Inorganic arsenic (iAs, arsenite and arsenate) has been thought to act as a carcinogen without reacting directly with DNA; neither iAs nor the As(...

  14. Chase the direct impact of rainfall into groundwater in Mt. Fuji from multiple analyses including microbial DNA

    NASA Astrophysics Data System (ADS)

    Kato, Kenji; Sugiyama, Ayumi; Nagaosa, Kazuyo; Tsujimura, Maki

    2016-04-01

    A huge amount of groundwater is stored in subsurface environment of Mt. Fuji, the largest volcanic mountain in Japan. Based on the concept of piston flow transport of groundwater an apparent residence time was estimated to ca. 30 years by 36Cl/Cl ratio (Tosaki et al., 2011). However, this number represents an averaged value of the residence time of groundwater which had been mixed before it flushes out. We chased signatures of direct impact of rainfall into groundwater to elucidate the routes of groundwater, employing three different tracers; stable isotopic analysis (delta 18O), chemical analysis (concentration of silica) and microbial DNA analysis. Though chemical analysis of groundwater shows an averaged value of the examined water which was blended by various water with different sources and routes in subsurface environment, microbial DNA analysis may suggest the place where they originated, which may give information of the source and transport routes of the water examined. Throughout the in situ observation of four rainfall events showed that stable oxygen isotopic ratio of spring water and shallow groundwater obtained from 726m a.s.l. where the average recharge height of rainfall was between 1500 and 1800 m became higher than the values before a torrential rainfall, and the concentration of silica decreased after this event when rainfall exceeded 300 mm in precipitation of an event. In addition, the density of Prokaryotes in spring water apparently increased. Those changes did not appear when rainfall did not exceed 100 mm per event. Thus, findings shown above indicated a direct impact of rainfall into shallow groundwater, which appeared within a few weeks of torrential rainfall in the studied geological setting. In addition, increase in the density of Archaea observed at deep groundwater after the torrential rainfall suggested an enlargement of the strength of piston flow transport through the penetration of rainfall into deep groundwater. This finding was

  15. From classical mutagenesis to nuclease-based breeding - directing natural DNA repair for a natural end-product.

    PubMed

    Pacher, Michael; Puchta, Holger

    2017-05-01

    Production of mutants of crop plants by the use of chemical or physical genotoxins has a long tradition. These factors induce the natural DNA repair machinery to repair damage in an error-prone way. In the case of radiation, multiple double-strand breaks (DSBs) are induced randomly in the genome, leading in very rare cases to a desirable phenotype. In recent years the use of synthetic, site-directed nucleases (SDNs) - also referred to as sequence-specific nucleases - like the CRISPR/Cas system has enabled scientists to use exactly the same naturally occurring DNA repair mechanisms for the controlled induction of genomic changes at pre-defined sites in plant genomes. As these changes are not necessarily associated with the permanent integration of foreign DNA, the obtained organisms per se cannot be regarded as genetically modified as there is no way to distinguish them from natural variants. This applies to changes induced by DSBs as well as single-strand breaks, and involves repair by non-homologous end-joining and homologous recombination. The recent development of SDN-based 'DNA-free' approaches makes mutagenesis strategies in classical breeding indistinguishable from SDN-derived targeted genome modifications, even in regard to current regulatory rules. With the advent of new SDN technologies, much faster and more precise genome editing becomes available at reasonable cost, and potentially without requiring time-consuming deregulation of newly created phenotypes. This review will focus on classical mutagenesis breeding and the application of newly developed SDNs in order to emphasize similarities in the context of the regulatory situation for genetically modified crop plants. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  16. The intrinsic role of nanoconfinement in chemical equilibrium: evidence from DNA hybridization.

    PubMed

    Rubinovich, Leonid; Polak, Micha

    2013-05-08

    Recently we predicted that when a reaction involving a small number of molecules occurs in a nanometric-scale domain entirely segregated from the surrounding media, the nanoconfinement can shift the position of equilibrium toward products via reactant-product reduced mixing. In this Letter, we demonstrate how most-recently reported single-molecule fluorescence measurements of partial hybridization of ssDNA confined within nanofabricated chambers provide the first experimental confirmation of this entropic nanoconfinement effect. Thus, focusing separately on each occupancy-specific equilibrium constant, quantitatively reveals extra stabilization of the product upon decreasing the chamber occupancy or size. Namely, the DNA hybridization under nanoconfined conditions is significantly favored over the identical reaction occurring in bulk media with the same reactant concentrations. This effect, now directly verified for DNA, can be relevant to actual biological processes, as well as to diverse reactions occurring within molecular capsules, nanotubes, and other functional nanospaces.

  17. Direct ultrasensitive electrochemical biosensing of pathogenic DNA using homogeneous target-initiated transcription amplification

    PubMed Central

    Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei

    2016-01-01

    Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification. PMID:26729209

  18. Direct ultrasensitive electrochemical biosensing of pathogenic DNA using homogeneous target-initiated transcription amplification

    NASA Astrophysics Data System (ADS)

    Yan, Yurong; Ding, Shijia; Zhao, Dan; Yuan, Rui; Zhang, Yuhong; Cheng, Wei

    2016-01-01

    Sensitive and specific methodologies for detection of pathogenic gene at the point-of-care are still urgent demands in rapid diagnosis of infectious diseases. This work develops a simple and pragmatic electrochemical biosensing strategy for ultrasensitive and specific detection of pathogenic nucleic acids directly by integrating homogeneous target-initiated transcription amplification (HTITA) with interfacial sensing process in single analysis system. The homogeneous recognition and specific binding of target DNA with the designed hairpin probe triggered circular primer extension reaction to form DNA double-strands which contained T7 RNA polymerase promoter and served as templates for in vitro transcription amplification. The HTITA protocol resulted in numerous single-stranded RNA products which could synchronously hybridized with the detection probes and immobilized capture probes for enzyme-amplified electrochemical detection on the biosensor surface. The proposed electrochemical biosensing strategy showed very high sensitivity and selectivity for target DNA with a dynamic response range from 1 fM to 100 pM. Using salmonella as a model, the established strategy was successfully applied to directly detect invA gene from genomic DNA extract. This proposed strategy presented a simple, pragmatic platform toward ultrasensitive nucleic acids detection and would become a versatile and powerful tool for point-of-care pathogen identification.

  19. Specific and reversible DNA-directed self-assembly of oil-in-water emulsion droplets

    PubMed Central

    Hadorn, Maik; Boenzli, Eva; Sørensen, Kristian T.; Fellermann, Harold; Eggenberger Hotz, Peter; Hanczyc, Martin M.

    2012-01-01

    Higher-order structures that originate from the specific and reversible DNA-directed self-assembly of microscopic building blocks hold great promise for future technologies. Here, we functionalized biotinylated soft colloid oil-in-water emulsion droplets with biotinylated single-stranded DNA oligonucleotides using streptavidin as an intermediary linker. We show the components of this modular linking system to be stable and to induce sequence-specific aggregation of binary mixtures of emulsion droplets. Three length scales were thereby involved: nanoscale DNA base pairing linking microscopic building blocks resulted in macroscopic aggregates visible to the naked eye. The aggregation process was reversible by changing the temperature and electrolyte concentration and by the addition of competing oligonucleotides. The system was reset and reused by subsequent refunctionalization of the emulsion droplets. DNA-directed self-assembly of oil-in-water emulsion droplets, therefore, offers a solid basis for programmable and recyclable soft materials that undergo structural rearrangements on demand and that range in application from information technology to medicine. PMID:23175791

  20. Specific and reversible DNA-directed self-assembly of oil-in-water emulsion droplets.

    PubMed

    Hadorn, Maik; Boenzli, Eva; Sørensen, Kristian T; Fellermann, Harold; Eggenberger Hotz, Peter; Hanczyc, Martin M

    2012-12-11

    Higher-order structures that originate from the specific and reversible DNA-directed self-assembly of microscopic building blocks hold great promise for future technologies. Here, we functionalized biotinylated soft colloid oil-in-water emulsion droplets with biotinylated single-stranded DNA oligonucleotides using streptavidin as an intermediary linker. We show the components of this modular linking system to be stable and to induce sequence-specific aggregation of binary mixtures of emulsion droplets. Three length scales were thereby involved: nanoscale DNA base pairing linking microscopic building blocks resulted in macroscopic aggregates visible to the naked eye. The aggregation process was reversible by changing the temperature and electrolyte concentration and by the addition of competing oligonucleotides. The system was reset and reused by subsequent refunctionalization of the emulsion droplets. DNA-directed self-assembly of oil-in-water emulsion droplets, therefore, offers a solid basis for programmable and recyclable soft materials that undergo structural rearrangements on demand and that range in application from information technology to medicine.

  1. Mechanism of human methyl-directed DNA methyltransferase and the fidelity of cytosine methylation.

    PubMed Central

    Smith, S S; Kaplan, B E; Sowers, L C; Newman, E M

    1992-01-01

    The properties of the methyl-directed DNA (cytosine-5-)-methyltransferase (EC 2.1.1.37) suggest that it is the enzyme that maintains patterns of methylation in the human genome. Proposals for the enzyme's mechanism of action suggest that 5-methyldeoxycytidine is produced from deoxycytidine via a dihydrocytosine intermediate. We have used an oligodeoxynucleotide containing 5-fluorodeoxycytidine as a suicide substrate to capture the enzyme and the dihydrocytosine intermediate. Gel retardation experiments demonstrate the formation of the expected covalent complex between duplex DNA containing 5-fluorodeoxycytidine and the human enzyme. Formation of the complex was dependent upon the presence of the methyl donor S-adenosylmethionine, suggesting that it comprises an enzyme-linked 5-substituted dihydrocytosine moiety in DNA. Dihydrocytosine derivatives are extremely labile toward hydrolytic deamination in aqueous solution. Because C-to-T transition mutations are especially prevalent at CG sites in human DNA, we have used high-performance liquid chromatography to search for thymidine that might be generated by hydrolysis during the methyl transfer reaction. Despite the potential for deamination inherent in the formation of the intermediate, the methyltransferase did not produce detectable amounts of thymidine. The data suggest that the ability of the human methyltransferase to preserve genetic information when copying a methylation pattern (i.e., its fidelity) is comparable to the ability of a mammalian DNA polymerase to preserve genetic information when copying a DNA sequence. Thus the high frequency of C-to-T transitions at CG sites in human DNA does not appear to be due to the normal enzymatic maintenance of methylation patterns. Images PMID:1584813

  2. Differential contribution of HP1 proteins to DNA end resection and homology-directed repair.

    PubMed

    Soria, Gaston; Almouzni, Geneviève

    2013-02-01

    Heterochromatin protein 1 paralogs (HP1α, β and γ in mammals) are not only central in heterochromatin organization, but have also been linked to transcriptional activation at euchromatic regions, maintenance of telomere stability and, most recently, to the DNA damage response (DDR). However, how HP1 proteins contribute to the DDR at a molecular level, and whether HP1 paralogs within the same organism, as well as their respective orthologs, have overlapping or unique roles in the DDR, remain to be elucidated. Herein, we have combined the analysis of the efficiency and kinetics of recruitment of key repair proteins to sites of DNA damage with specific DNA repair assays to demonstrate that human HP1 paralogs differentially modulate homology-directed repair (HDR) pathways, including homologous recombination (HR) and single-strand annealing (SSA). We find that while HP1α and β stimulate HR and SSA, HP1γ has an inhibitory role. In addition, we show that the stimulatory role of HP1α and β in HDR is linked to the DNA-end resection step of DNA breaks, through the promotion of RPA loading and phosphorylation at damage sites. Altogether, our findings provide mechanistic insight into how human HP1 proteins participate in the recombination process, emerging as important chromatin regulators during HDR.

  3. A clickable psoralen to directly quantify DNA interstrand crosslinking and repair.

    PubMed

    Evison, Benjamin J; Actis, Marcelo L; Fujii, Naoaki

    2016-03-01

    DNA interstrand crosslinks (ICLs) represent physical obstacles to advancing replication forks and transcription complexes. A range of ICL-inducing agents have successfully been incorporated into cancer therapeutics. While studies have adopted UVA-activated psoralens as model ICL-inducing agents for investigating ICL repair, direct detection of the lesion has often been tempered by tagging the psoralen scaffold with a relatively large reporter group that may perturb the biological activity of the parent psoralen. Here a minimally-modified psoralen probe was prepared featuring a small alkyne handle suitable for click chemistry. The psoralen probe, designated 8-propargyloxypsoralen (8-POP), can be activated by UVA in vitro to generate ICLs that are susceptible to post-labeling with an azide-tagged fluorescent reporter via a copper-catalyzed reaction. A modified alkaline comet assay demonstrated that UVA-activated 8-POP proficiently generated ICLs in cells. Cellular 8-POP-DNA lesions were amenable to click-mediated ligation to fluorescent reporters in situ, which permitted their detection and quantitation by fluorescence microscopy and flow cytometry. Small molecule DNA repair inhibitors to 8-POP-treated cells attenuated the removal of 8-POP-DNA lesions, validating 8-POP as an appropriate probe for investigating cellular ICL repair. The post-labeling strategy applied in this study is inexpensive, rapid and highly modular in nature with the potential for multiple applications in DNA repair studies.

  4. The role of reactivity in DNA templated native chemical PNA ligation during PCR.

    PubMed

    Roloff, Alexander; Seitz, Oliver

    2013-06-15

    DNA templated fluorogenic reactions have been used as a diagnostic tool for the sequence specific detection of nucleic acids; and it has been shown that the native chemical ligation between thioester- and 1,2-aminothiol-modified PNA probes is amongst the most selective DNA detection methods reported. We explored whether a DNA templated reaction can be interfaced with the polymerase chain reaction (PCR). This endeavor posed a significant challenge. The reactive groups involved must be sufficiently stable to tolerate the high temperature applied in the PCR process. Nevertheless, the ligation reaction must proceed very rapidly and sequence specifically within the short time available in the annealing and primer extension steps before denaturation is used after approx. 1 min to commence the next PCR cycle. This required a careful optimization of the ternary complex architecture as well as adjustments of probe length and probe reactivities. Our results point to the prime importance of the ligation architecture. We show that once suitable annealing sites have been identified less reactive probe sets may be preferable if sequence specificity is of major concern. The reactivity tuning enabled the development of an in-PCR ligation, which was used for the single nucleotide specific typing of the V600E (T1799A) point mutation in the human BRaf gene. Showcasing the efficiency and sequence specificity of native chemical PNA ligation, attomolar template proofed sufficient to trigger signal while a 1000-fold higher load of single mismatched template failed to induce appreciable signal.

  5. Chemical synthesis, DNA incorporation and biological study of a new photocleavable 2′-deoxyadenosine mimic

    PubMed Central

    Berthet, Nathalie; Crey-Desbiolles, Caroline; Kotera, Mitsuharu; Dumy, Pascal

    2009-01-01

    The phototriggered cleavage of chemical bonds has found numerous applications in biology, particularly in the field of gene sequencing through photoinduced DNA strand scission. However, only a small number of modified nucleosides that are able to cleave DNA at selected positions have been reported in the literature. Herein, we show that a new photoactivable deoxyadenosine analogue, 3-nitro-3-deaza-2′-deoxyadenosine (d(3-NiA)), was able to induce DNA backbone breakage upon irradiation (λ > 320 nm). The d(3-NiA) nucleoside was chemically incorporated at desired positions into 40-mer oligonucleotides as a phosphoramidite monomer and subsequent hybridization studies confirmed that the resulting modified duplexes display a behaviour that is close to that of the related natural sequence. Enzymatic action of the Klenow fragment exonuclease free revealed the preferential incorporation of dAMP opposite the 3-NiA base. On the other hand, incorporation of the analogous 3-NiA triphosphate to a primer revealed high enzyme efficiency and selectivity for insertion opposite thymine. Furthermore, only the enzymatically synthesized base pair 3-NiA:T was a substrate for further extension by the enzyme. All the hybridization and enzymatic data indicate that this new photoactivable 3-NiA triphosphate can be considered as a photochemically cleavable dATP analogue. PMID:19586934

  6. DNA polymerases engineered by directed evolution to incorporate non-standard nucleotides

    PubMed Central

    Laos, Roberto; Thomson, J. Michael; Benner, Steven A.

    2014-01-01

    DNA polymerases have evolved for billions of years to accept natural nucleoside triphosphate substrates with high fidelity and to exclude closely related structures, such as the analogous ribonucleoside triphosphates. However, polymerases that can accept unnatural nucleoside triphosphates are desired for many applications in biotechnology. The focus of this review is on non-standard nucleotides that expand the genetic “alphabet.” This review focuses on experiments that, by directed evolution, have created variants of DNA polymerases that are better able to accept unnatural nucleotides. In many cases, an analysis of past evolution of these polymerases (as inferred by examining multiple sequence alignments) can help explain some of the mutations delivered by directed evolution. PMID:25400626

  7. Recognizing nucleosides with transverse electronic transport via perpendicular direction of base planes for DNA sequencing

    NASA Astrophysics Data System (ADS)

    Yang, Bing; Dong, Ruixin; Yan, Xunling; Shi, Qiang

    2012-09-01

    Putting the four DNA nucleosides in the middle of gold [111] nanoelectrodes with base planes parallel to the electrode surface layer, we study the transverse electronic transport properties of four nucleosides along the direction of electrodes. First, the optimal distance of the electrodes is released. The results show that the optimal electrode distance to study transverse electronic transport characteristics of DNA nucleosides is about 0.68 nm. Second, we theoretically calculate the conductance and current of the four nucleosides via perpendicular direction of base planes in the bias range of [-2, 2] V by exploiting the first principle theory. According to the calculated results, we propose three methods to recognize the nucleoside type in practice application.

  8. Recognizing nucleosides with transverse electronic transport via perpendicular direction of base planes for DNA sequencing.

    PubMed

    Yang, Bing; Dong, Ruixin; Yan, Xunling; Shi, Qiang

    2012-09-19

    Putting the four DNA nucleosides in the middle of gold [111] nanoelectrodes with base planes parallel to the electrode surface layer, we study the transverse electronic transport properties of four nucleosides along the direction of electrodes. First, the optimal distance of the electrodes is released. The results show that the optimal electrode distance to study transverse electronic transport characteristics of DNA nucleosides is about 0.68 nm. Second, we theoretically calculate the conductance and current of the four nucleosides via perpendicular direction of base planes in the bias range of [-2, 2] V by exploiting the first principle theory. According to the calculated results, we propose three methods to recognize the nucleoside type in practice application.

  9. Direct chemical profiling of olive (Olea europaea) fruit epicuticular waxes by direct electrospray-ultrahigh resolution mass spectrometry.

    PubMed

    Vichi, Stefania; Cortés-Francisco, Nuria; Romero, Agustí; Caixach, Josep

    2015-03-01

    In the present paper, an electrospray ionization (ESI)-Orbitrap method is proposed for the direct chemical profiling of epicuticular wax (EW) from Olea europaea fruit. It constitutes a rapid and efficient tool suitable for a wide-ranging screening of a large number of samples. In a few minutes, the method provides a comprehensive characterization of total EW extracts, based on the molecular formula of their components. Accurate mass measurements are obtained by ultrahigh resolution mass spectrometry, and compositional restrictions are set on the basis of the information available from previous studies of olive EW. By alternating positive and negative ESI modes within the same analysis, complementary results are obtained and a wide range of chemical species is covered. This provides a detailed compositional overview that otherwise would only be available by applying multiple analytical techniques.

  10. Deep UV generation and direct DNA photo-interaction by harmonic nanoparticles in labelled samples

    NASA Astrophysics Data System (ADS)

    Staedler, Davide; Magouroux, Thibaud; Passemard, Solène; Schwung, Sebastian; Dubled, Marc; Schneiter, Guillaume Stéphane; Rytz, Daniel; Gerber-Lemaire, Sandrine; Bonacina, Luigi; Wolf, Jean-Pierre

    2014-02-01

    A biophotonics approach based on the nonlinear optical process of second harmonic generation is presented and demonstrated on malignant human cell lines labelled by harmonic nanoparticles. The method enables independent imaging and therapeutic action, selecting each modality by simply tuning the excitation laser wavelength from infrared to visible. In particular, the generation of deep ultraviolet radiation at 270 nm allows direct interaction with nuclear DNA in the absence of photosensitizing molecules.

  11. Simple and efficient oligonucleotide-directed mutagenesis using one primer and circular plasmid DNA template.

    PubMed

    Marotti, K R; Tomich, C S

    1989-01-01

    A rapid and simple procedure for site-directed mutagenesis is described. This method uses only a single oligonucleotide primer with the double-stranded circular plasmid DNA as the template for mutagenesis. The phage T4 gene 32 product is included during primer extension in vitro to increase efficiency. Single and multiple changes as well as deletions have been obtained at an efficiency of 1-2%.

  12. Closed-Loop Control of Chemical Injection Rate for a Direct Nozzle Injection System

    PubMed Central

    Cai, Xiang; Walgenbach, Martin; Doerpmond, Malte; Schulze Lammers, Peter; Sun, Yurui

    2016-01-01

    To realize site-specific and variable-rate application of agricultural pesticides, accurately metering and controlling the chemical injection rate is necessary. This study presents a prototype of a direct nozzle injection system (DNIS) by which chemical concentration transport lag was greatly reduced. In this system, a rapid-reacting solenoid valve (RRV) was utilized for injecting chemicals, driven by a pulse-width modulation (PWM) signal at 100 Hz, so with varying pulse width the chemical injection rate could be adjusted. Meanwhile, a closed-loop control strategy, proportional-integral-derivative (PID) method, was applied for metering and stabilizing the chemical injection rate. In order to measure chemical flow rates and input them into the controller as a feedback in real-time, a thermodynamic flowmeter that was independent of chemical viscosity was used. Laboratory tests were conducted to assess the performance of DNIS and PID control strategy. Due to the nonlinear input–output characteristics of the RRV, a two-phase PID control process obtained better effects as compared with single PID control strategy. Test results also indicated that the set-point chemical flow rate could be achieved within less than 4 s, and the output stability was improved compared to the case without control strategy. PMID:26805833

  13. Closed-Loop Control of Chemical Injection Rate for a Direct Nozzle Injection System.

    PubMed

    Cai, Xiang; Walgenbach, Martin; Doerpmond, Malte; Schulze Lammers, Peter; Sun, Yurui

    2016-01-20

    To realize site-specific and variable-rate application of agricultural pesticides, accurately metering and controlling the chemical injection rate is necessary. This study presents a prototype of a direct nozzle injection system (DNIS) by which chemical concentration transport lag was greatly reduced. In this system, a rapid-reacting solenoid valve (RRV) was utilized for injecting chemicals, driven by a pulse-width modulation (PWM) signal at 100 Hz, so with varying pulse width the chemical injection rate could be adjusted. Meanwhile, a closed-loop control strategy, proportional-integral-derivative (PID) method, was applied for metering and stabilizing the chemical injection rate. In order to measure chemical flow rates and input them into the controller as a feedback in real-time, a thermodynamic flowmeter that was independent of chemical viscosity was used. Laboratory tests were conducted to assess the performance of DNIS and PID control strategy. Due to the nonlinear input-output characteristics of the RRV, a two-phase PID control process obtained better effects as compared with single PID control strategy. Test results also indicated that the set-point chemical flow rate could be achieved within less than 4 s, and the output stability was improved compared to the case without control strategy.

