Science.gov

Sample records for dna electrophoretic mobility

  1. Electrophoretic mobility shift assays for the analysis of DNA-protein interactions.

    PubMed

    Gaudreault, Manon; Gingras, Marie-Eve; Lessard, Maryse; Leclerc, Steeve; Guérin, Sylvain L

    2009-01-01

    Electromobility shift assay is a simple, efficient, and rapid method for the study of specific DNA-protein interactions. It relies on the reduction in the electrophoretic mobility conferred to a DNA fragment by an interacting protein. The technique is suitable to qualitative, quantitative, and kinetic analyses. It can also be used to analyze conformational changes.

  2. Coarse-grained model of conformation-dependent electrophoretic mobility and its influence on DNA dynamics

    NASA Astrophysics Data System (ADS)

    Pandey, Harsh; Underhill, Patrick T.

    2015-11-01

    The electrophoretic mobility of molecules such as λ -DNA depends on the conformation of the molecule. It has been shown that electrohydrodynamic interactions between parts of the molecule lead to a mobility that depends on conformation and can explain some experimental observations. We have developed a new coarse-grained model that incorporates these changes of mobility into a bead-spring chain model. Brownian dynamics simulations have been performed using this model. The model reproduces the cross-stream migration that occurs in capillary electrophoresis when pressure-driven flow is applied parallel or antiparallel to the electric field. The model also reproduces the change of mobility when the molecule is stretched significantly in an extensional field. We find that the conformation-dependent mobility can lead to a new type of unraveling of the molecule in strong fields. This occurs when different parts of the molecule have different mobilities and the electric field is large.

  3. Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

    ERIC Educational Resources Information Center

    Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

  4. Predicting Electrophoretic Mobility of Protein-Ligand Complexes for Ligands from DNA-Encoded Libraries of Small Molecules.

    PubMed

    Bao, Jiayin; Krylova, Svetlana M; Cherney, Leonid T; Hale, Robert L; Belyanskaya, Svetlana L; Chiu, Cynthia H; Shaginian, Alex; Arico-Muendel, Christopher C; Krylov, Sergey N

    2016-05-17

    Selection of target-binding ligands from DNA-encoded libraries of small molecules (DELSMs) is a rapidly developing approach in drug-lead discovery. Methods of kinetic capillary electrophoresis (KCE) may facilitate highly efficient homogeneous selection of ligands from DELSMs. However, KCE methods require accurate prediction of electrophoretic mobilities of protein-ligand complexes. Such prediction, in turn, requires a theory that would be applicable to DNA tags of different structures used in different DELSMs. Here we present such a theory. It utilizes a model of a globular protein connected, through a single point (small molecule), to a linear DNA tag containing a combination of alternating double-stranded and single-stranded DNA (dsDNA and ssDNA) regions of varying lengths. The theory links the unknown electrophoretic mobility of protein-DNA complex with experimentally determined electrophoretic mobilities of the protein and DNA. Mobility prediction was initially tested by using a protein interacting with 18 ligands of various combinations of dsDNA and ssDNA regions, which mimicked different DELSMs. For all studied ligands, deviation of the predicted mobility from the experimentally determined value was within 11%. Finally, the prediction was tested for two proteins and two ligands with a DNA tag identical to those of DELSM manufactured by GlaxoSmithKline. Deviation between the predicted and experimentally determined mobilities did not exceed 5%. These results confirm the accuracy and robustness of our model, which makes KCE methods one step closer to their practical use in selection of drug leads, and diagnostic probes from DELSMs.

  5. Analysis of In Vitro DNA Interactions of Brassinosteroid-Controlled Transcription Factors Using Electrophoretic Mobility Shift Assay.

    PubMed

    Unterholzner, Simon J; Rozhon, Wilfried; Poppenberger, Brigitte

    2017-01-01

    Most signaling cascades ultimately lead to changes in gene expression by modulating the activity of transcription factors (TFs). The electrophoretic mobility shift assay (EMSA) is a simple but powerful in vitro method for investigation of specific protein-DNA interactions. It makes use of the fact that protein-DNA complexes have a lower electrophoretic mobility in gels than free DNA has. The application of labeled probes in combination with unlabeled competitors allows investigation of DNA-binding specificity and identification of binding motifs with single base-pair resolution. Here we describe the application of EMSAs for the study of interactions of the brassinosteroid-regulated TFs, BRASSINAZOLE-RESISTANT1, (BZR1), BRI1-ETHYL METHANESULFONATE-SUPPRESSOR1 (BES1)/BZR2, and CESTA with putative binding sites. The classical approach using radiolabeled probes, as well as the more recent application of fluorescent probes, is described and the advantages and disadvantages of both methods are discussed.

  6. Electrophoretic Mobilities of the Charge Variants of DNA and Other Polyelectrolytes: Similarities, Differences, and Comparison with Theory.

    PubMed

    Stellwagen, Nancy C

    2017-03-09

    Free solution electrophoretic mobilities of polyelectrolytes with different charge densities have been analyzed using data taken from the literature. The polyions include single- and double-stranded DNA oligomers, small aromatic molecules, peptides, proteins, and synthetic copolymers. Mobility variations due to differences in the background electrolytes were minimized by calculating mobility ratios, dividing the mobility of each charge variant in each data set by the mobility of the most highly charged polyion in that data set. In all cases, the mobility ratios increase linearly with the logarithm of the fractional charge, not the first power of the charge as usually assumed. In addition, the mobility ratios observed for all polyelectrolytes, except for the synthetic copolymers, exhibit a common dependence on the logarithm of fractional charge. The unique results observed for the synthetic copolymers may be due to the flexibility of their hydrocarbon backbones, in contrast to the relatively rigid hydrophilic backbones of the other polyelectrolytes. The mobilities observed for the DNA charge variants are well predicted by the Manning electrophoresis equation, whereas the mobilities predicted by zeta potential theories are higher. However, mobility ratios calculated from both theories agree with the observed results.

  7. Field and pore size dependence of the electrophoretic mobility of DNA: a combination of fluorescence recovery after photobleaching and electric birefringence measurements.

    PubMed

    Tinland, B; Pernodet, N; Weill, G

    1996-06-01

    By combining an electrophoretic cell with a setup of fluorescence recovery after photobleaching (FRAP) we can measure the electrophoretic mobility mu of double-stranded lambda DNA in agarose gel as a function of electric field E and gel concentration C. Mobility varies linearly with the field in agreement with the biased reptation model with fluctuations. The slopes are analyzed in term of orientation and compared with birefringence results. The mobility extrapolated at zero field follows the prediction of the reptation theory; we deduced the variation of the pore size with the agarose concentration. With a special use of our setup, we measure directly the free-mobility mu 0 of the DNA.

  8. Using electrophoretic mobility shift assays to measure equilibrium dissociation constants: GAL4-p53 binding DNA as a model system.

    PubMed

    Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology.

  9. Electrophoretic mobility of linear and star-branched DNA in semidilute polymer solutions.

    PubMed

    Saha, Sourav; Heuer, Daniel M; Archer, Lynden A

    2006-08-01

    Electrophoresis of large linear T2 (162 kbp) and 3-arm star-branched (N(Arm) = 48.5 kbp) DNA in linear polyacrylamide (LPA) solutions above the overlap concentration c* has been investigated using a fluorescence visualization technique that allows both the conformation and mobility mu of the DNA to be determined. LPA solutions of moderate polydispersity index (PI approximately 1.7-2.1) and variable polymer molecular weight Mw (0.59-2.05 MDa) are used as the sieving media. In unentangled semidilute solutions (c* < c < c(e)), we find that the conformational dynamics of linear and star-branched DNA in electric fields are strikingly different; the former migrating in predominantly U- or I-shaped conformations, depending on electric field strength E, and the latter migrating in a squid-like profile with the star-arms outstretched in the direction opposite to E and dragging the branch point through the sieving medium. Despite these visual differences, mu for linear and star-branched DNA of comparable size are found to be nearly identical in semidilute, unentangled LPA solutions. For LPA concentrations above the entanglement threshold (c > c(e)), the conformation of migrating linear and star-shaped DNA manifest only subtle changes from their unentangled solution features, but mu for the stars decreases strongly with increasing LPA concentration and molecular weight, while mu for linear DNA becomes nearly independent of c and Mw. These findings are discussed in the context of current theories for electrophoresis of large polyelectrolytes.

  10. Sedimentation of macroscopic rigid knots and its relation to gel electrophoretic mobility of DNA knots.

    PubMed

    Weber, Cédric; Carlen, Mathias; Dietler, Giovanni; Rawdon, Eric J; Stasiak, Andrzej

    2013-01-01

    We address the general question of the extent to which the hydrodynamic behaviour of microscopic freely fluctuating objects can be reproduced by macrosopic rigid objects. In particular, we compare the sedimentation speeds of knotted DNA molecules undergoing gel electrophoresis to the sedimentation speeds of rigid stereolithographic models of ideal knots in both water and silicon oil. We find that the sedimentation speeds grow roughly linearly with the average crossing number of the ideal knot configurations, and that the correlation is stronger within classes of knots. This is consistent with previous observations with DNA knots in gel electrophoresis.

  11. Electrophoretic mobilities of erythrocytes in various buffers

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.

  12. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...

  13. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...

  14. Electrophoretic mobility of semi-flexible double-stranded DNA in defect-controlled polymer networks: Mechanism investigation and role of structural parameters.

    PubMed

    Khairulina, Kateryna; Li, Xiang; Nishi, Kengo; Shibayama, Mitsuhiro; Chung, Ung-il; Sakai, Takamasa

    2015-06-21

    Our previous studies have reported an empirical model, which explains the electrophoretic mobility (μ) of double-stranded DNA (dsDNA) as a combination of a basic migration term (Rouse-like or reptation) and entropy loss term in polymer gels with ideal network structure. However, this case is of exception, considering a large amount of heterogeneity in the conventional polymer gels. In this study, we systematically tune the heterogeneity in the polymer gels and study the migration of dsDNA in these gels. Our experimental data well agree with the model found for ideal networks. The basic migration mechanism (Rouse-like or reptation) persists perfectly in the conventional heterogeneous polymer gel system, while the entropy loss term continuously changes with increase in the heterogeneity. Furthermore, we found that in the limit where dsDNA is shorter than dsDNA persistence length, the entropy loss term may be related to the collisional motions between DNA fragments and the cross-links.

  15. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations.

    PubMed

    Wagler, Patrick; Minero, Gabriel Antonio S; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S

    2015-10-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DNA in gel electrophoresis: sequences binding to the immobilized DNA are delayed in their migration. Such a system has been used for example to construct complex DNA filters facilitating DNA computations. However, these gels are formed irreversibly and the choice of immobilized sequences is made once off during fabrication. In this work, we demonstrate the reversible self-assembly of gels combined with amphiphilic DNA molecules, which exhibit hydrophobic hydrocarbon chains attached to the nucleobase. This amphiphilic DNA, which we term lipid-DNA, is synthesized in advance and is blended into a block copolymer gel to induce sequence-dependent DNA retention during electrophoresis. Furthermore, we demonstrate and characterize the programmable mobility shift of matching DNA in such reversible gels both in thin films and microchannels using microelectrode arrays. Such sequence selective separation may be employed to select nucleic acid sequences of similar length from a mixture via local electronics, a basic functionality that can be employed in novel electronic chemical cell designs and other DNA information-processing systems.

  16. Theory for the capillary electrophoretic separation of DNA in polymer solutions.

    PubMed

    Jung, Ho Jin; Bae, Young Chan

    2002-08-23

    We present a mathematical model based on the models of Hubert et al. [Macromolecules 29 (1996) 1006] and Sunada and Blanch [Electrophoresis, 19 (1998) 3128] to describe the electrophoretic mobility of DNA by a transient entanglement coupling mechanism. The proposed model takes into account the interactions between molecules in the capillary and the cross-section of collision between DNA and polymer molecules. The results show that the calculated values agree remarkably well with our electrophoretic mobility data.

  17. Gel electrophoretic mobility of charged particles in a medium with curved channels.

    PubMed

    Fridrikh, S; Gotlib, Y; Belenkij, B

    1997-01-01

    A model of electrophoretic mobility of small charged particles (for example short DNA fragments) in media with curved channels is proposed. The medium is represented by a dense material embedding the curved channels accessible to the charged particles. The steady flow method is used to obtain an analytical expression of the particles' electrophoretic mobility as a function of the channel's shape. The analogy between the statistical properties of the channels and polymer chains (free-jointed and with the persistent mobility mechanism) is used.

  18. Electrophoretic mobility of spherical nanoparticles confined in nanochannels

    NASA Astrophysics Data System (ADS)

    Liu, Yu-Wei; Wynne, Tom; Pennathur, Sumita; Meinhart, Carl

    2013-11-01

    We investigate the mobility of a charged spherical nanoparticle driven by weak electric fields that are confined in nanochannels. Factors affecting mobility include particle zeta potential, electrolyte concentration, and channel size. Classic models for electrophoretic mobility (e.g. Smoluchowski and Huckel) are valid only in the linear regime of small particle zeta potential, and for an unbounded fluid domain. The classical models fail to predict electrophoretic mobility estimated from experiments using ~ 42 nm diameter particles confined in a ~ 100 nm nanochannel. We adopt the asymptotically-expanded formulations of Khair and Squires (Phys. Fluids, 2009), and solve the fully-coupled equations on a well-resolved 3D finite element domain. For a charged 42 nm diameter nanoparticle, confined in a 100 nm high nanochannel, the electrophoretic mobility increases nonlinearly when particle zeta potential is greater than thermal potential kB T / e . When the channel size is decreased from 2.5 um to 100 nm, the mobility is reduced by up to 20%. The result suggests that particle/wall interactions, including overlapping double layers may affect electrophoretic mobility in a non-linear manner.

  19. Reliable electrophoretic mobilities free from Joule heating effects using CE.

    PubMed

    Evenhuis, Christopher J; Hruska, Vlastimil; Guijt, Rosanne M; Macka, Miroslav; Gas, Bohuslav; Marriott, Philip J; Haddad, Paul R

    2007-10-01

    Ionic electrophoretic mobilities determined by means of CE experiments are sometimes different when compared to generally accepted values based on limiting ionic conductance measurements. While the effect of ionic strength on electrophoretic mobility has been long understood, the increase in the mobility that results from Joule heating (the resistive heating that occurs when a current passes through an electrolyte) has been largely overlooked. In this work, a simple method for obtaining reliable and reproducible values of electrophoretic mobility is described. The electrophoretic mobility is measured over a range of driving powers and the extrapolation to zero power dissipation is employed to eliminate the effect of Joule heating. These extrapolated values of electrophoretic mobility can then be used to calculate limiting ionic mobilities by making a correction for ionic strength; this somewhat complicated calculation is conveniently performed by using the freeware program PeakMaster 5. These straightforward procedures improve the agreement between experimentally determined and literature values of limiting ionic mobility by at least one order of magnitude. Using Tris-chromate BGE with a value of conductivity 0.34 S/m and ionic strength 59 mM at a modest dissipated power per unit length of 2.0 W/m, values of mobility for inorganic anions were increased by an average of 12.6% relative to their values free from the effects of Joule heating. These increases were accompanied by a reduction in mobilities due to the ionic strength effect, which was 11% for univalent and 28% for divalent inorganic ions compared to their limiting ionic mobilities. Additionally, it was possible to determine the limiting ionic mobility for a number of aromatic anions by using PeakMaster 5 to perform an ionic strength correction. A major significance of this work is in being able to use CE to obtain reliable and accurate values of electrophoretic mobilities with all its benefits, including

  20. Controlled method of reducing electrophoretic mobility of various substances

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1989-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.

  1. A novel method of measuring electrophoretic mobility of gas bubbles.

    PubMed

    Najafi, Aref Seyyed; Drelich, Jaroslaw; Yeung, Anthony; Xu, Zhenghe; Masliyah, Jacob

    2007-04-15

    Accurate measurement of electrophoretic mobility for gas bubbles is a challenging task as it requires the creation of a desired number of very small air bubbles to ensure negligible rise velocities during the course of the measurement. Here, we report a simple and reliable method for generating stable dispersions of "nano-bubbles." Preparation of such dispersions relies on the nucleation of nano-bubbles in solutions supersaturated with gas. Electrophoretic mobility of these nano-bubbles is determined by the ZetaPALS technique (Brookhaven Instruments) using Uzgiris electrodes coated with palladium. The Smoluchowski limit is assumed in the calculation of zeta potentials. In regard to reproducibility and reliability, this novel method shows a clear advantage over other existing techniques of zeta potential measurement for bubbles.

  2. Method for Single-Cell Mass and Electrophoretic Mobility Measurement

    DTIC Science & Technology

    2010-02-01

    machining of the many custom components that were needed to conduct the research described in this thesis. This work has been funded by the National Cancer ...Characterization of Bacteria by Buoyant Mass and Electrophoretic Mobility 5.1 Introduction Bacterial biofilms , layers of bacterial cells attached to solid...descriptions of the initial adhesion kinetics of biofilm formation. [19, 20] One approach to this problem is to model the dependence of cellular EPM

  3. Electrophoretic mobility of spherical particles in bounded domain.

    PubMed

    Liu, Yu-Wei; Pennathur, Sumita; Meinhart, Carl D

    2016-01-01

    In this study, we improve on our 3D steady-state model of electrophoretic motion of spherical particles in bounded fluidic channels (Liu et al., 2014) to include the effect of nonsymmetric electrolytes, and further validate this improved model with detailed comparisons to experimental data. Specifically, we use the experimentally-measured particle mobilities from the work of Semenov et al. (2013), Napoli et al. (2011), and Wynne et al. (2012) to determine the corresponding particle zeta potentials using our model, and compare these results with classical theory. Incorporating the effects of nonsymmetric electrolytes, EDL polarization, and confinement, we show that our improved model is applicable to a wide range of practical experimental conditions, for example, particles that have high zeta potentials in a bounded channel filled with nonsymmetric electrolyte solutions, where classical theory is not applicable. In addition, we find that when electrolyte concentration is comparable to the concentration of hydronium or hydroxide ions, the complicated composition of ions increases the particle mobility. Finally, increased electrophoretic mobility can be observed when buffer solutions (phosphate or borate) were used as electrolyte solutions in experiments as opposed to simple symmetric electrolytes.

  4. Brownian dynamics simulations of electrophoretic DNA separations in a sparse ordered post array.

    PubMed

    Cho, Jaeseol; Dorfman, Kevin D

    2010-08-20

    We use Brownian dynamics simulations to analyze the electrophoretic separation of lambda-DNA (48.5kbp) and T4-DNA (169kbp) in a hexagonal array of 1microm diameter posts with a 3microm center-to-center distance. The simulation method takes advantage of an efficient interpolation algorithm for the non-uniform electric field to reach an ensemble size (100 molecules) and simulation length scale (1mm) that produces meaningful results for the average electrophoretic mobility and effective diffusion (dispersion) coefficient of these macromolecules as they move through the array. While the simulated electrophoretic mobility for lambda-DNA is close to the experimental data, the simulation underestimates the magnitude of the corresponding dispersion coefficient. The simulations predict baseline resolution in a 15mm device after 7min using an electric field around 30V/cm, with the resolution increasing exponentially as the electric field further decreases. The mobility and dispersivity data point out two essential phenomena that have been overlooked in previous models of DNA electrophoresis in post arrays: the relaxation time between collisions and simultaneous collisions with multiple posts.

  5. Electrophoretic dynamics of self-assembling branched DNA structures

    NASA Astrophysics Data System (ADS)

    Heuer, Daniel Milton

    This study advances our understanding of the electrophoretic dynamics of branched biopolymers and explores technologies designed to exploit their unique properties. New self-assembly techniques were developed to create branched DNA for visualization via fluorescence microscopy. Experiments in fixed gel networks reveal a distinct trapping behavior, in contrast with linear topologies. The finding that detection can be achieved by introducing a branch point contributes significantly to the field of separation science and can be exploited to develop new applications. Results obtained in polymer solutions point to identical mobilities for branched and linear topologies, despite large differences in their dynamics. This finding led to a new description of electrophoresis based on non-Newtonian viscoelastic effects in the electric double layer surrounding a charged object. This new theoretical framework presents a new outlook important not only to the electrophoretic physics of nucleic acids, but all charged objects including proteins, colloids, and nanoparticles. To study the behavior of smaller biopolymers, such as restriction fragments and recombination intermediates, a library of symmetrically branched DNA was synthesized followed by characterization in gels. The experimental results contribute a large body of information relating molecular architecture and the dynamics of rigid structures in an electric field. The findings allow us to create new separation technologies based on topology. These contributions can also be utilized in a number of different applications including the study of recombination intermediates and the separation of proteins according to structure. To demonstrate the importance of these findings, a sequence and mutation detection technique was envisioned and applied for genetic analysis. Restriction fragments from mutation "hotspots" in the p53 tumor suppressor gene, known to play a role in cancer development, were analyzed with this technique

  6. Electrophoretic mobility of cells in a vertical Ficoll gradiant

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Todd, P. W.; Kunze, M. E.; Gaines, R. A.

    1985-01-01

    The upward migration of living cells and test particles under the influence of a constant electric field in a low conductivity Ficoll gradient occurs at nearly constant velocity. Viscosity and neutral polymer concentration affect migration rate. Decreasing viscosity speeds up the particle migration, decreasing neutral polymer (Ficoll) concentration, slows particle migration, since electrophoretic mobility increases approximately linearly with neutral polymer concentration. Neutral polymers interact with the cell surface to effectively raise its zeta potential. An analytic function was developed from the known dependence of these physical variables on migration distance; the analysis expresses migration velocity as an explicit function of position in the density gradient. It predicts an almost linear increase in velocity of about 12 to 16% over the working region of the gradient. It was numerically integrated and correctly predicts cell migration distance vs time curves without the use of any fitted parameters. The resulting migration curves follow the expected slowly varying exponential form that closely resembles a straight line. The ability to determine standard electrophoretic mobilities from such curves depends on knowledge of the effect of Ficoll on the zeta potential of the cell type that is separated.

  7. Interplay between electrophoretic mobility and intrinsic viscosity of polypeptide chains.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, María V

    2012-03-01

    The present work is motivated specifically by the need to find a simple interplay between experimental values of electrophoretic mobility and intrinsic viscosity (IV) of polypeptides. The connection between these two properties, as they are evaluated experimentally in a formulated dilute solution, may provide relevant information concerning the physicochemical characterization and separation of electrically charged chains such as polypeptides. Based on this aspect, a study on the relation between the effective electrophoretic mobility and the IV of the following globular proteins is carried out: bovine carbonic anhydrase, staphylococcal nuclease, human carbonic anhydrase, lysozyme, human serum albumin. The basic interpretation of the IV through polypeptide chain conformations involves two unknowns: one is the Flory characteristic ratio involving short-range intramolecular interactions and the other is the Mark-Houwink exponent associated with large-range intramolecular interactions. Here, it will be shown via basic and well-established electrokinetic theories and scaling concepts that the IV and global chain flexibility of polypeptides in dilute solutions may be estimated from capillary zone electrophoresis, in addition to classical transport properties. The polypeptide local chain flexibility may change due to electrostatic interactions among closer chain ionizing groups and the hindrance effect of their associated structural water.

  8. Microfluidic devices for DNA sequencing: sample preparation and electrophoretic analysis.

    PubMed

    Paegel, Brian M; Blazej, Robert G; Mathies, Richard A

    2003-02-01

    Modern DNA sequencing 'factories' have revolutionized biology by completing the human genome sequence, but in the race to completion we are left with inefficient, cumbersome, and costly macroscale processes and supporting facilities. During the same period, microfabricated DNA sequencing, sample processing and analysis devices have advanced rapidly toward the goal of a 'sequencing lab-on-a-chip'. Integrated microfluidic processing dramatically reduces analysis time and reagent consumption, and eliminates costly and unreliable macroscale robotics and laboratory apparatus. A microfabricated device for high-throughput DNA sequencing that couples clone isolation, template amplification, Sanger extension, purification, and electrophoretic analysis in a single microfluidic circuit is now attainable.

  9. Relationship between electrophoretic mobility of erythrocytes and blood erythrocyte count in rats.

    PubMed

    Matyushichev, V B; Shamratova, V G

    2005-03-01

    A significant curvilinear relationship was found between erythrocyte count in rat blood and electrokinetic characteristics of these cells. Electrophoretic mobility of erythrocytes remained unchanged, slightly increased, or decreased with increasing cell count in the vascular bed depending on animal state. Excessive increase in the number of erythrocytes was accompanied by accumulation of cells with low electrophoretic mobility in the electric field.

  10. Electrophoretic mobility patterns of collagen following laser welding

    NASA Astrophysics Data System (ADS)

    Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.

    1991-06-01

    Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.

  11. Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.

    1985-01-01

    A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

  12. Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.

  13. Enhanced electrophoretic DNA separation in photonic crystal fiber.

    PubMed

    Sun, Yi; Nguyen, Nam-Trung; Kwok, Yien Chian

    2009-07-01

    Joule heating generated by the electrical current in capillary electrophoresis leads to a temperature gradient along the separation channel and consequently affects the separation quality. We describe a method of reducing the Joule heating effect by incorporating photonic crystal fiber into a micro capillary electrophoresis chip. The photonic crystal fiber consists of a bundle of extremely narrow hollow channels, which ideally work as separation columns. Electrophoretic separation of DNA fragments was simultaneously but independently carried out in 54 narrow capillaries with a diameter of 3.7 microm each. The capillary bundle offers more efficient heat dissipation owing to the high surface-to-volume ratio. Under the same electrical field strength, notable improvement in resolution was obtained in the capillary bundle chip.

  14. Effective electrophoretic mobilities and charges of anti-VEGF proteins determined by capillary zone electrophoresis.

    PubMed

    Li, S Kevin; Liddell, Mark R; Wen, He

    2011-06-01

    Macromolecules such as therapeutic proteins currently serve an important role in the treatment of eye diseases such as wet age-related macular degeneration and diabetic retinopathy. Particularly, bevacizumab and ranibizumab have been shown to be effective in the treatment of these diseases. Iontophoresis can be employed to enhance ocular delivery of these macromolecules, but the lack of information on the properties of these macromolecules has hindered its development. The objectives of the present study were to determine the effective electrophoretic mobilities and charges of bevacizumab, ranibizumab, and model compound polystyrene sulfonate (PSS) using capillary zone electrophoresis. Salicylate, lidocaine, and bovine serum albumin (BSA), which have known electrophoretic mobilities in the literature, were also studied to validate the present technique. The hydrodynamic radii and diffusion coefficients of BSA, bevacizumab, ranibizumab, and PSS were measured by dynamic light scattering. The effective charges were calculated using the Einstein relation between diffusion coefficient and electrophoretic mobility and the Henry equation. The results show that bevacizumab and ranibizumab have low electrophoretic mobilities and are net negatively charged in phosphate buffered saline (PBS) of pH 7.4 and 0.16M ionic strength. PSS has high negative charge but the electrophoretic mobility in PBS is lower than that expected from the polymer structure. The present study demonstrated that capillary electrophoresis could be used to characterize the mobility and charge properties of drug candidates in the development of iontophoretic drug delivery.