  14. Chemical sensing of in situ extracted organics by direct detection of mode-filtered light

    NASA Astrophysics Data System (ADS)

    Synovec, Robert E.; Bruckner, Carsten A.; Burgess, Lloyd W.; Foster, M. D.

    1994-10-01

    A novel chemical analyzer is described in which an optical fiber is inserted into a transparent capillary tube, such that the inner diameter of the tube is only a few microns larger than the outer diameter of the fiber cladding. This configuration is referred to as a torus column. When a sample volume is introduced to the torus column at a low flow rate, propagated light is mode-filtered due to a change in the critical angle at the core/clad interface, as a result of in-situ extracted chemical species. Conventionally, chemical species extracted into the cladding are sensed as a change in the transmitted light at the end of the fiber. An alternative approach, measuring this mode-filtered light directly along the side of the fiber, is reported. The new approach has a signal-to-noise advantage over the conventional approach. The result is a low volume sensor that temporally separates, as well as detects, chemical species that partition into the fiber cladding. The temporal information enhances sensor performance, providing first order information for subsequent data analysis. We have examined the modulation of the critical angle by chemical species of interest at steady-state concentrations, and as transient concentration profiles that were shifted in time. In summary, the analyzer has chemical selectivity provided by differences in the refractive index, distribution coefficient, and transient time of the concentration profile of each chemical species in a sample. The chemical analyzer should be a promising tool for process and environmental monitoring.

  15. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  16. DETECTION OF LOW DOSE RADIATION-AND CHEMICALLY-INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAYS

    EPA Science Inventory

    Rapid, sensitive and simple assays for radiation- and chemically-induced DNA damage can be of significant benefit to a number of fields including radiation biology, clinical research, and environmental monitoring. Although temperature-induced DNA strand separation has been use...

  17. Chemical discrimination of lubricant marketing types using direct analysis in real time time-of-flight mass spectrometry.

    PubMed

    Maric, Mark; Harvey, Lauren; Tomcsak, Maren; Solano, Angelique; Bridge, Candice

    2017-06-30

    In comparison to other violent crimes, sexual assaults suffer from very low prosecution and conviction rates especially in the absence of DNA evidence. As a result, the forensic community needs to utilize other forms of trace contact evidence, like lubricant evidence, in order to provide a link between the victim and the assailant. In this study, 90 personal bottled and condom lubricants from the three main marketing types, silicone-based, water-based and condoms, were characterized by direct analysis in real time time of flight mass spectrometry (DART-TOFMS). The instrumental data was analyzed by multivariate statistics including hierarchal cluster analysis, principal component analysis, and linear discriminant analysis. By interpreting the mass spectral data with multivariate statistics, 12 discrete groupings were identified, indicating inherent chemical diversity not only between but within the three main marketing groups. A number of unique chemical markers, both major and minor, were identified, other than the three main chemical components (i.e. PEG, PDMS and nonoxynol-9) currently used for lubricant classification. The data was validated by a stratified 20% withheld cross-validation which demonstrated that there was minimal overlap between the groupings. Based on the groupings identified and unique features of each group, a highly discriminating statistical model was then developed that aims to provide the foundation for the development of a forensic lubricant database that may eventually be applied to casework. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

  18. Inhibition of DNA synthesis by chemical carcinogens in cultures of initiated and normal proliferating rat hepatocytes

    SciTech Connect

    Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.

    1985-01-01

    Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone, tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.

  19. PE-Swab Direct STR Amplification of Forensic Touch DNA Samples.

    PubMed

    Liu, Jason Y

    2015-05-01

    The PE-Swab direct STR amplification workflow was developed to process low-level "touch DNA" samples. In this workflow, a forensic sample is first collected on a 4-mm PE-Swab (a novel sample collection device); two 2-mm punches containing collected samples are then generated from the PE-Swab and directly amplified for STR typing. Compared to the conventional STR workflow, which involves DNA extraction, purification, and elution volume reduction, the PE-Swab direct STR amplification workflow does not require sample preparation and takes <60 sec before a touch sample is ready for STR amplification. Because there is no DNA loss due to sample preparation, the PE-Swab workflow is more sensitive than the conventional STR workflow. The average peak height per sample obtained by the PE-swab workflow is 3 times higher than that from the conventional workflow with both low-level single source and two-contributor mixture samples tested in this study.

  20. [DNA and chemical analyses of commercial fly agaric-related products].

    PubMed

    Maruyama, Takuro; Kawahara, Nobuo; Fukiharu, Toshimitsu; Yokoyama, Kazumasa; Makino, Yukiko; Goda, Yukihiro

    2005-04-01

    Since June 6, 2002, psilocin and psilocybin-containing fungi (commonly called "magic mushrooms") have been regulated by the Narcotics and Psychotropics Control Law in Japan. However, various fly agaric-related products are now entering the Japanese market via the internet. In this study, fly agaric-related products available in this way were investigated for raw materials by DNA analysis and for additives by chemical analysis. Nucleotide sequence analysis of the mitochondrial 12S rDNA region suggested that these fly agaric-related products originate from A. muscaria or A. muscaria var. persicina. Furthermore, they were classified into three strains based on the ITS2-LSU nucleotide sequence. Harmine derivatives and/or tryptamine derivatives were detected in some of these products by LC/MS analysis. In accordance with this, the matK gene of Peganum harmala was found in all of the harmine derivative-containing samples.

  1. Initiation of simian virus 40 DNA replication in vitro: aphidicolin causes accumulation of early-replicating intermediates and allows determination of the initial direction of DNA synthesis.

    PubMed Central

    Decker, R S; Yamaguchi, M; Possenti, R; DePamphilis, M L

    1986-01-01

    Aphidicolin, a specific inhibitor of DNA polymerase alpha, provided a novel method for distinguishing between initiation of DNA synthesis at the simian virus 40 (SV40) origin of replication (ori) and continuation of replication beyond ori. In the presence of sufficient aphidicolin to inhibit total DNA synthesis by 50%, initiation of DNA replication in SV40 chromosomes or ori-containing plasmids continued in vitro, whereas DNA synthesis in the bulk of SV40 replicative intermediate DNA (RI) that had initiated replication in vivo was rapidly inhibited. This resulted in accumulation of early RI in which most nascent DNA was localized within a 600- to 700-base-pair region centered at ori. Accumulation of early RI was observed only under conditions that permitted initiation of SV40 ori-dependent, T-antigen-dependent DNA replication and only when aphidicolin was added to the in vitro system. Increasing aphidicolin concentrations revealed that DNA synthesis in the ori region was not completely resistant to aphidicolin but simply less sensitive than DNA synthesis at forks that were farther away. Since DNA synthesized in the presence of aphidicolin was concentrated in the 300 base pairs on the early gene side of ori, we conclude that the initial direction of DNA synthesis was the same as that of early mRNA synthesis, consistent with the model proposed by Hay and DePamphilis (Cell 28:767-779, 1982). The data were also consistent with initiation of the first DNA chains in ori by CV-1 cell DNA primase-DNA polymerase alpha. Synthesis of pppA/G(pN)6-8(pdN)21-23 chains on a single-stranded DNA template by a purified preparation of this enzyme was completely resistant to aphidicolin, and further incorporation of deoxynucleotide monophosphates was inhibited. Therefore, in the presence of aphidicolin, this enzyme could initiate RNA-primed DNA synthesis at ori first in the early gene direction and then in the late gene direction, but could not continue DNA synthesis for an extended

  2. Surface plasmon resonance technique for directly probing the interaction of DNA and graphene oxide and ultra-sensitive biosensing.

    PubMed

    Xue, Tianyu; Cui, Xiaoqiang; Guan, Weiming; Wang, Qiyu; Liu, Chang; Wang, Haitao; Qi, Kun; Singh, D J; Zheng, Weitao

    2014-08-15

    The binding of DNA with graphene oxide (GO) is important for applications in disease diagnosis, genetic screening, and drug discovery. The standard assay methods are mainly limited to indirect observation via fluorescence labeling. Here we report the use of surface plasmon resonance for direct sensing of DNA/GO binding. We show that this can be used for ultra-sensitive detection of single-stranded DNA (ssDNA). Furthermore, the results provide a more direct probe of DNA/GO binding abilities and confirm that hydrogen bonding plays a key role in the interaction between GO and ssDNA. This enables to a novel biosensor for highly sensitive and selective detection of ssDNA based on indirect competitive inhibition assay (ICIA). We report development of such a sensor with a linear dynamic range of 10(-14)-10(-6)M, a detection limit of 10fM and a high level of stability during repeated regeneration.

  3. Direct Conversion of Chemically De-Ashed Coal in Fuel Cells (II)

    SciTech Connect

    Cooper, J F

    2005-07-25

    We review the technical challenges associated with the production and use of various coal chars in a direct carbon conversion fuel cell. Existing chemical and physical deashing processes remove material below levels impacting performance at minimal cost. At equilibrium, sulfur entrained is rejected from the melt as COS in the offgas.

  4. Highly efficient direct conversion of human fibroblasts to neuronal cells by chemical compounds.

    PubMed

    Dai, Ping; Harada, Yoshinori; Takamatsu, Tetsuro

    2015-05-01

    Direct conversion of mammalian fibroblasts into induced neuronal (iN) cells has been attained by forced expression of pro-neural transcriptional factors, or by combining defined factors with either microRNAs or small molecules. Here, we show that neuronal cells can be converted from postnatal human fibroblasts into cell populations with neuronal purities of up to >80% using a combination of six chemical compounds. The chemical compound-induced neuronal cells (CiNCs) express neuron-specific proteins and functional neuron markers. The efficiency of CiNCs is unaffected by either the donor's age or cellular senescence (passage number). We propose this chemical direct converting strategy as a potential approach for highly efficient generation of neuronal cells from human fibroblasts for such uses as in neural disease modeling and regenerative medicine.

  5. Functionalized 2′-Amino-α-L-LNA - Directed Positioning of Intercalators for DNA Targeting

    PubMed Central

    Kumar, T. Santhosh; Madsen, Andreas S.; Østergaard, Michael E.; Sau, Sujay P.; Wengel, Jesper; Hrdlicka, Patrick J.

    2010-01-01

    Chemically modified oligonucleotides are increasingly applied in nucleic acid based therapeutics and diagnostics. LNA (Locked Nucleic Acid) and its diastereomer α-L-LNA are two promising examples hereof that exhibit increased thermal and enzymatic stability. Herein, the synthesis, biophysical characterization and molecular modeling of N2′-functionalized 2′-amino-α-L-LNA is described. Chemoselective N2′-functionalization of protected amino alcohol 1 followed by phosphitylation afforded a structurally varied set of target phosphoramidites, which were incorporated into oligodeoxyribonucleotides. Incorporation of pyrene-functionalized building blocks such as 2′-N-(pyren-1-yl)carbonyl-2′-amino-α-L-LNA (monomer X) led to extraordinary increases in thermal affinity of up to +19.5 °C per modification against DNA targets in particular. In contrast, incorporation of building blocks with small non-aromatic N2′-functionalities such as 2′-N-acetyl-2′-amino-α-L-LNA (monomer V) had detrimental effects on thermal affinity toward DNA/RNA complements with decreases of as much as −16.5 °C per modification. Extensive thermal DNA selectivity, favorable entropic contributions upon duplex formation, hybridization-induced bathochromic shifts of pyrene absorption maxima and increases of circular dichroism signals, and molecular modeling studies suggest that pyrene functionalized 2′-amino-α-L-LNA monomers W-Y having short linkers between the bicyclic skeleton and the pyrene moiety, allow high-affinity hybridization with DNA complements and precise positioning of intercalators in nucleic acid duplexes. This rigorous positional control has been utilized for the development probes for emerging therapeutic and diagnostic applications focusing on DNA-targeting. PMID:19108636

  6. Nanodosimetric Simulation of Direct Ion-Induced DNA Damage Using Different Chromatin Geometry Models.

    PubMed

    Henthorn, N T; Warmenhoven, J W; Sotiropoulos, M; Mackay, R I; Kirkby, K J; Merchant, M J

    2017-08-09

    Monte Carlo based simulation has proven useful in investigating the effect of proton-induced DNA damage and the processes through which this damage occurs. Clustering of ionizations within a small volume can be related to DNA damage through the principles of nanodosimetry. For simulation, it is standard to construct a small volume of water and determine spatial clusters. More recently, realistic DNA geometries have been used, tracking energy depositions within DNA backbone volumes. Traditionally a chromatin fiber is built within the simulation and identically replicated throughout a cell nucleus, representing the cell in interphase. However, the in vivo geometry of the chromatin fiber is still unknown within the literature, with many proposed models. In this work, the Geant4-DNA toolkit was used to build three chromatin models: the solenoid, zig-zag and cross-linked geometries. All fibers were built to the same chromatin density of 4.2 nucleosomes/11 nm. The fibers were then LET proton irradiated (5-80 keV/μm) or LET alpha-particle irradiated (63-226 keV/μm). Nanodosimetric parameters were scored for each fiber after each LET and used as a comparator among the models. Statistically significant differences were observed in the double-strand break backbone size distributions among the models, although nonsignificant differences were noted among the nanodosimetric parameters. From the data presented in this article, we conclude that selection of the solenoid, zig-zag or cross-linked chromatin model does not significantly affect the calculated nanodosimetric parameters. This allows for a simulation-based cell model to make use of any of these chromatin models for the scoring of direct ion-induced DNA damage.

  7. UVA-induced cyclobutane pyrimidine dimers in DNA: a direct photochemical mechanism?

    PubMed

    Mouret, Stéphane; Philippe, Coralie; Gracia-Chantegrel, Jocelyne; Banyasz, Akos; Karpati, Szilvia; Markovitsi, Dimitra; Douki, Thierry

    2010-04-07

    The carcinogenic action of UVA radiation is commonly attributed to DNA oxidation mediated by endogenous photosensitisers. Yet, it was recently shown that cyclobutane pyrimidine dimers (CPD), well known for their involvement in UVB genotoxicity, are produced in larger yield than oxidative lesions in UVA-irradiated cells and skin. In the present work, we gathered mechanistic information on this photoreaction by comparing formation of all possible bipyrimidine photoproducts upon UVA irradiation of cells, purified genomic DNA and dA(20):dT(20) oligonucleotide duplex. We observed that the distribution of photoproducts, characterized by the sole formation of CPD and the absence of (6-4) photoproducts was similar in the three types of samples. The CPD involving two thymines represented 90% of the amount of photoproducts. Moreover, the yields of formation of the DNA lesions were similar in cells and isolated DNA. In addition, the effect of the wavelength of the incident photons was found to be the same in isolated DNA and cells. This set of data shows that UVA-induced cyclobutane pyrimidine dimers are formed via a direct photochemical mechanism, without mediation of a cellular photosensitiser. This is possible because the double-stranded structure increases the capacity of DNA bases to absorb UVA photons, as evidenced in the case of the oligomer dA(20):dT(20). These results emphasize the need to consider UVA in the carcinogenic effects of sunlight. An efficient photoprotection is needed that can only be complete by completely blocking incident photons, rather than by systemic approaches such as antioxidant supplementation.

  8. Monitoring DNA contamination in handled vs. directly excavated ancient human skeletal remains.

    PubMed

    Pilli, Elena; Modi, Alessandra; Serpico, Ciro; Achilli, Alessandro; Lancioni, Hovirag; Lippi, Barbara; Bertoldi, Francesca; Gelichi, Sauro; Lari, Martina; Caramelli, David

    2013-01-01

    Bones, teeth and hair are often the only physical evidence of human or animal presence at an archaeological site; they are also the most widely used sources of samples for ancient DNA (aDNA) analysis. Unfortunately, the DNA extracted from ancient samples, already scarce and highly degraded, is widely susceptible to exogenous contaminations that can affect the reliability of aDNA studies. We evaluated the molecular effects of sample handling on five human skeletons freshly excavated from a cemetery dated between the 11 to the 14(th) century. We collected specimens from several skeletal areas (teeth, ribs, femurs and ulnas) from each individual burial. We then divided the samples into two different sets: one labeled as "virgin samples" (i.e. samples that were taken by archaeologists under contamination-controlled conditions and then immediately sent to the laboratory for genetic analyses), and the second called "lab samples"(i.e. samples that were handled without any particular precautions and subject to normal washing, handling and measuring procedures in the osteological lab). Our results show that genetic profiles from "lab samples" are incomplete or ambiguous in the different skeletal areas while a different outcome is observed in the "virgin samples" set. Generally, all specimens from different skeletal areas in the exception of teeth present incongruent results between "lab" and "virgin" samples. Therefore teeth are less prone to contamination than the other skeletal areas we analyzed and may be considered a material of choice for classical aDNA studies. In addition, we showed that bones can also be a good candidate for human aDNA analysis if they come directly from the excavation site and are accompanied by a clear taphonomic history.

  9. Direct DNA isolation from solid biological sources without pretreatments with proteinase-K and/or homogenization through automated DNA extraction.

    PubMed

    Ki, Jang-Seu; Chang, Ki Byum; Roh, Hee June; Lee, Bong Youb; Yoon, Joon Yong; Jang, Gi Young

    2007-03-01

    Genomic DNA from solid biomaterials was directly isolated with an automated DNA extractor, which was based on magnetic bead technology with a bore-mediated grinding (BMG) system. The movement of the bore broke down the solid biomaterials, mixed crude lysates thoroughly with reagents to isolate the DNA, and carried the beads to the next step. The BMG system was suitable for the mechanical homogenization of the solid biomaterials and valid as an automated system for purifying the DNA from the solid biomaterials without the need for pretreatment or disruption procedures prior to the application of the solid biomaterials.

  10. Direct Monte Carlo simulation of the chemical equilibrium composition of detonation products

    SciTech Connect

    Shaw, M.S.

    1993-06-01

    A new Monte Carlo simulation method has been developed by the author which gives the equilibrium chemical composition of a molecular fluid directly. The usual NPT ensemble (isothermal-isobaric) is implemented with N being the number of atoms instead of molecules. Changes in chemical composition are treated as correlated spatial moves of atoms. Given the interaction potentials between molecular products, ``exact`` EOS points including the equilibrium chemical composition can be determined from the simulations. This method is applied to detonation products at conditions in the region near the Chapman- Jouget state. For the example of NO, it is shown that the CJ detonation velocity can be determined to a few meters per second. A rather small change in cross potentials is shown to shift the chemical equilibrium and the CJ conditions significantly.

  11. Analysis of weblike network structures of directed graphs for chemical reactions in methane plasmas

    SciTech Connect

    Sakai, Osamu Nobuto, Kyosuke; Miyagi, Shigeyuki; Tachibana, Kunihide

    2015-10-15

    Chemical reactions of molecular gases like methane are so complicated that a chart of decomposed and/or synthesized species originating from molecules in plasma resembles a weblike network in which we write down species and reactions among them. Here we consider properties of the network structures of chemical reactions in methane plasmas. In the network, atoms/molecules/radical species are assumed to form nodes and chemical reactions correspond to directed edges in the terminology of graph theory. Investigation of the centrality index reveals importance of CH{sub 3} in the global chemical reaction, and difference of an index for each radical species between cases with and without electrons clarifies that the electrons are at an influential position to tighten the network structure.

  12. The role of hydration in the distribution of free radical trapping in directly ionized DNA.

    PubMed

    Purkayastha, Shubhadeep; Milligan, Jamie R; Bernhard, William A

    2006-07-01

    The purpose of this study was to elucidate the role of hydration (Gamma) in the distribution of free radical trapping in directly ionized DNA. Solid-state films of pUC18 (2686 bp) plasmids were hydrated to Gamma in the range 2.5 < or = Gamma < or = 22.5 mol water/mol nucleotide. Free radical yields, G(Sigmafr), measured by EPR at 4 K are seen to increase from 0.28 +/- 0.01 micromol/J at Gamma = 2.5 to 0.63 +/- 0.01 micromol/J at Gamma= 22.5, respectively. Based on a semi-empirical model of the free radical trapping events that follow the initial ionizations of the DNA components, we conclude that two-thirds of the holes formed on the inner solvation shell (Gamma < 10) transfer to the sugar-phosphate backbone. Likewise, of the holes produced by direct ionization of the sugar-phosphate, about one-third are trapped by deprotonation as neutral sugar-phosphate radical species, while the remaining two-thirds are found to transfer to the bases. This analysis provides the best measure to date for the probability of hole transfer (approximately 67%) into the base stack. It can thus be predicted that the distribution of holes formed in fully hydrated DNA at 4 K will be 78% on the bases and 22% on the sugar-phosphate. Adding the radicals due to electron attachment (confined to the pyrimidine bases), the distribution of all trapped radicals will be 89% on the bases and 11% on the sugar-phosphate backbone. This prediction is supported by partitioning results obtained from the high dose-response curves fitted to the two-component model. These results not only add to our understanding of how the holes redistribute after ionization but are also central to predicting the yield and location of strand breaks in DNA exposed to the direct effects of ionizing radiation.

  13. Chemical Methylation of RNA and DNA Viral Genomes as a Probe of In Situ Structure

    PubMed Central

    Yamakawa, Minoru; Shatkin, Aaron J.; Furuichi, Yasuhiro

    1981-01-01

    We used [methyl-3H] dimethyl sulfate to probe the genome structures of several RNA and DNA viruses. We compared sites of modification in nucleic acids that were methylated chemically before and after extraction from purified virions. With both single-stranded and double-stranded substrates alkylation occurred mainly at the N7 position of guanine. However, adenine N1 atoms were differentially accessible in single-stranded RNA and DNA. For example, the ratios of 1-methyladenosine to 7-methylguanosine for reovirus mRNA and deproteinized genome RNA were 0.43 and 0.03, respectively. Members of the Reoviridae methylated in situ yielded RNAs with ratios of 0.04 to 0.08, indicating that the intravirion genomes were double stranded. We obtained ratios of 0.26 and 0.35 for the RNAs of dimethyl sulfate-treated brome mosaic and avian sarcoma virions, respectively, which was consistent with partial protection of adenine N1 sites by structural proteins or genome conformation or both. The ratios of 1-methyladenosine to 7-methylguanosine for vaccinia virus DNAs methylated in situ (0.10) and after phenol extraction (0.14) were less than the ratios for φX174 and M13 DNAs (0.39 to 0.64) but considerably greater than the ratio observed with adenovirus DNA (0.002 to 0.02). The presence of a single-stranded region(s) in the vaccinia virus genome was confirmed by S1 nuclease digestion of [methyl-3H] DNA; the released radiolabeled fraction had a ratio of 0.41, compared with 0.025 for the residual duplex DNA. In addition to the structure-dependent accessibility of adenine N1, methylation of adenine N3 was severalfold lower in the intravirion genomes of vaccinia virus, φX174, and adenovirus than in the corresponding extracted DNAs. Chemical methylation of virions and subviral particles should be useful for in situ analyses of specific regions of RNA and DNA genomes, such as the sites of protein binding during virus maturation. PMID:6172596

  14. Evaluating legacy contaminants and emerging chemicals in marine environments using adverse outcome pathways and biological effects-directed analysis.

    PubMed

    Hutchinson, Thomas H; Lyons, Brett P; Thain, John E; Law, Robin J

    2013-09-30

    Natural and synthetic chemicals are essential to our daily lives, food supplies, health care, industries and safe sanitation. At the same time protecting marine ecosystems and seafood resources from the adverse effects of chemical contaminants remains an important issue. Since the 1970s, monitoring of persistent, bioaccumulative and toxic (PBT) chemicals using analytical chemistry has provided important spatial and temporal trend data in three important contexts; relating to human health protection from seafood contamination, addressing threats to marine top predators and finally providing essential evidence to better protect the biodiversity of commercial and non-commercial marine species. A number of regional conventions have led to controls on certain PBT chemicals over several years (termed 'legacy contaminants'; e.g. cadmium, lindane, polycyclic aromatic hydrocarbons [PAHs] and polychlorinated biphenyls [PCBs]). Analytical chemistry plays a key role in evaluating to what extent such regulatory steps have been effective in leading to reduced emissions of these legacy contaminants into marine environments. In parallel, the application of biomarkers (e.g. DNA adducts, CYP1A-EROD, vitellogenin) and bioassays integrated with analytical chemistry has strengthened the evidence base to support an ecosystem approach to manage marine pollution problems. In recent years, however,the increased sensitivity of analytical chemistry, toxicity alerts and wider environmental awareness has led to a focus on emerging chemical contaminants (defined as chemicals that have been detected in the environment, but which are currently not included in regulatory monitoring programmes and whose fate and biological impacts are poorly understood). It is also known that natural chemicals (e.g. algal biotoxins) may also pose a threat to marine species and seafood quality. Hence complex mixtures of legacy contaminants, emerging chemicals and natural biotoxins in marine ecosystems represent

  15. Direct-push geochemical profiling for assessment of inorganic chemical heterogeneity in aquifers

    USGS Publications Warehouse

    Schulmeister, M.K.; Healey, J.M.; Butler, J.J.; McCall, G.W.

    2004-01-01

    Discrete-depth sampling of inorganic groundwater chemistry is essential for a variety of site characterization activities. Although the mobility and rapid sampling capabilities of direct-push techniques have led to their widespread use for evaluating the distribution of organic contaminants, complementary methods for the characterization of spatial variations in geochemical conditions have not been developed. In this study, a direct-push-based approach for high-resolution inorganic chemical profiling was developed at a site where sharp chemical contrasts and iron-reducing conditions had previously been observed. Existing multilevel samplers (MLSs) that span a fining-upward alluvial sequence were used for comparison with the direct-push profiling. Chemical profiles obtained with a conventional direct-push exposed-screen sampler differed from those obtained with an adjacent MLS because of sampler reactivity and mixing with water from previous sampling levels. The sampler was modified by replacing steel sampling components with stainless-steel and heat-treated parts, and adding an adapter that prevents mixing. Profiles obtained with the modified approach were in excellent agreement with those obtained from an adjacent MLS for all constituents and parameters monitored (Cl, NO3, Fe, Mn, DO, ORP, specific conductance and pH). Interpretations of site redox conditions based on field-measured parameters were supported by laboratory analysis of dissolved Fe. The discrete-depth capability of this approach allows inorganic chemical variations to be described at a level of detail that has rarely been possible. When combined with the mobility afforded by direct-push rigs and on-site methods of chemical analysis, the new approach is well suited for a variety of interactive site-characterization endeavors. ?? 2003 Elsevier B.V. All rights reserved.

  16. The possible roles of water in the prebiotic chemical evolution of DNA.

    PubMed

    Cui, Shuxun

    2010-09-21

    There is no doubt that water is pivotal to life. Yet, as the emergence of life is still a big challenge in science, the detailed involvement of water in that process is not well recognized. Following the clues provided by recent single-molecule studies on DNA, we attempt to elucidate the possible roles of water in the prebiotic chemical evolution. Water has long been recognized as an important reactant in the Miller-Urey experiment and then as the only solvent of the primitive soup. Besides that, water also played a vital role in the prebiotic chemical evolution: water is the important criterion in the combinatorial library screening for self-assembling macromolecules. With this notion, the uniformity of biochemistry for all terrestrial life may be explained. A possible roadmap from the inorganic world to the origin of life is also discussed.

  17. Stabilization of Z-DNA by chemical bromination and its recognition by anti-Z-DNA antibodies

    SciTech Connect

    Hardin, C.C.; Zarling, D.A.; Puglisi, J.D.; Trulson, M.O.; Davis, P.W.; Tinoco, I. Jr.

    1987-08-11

    Limited chemical bromination of poly(r(C-G)) (32% br/sup 8/G, 26% br/sup 5/C) results in partial modification of guanine C8 and cytosine C5, producing a mixture of A- and Z-RNA forms. The Z conformation in the brominated polynucleotide is stabilized at much lower ionic strength than in the unmodified polynucleotide. Raising the ionic strength to 6 M NaBr or NaClO/sub 4/ results in a transition in Br-poly(r(C-G)) to a Z-RNA (Z/sub R/) conformation as judged by CD spectroscopy. /sup 1/H NMR data demonstrate a 1/1 mixture of A- and Z-RNAs in 110 mM NaBr buffer at 37/sup 0/C. Nuclear Overhauser effect (NOE) experiments permit complete assignments of GH8, CH6, CH5, GH1', AND CH1' resonances in both the A- and Z-forms. The NMR results indicate that unbrominated guanine residues undergo transition to the syn conformation (Z-form). Raman scattering data are consistent with a mixture of A- and Z-RNAs in 110 mM NaCl buffer at 37 /sup 0/C. /sup 31/P NMR spectra show six to eight resonances spread over a 1.8 ppm range whose chemical shifts are also consistent with an equilibrium mixture of A- and Z-RNAs. Radioimmunoassay and nitrocellulose filter binding competition experiments were performed to determine the extent of recognition of Br-poly(r(C-G)) by anti-Z-DNA antibodies. Competition RIA experiments verify the presence of a Z-DNA-like determinant in left-handed Br-poly(r(C-G)) at physiological NaCl concentration. In summary, these spectroscopic and immunochemical studies demonstrate that under conditions of conformational stress (i.e., containing brominated nucleosides) left-handed Z-RNA is stable and is specifically recognized by proteins at physiological temperature and ionic strength.

  18. Characterization of chemically modified oligonucleotides targeting a pathogenic mutation in human mitochondrial DNA.

    PubMed

    Tonin, Yann; Heckel, Anne-Marie; Dovydenko, Ilya; Meschaninova, Mariya; Comte, Caroline; Venyaminova, Alya; Pyshnyi, Dmitrii; Tarassov, Ivan; Entelis, Nina

    2014-05-01

    Defects in mitochondrial genome can cause a wide range of clinical disorders, mainly neuromuscular diseases. Most of the deleterious mitochondrial mutations are heteroplasmic, meaning that wild type and mutated forms of mtDNA coexist in the same cell. Therefore, a shift in the proportion between mutant and wild type molecules could restore mitochondrial functions. The anti-replicative strategy aims to induce such a shift in heteroplasmy by mitochondrial targeting specifically designed molecules in order to inhibit replication of mutant mtDNA. Recently, we developed mitochondrial RNA vectors that can be used to address anti-replicative oligoribonucleotides into human mitochondria and impact heteroplasmy level, however, the effect was mainly transient, probably due to a rapid degradation of RNA molecules. In the present study, we introduced various chemically modified oligonucleotides in anti-replicative RNAs. We show that the most important increase of anti-replicative molecules' lifetime can be achieved by using synthetic RNA-DNA chimerical molecules or by ribose 2'-O-methylation in nuclease-sensitive sites. The presence of inverted thymidine at 3' terminus and modifications of 2'-OH ribose group did not prevent the mitochondrial uptake of the recombinant molecules. All the modified oligonucleotides were able to anneal specifically with the mutant mtDNA fragment, but not with the wild-type one. Nevertheless, the modified oligonucleotides did not cause a significant effect on the heteroplasmy level in transfected transmitochondrial cybrid cells bearing a pathogenic mtDNA deletion, proving to be less efficient than non-modified RNA molecules.

  19. Direct single-molecule observations of local denaturation of a DNA double helix under a negative supercoil state.

    PubMed

    Takahashi, Shunsuke; Motooka, Shinya; Usui, Tomohiro; Kawasaki, Shohei; Miyata, Hidefumi; Kurita, Hirofumi; Mizuno, Takeshi; Matsuura, Shun-ichi; Mizuno, Akira; Oshige, Masahiko; Katsura, Shinji

    2015-03-17

    Effects of a negative supercoil on the local denaturation of the DNA double helix were studied at the single-molecule level. The local denaturation in λDNA and λDNA containing the SV40 origin of DNA replication (SV40ori-λDNA) was directly observed by staining single-stranded DNA regions with a fusion protein comprising the ssDNA binding domain of a 70-kDa subunit of replication protein A and an enhanced yellow fluorescent protein (RPA-YFP) followed by staining the double-stranded DNA regions with YOYO-1. The local denaturation of λDNA and SV40ori-λDNA under a negative supercoil state was observed as single bright spots at the single-stranded regions. When negative supercoil densities were gradually increased to 0, -0.045, and -0.095 for λDNA and 0, -0.047, and -0.1 for SV40ori-λDNA, single bright spots at the single-stranded regions were frequently induced under higher negative supercoil densities of -0.095 for λDNA and -0.1 for SV40ori-λDNA. However, single bright spots of the single-stranded regions were rarely observed below a negative supercoil density of -0.045 and -0.047 for λDNA and SV40ori-λDNA, respectively. The probability of occurrence of the local denaturation increased with negative superhelicity for both λDNA and SV40ori-λDNA.

  20. Kinetics of directed self-assembly of block copolymers on chemically patterned substrates

    NASA Astrophysics Data System (ADS)

    Müller, Marcus; Li, Weihua; Orozco Rey, Juan Carlos; Welling, Ulrich

    2015-09-01

    Chemically patterned surfaces have been successfully employed to direct the kinetics of self-assembly of block copolymers into dense, periodic morphologies (”chemoepitaxy”). Significant efforts have been directed towards understanding the kinetics of structure formation and, particularly, the formation and annihilation of defects. In the present manuscript we use computer simulations of a soft, coarse-grained polymer model to study the kinetics of structure formation of lamellar-forming block copolymer thin films on a chemical pattern of lines and spaces. The case where the copolymer material replicates the surface pattern and the more subtle scenario of sparse guiding patterns are considered. Our simulation results highlight (1) the importance of the early stages of pattern-directed self-assembly that template the subsequent morphology and (2) the dependence of the free-energy landscape on the incompatibility between the two blocks of the copolymer.

  1. Direct recognition of homology between double helices of DNA in Neurospora crassa

    PubMed Central

    Gladyshev, Eugene; Kleckner, Nancy

    2014-01-01

    Chromosomal regions of identical or nearly identical DNA sequence can preferentially associate with one another in the apparent absence of DNA breakage. Molecular mechanism(s) underlying such homology-dependent pairing phenomena remain(s) unknown. Using Neurospora crassa repeat-induced point mutation (RIP) as a model system, we show that a pair of DNA segments can be recognized as homologous if they share triplets of base pairs arrayed with the matching periodicity of 11 or 12 base pairs. This pattern suggests direct interactions between slightly underwound co-aligned DNA duplexes engaging once per turn and over many consecutive turns. The process occurs in the absence of MEI3, the only RAD51/DMC1 protein in N. crassa, demonstrating independence from the canonical homology recognition pathway. A new perspective is thus provided for further analysis of the breakage-independent recognition of homology that underlies RIP and, potentially, other processes where sequence-specific pairing of intact chromosomes is involved. PMID:24699390

  2. Directing folding pathways for multi-component DNA origami nanostructures with complex topology

    NASA Astrophysics Data System (ADS)

    Marras, A. E.; Zhou, L.; Kolliopoulos, V.; Su, H.-J.; Castro, C. E.

    2016-05-01

    Molecular self-assembly has become a well-established technique to design complex nanostructures and hierarchical mesoscale assemblies. The typical approach is to design binding complementarity into nucleotide or amino acid sequences to achieve the desired final geometry. However, with an increasing interest in dynamic nanodevices, the need to design structures with motion has necessitated the development of multi-component structures. While this has been achieved through hierarchical assembly of similar structural units, here we focus on the assembly of topologically complex structures, specifically with concentric components, where post-folding assembly is not feasible. We exploit the ability to direct folding pathways to program the sequence of assembly and present a novel approach of designing the strand topology of intermediate folding states to program the topology of the final structure, in this case a DNA origami slider structure that functions much like a piston-cylinder assembly in an engine. The ability to program the sequence and control orientation and topology of multi-component DNA origami nanostructures provides a foundation for a new class of structures with internal and external moving parts and complex scaffold topology. Furthermore, this work provides critical insight to guide the design of intermediate states along a DNA origami folding pathway and to further understand the details of DNA origami self-assembly to more broadly control folding states and landscapes.

  3. Phosphorylated Rad18 directs DNA Polymerase η to sites of stalled replication

    PubMed Central

    Day, Tovah A.; Palle, Komariah; Barkley, Laura R.; Kakusho, Naoko; Zou, Ying; Tateishi, Satoshi; Verreault, Alain; Masai, Hisao

    2010-01-01

    The E3 ubiquitin ligase Rad18 guides DNA Polymerase eta (Polη) to sites of replication fork stalling and mono-ubiquitinates proliferating cell nuclear antigen (PCNA) to facilitate binding of Y family trans-lesion synthesis (TLS) DNA polymerases during TLS. However, it is unclear exactly how Rad18 is regulated in response to DNA damage and how Rad18 activity is coordinated with progression through different phases of the cell cycle. Here we identify Rad18 as a novel substrate of the essential protein kinase Cdc7 (also termed Dbf4/Drf1-dependent Cdc7 kinase [DDK]). A serine cluster in the Polη-binding motif of Rad18 is phosphorylated by DDK. Efficient association of Rad18 with Polη is dependent on DDK and is necessary for redistribution of Polη to sites of replication fork stalling. This is the first demonstration of Rad18 regulation by direct phosphorylation and provides a novel mechanism for integration of S phase progression with postreplication DNA repair to maintain genome stability. PMID:21098111

  4. Direct identification of chlamydiae from clinical samples using a DNA microarray assay: a validation study.

    PubMed

    Borel, Nicole; Kempf, Evelyne; Hotzel, Helmut; Schubert, Evelyn; Torgerson, Paul; Slickers, Peter; Ehricht, Ralf; Tasara, Taurai; Pospischil, Andreas; Sachse, Konrad

    2008-02-01

    While DNA microarrays have become a widely accepted tool for mRNA expression monitoring, their use in rapid diagnosis of bacterial and viral pathogens is only emerging. So far, insufficient sensitivity and high costs have been the major limiting factors preventing more widespread use of microarray platforms in direct testing of clinical samples. In the present study, a total of 339 samples, among them 293 clinical specimens from animals and humans, were examined by the ArrayTube (AT) DNA microarray assay to detect chlamydial DNA and identify the species of Chlamydia and Chlamydophila involved. Samples included nasal and conjunctival swabs, formalin-fixed, paraffin-embedded and fresh organ tissue, milk, feces and cell culture. Notably, the AT test was shown to detect mixed infections in clinical samples. The calculated median sensitivity of 0.81 over the entire panel of clinical samples was comparable to conventional 16S PCR, but slightly lower than real-time PCR and other PCR assays. However, when a panel of long-time stored swab samples was excluded from the calculation, the sensitivity was clearly higher (0.87) and equivalent to that of real-time PCR. Altogether, the data demonstrate the suitability of this DNA microarray assay for routine diagnosis.

  5. Arabidopsis RETINOBLASTOMA RELATED directly regulates DNA damage responses through functions beyond cell cycle control.

    PubMed

    Horvath, Beatrix M; Kourova, Hana; Nagy, Szilvia; Nemeth, Edit; Magyar, Zoltan; Papdi, Csaba; Ahmad, Zaki; Sanchez-Perez, Gabino F; Perilli, Serena; Blilou, Ikram; Pettkó-Szandtner, Aladár; Darula, Zsuzsanna; Meszaros, Tamas; Binarova, Pavla; Bogre, Laszlo; Scheres, Ben

    2017-05-02

    The rapidly proliferating cells in plant meristems must be protected from genome damage. Here, we show that the regulatory role of the Arabidopsis RETINOBLASTOMA RELATED (RBR) in cell proliferation can be separated from a novel function in safeguarding genome integrity. Upon DNA damage, RBR and its binding partner E2FA are recruited to heterochromatic γH2AX-labelled DNA damage foci in an ATM- and ATR-dependent manner. These γH2AX-labelled DNA lesions are more dispersedly occupied by the conserved repair protein, AtBRCA1, which can also co-localise with RBR foci. RBR and AtBRCA1 physically interact in vitro and in planta Genetic interaction between the RBR-silenced amiRBR and Atbrca1 mutants suggests that RBR and AtBRCA1 may function together in maintaining genome integrity. Together with E2FA, RBR is directly involved in the transcriptional DNA damage response as well as in the cell death pathway that is independent of SOG1, the plant functional analogue of p53. Thus, plant homologs and analogues of major mammalian tumour suppressor proteins form a regulatory network that coordinates cell proliferation with cell and genome integrity. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  6. Induction of RNA-directed DNA methylation upon decondensation of constitutive heterochromatin.

    PubMed

    Schoft, Vera K; Chumak, Nina; Mosiolek, Magdalena; Slusarz, Lucyna; Komnenovic, Vukoslav; Brownfield, Lynette; Twell, David; Kakutani, Tetsuji; Tamaru, Hisashi

    2009-09-01

    Centromeric constitutive heterochromatin is marked by DNA methylation and dimethylated histone H3 Lys 9 (H3K9me2) in Arabidopsis. RNA-directed DNA methylation (RdDM) is a process that uses 24-nucleotide (nt) small interfering RNAs (siRNAs) to induce de novo methylation to its homologous DNA sequences. Despite the presence of centromeric 24-nt siRNAs, mutations in genes required for RdDM do not appreciably influence the methylation of centromeric repeats. The mechanism by which constitutive heterochromatin is protected from RdDM remains puzzling. Here, we report that the vegetative cell nuclei (VN) of the male gametophyte (pollen) invariably undergo extensive decondensation of centromeric heterochromatin and lose centromere identity. VN show greatly reduced H3K9me2, phenocopying nuclei carrying a mutation in the chromatin remodeller DECREASE IN DNA METHYLATION 1 (DDM1). However, unlike the situation in ddm1 nuclei, the decondensed heterochromatin retains dense CG methylation and transcriptional silencing, and, unexpectedly, is subjected to RdDM-dependent hypermethylation in non-CG contexts. These findings reveal two assembly orders of silent heterochromatin and implicate the condensed form in blocking the RdDM machinery.

  7. Simple, directional cDNA cloning for in situ transcript hybridization screens.

    PubMed

    Tamme, R; Mills, K; Rainbird, B; Nornes, S; Lardelli, M

    2001-10-01

    Here, we describe a suppression PCR-based method for directional cloning of randomly primed cDNAs from small quantities of tissue. Synthesis of the first cDNA strand is conducted on oligonucleotide-coated magnetic beads. Synthesis of the second strand is accomplished using nonspecifically primed suppression PCR. This method is used to synthesize a cDNA library from zebrafish embryos at 6-9 h after fertilization. The sequencing of the clones and their use in an in situ hybridization screen to detect restricted patterns of gene transcription in zebrafish embryos showed that this method allows the rapid identification of genes that are important for development and genes that are expressed at levels undetectable by whole-mount in situ transcript hybridization. The random priming of cDNA alleviates the problems encountered in the identification of zebrafish genes from poly(dT)-primed cDNA clones caused by the long 3' UTRs frequently found in transcripts from this organism.

  8. Detection and direct genomic sequencing of multiple rare unknown flanking DNA in highly complex samples.

    PubMed

    Schmidt, M; Hoffmann, G; Wissler, M; Lemke, N; Müssig, A; Glimm, H; Williams, D A; Ragg, S; Hesemann, C U; von Kalle, C

    2001-05-01

    By identifying the sequence of retro- and lentiviral integration sites in peripheral blood leukocytes, the clonal composition and fate of genetically modified hematopoietic progenitor and stem cells could be mapped in vitro and in vivo. Previously available methods have been limited to the analysis of mono- or oligoclonal integration sites present in high copy numbers. Here, we perform characterization of multiple rare retroviral and lentiviral integration sites in highly complex DNA samples. The reliability of this method results from nontarget DNA removal via magnetic extension primer tag selection (EPTS) preceding solid-phase ligation-mediated PCR. EPTS/LM-PCR allowed the simultaneous direct genomic sequencing of multiple proviral LTR-flanking sequences of retro- and lentiviral vectors even if only 1 per 100 to 1000 cells contained the provirus. A primer walking "around" the integration locus demonstrated the adaptability of EPTS/LM-PCR to study unknown flanking DNA regions unrelated to proviruses. The technique is fast, inexpensive, and sensitive in minimal samples. It enables studies of retro- and lentiviral integration, viral vector tracking in gene therapy, insertional mutagenesis, transgene integration, and direct genomic sequencing that until now have been difficult or impossible to perform.

  9. Environmental DNA metabarcoding reveals primary chemical contaminants in freshwater sediments from different land-use types.