  15. Effective Electrophoretic Mobilities and Charges of Anti-VEGF Proteins Determined by Capillary Zone Electrophoresis

    PubMed Central

    Li, S. Kevin; Liddell, Mark R.; Wen, He

    2011-01-01

    Macromolecules such as therapeutic proteins currently serve an important role in the treatment of eye diseases such as wet age-related macular degeneration and diabetic retinopathy. Particularly, bevacizumab and ranibizumab have been shown to be effective in the treatment of these diseases. Iontophoresis can be employed to enhance ocular delivery of these macromolecules, but the lack of information on the properties of these macromolecules has hindered its development. The objectives of the present study were to determine the effective electrophoretic mobilities and charges of bevacizumab, ranibizumab, and model compound polystyrene sulfonate (PSS) using capillary zone electrophoresis. Salicylate, lidocaine, and bovine serum albumin (BSA), which have known electrophoretic mobilities in the literature, were also studied to validate the present technique. The hydrodynamic radii and diffusion coefficients of BSA, bevacizumab, ranibizumab, and PSS were measured by dynamic light scattering. The effective charges were calculated using the Einstein relation between diffusion coefficient and electrophoretic mobility and the Henry equation. The results show that bevacizumab and ranibizumab have low electrophoretic mobilities and are net negatively charged in phosphate buffered saline (PBS) of pH 7.4 and 0.16 M ionic strength. PSS has high negative charge but the electrophoretic mobility in PBS is lower than that expected from the polymer structure. The present study demonstrated that capillary electrophoresis could be used to characterize the mobility and charge properties of drug candidates in the development of iontophoretic drug delivery. PMID:21269789

  16. An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

    PubMed

    Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen

    2016-11-29

    Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2(G73E) protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2(G73E) proteins) as a biological example.

  17. Electrophoretic transfer of DNA, RNA and protein onto diazobenzyloxymethyl (DBM) - paper.

    PubMed Central

    Stellwag, E J; Dahlberg, A E

    1980-01-01

    A method has been developed for the electrophoretic transfer of DNA, RNA, protein and ribonucleoprotein particles from a variety of gels onto diazobenzyloxymethyl (DBM) - paper. Conditions for the electrophoretic transfer of these macromolecules have been optimized to allow for nearly quantitative transfer and covalent coupling. DNA and RNA electrophoretically transferred to DBM-paper retain their ability to hybridize with specific probes. The high efficiency of transfer and the high capacity of DBM-paper for nucleic acids makes possible the sensitive detection of specific nucleotide sequences. Similar efficiency is achieved in electrophoretic transfer and covalent coupling of proteins to DBM-paper. Macromolecules can also be electrophoretically transferred and bound to DBM-paper incapable of covalent bond formation. Their elution from the paper in high salt provides a new and useful preparative method for isolation of DNA, RNA and protein. Images PMID:6158735

  18. A DC electrophoresis method for determining electrophoretic mobility through the pressure driven negation of electro osmosis

    NASA Astrophysics Data System (ADS)

    Karam, Pascal; Pennathur, Sumita

    2016-11-01

    Characterization of the electrophoretic mobility and zeta potential of micro and nanoparticles is important for assessing properties such as stability, charge and size. In electrophoretic techniques for such characterization, the bulk fluid motion due to the interaction between the fluid and the charged surface must be accounted for. Unlike current industrial systems which rely on DLS and oscillating potentials to mitigate electroosmotic flow (EOF), we propose a simple alternative electrophoretic method for optically determining electrophoretic mobility using a DC electric fields. Specifically, we create a system where an adverse pressure gradient counters EOF, and design the geometry of the channel so that the flow profile of the pressure driven flow matches that of the EOF in large regions of the channel (ie. where we observe particle flow). Our specific COMSOL-optimized geometry is two large cross sectional areas adjacent to a central, high aspect ratio channel. We show that this effectively removes EOF from a large region of the channel and allows for the accurate optical characterization of electrophoretic particle mobility, no matter the wall charge or particle size.

  19. Characterization of the Cell Surface Properties of Drinking Water Pathogens by Microbial Adhesion to Hydrocarbon and Electrophoretic Mobility Measurements

    EPA Science Inventory

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...

  20. ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS

    EPA Science Inventory

    The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...

  1. Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1992-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.

  2. Size and DNA distributions of electrophoretically separated cultured human kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Todd, P. W.

    1985-01-01

    Electrophoretic purification of purifying cultured cells according to function presumes that the size of cycle phase of a cell is not an overriding determinant of its electrophoretic velocity in an electrophoretic separator. The size distributions and DNA distributions of fractions of cells purified by density gradient electrophoresis were determined. No systematic dependence of electrophoretic migration upward in a density gradient column upon either size or DNA content were found. It was found that human leukemia cell populations, which are more uniform function and found in all phases of the cell cycle during exponential growth, separated on a vertical sensity gradient electrophoresis column according to their size, which is shown to be strictly cell cycle dependent.

  3. Computer-controlled pulsed magnetic field gradient NMR system for electrophoretic mobility measurements

    NASA Astrophysics Data System (ADS)

    Saarinen, Timothy R.; Woodward, W. Stephen

    1988-05-01

    A computer-controlled pulsed magnetic field gradient NMR (PFGNMR) system for making electrophoretic mobility and diffusion measurements is described. Emphasis is placed on the design and capabilities of the gradient and electrophoretic pulse generators. Various pulse sequences can be applied by the programmable gradient generator that can produce 0- to 10-A current pulses for 0 to 13 ms and continuous currents from 0 to 50 mA. The pulse areas are reproducible to within approximately 1 ppm. A pair of opposed Helmholtz coils in the probe create linear magnetic field gradients during the current pulses. Electric fields are applied across a U-tube electrophoretic cell by a 550-V constant current generator.

  4. Electrophoretic mobility of silica particles in a mixture of toluene and ethanol at different particle concentrations.

    PubMed

    Medrano, M; Pérez, A T; Lobry, L; Peters, F

    2009-10-20

    In this paper we present measurements of the electrophoretic mobility of colloidal particles by using heterodyne detection of light scattering. The measurements have been made up to concentrations of 5.4% silica nanoparticles, with a diameter on the order of 80 nm, in a mixture of 70% toluene and 30% ethanol. To make possible the measurements at these concentrations, the liquid mixture is chosen so as to match the index of refraction of the particles, thus resulting in a transparent suspension.

  5. Electrophoretic Mobilities of Escherichia coli O157:H7 and Wild-Type Escherichia coli Strains

    PubMed Central

    Lytle, Darren A.; Rice, Eugene W.; Johnson, Clifford H.; Fox, Kim R.

    1999-01-01

    The electrophoretic mobilities (EPMs) of a number of Escherichia coli O157:H7 and wild-type E. coli strains were measured. The effects of pH and ionic strength on the EPMs were investigated. The EPMs of E. coli O157:H7 strains differed from those of wild-type strains. As the suspension pH decreased, the EPMs of both types of strains increased. PMID:10388724

  6. The 'Densitometric Image Analysis Software' and its application to determine stepwise equilibrium constants from electrophoretic mobility shift assays.

    PubMed

    van Oeffelen, Liesbeth; Peeters, Eveline; Nguyen Le Minh, Phu; Charlier, Daniël

    2014-01-01

    Current software applications for densitometric analysis, such as ImageJ, QuantityOne (BioRad) and the Intelligent or Advanced Quantifier (Bio Image) do not allow to take the non-linearity of autoradiographic films into account during calibration. As a consequence, quantification of autoradiographs is often regarded as problematic, and phosphorimaging is the preferred alternative. However, the non-linear behaviour of autoradiographs can be described mathematically, so it can be accounted for. Therefore, the 'Densitometric Image Analysis Software' has been developed, which allows to quantify electrophoretic bands in autoradiographs, as well as in gels and phosphorimages, while providing optimized band selection support to the user. Moreover, the program can determine protein-DNA binding constants from Electrophoretic Mobility Shift Assays (EMSAs). For this purpose, the software calculates a chosen stepwise equilibrium constant for each migration lane within the EMSA, and estimates the errors due to non-uniformity of the background noise, smear caused by complex dissociation or denaturation of double-stranded DNA, and technical errors such as pipetting inaccuracies. Thereby, the program helps the user to optimize experimental parameters and to choose the best lanes for estimating an average equilibrium constant. This process can reduce the inaccuracy of equilibrium constants from the usual factor of 2 to about 20%, which is particularly useful when determining position weight matrices and cooperative binding constants to predict genomic binding sites. The MATLAB source code, platform-dependent software and installation instructions are available via the website http://micr.vub.ac.be.

  7. Electrophoretic Mobility Study of the Adsorption of Alkyl Xanthate Ions on Galena and Sphalerite.

    PubMed

    Song, S.; Lopez-Valdivieso, A.; Ojeda-Escamilla, M. C.

    2001-05-01

    The adsorption of ethyl and amyl xanthate ions on galena and sphalerite fines has been studied using electrophoretic light-scattering (ELS) measurements. It was performed on galena and sphalerite (<2&mgr;m) in aqueous solution at different potassium ethyl xanthate (PEX) and potassium amyl xanthate (PAX) concentrations. It has been observed that the presence of PEX or PAX caused the isoelectric points (IEP) of galena and sphalerite fines to shift and the electrophoretic mobility to reverse in sign, indicating that the xanthate ions chemisorbed on galena and sphalerite surfaces. This adsorption markedly broadened the electrophoretic mobility distribution of the mineral fines, suggesting that the populations of the particles have quite different adsorption densities of xanthate ions, and therefore the particle hydrophobicity was different. This phenomenon might be attributable to the effect of the hemimicelle adsorption of the xanthate ions on the minerals, the nonuniform distribution of active sites and their degree of activity, the effect of particle size and shape, etc. The nonuniform adsorption has been found to increase with increasing PEX or PAX concentration, reaching a maximum at a medium concentration followed by a decline. Also, experimental results have demonstrated that the nonuniform adsorption of the xanthate ions is much stronger on sphalerite than on galena, which may explain why sphalerite has a worse flotation response than galena when alkyl xanthates are used as collectors in flotation systems. Copyright 2001 Academic Press.

  8. Assessing 2D electrophoretic mobility spectroscopy (2D MOSY) for analytical applications.

    PubMed

    Fang, Yuan; Yushmanov, Pavel V; Furó, István

    2016-12-08

    Electrophoretic displacement of charged entity phase modulates the spectrum acquired in electrophoretic NMR experiments, and this modulation can be presented via 2D FT as 2D mobility spectroscopy (MOSY) spectra. We compare in various mixed solutions the chemical selectivity provided by 2D MOSY spectra with that provided by 2D diffusion-ordered spectroscopy (DOSY) spectra and demonstrate, under the conditions explored, a superior performance of the former method. 2D MOSY compares also favourably with closely related LC-NMR methods. The shape of 2D MOSY spectra in complex mixtures is strongly modulated by the pH of the sample, a feature that has potential for areas such as in drug discovery and metabolomics. Copyright © 2016 The Authors. Magnetic Resonance in Chemistry published by John Wiley & Sons Ltd. StartCopTextCopyright © 2016 The Authors. Magnetic Resonance in Chemistry published by John Wiley & Sons Ltd.

  9. High-Throughput Electrophoretic Mobility Shift Assays for Quantitative Analysis of Molecular Binding Reactions

    PubMed Central

    2015-01-01

    We describe a platform for high-throughput electrophoretic mobility shift assays (EMSAs) for identification and characterization of molecular binding reactions. A photopatterned free-standing polyacrylamide gel array comprised of 8 mm-scale polyacrylamide gel strips acts as a chassis for 96 concurrent EMSAs. The high-throughput EMSAs was employed to assess binding of the Vc2 cyclic-di-GMP riboswitch to its ligand. In optimizing the riboswitch EMSAs on the free-standing polyacrylamide gel array, three design considerations were made: minimizing sample injection dispersion, mitigating evaporation from the open free-standing polyacrylamide gel structures during electrophoresis, and controlling unit-to-unit variation across the large-format free-standing polyacrylamide gel array. Optimized electrophoretic mobility shift conditions allowed for 10% difference in mobility shift baseline resolution within 3 min. The powerful 96-plex EMSAs increased the throughput to ∼10 data/min, notably more efficient than either conventional slab EMSAs (∼0.01 data/min) or even microchannel based microfluidic EMSAs (∼0.3 data/min). The free-standing polyacrylamide gel EMSAs yielded reliable quantification of molecular binding and associated mobility shifts for a riboswitch–ligand interaction, thus demonstrating a screening assay platform suitable for riboswitches and potentially a wide range of RNA and other macromolecular targets. PMID:25233437

  10. Passive trapping of rigid rods due to conformation-dependent electrophoretic mobility.

    PubMed

    Pandey, Harsh; Szafran, Sylvia A; Underhill, Patrick T

    2016-03-28

    We present computer simulations of a rigid rod in a combination of an extensional fluid flow and extensional electric field. The electrophoretic mobility of the rod is different parallel or perpendicular to the rod. The dependence of the mobility on the conformation (orientation) leads to a new phenomenon where the rods can be passively trapped in all directions at the stagnation point. This contrasts with the behavior in either fluid flow or electric field alone, in which an object can be pushed towards the stagnation point along some directions but is pushed away in others. We have determined the state space where trapping occurs and have developed a model that describes the strength of trapping when it does occur. This new phenomenon could be used in the future to separate objects based on a coupling between their mobility and ability to be oriented.

  11. Electrophoretic mobility of a growing cell studied by photonic force microscope

    NASA Astrophysics Data System (ADS)

    Tonin, Mario; Bálint, Stefan; Mestres, Pau; Martınez, Ignacio A.; Petrov, Dmitri

    2010-11-01

    Living cells have spatially localized charged groups such as nucleus, cell walls, and others that can move in an external electric field providing the cell electrophoretic mobility (EPM). We suggest to monitor the EPM of a single living cell during its growth using optical tweezers combined with a position detector. As an example, we studied the EPM during the yeast growth, and we observed a nonmonotonic behavior of the EPM during the cell cycle, such as that the maximal EPM was observed at the initial stage of the growth, strongly reducing when the cell cycle is near its final stage.

  12. The Electrophoretic Mobility of a Polyelectrolyte within a Radially Confining Potential Well

    NASA Astrophysics Data System (ADS)

    Shendruk, Tyler; Bertrand, Martin; Slater, Gary W.

    2013-03-01

    We demonstrate that a polyelectrolyte electrophoresing while radially confined by a mechanical force has a conformationally dependent electrophoretic mobility that differs from its free-draining value. The mobility increases as a function of the confining harmonic potential and in the absence of solid walls. Mesoscale MPCD-MD hybrid simulations that include electro-hydrodynamics through a mean-field Debye Hückel approximation will be presented for a variety of well widths and contour lengths, demonstrating that mobility increases with confinement after a critical point but remains independent of polymerization. For this reason, models based on a change of monomer friction coefficient at the confinement boundary (such as those recently put forward to explain experimentally measured mobility polyelectrolytes confined within nano- and microfluidic channels) are not sufficient to explain our observations. Since the potential acts perpendicular to the electric field and only on the monomers, the Electro-Hydrodynamic Equivalence Principle does not predict the mobility to differ. We present a course-grained theory explaining these findings in terms of hydrodynamic coupling within overlapping diffuse layers.

  13. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates.

    PubMed

    Wang, Min S; Reed, Scott M

    2012-01-01

    Here, we demonstrate that aptamers tethered to gold nanoparticles enable direct visualization of protein-oligonucleotide interactions during gel electrophoresis. This technique is used to confirm that an aptamer previously identified as binding to C-reactive protein (CRP) only binds to the monomeric form of CRP. While native, pentameric CRP (pCRP) is used in clinical assays to predict cardiovascular disease (CVD) risk, it is the monomeric isoform that is more strongly associated with pro-inflammatory and pro-atherogenic effects. To visualize this selectivity, the CRP-aptamer was conjugated to streptavidin-coated gold nanoparticles and the mobility of the free oligonucleotide-nanoparticle conjugate (ON-NP) and the protein/ON-NP complex bands were visualized and recorded during electrophoresis using a simple digital camera. At a concentration of 6 μg/mL, monomeric CRP showed a significant decrease in the observed ON-NP mobility, whereas no change in mobility was observed with pCRP up to 18 μg/mL. Advantages of this nanoparticle-based electrophoretic mobility shift assay (NP-EMSA) over the traditional EMSA include real-time detection of protein-oligonucleotide interactions, the avoidance of harmful radioisotopes, and elimination of the need for expensive gel imagers. The availability of both the NP-EMSA technique and an mCRP-specific probe will allow for improved clinical diagnostic to more accurately predict future CVD risk.

  14. Electrophoretic chip for high-fidelity fractionation of double-stranded DNA.

    PubMed

    Sun, Kai; Li, Zheyu; Ueno, Kosei; Juodkazis, Saulius; Noji, Sumihare; Misawa, Hiroaki

    2007-05-01

    We report the high fidelity, on-chip fractionation of selected segments from an electrophoretic flow of separated fragments. dsDNA fragments (10-330 base pairs (bp)) were initially separated using a 6.5 cm long channel with an electric field strength of 150 V/cm. As an example of the fractionation process, a target fragment of 20 bp was selected and extracted from the separation channel. The extraction was confirmed and evaluated by fluorescence imaging. High resolution and extraction fidelity were achieved by introducing new procedures for (i) extraction channel-blocking and (ii) segment transfer with cleaning. These procedures are necessary for the development of a practical, fully automated multitarget fractionation electrophoretic chip. A kind of CCD image processing method was introduced to monitor, control, and evaluate the procedure of fractionation. The resolution limits of the separation and extraction are discussed.

  15. DNA mobility modifier

    DOEpatents

    Barron, Annelise

    2002-01-01

    Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.

  16. A substrate-optimized electrophoretic mobility shift assay for ADAM12.

    PubMed

    Kotzsch, Alexander; Skovgaard, Tine; Buus, Uwe; Andersen, Simon; Devkota, Kanchan; Berthelsen, Jens

    2014-05-01

    ADAM12 belongs to the A disintegrin and metalloprotease (ADAM) family of secreted sheddases activating extracellular growth factors such as epidermal growth factor receptor (EGFR) ligands and tumor necrosis factor-alpha (TNF-α). ADAM proteases, most notably ADAM17 (TNF-α-converting enzyme), have long been investigated as pharmaceutical drug targets; however, due to lack of potency and in vivo side effects, none of the small-molecule inhibitors discovered so far has made it beyond clinical testing. Ongoing research on novel selective inhibitors of ADAMs requires reliable biochemical assays to validate molecular probes from large-scale screening efforts. Here we describe an electrophoretic mobility shift assay for ADAM12 based on the identification of an optimized peptide substrate that is characterized by excellent performance and reproducibility.

  17. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    EPA Science Inventory

    Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...

  18. Autophosphorylation, electrophoretic mobility and immunoreaction of oat phototropin 1 under UV and blue Light.

    PubMed

    Knieb, Elke; Salomon, Michael; Rüdiger, Wolfhart

    2005-01-01

    Phototropins are UV-A/blue light photoreceptors containing two flavin mononucleotide (FMN)-binding domains, light, oxygen and voltage (LOV)1 and LOV2, of which LOV2 is more sensitive toward light and more important for the physiological response compared with LOV1. Some physiological responses are plant phototropism, chloroplast migration and stomatal opening. Oat phototropin 1 together with light-dependent autophosphorylation shows a reduced electrophoretic mobility and reduced immunoreaction against a heterologous antiserum; both effects were suggested to be caused by phosphorylation at the same sites (M. Salomon, E. Knieb, T. von Zeppelin and W. Rudiger [2003] Biochemistry 42, 4217-4225). In this study, we show that both effects can be separated from each other: at low temperature, reduced immunoreaction preceded the mobility shift, and irradiation with UV-C light led to the mobility shift without the loss of immunoreactivity. We demonstrated that UV-C light at 280 nm, which does not match any absorption maximum of FMN, leads to autophosphorylation of phototropin. It is hypothesized that UV-C light causes differential activation of the LOV domains via energy transfer from aromatic amino acids.

  19. Measurements of the electrophoretic mobility with a new laser Doppler cytopherometer (Lazypher) and critical evaluation of the Electrophorese Mobility Test (EMT)

    NASA Astrophysics Data System (ADS)

    Hoffmann, W.

    1982-01-01

    The new developed Laser Doppler Cytopherometer (Lazypher) allows the exact and objective measurement of the electrophoretic mobility of particles. Comparative experiments with the Free Flow Cell Electrophoresis instrument of Hannig showed identical results. The impression that the electrophoretic Mobility Test is not valid for cancer diagnosis has been substantiated. But in its present form with the new instrument (Lazypher) possible improvements, e.g. isolation of lymphocytes, purification of ""antigens'' or indicator particles, can be estimated objectively for their value for the test system.

  20. Assessment of Carbon- and Metal-Based Nanoparticle DNA Damage with Microfluidic Electrophoretic Separation Technology.

    PubMed

    Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M

    2015-02-01

    In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.

  1. Measurement of the position-dependent electrophoretic force on DNA in a glass nanocapillary.

    PubMed

    Bulushev, Roman D; Steinbock, Lorenz J; Khlybov, Sergey; Steinbock, Julian F; Keyser, Ulrich F; Radenovic, Aleksandra

    2014-11-12

    The electrophoretic force on a single DNA molecule inside a glass nanocapillary depends on the opening size and varies with the distance along the symmetrical axis of the nanocapillary. Using optical tweezers and DNA-coated beads, we measured the stalling forces and mapped the position-dependent force profiles acting on DNA inside nanocapillaries of different sizes. We showed that the stalling force is higher in nanocapillaries of smaller diameters. The position-dependent force profiles strongly depend on the size of the nanocapillary opening, and for openings smaller than 20 nm, the profiles resemble the behavior observed in solid-state nanopores. To characterize the position-dependent force profiles in nanocapillaries of different sizes, we used a model that combines information from both analytical approximations and numerical calculations.

  2. Electrophoretic and field-effect graphene for all-electrical DNA array technology.

    PubMed

    Xu, Guangyu; Abbott, Jeffrey; Qin, Ling; Yeung, Kitty Y M; Song, Yi; Yoon, Hosang; Kong, Jing; Ham, Donhee

    2014-09-05

    Field-effect transistor biomolecular sensors based on low-dimensional nanomaterials boast sensitivity, label-free operation and chip-scale construction. Chemical vapour deposition graphene is especially well suited for multiplexed electronic DNA array applications, since its large two-dimensional morphology readily lends itself to top-down fabrication of transistor arrays. Nonetheless, graphene field-effect transistor DNA sensors have been studied mainly at single-device level. Here we create, from chemical vapour deposition graphene, field-effect transistor arrays with two features representing steps towards multiplexed DNA arrays. First, a robust array yield--seven out of eight transistors--is achieved with a 100-fM sensitivity, on par with optical DNA microarrays and at least 10 times higher than prior chemical vapour deposition graphene transistor DNA sensors. Second, each graphene acts as an electrophoretic electrode for site-specific probe DNA immobilization, and performs subsequent site-specific detection of target DNA as a field-effect transistor. The use of graphene as both electrode and transistor suggests a path towards all-electrical multiplexed graphene DNA arrays.

  3. Simulation of electrophoretic stretching of DNA in a microcontraction using an obstacle array for conformational preconditioning

    PubMed Central

    Trahan, Daniel W.; Doyle, Patrick S.

    2009-01-01

    Recently our group has reported experiments using an obstacle array to precondition the conformations of DNA molecules to facilitate their stretch in a microcontraction. Based upon previous successes simulating electrophoretic stretching in microcontractions without obstacles, we use our simulation model to study the deformation of DNA chains in a microcontraction preceded by an array of cylindrical obstacles. We compare our data to the experimental results and find good qualitative, and even quantitative, agreement concerning the behavior of the chains in the array; however, the simulations overpredict the mean stretch of the chains as they leave the contraction. We examine the amount of stretch gained between leaving the array and reaching the end of the contraction and speculate that the differences seen are caused by nonlinear electrokinetic effects that become important in the contraction due to a combination of field gradients and high field strengths. PMID:19693392

  4. Rapid agarose gel electrophoretic mobility shift assay for quantitating protein: RNA interactions.

    PubMed

    Ream, Jennifer A; Lewis, L Kevin; Lewis, Karen A

    2016-10-15

    Interactions between proteins and nucleic acids are frequently analyzed using electrophoretic mobility shift assays (EMSAs). This technique separates bound protein:nucleic acid complexes from free nucleic acids by electrophoresis, most commonly using polyacrylamide gels. The current study utilizes recent advances in agarose gel electrophoresis technology to develop a new EMSA protocol that is simpler and faster than traditional polyacrylamide methods. Agarose gels are normally run at low voltages (∼10 V/cm) to minimize heating and gel artifacts. In this study we demonstrate that EMSAs performed using agarose gels can be run at high voltages (≥20 V/cm) with 0.5 × TB (Tris-borate) buffer, allowing for short run times while simultaneously yielding high band resolution. Several parameters affecting band and image quality were optimized for the procedure, including gel thickness, agarose percentage, and applied voltage. Association of the siRNA-binding protein p19 with its target RNA was investigated using the new system. The agarose gel and conventional polyacrylamide gel methods generated similar apparent binding constants in side-by-side experiments. A particular advantage of the new approach described here is that the short run times (5-10 min) reduce opportunities for dissociation of bound complexes, an important concern in non-equilibrium nucleic acid binding experiments.

  5. Determination of electrokinetic and hydrodynamic parameters of proteins by modeling their electrophoretic mobilities through the electrically charged spherical soft particle.

    PubMed

    Deiber, Julio A; Piaggio, María V; Peirotti, Marta B

    2013-03-01

    This work explores the possibility of using the electrically charged "spherical soft particle" (SSP) to model the electrophoretic mobility of proteins in the low charge regime. The general framework concerning the electrophoretic mobility of the SSP already presented in the literature is analyzed and discussed here in particular for polyampholyte-polypeptide chains. In this regard, this theory is applied to BSA for different protocol pH values. The physicochemical conditions required to model proteins as SSP from their experimentally determined electrophoretic mobilities are established. In particular, the protein charge regulation phenomenon and the SSP particle core are included to study BSA having isoelectric point pI ≈ 5.71, within a wide range of bulk pH values. The results of this case study are compared with previous ones concerning the spherical porous particle and the spherical hard particle with occluded water. A discussion of chain conformations in the SSP polyampholyte layer is presented through estimations of the packing and friction fractal dimensions.

  6. Determination of electrokinetic and hydrodynamic parameters of proteins by modeling their electrophoretic mobilities through the electrically charged spherical porous particle.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2013-03-01

    This work explores the possibility of using the electrically charged "spherical porous particle" (SPP) to model the electrophoretic mobility of proteins in the low charge regime. In this regard, the electrophoretic mobility expression of the charged SPP (Hermans-Fujita model) is used and applied here to BSA and staphylococcal nuclease for different protocol pH values. The SPP is presented within the general framework of the "spherical soft particle" as described in the literature. The physicochemical conditions required to model proteins as SPP from their experimentally determined electrophoretic mobilities are established. It is shown that particle permeability and porosity and chain packing and friction fractal dimensions are relevant structural properties of proteins when hydrodynamic interaction between amino acid residues is present. The charge regulation phenomenon of BSA and staphylococcal nuclease with pIs ≈ 5.71 and 9.63, respectively, is described through the SPP within a wide range of bulk pH values. These case studies illustrate when the average regulating {pH} of the protein domain is lower and higher than the protocol pH. Further research for using the general spherical soft particle is also proposed on the basis of results and main conclusions.

  7. Easy measurement and analysis method of zeta potential and electrophoretic mobility of water-dispersed colloidal particles by using a self-mixing solid-state laser

    NASA Astrophysics Data System (ADS)

    Sudo, S.; Ohtomo, T.; Otsuka, K.

    2013-08-01

    We describe a highly sensitive method of measuring electrophoretic mobility and zeta potential of water-dispersed colloidal particles by using a self-mixing laser Doppler velocimeter with a laser-diode-pumped, thin-slice solid-state laser with extremely high optical sensitivity. The power spectra of laser output modulated by reinjected laser light scattered by the electrophoretic particles were observed. The power spectrum cannot be described by the well-known formula for translational motion or flowing Brownian motion, i.e., a combination of Doppler shift, diffusion, and translation. The power spectra shape is found to reflect the velocity distribution of electrophoretic particles in a capillary tube due to the electro-osmotic flow contribution. Not only evaluation of the electrophoretic mobility and zeta potential but also the particle diameter undergoing electrophoretic motion can be performed from the shape of the power spectrum.