    PubMed

    Xie, Yuwei; Wang, Jizhong; Yang, Jianghua; Giesy, John P; Yu, Hongxia; Zhang, Xiaowei

    2017-04-01

    Land-use intensification threatens freshwater biodiversity. Freshwater eukaryotic communities are affected by multiple chemical contaminants with a land-use specific manner. However, biodiversities of eukaryotes and their associations with multiple chemical contaminants are largely unknown. This study characterized in situ eukaryotic communities in sediments exposed to mixtures of chemical contaminants and assessed relationships between various environmental variables and eukaryotic communities in sediments from the Nanfei River. Eukaryotic communities in the sediment samples were dominated by Annelida, Arthropoda, Rotifera, Ochrophyta, Chlorophyta and Ciliophora. Alpha-diversities (Shannon entropy) and structures of eukaryotic communities were significantly different between land-use types. According to the results of multiple statistical tests (PCoA, distLM, Mantel and network analysis), dissimilarity of eukaryotic community structures revealed the key effects of pyrethroid insecticides, manganese, zinc, lead, chromium and polycyclic aromatic hydrocarbons (PAHs) on eukaryotic communities in the sediment samples from the Nanfei River. Furthermore, taxa associated with land-use types were identified and several sensitive eukaryotic taxa to some of the primary contaminants were identified as potential indicators to monitor effects of the primary chemical contaminants. Overall, environmental DNA metabarcoding on in situ eukaryotic communities provided a powerful tool for biomonitoring and identifying primary contaminants and their complex effects on benthic eukaryotic communities in freshwater sediments. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A high-throughput chemical screen with FDA approved drugs reveals that the antihypertensive drug Spironolactone impairs cancer cell survival by inhibiting homology directed repair

    PubMed Central

    Shahar, Or David; Kalousi, Alkmini; Eini, Lital; Fisher, Benoit; Weiss, Amelie; Darr, Jonatan; Mazina, Olga; Bramson, Shay; Kupiec, Martin; Eden, Amir; Meshorer, Eran; Mazin, Alexander V.; Brino, Laurent; Goldberg, Michal; Soutoglou, Evi

    2014-01-01

    DNA double-strand breaks (DSBs) are the most severe type of DNA damage. DSBs are repaired by non-homologous end-joining or homology directed repair (HDR). Identifying novel small molecules that affect HDR is of great importance both for research use and therapy. Molecules that elevate HDR may improve gene targeting whereas inhibiting molecules can be used for chemotherapy, since some of the cancers are more sensitive to repair impairment. Here, we performed a high-throughput chemical screen for FDA approved drugs, which affect HDR in cancer cells. We found that HDR frequencies are increased by retinoic acid and Idoxuridine and reduced by the antihypertensive drug Spironolactone. We further revealed that Spironolactone impairs Rad51 foci formation, sensitizes cancer cells to DNA damaging agents, to Poly (ADP-ribose) polymerase (PARP) inhibitors and cross-linking agents and inhibits tumor growth in xenografts, in mice. This study suggests Spironolactone as a new candidate for chemotherapy. PMID:24682826

  11. Peptide-Metal Organic Framework Swimmers that Direct the Motion toward Chemical Targets.

    PubMed

    Ikezoe, Yasuhiro; Fang, Justin; Wasik, Tomasz L; Shi, Menglu; Uemura, Takashi; Kitagawa, Susumu; Matsui, Hiroshi

    2015-06-10

    Highly efficient and robust chemical motors are expected for the application in microbots that can selectively swim toward targets and accomplish their tasks in sensing, labeling, and delivering. However, one of major issues for such development is that current artificial swimmers have difficulty controlling their directional motion toward targets like bacterial chemotaxis. To program synthetic motors with sensing capability for the target-directed motion, we need to develop swimmers whose motions are sensitive to chemical gradients in environments. Here we create a new intelligent biochemical swimmer by integrating metal organic frameworks (MOFs) and peptides that can sense toxic heavy metals in solution and swim toward the targets. With the aid of Pb-binding enzymes, the peptide-MOF motor can directionally swim toward PbSe quantum dots (QD) by sensing pH gradient and eventually complete the motion as the swimmer reaches the highest gradient point at the target position in solution. This type of technology could be evolved to miniaturize chemical robotic systems that sense target chemicals and swim toward target locations.

  12. Direct mechanical stimulation of tip links in hair cells through DNA tethers.

    PubMed

    Basu, Aakash; Lagier, Samuel; Vologodskaia, Maria; Fabella, Brian A; Hudspeth, A J

    2016-06-22

    Mechanoelectrical transduction by hair cells commences with hair-bundle deflection, which is postulated to tense filamentous tip links connected to transduction channels. Because direct mechanical stimulation of tip links has not been experimentally possible, this hypothesis has not been tested. We have engineered DNA tethers that link superparamagnetic beads to tip links and exert mechanical forces on the links when exposed to a magnetic-field gradient. By pulling directly on tip links of the bullfrog's sacculus we have evoked transduction currents from hair cells, confirming the hypothesis that tension in the tip links opens transduction channels. This demonstration of direct mechanical access to tip links additionally lays a foundation for experiments probing the mechanics of individual channels.

  13. RecA stimulates AlkB-mediated direct repair of DNA adducts

    PubMed Central

    Shivange, Gururaj; Monisha, Mohan; Nigam, Richa; Kodipelli, Naveena; Anindya, Roy

    2016-01-01

    The Escherichia coli AlkB protein is a 2-oxoglutarate/Fe(II)-dependent demethylase that repairs alkylated single stranded and double stranded DNA. Immunoaffinity chromatography coupled with mass spectrometry identified RecA, a key factor in homologous recombination, as an AlkB-associated protein. The interaction between AlkB and RecA was validated by yeast two-hybrid assay; size-exclusion chromatography and standard pull down experiment and was shown to be direct and mediated by the N-terminal domain of RecA. RecA binding results AlkB–RecA heterodimer formation and RecA–AlkB repairs alkylated DNA with higher efficiency than AlkB alone. PMID:27378775

  14. Directional DNA methylation changes and complex intermediate states accompany lineage specificity in the adult hematopoietic compartment.

    PubMed

    Hodges, Emily; Molaro, Antoine; Dos Santos, Camila O; Thekkat, Pramod; Song, Qiang; Uren, Philip J; Park, Jin; Butler, Jason; Rafii, Shahin; McCombie, W Richard; Smith, Andrew D; Hannon, Gregory J

    2011-10-07

    DNA methylation has been implicated as an epigenetic component of mechanisms that stabilize cell-fate decisions. Here, we have characterized the methylomes of human female hematopoietic stem/progenitor cells (HSPCs) and mature cells from the myeloid and lymphoid lineages. Hypomethylated regions (HMRs) associated with lineage-specific genes were often methylated in the opposing lineage. In HSPCs, these sites tended to show intermediate, complex patterns that resolve to uniformity upon differentiation, by increased or decreased methylation. Promoter HMRs shared across diverse cell types typically display a constitutive core that expands and contracts in a lineage-specific manner to fine-tune the expression of associated genes. Many newly identified intergenic HMRs, both constitutive and lineage specific, were enriched for factor binding sites with an implied role in genome organization and regulation of gene expression, respectively. Overall, our studies represent an important reference data set and provide insights into directional changes in DNA methylation as cells adopt terminal fates.

  15. Direct, concurrent measurements of the forces and currents affecting DNA in a nanopore with comparable topography.

    PubMed

    Nelson, Edward M; Li, Hui; Timp, Gregory

    2014-06-24

    We report direct, concurrent measurements of the forces and currents associated with the translocation of a single-stranded DNA molecule tethered to the tip of an atomic force microscope (AFM) cantilever through synthetic pores with topagraphies comparable to the DNA. These measurements were performed to gauge the signal available for sequencing and the electric force required to impel a single molecule through synthetic nanopores ranging from 1.0 to 3.5 nm in diameter in silicon nitride membranes 6-10 nm thick. The measurements revealed that a molecule can slide relatively frictionlessly through a pore, but regular fluctuations are observed intermittently in the force (and the current) every 0.35-0.72 nm, which are attributed to individual nucleotides translating through the nanopore in a turnstile-like motion.

  16. Trace DNA evidence dynamics: An investigation into the deposition and persistence of directly- and indirectly-transferred DNA on regularly-used knives.

    PubMed

    Meakin, Georgina E; Butcher, Emma V; van Oorschot, Roland A H; Morgan, Ruth M

    2017-03-21

    Empirical data on the transfer and persistence of trace DNA are crucial to the evaluation of forensic DNA evidence. This evaluation can be complicated by the occurrence of indirect DNA transfer; the possibility of which is well established, but research into such transfer is often focussed on unrealistic situations, e.g. handling of DNA-free items after participants have shaken hands for 1-2min. To simulate more realistic scenarios, this study investigated the deposition and persistence of both directly- and indirectly-transferred DNA on knives that had been artificially set up as 'regularly-used'. Each knife was handled in a prescribed manner by a specific participant over two consecutive days to simulate regular use. Each participant then shook hands for 10s with a fellow volunteer and immediately stabbed one of their knives into a foam block repeatedly for 60s. DNA was recovered by mini-taping from triplicate sets of knife handles from four pairings of volunteers after regular use, and at one hour, one day and one week after the handshaking and stabbing events. Total amounts of DNA recovered from the knives, regularly used by a single person, varied among individuals; one volunteer consistently deposited significantly greater amounts than the others, whilst another volunteer did not always leave complete profiles. DNA attributed to the regular user persisted for at least a week, declining with increasing time between DNA deposition and recovery. Non-donor DNA was co-deposited at <5% of the profiles recovered, except for one volunteer, who consistently left DNA from their romantic partner on their knives at ∼25% and ∼11% of the profiles before and after the handshaking and stabbing events, respectively. In three pairings of volunteers, after the handshaking and stabbing events, alleles that could be attributed to the respective handshakers' profiles were detected as partial minor profiles, equating to ∼10% of the profiles recovered. For the fourth pairing

  17. A chemical enucleation method for the transfer of mitochondrial DNA to rho(o) cells.

    PubMed

    Bayona-Bafaluy, Maria Pilar; Manfredi, Giovanni; Moraes, Carlos T

    2003-08-15

    The study of pathogenic mitochondrial DNA mutations has, in most cases, relied on the production of transmitochondrial cybrids. Although the procedure to produce such cybrids is well established, it is laborious and cumbersome. Moreover, the mechanical enucleation procedure is inefficient and different techniques have to be used depending on the adherence properties of the cell. To circumvent these difficulties, we developed a chemical enucleation method that can have wide applicability for the production of transmitochondrial cybrids. The method is based on the use of actinomycin D to render the nuclear genome transcription/replication inactive and unable to recover after treatment. Such treated cells are fused to cells devoid of mitochondrial DNA and selected for the presence of a functional oxidative phosphorylation system. Our results showed that 95% of the clones recovered by this procedure are true transmitochondrial cybrids. This method greatly facilitates the production of transmitochondrial cybrids, thereby increasing the number of mtDNA mutations and the recipient cell types that can be studied by this system.

  18. Chemically-modified graphenes for oxidation of DNA bases: analytical parameters.

    PubMed

    Goh, Madeline Shuhua; Bonanni, Alessandra; Ambrosi, Adriano; Sofer, Zdeněk; Pumera, Martin

    2011-11-21

    We studied the electroanalytical performances of chemically-modified graphenes (CMGs) containing different defect densities and amounts of oxygen-containing groups, namely graphite oxide (GPO), graphene oxide (GO), thermally reduced graphene oxide (TR-GO) and electrochemically reduced graphene oxide (ER-GO) by comparing the sensitivity, selectivity, linearity and repeatability towards the oxidation of DNA bases. We have observed that for differential pulse voltammetric (DPV) detection of adenine and cytosine, all CMGs showed enhanced sensitivity to oxidation, while for guanine and thymine, ER-GO and TR-GO exhibited much improved sensitivity over bare glassy carbon (GC) as well as over GPO and GO. There is also significant selectivity enhancement when using GPO for adenine and TR-GO for thymine. Our results have uncovered that the differences in surface functionalities, structure and defects of various CMGs largely influence their electrochemical behaviour in detecting the oxidation of DNA bases. The findings in this report will provide a useful guide for the future development of label-free electrochemical devices for DNA analysis.

  19. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome

    PubMed Central

    Li, Qing; Gent, Jonathan I.; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D.; Hirsch, Candice N.; Dawe, R. Kelly; Madzima, Thelma F.; McGinnis, Karen M.; Lisch, Damon; Schmitz, Robert J.; Vaughn, Matthew W.; Springer, Nathan M.

    2015-01-01

    The maize genome is relatively large (∼2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes. PMID:26553984

  20. RNA-directed DNA methylation enforces boundaries between heterochromatin and euchromatin in the maize genome.

    PubMed

    Li, Qing; Gent, Jonathan I; Zynda, Greg; Song, Jawon; Makarevitch, Irina; Hirsch, Cory D; Hirsch, Candice N; Dawe, R Kelly; Madzima, Thelma F; McGinnis, Karen M; Lisch, Damon; Schmitz, Robert J; Vaughn, Matthew W; Springer, Nathan M

    2015-11-24

    The maize genome is relatively large (∼ 2.3 Gb) and has a complex organization of interspersed genes and transposable elements, which necessitates frequent boundaries between different types of chromatin. The examination of maize genes and conserved noncoding sequences revealed that many of these are flanked by regions of elevated asymmetric CHH (where H is A, C, or T) methylation (termed mCHH islands). These mCHH islands are quite short (∼ 100 bp), are enriched near active genes, and often occur at the edge of the transposon that is located nearest to genes. The analysis of DNA methylation in other sequence contexts and several chromatin modifications revealed that mCHH islands mark the transition from heterochromatin-associated modifications to euchromatin-associated modifications. The presence of an mCHH island is fairly consistent in several distinct tissues that were surveyed but shows some variation among different haplotypes. The presence of insertion/deletions in promoters often influences the presence and position of an mCHH island. The mCHH islands are dependent upon RNA-directed DNA methylation activities and are lost in mop1 and mop3 mutants, but the nearby genes rarely exhibit altered expression levels. Instead, loss of an mCHH island is often accompanied by additional loss of DNA methylation in CG and CHG contexts associated with heterochromatin in nearby transposons. This suggests that mCHH islands and RNA-directed DNA methylation near maize genes may act to preserve the silencing of transposons from activity of nearby genes.

  1. Programming chemical kinetics: engineering dynamic reaction networks with DNA strand displacement

    NASA Astrophysics Data System (ADS)

    Srinivas, Niranjan

    Over the last century, the silicon revolution has enabled us to build faster, smaller and more sophisticated computers. Today, these computers control phones, cars, satellites, assembly lines, and other electromechanical devices. Just as electrical wiring controls electromechanical devices, living organisms employ "chemical wiring" to make decisions about their environment and control physical processes. Currently, the big difference between these two substrates is that while we have the abstractions, design principles, verification and fabrication techniques in place for programming with silicon, we have no comparable understanding or expertise for programming chemistry. In this thesis we take a small step towards the goal of learning how to systematically engineer prescribed non-equilibrium dynamical behaviors in chemical systems. We use the formalism of chemical reaction networks (CRNs), combined with mass-action kinetics, as our programming language for specifying dynamical behaviors. Leveraging the tools of nucleic acid nanotechnology (introduced in Chapter 1), we employ synthetic DNA molecules as our molecular architecture and toehold-mediated DNA strand displacement as our reaction primitive. Abstraction, modular design and systematic fabrication can work only with well-understood and quantitatively characterized tools. Therefore, we embark on a detailed study of the "device physics" of DNA strand displacement (Chapter 2). We present a unified view of strand displacement biophysics and kinetics by studying the process at multiple levels of detail, using an intuitive model of a random walk on a 1-dimensional energy landscape, a secondary structure kinetics model with single base-pair steps, and a coarse-grained molecular model that incorporates three-dimensional geometric and steric effects. Further, we experimentally investigate the thermodynamics of three-way branch migration. Our findings are consistent with previously measured or inferred rates for

  2. Visible light may directly induce nuclear DNA damage triggering the death pathway in RGC-5 cells.

    PubMed

    Li, Guang-Yu; Fan, Bin; Ma, Tong-Hui

    2011-01-01

    Visible light has been previously demonstrated to induce retinal ganglion cell (RGC)-5 cell death through the mitochondrial pathway. The present study was designed to determine whether visible light might also directly trigger the death pathway by damaging nuclear DNA. RGC-5 cells were exposed to various intensities and durations of visible light exposure. Cell viability and death were monitored with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and propidium iodide staining. Nuclear DNA damage caused by light was determined with the plasmid assay, genome DNA assay, and in situ terminal deoxynucleotidyl transferase dUTP nick end labeling. The subsequent activation of nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP-1) was measured with western blot, and PARP-1's role in the death pathway was assessed by using specific inhibitors. Poly (ADP-ribose) glycohydrolase and apoptosis-inducing factor (AIF) inhibitors were used to show their influence on light-induced cell death. Calcium influx was examined with the fura-2 assay and calcium channel blocker. We found that visible light induced RGC-5 cell death in a time- and intensity-dependent manner. After the light intensity was increased to 2,600 lx, activation of the death pathway in RGC-5 cells was clearly observed by detecting double-strand DNA breaks and nuclear DNA damage in vitro. Nuclear enzyme PARP-1 was promptly activated after exposure to 2,600 lx of light for 2 days, and specific inhibitors of PARP-1 had significant neuroprotective effects. The poly(ADP-ribose) glycohydrolase inhibitor tannic acid and AIF inhibitor N-phenylmaleimide partially protected RGC-5 cells from light injury. A massive calcium influx was detected after 2 days of light exposure, and a calcium channel blocker partially protected cells against light injury. These results suggest that visible light exposure may directly cause nuclear DNA damage, which consequently activates PARP-1. In addition, RGC-5 cells damaged

  3. Visible light may directly induce nuclear DNA damage triggering the death pathway in RGC-5 cells

    PubMed Central

    Fan, Bin; Ma, Tong-Hui

    2011-01-01

    Purpose Visible light has been previously demonstrated to induce retinal ganglion cell (RGC)-5 cell death through the mitochondrial pathway. The present study was designed to determine whether visible light might also directly trigger the death pathway by damaging nuclear DNA. Methods RGC-5 cells were exposed to various intensities and durations of visible light exposure. Cell viability and death were monitored with the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and propidium iodide staining. Nuclear DNA damage caused by light was determined with the plasmid assay, genome DNA assay, and in situ terminal deoxynucleotidyl transferase dUTP nick end labeling. The subsequent activation of nuclear enzyme poly(ADP-ribose) polymerase-1 (PARP-1) was measured with western blot, and PARP-1’s role in the death pathway was assessed by using specific inhibitors. Poly (ADP-ribose) glycohydrolase and apoptosis-inducing factor (AIF) inhibitors were used to show their influence on light-induced cell death. Calcium influx was examined with the fura-2 assay and calcium channel blocker. Results We found that visible light induced RGC-5 cell death in a time- and intensity-dependent manner. After the light intensity was increased to 2,600 lx, activation of the death pathway in RGC-5 cells was clearly observed by detecting double-strand DNA breaks and nuclear DNA damage in vitro. Nuclear enzyme PARP-1 was promptly activated after exposure to 2,600 lx of light for 2 days, and specific inhibitors of PARP-1 had significant neuroprotective effects. The poly(ADP-ribose) glycohydrolase inhibitor tannic acid and AIF inhibitor N-phenylmaleimide partially protected RGC-5 cells from light injury. A massive calcium influx was detected after 2 days of light exposure, and a calcium channel blocker partially protected cells against light injury. Conclusions These results suggest that visible light exposure may directly cause nuclear DNA damage, which consequently activates

  4. The Pseudorabies Virus DNA Polymerase Accessory Subunit UL42 Directs Nuclear Transport of the Holoenzyme

    PubMed Central

    Wang, Yi-Ping; Du, Wen-Juan; Huang, Li-Ping; Wei, Yan-Wu; Wu, Hong-Li; Feng, Li; Liu, Chang-Ming

    2016-01-01

    Pseudorabies virus (PRV) DNA replication occurs in the nuclei of infected cells and requires the viral DNA polymerase. The PRV DNA polymerase comprises a catalytic subunit, UL30, and an accessory subunit, UL42, that confers processivity to the enzyme. Its nuclear localization is a prerequisite for its enzymatic function in the initiation of viral DNA replication. However, the mechanisms by which the PRV DNA polymerase holoenzyme enters the nucleus have not been determined. In this study, we characterized the nuclear import pathways of the PRV DNA polymerase catalytic and accessory subunits. Immunofluorescence analysis showed that UL42 localizes independently in the nucleus, whereas UL30 alone predominantly localizes in the cytoplasm. Intriguingly, the localization of UL30 was completely shifted to the nucleus when it was coexpressed with UL42, demonstrating that nuclear transport of UL30 occurs in an UL42-dependent manner. Deletion analysis and site-directed mutagenesis of the two proteins showed that UL42 contains a functional and transferable bipartite nuclear localization signal (NLS) at amino acids 354–370 and that K354, R355, and K367 are important for the NLS function, whereas UL30 has no NLS. Coimmunoprecipitation assays verified that UL42 interacts with importins α3 and α4 through its NLS. In vitro nuclear import assays demonstrated that nuclear accumulation of UL42 is a temperature- and energy-dependent process and requires both importins α and β, confirming that UL42 utilizes the importin α/β-mediated pathway for nuclear entry. In an UL42 NLS-null mutant, the UL42/UL30 heterodimer was completely confined to the cytoplasm when UL42 was coexpressed with UL30, indicating that UL30 utilizes the NLS function of UL42 for its translocation into the nucleus. Collectively, these findings suggest that UL42 contains an importin α/β-mediated bipartite NLS that transports the viral DNA polymerase holoenzyme into the nucleus in an in vitro expression system

  5. The Human Tim-Tipin Complex Interacts Directly with DNA Polymerase ϵ and Stimulates Its Synthetic Activity*

    PubMed Central

    Aria, Valentina; De Felice, Mariarita; Di Perna, Roberta; Uno, Shuji; Masai, Hisao; Syväoja, Juhani E.; van Loon, Barbara; Hübscher, Ulrich; Pisani, Francesca M.

    2013-01-01

    The Tim-Tipin complex plays an important role in the S phase checkpoint and replication fork stability in metazoans, but the molecular mechanism underlying its biological function is poorly understood. Here, we present evidence that the recombinant human Tim-Tipin complex (and Tim alone) markedly enhances the synthetic activity of DNA polymerase ϵ. In contrast, no significant effect on the synthetic ability of human DNA polymerase α and δ by Tim-Tipin was observed. Surface plasmon resonance measurements and co-immunoprecipitation experiments revealed that recombinant DNA polymerase ϵ directly interacts with either Tim or Tipin. In addition, the results of DNA band shift assays suggest that the Tim-Tipin complex (or Tim alone) is able to associate with DNA polymerase ϵ bound to a 40-/80-mer DNA ligand. Our results are discussed in view of the molecular dynamics at the human DNA replication fork. PMID:23511638

  6. DNA damage induced by occupational and environmental exposure to miscellaneous chemicals.

    PubMed

    da Silva, Juliana

    Epidemiological studies for hazardous situations resulting from the risk of environmental and/or occupational exposure to miscellaneous chemicals present several difficulties. Biomonitoring of human populations can provide an early detection system for the initiation of cell dysregulation in the development of cancer, which would help develop an efficient prevention program. Recently, the cytokinesis-block micronucleus (CBMN) assay in lymphocyte cells has become an important tool for assessing DNA damage in exposed populations. This is the method of choice for population-based studies of occupational and/or environmental exposure to different agents. In this review, human populations exposed to coal, dyes, paints, organic solvents in a complex mixture, and others miscellaneous chemicals were analyzed. Data from 28 studies was evaluated in relation to the effect of complex mixture exposition on micronucleus (MN) frequency. Other biomarkers and the background factors were evaluated as well, such as gender, age, or smoking habit. Most of these studies (75%) showed a significant increase of micronucleated cells to exposed groups in relation to the control groups, besides chromosomal aberrations (CA), sister chromatid exchanging (SCE) and comet cells (comet assay). The studies from this review about miscellaneous chemicals exposures using CBMN assay have indicated some time and dose-dependent effects. Overall, the findings suggest that the responses resulting from exposure to complex mixtures are varied and complicated. However, they are also an important mechanism of DNA damage concerning disruption of metal ion homeostasis that may lead to oxidative stress, a state where increased formation of reactive oxygen species (ROS) overwhelms body antioxidant protection and subsequently could induce cancer.