  8. Liquid phase separation of proteins based on electrophoretic effects in an electrospray setup during sample introduction into a gas-phase electrophoretic mobility molecular analyzer (CE-GEMMA/CE-ES-DMA).

    PubMed

    Weiss, Victor U; Kerul, Lukas; Kallinger, Peter; Szymanski, Wladyslaw W; Marchetti-Deschmann, Martina; Allmaier, Günter

    2014-09-02

    Nanoparticle characterization is gaining importance in food technology, biotechnology, medicine, and pharmaceutical industry. An instrument to determine particle electrophoretic mobility (EM) diameters in the single-digit to double-digit nanometer range receiving increased attention is the gas-phase electrophoretic mobility molecular analyzer (GEMMA) separating electrophoretically single charged analytes in the gas-phase at ambient pressure. A fused-silica capillary is used for analyte transfer to the gas-phase by means of a nano electrospray (ES) unit. The potential of this capillary to separate analytes electrophoretically in the liquid phase due to different mobilities is, at measurement conditions recommended by the manufacturer, eliminated due to elevated pressure applied for sample introduction. Measurements are carried out upon constant feeding of analytes to the system. Under these conditions, aggregate formation is observed for samples including high amounts of non-volatile components or complex samples. This makes the EM determination of individual species sometimes difficult, if not impossible. With the current study we demonstrate that liquid phase electrophoretic separation of proteins (as exemplary analytes) occurs in the capillary (capillary zone electrophoresis, CE) of the nano ES unit of the GEMMA. This finding was consecutively applied for on-line desalting allowing EM diameter determination of analytes despite a high salt concentration within samples. The present study is to our knowledge the first report on the use of the GEMMA to determine EM diameters of analytes solubilized in the ES incompatible electrolyte solutions by the intended use of electrophoresis (in the liquid phase) during sample delivery. Results demonstrate the proof of concept of such an approach and additionally illustrate the high potential of a future on-line coupling of a capillary electrophoresis to a GEMMA instrument.

  9. Separation of very hydrophobic analytes by micellar electrokinetic chromatography IV. Modeling of the effective electrophoretic mobility from carbon number equivalents and octanol-water partition coefficients.

    PubMed

    Huhn, Carolin; Pyell, Ute

    2008-07-11

    It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.

  10. Determination of electrolyte friction from measurements of the tracer diffusion coefficients, mutual diffusion coefficients, and electrophoretic mobilities of charged spheres

    NASA Astrophysics Data System (ADS)

    Gorti, Sridhar; Plank, Lindsay; Ware, B. R.

    1984-07-01

    The technique of fluorescence recovery after photobleaching has been used to measure the tracer diffusion coefficient of fluorescein-labeled charged polystyrene spheres in dilute solutions as a function of solution ionic strength. As the ratio of the particle radius (a) to the Debye-Hückel screening length (κ-1) was varied from 13 to 0.6, a 20% reduction in tracer diffusion coefficient was observed. The mutual diffusion coefficient, measured by quasielastic light scattering, increased as κa was reduced, demonstrating the dominant effect of thermodynamic factors on this parameter. The tracer data have been compared with theoretical predictions of other workers describing the influence of small-ion interactions with a charge sphere on its translational friction. The theoretical results of Schurr, and Booth, involve an explicit dependence on the electrokinetic charge of the sphere and yield estimates of this parameter (by least squares) which are significantly smaller than those obtained from laser Doppler electrophoretic light scattering results for the electrophoretic mobility of the labeled spheres. Approximations in the theoretical analyses are expected to account for these discrepancies.

  11. Affinity Capillary Electrophoresis for Selective Control of Electrophoretic Mobility of Sialic Acid Using Lanthanide-Hexadentate Macrocyclic Polyazacarboxylate Complexes.

    PubMed

    Goto, Daiki; Ouchi, Kazuki; Shibukawa, Masami; Saito, Shingo

    2015-01-01

    It is difficult to control the electrophoretic mobility in order to obtain high resolution among saccharides in complex samples. We report herein on a new affinity capillary electrophoresis (ACE) method for an anionic monosaccharide, N-acetylneuraminic acid (Neu5Ac), which is important in terms of pathological diagnosis, using lanthanide-hexadentate macrocyclic polyazacarboxylate complexes (Ln-NOTA) as affinity reagents. It was shown that Ln-NOTA complexes increased the anionic mobility of Neu5Ac by approximately 40% through selective complexation with Neu5Ac. The extent of change in the mobility strongly depended on the type of central metal ion of Ln-NOTA. The stability constant (K) of Lu-NOTA with Neu5Ac was determined by ACE to be log Kb = 3.62 ± 0.04, which is the highest value among artificial receptors for Neu5Ac reported so far. Using this ACE, the Neu5Ac content in a glycoprotein sample, α1-acid glycoprotein (AGP), was determined after acid hydrolysis. Complete separation between Neu5Ac and hydrolysis products was successful by controlling the mobility to determine the concentration of Neu5Ac.

  12. Patterns of Molecular Variation. II. Associations of Electrophoretic Mobility and Larval Substrate within Species of the DROSOPHILA MULLERI Complex

    PubMed Central

    Richardson, R. H.; Smouse, Peter E.; Richardson, Martha E.

    1977-01-01

    Electromorphic variation among populations of Drosophila mojavensis, D. arizonensis and D. longicornis was examined for seven genetic loci. The average electrophoretic mobility for a population was used as the metric. D. mojavensis and D. arizonensis use larval substrates in different parts of their geographic ranges, while D. longicornis is more narrowly restricted to different species of the cactus Opuntia in different localities. There is marked electromorphic variation among populations of either D. mojavensis or D. arizonensis, and the bulk of this variation is accounted for by differences in laval substrate. There is somewhat less variation among populations of D. longicornis, and only a moderate portion of this is accounted for by larval substrate differences. There appears to be an association between the taxonomic diversity of the larval substrates and the electromorphic diversity of the Drosophila populations utilizing those substrates. Evidence is reviewed that suggests physiological mechanisms for these possibly adaptive associations. PMID:838268

  13. [Erythrocyte sedimentation rate in diluted suspensions and their electrophoretic mobility in a vertical electrical field].

    PubMed

    Balmukhanov, B S; Basenova, A T; Bulegenov, K E

    1989-01-01

    The sedimentation rates (SR) of human red blood cells (RBC) were measured in diluted suspensions using the thin plate chamber. If the suspension medium was phosphate buffer saline or 0,18 M NaCl the SR-dependence on the distance to the chambers wall corresponded to SR distribution of small particles without interaction. The more NaCl content was decreased down to 0.145 M, the more temperature-dependent variations of SR were noted, while SR distribution became distinct with the predicted one for the non-interacting particles. The use of SR distribution is discussed for testing the RBC interaction in diluted suspensions caused by sedimentation. The electrophoretic measurements carried out under vertical oriented electrical field showed the rate of RBC movement to be the linear function of the field gradient and to be not influenced under the SR modifying conditions.

  14. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    PubMed

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove.

  15. Gel mobilities of linking-number topoisomers and their dependence on DNA helical repeat and elasticity

    PubMed Central

    Vetcher, Alexandre A.; McEwen, Abbye E.; Abujarour, Ramzey; Hanke, Andreas; Levene, Stephen D.

    2010-01-01

    Agarose-gel electrophoresis has been used for more than thirty years to characterize the linking-number (Lk) distribution of closed-circular DNA molecules. Although the physical basis of this technique remains poorly understood, the gel-electrophoretic behavior of covalently closed DNAs has been used to determine the local unwinding of DNA by proteins and small-molecule ligands, characterize supercoiling-dependent conformational transitions in duplex DNA, and to measure helical-repeat changes due to shifts in temperature and ionic strength. Those results have been analyzed by assuming that the absolute mobility of a particular topoisomer is mainly a function of the integral number of superhelical turns, and thus a slowly varying function of plasmid molecular weight. In examining the mobilities of Lk topoisomers for a series of plasmids that differ incrementally in size over more than one helical turn, we found that the size-dependent agarose-gel mobility of individual topoisomers with identical values of Lk (but different values of the excess linking number, ΔLk) vary dramatically over a duplex turn. Our results suggest that a simple semi-empirical relationship holds between the electrophoretic mobility of linking-number topoisomers and their average writhe in solution. PMID:20346570

  16. Poly(styrene/alpha-tert-butoxy-omega-vinylbenzylpolyglycidol) microspheres for immunodiagnostics. Principle of a novel latex test based on combined electrophoretic mobility and particle aggregation measurements.

    PubMed

    Radomska-Galant, Izabela; Basinska, Teresa

    2003-01-01

    The principle of a novel latex agglutination test based on combined results of electrophoretic mobility and particle aggregation measurements is described. Poly(styrene/alpha-tert-butoxy-omega-vinylbenzylpolyglycidol) (P(S/PGL)) microspheres were synthesized by a one step soap-free emulsion copolymerization of styrene and alpha-tert-butoxy-omega-vinylbenzylpolyglycidol macromonomer with number average molecular weight Mn = 2700 (polydispersity [Mw]/[Mn] = 1.10). Particles with monomodal size distribution (number average diameter Dn = 220 nm) and surface fraction of polyglycidol equal to f = 0.42 mol % were obtained. Human serum albumin (HSA) was covalently bound onto the surface of P(S/PGL) microspheres activated with 1,3,5-trichlorotriazine. In a model immunodiagnostic assay for anti-HSA, in which P(S/PGL) particles with covalently bound HSA have been used, the electrophoretic mobility and aggregation of microspheres were measured simultaneously. This approach allowed detection of anti-HSA in the serum in the range of anti-HSA concentrations from 0.1 to 150 microg/mL. The highest changes in electrophoretic mobility were registered for microspheres with surface concentration of immobilized HSA equal to Gamma = 9.2 x 10(-4) g/m2.

  17. Surface charge of trypanosoma cruzi. Binding of cationized ferritin and measurement of cellular electrophoretic mobility.

    PubMed

    De Souza, W; Arguello, C; Martinez-Paloma, A; Trissl, D; Gonzáles-Robles, A; Chiari, E

    1977-08-01

    The surface charge of epimastigote and trypomastigote forms of Trypanosoma cruzi was evaluated by means of binding of cationized ferritin to the cell surface as visualized by electron microscopy, and by direct measurements of the cellular microelectrophoretic mobility (EPM). Epimastigote forms had a mean EPM of -0.52 micrometer-s-1-V-1-cm and were lightly labeled with cationized ferritin. In contrast, bloodstream trypomastigotes had a much higher EPM (-1.14), and the surface was heavily labeled with cationized ferritin. When trypomastigotes from staionary phase cultures were isolated on DEAE cellulose columns, the mean EPM was found to be significantly lower (-0.63), and labeling with cationized ferritin decreased. With a mixed population containing epimastigote, trypomastigote, and intermediate forms, EPM values ranging between -0.70 to -1.14 were found. From these observations we conclude that there is a definite increase in negative surface charge during development from epi- to trypomastigote forms of T. cruzi.

  18. Electrophoretic mobility, catalytic rate, and activation energy of catalysis of single molecules of the enzyme β-glucuronidase from Escherichia coli.

    PubMed

    Craig, Douglas B; King, Steffany D; Reinfelds, Gundars; Henderson, Anna R P; Wood, Tabitha E H

    2017-03-01

    Single molecule assays were performed on the enzyme E. coli β-glucuronidase using a capillary electrophoresis-based protocol. Electrophoretic mobility, catalytic rate and activation energy of catalysis were all found to be heterogeneous. The average mobility at 22°C was -1.1×10(-8)±0.1m(2)V(-1)s(-1) (N=49) with a total range of -0.6 to -1.3×10(-8)m(2)V(-1)s(-1). The range in electrophoretic mobility suggests that the differences in shape or charge of the individual molecules underlying the heterogeneity are likely minimal. The average catalytic rate at 22°C was 37,000±19,000min(-1) (N=49) with a total range of 14,000 to 130,000min(-1). Both of these properties were measured simultaneously for each of the molecules. There was a weak correlation (r(2)=0.43) between mobility and rate with the molecules with a less negative mobility having a tendency to have a higher rate. The average activation energy of catalysis, as determined by comparing rates at 22 and 35°C, was found to be 48±18kJmol(-1) (N=7) with a total range of 18-66kJmol(-1).

  19. Capillary electrophoretic separation of DNA restriction fragments using dilute polymer solutions

    SciTech Connect

    Braun, B.; Blanch, W.; Prausnitz, J.M.

    1997-02-01

    Because the mechanism of DNA separation in capillary electrophoresis is not well understood, selection of polymers is a {open_quotes}trial-and-error{close_quotes} procedure. We investigated dilute-solution DNA separations by capillary electrophoresis using solutions of four polymers that differ in size, shape and stiffness. Hydroxyethylcellulose of high molecular weight provides excellent separation of large DNA fragments (2027 bp - 23130 bp). Polyvinylpyrrolidone separates DNA from 72 bp to 23 kbp and star-(polyethylene oxide), like linear poly (ethylene oxide), provides separation of fragments up to 1353 bp.

  20. Simulation guided design of a microfluidic device for electrophoretic stretching of DNA

    PubMed Central

    Hsieh, Chih-Chen; Lin, Tsung-Hsien; Huang, Chiou-De

    2012-01-01

    We have used Brownian dynamics-finite element method (BD-FEM) to guide the optimization of a microfluidic device designed to stretch DNA for gene mapping. The original design was proposed in our previous study [C. C. Hsieh and T. H. Lin, Biomicrofluidics 5(4), 044106 (2011)] for demonstrating a new pre-conditioning strategy to facilitate DNA stretching through a microcontraction using electrophoresis. In this study, we examine the efficiency of the original device for stretching DNA with different sizes ranging from 48.5 kbp (λ-DNA) to 166 kbp (T4-DNA). The efficiency of the device is found to deteriorate with increasing DNA molecular weight. The cause of the efficiency loss is determined by BD-FEM, and a modified design is proposed by drawing an analogy between an electric field and a potential flow. The modified device does not only regain the efficiency for stretching large DNA but also outperforms the original device for stretching small DNA. PMID:24155866

  1. Simulation of conformational preconditioning strategies for electrophoretic stretching of DNA in a microcontraction

    PubMed Central

    Hsieh, Chih-Chen; Lin, Tsung-Hsien

    2011-01-01

    We have used Brownian dynamics-finite element method to examine two conformational preconditioning approaches for improving DNA stretching in a microcontraction for the purpose of direct gene analysis. The newly proposed “pre-stretching” strategy is found to significantly improve the degree of DNA extension at the exit of the contraction. On the other hand, applying an oscillating extensional field to DNA yields no preconditioning effect. Detailed analysis of the evolution of DNA extension and conformation reveals that the success of our “pre-stretching” strategy relies on the “non-local” effect that cannot be predicted using simple kinematics analysis. In other words, accurate prediction can only be obtained using detailed simulations. Comparing to the existing preconditioning strategies, our “pre-stretching” method is easy to implement while still providing a very good performance. We hope that the insight gained from this study can be useful for future design of biomicrofluidic devices for DNA manipulation. PMID:22662058

  2. DNA Electrophoretic Migration Patterns Change after Exposure of Jurkat Cells to a Single Intense Nanosecond Electric Pulse

    PubMed Central

    Romeo, Stefania; Zeni, Luigi; Sarti, Maurizio; Sannino, Anna; Scarfì, Maria Rosaria; Vernier, P. Thomas; Zeni, Olga

    2011-01-01

    Intense nanosecond pulsed electric fields (nsPEFs) interact with cellular membranes and intracellular structures. Investigating how cells respond to nanosecond pulses is essential for a) development of biomedical applications of nsPEFs, including cancer therapy, and b) better understanding of the mechanisms underlying such bioelectrical effects. In this work, we explored relatively mild exposure conditions to provide insight into weak, reversible effects, laying a foundation for a better understanding of the interaction mechanisms and kinetics underlying nsPEF bio-effects. In particular, we report changes in the nucleus of Jurkat cells (human lymphoblastoid T cells) exposed to single pulses of 60 ns duration and 1.0, 1.5 and 2.5 MV/m amplitudes, which do not affect cell growth and viability. A dose-dependent reduction in alkaline comet-assayed DNA migration is observed immediately after nsPEF exposure, accompanied by permeabilization of the plasma membrane (YO-PRO-1 uptake). Comet assay profiles return to normal within 60 minutes after pulse delivery at the highest pulse amplitude tested, indicating that our exposure protocol affects the nucleus, modifying DNA electrophoretic migration patterns. PMID:22164287

  3. Sequence Dependent Electrophoretic Separations of DNA in Pluronic F127 Gels

    NASA Astrophysics Data System (ADS)

    You, Seungyong; van Winkle, David H.

    2010-03-01

    Two-dimensional (2-D) electrophoresis has successfully been used to visualize the separation of DNA fragments of the same length. We electrophorese a double-stranded DNA ladder in an Agarose gel for the first dimension and in gels of Pluronic F127 for the second dimension at room temperature. The 1000 bp band that travels together as a single band in an Agarose gel is split into two bands in Pluronic gels. The slower band follows the exponential decay trend that the other ladder constituents do. After sequencing the DNA fragments, the faster band has an apparently random sequence, while the slower band and the others have two A-tracts in each 250 bp segment. The A-tracts consist of a series of at least five adenine bases pairing with thymine bases. This result leads to the conclusion that the migration of the DNA molecules bent with A-tracts is more retarded in Pluronic gels than the wild-type of DNA molecules.

  4. [Determination of the electrophoretic mobility of peripheral red blood cells from healthy individuals, by using ethylene-2-amine-4-chloroacetic acid as a preservative].

    PubMed

    Iastrubinetskaia, O I; Popova, O V; Sarycheva, T G; Tentsova, I A; Kozinets, G I

    2009-01-01

    It is now known that the electric charge of a surface cellular membrane is a rather characteristic value for each type of a cell. Cellular electrophoresis may be used to study the electrokinetic properties of red blood cells in each specific case, thereby obtaining indirect information on the state of a surface membrane as the electrophoretic mobility (EPM) rate is directly proportional to the value of a cellular electric charge. The study was undertaken to compare the EPM rates of peripheral red blood cells from donors, by employing two different preservatives: EDTCHA and sodium citrate. No statistically significant differences were found in the groups under study and these parameters were comparable.

  5. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, B.L.; Thilly, W.G.; Foret, F.; Khrapko, K.; Koehavong, P.; Cohen, A.S.; Giese, R.W.

    1997-05-27

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability. 18 figs.

  6. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, Barry L.; Thilly, William G.; Foret, Frantisek; Khrapko, Konstaintin; Koehavong, Phouthone; Cohen, Aharon S.; Giese, Roger W.

    1997-01-01

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability.

  7. [Electrophoretic karyotypes and genomic DNA restriction fragment analysis: their usefulness as tools in the epidemiological study of Candid parapsilosis].

    PubMed

    Perrotta, D; Rodero, L; Demkura, H; Canteros, C; Davel, G

    2002-01-01

    During the past decades, several studies have reported an increase in the incidence of nosocomial candidosis. In a prospective study, performed at the Departamento de Micología, INEI, ANLIS Dr. C. G. Malbrán and the Servicio de Neonatología and Microbiología, Hospital de Niños Sor María Ludovica, from October 1995 to December 1996, 167 patients with candidosis were detected. Candida species isolated were C. albicans (53.1%), C. parapsilosis (26.5%) and C. tropicalis (14.8%). The aim of this work was to characterize the clinical C. parapsilosis isolates from pediatric patients hospitalized in two neonatal intensive care units from the same hospital and to evaluate the usefulness of electrophoretic karyotype (EK) and restriction endonuclease analysis of genomic DNA (REAG) using a low frequency digestion enzyme. EK of all isolates disclosed 12 banding patterns and REAG with endonuclease Sfi I showed only 5 groups. However, isolates from the control group could not be separated from the clinical isolates. The isolates within each dendogram group for EK or REAG were apparently unrelated. Our results show that EK yields better results than REAG, but that it falls short of the desired discrimination, which suggests that these techniques do not seem to be useful for studying nosocomial C. parapsilosis outbreaks.

  8. Rare deficiency types of alpha 1-antitrypsin: electrophoretic variation and DNA haplotypes.

    PubMed Central

    Cox, D W; Billingsley, G D

    1989-01-01

    A deficiency of the plasma protease inhibitor alpha 1-antitrypsin (alpha 1AT), is usually associated with the deficiency allele PI*Z. However, other alleles can also produce a deficiency. Some of these rare deficiency alleles produce a low concentration (3%-15% of normal) of alpha 1AT and include Mmalton, Mduarte, Mheerlen, and Mprocida. Null, or nonproducing, alleles are associated with trace amounts (less than 1%) of plasma alpha 1AT. We have identified, using isoelectric focusing, the deficiency alleles in 222 patients (68 children and 154 adults) with alpha 1AT deficiency. In addition to PI*Z, we found low-producing alleles PI*Mmalton and PI*Mcobalt and four null (PI*QO) alleles. On the basis of a population frequency of .0122 for PI*Z, frequencies for other deficiency alleles are 1.1 x 10(-4) for PI*Mmalton, 2.5 x 10(-5) for PI*Mcobalt (which may be the same as that for PI*Mduarte, and 1.4 x 10(-4) for all null alleles combined. Using 12 polymorphic restriction sites with seven different restriction enzymes, we have obtained DNA haplotypes for each of the rare deficiency types. All of the rare deficiency alleles can be distinguished from PI*Z by their DNA haplotype, and most can be distinguished from each other. DNA haplotypes are useful to indicate the presence of new types of null alleles, to identify genetic compounds for rare deficiency alleles, and to identify the original normal allele from which each deficiency allele is derived. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:2786333

  9. On the electrophoretic mobility of succinoglycan modelled as a spherical polyelectrolyte: From Hermans-Fujita theory to charge regulation in multi-component electrolytes.

    PubMed

    Hill, Reghan J

    2016-11-15

    Literature interpretations of the electrophoretic mobility of spherical polyelectrolytes are revisited using the capillary-electrophoresis data of Duval et al. (2006) for the extracellular polysaccharide succinoglycan as an example. Subtle changes in the polyelectrolyte mobility have recently been attributed to new electrokinetic theories that feature multi-component electrolytes, charge regulation, and the so-called polarization and relaxation phenomena. However, these calculations exhibit several unusual trends that have yet to be explained, and so the conclusions drawn from them are controversial. Here, independent computations strengthen conclusions drawn from the original model of Duval et al., i.e., the discrepancies between experiments and all the presently available electrokinetic theories reflect changes in the conformation of succinoglycan arising from changes in the electrolyte pH and ionic strength.

  10. Determination of pKa values of tenoxicam from 1H NMR chemical shifts and of oxicams from electrophoretic mobilities (CZE) with the aid of programs SQUAD and HYPNMR.

    PubMed

    Rodríguez-Barrientos, Damaris; Rojas-Hernández, Alberto; Gutiérrez, Atilano; Moya-Hernández, Rosario; Gómez-Balderas, Rodolfo; Ramírez-Silva, María Teresa

    2009-12-15

    In this work it is explained, by the first time, the application of programs SQUAD and HYPNMR to refine equilibrium constant values through the fit of electrophoretic mobilities determined by capillary zone electrophoresis experiments, due to the mathematical isomorphism of UV-vis absorptivity coefficients, NMR chemical shifts and electrophoretic mobilities as a function of pH. Then, the pK(a) values of tenoxicam in H(2)O/DMSO 1:4 (v/v) have been obtained from (1)H NMR chemical shifts, as well as of oxicams in aqueous solution from electrophoretic mobilities determined by CZE, at 25 degrees C. These values are in very good agreement with those reported by spectrophotometric and potentiometric measurements.

  11. Comprehensive Size-Determination of Whole Virus Vaccine Particles Using Gas-Phase Electrophoretic Mobility Macromolecular Analyzer, Atomic Force Microscopy, and Transmission Electron Microscopy

    PubMed Central

    Havlik, Marlene; Marchetti-Deschmann, Martina; Friedbacher, Gernot; Winkler, Wolfgang; Messner, Paul; Perez-Burgos, Laura; Tauer, Christa; Allmaier, Günter

    2015-01-01

    Biophysical properties including particle size distribution, integrity, and shape of whole virus vaccine particles at different stages in tick-borne encephalitis (TBE) vaccines formulation were analyzed by a new set of methods. Size-exclusion chromatography (SEC) was used as a conservative sample preparation for vaccine particle fractionation and gas-phase electrophoretic mobility macromolecular analyzer (GEMMA) for analyzing electrophoretic mobility diameters of isolated TBE virions. The derived particle diameter was then correlated with molecular weight. The diameter of the TBE virions determined after SEC by GEMMA instrumentation was 46.8 ± 1.1 nm. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were implemented for comparison purposes and to gain morphological information on the virion particle. Western blotting (Dot Blot) as an immunological method confirmed biological activity of the particles at various stages of the developed analytical strategy. AFM and TEM measurements revealed higher diameters with much higher SD for a limited number of virions, 60.4 ± 8.5 and 53.5 ± 5.3 nm, respectively. GEMMA instrumentation was also used for fractionation of virions with specifically selected diameters in the gas-phase, which were finally collected by means of an electrostatic sampler. At that point (i.e., after particle collection), AFM and TEM showed that the sampled virions were still intact, exhibiting a narrow size distribution (i.e., 59.8 ± 7.8 nm for AFM and 47.5 ± 5.2 nm for TEM images), and most importantly, dot blotting confirmed immunological activity of the collected samples. Furthermore dimers and virion artifacts were detected, too. PMID:26266988

  12. Electrophoretic cell separation by means of microspheres

    NASA Technical Reports Server (NTRS)

    Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.

    1979-01-01

    The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.

  13. Electrophoretic cell separation by means of immunomicrospheres

    NASA Technical Reports Server (NTRS)

    Rembaum, A.; Smolka, A. J. K.

    1980-01-01

    The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.

  14. Electrophoretic Focusing

    NASA Technical Reports Server (NTRS)

    Snyder, Robert S.

    2001-01-01

    Electrophoretic focusing is a new method of continuous flow electrophoresis that introduces precision flow control to achieve high resolution separations. The electric field is applied perpendicular to an incoming sample lamina and buffer but also perpendicular to the broad faces of the thin rectangular chamber. A uniform fluid cross-flow then enters and exits the separation chamber through the same broad faces which are porous. A balance is achieved by adjusting either the electric field or the cross-flow so the desired sample fraction with its specific migration velocity encounters an opposing flow of the same velocity. Applying an electric field transverse to the incoming sample lamina and opposing this field with a carefully configured buffer flow, a sample constituent can be selected and focused into a narrow stream for subsequent analysis. Monotonically changing either electric field or buffer cross-flow will yield a scan of all constituents of the sample. Stopping the scan increases the collection time for minor constituents to improve their analysis. Using the high voltage gradients and/or cross-flow to rapidly deflect extraneous sample through the porous screens and into either of the side (purge) chambers, the selected sample is focused in the center plane of the separation chamber and collected without contact or interaction with the separation chamber walls. Results will be presented on the separation of a range of materials including dyes, proteins, and monodisperse polystyrene latexes. Sources of sample dispersion inherent in other electrokinetic techniques will be shown to be negligible for a variety of sample concentrations, buffer properties and operating conditions.