  7. Chemical kinetic behavior of chlorogenic acid in protecting erythrocyte and DNA against radical-induced oxidation.

    PubMed

    Tang, You-Zhi; Liu, Zai-Qun

    2008-11-26

    As an abundant ingredient in coffee, chlorogenic acid (CGA) is a well-known antioxidant. Although some works have dealt with its radical-scavenging property, the present work investigated the protective effects of CGA on the oxidation of DNA and on the hemolysis of human erythrocytes induced by 2,2'-azobis(2-amidinopropane hydrochloride) (AAPH) by means of chemical kinetics. The inhibition period (t(inh)) derived from the protective effect of CGA on erythrocyte and DNA was proportional to its concentration, t(inh) = (n/R(i))[CGA], where R(i) refers to the radical-initiation rate, and n indicates the number of radical-propagation chains terminated by CGA. It was found that the n of CGA to protect erythrocytes was 0.77, lower than that of vitamin E (2.0), but higher than that of vitamin C (0.19). Furthermore, CGA facilitated a mutual protective effect with VE and VC on AAPH-induced hemolysis by increasing n of VE and VC. CGA was also found to be a membrane-stabilizer to protect erythrocytes against hemin-induced hemolysis. Moreover, the n of CGA was only 0.41 in the process of protecting DNA. This fact revealed that CGA served as an efficient antioxidant to protect erythrocytes more than to protect DNA. Finally, the reaction between CGA and 2,2'-azinobis(3-ethylbenzothiazoline-6-sulfonate) radical cation (ABTS(+*)) or 2,2'-diphenyl-1-picrylhydrazyl (DPPH) revealed that CGA was able to trap radicals by reducing radicals more than by donating its hydrogen atoms to radicals.

  8. Polycationic ligands of different chemical classes stimulate DNA strand displacement between short oligonucleotides in a protein-free system.

    PubMed

    Volodin, Alexander A; Bocharova, Tatiana N; Smirnova, Elena A

    2016-09-01

    The ability of polycationic ligands to stimulate DNA strand displacement between short oligonucleotides in a protein-free system is demonstrated. We show that two ligands, tetracationic aliphatic amine (spermine) and a dicationic intercalating drug (chloroquine), promote strand displacement in a concentration-dependent manner. At low concentrations both ligands decelerate spontaneous strand displacement because of their impact on the stability of the DNA duplex. At elevated concentrations they accelerate strand displacement via formation of intermediate structures containing three DNA strands. The rate of the last process does not correlate with the thermal dissociation rate of the entire DNA duplex. It indicates that, possibly, the action of these agents cannot be explained by their influence on the stability of the DNA duplex. In general, our results suggest that the ability to stimulate DNA strand displacement appears to be a common feature of polycations of different chemical and structural classes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 633-641, 2016.

  9. The Influence of Primary and Secondary DNA Structure in Deletion and Duplication between Direct Repeats in Escherichia Coli

    PubMed Central

    Trinh, T. Q.; Sinden, R. R.

    1993-01-01

    We describe a system to measure the frequency of both deletions and duplications between direct repeats. Short 17- and 18-bp palindromic and nonpalindromic DNA sequences were cloned into the EcoRI site within the chloramphenicol acetyltransferase gene of plasmids pBR325 and pJT7. This creates an insert between direct repeated EcoRI sites and results in a chloramphenicol-sensitive phenotype. Selection for chloramphenicol resistance was utilized to select chloramphenicol resistant revertants that included those with precise deletion of the insert from plasmid pBR325 and duplication of the insert in plasmid pJT7. The frequency of deletion or duplication varied more than 500-fold depending on the sequence of the short sequence inserted into the EcoRI site. For the nonpalindromic inserts, multiple internal direct repeats and the length of the direct repeats appear to influence the frequency of deletion. Certain palindromic DNA sequences with the potential to form DNA hairpin structures that might stabilize the misalignment of direct repeats had a high frequency of deletion. Other DNA sequences with the potential to form structures that might destabilize misalignment of direct repeats had a very low frequency of deletion. Duplication mutations occurred at the highest frequency when the DNA between the direct repeats contained no direct or inverted repeats. The presence of inverted repeats dramatically reduced the frequency of duplications. The results support the slippage-misalignment model, suggesting that misalignment occurring during DNA replication leads to deletion and duplication mutations. The results also support the idea that the formation of DNA secondary structures during DNA replication can facilitate and direct specific mutagenic events. PMID:8325478

  10. DNA-directed immobilization of horseradish peroxidase onto porous SiO2 optical transducers

    NASA Astrophysics Data System (ADS)

    Shtenberg, Giorgi; Massad-Ivanir, Naama; Engin, Sinem; Sharon, Michal; Fruk, Ljiljana; Segal, Ester

    2012-08-01

    Multifunctional porous Si nanostructure is designed to optically monitor enzymatic activity of horseradish peroxidase. First, an oxidized PSi optical nanostructure, a Fabry-Pérot thin film, is synthesized and is used as the optical transducer element. Immobilization of the enzyme onto the nanostructure is performed through DNA-directed immobilization. Preliminary studies demonstrate high enzymatic activity levels of the immobilized horseradish peroxidase, while maintaining its specificity. The catalytic activity of the enzymes immobilized within the porous nanostructure is monitored in real time by reflective interferometric Fourier transform spectroscopy. We show that we can easily regenerate the surface for consecutive biosensing analysis by mild dehybridization conditions.

  11. Direct Measurement of Atmospheric Ammonia from an Airborne Miniature Chemical Ionization Mass Spectrometer (miniCIMS)

    NASA Astrophysics Data System (ADS)

    Casados, K.; Schill, S.; Freeman, S.; Zoerb, M.; Bertram, T. H.; Lefer, B. L.

    2015-12-01

    Ammonia is emitted into the atmosphere from a variety of sources such as trees, ocean, diary fields, biomass burning, and fuel emissions. Previous studies have investigated the environmental impacts of atmospheric ammonia which can include chemical reactivity, nucleation of fine particulate matter 2.5 (PM 2.5 ), and implications for human health, but its chemical nature and relatively short lifetime make direct measurement of atmospheric ammonia difficult. During the 2015 NASA Student Airborne Research Program (SARP) an airborne miniature Chemical Ionization Mass Spectrometer (miniCIMS) was deployed on the NASA DC-8 flying laboratory in the Southern California region. The spatial and temporal variability of measured atmospheric ammonia concentrations will be discussed.

  12. Directed In Situ Shaping of Complex Nano- and Microstructures during Chemical Synthesis.

    PubMed

    Artus, Georg R J; Olveira, Sandro; Patra, Debabrata; Seeger, Stefan

    2017-02-01

    Chemical composition and shape determine the basic properties of any object. Commonly, chemical synthesis and shaping follow each other in a sequence, although their combination into a single process would be an elegant simplification. Here, a pathway of simultaneous synthesis and shaping as applied to polysiloxanes on the micro- and nanoscale is presented. Complex structures such as stars, chalices, helices, volcanoes, rods, or combinations thereof are obtained. Varying the shape-controlling reaction parameters including temperature, water saturation, and the type of substrate allows to direct the reaction toward specific structures. A general mechanism of growth is suggested and analytical evidence and thermodynamic calculations to support it are provided. An aqueous droplet in either gaseous atmosphere or in a liquid organic solvent serves as a spatially confined polymerization volume. By substituting the starting materials, germanium-based nanostructures are also obtained. This transferability marks this approach as a major step toward a generally applicable method of chemical synthesis including in situ shaping.

  13. Direct conversion of radioactive and chemical waste containing metals, ceramics, amorphous solids, and organics to glass

    SciTech Connect

    Forsberg, C.W.; Beahm, E.C.; Parker, G.W.

    1994-05-02

    The Glass Material Oxidation and Dissolution System (CMODS) is a new process for direct conversion of radioactive, mixed, and chemical wastes to glass. The wastes can be in the chemical forms of metals, ceramics, amorphous solids, and organics. GMODS destroys organics and it incorporates heavy metals and radionuclides into a glass. Processable wastes may include miscellaneous spent fuels (SF), SF hulls and hardware, plutonium wastes in different forms, high-efficiency particulate air (HEPA) filters, ion-exchange resins, failed equipment, and laboratory wastes. Thermodynamic calculations indicate theoretical feasibility. Small-scale laboratory experiments (< 100 g per test) have demonstrated chemical laboratory feasibility for several metals. Additional work is needed to demonstrate engineering feasibility.

  14. Chemical extraction versus direct smear for MALDI-TOF mass spectrometry identification of anaerobic bacteria.

    PubMed

    Fournier, Rémi; Wallet, Frédéric; Grandbastien, Bruno; Dubreuil, Luc; Courcol, René; Neut, Christel; Dessein, Rodrigue

    2012-06-01

    In the present study, two pre-analytic processes for mass spectrometric bacterial identification were compared: the time-consuming reference method, chemical extraction, and the direct smear technique directly using cultured colonies without any further preparation. These pre-analytic processes were compared in the identification of a total of 238 strains of anaerobic bacteria representing 34 species. The results showed that 218/238 strains were identified following chemical extraction, 185 identifications (77.7%) were secured to both genus and species [log(score) > 2.0] whereas 33 identifications (14%) were secured to genus only [log(score) between 1.7 and 2.0]. Following direct smear, 207/238 anaerobic bacteria were identified, 158 identifications (66.4%) were secured to both genus and species [log(score) > 2.0] whereas 49 identifications were secured to genus only [log(score) between 1.7 and 2.0]. Twenty strains were not identified [log(score) < 1.7] by MALDI-TOF MS following chemical extraction whereas 31 strains were not identified with the direct smear technique. Although direct smear led to a significant decrease of the log(score) values for the Clostridium genus and the Gram positive anaerobic bacteria (GPAC) group (p < 0.0001, Wilcoxon test), identification to both species and genus were not changed. However these differences were not statistically significant (p = 0.1, Chi square). Therefore, MALDI-TOF MS identification following the direct smear technique appears to both non-inferior to the reference method and relevant for anaerobic bacteria identification.

  15. ARSENIC (III) METHYLATED SPECIES REACT WITH DNA DIRECTLY AND COULD BE PROXIMATED/ULTIMATE GENOTOXIC FORMS OF ARSENIC

    EPA Science Inventory


    ARSENIC(III) METHYLATED SPECIES REACT WITH DNA DIRECTL Y AND COULD BE PROXIMATE/ULTIMATE GENOTOXIC FORMS OF ARSENIC


    Arsenite and arsenate (iAs, inorganic arsenic) have been thought to act as genotoxicants without reacting directly with DNA; neither iAs nor As(V) m...

  16. ARSENIC (III) METHYLATED SPECIES REACT WITH DNA DIRECTLY AND COULD BE PROXIMATED/ULTIMATE GENOTOXIC FORMS OF ARSENIC

    EPA Science Inventory


    ARSENIC(III) METHYLATED SPECIES REACT WITH DNA DIRECTL Y AND COULD BE PROXIMATE/ULTIMATE GENOTOXIC FORMS OF ARSENIC


    Arsenite and arsenate (iAs, inorganic arsenic) have been thought to act as genotoxicants without reacting directly with DNA; neither iAs nor As(V) m...

  17. Directed Molecular Evolution Improves the Immunogenicity and Protective Efficacy of a Venezuelan Equine Encephalitis Virus DNA Vaccine

    DTIC Science & Technology

    2009-05-01

    VEEV IA/B challenge. Our results indicate that it is pos- sible to improve the immunogenicity and protective efficacy of alphavirus DNA vaccines using... alphaviruses that ause periodic epizootics in the Americas [1]. These New World lphaviruses cause diseases in humans characterized by fever, eadache...equine encephalitis virus, VEE, alphavirus , DNA vaccine, envelope glycoproteins, directed molecular evolution, efficacy, immunogenicity, laboratory

  18. Topoisomerase I-Mediated DNA Cleavage Induced by the Minor Groove-Directed Binding of Bibenzimidazoles to a Distal Site

    PubMed Central

    Khan, Qasim A.; Pilch, Daniel S.

    2007-01-01

    Summary Many agents (e.g., camptothecins, indolocarbazoles, indenoisoquinolines, and dibenzonaphthyridines) stimulate topoisomerase I-mediated DNA cleavage (a behavior termed topoisomerase I poisoning) by interacting with both the DNA and the enzyme at the site of cleavage (typically by intercalation between the −1 and +1 base pairs). The bibenzimidazoles, which include Hoechst 33258 and 33342, are a family of DNA minor groove-directed agents that also stimulate topoisomerase I-mediated DNA cleavage. However, the molecular mechanism by which these ligands poison TOP1 is poorly understood. Toward this goal, we have used a combination of mutational, footprinting, and DNA binding affinity analyses to define the DNA binding site for Hoechst 33258 and a related derivative that results in optimal induction of TOP1-mediated DNA cleavage. We show that this DNA binding site is located downstream from the site of DNA cleavage, encompassing the base pairs from position +4 to +8. The distal nature of this binding site relative to the site of DNA cleavage suggests that minor groove-directed agents like the bibenzimidazoles poison TOP1 via a mechanism distinct from compounds like the camptothecins, which interact at the site of cleavage. PMID:17095016

  19. DNA-testing for BRCA1/2 prior to genetic counselling in patients with breast cancer: design of an intervention study, DNA-direct.

    PubMed

    Sie, Aisha S; Spruijt, Liesbeth; van Zelst-Stams, Wendy A G; Mensenkamp, Arjen R; Ligtenberg, Marjolijn J; Brunner, Han G; Prins, Judith B; Hoogerbrugge, Nicoline

    2012-05-08

    Current practice for patients with breast cancer referred for genetic counseling, includes face-to-face consultations with a genetic counselor prior to and following DNA-testing. This is based on guidelines regarding Huntington's disease in anticipation of high psychosocial impact of DNA-testing for mutations in BRCA1/2 genes. The initial consultation covers generic information regarding hereditary breast cancer and the (im)possibilities of DNA-testing, prior to such testing. Patients with breast cancer may see this information as irrelevant or unnecessary because individual genetic advice depends on DNA-test results. Also, verbal information is not always remembered well by patients. A different format for this information prior to DNA-testing is possible: replacing initial face-to-face genetic counseling (DNA-intake procedure) by telephone, written and digital information sent to patients' homes (DNA-direct procedure). In this intervention study, 150 patients with breast cancer referred to the department of Clinical Genetics of the Radboud University Nijmegen Medical Centre are given the choice between two procedures, DNA-direct (intervention group) or DNA-intake (usual care, control group). During a triage telephone call, patients are excluded if they have problems with Dutch text, family communication, or of psychological or psychiatric nature. Primary outcome measures are satisfaction and psychological distress. Secondary outcome measures are determinants for the participant's choice of procedure, waiting and processing times, and family characteristics. Data are collected by self-report questionnaires at baseline and following completion of genetic counseling. A minority of participants will receive an invitation for a 30 min semi-structured telephone interview, e.g. confirmed carriers of a BRCA1/2 mutation, and those who report problems with the procedure. This study compares current practice of an intake consultation (DNA-intake) to a home informational

  20. Direct evidence of chemical ordering in the FePt nanostructured alloy by HR-TEM

    NASA Astrophysics Data System (ADS)

    Gupta, Rekha; Medwal, Rohit; Annapoorni, S.

    2015-07-01

    The iron-platinum (FePt) alloy exhibits structural and magnetic phase transformation even at a low temperature of 300 °C with an insignificant grain growth. These transformation studies were understood nano-scopically using high resolution-transmission electron microscopy (HR-TEM). The FePt grains show strain induced structural transformation and adopts polycrystalline behaviour. The chemical ordering of FePt grains is explained using Fast Fourier Transform (FFT) analysis of the TEM image. HR-TEM image shows the hexagonal arrangement of Pt atoms in the [0 0 1] direction in the FePt unit cell which gives the direct evidence of chemical ordering in FePt nanostructured alloy. The filtration and reconstruction method has been employed with the help of inverse Fast Fourier Transformation tool, confirming the formation of L10 FePt phase. The chemical ordering is also confirmed by structural and magnetic measurements revealing an order parameter of 0.875 and coercivity 3 kOe respectively at a low annealing temperature of 300 °C. The chemical ordering at low annealing temperature makes it suitable for media storage applications.

  1. Directed Self-Assembly of Hierarchical Supramolecular Block Copolymer Thin Films on Chemical Patterns

    SciTech Connect

    Wu, Guang-Peng; Liu, Xiaoying; Chen, Xuanxuan; Suh, Hyo Seon; Li, Xiao; Ren, Jiaxing; Arges, Christopher G.; Li, Faxue; Jiang, Zhang; Nealey, Paul F.

    2016-03-18

    A long-range ordered lamellae-within-lamellae hierarchical structure is reported for the first time through the directed self-assembly of supramolecular polymer-surfactant thin films on chemical patterns with density multiplication. The coassembly of supramolecular system with gold nanoparticles is further achieved to create a hybrid material with well-organized nanoparticle arrays, expanding the palette of morphologies and structures available for nanoscale fabrication.

  2. Low molecular weight chemicals, hypersensitivity, and direct toxicity: the acid anhydrides.

    PubMed Central

    Venables, K M

    1989-01-01

    The acid anhydrides are a group of reactive chemicals used widely in alkyd and epoxy resins. The major hazards to health are mucosal and skin irritation and sensitisation of the respiratory tract. Most occupational asthma caused by acid anhydrides appears to be immunologically mediated. Immunological mechanisms have been proposed to explain an influenza-like syndrome and pulmonary haemorrhage, but direct toxicity may also be important in the aetiology of these conditions. PMID:2653411

  3. Renewable platform chemicals from directional microwave-assisted liquefaction coupling stepwise extraction of waste biomass

    Treesearch

    Junfeng Feng; Chungyun Hse; Zhongzhi Yang; Kui Wang; Jianchun Jiang; Junming Xu

    2017-01-01

    Directional microwave-assisted liquefaction and stepwise extraction are introduced for producing platform chemicals: aromatics and monosaccharides. When sulfuric acid was used as a catalyst, a 45% monosaccharides yield and a 29% aromatics yield were obtained from bamboo with 0.3 g catalyst per 18 g methanol and 2 g bamboo at 160 °C with 10 min. Approximately 78–86 wt%...

  4. Sub-wavelength plasmonic readout for direct linear analysis of optically tagged DNA

    NASA Astrophysics Data System (ADS)

    Varsanik, Jonathan; Teynor, William; LeBlanc, John; Clark, Heather; Krogmeier, Jeffrey; Yang, Tian; Crozier, Kenneth; Bernstein, Jonathan

    2010-02-01

    This work describes the development and fabrication of a novel nanofluidic flow-through sensing chip that utilizes a plasmonic resonator to excite fluorescent tags with sub-wavelength resolution. We cover the design of the microfluidic chip and simulation of the plasmonic resonator using Finite Difference Time Domain (FDTD) software. The fabrication methods are presented, with testing procedures and preliminary results. This research is aimed at improving the resolution limits of the Direct Linear Analysis (DLA) technique developed by US Genomics [1]. In DLA, intercalating dyes which tag a specific 8 base-pair sequence are inserted in a DNA sample. This sample is pumped though a nano-fluidic channel, where it is stretched into a linear geometry and interrogated with light which excites the fluorescent tags. The resulting sequence of optical pulses produces a characteristic "fingerprint" of the sample which uniquely identifies any sample of DNA. Plasmonic confinement of light to a 100 nm wide metallic nano-stripe enables resolution of a higher tag density compared to free space optics. Prototype devices have been fabricated and are being tested with fluorophore solutions and tagged DNA. Preliminary results show evanescent coupling to the plasmonic resonator is occurring with 0.1 micron resolution, however light scattering limits the S/N of the detector. Two methods to reduce scattered light are presented: index matching and curved waveguides.

  5. Correlative assessment of fecal indicators using human mitochondrial DNA as a direct marker.

    PubMed

    Kapoor, Vikram; Smith, Christopher; Santo Domingo, Jorge W; Lu, Ting; Wendell, David

    2013-09-17

    Identifying the source of surface water fecal contamination is paramount to mitigating pollution and risk to human health. Fecal bacteria such as E. coli have been staple indicator organisms for over a century, however there remains uncertainty with E. coli-based metrics since these bacteria are abundant in the environment. The relationships between the presence of direct indicator of human waste (human mitochondrial DNA), human-specific Bacteroidales, and E. coli were studied for water samples taken from an urban creek system (Duck Creek Watershed, Cincinnati, OH) impacted by combined sewer overflows. Logistic regression analysis shows that human-specific Bacteroidales correlates much more closely to human mitochondrial DNA (R = 0.62) relative to E. coli (R = 0.33). We also examine the speciation of Bacteroidales within the Duck Creek Watershed using next-generation sequencing technology (Ion Torrent) and show the most numerous populations to be associated with sewage. Here we demonstrate that human-specific Bacteroidales closely follow the dynamics of human mitochondrial DNA concentration changes, indicating that these obligate anaerobes are more accurate than E. coli for fecal source tracking, lending further support to risk overestimation using coliforms, especially fecal coliforms and E. coli.

  6. Directly labeled DNA probes using fluorescent nucleotides with different length linkers.

    PubMed Central

    Zhu, Z; Chao, J; Yu, H; Waggoner, A S

    1994-01-01

    Directly labeled fluorescent DNA probes have been made by nick translation and PCR using dUTP attached to the fluorescent label, Cy3, with different length linkers. With preparation of probes by PCR we find that linker length affects the efficiency of incorporation of Cy3-dUTP, the yield of labeled probe, and the signal intensity of labeled probes hybridized to chromosome target sequences. For nick translation and PCR, both the level of incorporation and the hybridization fluorescence signal increased in parallel when the length of the linker arm is increased. Under optimal conditions, PCR yielded more densely labeled probes, however, the yield of PCR labeled probe decreased with greater linear density of labeling. By using a Cy3-modified dUTP with the longest linker under optimal conditions it was possible to label up to 28% of the possible substitution sites on the target DNA with reasonable yield by PCR and 18% by nick translation. A mechanism involving steric interactions between the polymerase, cyanine-labeled sites on template and extending chains and the modified dUTP substrate is proposed to explain the inverse correlation between the labeling efficiency and the yield of DNA probe synthesis by PCR. Images PMID:8078779

  7. A contamination assessment of the CI carbonaceous meteorite Orgueil using a DNA-directed approach

    NASA Astrophysics Data System (ADS)

    Aerts, J. W.; Elsaesser, A.; RöLing, W. F. M.; Ehrenfreund, P.