  15. Relatedness Analyses of Histoplasma capsulatum Isolates from Mexican Patients with AIDS-Associated Histoplasmosis by Using Histoplasmin Electrophoretic Profiles and Randomly Amplified Polymorphic DNA Patterns

    PubMed Central

    Reyes-Montes, M. R.; Bobadilla-Del Valle, M.; Martínez-Rivera, M. A.; Rodríguez-Arellanes, G.; Maravilla, E.; Sifuentes-Osornio, J.; Taylor, M. L.

    1999-01-01

    The present paper analyzes the histoplasmin electrophoretic profiles and the randomly amplified polymorphic DNA (RAPD) patterns of the fungus Histoplasma capsulatum isolated from Mexican patients with AIDS-associated histoplasmosis. Clinical isolates from Guatemala, Colombia, and Panama, as well as H. capsulatum isolates from different sources in nature, were also processed. All histoplasmin samples shared four antigenic fractions of 200, 49, 10.5, and 8.5 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). According to their percentage of relatedness, based on SDS-PAGE histoplasmin electrophoretic image analysis, H. capsulatum isolates were divided in two groups: group A contained all AIDS-associated isolates studied and two human reference strains from Mexican histoplasmosis patients without AIDS; group B included bat guano, infected bat, and cock excreta isolates from the State of Guerrero, Mexico, plus three human histoplasmosis strains from Guatemala, Panama, and Colombia. Polymorphic DNA patterns evaluated by RAPD-PCR showed three major bands of 4.4, 3.2, and 2.3 kb in most H. capsulatum isolates studied. Four groups were related by DNA polymorphisms: group I was formed by most of the AIDS-associated H. capsulatum isolates studied, one human histoplasmosis strain from Colombia, two human reference strains from Mexican patients without AIDS, and one human histoplasmosis strain from Guatemala. Group II consisted of only a single strain from Panama. Group III included three strains: one from a Mexican patient with AIDS and two isolated from nature in Guerrero (cock excreta and bat guano). The last, group IV, consisted of only one strain isolated from an infected bat, captured in Guerrero. A tight relationship between phenotypic and genotypic characterization was observed, and both analyses could be useful tools for typing H. capsulatum from different sources and geographic origins. PMID:10203495

  16. Nano electrospray gas-phase electrophoretic mobility molecular analysis (nES GEMMA) of liposomes: applicability of the technique for nano vesicle batch control

    PubMed Central

    Weiss, Victor U.; Urey, Carlos; Gondikas, Andreas; Golesne, Monika; Friedbacher, Gernot; von der Kammer, Frank; Hofmann, Thilo; Andersson, Roland; Marko-Varga, György; Marchetti-Deschmann, Martina

    2016-01-01

    Liposomes are biodegradable nanoparticle vesicles consisting of a lipid bilayer encapsulating an aqueous core. Entrapped cargo material is shielded from the extra-vesicular medium and sustained release of encapsulated material can be achieved. However, application of liposomes as nano-carriers demands their characterization concerning size and size distribution, particle-number concentration, occurrence of vesicle building blocks in solution and determination of the resulting vesicle encapsulation capacity. These questions can be targeted via gas-phase electrophoretic mobility molecular analysis (GEMMA) based on a nano electrospray (nES) charge-reduction source. This instrument separates single-charged nanoparticles in the gas-phase according to size in a high-laminar sheath-flow by means of an orthogonal, tunable electric field. nES GEMMA analysis enables to confirm liposome integrity after passage through the instrument (in combination with atomic force microscopy) as well as to exclude vesicle aggregation. Additionally, nanoparticle diameters at peak apexes and size distribution data are obtained. Differences of hydrodynamic and dry particle diameter values, as well as the effect of number- and mass-based concentration data analysis on obtained liposome diameters are shown. Furthermore, the repeatability of liposome preparation is studied, especially upon incorporation of PEGylated lipids in the bilayer. Finally, the instruments applicability to monitor mechanical stress applied to vesicles is demonstrated. PMID:27549027

  17. Combining gas-phase electrophoretic mobility molecular analysis (GEMMA), light scattering, field flow fractionation and cryo electron microscopy in a multidimensional approach to characterize liposomal carrier vesicles.

    PubMed

    Urey, Carlos; Weiss, Victor U; Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland

    2016-11-20

    For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability.

  18. Nano electrospray gas-phase electrophoretic mobility molecular analysis (nES GEMMA) of liposomes: applicability of the technique for nano vesicle batch control.

    PubMed

    Weiss, Victor U; Urey, Carlos; Gondikas, Andreas; Golesne, Monika; Friedbacher, Gernot; von der Kammer, Frank; Hofmann, Thilo; Andersson, Roland; Marko-Varga, György; Marchetti-Deschmann, Martina; Allmaier, Günter

    2016-10-17

    Liposomes are biodegradable nanoparticle vesicles consisting of a lipid bilayer encapsulating an aqueous core. Entrapped cargo material is shielded from the extra-vesicular medium and sustained release of encapsulated material can be achieved. However, application of liposomes as nano-carriers demands their characterization concerning size and size distribution, particle-number concentration, occurrence of vesicle building blocks in solution and determination of the resulting vesicle encapsulation capacity. These questions can be targeted via gas-phase electrophoretic mobility molecular analysis (GEMMA) based on a nano electrospray (nES) charge-reduction source. This instrument separates single-charged nanoparticles in the gas-phase according to size in a high-laminar sheath-flow by means of an orthogonal, tunable electric field. nES GEMMA analysis enables to confirm liposome integrity after passage through the instrument (in combination with atomic force microscopy) as well as to exclude vesicle aggregation. Additionally, nanoparticle diameters at peak apexes and size distribution data are obtained. Differences of hydrodynamic and dry particle diameter values, as well as the effect of number- and mass-based concentration data analysis on obtained liposome diameters are shown. Furthermore, the repeatability of liposome preparation is studied, especially upon incorporation of PEGylated lipids in the bilayer. Finally, the instruments applicability to monitor mechanical stress applied to vesicles is demonstrated.

  19. Charge regulation phenomenon predicted from the modeling of polypeptide electrophoretic mobilities as a relevant mechanism of amyloid-beta peptide oligomerization.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2016-03-01

    Electrophoretic mobilities of amyloid-beta (1-40) and (1-42) peptides and their aggregates are modeled to study the amyloidogenic pathway associated with Alzheimer´s Disease. The near molecule pH generated by the intraparticle charge regulation phenomenon during the oligomerization of amyloid-beta (1-40) and (1-42) peptides is evaluated and discussed as a relevant mechanism supporting the "amyloid cascade hypothesis" proposed in the literature. A theoretical framework associated with the oligomerization of amyloid-beta peptides including simple scaling laws and the consideration of electrokinetic and hydrodynamic global properties of oligomers is presented. The central finding is the explanation of the near molecule pH change toward the pI when the oligomerization number increases. These results allow one to rationalize consecutive physical stages that validate the amyloid cascade hypothesis. Concluding remarks involving mainly the effects of pair and intraparticle charge regulation phenomena on the amyloidogenic pathway with some suggestions for future research are provided.

  20. Estimation of electrokinetic and hydrodynamic global properties of relevant amyloid-beta peptides through the modeling of their effective electrophoretic mobilities and analysis of their propensities to aggregation.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2014-09-01

    Neuronal activity loss may be due to toxicity caused by amyloid-beta peptides forming soluble oligomers. Here amyloid-beta peptides (1-42, 1-40, 1-39, 1-38, and 1-37) are characterized through the modeling of their experimental effective electrophoretic mobilities determined by a capillary zone electrophoresis method as reported in the literature. The resulting electrokinetic and hydrodynamic global properties are used to evaluate amyloid-beta peptide propensities to aggregation through pair particles interaction potentials and Brownian aggregation kinetic theories. Two background electrolytes are considered at 25°C, one for pH 9 and ionic strength I = 40 mM (aggregation is inhibited through NH4OH) the other for pH 10 and I = 100 mM (without NH4OH). Physical explanations of peptide oligomerization mechanisms are provided. The effect of hydration, electrostatic, and dispersion forces in the amyloidogenic process of amyloid-beta peptides (1-40 and 1-42) are quantitatively presented. The interplay among effective charge number, hydration, and conformation of chains is described. It is shown that amyloid-beta peptides (1-40 and 1-42) at pH 10, I = 100 mM and 25°C, may form soluble oligomers, mainly of order 2 and 4, after an incubation of 48 h, which at higher times evolve and end up in complex structures (protofibrils and fibrils) found in plaques associated with Alzheimer's disease.

  1. Electrophoretic mobility of cell nuclei (EMN index) as a biomarker of the biological aging process: Considering the association between EMN index and age.

    PubMed

    Czapla, Z; McPhail, S M

    2015-12-01

    The present study examined whether a specific property of cell microstructures may be useful as a biomarker of aging. Specifically, the association between age and changes of cellular structures reflected in electrophoretic mobility of cell nuclei index (EMN index) values across the adult lifespan was examined. This report considers findings from cross sections of females (n=1273) aged 18-98 years, and males (n=506) aged 19-93 years. A Biotest apparatus was used to perform intracellular microelectrophoresis on buccal epithelial cells collected from each individual. EMN index was calculated on the basis of the number of epithelial cells with mobile nuclei in reference to the cells with immobile nuclei per 100cells. Regression analyses indicated a significant negative association between EMN index value and age for men (r=-0.71, p<0.001) and women (r=-0.60, p<0.001); demonstrating a key requirement that must be met by a biomarker of aging. The strength of association observed between EMN index and age for both men and women was encouraging and supports the potential use of EMN index for determining a biological age of an individual (or a group). In this study, a new attempt of complex explanation of cellular mechanisms contributing to age related changes of the EMN index was made. In this study, a new attempt of complex explanation of cellular mechanisms contributing to age related changes of the EMN index was made. EMN index has demonstrated potential to meet criteria proposed for biomarkers of aging and further investigations are necessary.

  2. Properties of poly(styrene/alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol) microspheres suspended in water. Effect of sodium chloride and temperature on particle diameters and electrophoretic mobility.

    PubMed

    Basinska, Teresa; Slomkowski, Stanislaw; Kazmierski, Slawomir; Chehimi, Mohamed M

    2008-08-19

    Hydrodynamic and electrophoretic properties of core-shell poly(styrene/alpha- tert-butoxy-omega-vinylbenzyl-polyglycidol) (P(S/PGL)) microspheres suspended in water are described. The microspheres were obtained by surfactant-free emulsion copolymerization of styrene and alpha- tert-butoxy-omega-vinylbenzyl-polyglycidol macromonomer ( M n = 2800, M w/ M n = 1.05). The process yielded microspheres with number average diameter D n = 270 nm and with low diameter dispersity index D w/ D n = 1.01. Shells of P(S/PGL) microspheres were enriched in polyglycidol. Molar fraction of polyglycidol monomeric units in the shells (determined by X-ray photoelectron spectroscopy) was equal to 0.34, which is much higher than the average molar fraction of polyglycidol monomeric units in whole particles of 0.048. Influences of NaCl concentration and temperature on P(S/PGL) microsphere diameters and on their electrophoretic mobility were investigated. It was found that hydrodynamic diameter of P(S/PGL) microspheres, determined by photon correlation spectroscopy, decreased significantly when temperature did exceed a certain value (transition temperature, T t). It has been found that the decrease is more pronounced for higher concentrations of NaCl in the medium. For microspheres suspended in 10 (-1) M NaCl, the hydrodynamic diameter decreased by 8% whereas for the same particles in pure water the diameter decreased by 5.2%. The process of shrinkage was fully reversible. Values of T t for P(S/PGL) microspheres were lower for higher concentrations of NaCl. Adjustment of salt concentration allowed controlling T t in a range from 44.4 to 49.9 degrees C. 13C NMR relaxation time measurements (T 1) for carbon atoms in polyglycidol macromonomer revealed that T 1 did increase with increasing temperature (in temperature range from 25 to 75 degrees C) indicating higher motion of chains at higher temperature. Addition of NaCl did not induce a substantial change of T 1 in the mentioned temperature

  3. Principle of a new immunoassay based on electrophoretic mobility of poly(styrene/alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol) microspheres: application for the determination of helicobacter pylori IgG in blood serum.

    PubMed

    Basinska, Teresa; Wisniewska, Monika; Chmiela, Magdalena

    2005-01-14

    The principle of a novel latex diagnostic test for the determination of antibodies against Helicobacter pylori in blood sera is described. The test is based on the measurement of the electrophoretic mobility of the microspheres with immobilized H. pylori antigens. The electrophoretic mobility of these microspheres depends on the concentration of the antibodies against H. pylori in suspending medium. Particles with hydrophilic polyglycidol in the surface layer were used for the test. The microspheres were obtained by an emulsifier-free emulsion copolymerization of styrene and alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol macromonomer (D(n) = 220 nm, diameter polydispersity factor D(w)//D(n) = 1.02). Activation of polyglycidol hydroxyl groups with cyanuric chloride allowed for covalent immobilization of H. pylori antigens. The fraction of H. pylori not specifically adsorbed onto the microspheres was negligible. Changes of the electrophoretic mobility of the microspheres with the surface concentration of the covalently immobilized H. pylori antigens Gamma = (1.6 +/- 0.3) . 10(-3) g m(-2) were suitable for the detection of the antibodies in the sera of patients with titer in the range (determined by the indirect ELISA test) from 1:500 to 1:32 000.

  4. Effects of non-equilibrium association-dissociation processes in the dynamic electrophoretic mobility and dielectric response of realistic salt-free concentrated suspensions.

    PubMed

    Carrique, Félix; Ruiz-Reina, Emilio; Lechuga, Luis; Arroyo, Francisco J; Delgado, Ángel V

    2013-12-01

    Electrokinetic investigations in nanoparticle suspensions in aqueous media are most often performed assuming that the liquid medium is a strong electrolyte solution with specified concentration. The role of the ions produced by the process of charging the surfaces of the particles is often neglected or, at most, the concentrations of such ions are estimated in some way and added to the concentrations of the ions in the externally prepared solution. The situation here considered is quite different: no electrolyte is dissolved in the medium, and ideally only the counterions stemming from the particle charging are assumed to be in solution. This is the case of so-called salt-free systems. With the aim of making a model for such kind of dispersions as close to real situations as possible, it was previously found to consider the unavoidable presence of H(+) and OH(-) coming from water dissociation, as well as the (almost unavoidable) ions stemming from the dissolution of atmospheric CO2. In this work, we extend such approach by considering that the chemical reactions involved in dissociation and recombination of the (weak) electrolytes in solution must not necessarily be in equilibrium conditions (equal rates of forward and backward reactions). To that aim, we calculate the frequency spectra of the electric permittivity and dynamic electrophoretic mobility of salt-free suspensions considering realistic non-equilibrium conditions, using literature values for the rate constants of the reactions. Four species are linked by such reactions, namely H(+) (from water, from the--assumed acidic--groups on the particle surfaces, and from CO2 dissolution), OH(-) (from water), HCO3(-) and H2CO3 (again from CO2). A cell model is used for the calculations, which are extended to arbitrary values of the surface charge, the particle size, and particle volume fraction, in a wide range of the field frequency ω. Both approaches predict a high frequency relaxation of the counterion

  5. Mobility of Electron in DNA Crystals by Laser Radiation

    NASA Technical Reports Server (NTRS)

    Zhang, Kaixi; Zhao, Qingxun; Cui, Zhiyun; Zhang, Ping; Dong, Lifang

    1996-01-01

    The mobility of electrons in laser radiated DNA is closed to the energy transfer and energy migration of a biological molecule. Arrhenius has studied the conductivity of the electrons in a biological molecule. But his result is far from the experimental result and meanwhile the relation between some parameters in his theory and the micro-quantities in DNA is not very clear. In this paper, we propose a new phonon model of electron mobility in DNA and use Lippman-Schwinger equation and S-matrix theory to study the mobility of electrons in DNA crystal. The result is relatively close to the experiment result and some parameters in Arrhenius theory are explained in our work.

  6. Experimental test of new theoretical models for the electrokinetic properties of biological membranes. The effect of UO/sup 2 + +/ and tetracaine on the electrophoretic mobility of bilayer membranes and human erythrocytes

    SciTech Connect

    Pasquale, L.; Winiski, A.; Oliva, C.; Vaio, G.; McLaughlin, S.

    1986-12-01

    For a large smooth particle with charges at the surface, the electrophoretic mobility is proportional to the zeta potential, which is related to the charge density by the Gouy-Chapman theory of the diffuse double layer. This classical model adequately describes the dependence of the electrophoretic mobility of phospholipid vesicles on charge density and salt concentration, but it is not applicable to most biological cells, for which new theoretical models have been developed. We tested these new models experimentally by measuring the effect of UO/sup 2 + +/ on the electrophoretic mobility of model membranes and human erythrocytes in 0.15 M NaCl at pH 5. We used UO/sup 2 + +/ for these studies because it should adsorb specifically to the bilayer surface of the erythrocyte and should not change the density of fixed charges in the glycocalyx. Our experiments demonstrate that it forms high-affinity complexes with the phosphate groups of several phospholipids in a bilayer but does not bind significantly to sialic acid residues. As observed previously, UO/sup 2 + +/ adsorbs strongly to egg phosphatidylcholine (PC) vesicles: 0.1 mM UO/sup 2 + +/ changes the zeta potential of PC vesicles from 0 to +40 mV. It also has a large effect on the electrophoretic mobility of vesicles formed from mixtures of PC and the negative phospholipid phosphatidylserine (PS): 0.1 mM UO/sup 2 + +/ changes the zeta potential of PC/PS vesicles (10 mol % PS) from -13 to +37 mV. In contrast, UO/sup 2 + +/ has only a small effect on the electrophoretic mobility of either vesicles formed from mixtures of PC and the negative ganglioside GM1 or erythrocytes: 0.1 mM UO/sup 2 + +/ changes the apparent zeta potential of PC/GM1 vesicles (17 mol % GM1) from -11 to +5 mV and the apparent zeta potential of erythrocytes from -12 to -4 mV.

  7. DNA electrophoresis in agarose gels: effects of field and gel concentration on the exponential dependence of reciprocal mobility on DNA length.

    PubMed

    Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H

    2002-08-01

    Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.

  8. Electrophoretic and electro-optical studies on the conformation and susceptibility to psoralen crosslinking of magnetically oriented DNA

    SciTech Connect

    Roots, R.J.; Kraft, G.H.; Farinato, R.S.; Tenforde, T.S.

    1982-08-01

    Gel electrophoresis and electro-optical birefringence measurements were performed on the replicative form of bacteriophage phi X-174 DNA subjected to orientation in a homogeneous stationary magnetic field. The conformation of this superhelical double-stranded form of DNA, and its sensitivity to intercalation and crosslinking by a psoralen derivative, were found to be unaffected by a 1 h exposure to a 2.15 Tesla field. In addition, no alteration was detected in the infectivity of the exposed phi X-174 DNA in E. coli bacterial hosts.

  9. Electrophoretic study of Clostridium species.

    PubMed Central

    Cato, E P; Hash, D E; Holdeman, L V; Moore, W E

    1982-01-01

    Polyacrylamide gel electrophoretic analysis of soluble cellular proteins (without sodium dodecyl sulfate) of 70 Clostridium species indicated that the procedure was readily applicable to the differentiation of species in the genus. The protein patterns correlated well with the available DNA homology data and with most accepted differential tests. Results indicated that several earlier names for species were synonyms of those of accepted species and that two accepted species may be synonymous. Images PMID:6175658

  10. Mobile DNA in the pathogenic Neisseria

    PubMed Central

    Obergfell, Kyle P.; Seifert, H. Steven

    2015-01-01

    The genus Neisseria contains two pathogenic species of notable public health concern: Neisseria gonorrhoeae and Neisseria meningitidis. These pathogens display a notable ability to undergo frequent programmed recombination events. The recombination mediated pathways of transformation and pilin antigenic variation in the Neisseria are well studied systems that are critical for pathogenesis. Here we will detail the conserved and unique aspects of transformation and antigenic variation in the Neisseria. Transformation will be followed from initial DNA binding through recombination into the genome with consideration to the factors necessary at each step. Additional focus is paid to the unique type IV secretion system that mediates donation of transforming DNA in the pathogenic Neisseria. The pilin antigenic variation system uses programed recombinations to alter a major surface determinant which allows immune avoidance and promotes infection. We discuss the trans- and cis- acting factors which facilitate pilin antigenic variation and present the current understanding of the mechanisms involved in the process. PMID:25866700

  11. Mobile units of DNA in phytoplasma genomes.

    PubMed

    Dickinson, Matt

    2010-09-01

    Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.

  12. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance.

    PubMed

    Li, Ming-Wei; Lin, Rui-Qing; Song, Hui-Qun; Sani, Rehana A; Wu, Xiang-Yun; Zhu, Xing-Quan

    2008-07-01

    Sequence variability in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunits 1 and 4 (nad1 and nad4), among and within Toxocara canis, T. cati, T. malaysiensis, T. vitulorum and Toxascaris leonina from different geographical origins was examined by a mutation-scanning approach. A portion of the cox1 gene (pcox1), a portion of the nad1 and nad4 genes (pnad1 and pnad4) were amplified separately from individual ascaridoid nematodes by polymerase chain reaction and the amplicons analyzed by single-strand conformation polymorphism (SSCP). Representative samples displaying sequence variation in SSCP profiles were subjected to sequencing in order to define genetic markers for their specific identification and differentiation. While the intra-specific sequence variations within each of the five ascaridoid species were 0.2-3.7% for pcox1, 0-2.8% for pnad1 and 0-2.3% for pnad4, the inter-specific sequence differences were significantly higher, being 7.9-12.9% for pcox1, 10.7-21.1% for pnad1 and 12.9-21.7% for pnad4, respectively. Phylogenetic analyses based on the combined sequences of pcox1, pnad1 and pnad4 revealed that the recently described species T. malaysiensis was more closely related to T. cati than to T. canis. These findings provided mtDNA evidence for the validity of T. malaysiensis and also demonstrated clearly the usefulness and attributes of the mutation-scanning sequencing approach for studying the population genetic structures of these and other nematodes of socio-economic importance.

  13. Mobility of long-chain DNA in two-dimensional artificial gels

    NASA Astrophysics Data System (ADS)

    Turner, Stephen W. P.; Han, Jongyoon; Craighead, Harold G.

    2000-03-01

    In this study, a two-dimensional array of nanofabricated obstacles is used as an artificial gel to study the electrophoretic mobility dependence of DNA as a function of pore size, molecule length and electric field. Limitations in feature size have prevented previous studies from testing the crossover from the separating to the non-separating regime predicted by the biased reptation model of Lumpkin, Dejardin and Zimm[1] and the modified model of Duke, Semenov and Viovy.[2] That limitation is overcome in this work with the use of electron beam lithography to define features as small as 30 nm. Attainment of these feature sizes was made possible by the use of a sacrificial-layer-based technique for fluidics fabrication.[3] A novel band-launching strategy is used to provide band separation data for the first time in this system. Molecule lengths between 5 and 150 kilobases are studied for electric field strengths from 0.1 to 20 Volts per meter. [1] O. Lumpkin, P. Dejardin and B. Zimm, Biopolymers, Vol. 24, 1573-1593 (1985) [2] T. Duke, A. Semenov and J. Viovy, Phys. Rev. Lett. Vol. 69, No. 22, 3260-3263 (1992) [3] S. Turner, A. Perez, A. Lopez, and H. Craighead, J. Vac. Sci. Technol. B 16(6) 3835-3840 (1998)

  14. Mobile DNA elements in T4 and related phages

    PubMed Central

    2010-01-01

    Mobile genetic elements are common inhabitants of virtually every genome where they can exert profound influences on genome structure and function in addition to promoting their own spread within and between genomes. Phage T4 and related phage have long served as a model system for understanding the molecular mechanisms by which a certain class of mobile DNA, homing endonucleases, promote their spread. Homing endonucleases are site-specific DNA endonucleases that initiate mobility by introducing double-strand breaks at defined positions in genomes lacking the endonuclease gene, stimulating repair and recombination pathways that mobilize the endonuclease coding region. In phage T4, homing endonucleases were first discovered as encoded within the self-splicing td, nrdB and nrdD introns of T4. Genomic data has revealed that homing endonucleases are extremely widespread in T-even-like phage, as evidenced by the astounding fact that ~11% of the T4 genome encodes homing endonuclease genes, with most of them located outside of self-splicing introns. Detailed studies of the mobile td intron and its encoded endonuclease, I-TevI, have laid the foundation for genetic, biochemical and structural aspects that regulate the mobility process, and more recently have provided insights into regulation of homing endonuclease function. Here, we summarize the current state of knowledge regarding T4-encoded homing endonucleases, with particular emphasis on the td/I-TevI model system. We also discuss recent progress in the biology of free-standing endonucleases, and present areas of future research for this fascinating class of mobile genetic elements. PMID:21029434

  15. Global chain properties of an all l-α-eicosapeptide with a secondary α-helix and its all retro d-inverso-α-eicosapeptide estimated through the modeling of their CZE-determined electrophoretic mobilities.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2014-03-01

    Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 < pH < 6. In this regard, an all l-α-eicosapeptide, including a secondary α-helix (Peptide 1) and its all retro d-inverso-α-eicosapeptide (Peptide 2), are considered. Despite Peptides 1 and 2 are isomeric chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes.

  16. Global properties and propensity to dimerization of the amyloid-beta (12-28) peptide fragment through the modeling of its monomer and dimer diffusion coefficients and electrophoretic mobilities.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2015-03-01

    Neuronal activity loss may be due to toxicity caused mainly by amyloid-beta (1-40) and (1-42) peptides forming soluble oligomers. Here the amyloid-beta (12-28) peptide fragment (monomer) and its dimer are characterized at low pH through the modeling of their diffusion coefficients and effective electrophoretic mobilities. Translational diffusion coefficient experimental values of monomer and dimer analogs of this peptide fragment and monomer and dimer mixtures at thermodynamic equilibrium are used as reported in the literature for different monomer initial concentrations. The resulting electrokinetic and hydrodynamic global properties are employed to evaluate the amyloid-beta (12-28) peptide fragment propensity to dimerization through a thermodynamic theoretical framework. Therefore equilibrium constants are considered at pH 2.9 to elucidate one of the amyloidogenic mechanisms involving the central hydrophobic region LVFFA of the peptide spanning residues 17-21 associated with phenylalanine at positions 19 and 20 in the amino acid sequence of amyloid-beta peptides. An analysis demonstrating that peptide aggregation is a concentration-dependent process is provided, where both pair and intraparticle charge regulation phenomena become relevant. It is shown that the modeling of the effective electrophoretic mobility of the amyloid-beta (12-28) peptide fragment is crucial to understand the effect of hydrophobic region LVFFA in the amyloidogenic process.

  17. Mobile DNA and evolution in the 21st century

    PubMed Central

    2010-01-01

    Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW) memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs). The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification. PMID:20226073

  18. Electrophoresis of end-labeled DNA: Theory and experiment

    NASA Astrophysics Data System (ADS)

    Lau, Henry W.; Archer, Lynden A.

    2010-03-01

    The dynamic behavior of end-labeled DNA during free-solution electrophoresis is investigated using a simple dumbbell model for the labeled DNA. We study the effect of the applied field, label size, and chain stiffness on DNA conformation and electrophoretic mobility. High applied fields are predicted to magnify the size-dependence of mobility and to yield a nonmonotonic dependence of electrophoretic mobility on applied field. The effectiveness of leveraging label size and DNA chain stiffness for improving resolution is also discussed in the context of DNA deformation. To evaluate the most salient model predictions, we use capillary electrophoresis experiments to characterize the size- and field-dependent mobility of dsDNA fragments (300 bp-2 kbp) end-functionalized with streptavidin. Our experimental results are found to be in generally good accord with expectations based on the dumb-bell model. We discuss implications of these findings for fast, size-based separation of DNA in free solution.

  19. An evaluation of the SPIFE 3000 semi-automated gel electrophoresis system for the identification of hemoglobin variants and comparison of relative electrophoretic mobilities with manual gel electrophoresis methods.

    PubMed

    Hoyer, J D; Markley, K M; Savedra, M E; Kubik, K S; Scheidt, R M

    2010-06-01

    Laboratory identification of hemoglobin (Hb) variants can involve multiple techniques. The use of semi-automated instruments that perform gel electrophoresis and staining, such as the SPIFE 3000 electrophoresis system, can greatly reduce the labor required for these commonly used techniques. We performed a comparison of the method involved in SPIFE 3000 system with those of manual gel electrophoresis. A total of 22 540 samples were analyzed using the SPIFE 3000, and compared with mobilities on cellulose acetate and citrate agar gels using standard manual methods. The results were compared using relative electrophoretic mobilities (REM). Of the 191 Hb variants identified, only 13 had REM that differed from manual electrophoresis when analyzed using the SPIFE 3000 system. One variant (Hb O-Indonesia) showed different mobility on both acid and alkaline gels, two (Hb E, Hb Sunshine Seth) on alkaline gel only, and 10 (Hbs N-Baltimore, N-Seattle, O-Arab, Shelby, Summer Hill, Tak, Hasharon, M-Iwate, Q-Iran, and Setif) on acid gels only. The SPIFE 3000 semi-automated electrophoresis system produces similar results when compared with those of standard manual electrophoresis methods.

  20. Mobile DNA elements in the generation of diversity and complexity in the brain.

    PubMed

    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H

    2014-08-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  1. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.

    2015-01-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  2. Arylsulfatase A: Relationship of genotype to variant electrophoretic properties

    SciTech Connect

    Park, D.S.; Poretz, R.D.; Ricketts, M.H.; Manowitz, P.

    1996-04-01

    Previous work has shown that specific electrophoretic variants of arylsulfatase A occur more frequently among alcoholic patients than among psychiatric and normal controls. The present study sequenced the gene for two of these electrophoretic variants, IIIa and IIIb. Both contain an A-to-G transition corresponding to substitution of Asn{sub 350} by Ser, with the resulting loss of an N -glycosylation site. The difference in electrophoretic mobility of their gene products is due to a mutation in the IIIb gene resulting in the replacement of Arg{sub 496} by His. Evidence is presented that individuals posessing either of two other electrophoretic variants, Va and Vb, are heterozygous for a normal ASA allele and either a IIIa or IIIb allele, respectively. Thus, the relationship between the phenotype of the electrophoretic banding patterns, IIIa, IIIb, Va, and Vb, and their corresponding genotypes has been elucidated. 18 refs., 5 figs., 1 tab.

  3. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.

    PubMed

    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh

    2015-10-01

    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  4. DNA electrophoresis in agarose gels: A new mobility vs. DNA length dependence

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin

    2002-04-01

    Separations were performed on double stranded DNA (dsDNA) using electrophoresis. Electrophoresis is the steady transport of particles under the influence of an external electric field. Double stranded DNA fragments ranging in length from 200 base pairs (bp) to 194,000 bp (0.34 nm = 1 bp) were electrophoresed at agarose gel concentrations T = 0.4%--1.5%. The electric field was varied from 0.62 V/cm to 6.21 V/cm. A wide range of electric fields and gel concentrations were used to study the usefulness of a new interpolation equation, 1mL =1mL-( 1mL-1 ms)e-L/g , where mL,ms , and g are independent free fitting parameters. The long length mobility limit is interpreted as mL , the short length mobility limit is ms , and g is the crossover between the long length limit and the short length limit. This exponential relation fit very well (chi2 ≥ 0.999) when there are two smooth transitions observed in the "reptation plots" (plotting 3mL/m∘ vs. L) (J. Rousseau, G. Drouin, and G. W. Slater, Phys Rev Lett. 1997, 79, 1945--1948). Fits deviate from the data when three different slopes were observed in the reptation plots. Reptation plots were used to determine a phase diagram for dsDNA migration regimes. The phase diagrams define different regions where mechanisms for molecular transport affect the migration of dsDNA in agarose gels during electrophoresis. The parameters from the equation have also been interpreted to provide a physical description of the structure of the agarose gel by calculating the pore sizes. The relations between the values for the pore sizes and the phase diagrams are interpreted to better understand the migration of the DNA through agarose gels.

  5. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    PubMed

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and

  6. Multistage Electrophoretic Separators

    NASA Technical Reports Server (NTRS)

    Thomas, Nathan; Doyle, John F.; Kurk, Andy; Vellinger, John C.; Todd, Paul

    2006-01-01

    A multistage electrophoresis apparatus has been invented for use in the separation of cells, protein molecules, and other particles and solutes in concentrated aqueous solutions and suspensions. The design exploits free electrophoresis but overcomes the deficiencies of prior free-electrophoretic separators by incorporating a combination of published advances in mathematical modeling of convection, sedimentation, electro-osmotic flow, and the sedimentation and aggregation of droplets. In comparison with other electrophoretic separators, these apparatuses are easier to use and are better suited to separation in relatively large quantities characterized in the art as preparative (in contradistinction to smaller quantities characterized in the art as analytical). In a multistage electrophoretic separator according to the invention, an applied vertical steady electric field draws the electrically charged particles of interest from within a cuvette to within a collection cavity that has been moved into position of the cuvette. There are multiple collection cavities arranged in a circle; each is aligned with the cuvette for a prescribed short time. The multistage, short-migration-path character of the invention solves, possibly for the first time, the fluid-instability problems associated with free electrophoresis. The figure shows a prototype multistage electrophoretic separator that includes four sample stations and five collection stages per sample. At each sample station, an aqueous solution or suspension containing charged species to be separated is loaded into a cuvette, which is machined into a top plate. The apparatus includes a lower plate, into which 20 collection cavities have been milled. Each cavity is filled with an electrophoresis buffer solution. For the collection of an electrophoretic fraction, the lower plate is rotated to move a designated collection cavity into alignment with the opening of the cuvette. An electric field is then applied between a non

  7. Disappearance of the negative charge in giant DNA with a folding transition.

    PubMed Central

    Yamasaki, Y; Teramoto, Y; Yoshikawa, K

    2001-01-01

    In the present study we measure the electrophoretic mobility of giant T4 DNA (166 kbp) by electrophoretic light scattering for the elongated and folded compact states at different spermidine (trivalent cation) concentrations in 50 mM sodium maleate buffer (pH 6.0). It is found that the electrophoretic mobility of elongated DNA in the absence of the multivalent cation is seven times greater than that of fully folded compact DNA, where, with the increase of the concentration of spermidine, an abrupt transition is generated after a gradual decrease of the mobility. An analysis of the electrophoretic mobility suggests that the folded compact DNA chains almost completely lose their negative charges, by taking into account the difference of friction mechanism between an elongated and folded compact state. From the single chain observation by use of fluorescence microscopy, it is found that a phase-segregated structure is generated at intermediate concentrations of spermidine. The gradual decrease of the electrophoretic mobility in the transition region is, thus, attributed to the formation of the segregated state, exhibiting partial electroneutralization in the folded part. Disappearance of the negative charges in the completely folded compact DNAs is discussed in relation to the mechanism of transition, in terms of a first-order phase transition. PMID:11371456

  8. Electrophoretic heterogeneity limits the utility of streptavidin-β-galactosidase as a probe in free zone capillary electrophoresis separations.

    PubMed

    Craig, Douglas B; Henderson, Anna

    2013-02-01

    Single molecule assays were performed on streptavidin-β-galactosidase using a capillary electrophoresis-based protocol in order to assess the suitability of single molecule β-galactosidase assays for adaptation to the detection of single copies of target DNA. The conjugate was found to have a heterogeneous catalytic rate, showing an average rate of 44,000 ± 24,000 min(-1), which is similar to that of the unmodified enzyme. Electrophoretic mobility was also measured on individual molecules and determined to be -1.32 × 10(-4) ± 0.19 × 10(-4) cm(2)V(-1)s(-1). The variance in mobility was several times that reported for the unmodified enzyme. The electrophoretic heterogeneity was found to result in the formation of a broad window of peaks in the resultant electropherograms of free zone separations of small plugs of streptavidin-β-galactosidase. This range of mobilities largely overlapped with that of the conjugate bound to primer and plasmid containing a target DNA sequence. This overlap suggests that the separation of free conjugate from that bound to target DNA, which is a requirement for application of the single enzyme molecule assay to the detection of target DNA sequences, is not plausible using free zone capillary electrophoresis.

  9. Optimization of the southern electrophoretic transfer method

    SciTech Connect

    Allison, M.A.; Fujimura, R.K.

    1987-01-01

    The technique of separating DNA fragments using agarose gel electrophoresis is essential in the analysis of nucleic acids. Further, after the method of transferring specific DNA fragments from those agarose gels to cellulose nitrate membranes was developed in 1975, a method was developed to transfer DNA, RNA, protein and ribonucleoprotein particles from various gels onto diazobenzyloxymethyl (DBM) paper using electrophoresis as well. This paper describes the optimum conditions for quantitative electrophoretic transfer of DNA onto nylon membranes. This method exemplifies the ability to hybridize the membrane more than once with specific RNA probes by providing sufficient retention of the DNA. Furthermore, the intrinsic properties of the nylon membrane allow for an increase in the efficiency and resolution of transfer while using somewhat harsh alkaline conditions. The use of alkaline conditions is of critical importance since we can now denature the DNA during transfer and thus only a short pre-treatment in acid is required for depurination. 9 refs., 7 figs.

  10. Electrophoretic Transport of Biomolecules through Carbon Nanotube Membranes

    PubMed Central

    Sun, Xinghua; Su, Xin; Wu, Ji; Hinds, Bruce J.

    2013-01-01

    Electrophoretic transport of proteins across electrochemically oxidized multi-walled carbon nanotube (MWCNT) membranes has been investigated. Small charged protein, lysozyme, was successfully pumped across MWCNT membranes by electric field while rejecting larger bovine serum albumin (BSA). Transport of the lysozome was reduced by a factor of about 30 in comparison to bulk mobility and consistent with prediction for hindered transport. Mobilities between 0.33-1.4×10-9 m2/V-s were observed and are approximately 10 fold faster than comparable ordered nanoporous membranes and are consistent with continuum models. For mixtures of BSA and lysozyme, complete rejection of BSA is seen with electrophoretic separations PMID:21338104

  11. Determination of the dissociation constants (pKa) of secondary and tertiary amines in organic media by capillary electrophoresis and their role in the electrophoretic mobility order inversion.

    PubMed

    Cantu, Marcelo Delmar; Hillebranda, Sandro; Carrilho, Emanuel

    2005-03-11

    Non-aqueous capillary electrophoresis (NACE) may provide a selectivity enhancement in separations since the analyte dissociation constants (pKa) in organic media are different from those in aqueous solutions. In this work, we have studied the inversion in mobility order observed in the separation of tertiary (imipramine (IMI) and amitryptiline (AMI)) and secondary amines (desipramine (DES) and nortryptiline (NOR)) in water, methanol, and acetonitrile. We have determined the pKa values in those solvents and the variation of dissociation constants with the temperature. From these data, and applying the Van't Hoff equation, we have calculated the thermodynamic parameters deltaH and deltaS. The pKa values found in methanol for DES, NOR, IMI, and AMI were 10.80, 10.79, 10.38, and 10.33, respectively. On the other hand, in acetonitrile an opposite relation was found since the values were 20.60, 20.67, 20.74, and 20.81 for DES, NOR, IMI, and AMI. This is the reason why a migration order inversion is observed in NACE for these solvents. The thermodynamic parameters were evaluated and presented a tendency that can be correlated with that observed for pKa values.

  12. The toxic effects of mobile phone radiofrequency (940 MHz) on the structure of calf thymus DNA.

    PubMed

    Hekmat, Azadeh; Saboury, Ali Akbar; Moosavi-Movahedi, Ali Akbar

    2013-02-01

    Currently, the biological effects of nonionizing electromagnetic fields (EMFs) including radiofrequency (RF) radiation have been the subject of numerous experimental and theoretical studies. The aim of this study is to evaluate the possible biological effects of mobile phone RF (940 MHz, 15 V/m and SAR=40 mW/kg) on the structure of calf thymus DNA (ct DNA) immediately after exposure and 2 h after 45 min exposure via diverse range of spectroscopic instruments. The UV-vis and circular dichroism (CD) experiments depict that mobile phone EMFs can remarkably cause disturbance on ct DNA structure. In addition, the DNA samples, immediately after exposure and 2 h after 45 min exposure, are relatively thermally unstable compared to the DNA solution, which was placed in a small shielded box (unexposed ct DNA). Furthermore, the exposed DNA samples (the DNA samples that were exposed to 940 MHz EMF) have more fluorescence emission when compared with the unexposed DNA, which may have occurred attributable to expansion of the exposed DNA structure. The results of dynamic light scattering (DLS) and zeta potential experiments demonstrate that RF-EMFs lead to increment in the surface charge and size of DNA. The structure of DNA immediately after exposure is not significantly different from the DNA sample 2 h after 45 min exposure. In other words, the EMF-induced conformational changes are irreversible. Collectively, our results reveal that 940 MHz can alter the structure of DNA. The displacement of electrons in DNA by EMFs may lead to conformational changes of DNA and DNA disaggregation. Results from this study could have an important implication on the health effects of RF-EMFs exposure. In addition, this finding could proffer a novel strategy for the development of next generation of mobile phone.

  13. Electrophoretic Light Scattering: Instrumentation and Application to the Measurement of the Electric Charge of Human Blood Cells.

    DTIC Science & Technology

    1982-03-15

    blood cells Human Blood cells- . . .. . Platelets Electric charge Electrophoretic mobility 20. ABSTRACT (Continue on reverse side If necessary and...the electrophoretic mobility of human blood cells and platelets . The technique is called Electrophoretic Light Scattering (ELS), and the measurement...predictive value in ascertaining the quality of preserved red blood cells and platelets . It was found that neither liquid storage (up to 30 days) nor

  14. Effects of Crowder Structure and Salt on DNA Mobility and Conformation in Crowded Environments

    NASA Astrophysics Data System (ADS)

    Gorczyca, Stephanie M.; Robertson-Anderson, Rae M.

    Biological cells are crowded environments in which DNA must move through to perform specific functions. We study how the properties of crowded cell-like environments impact DNA dynamics by tracking individual 115 kbp ring and linear DNA in different crowded environments using single-molecule fluorescence microscopy. We determine the role of crowder structure and salt on DNA diffusion and conformation by measuring the mean-squared center-of-mass displacements, as well as the conformational shape, size, and fluctuations of each molecule. Previously, we used 10 and 500 kDa dextran as crowders and showed that mobility of both ring and linear DNA decreased exponentially with increased crowding, but rings compact while linear DNA elongate. These effects were dependent solely on the reduction in available volume for DNA rather than size or number of crowders. Here we use crowders of similar molecular weight, but different structure to dextran (10 kDa PEG and 400 kDa Ficoll). We find that DNA mobility reduction is independent of crowder structure and that ring and linear DNA undergo more significant compaction. Finally, we characterize the role of salt on DNA mobility and conformation to determine the relative roles of enthalpic versus entropic effects on crowding-induced DNA dynamics. This research was funded by the AFOSR Young Investigator Program, Grant No. FA95550-12-1-0315 and the Arnold and Mabel Beckman Scholarship Foundation.

  15. CRISPR-Cas immunity and mobile DNA: a new superfamily of DNA transposons encoding a Cas1 endonuclease.

    PubMed

    Hickman, Alison B; Dyda, Fred

    2014-01-01

    Mobile genetic elements such as DNA transposons are a feature of most genomes. The existence of novel DNA transposons can be inferred when whole genome sequencing reveals the presence of hallmarks of mobile elements such as terminal inverted repeats (TIRs) flanked by target site duplications (TSDs). A recent report describes a new superfamily of DNA transposons in the genomes of a few bacteria and archaea that possess TIRs and TSDs, and encode several conserved genes including a cas1 endonuclease gene, previously associated only with CRISPR-Cas adaptive immune systems. The data strongly suggests that these elements, designated 'casposons', are likely to be bona fide DNA transposons and that their Cas1 nucleases act as transposases and are possibly still active.

  16. High-performance capillary electrophoretic method for the quantification of 5-methyl 2'-deoxycytidine in genomic DNA: application to plant, animal and human cancer tissues.

    PubMed

    Fraga, Mario F; Uriol, Esther; Borja Diego, L; Berdasco, María; Esteller, Manel; Cañal, María Jesús; Rodríguez, Roberto

    2002-06-01

    A new approach to the evaluation of the relative degree of genomic DNA methylation through the quantification of 2'-deoxynucleosides is proposed. Detection and quantification of 5-methyl 2'-deoxycytidine in genomic DNA has been performed using micellar high-performance capillary electrophoresis (HPCE) with UV-Vis detection. This approach has been demonstrated to be more sensitive and specific than other HPCE methods for the quantification of DNA methylation degree and also to be faster than other HPLC-based methods. The detection and quantification of nucleosides through enzymatic hydrolyses notably increases the specificity of the technique and allows its exploitation in the analysis of poorly purified and/or concentrated DNA samples such as those obtained from meristematic plant regions and paraffin-embedded tissues.

  17. INFLUENCE OF BORATE BUFFERS ON THE ELECTROPHORETIC BEHAVIOR OF HUMIC SUBSTANCES IN CAPILLARY ZONE ELECTROPHORESIS

    EPA Science Inventory

    The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...

  18. Draft Genome Sequences of Eight Nontypeable Haemophilus influenzae Strains Previously Characterized Using an Electrophoretic Typing Scheme.

    PubMed

    Mussa, Huda J; VanWagoner, Timothy M; Morton, Daniel J; Seale, Thomas W; Whitby, Paul W; Stull, Terrence L

    2015-11-25

    Nontypeable Haemophilus influenzae is an important cause of human disease. Strains were selected for genome sequencing to represent the breadth of nontypeable strains within the species, as previously defined by the electrophoretic mobility of 16 metabolic enzymes.

  19. Draft Genome Sequences of Eight Nontypeable Haemophilus influenzae Strains Previously Characterized Using an Electrophoretic Typing Scheme

    PubMed Central

    Mussa, Huda J.; VanWagoner, Timothy M.; Seale, Thomas W.; Whitby, Paul W.; Stull, Terrence L.

    2015-01-01

    Nontypeable Haemophilus influenzae is an important cause of human disease. Strains were selected for genome sequencing to represent the breadth of nontypeable strains within the species, as previously defined by the electrophoretic mobility of 16 metabolic enzymes. PMID:26607889

  20. Electrophoretic deposition of biomaterials

    PubMed Central

    Boccaccini, A. R.; Keim, S.; Ma, R.; Li, Y.; Zhitomirsky, I.

    2010-01-01

    Electrophoretic deposition (EPD) is attracting increasing attention as an effective technique for the processing of biomaterials, specifically bioactive coatings and biomedical nanostructures. The well-known advantages of EPD for the production of a wide range of microstructures and nanostructures as well as unique and complex material combinations are being exploited, starting from well-dispersed suspensions of biomaterials in particulate form (microsized and nanoscale particles, nanotubes, nanoplatelets). EPD of biological entities such as enzymes, bacteria and cells is also being investigated. The review presents a comprehensive summary and discussion of relevant recent work on EPD describing the specific application of the technique in the processing of several biomaterials, focusing on (i) conventional bioactive (inorganic) coatings, e.g. hydroxyapatite or bioactive glass coatings on orthopaedic implants, and (ii) biomedical nanostructures, including biopolymer–ceramic nanocomposites, carbon nanotube coatings, tissue engineering scaffolds, deposition of proteins and other biological entities for sensors and advanced functional coatings. It is the intention to inform the reader on how EPD has become an important tool in advanced biomaterials processing, as a convenient alternative to conventional methods, and to present the potential of the technique to manipulate and control the deposition of a range of nanomaterials of interest in the biomedical and biotechnology fields. PMID:20504802

  1. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Astrophysics Data System (ADS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Todd, P.; Wilfinger, W.; Grindeland, R.; Lewis, M. L.

    A Continuous Flow Electrophoresis System (CFES) was used on Space Shuttle flight STS-8 to separate specific secretory cells from suspensions of cultured primary human embryonic kidney cells and rat pituitary cells. The objectives were to isolate the subfractions of kidney cells that produce the largest amounts of urokinase (plasminogen activator), and to isolate the subfractions of rat pituitary cells that secrete growth hormone, prolactin, and other hormones. Kidney cells were separated into more than 32 fractions in each of two electrophoretic runs. Electrophoretic mobility distributions in flight experiments were spread more than the ground controls. Multiple assay methods confirmed that all cultured kidney cell fractions produced some urokinase, and five to six fractions produced significantly more urokinase than the other fractions. Several fractions also produced tissue plasminogen activator. The pituitary cells were separated into 48 fractions in each of the two electrophoretic runs, and the amounts of growth hormone (GH) and prolactin (PRL) released into the medium for each cell fraction were determined. Cell fractions were grouped into eight mobility classes and immunocytochemically assayed for the presence of GH, PRL, ACTH, LH, TSH, and FSH. The patterns of hormone distribution indicate that the specialized cells producing GH and PRL are isolatable due to the differences in electrophoretic mobilities.

  2. Two high-mobility group box domains act together to underwind and kink DNA

    SciTech Connect

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  3. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  4. The free solution mobility of DNA and other analytes varies as the logarithm of the fractional negative charge.

    PubMed

    Stellwagen, Nancy C; Peters, Justin P; Dong, Qian; Maher, L James; Stellwagen, Earle

    2014-07-01

    The free solution mobilities of ssDNA and dsDNA molecules with variable charge densities have been measured by CE. DNA charge density was modified either by appending positively or negatively charged groups to the thymine residues in a 98 bp DNA molecule, or by replacing some of the negatively charged phosphate internucleoside linkers in small ssDNA or dsDNA oligomers with positively charged phosphoramidate linkers. Mobility ratios were calculated for each dataset by dividing the mobility of a charge variant by the mobility of its unmodified parent DNA. Mobility ratios essentially eliminate the effect of the BGE on the observed mobility, making it possible to compare analytes measured under different experimental conditions. Neutral moieties attached to the thymine residues in the 98-bp DNA molecule had little or no effect on the mobility ratios, indicating that bulky substituents in the DNA major groove do not affect the mobility significantly. The mobility ratios observed for the thymine-modified and linker-modified DNA charge variants increased approximately linearly with the logarithm of the fractional negative charge of the DNA. Mobility ratios calculated from previous studies of linker-modified DNA charge variants and small multicharged organic molecules also increased approximately linearly with the logarithm of the fractional negative charge of the analyte. The results do not agree with the Debye-Hückel-Onsager theory of electrophoresis, which predicts that the mobility of an analyte should depend linearly on analyte charge, not the logarithm of the charge, when the frictional coefficient is held constant.

  5. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    NASA Astrophysics Data System (ADS)

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies.

  6. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    PubMed Central

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies. PMID:28094784

  7. SWI/SNF- and RSC-catalyzed nucleosome mobilization requires internal DNA loop translocation within nucleosomes.

    PubMed

    Liu, Ning; Peterson, Craig L; Hayes, Jeffrey J

    2011-10-01

    The multisubunit SWI/SNF and RSC complexes utilize energy derived from ATP hydrolysis to mobilize nucleosomes and render the DNA accessible for various nuclear processes. Here we test the idea that remodeling involves intermediates with mobile DNA bulges or loops within the nucleosome by cross-linking the H2A N- or C-terminal tails together to generate protein "loops" that constrict separation of the DNA from the histone surface. Analyses indicate that this intranucleosomal cross-linking causes little or no change in remodeling-dependent exposure of DNA sequences within the nucleosome to restriction enzymes. However, cross-linking inhibits nucleosome mobilization and blocks complete movement of nucleosomes to extreme end positions on the DNA fragments. These results are consistent with evidence that nucleosome remodeling involves intermediates with DNA loops on the nucleosome surface but indicate that such loops do not freely diffuse about the surface of the histone octamer. We propose a threading model for movement of DNA loops around the perimeter of the nucleosome core.

  8. Electrophoretic approach to the biochemical systematics of gammarids

    NASA Astrophysics Data System (ADS)

    Bulnheim, H.-P.; Scholl, A.

    1981-12-01

    By utilizing the techniques for electrophoretic separation of proteins by vertical starch gels, the biochemical systematics of 10 Gammaridae species obtained from marine, brackish and freshwater habitats was studied. They included Chaetogammarus marinus, Gammarus zaddachi, G. salinus, G. oceanicus, G. tigrinus, G. chevreuxi, G. locusta, G. duebeni duebeni, G. d. celticus, G. pulex pulex, and G. fossarum. For comparison of electrophoretic mobilities selected enzymes (phosphoglucose isomerase, glutamate oxalacetate transaminase, arginine phosphokinase, hexokinase, leucine amino peptidase, mannose 6-phosphate isomerase) were assayed. They were used as diagnostic characters in terms of electrophoretic identities or diversities of most frequent alleles at polymorphic gene loci. These criteria could be applied to estimate intrageneric enzymic variation and degrees of genetic relatedness between the crustacean amphipod species under consideration, thereby complementing traditional morphological classification.

  9. Epigenetic control of mobile DNA as an interface between experience and genome change

    PubMed Central

    Shapiro, James A.

    2014-01-01

    Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration. PMID:24795749

  10. Single DNA imaging and length quantification through a mobile phone microscope

    NASA Astrophysics Data System (ADS)

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2016-03-01

    The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

  11. Effect of ultrasound on the separation of DNA fragments in agarose gel electrophoresis

    SciTech Connect

    Ma, Yinfa; Yeung, E.S. )

    1990-06-01

    Since its first use in 1966 interest in and the applications of electrophoresis of DNA fragments in agarose gel have grown rapidly. Nowadays, agarose gel electrophoresis has become a standard technique with high resolving power for the analysis of DNA structure, for example for the determination of the length of DNA fragments obtained by the action of restriction enzymes. The electrophoretic mobility ({mu}) of DNA fragments is influenced by various parameters-molecular weight, gel concentration, temperature, electric field, and DNA-agarose affinity. A comprehensive study of the influence of these main parameters has been reported. In this paper, the authors investigate a new effect on the electrophoretic mobility of DNA fragments in agarose gels, viz. the influence of ultrasound.