    2016-05-01

    The Orgueil meteorite has become one of the most well-studied carbonaceous meteorites, after it fell in France 150 yr ago. Extraterrestrial organic compounds such as amino acids and nucleobases in the parts per billion ranges were identified in Orgueil samples with supporting isotopic analyses. However, speculations of terrestrial contamination such as organic inclusions in the form of microbes and seeds accompanied the analyses of the Orgueil meteorite ever since its fall. By using molecular analysis, we performed DNA extractions and spiking experiments combined with 16S and 18S rRNA gene targeted PCR amplification to quantify the level of terrestrial biocontamination. Our results indicate that terrestrial contamination with DNA was insignificant in the investigated meteorite fraction. We also remeasured and confirmed concentrations of amino acids found in previous studies and conclude that their rather high concentrations and distribution cannot be explained by terrestrial contamination with microorganisms alone. These results represent the first analysis using DNA-directed tools in the analysis of the Orgueil meteorite to determine trace levels of biomarkers.

  8. DNA microstructural requirements for neocarzinostatin chromophore-induced direct strand cleavage.

    PubMed Central

    Lee, S H; Thivierge, J O; Goldberg, I H

    1989-01-01

    The microstructural requirements for optimal interaction of neocarzinostatin chromophore (NCS-C) with DNA have been investigated using a series of hexadeoxyribonucleotides with modified bases such as O6-methyl G (MeG), I, 5-methyl C (MeC), U, or 5-Bromo U (BrU) at specific sites in its preferred trinucleotide 5'GNaNb3':5'Na,Nb,C3' (Na = A, C, or T). Results show that MeG:C and G:MeC in place of G:C improve direct strand cleavage at the target Nb (Nb = T greater than A much greater than C greater than G), whereas MeC:G and C:MeG in place of Na:Nb, hinder cleavage. The optimal base target at Nb appears to be determined by its ability to form T:A type base pairing instead of C:G type. The observed differences in DNA strand cleavage patterns can be rationalized by induced changes in target site structure and are compatible with a model for NCS-C:DNA interaction in which the naphthoate moiety intercalates between 5'GNa3', and the activated tetrahydro-s-indacene, lying in the minor groove, abstracts a hydrogen atom from C-5' of Nb. PMID:2527356

  9. The effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and X-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to X rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between X-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I-, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  10. Effects of radioprotectors on DNA polymerase I-directed repair synthesis and DNA strand breaks in toluene-treated and x-irradiated Escherichia coli

    SciTech Connect

    Billen, D.

    1983-07-01

    In Escherichia coli made permeable to nucleotides by toluene treatment, a DNA polymerase I-directed repair synthesis is induced by exposure to x rays. This repair synthesis may be amplified and easily measured through inhibition of DNA ligase action. In an effort to learn more of the relationship between x-ray-induced strand breaks in cellular DNA and the extent of this repair synthesis, experiments designed to compare the influence of radioprotectors on both strand-break production and repair synthesis have been carried out. The results show that cysteamine, sodium formate, and glycerol not only protect against strand breaks but also reduce DNA polymerase I-directed repair synthesis. However, I/sup -/, an efficient hydroxyl radical scavenger, is not as effective a protective agent against strand breaks and does not measurably affect repair synthesis in our system.

  11. Direct identification of base-paired RNA nucleotides by correlated chemical probing.

    PubMed

    Krokhotin, Andrey; Mustoe, Anthony M; Weeks, Kevin M; Dokholyan, Nikolay V

    2017-01-01

    Many RNA molecules fold into complex secondary and tertiary structures that play critical roles in biological function. Among the best-established methods for examining RNA structure are chemical probing experiments, which can report on local nucleotide structure in a concise and extensible manner. While probing data are highly useful for inferring overall RNA secondary structure, these data do not directly measure through-space base-pairing interactions. We recently introduced an approach for single-molecule correlated chemical probing with dimethyl sulfate (DMS) that measures RNA interaction groups by mutational profiling (RING-MaP). RING-MaP experiments reveal diverse through-space interactions corresponding to both secondary and tertiary structure. Here we develop a framework for using RING-MaP data to directly and robustly identify canonical base pairs in RNA. When applied to three representative RNAs, this framework identified 20%-50% of accepted base pairs with a <10% false discovery rate, allowing detection of 88% of duplexes containing four or more base pairs, including pseudoknotted pairs. We further show that base pairs determined from RING-MaP analysis significantly improve secondary structure modeling. RING-MaP-based correlated chemical probing represents a direct, experimentally concise, and accurate approach for detection of individual base pairs and helices and should greatly facilitate structure modeling for complex RNAs. © 2016 Krokhotin et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  12. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags

    PubMed Central

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method “relay primer-dependent bypass” utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3′-terminus prior to ligation to adjacent oligonucleotides. The second reading method “repeat-dependent bypass” utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3′-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries. PMID:25483841

  13. Universal strategies for the DNA-encoding of libraries of small molecules using the chemical ligation of oligonucleotide tags.

    PubMed

    Litovchick, Alexander; Clark, Matthew A; Keefe, Anthony D

    2014-01-01

    The affinity-mediated selection of large libraries of DNA-encoded small molecules is increasingly being used to initiate drug discovery programs. We present universal methods for the encoding of such libraries using the chemical ligation of oligonucleotides. These methods may be used to record the chemical history of individual library members during combinatorial synthesis processes. We demonstrate three different chemical ligation methods as examples of information recording processes (writing) for such libraries and two different cDNA-generation methods as examples of information retrieval processes (reading) from such libraries. The example writing methods include uncatalyzed and Cu(I)-catalyzed alkyne-azide cycloadditions and a novel photochemical thymidine-psoralen cycloaddition. The first reading method "relay primer-dependent bypass" utilizes a relay primer that hybridizes across a chemical ligation junction embedded in a fixed-sequence and is extended at its 3'-terminus prior to ligation to adjacent oligonucleotides. The second reading method "repeat-dependent bypass" utilizes chemical ligation junctions that are flanked by repeated sequences. The upstream repeat is copied prior to a rearrangement event during which the 3'-terminus of the cDNA hybridizes to the downstream repeat and polymerization continues. In principle these reading methods may be used with any ligation chemistry and offer universal strategies for the encoding (writing) and interpretation (reading) of DNA-encoded chemical libraries.

  14. Ultrasensitive detection of DNA and RNA based on enzyme-free click chemical ligation chain reaction on dispersed gold nanoparticles.

    PubMed

    Kato, Daiki; Oishi, Motoi

    2014-10-28

    An ultrasensitive colorimetric DNA and RNA assay using a combination of enzyme-free click chemical ligation chain reaction (CCLCR) on dispersed gold nanoparticles (GNPs) and a magnetic separation process has been developed. The click chemical ligation between an azide-containing probe DNA-modified GNP and a dibenzocyclooctyne-containing probe biotinyl DNA occurred through hybridization with target DNA (RNA) to form the biotinyl-ligated GNPs (ligated products). Eventually, both the biotinyl-ligated GNPs and target DNA (RNA) were amplified exponentially using thermal cycling. After separation of the biotinyl-ligated GNPs using streptavidin-modified magnetic beads, the change in intensity of the surface plasmon band at 525 nm in the supernatants was observed by UV/vis measurement and was also evident visually. The CCLCR assay provides ultrasensitive detection (50 zM: several copies) of target DNA that is comparable to PCR-based approaches. Note that target RNA could also be detected with similar sensitivity without the need for reverse transcription to the corresponding cDNA. The amplification efficiency of the CCLCR assay was as high as 82% due to the pseudohomogeneous reaction behavior of CCLCR on dispersed GNPs. In addition, the CCLCR assay was able to discriminate differences in single-base mismatches and to specifically detect target DNA and target RNA from the cell lysate.

  15. Tuning the strength of chemical patterns for directed self-assembly of block copolymers

    NASA Astrophysics Data System (ADS)

    Williamson, Lance; Lin, Guanyang; Cao, Yi; Gronheid, Roel; Nealey, Paul

    2014-03-01

    Directed self-assembly (DSA) of block copolymers (BCP) via chemo-epitaxy is a potential lithographic solution to patterns of dense features. The LiNe (Liu-Nealey) flow was used to fabricate the chemical pattern, which guides the BCP due to the different wetting behavior of the materials. Fine control of both the chemical pattern chemistry and geometry are important for DSA of BCP. Furthermore, wetting behavior considerations for DSA extend beyond pattern design and include the surrounding region. BCP DSA would be easier to integrate into device design if the patterned region were isolated with a featureless region (horizontal lamellar BCP assembly) rather than undirected BCP fingerprint structures. This paper addresses two processing steps found to be modifying the guide material. For one, the backfill brush grafts to the cross-linked polystyrene (XPS), albeit at a lower rate than the brush grafts to the exposed substrate. Undersaturating the backfill brush only moderately improves the XPS wetting behavior, but also negatively impacts the background region of the chemical pattern. Replacing the brush grafting functionality so that the brush grafts at lower annealing conditions also did not avoid the side reaction between the brush and the XPS. The other step modifying the XPS is the trim etch. Replacing the trim etch process was effective at generating a chemical pattern that can orient the BCP horizontally on a stripe 11 L0 wide passing through a field of chemical pattern.

  16. DNA Unzipping and the Unbinding of Directed Polymers in a Random Media

    NASA Astrophysics Data System (ADS)

    Kafri, Yariv; Polkovnikov, Anatoli

    2006-11-01

    We consider the unbinding of a directed polymer in a random media from a wall in d=1+1 dimensions and a simple one-dimensional model for DNA unzipping. Using the replica trick we show that the restricted partition functions of these problems are identical up to an overall normalization factor. Our finding gives an example of a generalization of the stochastic matrix form decomposition to disordered systems, a method which allows us to reduce the dimensionality of the problem. The equivalence between the two problems, for example, allows us to derive the probability distribution for finding the directed polymer a distance z from the wall. We discuss implications of these results for the related Kardar-Parisi-Zhang equation and the asymmetric exclusion process.

  17. DNA unzipping and the unbinding of directed polymers in a random media

    NASA Astrophysics Data System (ADS)

    Kafri, Yariv; Polkovnikov, Anatoli

    2007-03-01

    We consider the unbinding of a directed polymer in a random media from a wall in d=1+1 dimensions and a simple one-dimensional model for DNA unzipping. Using the replica trick we show that the restricted partition functions of these problems are identical up to an overall normalization factor. Our finding gives an example of a generalization of the stochastic matrix form decomposition to disordered systems; a method which effectively allows to reduce the dimensionality of the problem. The equivalence between the two problems, for example, allows us to derive the probability distribution for finding the directed polymer a distance z from the wall. We discuss implications of these results for the related Kardar-Parisi-Zhang equation and the asymmetric exclusion process.

  18. Self-assembly of molecule-like nanoparticle clusters directed by DNA nanocages.

    PubMed

    Li, Yulin; Liu, Zhiyu; Yu, Guimei; Jiang, Wen; Mao, Chengde

    2015-04-08

    Analogous to the atom-molecule relationship, nanoparticle (NP) clusters (or NP-molecules) with defined compositions and directional bonds could potentially integrate the properties of the component individual NPs, leading to emergent properties. Despite extensive efforts in this direction, no general approach is available for assembly of such NP-molecules. Here we report a general method for building this type of structures by encapsulating NPs into self-assembled DNA polyhedral wireframe nanocages, which serve as guiding agents for further assembly. As a demonstration, a series of NP-molecules have been assembled and validated. Such NP-molecules will, we believe, pave a way to explore new nanomaterials with emergent functions/properties that are related to, but do not belong to the individual component nanoparticles.

  19. Kinetic analysis of oligodeoxyribonucleotide-directed triple-helix formation on DNA.

    PubMed

    Maher, L J; Dervan, P B; Wold, B J

    1990-09-18

    Pyrimidine oligonucleotides recognize extended purine sequences in the major groove of double-helical DNA by triple-helix formation. The resulting local triple helices are relatively stable and can block DNA recognition by sequence-specific DNA binding proteins such as restriction endonucleases. Association and dissociation kinetics for the oligodeoxyribonucleotide 5'-CTCTTTCCTCTCTTTTTCCCC (bold C's indicate 5-methylcytosine residues) are now measured with a restriction endonuclease protection assay. When oligonucleotides are present in greater than 10-fold excess over the DNA target site, the binding reaction kinetics are pseudo first order in oligonucleotide concentration. Under our standard conditions (37 degrees C, 25 mM Tris-acetate, pH 6.8, 70 mM sodium chloride, 20 mM magnesium chloride, 0.4 mM spermine tetrahydrochloride, 10 mM beta-mercaptoethanol, 0.1 mg/mL bovine serum albumin) the value of the observed pseudo-first-order association rate constant, k2obs, is 1.8 x 10(3) +/- 1.9 x 10(2) L.(mol of oligomer-1.s-1. Measurement of the dissociation rate constant yields an equilibrium dissociation constant of approximately 10 nM. Increasing sodium ion concentration slightly decreased the association rate, substantially increased the dissociation rate, and thereby reduced the equilibrium binding constant. This effect was reversible by increasing multivalent cation concentration, confirming the significant role of multivalent cations in oligonucleotide-directed triple-helix formation under these conditions. Finally, a small reduction in association rate, a large increase in dissociation rate, and a resulting reduction in the equilibrium binding constant were observed upon increasing the pH between 6.8 and 7.2.

  20. Trace DNA from insect skins: a comparison of five extraction protocols and direct PCR on chironomid pupal exuviae.

    PubMed

    Kranzfelder, Petra; Ekrem, Torbjørn; Stur, Elisabeth

    2016-01-01

    Insect skins (exuviae) are of extracellular origin and shed during moulting. The skins do not contain cells or DNA themselves, but epithelial cells and other cell-based structures might accidentally attach as they are shed. This source of trace DNA can be sufficient for PCR amplification and sequencing of target genes and aid in species identification through DNA barcoding or association of unknown life stages. Species identification is essential for biomonitoring programs, as species vary in sensitivities to environmental factors. However, it requires a DNA isolation protocol that optimizes the output of target DNA. Here, we compare the relative effectiveness of five different DNA extraction protocols and direct PCR in isolation of DNA from chironomid pupal exuviae. Chironomidae (Diptera) is a species-rich group of aquatic macroinvertebrates widely distributed in freshwater environments and considered a valuable bioindicator of water quality. Genomic DNA was extracted from 61.2% of 570 sampled pupal exuviae. There were significant differences in the methods with regard to cost, handling time, DNA quantity, PCR success, sequence success and the ability to sequence target taxa. The NucleoSpin(®) Tissue XS Kit, DNeasy(®) Blood and Tissue kit, and QuickExtract(™) DNA Extraction Solution provided the best results in isolating DNA from single pupal exuviae. Direct PCR and DTAB/CTAB methods gave poor results. While the observed differences in DNA isolation methods on trace DNA will be relevant to research that focuses on aquatic macroinvertebrate ecology, taxonomy and systematics, they should also be of interest for studies using environmental barcoding and metabarcoding of aquatic environments. © 2015 John Wiley & Sons Ltd.

  1. RNase-like domain in DNA-directed RNA polymerase II.

    PubMed Central

    Shirai, T; Go, M

    1991-01-01

    DNA-directed RNA polymerase is responsible for gene expression. Despite its importance, many details of its function and higher-order structure still remain unknown. We report here a local sequence similarity between the second largest subunit of RNA polymerase II and bacterial RNases Ba (barnase), Bi, and St. The most remarkable similarity is that the catalytic sites of the RNases are shared with the eukaryotic RNA polymerase II subunits of Drosophila melanogaster and Saccharomyces cerevisiae. Several amino acids conserved among the RNases and the RNase-like domains of the RNA polymerase subunits are located in the neighborhood of the catalytic sites of barnase, whose three-dimensional structure has been resolved. This observation suggests the functional importance of the RNase-like domain of the RNA polymerase subunits and indicates that the RNase-like domain may have RNase activity. The location of the RNase-like domain relative to the region necessary for RNA polymerization is similar to the relative proximity of 5'----3' or 3'----5' exonuclease and the region of polymerase activity of DNA polymerase I. The RNase-like domain might work in proofreading, as in RNA-directed RNA polymerase of influenza virus, or it may contribute to RNA binding through an unknown function. Images PMID:1924368

  2. DNA-directed in vitro synthesis of proteins involved in bacterial transcription and translation.

    PubMed Central

    Zarucki-Schulz, T; Jerez, C; Goldberg, G; Kung, H F; Huang, K H; Brot, N; Weissbach, H

    1979-01-01

    The in vitro synthesis of elongation factor (EF)-Tu (tufB), the beta beta' subunits of RNA polymerase, ribosomal proteins L10 and L12 directed by DNA from the transducing phage lambda rifd 18, EF-Tu (tufA), EF-G, and the alpha subunit of RNA polymerase directed by DNA from the transducing phage lambda fus3 has been investigated in a crude and a partially defined protein-synthesizing system. Proteins L10 and L12 are synthesized in the partially defined system almost as well as in the crude system. However, the synthesis of EF-Tu, EF-G, and the alpha and beta beta' subunits of RNA polymerase is far less efficient in the partially defined system. An active fraction that stimulates the synthesis of these latter proteins has been obtained by fractionation of a high-speed supernatant on DEAE-cellulose. Because previous studies showed that this fraction (1 M DEAE salt eluate) contains a protein, called L factor, that stimulates beta-galactosidase synthesis in vitro, L factor was tested for activity. Although L factor stimulates the synthesis of the beta beta' subunits, it has little or no effect on the in vitro synthesis of the other products studied. In the present experiments, the ratio of L12/L10 and of EF-Tu (tufA)/EF-G formed is 4-6. These values are consistent with in vivo results. Images PMID:160561

  3. Hybrid Magnetic-DNA Directed Immobilisation Approach for Efficient Protein Capture and Detection on Microfluidic Platforms.

    PubMed

    Esmaeili, Elaheh; Ghiass, Mohammad Adel; Vossoughi, Manouchehr; Soleimani, Masoud

    2017-03-15

    In this study, a hybrid magnetic-DNA directed immobilisation approach is presented to enhance protein capture and detection on a microfluidic platform. DNA-modified magnetic nanoparticles are added in a solution to capture fluorescently labelled immunocomplexes to be detected optically. A magnetic set-up composed of cubic permanent magnets and a microchannel was designed and implemented based on finite element analysis results to efficiently concentrate the nanoparticles only over a defined area of the microchannel as the sensing zone. This in turn, led to the fluorescence emission localisation and the searching area reduction. Also, compared to processes in which the immunocomplex is formed directly on the surface, the proposed approach provides a lower steric hindrance, higher mass transfer, lower equilibrium time, and more surface concentration of the captured targets leading to a faster and more sensitive detection. As a proof-of-concept, the set-up is capable of detecting prostate-specific membrane antigen with concentrations down to 0.7 nM. Our findings suggest that the approach holds a great promise for applications in clinical assays and disease diagnosis.

  4. RNA-directed DNA methylation and plant development require an IWR1-type transcription factor.

    PubMed

    Kanno, Tatsuo; Bucher, Etienne; Daxinger, Lucia; Huettel, Bruno; Kreil, David P; Breinig, Frank; Lind, Marc; Schmitt, Manfred J; Simon, Stacey A; Gurazada, Sai Guna Ranjan; Meyers, Blake C; Lorkovic, Zdravko J; Matzke, Antonius J M; Matzke, Marjori

    2010-01-01

    RNA-directed DNA methylation (RdDM) in plants requires two RNA polymerase (Pol) II-related RNA polymerases, namely Pol IV and Pol V. A genetic screen designed to reveal factors that are important for RdDM in a developmental context in Arabidopsis identified DEFECTIVE IN MERISTEM SILENCING 4 (DMS4). Unlike other mutants defective in RdDM, dms4 mutants have a pleiotropic developmental phenotype. The DMS4 protein is similar to yeast IWR1 (interacts with RNA polymerase II), a conserved putative transcription factor that interacts with Pol II subunits. The DMS4 complementary DNA partly complements the K1 killer toxin hypersensitivity of a yeast iwr1 mutant, suggesting some functional conservation. In the transgenic system studied, mutations in DMS4 directly or indirectly affect Pol IV-dependent secondary short interfering RNAs, Pol V-mediated RdDM, Pol V-dependent synthesis of intergenic non-coding RNA and expression of many Pol II-driven genes. These data suggest that DMS4 might be a regulatory factor for several RNA polymerases, thus explaining its diverse roles in the plant.

  5. Admission cell free DNA as a prognostic factor in burns: quantification by use of a direct rapid fluorometric technique.

    PubMed

    Shoham, Yaron; Krieger, Yuval; Perry, Zvi H; Shaked, Gad; Bogdanov-Berezovsky, Alexander; Silberstein, Eldad; Sagi, Amiram; Douvdevani, Amos

    2014-01-01

    Despite great advances in the treatment of burn patients, useful prognostic markers are sparse. During the past years there has been increasing interest in circulating plasma cell free DNA as a potential marker for tissue injury. We have developed a rapid direct fluorescent assay for cell free DNA quantification that allows obtaining accurate, fast, and inexpensive measurements. To use this technique for measuring plasma cell free DNA levels in burn patients and to further explore the use of cell free DNA as a potential marker of patient outcome in burns. Cell free DNA levels obtained from 14 burn victims within 6 hours of injury and 14 healthy controls were quantified by a direct rapid fluorometric assay. Patient admission cell free DNA levels were significantly elevated compared with that of controls (1797 ± 1523 ng/mL versus 374 ± 245 ng/mL, P = 0.004). There are statistically significant correlations between cell free DNA admission levels and burn degree (Spearman's correlation = 0.78, P = 0.001), total body surface area (Spearman's correlation = 0.61, P = 0.02), and total burn volume (Spearman's correlation = 0.64, P = 0.014). Admission cell free DNA levels can serve as a prognostic factor in burns and future routine use can be made possible by use of our direct rapid fluorometric assay.

  6. Noninvasive Facial Rejuvenation. Part 3: Physician-Directed-Lasers, Chemical Peels, and Other Noninvasive Modalities.

    PubMed

    Meaike, Jesse D; Agrawal, Nikhil; Chang, Daniel; Lee, Edward I; Nigro, Marjory G

    2016-08-01

    A proper knowledge of noninvasive facial rejuvenation is integral to the practice of a cosmetic surgeon. Noninvasive facial rejuvenation can be divided into patient- versus physician-directed modalities. Patient-directed facial rejuvenation combines the use of facial products such as sunscreen, moisturizers, retinoids, α-hydroxy acids, and various antioxidants to both maintain youthful skin and rejuvenate damaged skin. Physicians may recommend and often prescribe certain products, but patients are in control with this type of facial rejuvenation. On the other hand, physician-directed facial rejuvenation entails modalities that require direct physician involvement, such as neuromodulators, filler injections, laser resurfacing, microdermabrasion, and chemical peels. With the successful integration of each of these modalities, a complete facial regimen can be established and patient satisfaction can be maximized. This article is the last in a three-part series describing noninvasive facial rejuvenation. Here the authors review the mechanism, indications, and possible complications of lasers, chemical peels, and other commonly used noninvasive modalities.

  7. Direct immobilization of DNA probes on non-modified plastics by UV irradiation and integration in microfluidic devices for rapid bioassay.

    PubMed

    Sun, Yi; Perch-Nielsen, Ivan; Dufva, Martin; Sabourin, David; Bang, Dang Duong; Høgberg, Jonas; Wolff, Anders

    2012-01-01

    DNA microarrays have become one of the most powerful tools in the field of genomics and medical diagnosis. Recently, there has been increased interest in combining microfluidics with microarrays since this approach offers advantages in terms of portability, reduced analysis time, low consumption of reagents, and increased system integration. Polymers are widely used for microfluidic systems, but fabrication of microarrays on such materials often requires complicated chemical surface modifications, which hinders the integration of microarrays into microfluidic systems. In this paper, we demonstrate that simple UV irradiation can be used to directly immobilize poly(T)poly(C)-tagged DNA oligonucleotide probes on many different types of plastics without any surface modification. On average, five- and fourfold improvement in immobilization and hybridization efficiency have been achieved compared to surface-modified slides with aminated DNA probes. Moreover, the TC tag only costs 30% of the commonly used amino group modifications. Using this microarray fabrication technique, a portable cyclic olefin copolymer biochip containing eight individually addressable microfluidic channels was developed and used for rapid and parallel identification of Avian Influenza Virus by DNA hybridization. The one-step, cost-effective DNA-linking method on non-modified polymers significantly simplifies microarray fabrication procedures and permits great flexibility to plastic material selection, thus making it convenient to integrate microarrays into plastic microfluidic systems.

  8. Isolation of SMA candidate genes from a YAC contig by direct selection of cDNA clones from normalized cDNA libraries

    SciTech Connect

    Ross, B.M.; Bonaldo, M.F.; Vitale, E.

    1994-09-01

    A YAC contig has been constructed across the spinal muscular atrophy (SMA) region of chromosome 5 (5q11-13). Further definition by pedigree analysis has yielded a minimal genetic region of 400 kb. For isolation of candidate genes in this region, the following cDNA selection method was hybridized to directionally cloned normalized (Cot 1 DNA-preannealed) cDNA libraries in the form of single-stranded circles. The libraries used were constructed from SMA infant brain and normal fetal liver+spleen. Hybridizing circles were eluted off the filter, partially converted into duplexes and electroporated into bacteria. The selected clones were then sequentially hybridized with a human Cot 1 DNA probe (BRL), and a probe made from the corresponding YAC DNA. Clones that hybridized only to the YAC DNA probe were verified to map to the critical region by genomic Southern analyses. Ten different cDNA clones have been isolated by this procedure so far. Three of them have been definitively mapped back to the region. Four of the ten clones are now completely sequenced. One clone shows sequence homology to a transcriptional initiation factor; another has homology to a prokaryotic attachment site sequence for the lipid moiety of membrane lipoproteins. Two clones show no homology to sequences represented in the public databases. We are continuing the full characterization of the cDNA clones as candidates for the SMA gene.

  9. Evaluation of microbial community in hydrothermal field by direct DNA sequencing

    NASA Astrophysics Data System (ADS)

    Kawarabayasi, Y.; Maruyama, A.

    2002-12-01

    Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the

  10. Radical Formation and Chemical Track Structure in Ion-Beam Irradiated DNA

    NASA Astrophysics Data System (ADS)

    Becker, David; Adhikary, Amitava; Khanduri, Deepti; Sevilla, Michael D.

    2009-12-01

    Ion-beam irradiation of hydrated DNA at 77 K results in formation of at least three base radicals and a variety of radicals on the sugar phosphate backbone that can be observed using Electron Spin Resonance (ESR) spectroscopy. From dose-response curves for these radicals, we have formulated a radiation-chemical model of the track structure for ion-beam irradiated DNA. The model for chemical behavior posits that the base radicals trapped at 77 K are formed almost entirely in the track penumbra. The lower yields observed in ion-beam irradiated samples results from the fact that only a portion of the energy deposited by the ion beam ends up in this γ-like region. The remainder of the energy is deposited in the core in which the proximity of ion-radical formation results in the fast recombination of oppositely charged radicals, so few survive in the core at 77 K. However, a second group of radicals, neutral sugar radicals, are not as susceptible to recombination as are ion radicals, and can survive after formation in the core; these are presumed to form predominantly in the core. They include the sugar radicals, C1'ṡC3'ṡC5'ṡ, formed from oxidative processes, and C3'ṡdephos and phosphorous radicals which are formed after immediate strand breaks. The later species are thought to result from reductive cleavage by low energy electrons (LEE.) The high energy density in the core results in excited state processes that produce additional sugar radicals. The spatial characteristics of the radicals, deduced from PELDOR experiments, indicates that multiply damaged cluster sites (MDS) are formed in the core; these would be biologically significant, if formed in cells.

  11. DNA aptamers for selective identification and separation of flame retardant chemicals.

    PubMed

    Kim, Un-Jung; Kim, Byoung Chan

    2016-09-14

    Polybrominated diphenyl ethers (PBDEs) are group of chemicals which are representative persistent organic pollutants (POPs) and used as brominated flame retardants for many consumer products. PBDEs were phased out since 2009 but are still frequently observed in various environmental matrices and human body. Here, we report ssDNA aptamers which bind to BDE47, one of the PBDE congeners commonly found in various environmental matrices, and show affinity to other major tri-to hepta- BDE congeners. The PBDE specific aptamers were isolated from random library of ssDNA using Mag-SELEX. Two out of 15 sequences, based on their alignment and hairpin loop structures, were chosen to determine dissociation constant with BDE47 and showed from picomolar to nanomolar affinities (200 pM and 1.53 nM). The aptamers displayed high selectivity to the original target, BDE47, and implying general specificity to PBDE backbone with varying affinities to other congeners. Further, we showed that the use of two aptamers together could enhance the separation efficiency of BDE47 and other BDE congeners when dissolved in a solvent compared to use of single aptamer. These aptamers are expected to provide a tool for preliminary screening or quick separation of PBDEs in environmental samples prior to trace quantitative analysis.

  12. Chemical Elemental Distribution and Soil DNA Fingerprints Provide the Critical Evidence in Murder Case Investigation

    PubMed Central

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea

    2011-01-01

    Background The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. Methodology/Principal Findings The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Conclusions Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping. PMID:21674041

  13. Gener: a minimal programming module for chemical controllers based on DNA strand displacement

    PubMed Central

    Kahramanoğulları, Ozan; Cardelli, Luca

    2015-01-01

    Summary: Gener is a development module for programming chemical controllers based on DNA strand displacement. Gener is developed with the aim of providing a simple interface that minimizes the opportunities for programming errors: Gener allows the user to test the computations of the DNA programs based on a simple two-domain strand displacement algebra, the minimal available so far. The tool allows the user to perform stepwise computations with respect to the rules of the algebra as well as exhaustive search of the computation space with different options for exploration and visualization. Gener can be used in combination with existing tools, and in particular, its programs can be exported to Microsoft Research’s DSD tool as well as to LaTeX. Availability and implementation: Gener is available for download at the Cosbi website at http://www.cosbi.eu/research/prototypes/gener as a windows executable that can be run on Mac OS X and Linux by using Mono. Contact: ozan@cosbi.eu PMID:25957353

  14. Chemical elemental distribution and soil DNA fingerprints provide the critical evidence in murder case investigation.

    PubMed

    Concheri, Giuseppe; Bertoldi, Daniela; Polone, Elisa; Otto, Stefan; Larcher, Roberto; Squartini, Andrea

    2011-01-01

    The scientific contribution to the solution of crime cases, or throughout the consequent forensic trials, is a crucial aspect of the justice system. The possibility to extract meaningful information from trace amounts of samples, and to match and validate evidences with robust and unambiguous statistical tests, are the key points of such process. The present report is the authorized disclosure of an investigation, carried out by Attorney General appointment, on a murder case in northern Italy, which yielded the critical supporting evidence for the judicial trial. The proportional distribution of 54 chemical elements and the bacterial community DNA fingerprints were used as signature markers to prove the similarity of two soil samples. The first soil was collected on the crime scene, along a corn field, while the second was found in trace amounts on the carpet of a car impounded from the main suspect in a distant location. The matching similarity of the two soils was proven by crossing the results of two independent techniques: a) elemental analysis via inductively coupled plasma mass spectrometry (ICP-MS) and optical emission spectrometry (ICP-OES) approaches, and b) amplified ribosomal DNA restriction analysis by gel electrophoresis (ARDRA). Besides introducing the novel application of these methods to forensic disciplines, the highly accurate level of resolution observed, opens new possibilities also in the fields of soil typing and tracking, historical analyses, geochemical surveys and global land mapping.

  15. Gener: a minimal programming module for chemical controllers based on DNA strand displacement.

    PubMed

    Kahramanoğulları, Ozan; Cardelli, Luca

    2015-09-01

    : Gener is a development module for programming chemical controllers based on DNA strand displacement. Gener is developed with the aim of providing a simple interface that minimizes the opportunities for programming errors: Gener allows the user to test the computations of the DNA programs based on a simple two-domain strand displacement algebra, the minimal available so far. The tool allows the user to perform stepwise computations with respect to the rules of the algebra as well as exhaustive search of the computation space with different options for exploration and visualization. Gener can be used in combination with existing tools, and in particular, its programs can be exported to Microsoft Research's DSD tool as well as to LaTeX. Gener is available for download at the Cosbi website at http://www.cosbi.eu/research/prototypes/gener as a windows executable that can be run on Mac OS X and Linux by using Mono. ozan@cosbi.eu. © The Author 2015. Published by Oxford University Press.

  16. Development of Procedures for Direct Extraction of Cryptosporidium DNA from Water Concentrates and for Relief of PCR Inhibitors

    PubMed Central

    Jiang, Jianlin; Alderisio, Kerri A.; Singh, Ajaib; Xiao, Lihua

    2005-01-01

    Extraction of high-quality DNA is a key step in PCR detection of Cryptosporidium and other pathogens in environmental samples. Currently, Cryptosporidium oocysts in water samples have to be purified from water concentrates before DNA is extracted. This study compared the effectiveness of six DNA extraction methods (DNA extraction with the QIAamp DNA minikit after oocyst purification with immunomagnetic separation and direct DNA extraction methods using the FastDNA SPIN kit for soil, QIAamp DNA stool minikit, UltraClean soil kit, or QIAamp DNA minikit and the traditional phenol-chloroform technique) for the detection of Cryptosporidium with oocyst-seeded samples, DNA-spiked samples, and field water samples. The study also evaluated the effects of different PCR facilitators (nonacetylated bovine serum albumin, the T4 gene 32 protein, and polyvinylpyrrolidone) and treatments (the use of GeneReleaser or ultrafiltration) for the relief from or removal of inhibitors of PCR amplification. The results of seeding and spiking studies showed that PCR inhibitors were presented in all DNA solutions extracted by the six methods. However, the effect of PCR inhibitors could be relieved significantly by the addition of 400 ng of bovine serum albumin/μl or 25 ng of T4 gene 32 protein/μl to the PCR mixture. With the inclusion of bovine serum albumin in the PCR mixture, DNA extracted with the FastDNA SPIN kit for soil without oocyst isolation resulted in PCR performance similar to that produced by the QIAamp DNA minikit after oocysts were purified by immunomagnetic separation. PMID:15746310

  17. Direct Measurement and Chemical Speciation of Top Ring Zone Liquid During Engine Operation

    SciTech Connect

    Splitter, Derek A; Burrows, Barry Clay; Lewis Sr, Samuel Arthur

    2015-01-01

    The present manuscript consists of proof of concept experiments involving direct measurements and detailed chemical speciation from the top ring zone of a running engine. The work uses a naturally aspirated single cylinder utility engine that has been modified to allow direct liquid sample acquisition from behind the top ring. Samples were analyzed and spectated using gas chromatographic techniques. Results show that the liquid mixture in the top ring zone is neither neat lubricant nor fuel but a combination of the two with unique chemical properties. At the tested steady state no-load operating condition, the chemical species of the top ring zone liquid were found to be highly dependent on boiling point, where both low reactivity higher boiling point fuel species and lubricant are observed to be the dominant constituents. The results show that at least for the tested condition, approximately 25% of the top ring zone is comprised of gasoline fuel like molecules, which are dominated by high octane number aromatic species, while the remainder of the liquid is comprised of lubricant like species.

  18. Chemical Methods for the Direct Detection and Labeling of S-Nitrosothiols

    PubMed Central

    Bechtold, Erika

    2012-01-01

    Abstract Significance: Posttranslational modification of proteins through phosphorylation, glycosylation, and oxidation adds complexity to the proteome by reversibly altering the structure and function of target proteins in a highly controlled fashion. Recent Advances: The study of reversible cysteine oxidation highlights a role for this oxidative modification in complex signal transduction pathways. Nitric oxide (NO), and its respective metabolites (including reactive nitrogen species), participates in a variety of these cellular redox processes, including the reversible oxidation of cysteine to S-nitrosothiols (RSNOs). RSNOs act as endogenous transporters of NO, but also possess beneficial effects independent of NO-related signaling, which suggests a complex and versatile biological role. In this review, we highlight the importance of RSNOs as a required posttranslational modification and summarize the current methods available for detecting S-nitrosation. Critical Issues: Given the limitations of these indirect detection methods, the review covers recent developments toward the direct detection of RSNOs by phosphine-based chemical probes. The intrinsic properties that dictate this phosphine/RSNO reactivity are summarized. In general, RSNOs (both small molecule and protein) react with phosphines to yield reactive S-substituted aza-ylides that undergo further reactions leading to stable RSNO-based adducts. Future Directions: This newly explored chemical reactivity forms the basis of a number of exciting potential chemical methods for protein RSNO detection in biological systems. Antioxid. Redox Signal. 17, 981–991. PMID:22356122

  19. Chemical and structural characterization of interstrand cross-links formed between abasic sites and adenine residues in duplex DNA

    PubMed Central

    Price, Nathan E.; Catalano, Michael J.; Liu, Shuo; Wang, Yinsheng; Gates, Kent S.

    2015-01-01

    A new type of interstrand DNA–DNA cross-link between abasic (Ap) sites and 2′-deoxyadenosine (dA) residues was recently reported, but the chemical structure and properties of this lesion were not rigorously established. Here we characterized the nucleoside cross-link remnant released by enzymatic digestion of duplex DNA containing the dA-Ap cross-link. A synthetic standard was prepared for the putative nucleoside cross-link remnant 6 in which the anomeric carbon of the 2-deoxyribose residue was connected to the exocyclic N6-amino group of dA. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis showed that the synthetic material 6 matched the authentic cross-link remnant released by enzymatic digestion of cross-linked DNA. These findings establish the chemical structure of the dA-Ap cross-link released from duplex DNA and may provide methods for the detection of this lesion in cellular DNA. Both the nucleoside cross-link remnant 6 and the cross-link in duplex DNA were quite stable at pH 7 and 37°C, suggesting that the dA-Ap cross-link could be a persistent lesion with the potential to block the action of various DNA processing enzymes. PMID:25779045

  20. Renewable platform chemicals from directional microwave-assisted liquefaction coupling stepwise extraction of waste biomass.

    PubMed

    Feng, Junfeng; Hse, Chungyun; Yang, Zhongzhi; Wang, Kui; Jiang, Jianchun; Xu, Junming

    2017-11-01

    Directional microwave-assisted liquefaction and stepwise extraction are introduced for producing platform chemicals: aromatics and monosaccharides. When sulfuric acid was used as a catalyst, a 45% monosaccharides yield and a 29% aromatics yield were obtained from bamboo with 0.3g catalyst per 18g methanol and 2g bamboo at 160°C with 10min. Approximately 78-86wt% of the six biomass materials were converted into liquid products. After the stepwise extraction and precipitation process, the yields of monosaccharide derivatives and three phenolic compound fractions were 39-45% and 28-32%, respectively. Monosaccharides from holocellulose collected with a high purity of methyl glycosides were higher than 90%. Aromatic derivatives with different weight-molecular distributions were separated into three fractions with more than 80% phenolics. As their similar chemical properties within each fraction, platform chemicals have great commercial potential for producing high-quality chemicals and biofuels using mild upgrading conditions. Copyright © 2017. Published by Elsevier Ltd.

  1. Large-scale dynamics of directed self-assembly defects on chemically pre-patterned surface

    NASA Astrophysics Data System (ADS)

    Yoshimoto, Kenji; Taniguchi, Takashi

    2013-03-01

    Morphological defects of block copolymers are dynamically formed during the annealing step of directed self­ assembly (DSA) process. Understanding the dynamics of such defects is crucial to manufacture defect-free wafers, however it is not well-understood due to difficulties in in-situ measurements. In order to provide some insights into this problem, we have performed dynamic simulations of symmetric diblock copolymers on chemically pre-patterned surface. A simplified model, so-called the Ohta-Kawasaki (OK) model was employed in this study, whose free energy and chemical potential were expressed as a function of the local order parameters. Time evolution of the local order parameters were calculated numerically and iteratively from the equation of continuity. As a test case, the two-dimensional (2D) dynamic simulations were performed including thermal fluctuations. The time evolution of the lamella defects was successfully characterized as a function of the interactive strength between the diblock copolymers and the chemically pre-patterned surface. In the three­ dimensional (3D) dynamic simulations, some complicated morphologies formed on the chemically pre-patterned surface were found to be similar to those obtained from Monte Carlo simulations. Our preliminary simulation data prove that for small χNs, dynamic simulations of diblock copolymers with OK model could be a powerful method to predict DSA defects with reasonable accuracy and with small computational cost.

  2. Three-Tone Chemical Patterns for Block Copolymer Directed Self-Assembly

    SciTech Connect

    Williamson, Lance D.; Seidel, Robert N.; Chen, Xuanxuan; Suh, Hyo Seon; Rincon Delgadillo, Paulina; Gronheid, Roel; Nealey, Paul F.

    2016-02-03

    Chemical patterns for directed self-assembly (DSA) of lamellaeforming block copolymers (BCP) with density multiplication can be fabricated by patterning resist on a cross-linked polystyrene layer, etching to create guide stripes, and depositing end-grafted brushes in between the stripes as background. To date, two-tone chemical patterns have been targeted with the guide stripes preferentially wet by one block of the copolymer and the background chemistry weakly preferentially wet by the other block. In the course of fabricating chemical patterns in an all-track process using 300 mm wafers, it was discovered that the etching process followed by brush grafting could produce a three-tone pattern. We characterized the three regions of the chemical patterns with a combination of SEM, grazing-incidence small-angle X-ray scattering (GISAXS), and assessment of BCP-wetting behavior, and evaluated the DSA behavior on patterns over a range of guide stripe widths. In its best form, the three-tone pattern consists of guide stripes preferentially wet by one block of the copolymer, each flanked by two additional stripes that wet the other block of the copolymer, with a third chemistry as the background. Three-tone patterns guide three times as many BCP domains as two-tone patterns and thus have the potential to provide a larger driving force for the system to assemble into the desired architecture with fewer defects in shorter time and over a larger process window.

  3. Fiber optic chemical sensors: The evolution of high- density fiber-optic DNA microarrays

    NASA Astrophysics Data System (ADS)

    Ferguson, Jane A.

    2001-06-01

    Sensors were developed for multianalyte monitoring, fermentation monitoring, lactate analysis, remote oxygen detection for use in bioremediation monitoring and in a fuel spill clean-up project, heavy metal analysis, and high density DNA microarrays. The major focus of this thesis involved creating and improving high-density DNA gene arrays. Fiber optic sensors are created using fluorescent indicators, polymeric supports, and optical fiber substrates. The fluorescent indicator is entrapped in a polymer layer and attached to the tip of the optical fiber. The tip of the fiber bearing the sensing layer (the distal end) is placed in the sample of interest while the other end of the fiber (the proximal end) is connected to an analysis system. Any length of fiber can be used without compromising the integrity or sensitivity of the system. A fiber optic oxygen sensor was designed incorporating an oxygen sensitive fluorescent dye and a gas permeable polymer attached to an optical fiber. The construction simplicity and ruggedness of the sensor enabled its deployment for in situ chemical oxidation and bioremediation studies. Optical fibers were also used as the substrate to detect biomolecules in solution. To monitor bioprocesses, the production of the analyte of interest must be coupled with a species that is optically measurable. For example, oxygen is consumed in many metabolic functions. The fiber optic oxygen sensor is equipped with an additional sensing layer. Upon contact with a specific biochemical in the sample, a reaction occurs in the additional sensing layer that either consumes or produces oxygen. This dual layer system was used to monitor the presence of lactate, an important metabolite for clinical and bioprocess analysis. In many biological and environmental systems, the generation of one species occurs coincidentally with the generation or consumption of another species. A multianalyte sensor was prepared that can monitor the simultaneous activity of pH, CO2

  4. TANK VAPOR CHEMICALS OF POTENTIAL CONCERN & EXISTING DIRECT READING INSTRUMENTION & PERSONAL PROTECTIVE EQUIPMENT CONSIDERATIONS

    SciTech Connect

    BUTLER, N.K.

    2004-11-01

    This document takes the newly released Industrial Hygiene Chemical Vapor Technical Basis (RPP-22491) and evaluates the chemicals of potential concern (COPC) identified for selected implementation actions by the industrial hygiene organization. This document is not intended as a hazard analysis with recommended controls for all tank farm activities. Not all of the chemicals listed are present in all tanks; therefore, hazard analyses can and should be tailored as appropriate. Detection of each chemical by current industrial hygiene non-specific instrumentation in use at the tank farms is evaluated. Information gaps are identified and recommendations are made to resolve these needs. Of the 52 COPC, 34 can be detected with existing instrumentation. Three additional chemicals could be detected with a photoionization detector (PID) equipped with a different lamp. Discussion with specific instrument manufacturers is warranted. Consideration should be given to having the SapphIRe XL customized for tank farm applications. Other instruments, sampling or modeling techniques should be evaluated to estimate concentrations of chemicals not detected by direct reading instruments. In addition, relative instrument response needs to be factored in to action levels used for direct reading instruments. These action levels should be correlated to exposures to the COPC and corresponding occupational exposure limits (OELs). The minimum respiratory protection for each of the COPC is evaluated against current options. Recommendations are made for respiratory protection based on each chemical. Until exposures are sufficiently quantified and analyzed, the current use of supplied air respiratory protection is appropriate and protective for the COPC. Use of supplied air respiratory protection should be evaluated once a detailed exposure assessment for the COPC is completed. The established tank farm OELs should be documented in the TFC-PLN-34. For chemicals without an established tank farm OEL

  5. Ultraviolet light photobiology of the protozoan Tetrahymena pyriformis and chemical reactivation of DNA damage

    SciTech Connect

    Wheeler, J.S.