  12. Skeleton versus fine earth: what information is stored in the mobile extracellular soil DNA fraction?

    NASA Astrophysics Data System (ADS)

    Ascher, Judith; Ceccherini, Maria Teresa; Agnelli, Alberto; Corti, Guiseppe; Pietramellara, Giacomo

    2010-05-01

    The soil genome consists of an intracellular and an extracellular fraction. Recently, soil extracellular DNA (eDNA) has been shown to be quantitatively relevant, with a high survival capacity and mobility, playing a crucial role in the gene transfer by transformation, in the formation of bacterial biofilm and as a source of nutrients for soil microorganisms. The eDNA fraction can be discriminated and classified by its interaction with clay minerals, humic acids and Al/Fe oxihydroxides, resulting in differently mobile components. The eDNA extractable in water, classified as DNA free in the extracellular soil environment or adsorbed on soil colloids (eDNAfree/adsorbed), is hypothesized to be the most mobile DNA in soil. Challenging to assess the information stored in this DNA fraction, eDNAfree/adsorbed was recovered from fine earth (< 4 mm) and highly altered rock fragments or skeleton (4-10 mm) of six consecutive horizons (A1-BCb2) of a forest soil profile by washing the two soil fractions with H2O. Quantitative analysis have been conducted in terms of DNA yields (fluorimeter and spectrophotometer), molecular weight and fragment length distribution (gel electrophoresis), and qualitative analysis in terms of the composition and distribution of fungal and bacterial communities (Denaturing Gradient Gel Electrophoresis- fingerprinting). The mobile soil eDNA, extracted from each horizon, was characterised by low molecular weight (< 2 kb) and amounts ranging from 3.96 (±0.179) to 0.17 (±0.023) µg g-1 for the fine earth and from 1.42 (±0.111) to 0.11 (±0.007) µg g-1 for the skeleton. Genetic fingerprinting of eDNA recovered from fine earth and skeleton revealed characteristic fungal and bacterial communities of each horizon, but also similarities among the microbial communities of both soil fractions and horizons. This could be interpreted also as a result of the movement of eDNA along the soil profile and from fine earth to skeleton. The molecular characterization

  13. Analysis of electrophoretic patterns of arbitrarily primed PCR profiling.

    PubMed

    Trifunović, Dragana; Radović, Milan; Ristić, Zoran; Guzvić, Miodrag; Dimitrijević, Bogomir

    2005-11-01

    We present a mathematical algorithm for the analysis of electrophoretic patterns resulting from arbitrarily primed PCR profiling. The algorithm is based on the established mathematical procedures applied to the analysis of digital images of gel patterns. The algorithm includes (a) transformation of the image into a matrix form, (b) identification of every electrophoretic lane as a set of matrix columns that are further mathematically processed, (c) averaging of matrix columns corresponding to electrophoretic lanes that define lane representatives, (d) elimination of "smiling" bands, (e) solving the problem of a lane offset, and (f) removal of the background. Representation of individual electrophoretic lanes in the form of functions allows interlane comparisons and further mathematical analysis. Direct comparison of selected lanes was obtained by employing correlation analysis. Gel images were those obtained after arbitrarily primed PCR analysis of DNA that underwent damage induced by gamma radiation from a (60)Co source. The applied method proved to be useful for elimination of subjectivity of visual inspection. It offers the possibility to avoid overlooking important differences in case of suboptimal electrophoretic resolution. In addition, higher precision is achieved in the assessment of quantitative differences due to better insight into experimental artifacts. These simple mathematical methods offer an open-type algorithm, i.e., this algorithm enables easy implementation of different parameters that may be useful for other analytical needs.

  14. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  15. Electrophoretic Deposition for Fabricating Microbatteries

    NASA Technical Reports Server (NTRS)

    West, William; Whitacre, Jay; Bugga, Ratnakumar

    2003-01-01

    An improved method of fabrication of cathodes of microbatteries is based on electrophoretic deposition. Heretofore, sputtering (for deposition) and the use of photoresist and liftoff (for patterning) have been the primary methods of fabricating components of microbatteries. The volume of active electrode material that can be deposited by sputtering is limited, and the discharge capacities of prior microbatteries have been limited accordingly. In addition, sputter deposition is slow. In contrast, electrophoretic deposition is much faster and has shown promise for increasing discharge capacities by a factor of 10, relative to those of microbatteries fabricated by prior methods.

  16. Electrophoretic Retardation of Colloidal Particles in Nonpolar Liquids

    NASA Astrophysics Data System (ADS)

    Strubbe, Filip; Beunis, Filip; Brans, Toon; Karvar, Masoumeh; Woestenborghs, Wouter; Neyts, Kristiaan

    2013-04-01

    We have measured the electrophoretic mobility of single, optically trapped colloidal particles, while gradually depleting the co-ions and counterions in the liquid around the particle by applying a dc voltage. This is achieved in a nonpolar liquid, where charged reverse micelles act as co-ions and counterions. By increasing the dc voltage, the mobility first increases when the concentrations of co-ions and counterions near the particle start to decrease. At sufficiently high dc voltage (around 2 V), the mobility reaches a saturation value when the co-ions and counterions are fully separated. The increase in mobility is larger when the equilibrium ionic strength is higher. The dependence of the experimental data on the equilibrium ionic strength and on the applied voltage is in good agreement with the standard theory of electrophoretic retardation, assuming that the bare particle charge remains constant. This method is useful for studying the electrophoretic retardation effect and charging mechanisms for nonpolar colloids, and it sheds light on previously unexplained particle acceleration in electronic ink devices.

  17. Electrophoretic Analysis of Histones from Gibberellic Acid-treated Dwarf Peas

    PubMed Central

    Spiker, Steven; Chalkley, Roger

    1971-01-01

    Histones from the epicotyls of light-grown dwarf peas (Pisum sativum L. cv. Little Marvel) which had been treated with gibberellic acid were compared to histones from control dwarf peas by the method of polyacrylamide gel electrophoresis. The histone complements were found to be unaltered in the electrophoretic mobility and relative quantity of the individual fractions. The ratio of histone to DNA was also unaffected by treatment with gibberellic acid. The investigation confirmed earlier reports that over 95% of the histone of peas is contained in seven molecular species and that one of these can exist both as an oxidized disulfide dimer and as a reduced monomer. Evidence is presented which indicates that only the monomer form exists in vivo in the pea epicotyl tissue and that the oxidized dimer is an artifact of extraction. The implications of the data concerning the mechanism of action of gibberellic acid are discussed. Images PMID:16657619

  18. Electrophoretic Process For Purifying Wastewater

    NASA Technical Reports Server (NTRS)

    Sammons, David W.; Twitty, Garland E.; Sharnez, Rizwan; Egen, Ned B.

    1992-01-01

    Microbes, poisonous substances, and colloidal particles removed by combination of electric fields. Electrophoretic process removes pathogenicorganisms, toxins, toxic metals, and cooloidal soil particles from wastewater. Used to render domestic, industrial, and agricultural wastewater streams potable. Process also useful in bioregenerative and other closed systems like in space stations and submarines, where water must be recycled.

  19. Characterization of exogenous DNA mobility in live cells through fluctuation correlation spectroscopy.

    PubMed

    Mieruszynski, Stephen; Digman, Michelle A; Gratton, Enrico; Jones, Mark R

    2015-09-10

    The spatial-temporal dynamics of delivered DNA is a critical aspect influencing successful gene delivery. A comprehensive model of DNA lipoplex trafficking through live cells has yet to be demonstrated. Here the bioimaging approaches Raster Image Correlation Spectroscopy (RICS) and image-Means Square Displacement (iMSD) were applied to quantify DNA mechanical dynamics in live cells. DNA lipoplexes formed from DNA with a range of 21 bp to 5.5 kbp exhibited a similar range of motion within the cytoplasm of myoblast cells regardless of size. However, the rate of motion was dictated by the intracellular location, and DNA cluster size. This analysis demonstrated that the different transport mechanisms either had a size dependent mobility, including random diffusion, whereas other mechanisms were not influenced by the DNA size such as active transport. The transport mechanisms identified followed a spatial dependence comparable to viral trafficking of non-active transport mechanism upon cellular entry, active transport within the cytoplasm and further inactive transportation along the peri-nuclear region. This study provides the first real-time insight into the trafficking of DNA delivered through lipofection using image-based fluctuation correlation spectroscopy approaches. Thereby, gaining information with single particle sensitivity to develop a deeper understanding of DNA lipoplex delivery through the cell.

  20. Characterization of exogenous DNA mobility in live cells through fluctuation correlation spectroscopy

    PubMed Central

    Mieruszynski, Stephen; Digman, Michelle A.; Gratton, Enrico; Jones, Mark R

    2015-01-01

    The spatial-temporal dynamics of delivered DNA is a critical aspect influencing successful gene delivery. A comprehensive model of DNA lipoplex trafficking through live cells has yet to be demonstrated. Here the bioimaging approaches Raster Image Correlation Spectroscopy (RICS) and image-Means Square Displacement (iMSD) were applied to quantify DNA mechanical dynamics in live cells. DNA lipoplexes formed from DNA with a range of 21 bp to 5.5 kbp exhibited a similar range of motion within the cytoplasm of myoblast cells regardless of size. However, the rate of motion was dictated by the intracellular location, and DNA cluster size. This analysis demonstrated that the different transport mechanisms either had a size dependent mobility, including random diffusion, whereas other mechanisms were not influenced by the DNA size such as active transport. The transport mechanisms identified followed a spatial dependence comparable to viral trafficking of non-active transport mechanism upon cellular entry, active transport within the cytoplasm and further inactive transportation along the peri-nuclear region. This study provides the first real-time insight into the trafficking of DNA delivered through lipofection using image-based fluctuation correlation spectroscopy approaches. Thereby, gaining information with single particle sensitivity to develop a deeper understanding of DNA lipoplex delivery through the cell. PMID:26354725

  1. Two-dimensional agarose gel electrophoresis of DNA topoisomers.

    PubMed

    Roca, Joaquim

    2009-01-01

    The electrophoretic velocity of a duplex DNA ring is mainly determined by its overall shape. Consequently, DNA topoisomers of opposite supercoiling handedness can have identical gel velocity, and topoisomers highly supercoiled cannot be separated beyond some point. These problems are overcome by two-dimensional agarose gel electrophoresis, which involves two successive electrophoresis steps in one gel slab. The first and second electrophoresis steps are conducted in orthogonal directions with different concentrations of DNA intercalating agents. These compounds alter the overall shape of the DNA and, thereby, change the relative mobility of individual DNA topoisomers.

  2. Single-molecule studies of high-mobility group B architectural DNA bending proteins.

    PubMed

    Murugesapillai, Divakaran; McCauley, Micah J; Maher, L James; Williams, Mark C

    2017-02-01

    Protein-DNA interactions can be characterized and quantified using single molecule methods such as optical tweezers, magnetic tweezers, atomic force microscopy, and fluorescence imaging. In this review, we discuss studies that characterize the binding of high-mobility group B (HMGB) architectural proteins to single DNA molecules. We show how these studies are able to extract quantitative information regarding equilibrium binding as well as non-equilibrium binding kinetics. HMGB proteins play critical but poorly understood roles in cellular function. These roles vary from the maintenance of chromatin structure and facilitation of ribosomal RNA transcription (yeast high-mobility group 1 protein) to regulatory and packaging roles (human mitochondrial transcription factor A). We describe how these HMGB proteins bind, bend, bridge, loop and compact DNA to perform these functions. We also describe how single molecule experiments observe multiple rates for dissociation of HMGB proteins from DNA, while only one rate is observed in bulk experiments. The measured single-molecule kinetics reveals a local, microscopic mechanism by which HMGB proteins alter DNA flexibility, along with a second, much slower macroscopic rate that describes the complete dissociation of the protein from DNA.

  3. Nanoscale histone localization in live cells reveals reduced chromatin mobility in response to DNA damage

    PubMed Central

    Liu, Jing; Vidi, Pierre-Alexandre; Lelièvre, Sophie A.; Irudayaraj, Joseph M. K.

    2015-01-01

    ABSTRACT Nuclear functions including gene expression, DNA replication and genome maintenance intimately rely on dynamic changes in chromatin organization. The movements of chromatin fibers might play important roles in the regulation of these fundamental processes, yet the mechanisms controlling chromatin mobility are poorly understood owing to methodological limitations for the assessment of chromatin movements. Here, we present a facile and quantitative technique that relies on photoactivation of GFP-tagged histones and paired-particle tracking to measure chromatin mobility in live cells. We validate the method by comparing live cells to ATP-depleted cells and show that chromatin movements in mammalian cells are predominantly energy dependent. We also find that chromatin diffusion decreases in response to DNA breaks induced by a genotoxic drug or by the ISceI meganuclease. Timecourse analysis after cell exposure to ionizing radiation indicates that the decrease in chromatin mobility is transient and precedes subsequent increased mobility. Future applications of the method in the DNA repair field and beyond are discussed. PMID:25501817

  4. 53BP1 and the LINC Complex Promote Microtubule-Dependent DSB Mobility and DNA Repair.

    PubMed

    Lottersberger, Francisca; Karssemeijer, Roos Anna; Dimitrova, Nadya; de Lange, Titia

    2015-11-05

    Increased mobility of chromatin surrounding double-strand breaks (DSBs) has been noted in yeast and mammalian cells but the underlying mechanism and its contribution to DSB repair remain unclear. Here, we use a telomere-based system to track DNA damage foci with high resolution in living cells. We find that the greater mobility of damaged chromatin requires 53BP1, SUN1/2 in the linker of the nucleoskeleton, and cytoskeleton (LINC) complex and dynamic microtubules. The data further demonstrate that the excursions promote non-homologous end joining of dysfunctional telomeres and implicated Nesprin-4 and kinesins in telomere fusion. 53BP1/LINC/microtubule-dependent mobility is also evident at irradiation-induced DSBs and contributes to the mis-rejoining of drug-induced DSBs in BRCA1-deficient cells showing that DSB mobility can be detrimental in cells with numerous DSBs. In contrast, under physiological conditions where cells have only one or a few lesions, DSB mobility is proposed to prevent errors in DNA repair.

  5. Electrophoretic separation of a class of nucleosomes enriched in HMG 14 and 17 and actively transcribed globin genes.

    PubMed Central

    Albanese, I; Weintraub, H

    1980-01-01

    Monomer nucleosomes from chick erythrocytes can be fractionated according to their electrophoretic mobility in (comparatively) high salt acrylamide gels. We show that the fractionation is based predominantly on differences in charge. The monomer heterogeneity persists even when the nucleosomes are trimmed down to 145 bp with Exo III or when H1 and H5 are removed. The slowest migrating monomers are associated with HMG 14 and 17; however, we do not believe that these proteins are entirely responsible for the altered mobility since the nucleosome heterogeneity persists even after removal of HMG 14 and 17. The DNA associated with the HMG 14 and 17 containing nucleosomes is shown to be enriched in actively transcribed globin sequences. Images PMID:6448987

  6. Identification and quantitation of morphological cell types in electrophoretically separated human embryonic kidney cell cultures

    NASA Technical Reports Server (NTRS)

    Williams, K. B.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.

  7. On the flow field about an electrophoretic particle

    NASA Astrophysics Data System (ADS)

    Orsini, Gabriele; Tricoli, Vincenzo

    2012-10-01

    The flow field about an electrophoretic body is theoretically investigated by analytical methods. An effective boundary condition for the electric potential at particle surface is derived. This condition, which generalizes the one obtained by Levich [Physicochemical Hydrodynamics (Prentice-Hall, Englewood Cliffs, 1962), Chap. 9, p. 475], captures the effect of (convective and electromigratory) surface current in the Debye layer and is valid as far as it is legitimate to neglect ion-concentration gradient in the bulk liquid. Conditions for negligible concentration gradients are also presented and discussed. The effect of surface current determines a deviation from Morrison's "classical" theory, which predicts irrotational flow-field for any particle shape with electrophoretic velocity given by the well-known Smoluchowski formula and always directed along the applied electric field. It is shown here that in the presence of the above effect the irrotationality of the flow field is not preserved if the particle surface has non-uniform curvature. However, irrotational flow-field still subsists for a sphere and a cylinder and is analytically determined in terms of a new non-dimensional parameter, referred to as the electrophoretic number. The case of spheroidal objects is also examined in detail. In this case the flow field, though not strictly irrotational, is shown to be nearly approximated by an irrotational flow-field, which is also determined over wide ranges of electrophoretic number and spheroid aspect ratio. The quality of this approximation is expressed as a relative error on the Helmholtz-Smoluchowski condition and numerically evaluated both in longitudinal and transverse configuration. The limiting cases of spheroid degenerating into a needle and a disk are also addressed. In all above cases the respective mobilities deviate from Smoluchowski's formula and depend on the electrophoretic number. An important effect of surface ion-transport in the double layer is

  8. Sensitive and robust electrophoretic NMR: Instrumentation and experiments

    NASA Astrophysics Data System (ADS)

    Hallberg, Fredrik; Furó, István; Yushmanov, Pavel V.; Stilbs, Peter

    2008-05-01

    Although simple as a concept, electrophoretic NMR (eNMR) has so far failed to find wider application. Problems encountered are mainly due to disturbing and partly irreproducible convection-like bulk flow effects from both electro-osmosis and thermal convection. Additionally, bubble formation at the electrodes and rf noise pickup has constrained the typical sample geometry to U-tube-like arrangements with a small filling factor and a low resulting NMR sensitivity. Furthermore, the sign of the electrophoretic mobility cancels out in U-tube geometries. We present here a new electrophoretic sample cell based on a vertically placed conventional NMR sample tube with bubble-suppressing palladium metal as electrode material. A suitable radiofrequency filter design prevents noise pickup by the NMR sample coil from the high-voltage leads which extend into the sensitive sample volume. Hence, the obtained signal-to-noise ratio of this cell is one order of magnitude higher than that of our previous U-tube cells. Permitted by the retention of the sign of the displacement-related signal phase in the new cell design, an experimental approach is described where bulk flow effects by electro-osmosis and/or thermal convection are compensated through parallel monitoring of a reference signal from a non-charged species in the sample. This approach, together with a CPMG-like pulse train scheme provides a superior first-order cancellation of non-electrophoretic bulk flow effects.

  9. Design Modification of Electrophoretic Equipment

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1973-01-01

    The improved design of a zone electrophoretic sampler is reported that can be used in mass screening for hemoglobin S, the cause of sickle cell anemia. Considered is a high voltage multicell cellulose acetate device that requires 5 to 6 minutes electrophoresis periods; cells may be activitated individually or simultaneously. A multisample hemoglobin applicator standardizes the amount of sample applied and transfers the homolysate to the electrical wires.

  10. New directions in electrophoretic methods

    SciTech Connect

    Forgensen, J.W.; Phillips, M.

    1987-01-01

    This text presents the state of art of electrophoretic technology and applications. Included are electrophoresis in polyacrylamide gels; immobilized pH gradients; rehydratable polyacrylamide gels; silver-stain detection of proteins; color silver staining of polypeptides; electrophoresis and electrofocusing standards; standardization in isoelectric focusing, high-resolution, two-dimensional electrophoresis; applications of isoelectric focusing; agarose gel electrophoresis; pulsed electrophoresis; capillary zone electrophoresis; capillary isotachophoresis; isotachophoresis of synthetic ion-containing polymers; and preparative electrophoresis.

  11. Mobile Phone Radiation Induces Reactive Oxygen Species Production and DNA Damage in Human Spermatozoa In Vitro

    PubMed Central

    De Iuliis, Geoffry N.; Newey, Rhiannon J.; King, Bruce V.; Aitken, R. John

    2009-01-01

    Background In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. Principal Findings Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR) tuned to 1.8 GHz and covering a range of specific absorption rates (SAR) from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001). Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. Conclusions RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications for the safety of

  12. Universal scaling of crowding-induced DNA mobility is coupled with topology-dependent molecular compaction and elongation.

    PubMed

    Gorczyca, Stephanie M; Chapman, Cole D; Robertson-Anderson, Rae M

    2015-10-21

    Using single-molecule fluorescence microscopy and particle-tracking techniques, we elucidate the role DNA topology plays in the diffusion and conformational dynamics of crowded DNA molecules. We focus on large (115 kbp), double-stranded ring and linear DNA crowded by varying concentrations (0-40%) of dextran (10, 500 kDa) that mimic cellular conditions. By tracking the center-of-mass and measuring the lengths of the major and minor axes of single DNA molecules, we characterize both DNA mobility reduction as well as crowding-induced conformational changes (from random spherical coils). We reveal novel topology-dependent conformations, with single ring molecules undergoing compaction to ordered spherical configurations ∼20% smaller than dilute random coils, while linear DNA elongates by ∼2-fold. Surprisingly, these highly different conformations result in nearly identical exponential mobility reduction dependent solely on crowder volume fraction Φ, revealing a universal critical crowding concentration of Φc≅ 2.3. Beyond Φc DNA exhibits topology-independent conformational relaxation dynamics despite highly distinct topology-driven conformations. Our collective results reveal that topology-dependent conformational changes, unique to crowded environments, enable DNA to overcome the classically expected mobility reduction that high-viscosity crowded environments impose. Such coupled universal dynamics suggest a mechanism for DNA to maintain sufficient mobility required for wide-ranging biological processes despite severe cellular crowding.

  13. DSB (Im)mobility and DNA repair compartmentalization in mammalian cells.

    PubMed

    Lemaître, Charlène; Soutoglou, Evi

    2015-02-13

    Chromosomal translocations are considered as causal in approximately 20% of cancers. Therefore, understanding their mechanisms of formation is crucial in the prevention of carcinogenesis. The first step of translocation formation is the concomitant occurrence of double-strand DNA breaks (DSBs) in two different chromosomes. DSBs can be repaired by different repair mechanisms, including error-free homologous recombination (HR), potentially error-prone non-homologous end joining (NHEJ) and the highly mutagenic alternative end joining (alt-EJ) pathways. Regulation of DNA repair pathway choice is crucial to avoid genomic instability. In yeast, DSBs are mobile and can scan the entire nucleus to be repaired in specialized DNA repair centers or if they are persistent, in order to associate with the nuclear pores or the nuclear envelope where they can be repaired by specialized repair pathways. DSB mobility is limited in mammals; therefore, raising the question of whether the position at which a DSB occurs influences its repair. Here, we review the recent literature addressing this question. We first present the reports describing the extent of DSB mobility in mammalian cells. In a second part, we discuss the consequences of non-random gene positioning on chromosomal translocations formation. In the third part, we discuss the mobility of heterochromatic DSBs in light of our recent data on DSB repair at the nuclear lamina, and finally, we show that DSB repair compartmentalization at the nuclear periphery is conserved from yeast to mammals, further pointing to a role for gene positioning in the outcome of DSB repair. When regarded as a whole, the different studies reviewed here demonstrate the importance of nuclear architecture on DSB repair and reveal gene positioning as an important parameter in the study of tumorigenesis.

  14. Preparation of Panel and Charged Particles for Electrophoretic Display

    NASA Astrophysics Data System (ADS)

    Choi, Hyung Suk; Park, Jin Woo; Park, Lee Soon; Lee, Jung Kyung; Han, Yoon Soo; Kwon, Younghwan

    Studies on the formulation of photosensitive paste for transparent soft mold press (TSMP) method have been performed. With the optimum formulation of the photosensitive paste the box-type barrier rib with good flexibility and high solvent resistance was fabricated, suitable for the panel material of the electrophoretic display. Cationically-charged white particles were prepared by using TiO2 nanoparticles, silane coupling agent with amino groups, dispersant and acetic acid. The cationically charged TiO2 particles exhibited 74.09 mV of zeta potential and 3.11 × 10-5 cm2/Vs of mobility. Electrophoretic display fabricated with the charged TiO2 particles exhibited 10 V of low driving voltage and maximum contrast ratio (5.3/1) at 30 V.

  15. Electrophoretic separator for purifying biologicals

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Mathematical expressions were developed to describe the interrelationships between operating requirements (capabilities), cell parameters, and system constraints in terms of design criteria definition. The mathematical model was programmed for computer solution. The model was exercised to identify performance-limiting characteristics, and analyses were conducted to predict operation in space of an experiment involving separation of four components. An engineering model of a flowing electrophoretic separator was constructed. The design is directed toward verifying improvements in resolution and throughput of a thicker cell than can be used on earth.

  16. Hole mobilities of periodic models of DNA double helices in the nucleosomes at different temperatures

    NASA Astrophysics Data System (ADS)

    Bende, Attila; Bogár, Ferenc; Ladik, János

    2013-04-01

    Using the Hartree-Fock crystal orbital method band structures of poly(G˜-C˜) and poly(A˜-T˜) were calculated (G˜, etc. means a nucleotide) including water molecules and Na+ ions. Due to the close packing of DNA in the ribosomes the motion of the double helix and the water molecules around it are strongly restricted, therefore the band picture can be used. The mobilities were calculated from the highest filled bands. The hole mobilities increase with decreasing temperatures. They are of the same order of magnitude as those of poly(A˜) and poly(T˜). For poly(G˜) the result is ˜5 times larger than in the poly(G˜-C˜) case.

  17. Electrophoretic separator for purifying biologicals, part 1

    NASA Technical Reports Server (NTRS)

    Mccreight, L. R.

    1978-01-01

    A program to develop an engineering model of an electrophoretic separator for purifying biologicals is summarized. An extensive mathematical modeling study and numerous ground based tests were included. Focus was placed on developing an actual electrophoretic separator of the continuous flow type, configured and suitable for flight testing as a space processing applications rocket payload.

  18. The glucosaminidase domain of Atl – the major Staphylococcus aureus autolysin – has DNA-binding activity

    PubMed Central

    Grilo, Inês R; Ludovice, Ana Madalena; Tomasz, Alexander; de Lencastre, Hermínia; Sobral, Rita G

    2014-01-01

    In this communication, we describe evidence demonstrating the capacity of Atl, the major Staphylococcus aureus autolytic enzyme to bind DNA. Electrophoretic mobility shift assays (EMSA) show that both the Atl protein and the endo-β-N-acetylglucosaminidase (GL) domain were able to bind DNA of nonspecific sequence. The implications of this unexpected observation for the physiology of S. aureus remain to be explored. PMID:24585695

  19. Nonlinear electrophoretic response yields a unique parameter for separation of biomolecules

    PubMed Central

    Pel, Joel; Broemeling, David; Mai, Laura; Poon, Hau-Ling; Tropini, Giorgia; Warren, René L.; Holt, Robert A.; Marziali, Andre

    2009-01-01

    We demonstrate a unique parameter for biomolecule separation that results from the nonlinear response of long, charged polymers to electrophoretic fields and apply it to extraction and concentration of nucleic acids from samples that perform poorly under conventional methods. Our method is based on superposition of synchronous, time-varying electrophoretic fields, which can generate net drift of charged molecules even when the time-averaged molecule displacement generated by each field individually is zero. Such drift can only occur for molecules, such as DNA, whose motive response to electrophoretic fields is nonlinear. Consequently, we are able to concentrate DNA while rejecting high concentrations of contaminants. We demonstrate one application of this method by extracting DNA from challenging samples originating in the Athabasca oil sands. PMID:19706437

  20. Urokinase production by electrophoretically separated cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.

    1985-01-01

    Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.

  1. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.

    1984-01-01

    Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.

  2. Dichotomous Life of DNA Binding High Mobility Group Box1 Protein in Human Health and Disease.

    PubMed

    Lohani, Neelam; Rajeswari, Moganty R

    2016-01-01

    The High mobility group box 1 (HMGB1) protein is an extremely versatile, highly conserved nuclear protein, with its unique intracellular and extracellular functions mediated by its relatively simple domain structure. Within the nucleus, HMGB1 binds to DNA minor groove in a nonspecific manner and causes bends in the double helix thus helps in recruiting a number of DNA binding protein and transcription factors, to facilitate transcription of various genes. HMGB1 also helps in DNA repair, chromatin remodeling, V (D) J recombination, and assembly of nucleosome on the chromatin. On contrary, under pathological conditions HMGB1 displays inflammatory response by interaction with specific cell surface receptors like RAGE, TLR-4, TLR9, and TLR2 and activates NF-kB downstream signaling pathways. The upregulation of HMGB1 is directly associated with the pathogenesis of cancer, sepsis, ischemia, hemorrhagic shock, anorexia, rheumatic disease, periodontal disease etc. Therefore, HMGB1 has been considered as a promising target in the treatment of various human diseases. The interest in HMGB1 is evident and reflected in the exponential increase in the recent publications, and therefore there is a need for an update on the understanding of the role of HMGB1 in pathogenesis and its potential application of HMGB1 as a therapeutic target in a number of human diseases.

  3. Extreme dryness and DNA-protein cross-links

    NASA Astrophysics Data System (ADS)

    Bieger-Dose, A.; Dose, K.; Meffert, R.; Mehler, M.; Risi, S.

    Exposure of fungal conidia (Aspergillus ochraceus) or spores of Bacillus subtilis to extreme dryness or vacuum induces DNA lesions, including strand breaks and the formation of DNA-protein cross-links. In wet cells only a small amount of protein is bound to DNA, but exposure to conditions of lowered water activity results in an increasing number of cross-links between DNA and proteins. In fungal conidia these cross-links are detected after selective iodination (125J) of the DNA-bound proteins followed by gel electrophoresis and subsequent autoradiography. Another approach is the labelling of DNA with 32p by means of nick translation and the detection of differences in the electrophoretic mobility of DNA before and after digestion with proteinase K of proteins bound to DNA.

  4. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory.

    PubMed

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-21

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10(-1) cm(2) V(-1) s(-1) which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  5. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory

    NASA Astrophysics Data System (ADS)

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-01

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10-1 cm2 V-1 s-1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  6. Objective data on DNA success rates can aid the selection process of crime samples for analysis by rapid mobile DNA technologies.

    PubMed

    Mapes, A A; Kloosterman, A D; Poot, C J de; van Marion, V

    2016-07-01

    Mobile Rapid-DNA devices have recently become available on the market. These devices can perform DNA analyses within 90min with an easy 'sample in-answer out' system, with the option of performing comparisons with a DNA database or reference profile. However, these fast mobile systems cannot yet compete with the sensitivity of the standard laboratory analysis. For the future this implies that Scene of Crime Officers (SoCOs) need to decide on whether to analyse a crime sample with a Rapid-DNA device and to get results within 2h or to secure and analyse the sample at the laboratory with a much longer throughput time but with higher sensitivity. This study provides SoCOs with evidence-based information on DNA success rates, which can improve their decisions at the crime scene on whether or not to use a Rapid-DNA device. Crime samples with a high success rate in the laboratory will also have the highest potential for Rapid-DNA analysis. These include samples from e.g. headwear, cigarette ends, articles of clothing, bloodstains, and drinking items.

  7. Automated Parallel Capillary Electrophoretic System

    DOEpatents

    Li, Qingbo; Kane, Thomas E.; Liu, Changsheng; Sonnenschein, Bernard; Sharer, Michael V.; Kernan, John R.

    2000-02-22

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  8. Particle separations by electrophoretic techniques

    SciTech Connect

    Ballou, N.E.; Petersen, S.L.; Ducatte, G.R.; Remcho, V.T.

    1996-03-01

    A new method for particle separations based on capillary electrophoresis has been developed and characterized. It uniquely separates particles according to their chemical nature. Separations have been demonstrated with chemically modified latex particles and with inorganic oxide and silicate particles. Separations have been shown both experimentally and theoretically to be essentially independent of particle size in the range of about 0.2 {mu}m to 10 {mu}m. The method has been applied to separations of U0{sub 2} particles from environmental particulate material. For this, an integrated method was developed for capillary electrophoretic separation, collection of separated fractions, and determinations of U0{sub 2} and environmental particles in each fraction. Experimental runs with the integrated method on mixtures of UO{sub 2} particles and environmental particulate material demonstrated enrichment factors of 20 for UO{sub 2} particles in respect to environmental particles in the U0{sub 2}containing fractions. This enrichment factor reduces the costs and time for processing particulate samples by the lexan process by a factor of about 20.

  9. CAPILLARY ELECTROPHORETIC BEHAVIOR OF SEVEN SULFONYLUREAS

    EPA Science Inventory

    The electrophoretic behavior of bensulfuron Me, sulfometuron Me, nicosulfuron (Accent), chlorimuron Et, thifensulfuron Me (Harmony), metsulfuron Me, and chlorsulfuron was studied under capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) conditio...

  10. Automated band mapping in electrophoretic gel images using background information

    PubMed Central

    Zerr, Troy; Henikoff, Steven

    2005-01-01

    Some popular methods for polymorphism and mutation discovery involve ascertainment of novel bands by the examination of electrophoretic gel images. Although existing strategies for mapping bands work well for specific applications, such as DNA sequencing, these strategies are not well suited for novel band detection. Here, we describe a general strategy for band mapping that uses background banding patterns to facilitate lane calling and size calibration. We have implemented this strategy in GelBuddy, a user-friendly Java-based program for PC and Macintosh computers, which includes several utilities to assist discovery of mutations and polymorphisms. We demonstrate the use of GelBuddy in applications based on single-base mismatch cleavage of heteroduplexed PCR products. Use of software designed to facilitate novel band detection can significantly shorten the time needed for image analysis and data entry in a high-throughput setting. Furthermore, the interactive strategy implemented in GelBuddy has been successfully applied to DNA fingerprinting applications, such as AFLP. GelBuddy promises to make electrophoretic gel analysis a viable alternative to DNA resequencing for discovery of mutations and polymorphisms. PMID:15894797

  11. Properties of electrophoretic fractions of human embryonic kidney cells separated on space shuttle flight STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.

    1985-01-01

    Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.

  12. Construction of a cDNA clone corresponding to mouse alpha 1(IV) procollagen.

    PubMed Central

    dos Santos, C L; Villa, L L; Sonohara, S; Brentani, R R

    1984-01-01

    A new procedure for the synthesis of double stranded cDNA, based upon release of mRNA by "in vitro" translation, was used to clone type IV collagen. Collagen synthesizing polysomes selectively isolated from a mouse parietal yolk sac carcinoma (PYS-2) were used for translation in an heterologous cell-free system. Translation products were collagenase-sensitive and displayed an electrophoretic mobility correspondent to type IV collagen. Translation released mRNA was employed to construct a 100 base pairs long cDNA clone which hybridized to a 7,800 nucleotides long mRNA. Peptides synthesized by "in vitro" translation of hybrid selected mRNA displayed an electrophoretic mobility compatible with that of alpha 1 (IV) collagen, were sensitive to collagenase and were immunoprecipitated by anti-type IV collagen antibody. Images PMID:6546618

  13. Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays.

    PubMed Central

    Delwart, E L; Sheppard, H W; Walker, B D; Goudsmit, J; Mullins, J I

    1994-01-01

    High mutation rates and strong selective pressures imposed on human immunodeficiency viruses in vivo result in the formation of pools of genetic variants known as quasispecies. DNA heteroduplex mobility and tracking analyses were used to monitor the generation of HIV sequence diversity, to estimate quasispecies complexity, and to assess the turnover of genetic variants to approach an understanding of the relationship between viral quasispecies evolution in vivo and disease progression. Proviral DNA pools were nearly homogeneous soon after sexual transmission. The emergence and clearance of individual variants then occurred at different rates in different individuals. High quasispecies complexity was found in long-term-infected, asymptomatic individuals, while rapid CD4+ cell decline and AIDS were often, but not always, associated with lower quasispecies complexity. Proviral genetic variation was often low following in vitro culture, because of the outgrowth of one or a few variants that often became more abundant only later as proviruses in peripheral blood mononuclear cells. These studies provide insight into the dynamics of human immunodeficiency virus sequence changes in vivo and illustrate the utility of heteroduplex analysis for the study of phenomena associated with rapid genetic changes. Images PMID:8084001

  14. BRCA2 diffuses as oligomeric clusters with RAD51 and changes mobility after DNA damage in live cells

    PubMed Central

    Reuter, Marcel; Zelensky, Alex; Smal, Ihor; Meijering, Erik; van Cappellen, Wiggert A.; de Gruiter, H. Martijn; van Belle, Gijsbert J.; van Royen, Martin E.; Houtsmuller, Adriaan B.; Essers, Jeroen; Kanaar, Roland

    2014-01-01

    Genome maintenance by homologous recombination depends on coordinating many proteins in time and space to assemble at DNA break sites. To understand this process, we followed the mobility of BRCA2, a critical recombination mediator, in live cells at the single-molecule level using both single-particle tracking and fluorescence correlation spectroscopy. BRCA2-GFP and -YFP were compared to distinguish diffusion from fluorophore behavior. Diffusive behavior of fluorescent RAD51 and RAD54 was determined for comparison. All fluorescent proteins were expressed from endogenous loci. We found that nuclear BRCA2 existed in oligomeric clusters, and exhibited heterogeneous mobility. DNA damage increased BRCA2 transient binding, presumably including binding to damaged sites. Despite its very different size, RAD51 displayed mobility similar to BRCA2, which indicates physical interaction between these proteins both before and after induction of DNA damage. We propose that BRCA2-mediated sequestration of nuclear RAD51 serves to prevent inappropriate DNA interactions and that all RAD51 is delivered to DNA damage sites in association with BRCA2. PMID:25488918

  15. Mobilization

    DTIC Science & Technology

    1987-01-01

    istic and romantic emotionalism that typifies this genre. Longino, James C., et al. “A Study of World War Procurement and Industrial Mobilization...States. Harrisburg, PA: Military Service Publishing Co., 1941. CARL 355.22 J72b. Written in rough prose , this World War II era document explains the

  16. Functional analysis of DNA bending and unwinding by the high mobility group domain of LEF-1

    PubMed Central

    Giese, Klaus; Pagel, John; Grosschedl, Rudolf

    1997-01-01

    LEF-1 (lymphoid enhancer-binding factor 1) is a cell type-specific member of the family of high mobility group (HMG) domain proteins that recognizes a specific nucleotide sequence in the T cell receptor (TCR) α enhancer. In this study, we extend the analysis of the DNA-binding properties of LEF-1 and examine their contributions to the regulation of gene expression. We find that LEF-1, like nonspecific HMG-domain proteins, can interact with irregular DNA structures such as four-way junctions, albeit with lower efficiency than with specific duplex DNA. We also show by a phasing analysis that the LEF-induced DNA bend is directed toward the major groove. In addition, we find that the interaction of LEF-1 with a specific binding site in circular DNA changes the linking number of DNA and unwinds the double helix. Finally, we identified two nucleotides in the LEF-1-binding site that are important for protein-induced DNA bending. Mutations of these nucleotides decrease both the extent of DNA bending and the transactivation of the TCRα enhancer by LEF-1, suggesting a contribution of protein-induced DNA bending to the function of TCRα enhancer. PMID:9371763

  17. Study of the Electrophoretic Behavior of Cephalosporins by Capillary Zone Electrophoresis

    PubMed Central

    Hancu, Gabriel; Sasebeşi, Adina; Rusu, Aura; Kelemen, Hajnal; Ciurba, Adriana

    2015-01-01

    Purpose: The aim of the study was the characterization of the electrophoretic behavior of cephalosporins from different generation having different structural characteristics in order to develop a rapid, simple and efficient capillary electrophoretic method for their identification and simultaneous separation from complex mixtures. Methods: Ten cephalosporin derivatives (cefaclor, cefadroxil, cefalexin, cefazolin, cefoxitin, cefuroxime, cefoperazone, cefotaxime, ceftazidime, ceftriaxone) were analyzed by capillary zone electrophoresis using different background electrolyte solutions at different pH values. Electrophoretic mobilities of the analytes were calculated, the influence of the electrophoretic parameteres on the separation was established and the analytical conditions were optimized. Results: Taking into consideration their structural and chemical properties cephalosporins can be detected over a pH range between 6 and 10. The best results were obtained using a buffer solution containing 25 mM disodium hydrogenophosphate - 25 mM sodium dihydrogenophosphate, at a pH – 7.00, + 25 kV voltage at a temperature of 25 °C, UV detection at 210 nm. Using the optimized analytical conditions we achieved the simultaneous baseline separation for seven cephalosporins in less then 10 minutes. Conclusion: Using the described optimized electrophoretic procedures, capillary electrophoresis can be used for the identification and determination of cephalosporins in formulated pharmaceutical products and for their separation from complex mixtures. PMID:26236661

  18. Cohesin phosphorylation and mobility of SMC1 at ionizing radiation-induced DNA double-strand breaks in human cells

    SciTech Connect

    Bauerschmidt, Christina; Helleday, Thomas

    2011-02-01

    Cohesin, a hetero-tetrameric complex of SMC1, SMC3, Rad21 and Scc3, associates with chromatin after mitosis and holds sister chromatids together following DNA replication. Following DNA damage, cohesin accumulates at and promotes the repair of DNA double-strand breaks. In addition, phosphorylation of the SMC1/3 subunits contributes to DNA damage-induced cell cycle checkpoint regulation. The aim of this study was to determine the regulation and consequences of SMC1/3 phosphorylation as part of the cohesin complex. We show here that the ATM-dependent phosphorylation of SMC1 and SMC3 is mediated by H2AX, 53BP1 and MDC1. Depletion of RAD21 abolishes these phosphorylations, indicating that only the fully assembled complex is phosphorylated. Comparison of wild type SMC1 and SMC1S966A in fluorescence recovery after photo-bleaching experiments shows that phosphorylation of SMC1 is required for an increased mobility after DNA damage in G2-phase cells, suggesting that ATM-dependent phosphorylation facilitates mobilization of the cohesin complex after DNA damage.

  19. Photon Correlation Spectroscopy and Electrophoretic Light Scattering Using Optical Fibres.

    NASA Astrophysics Data System (ADS)

    MacFadyen, Allan John

    Available from UMI in association with The British Library. In photon correlation spectroscopy, the fast local fluctuations in the intensity of the light scattered by submicron particles in suspension are recorded and analysed in terms of the particle motion. These may then be related to the particle size, or, when the particles are subjected to an electric field, the electrophoretic mobility. Light scattering apparatus traditionally incorporates a fixed goniometer arrangement. Recently, however, systems have been reported which incorporate optical fibres for use in remote or on-line situations. In this thesis, recent advances in the development of fibre-based photon correlation systems are reviewed and the design and construction of two novel optical fibre apparatus prototypes, incorporating "SELFOC" lenses, miniature prisms and single mode detection fibre, is discussed. The final outcome, an optical fibre sensor, which combines both photon correlation and electrophoretic light scattering measurements in a single, compact dip -in probe for the first time, is described. Results are presented for a variety of colloidal particles in suspension including polystyrene and "Microsilica" spheres, PTFE ellipsoids and kaolinite platelets, all of which demonstrate the viability of the apparatus.

  20. Patterns of prehistoric human mobility in Polynesia indicated by mtDNA from the Pacific rat

    PubMed Central

    Matisoo-Smith, E.; Roberts, R. M.; Irwin, G. J.; Allen, J. S.; Penny, D.; Lambert, D. M.

    1998-01-01

    Human settlement of Polynesia was a major event in world prehistory. Despite the vastness of the distances covered, research suggests that prehistoric Polynesian populations maintained spheres of continuing interaction for at least some period of time in some regions. A low level of genetic variation in ancestral Polynesian populations, genetic admixture (both prehistoric and post-European contact), and severe population crashes resulting from introduction of European diseases make it difficult to trace prehistoric human mobility in the region by using only human genetic and morphological markers. We focus instead on an animal that accompanied the ancestral Polynesians on their voyages. DNA phylogenies derived from mitochondrial control-region sequences of Pacific rats (Rattus exulans) from east Polynesia are presented. A range of specific hypotheses regarding the degree of interaction within Polynesia are tested. These include the issues of multiple contacts between central east Polynesia and the geographically distinct archipelagos of New Zealand and Hawaii. Results are inconsistent with models of Pacific settlement involving substantial isolation after colonization and confirm the value of genetic studies on commensal species for elucidating the history of human settlement. PMID:9844030

  1. Methylated DNA-binding protein is present in various mammalian cell types

    SciTech Connect

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. ); Ehrlich, K.C. )

    1988-08-25

    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  2. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, R.D.; Olivares, J.A.

    1989-06-27

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.

  3. A simplified electrophoretic system for determining molecular weights of proteins.

    PubMed

    Manwell, C

    1977-09-01

    Electrophoresis of 31 different proteins in commercially prepared polyacrylamide gradient gels, Gradipore, yields a linear relationship between a hypothetical limiting pore size (the reciprocal of a limiting gel concentration, GL) and the cube root of the mol.wt., over the range 13 500-9000 000. A regression analysis of these data reveals that 98.6% of all variability in 1/GL is explained by the molecular weight, and this degree of accuracy compares favourably with existing methods for the determination of molecular weight by retardation of mobility in polyacrylamide. This new procedure has the additional advantages that molecular-weight standards can be obtained from readily available body fluids or tissue extracts by localizing enzymes and other proteins by standard histochemical methods, and that the same electrophoretic system can be used in determining molecular weights as is used in routine surveys of populations for individual and species variation in protein heterogeneity.

  4. Preparation of guinea pig macrophage for electrophoretic experiments in space

    NASA Technical Reports Server (NTRS)

    1979-01-01

    Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.

  5. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, Richard D.; Olivares, Jose A.

    1989-01-01

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.

  6. Survival rate of eukaryotic cells following electrophoretic nanoinjection

    PubMed Central

    Simonis, Matthias; Hübner, Wolfgang; Wilking, Alice; Huser, Thomas; Hennig, Simon

    2017-01-01

    Insertion of foreign molecules such as functionalized fluorescent probes, antibodies, or plasmid DNA to living cells requires overcoming the plasma membrane barrier without harming the cell during the staining process. Many techniques such as electroporation, lipofection or microinjection have been developed to overcome the cellular plasma membrane, but they all result in reduced cell viability. A novel approach is the injection of cells with a nanopipette and using electrophoretic forces for the delivery of molecules. The tip size of these pipettes is approximately ten times smaller than typical microinjection pipettes and rather than pressure pulses as delivery method, moderate DC electric fields are used to drive charged molecules out of the tip. Here, we show that this approach leads to a significantly higher survival rate of nanoinjected cells and that injection with nanopipettes has a significantly lower impact on the proliferation behavior of injected cells. Thus, we propose that injection with nanopipettes using electrophoretic delivery is an excellent alternative when working with valuable and rare living cells, such as primary cells or stem cells. PMID:28120926

  7. Molecular Dynamics Simulations Illuminate the Role of Counterion Condensation in the Electrophoretic Transport of Homogalacturonans.

    PubMed

    Irani, Amir H; Owen, Jessie L; Mercadante, Davide; Williams, Martin A K

    2017-02-13

    Homogalacturonans (HGs) are polysaccharide copolymers of galacturonic acid and its methylesterified counterpart. The inter- and intramolecular distributions of the methylesterifed residues are vital behavior-determining characteristics of a sample's structure, and much experimental effort has been directed to their measurement. While many techniques are able to measure the sample-averaged degree of methylesterification (DM), the measurement of inter- and intramolecular charge distributions are challenging. Here, molecular dynamics (MD) simulations are used to calculate the electrophoretic mobilities of HGs that have different amounts and distributions of charges placed along the backbone. The simulations are shown to capture experimental results well, even for low-DM samples that possess high charge densities. In addition, they illuminate the role that local counterion condensation can play in the determination of the electrophoretic mobility of heterogeneous blocky polyelectrolytes that cannot be adequately described by a single chain-averaged charge spacing.

  8. Electrophoretic purification of cells in space - Evaluation of results from STS-3

    NASA Technical Reports Server (NTRS)

    Sarnoff, B. E.; Kunze, M. E.; Todd, P.

    1983-01-01

    The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.

  9. Eccentric electrophoretic motion of a rectangular particle in a rectangular microchannel.

    PubMed

    Li, Dongquing; Daghighi, Yasaman

    2010-02-15

    Understanding of the effects of the boundary - the channel walls - on the electrophoretic motion of particles in microchannels is very important. This paper developed an analytical solution of the electrophoretic mobility for eccentric motion of a rectangular particle in a rectangular microchannel. The simple geometry of the system does not limit the generality of the qualitative prediction of the model and the analytical solution. Several special cases are studied, and the effects of the degree of the eccentricity, the particle's size relative to the channel's size, and the relative zeta potentials on the particle's mobility are discussed. For the case where the particle's cross-section area is close to the cross-section area of the microchannel, the model's predictions are compared with the published experimental results and good agreement was found.

  10. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass)...

  11. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass)...

  12. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass)...

  13. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass)...

  14. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass)...

  15. Microscopic Electrohydrodynamics of DNA electrophoresis

    NASA Astrophysics Data System (ADS)

    Aksimentiev, Aleksei; Luan, Binquan

    2008-03-01

    Gel electrophoresis is currently the most successful yet costly method to sequence DNA. Electrophoresis of DNA through solid-state nanopores holds promise for reducing the costs and making personal genomics a reality. The underlying physics of DNA electrophoresis, however, remains controversial. Theoretical models of this process often invoke the notion of the effective charge of a DNA molecule qeff to account for the reduced electric force on DNA in an external field E, i.e. F= qeffE. However, experimental estimates of qeff can differ from each other by as much as ten times. To clarify the physical origin of the reduction of an electric force on DNA in electrophoresis, we investigated this process through extensive all-atom molecular dynamics simulations. Our results demonstrate that the effective screening of the DNA charge arises from the hydrodynamic drag of the electroosmotic flow, not from the counterion condensation. We show that the effective driving force F of an applied electric field E in a nanopore obeys the same law as in a bulk electrolyte: F=ξμE. Here, ξ and μ are, respectively, the friction coefficient and electrophoretic mobility of DNA that depend on the surface properties of a nanopore, such as its roughness. Based on the above law, a method for determining the effective driving force is suggested that does not require a direct force measurement.

  16. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair

    PubMed Central

    Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens. PMID:27723831

  17. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair.

    PubMed

    Pellarin, Ilenia; Arnoldo, Laura; Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens.

  18. Method for in-situ calibration of electrophoretic analysis systems

    DOEpatents

    Liu, Changsheng; Zhao, Hequan

    2005-05-08

    An electrophoretic system having a plurality of separation lanes is provided with an automatic calibration feature in which each lane is separately calibrated. For each lane, the calibration coefficients map a spectrum of received channel intensities onto values reflective of the relative likelihood of each of a plurality of dyes being present. Individual peaks, reflective of the influence of a single dye, are isolated from among the various sets of detected light intensity spectra, and these can be used to both detect the number of dye components present, and also to establish exemplary vectors for the calibration coefficients which may then be clustered and further processed to arrive at a calibration matrix for the system. The system of the present invention thus permits one to use different dye sets to tag DNA nucleotides in samples which migrate in separate lanes, and also allows for in-situ calibration with new, previously unused dye sets.

  19. Development of microfluidic modules for DNA purification via phenol extraction and analyte concentration using transverse electrokinetics

    NASA Astrophysics Data System (ADS)

    Morales, Mercedes C.

    In this work, microfluidic platforms have been designed and evaluated to demonstrate microscale DNA purification via organic (phenol) extraction as well as analyte trapping and concentration using a transverse electrokinetic force balance. First, in order to evaluate DNA purification via phenol extraction in a microdevice, an aqueous phase containing protein and DNA and an immiscible receiving organic phase were utilized to evaluate microfluidic DNA extraction under both stratified and droplet-based flow conditions using a serpentine microfluidic device. The droplet based flow resulted in a significant improvement of protein partitioning from the aqueous phase due to the flow recirculation inside each droplet improving material convective transport into the organic phase. The plasmid recovery from bacterial lysates using droplet-based flow was high (>92%) and comparable to the recovery achieved using commercial DNA purification kits and standard macroscale phenol extraction. Second, a converging Y-inlet microfluidic channel with integrated coplanar electrodes was used to investigate transverse DNA and protein migration under uniform direct current (DC) electric fields. Negatively charged samples diluted in low and high ionic strength buffers were co-infused with a receiving buffer of the same ionic strength into a main channel where transverse electric fields were applied. Experimental results demonstrated that charged analytes could traverse the channel width and accumulate at the positive bias electrode in a low electroosmotic mobility and high electrophoretic mobility condition (high ionic strength buffer) or migrated towards an equilibrium position within the channel when both electroosmotic mobility and electrophoretic mobility are high (low ionic strength buffer). The different behaviors are the result of a balance between the electrophoretic force and a drag force induced by a recirculating electroosmotic flow generated across the channel width due to the

  20. Conductivity and electrophoretic mobility of dilute ionic solutions.

    PubMed

    Allison, Stuart; Wu, Hengfu; Twahir, Umar; Pei, Hongxia

    2010-12-01

    Two complementary continuum theories of electrokinetic transport are examined with particular emphasis on the equivalent conductance of binary electrolytes. The "small ion" model [R.M. Fuoss, L. Onsager, J. Phys. Chem. 61 (1957) 668] and "large ion" model [R.W. O'Brien, L.R. White, J. Chem. Soc. Faraday Trans. 2 (74) (1978) 1607] are both discussed and the "large ion" model is generalized to include an ion exclusion distance and to account in a simple but approximate way for the Brownian motion of all ions present. In addition, the "large ion" model is modified to treat "slip" hydrodynamic boundary conditions in addition to the standard "stick" boundary condition. Both models are applied to the equivalent conductance of dilute KCl, MgCl(2), and LaCl(3) solutions and both are able to reproduce experimental conductances to within an accuracy of several tenths of a percent. Despite fundamental differences in the "small ion" and "large ion" theories, they both work equally well in this application. In addition, both "stick-large ion" and "slip-large ion" models are equally capable of accounting for the equivalent conductances of the three electrolyte solutions.

  1. Electrophoretic mobility of magnetite particles in high temperature water

    SciTech Connect

    Vidojkovic, Sonja; Rodriguez-Santiago, V; Fedkin, Mark V.; Wesolowski, David J; Lvov, Serguei N.

    2011-01-01

    Magnetite(Fe3O4) isoneofthemostcommonoxidesformingdepositsandparticulatephasesin industrialhightemperaturewatercircuits.Itscolloidalcharacteristicsplayaprincipalroleinthe mechanismofdepositformationandcanbeusedascontrollingfactorstopreventorminimizedeposit formationanddamageofindustrialpipelinesduetounder-depositcorrosion.Inthisstudy,ahigh temperatureparticleelectrophoresistechniquewasemployedtomeasurethezetapotentialatthe magnetite/waterinterface the parameterthatcontrolscolloidalstabilityofparticles,theiraggrega- tion, anddeposition.Themeasurementsweremadeattemperaturesupto200 1C overawiderangeofpH. The isoelectricpointsofmagnetite,atwhichthedepositionofparticlesisincreased,weredeterminedatpH 6.35, 6.00,5.25,and5.05fortemperatures25,100,150,and200 1C, respectively.Theobserved temperaturedependenceofzetapotentialandtheisoelectricpHpointofmagnetitecanhelptoexplain the extentofinteractionsbetweenthecolloidalparticlesandthesteelwallsurfacesunderhydro- thermalconditions,andindicatemethodsforcontrollingandmitigatingoxidedepositioninhigh temperaturewatercycles.

  2. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes.