    1988-01-01

    The tunable dye laser was developed in order to perform UV-B and UV-C (254-320 nm) action spectra studies on several different organisms. Using the laser, action spectra studies have been performed for Escherichia coli, Saccharomyces, Chlamydomonas, Caenorhabditis elegans, Paramecium, and Tetrahymena pyriformis. Studies generally indicate increasing LD{sub 50} values with increasing wavelength. Two notable findings were made: (1) The action spectra does not follow the DNA absorption spectra at 280, 290 and 295 nm; (2) The repair competent/repair defective sensitization factor does not remain constant throughout the wavelength region. In addition it was found that the repair defective strain of E. coli, Bs-1, showed an increase in survival with increasing UV irradiation, at certain dose levels. Further experiments were designed to better characterize the reactivation. Tetrahymena were exposed to UV-C and reactivated with methyl methanesulfonate (MMS) and 4-nitro quinoline oxide (4-NQO). In both cases survival was seen to increase after chemical exposure. Likewise, UV-C was found to reactivate chemical damage (MMS).

  6. Characterization of environmental chemicals with potential for DNA damage using isogenic DNA repair-deficient chicken DT40 cell lines.

    PubMed

    Yamamoto, Kimiyo N; Hirota, Kouji; Kono, Koichi; Takeda, Shunichi; Sakamuru, Srilatha; Xia, Menghang; Huang, Ruili; Austin, Christopher P; Witt, Kristine L; Tice, Raymond R

    2011-08-01

    Included among the quantitative high throughput screens (qHTS) conducted in support of the US Tox21 program are those being evaluated for the detection of genotoxic compounds. One such screen is based on the induction of increased cytotoxicity in seven isogenic chicken DT40 cell lines deficient in DNA repair pathways compared to the parental DNA repair-proficient cell line. To characterize the utility of this approach for detecting genotoxic compounds and identifying the type(s) of DNA damage induced, we evaluated nine of 42 compounds identified as positive for differential cytotoxicity in qHTS (actinomycin D, adriamycin, alachlor, benzotrichloride, diglycidyl resorcinol ether, lovastatin, melphalan, trans-1,4-dichloro-2-butene, tris(2,3-epoxypropyl)isocyanurate) and one non-cytotoxic genotoxic compound (2-aminothiamine) for (1) clastogenicity in mutant and wild-type cells; (2) the comparative induction of γH2AX positive foci by melphalan; (3) the extent to which a 72-hr exposure duration increased assay sensitivity or specificity; (4) the use of 10 additional DT40 DNA repair-deficient cell lines to better analyze the type(s) of DNA damage induced; and (5) the involvement of reactive oxygen species in the induction of DNA damage. All compounds but lovastatin and 2-aminothiamine were more clastogenic in at least one DNA repair-deficient cell line than the wild-type cells. The differential responses across the various DNA repair-deficient cell lines provided information on the type(s) of DNA damage induced. The results demonstrate the utility of this DT40 screen for detecting genotoxic compounds, for characterizing the nature of the DNA damage, and potentially for analyzing mechanisms of mutagenesis.

  7. Porous polybenzimidazole membranes with excellent chemical stability and ion conductivity for direct borohydride fuel cells

    NASA Astrophysics Data System (ADS)

    Chen, Dongju; Yu, Shanshan; Liu, Xue; Li, Xianfeng

    2015-05-01

    Porous membranes based on polybenzimidazole (PBI) are firstly introduced in direct borohydride fuel cell application (DBFC). Membranes with different thicknesses and porosity are successfully fabricated via water vapor phase inversion process. The prepared membranes show excellent ion conductivity and chemical stability under DBFC operating condition. Compare with Nafion 115, the prepared membranes show higher ion conductivity, as a result, much higher peak power density. No weight loss is observed after immersing the prepared membranes in a 3 M NaOH solution for 30 days, indicating the excellent chemical stability of porous PBI membranes. And the DBFC cells assembled with prepared membranes could discharge at 200 mA cm-2 for more than 250 h without voltage decay, which is the longest time reported by far. This work provides a totally new idea for fabricating versatile DBFC membranes.

  8. Medicinal plants recommended by the world health organization: DNA barcode identification associated with chemical analyses guarantees their quality.

    PubMed

    Palhares, Rafael Melo; Gonçalves Drummond, Marcela; Dos Santos Alves Figueiredo Brasil, Bruno; Pereira Cosenza, Gustavo; das Graças Lins Brandão, Maria; Oliveira, Guilherme

    2015-01-01

    Medicinal plants are used throughout the world, and the regulations defining their proper use, such as identification of the correct species and verification of the presence, purity and concentration of the required chemical compounds, are widely recognized. Herbal medicines are made from vegetal drugs, the processed products of medicinal species. These processed materials present a number of challenges in terms of botanical identification, and according to the World Health Organization (WHO), the use of incorrect species is a threat to consumer safety. The samples used in this study consisted of the dried leaves, flowers and roots of 257 samples from 8 distinct species approved by the WHO for the production of medicinal herbs and sold in Brazilian markets. Identification of the samples in this study using DNA barcoding (matK, rbcL and ITS2 regions) revealed that the level of substitutions may be as high as 71%. Using qualitative and quantitative chemical analyses, this study identified situations in which the correct species was being sold, but the chemical compounds were not present. Even more troubling, some samples identified as substitutions using DNA barcoding contained the chemical compounds from the correct species at the minimum required concentration. This last situation may lead to the use of unknown species or species whose safety for human consumption remains unknown. This study concludes that DNA barcoding should be used in a complementary manner for species identification with chemical analyses to detect and quantify the required chemical compounds, thus improving the quality of this class of medicines.

  9. Direct immobilization of DNA oligomers onto the amine-functionalized glass surface for DNA microarray fabrication through the activation-free reaction of oxanine

    PubMed Central

    Pack, Seung Pil; Kamisetty, Nagendra Kumar; Nonogawa, Mitsuru; Devarayapalli, Kamakshaiah Charyulu; Ohtani, Kairi; Yamada, Kazunari; Yoshida, Yasuko; Kodaki, Tsutomu; Makino, Keisuke

    2007-01-01

    Oxanine having an O-acylisourea structure was explored to see if its reactivity with amino group is useful in DNA microarray fabrication. By the chemical synthesis, a nucleotide unit of oxanine (Oxa-N) was incorporated into the 5′-end of probe DNA with or without the -(CH2)n- spacers (n = 3 and 12) and found to immobilize the probe DNA covalently onto the NH2-functionalized glass slide by one-pot reaction, producing the high efficiency of the target hybridization. The methylene spacer, particularly the longer one, generated higher efficiency of the target recognition although there was little effect on the amount of the immobilized DNA oligomers. The post-spotting treatment was also carried out under the mild conditions (at 25 or 42°C) and the efficiencies of the immobilization and the target recognition were evaluated similarly, and analogous trends were obtained. It has also been determined under the mild conditions that the humidity and time of the post-spotting treatment, pH of the spotting solution and the synergistic effects with UV-irradiation largely contribute to the desired immobilization and resulting target recognition. Immobilization of DNA oligomer by use of Oxa-N on the NH2-functionalized surface without any activation step would be employed as one of the advanced methods for generating DNA-conjugated solid surface. PMID:17715142

  10. The importance of Guthrie cards and other medical samples for the direct matching of disaster victims using DNA profiling.

    PubMed

    Hartman, D; Benton, L; Morenos, L; Beyer, J; Spiden, M; Stock, A

    2011-02-25

    The identification of disaster victims through the use of DNA analysis is an integral part of any Disaster Victim Identification (DVI) response, regardless of the scale and nature of the disaster. As part of the DVI response to the 2009 Victorian Bushfires Disaster, DNA analysis was performed to assist in the identification of victims through kinship (familial matching to relatives) or direct (self source sample) matching of DNA profiles. Although most of the DNA identifications achieved were to reference samples from relatives, there were a number of DNA identifications (12) made through direct matching. Guthrie cards, which have been collected in Australia over the past 30 years, were used to provide direct reference samples. Of the 236 ante-mortem (AM) samples received, 21 were Guthrie cards and one was a biopsy specimen; all yielding complete DNA profiles when genotyped. This publication describes the use of such Biobanks and medical specimens as a sample source for the recovery of good quality DNA for comparisons to post-mortem (PM) samples.

  11. One-pot DNA construction for synthetic biology: the Modular Overlap-Directed Assembly with Linkers (MODAL) strategy

    PubMed Central

    Casini, Arturo; MacDonald, James T.; Jonghe, Joachim De; Christodoulou, Georgia; Freemont, Paul S.; Baldwin, Geoff S.; Ellis, Tom

    2014-01-01

    Overlap-directed DNA assembly methods allow multiple DNA parts to be assembled together in one reaction. These methods, which rely on sequence homology between the ends of DNA parts, have become widely adopted in synthetic biology, despite being incompatible with a key principle of engineering: modularity. To answer this, we present MODAL: a Modular Overlap-Directed Assembly with Linkers strategy that brings modularity to overlap-directed methods, allowing assembly of an initial set of DNA parts into a variety of arrangements in one-pot reactions. MODAL is accompanied by a custom software tool that designs overlap linkers to guide assembly, allowing parts to be assembled in any specified order and orientation. The in silico design of synthetic orthogonal overlapping junctions allows for much greater efficiency in DNA assembly for a variety of different methods compared with using non-designed sequence. In tests with three different assembly technologies, the MODAL strategy gives assembly of both yeast and bacterial plasmids, composed of up to five DNA parts in the kilobase range with efficiencies of between 75 and 100%. It also seamlessly allows mutagenesis to be performed on any specified DNA parts during the process, allowing the one-step creation of construct libraries valuable for synthetic biology applications. PMID:24153110

  12. Directly incorporating fluorochromes into DNA probes by PCR increases the efficience of fluorescence in situ hybridization

    SciTech Connect

    Dittmer, Joy

    1996-05-01

    The object of this study was to produce a directly labeled whole chromosome probe in a Degenerative Oligonucleotide Primed-Polymerase Chain Reaction (DOP-PCR) that will identify chromosome breaks, deletions, inversions and translocations caused by radiation damage. In this study we amplified flow sorted chromosome 19 using DOP-PCR. The product was then subjected to a secondary DOP PCR amplification, After the secondary amplification the DOP-PCR product was directly labeled in a tertiary PCR reaction with rhodamine conjugated with dUTP (FluoroRed) to produce a DNA fluorescent probe. The probe was then hybridized to human metaphase lymphocytes on slides, washed and counterstained with 4{prime},6-diamino-2-phenylindole (DAPI). The signal of the FluoroRed probe was then compared to a signal of a probe labeled with biotin and stained with avidin fluorescein isothio cynate (FITC) and anti-avidin FITC. The results show that the probe labeled with FluoroRed gave signals as bright as the probe with biotin labeling. The FluoroRed probe had less noise than the biotin labeled probe. Therefore, a directly labeled probe has been successfully produced in a DOP-PCR reaction. In future a probe labeled with FluoroRed will be produced instead of a probe labeled with biotin to increase efficiency.

  13. The a2 mating-type locus genes lga2 and rga2 direct uniparental mitochondrial DNA (mtDNA) inheritance and constrain mtDNA recombination during sexual development of Ustilago maydis.

    PubMed

    Fedler, Michael; Luh, Kai-Stephen; Stelter, Kathrin; Nieto-Jacobo, Fernanda; Basse, Christoph W

    2009-03-01

    Uniparental inheritance of mitochondria dominates among sexual eukaryotes. However, little is known about the mechanisms and genetic determinants. We have investigated the role of the plant pathogen Ustilago maydis genes lga2 and rga2 in uniparental mitochondrial DNA (mtDNA) inheritance during sexual development. The lga2 and rga2 genes are specific to the a2 mating-type locus and encode small mitochondrial proteins. On the basis of identified sequence polymorphisms due to variable intron numbers in mitochondrial genotypes, we could demonstrate that lga2 and rga2 decisively influence mtDNA inheritance in matings between a1 and a2 strains. Deletion of lga2 favored biparental inheritance and generation of recombinant mtDNA molecules in combinations in which inheritance of mtDNA of the a2 partner dominated. Conversely, deletion of rga2 resulted in predominant loss of a2-specific mtDNA and favored inheritance of the a1 mtDNA. Furthermore, expression of rga2 in the a1 partner protected the associated mtDNA from elimination. Our results indicate that Lga2 in conjunction with Rga2 directs uniparental mtDNA inheritance by mediating loss of the a1-associated mtDNA. This study shows for the first time an interplay of mitochondrial proteins in regulating uniparental mtDNA inheritance.

  14. The a2 Mating-Type Locus Genes lga2 and rga2 Direct Uniparental Mitochondrial DNA (mtDNA) Inheritance and Constrain mtDNA Recombination During Sexual Development of Ustilago maydis

    PubMed Central

    Fedler, Michael; Luh, Kai-Stephen; Stelter, Kathrin; Nieto-Jacobo, Fernanda; Basse, Christoph W.

    2009-01-01

    Uniparental inheritance of mitochondria dominates among sexual eukaryotes. However, little is known about the mechanisms and genetic determinants. We have investigated the role of the plant pathogen Ustilago maydis genes lga2 and rga2 in uniparental mitochondrial DNA (mtDNA) inheritance during sexual development. The lga2 and rga2 genes are specific to the a2 mating-type locus and encode small mitochondrial proteins. On the basis of identified sequence polymorphisms due to variable intron numbers in mitochondrial genotypes, we could demonstrate that lga2 and rga2 decisively influence mtDNA inheritance in matings between a1 and a2 strains. Deletion of lga2 favored biparental inheritance and generation of recombinant mtDNA molecules in combinations in which inheritance of mtDNA of the a2 partner dominated. Conversely, deletion of rga2 resulted in predominant loss of a2-specific mtDNA and favored inheritance of the a1 mtDNA. Furthermore, expression of rga2 in the a1 partner protected the associated mtDNA from elimination. Our results indicate that Lga2 in conjunction with Rga2 directs uniparental mtDNA inheritance by mediating loss of the a1-associated mtDNA. This study shows for the first time an interplay of mitochondrial proteins in regulating uniparental mtDNA inheritance. PMID:19104076

  15. 53BP1 fosters fidelity of homology-directed DNA repair.

    PubMed

    Ochs, Fena; Somyajit, Kumar; Altmeyer, Matthias; Rask, Maj-Britt; Lukas, Jiri; Lukas, Claudia

    2016-08-01

    Repair of DNA double-strand breaks (DSBs) in mammals is coordinated by the ubiquitin-dependent accumulation of 53BP1 at DSB-flanking chromatin. Owing to its ability to limit DNA-end processing, 53BP1 is thought to promote nonhomologous end-joining (NHEJ) and to suppress homology-directed repair (HDR). Here, we show that silencing 53BP1 or exhausting its capacity to bind damaged chromatin changes limited DSB resection to hyper-resection and results in a switch from error-free gene conversion by RAD51 to mutagenic single-strand annealing by RAD52. Thus, rather than suppressing HDR, 53BP1 fosters its fidelity. These findings illuminate causes and consequences of synthetic viability acquired through 53BP1 silencing in cells lacking the BRCA1 tumor suppressor. We show that such cells survive DSB assaults at the cost of increasing reliance on RAD52-mediated HDR, which may fuel genome instability. However, our findings suggest that when challenged by DSBs, BRCA1- and 53BP1-deficient cells may become hypersensitive to, and be eliminated by, RAD52 inhibition.

  16. Marking of specific sequences in double-stranded DNA molecules—SNP detection and direct observation

    PubMed Central

    Shigemori, Yasushi; Haruta, Hirotaka; Okada, Takao; Oishi, Michio

    2004-01-01

    In this study, we describe a simple method to mark specific sequences in double-stranded DNA molecules. For the marking, we used two specifically designed oligonucleotides, one of which is complementary to the sequence to be marked and the other, serving as a splint, to make the marking stable and detectable by subsequent various analytical means. In the presence of the two deoxyoligonucleotides, whereas RecA protein-mediated reaction converts the sequence to be marked to a regional triple-stranded structure with the complementary (probing) oligonucleotide, DNA ligase transforms it to a stable multi- (possibly quintuple) stranded structure with the splint oligonucleotide. The whole marking process is simple and completed in a single reaction mixture. Because RecA protein makes the marking to proceed with high fidelity, we were able to mark (detect) SNPs in complex genomes like human's. Furthermore, the structure of the marked sequence is stable and quite distinct enough to be readily detectable by biochemical means or direct observation by scanning probe microscopy. PMID:15574826

  17. An unusual case of Streptococcus anginosus group pyomyositis diagnosed using direct 16S ribosomal DNA sequencing.

    PubMed

    Walkty, Andrew; Embil, John M; Nichol, Kim; Karlowsky, James

    2014-01-01

    Bacteria belonging to the Streptococcus anginosus group (Streptococcus intermedius, Streptococcus constellatus and Streptococcus anginosus) are capable of causing serious pyogenic infections, with a tendency for abscess formation. The present article reports a case of S anginosus group pyomyositis in a 47-year-old man. The pathogen was recovered from one of two blood cultures obtained from the patient, but speciation was initially not performed because the organism was considered to be a contaminant (viridans streptococci group). The diagnosis was ultimately confirmed using 16S ribosomal DNA sequencing of purulent fluid obtained from a muscle abscess aspirate. The present case serves to emphasize that finding even a single positive blood culture of an organism belonging to the S anginosus group should prompt careful evaluation of the patient for a pyogenic focus of infection. It also highlights the potential utility of 16S ribosomal DNA amplification and sequencing in direct pathogen detection from aspirated fluid in cases of pyomyositis in which antimicrobial therapy was initiated before specimen collection.

  18. Direct sequencing of mitochondrial DNA detects highly divergent haplotypes in blue marlin (Makaira nigricans).

    PubMed

    Finnerty, J R; Block, B A

    1992-06-01

    We were able to differentiate between species of billfish (Istiophoridae family) and to detect considerable intraspecific variation in the blue marlin (Makaira nigricans) by directly sequencing a polymerase chain reaction (PCR)-amplified, 612-bp fragment of the mitochondrial cytochrome b gene. Thirteen variable nucleotide sites separated blue marlin (n = 26) into 7 genotypes. On average, these genotypes differed by 5.7 base substitutions. A smaller sample of swordfish from an equally broad geographic distribution displayed relatively little intraspecific variation, with an average of 1.3 substitutions separating different genotypes. A cladistic analysis of blue marlin cytochrome b variants indicates two major divergent evolutionary lines within the species. The frequencies of these two major evolutionary lines differ significantly between Atlantic and Pacific ocean basins. This finding is important given that the Atlantic stocks of blue marlin are considered endangered. Migration from the Pacific can help replenish the numbers of blue marlin in the Atlantic, but the loss of certain mitochondrial DNA haplotypes in the Atlantic due to overfishing probably could not be remedied by an influx of Pacific fish because of their absence in the Pacific population. Fishery management strategies should attempt to preserve the genetic diversity within the species. The detection of DNA sequence polymorphism indicates the utility of PCR technology in pelagic fishery genetics.

  19. Common architecture of nuclear receptor heterodimers on DNA direct repeat elements with different spacings.

    PubMed

    Rochel, Natacha; Ciesielski, Fabrice; Godet, Julien; Moman, Edelmiro; Roessle, Manfred; Peluso-Iltis, Carole; Moulin, Martine; Haertlein, Michael; Callow, Phil; Mély, Yves; Svergun, Dmitri I; Moras, Dino

    2011-05-01

    Nuclear hormone receptors (NHRs) control numerous physiological processes through the regulation of gene expression. The present study provides a structural basis for understanding the role of DNA in the spatial organization of NHR heterodimers in complexes with coactivators such as Med1 and SRC-1. We have used SAXS, SANS and FRET to determine the solution structures of three heterodimer NHR complexes (RXR-RAR, PPAR-RXR and RXR-VDR) coupled with the NHR interacting domains of coactivators bound to their cognate direct repeat elements. The structures show an extended asymmetric shape and point to the important role played by the hinge domains in establishing and maintaining the integrity of the structures. The results reveal two additional features: the conserved position of the ligand-binding domains at the 5' ends of the target DNAs and the binding of only one coactivator molecule per heterodimer, to RXR's partner.

  20. Phylogenetic relationships of annual and perennial wild rice: probing by direct DNA sequencing.

    PubMed

    Barbier, P; Morishima, H; Ishihama, A

    1991-05-01

    The phylogenetic relationships between Asian wild rice strains were analyzed by direct sequencing of PCR-amplified DNA fragments. The sequence of three introns located in the phytochrome gene was determined for eight strains of the Asian wild rice, Oryza rufipogon, and one strain of the related African species, Oryza longistaminata. The number of nucleotide substitutions per site between various strains within a single species, O. rufipogon, ranged between 0.0017 and 0.0050, while those between two related species, O. rufipogon and O. longistaminate, were 0.043-0.049 (23-26 within 532 bp). Taken together with the sequence differences of the 10-kDa prolamin gene, a model is proposed for the phylogenetic relationships and evolutionary history of annuals and perennials within O. rufipogon.

  1. Direct observation of the interaction of single fluorescent nucleotide analogue molecules with DNA polymerase I

    NASA Astrophysics Data System (ADS)

    Ye, Jing Yong; Yamane, Yuji; Yamauchi, Masayo; Nakatsuka, Hiroki; Ishikawa, Mitsuru

    2000-04-01

    The interaction of a fluorescent nucleotide analogue, 2'- (or-3')- O-(2,4,6-trinitrophenyl) adenosine 5'-triphosphate (TNP-ATP), with the Klenow fragment of DNA polymerase I (Pol I) was visualized at a single-molecule level. Upon excitation, individual enzyme-TNP-ATP complexes resulted in bright fluorescent spots owing to the increase of the fluorescence quantum yield of TNP-ATP when it bound to the enzyme molecule, whereas unbound TNP-ATP molecules were not visible in the single molecule detection. Thus, we directly investigated the individual interactions of TNP-ATP with the enzyme using single-molecule fluorescence imaging and time-resolved spectroscopy of single enzyme-TNP-ATP complexes without prior separation of the unbound probe molecules.