    PubMed

    Tubio, Jose M C; Li, Yilong; Ju, Young Seok; Martincorena, Inigo; Cooke, Susanna L; Tojo, Marta; Gundem, Gunes; Pipinikas, Christodoulos P; Zamora, Jorge; Raine, Keiran; Menzies, Andrew; Roman-Garcia, Pablo; Fullam, Anthony; Gerstung, Moritz; Shlien, Adam; Tarpey, Patrick S; Papaemmanuil, Elli; Knappskog, Stian; Van Loo, Peter; Ramakrishna, Manasa; Davies, Helen R; Marshall, John; Wedge, David C; Teague, Jon W; Butler, Adam P; Nik-Zainal, Serena; Alexandrov, Ludmil; Behjati, Sam; Yates, Lucy R; Bolli, Niccolo; Mudie, Laura; Hardy, Claire; Martin, Sancha; McLaren, Stuart; O'Meara, Sarah; Anderson, Elizabeth; Maddison, Mark; Gamble, Stephen; Foster, Christopher; Warren, Anne Y; Whitaker, Hayley; Brewer, Daniel; Eeles, Rosalind; Cooper, Colin; Neal, David; Lynch, Andy G; Visakorpi, Tapio; Isaacs, William B; van't Veer, Laura; Caldas, Carlos; Desmedt, Christine; Sotiriou, Christos; Aparicio, Sam; Foekens, John A; Eyfjörd, Jórunn Erla; Lakhani, Sunil R; Thomas, Gilles; Myklebost, Ola; Span, Paul N; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Van de Vijver, Marc; Vincent-Salomon, Anne; Van den Eynden, Gert G; Flanagan, Adrienne M; Futreal, P Andrew; Janes, Sam M; Bova, G Steven; Stratton, Michael R; McDermott, Ultan; Campbell, Peter J

    2014-08-01

    Long interspersed nuclear element-1 (L1) retrotransposons are mobile repetitive elements that are abundant in the human genome. L1 elements propagate through RNA intermediates. In the germ line, neighboring, nonrepetitive sequences are occasionally mobilized by the L1 machinery, a process called 3' transduction. Because 3' transductions are potentially mutagenic, we explored the extent to which they occur somatically during tumorigenesis. Studying cancer genomes from 244 patients, we found that tumors from 53% of the patients had somatic retrotranspositions, of which 24% were 3' transductions. Fingerprinting of donor L1s revealed that a handful of source L1 elements in a tumor can spawn from tens to hundreds of 3' transductions, which can themselves seed further retrotranspositions. The activity of individual L1 elements fluctuated during tumor evolution and correlated with L1 promoter hypomethylation. The 3' transductions disseminated genes, exons, and regulatory elements to new locations, most often to heterochromatic regions of the genome.

  3. A unified mathematical theory of electrophoretic processes

    NASA Technical Reports Server (NTRS)

    Bier, M.; Palusinski, O. A.; Mosher, R. A.; Graham, A.; Saville, D. A.

    1983-01-01

    A mathematical theory is presented which shows that each of the four classical electrophoretic modes (zone electrophoresis, moving boundary electrophoresis, isotachophoresis, and isoelectric focusing) is based on the same general principles and can collectively be described in terms of a single set of equations. This model can predict the evolution of the four electrophoretic modes as a function of time. The model system is one-dimensional, neglecting the effects of electroosmosis, temperature gradients, and any bulk flows of liquid. The model is based on equations which express the components' dissociation equilibria, the mass transport due to electromigration and diffusion, electroneutrality, and the conservation of mass and charge. The model consists of a system of coupled partial differential and nonlinear algebraic equations which can be solved numerically by use of a computer. The versatility of this model was verified using an example of a three-component system containing cacodylate, tris hydroxylmethylaminomethane, and histidine. Results show that this model not only correctly predicts the characteristic features of each electrophoretic mode, but also gives details of the concentration, pH, and conductivity profiles not easily amenable to direct experimental measurement.

  4. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    PubMed Central

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  5. Characterizing and controlling the motion of ssDNA in a solid-state nanopore.

    PubMed

    Luan, Binquan; Martyna, Glenn; Stolovitzky, Gustavo

    2011-11-02

    Sequencing DNA in a synthetic solid-state nanopore is potentially a low-cost and high-throughput method. Essential to the nanopore-based DNA sequencing method is the ability to control the motion of a single-stranded DNA (ssDNA) molecule at single-base resolution. Experimental studies showed that the average translocation speed of DNA driven by a biasing electric field can be affected by ionic concentration, solvent viscosity, or temperature. Even though it is possible to slow down the average translocation speed, instantaneous motion of DNA is too diffusive to allow each DNA base to stay in front of a sensor site for its measurement. Using extensive all-atom molecular dynamics simulations, we study the diffusion constant, friction coefficient, electrophoretic mobility, and effective charge of ssDNA in a solid-state nanopore. Simulation results show that the spatial fluctuation of ssDNA in 1 ns is comparable to the spacing between neighboring nucleotides in ssDNA, which makes the sensing of a DNA base very difficult. We demonstrate that the recently proposed DNA transistor could potentially solve this problem by electrically trapping ssDNA inside the DNA transistor and ratcheting ssDNA base-by-base in a biasing electric field. When increasing the biasing electric field, we observed that the translocation of ssDNA changes from ratcheting to steady-sliding. The simulated translocation of ssDNA in the DNA transistor was theoretically characterized using Fokker-Planck analysis.

  6. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  7. The effect of pH on charge inversion and condensation of DNA.

    PubMed

    Guo, Zilong; Wang, Yanwei; Yang, Anthony; Yang, Guangcan

    2016-08-21

    Charge inversion and condensation of DNA in solutions of trivalent and quadrivalent counterions are significantly influenced by the pH value of the solution. We systematically investigated the condensation and charge compensation of DNA by spermidine, hexammine cobalt(iii) (cohex, [Co(NH3)6](3+)) and spermine in solutions of a wide range of pH values from 3 to 9.3 by dynamic light scattering, magnetic tweezers, and atomic force microscopy. In trivalent counterion solution, we found that there is a critical concentration (0.75 mM for cohex and 0.5 mM for spermidine), under which the electrophoresis mobility of DNA initially increases, reaches a maximum, and finally decreases when the pH value is decreased. In contrast, above the critical concentration, the electrophoretic mobility of DNA increases monotonously with decreasing pH value of the solution. The corresponding condensing force has the same dependence on the pH value. However, for the case of quadrivalent counterions, the electrophoretic mobility of DNA is monotonously promoted by lowering the pH value of the solution at any concentration of counterions in which charge inversion of DNA may occur. In atomic force microscopy images and force spectroscopy of magnetic tweezers, we found that maximal charge neutralization and condensation force correspond to the most compact DNA condensation. We propose a mechanism of promoting DNA charge neutralization: small and highly mobile hydrogen ions tend to attach to the DNA-counterion complex to further neutralize its remaining charge, which is related to the surface area of the complex. Therefore, this further neutralization is prominent when the complex is toroidal which corresponds to the case of mild ion concentration while it is less prominent for more compact globules or rod complexes at high counterion concentration.

  8. ProReg XL Tool: an easy-to-use computer tool suite for rapidly regrouping a large number of identical electrophoretic profiles.

    PubMed

    Massias, Bastien; Urdaci, Maria C

    2009-05-01

    The ProReg XL Tool (Profile Regrouping Excel Tool) is a new tool suite designed to rapidly regroup a large number of identical electrophoretic profiles. This tool suite is coded in Visual Basic Application for Microsoft Excel, and thus requires this spreadsheet software to operate. It was designed for use with a new screening strategy of clones from an rrs (16S rDNA) clone library, but it may also be helpful in other electrophoretic applications. ProReg XL Tool is organized in different steps where the user has the capability--in addition to regrouping electrophoretic profiles--to control gel quality, determine signal attenuation, and draw pie charts.

  9. Genetic population structure and mobility of two nectar-feeding bats from Venezuelan deserts: inferences from mitochondrial DNA.

    PubMed

    Newton, Lyndsay R; Nassar, Jafet M; Fleming, Theodore H

    2003-11-01

    Glossophaga longirostris and Leptonycteris curasoae are nectar-feeding bats associated with arid zones in northern South America. Despite their close phylogenetic relationship, sympatric condition and niche similarities, morphological and ecological evidence suggest that these species differ in dispersal capabilities. Using mitochondrial DNA, we tested the hypothesis that these species exhibit different levels of population structure that are congruent with their particular movement capabilities. We sequenced a section of the control region of mtDNA for 41 G. longirostris and 42 L. curasoae from 11 zones in Venezuela. Population subdivision in G. longirostris (FST = 0.725) was considerably higher than in L. curasoae (FST = 0.167). L. curasoae individuals shared haplotypes at greater distances (812 km) than G. longirostris (592 km). Our results offer preliminary evidence for one of two possible scenarios, either greater mobility in L. curasoae or a higher degree of female philopatry in G. longirostris.

  10. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study.

    PubMed

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-11-09

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure-activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  11. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    PubMed Central

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  12. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  13. Rice HMGB1 protein recognizes DNA structures and bends DNA efficiently.

    PubMed

    Wu, Qiang; Zhang, Wensheng; Pwee, Keng-Hock; Kumar, Prakash P

    2003-03-01

    We analyzed the DNA-binding and DNA-bending properties of recombinant HMGB1 proteins based on a rice HMGB1 cDNA. Electrophoretic mobility shift assay demonstrated that rice HMGB1 can bind synthetic four-way junction (4H) DNA and DNA minicircles efficiently but the binding to 4H can be completed out by HMGA and histone H1. Conformational changes were detected by circular dichroism analysis with 4H DNA bound to various concentrations of HMGB1 or its truncated forms. T4 ligase-mediated circularization assays with short DNA fragments of 123 bp showed that the protein is capable of increasing DNA flexibility. The 123-bp DNA formed closed circular monomers efficiently in its presence, similar to that in an earlier study on maize HMG. Additionally, our results show for the first time that the basic N-terminal domain enhances the affinity of the plant HMGB1 protein for 4H DNA, while the acidic C-terminal domain has the converse effects.

  14. Scanning and storage of electrophoretic records

    DOEpatents

    McKean, Ronald A.; Stiegman, Jeff

    1990-01-01

    An electrophoretic record that includes at least one gel separation is mounted for motion laterally of the separation record. A light source is positioned to illuminate at least a portion of the record, and a linear array camera is positioned to have a field of view of the illuminated portion of the record and orthogonal to the direction of record motion. The elements of the linear array are scanned at increments of motion of the record across the field of view to develop a series of signals corresponding to intensity of light at each element at each scan increment.

  15. DNA electrophoresis in agarose gels: Effects of electric field and gel concentration on the exponential dependence of reciprocal mobility on DNA length

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin; van Winkle, David; Randolph, Rill

    2002-03-01

    Electrophoresis was performed on double stranded DNA fragments ranging in length from 200 bp to 48502 bp at agarose gel concentrations T = 0.5% - 1.5% and electric fields E = 0.71 V/cm to 5 V/cm. A wide range of electric fields and gel concentrations were used to find what range of conditions work with the new interpolation equation, 1/μ(L) = 1/μl - (1/μl - 1/μ_s)e^-L/γ. The equation fit extremely well (\\chi^2 >= 0.999) to data with E = 2.5 V/cm to 5 V/cm and for lower fields (E < 2.5 V/cm) at low gel concentrations (T = 0.5% and 0.7%). This exponential relation seemed to hold when there is a smooth transition from the Ogston sieving regime to the reptation regime when looking at the “reptation plots” (plotting 3μL/μo vs. L) (Rousseau, J., Drouin, G., and Slater, G. W., Phys Rev Lett. 1997, 79, 1945-1948). For separations of single-stranded DNA in polyacrylamide, similar reptation plots have a region with a negative slope between the Ogston sieving regime and the reptation regime which has been interpreted as the signature of entropic trapping. When separating double-stranded DNA in agarose it was observed that fits deviate from the data when three different slopes are observed in the reptation plots. Failure of the simple exponential relationship between reciprocal mobility and DNA length appears to be the consequence of entropic trapping.

  16. Trapping of branched DNA in microfabricated structures.

    PubMed Central

    Volkmuth, W D; Duke, T; Austin, R H; Cox, E C

    1995-01-01

    We have observed electrostatic trapping of tribranched DNA molecules undergoing electrophoresis in a microfabricated pseudo-two-dimensional array of posts. Trapping occurs in a unique transport regimen in which the electrophoretic mobility is extremely sensitive to polymer topology. The arrest of branched polymers is explained by considering their center-of-mass motion; in certain conformations, owing to the constraints imposed by the obstacles a molecule cannot advance without the center of mass first moving a short distance backwards. The depth of the resulting local potential well can be much greater than the thermal energy so that escape of an immobilized molecule can be extremely slow. We summarize the expected behavior of the mobility as a function of field strength and topology and point out that the microfabricated arrays are highly suitable for detecting an extremely small number of branched molecules in a very large population of linear molecules. Images Fig. 2 PMID:7624337

  17. Visualizing ion relaxation in the transport of short DNA fragments.

    PubMed Central

    Allison, S A; Wang, H; Laue, T M; Wilson, T J; Wooll, J O

    1999-01-01

    Ion relaxation plays an important role in a wide range of phenomena involving the transport of charged biomolecules. Ion relaxation is responsible for reducing sedimentation and diffusion constants, reducing electrophoretic mobilities, increasing intrinsic viscosities, and, for biomolecules that lack a permanent electric dipole moment, provides a mechanism for orienting them in an external electric field. Recently, a numerical boundary element method was developed to solve the coupled Navier-Stokes, Poisson, and ion transport equations for a polyion modeled as a rigid body of arbitrary size, shape, and charge distribution. This method has subsequently been used to compute the electrophoretic mobilities and intrinsic viscosities of a number of model proteins and DNA fragments. The primary purpose of the present work is to examine the effect of ion relaxation on the ion density and fluid velocity fields around short DNA fragments (20 and 40 bp). Contour density as well as vector field diagrams of the various scalar and vector fields are presented and discussed at monovalent salt concentrations of 0.03 and 0.11 M. In addition, the net charge current fluxes in the vicinity of the DNA fragments at low and high salt concentrations are briefly examined and discussed. PMID:10233066

  18. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  19. Polyacrylamide medium for the electrophoretic separation of biomolecules

    DOEpatents

    Madabhushi, Ramakrishna S.; Gammon, Stuart A.

    2003-11-11

    A polyacryalmide medium for the electrophoretic separation of biomolecules. The polyacryalmide medium comprises high molecular weight polyacrylamides (PAAm) having a viscosity average molecular weight (M.sub.v) of about 675-725 kDa were synthesized by conventional red-ox polymerization technique. Using this separation medium, capillary electrophoresis of BigDye DNA sequencing standard was performed. A single base resolution of .about.725 bases was achieved in .about.60 minute in a non-covalently coated capillary of 50 .mu.m i.d., 40 cm effective length, and a filed of 160 V/cm at 40.degree. C. The resolution achieved with this formulation to separate DNA under identical conditions is much superior (725 bases vs. 625 bases) and faster (60 min. vs. 75 min.) to the commercially available PAAm, such as supplied by Amersham. The formulation method employed here to synthesize PAAm is straight-forward, simple and does not require cumbersome methods such as emulsion polymerizaiton in order to achieve very high molecular weights. Also, the formulation here does not require separation of PAAm from the reaction mixture prior to reconstituting the polymer to a final concentration. Furthermore, the formulation here is prepared from a single average mol. wt. PAAm as opposed to the mixture of two different average mo. wt. PAAm previously required to achieve high resolution.

  20. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  1. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  2. The dMi-2 chromodomains are DNA binding modules important for ATP-dependent nucleosome mobilization

    PubMed Central

    Bouazoune, Karim; Mitterweger, Angelika; Längst, Gernot; Imhof, Axel; Akhtar, Asifa; Becker, Peter B.; Brehm, Alexander

    2002-01-01

    Drosophila Mi-2 (dMi-2) is the ATPase subunit of a complex combining ATP-dependent nucleosome remodelling and histone deacetylase activities. dMi-2 contains an HMG box-like region, two PHD fingers, two chromodomains and a SNF2-type ATPase domain. It is not known which of these domains contribute to nucleosome remodelling. We have tested a panel of dMi-2 deletion mutants in ATPase, nucleosome mobilization and nucleosome binding assays. Deletion of the chromodomains impairs all three activities. A dMi-2 mutant lacking the chromodomains is incorporated into a functional histone deacetylase complex in vivo but has lost nucleosome-stimulated ATPase activity. In contrast to dHP1, dMi-2 does not bind methylated histone H3 tails and does not require histone tails for nucleosome binding. Instead, the dMi-2 chromodomains display DNA binding activity that is not shared by other chromodomains. Our results suggest that the chromodomains act at an early step of the remodelling process to bind the nucleosome substrate predominantly via protein–DNA interactions. Furthermore, we identify DNA binding as a novel chromodomain-associated activity. PMID:12006495

  3. Applications of graphene electrophoretic deposition. A review.

    PubMed

    Chavez-Valdez, A; Shaffer, M S P; Boccaccini, A R

    2013-02-14

    This Review summarizes research progress employing electrophoretic deposition (EPD) to fabricate graphene and graphene-based nanostructures for a wide range of applications, including energy storage materials, field emission devices, supports for fuel cells, dye-sensitized solar cells, supercapacitors and sensors, among others. These carbonaceous nanomaterials can be dispersed in organic solvents, or more commonly in water, using a variety of techniques compatible with EPD. Most deposits are produced under constant voltage conditions with deposition time also playing an important role in determining the morphology of the resulting graphene structures. In addition to simple planar substrates, it has been shown that uniform graphene-based layers can be deposited on three-dimensional, porous, and even flexible substrates. In general, electrophoretically deposited graphene layers show excellent properties, e.g., high electrical conductivity, large surface area, good thermal stability, high optical transparency, and robust mechanical strength. EPD also enables the fabrication of functional composite materials, e.g., graphene combined with metallic nanoparticles, with other carbonaceous materials (e.g., carbon nanotubes) or polymers, leading to novel nanomaterials with enhanced optical and electrical properties. In summary, the analysis of the available literature reveals that EPD is a simple and convenient processing method for graphene and graphene-based materials, which is easy to apply and versatile. EPD has, therefore, a promising future for applications in the field of advanced nanomaterials, which depend on the reliable manipulation of graphene and graphene-containing systems.

  4. Continuous-flow electrophoretic separator for biologicals

    NASA Technical Reports Server (NTRS)

    Mccreight, L. R.; Griffin, R. N.; Locker, R. J.

    1976-01-01

    In the near absence of gravity, a continuous-flow type of electrophoretic separator can be operated with a much thicker separation chamber than is possible under 1 g conditions. This should permit either better resolution or shorter separation time per unit of sample. An apparatus to perform experiments on sounding rockets is under development and will be described. The electrophoresis cell is 5 mm thick by 5 cm wide with 10 cm long electrodes. It is supplied with buffer, sample, and coolant at about 4 C through the use of a passive refrigerant system. UV sample detection and provision for recovery and cold storage of up to 50 sample fractions are now being added to the basic unit. A wide range of operating conditions are electronically programmable into the unit, even up to a short time before flight, and a further range of some parameters can be achieved by exchanging power supplies and by changing gears in the motor drive units of the pump. The preliminary results of some separation studies on various biological products using a commercially available electrophoretic separator are also presented.

  5. Electrophoretic Porosimetry of Sol-Gels

    NASA Technical Reports Server (NTRS)

    Snow, L. A.; Smith, D. D.; Sibille, L.; Hunt, A. J.; Ng, J.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    It has been hypothesized that gravity has an effect on the formation and resulting microstructure of sol-gels. In order to more clearly resolve the effect of gravity, pores may be non-destructively analyzed in the wet gel, circumventing the shrinkage and coarsening associated with the drying procedure. We discuss the development of an electrophoretic technique, analogous to affinity chromatography, for the determination of pore size distribution and its application to silica gels. Specifically a monodisperse charged dye is monitored by an optical densitometer as it moves through the wet gel under the influence of an electric field. The transmittance data (output) represents the convolution of the dye concentration profile at the beginning of the run (input) with the pore size distribution (transfer function), i.e. linear systems theory applies. Because of the practical difficulty in producing a delta function input dye profile we prefer instead to use a step function. Average pore size is then related to the velocity of this dye front, while the pore size distribution is related to the spreading of the front. Preliminary results of this electrophoretic porosimetry and its application to ground and space-grown samples will be discussed.

  6. Dynamics of DNA molecules under gel electrophoresis

    SciTech Connect

    Kotaka, Tadao, Adachi, Shiro; Shikata, Toshiyuki

    1993-12-31

    Electrophoretic mobilities {mu} of double stranded linear DNAs were examined in agarose gels subjected to a biased sinusoidal field (BSF) that utilizes a sinusoidal field of strength E{sub s} and frequency f superposed on a steady bias field of strength E{sub b}. Under BSF with E{sub s} {much_gt} E{sub b}. DNA fragments with the size M > 20 kbp exhibited peculiar behavior which the authors called a pin down phenomenon in that the {mu} shows a minimum {mu}{sub p} at a particular f{sub p} (pin down frequency) specific to M, C{sub gel} and the field strengths. The dynamics of DNA molecules under such pin-down conditions were examined by direct observation via fluorescence microscopy as well as dynamic electric birefringence.

  7. Electrophoretic separation of lunar soils in a space manufacturing facility

    NASA Technical Reports Server (NTRS)

    Dunning, J. D.; Snyder, R. S.

    1981-01-01

    The feasibility of electrophoretic separation of lunar soil into its mineral constituents is discussed in this paper. The process and its applicability to lunar soil separation are considered in light of the special requirements of a space manufacturing effort. Data generated in studies at NASA-Marshall Space Flight Center, which assess the efficiency of electrophoretic separation of lunar soil, are discussed and evaluated.

  8. Single Molecular Demonstration of Modulating Charge Inversion of DNA

    PubMed Central

    Wang, Yanwei; Wang, Ruxia; Cao, Bozhi; Guo, Zilong; Yang, Guangcan

    2016-01-01

    Charge inversion of DNA is a counterintuitive phenomenon in which the effective charge of DNA switches its sign from negative to positive in the presence of multivalent counterions. The underlying microscopic mechanism is still controversial whether it is driven by a specific chemical affinity or electrostatic ion correlation. It is well known that DNA shows no charge inversion in normal aqueous solution of trivalent counterions though they can induce the conformational compaction of DNA. However, in the same trivalent counterion condition, we demonstrate for the first time the occurrence of DNA charge inversion by decreasing the dielectric constant of solution to make the electrophoretic mobility of DNA increase from a negative value to a positive value. In contrast, the charge inversion of DNA induced by quadrivalent counterions can be canceled out by increasing the dielectric constant of solution. The physical modulation of DNA effective charge in two ways unambiguously demonstrates that charge inversion of DNA is a predominantly electrostatic phenomenon driven by the existence of a strongly correlated liquid (SCL) of counterions at the DNA surface. This conclusion is also supported by the measurement of condensing and unraveling forces of DNA condensates by single molecular MT. PMID:27929107

  9. Single Molecular Demonstration of Modulating Charge Inversion of DNA

    NASA Astrophysics Data System (ADS)

    Wang, Yanwei; Wang, Ruxia; Cao, Bozhi; Guo, Zilong; Yang, Guangcan

    2016-12-01

    Charge inversion of DNA is a counterintuitive phenomenon in which the effective charge of DNA switches its sign from negative to positive in the presence of multivalent counterions. The underlying microscopic mechanism is still controversial whether it is driven by a specific chemical affinity or electrostatic ion correlation. It is well known that DNA shows no charge inversion in normal aqueous solution of trivalent counterions though they can induce the conformational compaction of DNA. However, in the same trivalent counterion condition, we demonstrate for the first time the occurrence of DNA charge inversion by decreasing the dielectric constant of solution to make the electrophoretic mobility of DNA increase from a negative value to a positive value. In contrast, the charge inversion of DNA induced by quadrivalent counterions can be canceled out by increasing the dielectric constant of solution. The physical modulation of DNA effective charge in two ways unambiguously demonstrates that charge inversion of DNA is a predominantly electrostatic phenomenon driven by the existence of a strongly correlated liquid (SCL) of counterions at the DNA surface. This conclusion is also supported by the measurement of condensing and unraveling forces of DNA condensates by single molecular MT.

  10. Capillary electrophoretic study of green fluorescent hollow carbon nanoparticles.

    PubMed

    Liu, Lizhen; Feng, Feng; Hu, Qin; Paau, Man Chin; Liu, Yang; Chen, Zezhong; Bai, Yunfeng; Guo, Fangfang; Choi, Martin M F

    2015-09-01

    CE coupled with laser-induced fluorescence and UV absorption detections has been applied to study the complexity of as-synthesized green fluorescent hollow carbon nanoparticles (HC-NP) samples. The effects of pH, type, and concentration of the run buffer and SDS on the separation of HC-NP are studied in detail. It is observed that phosphate run buffer is more effective in separating the HC-NP and the optimal run buffer is found to be 30 mM phosphate and 10 mM SDS at pH 9.0. The CE separation of this HC-NP is based on the difference in size and electrophoretic mobility of HC-NP. Some selected HC-NP fractions are collected and further characterized by UV-visible absorption and photoluminescence (PL) spectroscopy, MS, and transmission electron microscopy. The fractionated HC-NP show profound differences in absorption, emission characteristics, and PL quantum yield that would have been otherwise misled by studying the complex mixture alone. It is anticipated that our CE methodology will open a new initiative on extensive studies of individual HC-NP species in the biomedical, catalysis, electronic, and optical device, energy storage, material, and sensing field.

  11. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors.

    PubMed

    He, Gaofei; Tolic, Ana; Bashkin, James K; Poon, Gregory M K

    2015-04-30

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs' binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs.

  12. Comparative Analysis of Interaction of Human and Yeast DNA Damage Recognition Complexes with Damaged DNA in Nucleotide Excision Repair*

    PubMed Central

    Krasikova, Yuliya S.; Rechkunova, Nadejda I.; Maltseva, Ekaterina A.; Pestryakov, Pavel E.; Petruseva, Irina O.; Sugasawa, Kaoru; Chen, Xuejing; Min, Jung-Hyun; Lavrik, Olga I.

    2013-01-01

    The human XPC-RAD23B complex and its yeast ortholog, Rad4-Rad23, are the primary initiators of global genome nucleotide excision repair. The interaction of these proteins with damaged DNA was analyzed using model DNA duplexes containing a single fluorescein-substituted dUMP analog as a lesion. An electrophoretic mobility shift assay revealed similarity between human and yeast proteins in DNA binding. Quantitative analyses of XPC/Rad4 binding to the model DNA structures were performed by fluorescent depolarization measurements. XPC-RAD23B and Rad4-Rad23 proteins demonstrate approximately equal binding affinity to the damaged DNA duplex (KD ∼ (0.5 ± 0.1) and (0.6 ± 0.3) nm, respectively). Using photoreactive DNA containing 5-iodo-dUMP in defined positions, XPC/Rad4 location on damaged DNA was shown. Under conditions of equimolar binding to DNA both proteins exhibited the highest level of cross-links to 5I-dUMP located exactly opposite the damaged nucleotide. The positioning of the XPC and Rad4 proteins on damaged DNA by photocross-linking footprinting is consistent with x-ray analysis of the Rad4-DNA crystal complex. The identity of the XPC and Rad4 location illustrates the common principles of structure organization of DNA damage-scanning proteins from different Eukarya organisms. PMID:23443653

  13. Salt dependence of DNA translocation dynamics through silicon nanopores detected by ultraviolet excitation

    NASA Astrophysics Data System (ADS)

    Ito, Shintaro; Yamazaki, Hirohito; Tsukahara, Mutsumi; Esashika, Keiko; Saiki, Toshiharu

    2016-04-01

    DNA translocation through nanopores was observed using ultraviolet excitation to investigate the effect of salt concentration and counterion species on the translocation speed. The translocation of 9.6-kbp DNA molecules was measured in an aqueous solvent containing KCl, NaCl, or LiCl. An increase in the KCl concentration from 0.5 to 2 M increased the DNA translocation time. Maintaining the salt concentration at 1.0 M but replacing KCl with NaCl or LiCl also increased the translocation time. These results suggest that the effective charge on the DNA changed due to the binding of counterions, decreasing the DNA electrophoretic mobility. Significant correlation was observed between the translocation time and the dwell time in the observation volume (time needed to move out of the observation volume), and a possible explanation for this observation is provided.

  14. The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.

    PubMed Central

    Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S

    1994-01-01

    Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images PMID:7935371

  15. The relationship between UV-irradiance, photoprotective compounds and DNA damage in two intertidal invertebrates with contrasting mobility characteristics.

    PubMed

    Cubillos, Victor Mauricio; Burritt, David J; Lamare, Miles D; Peake, Barrie M

    2015-08-01

    The photoprotective role of mycosporine-like amino acids (MAA) against the generation of DNA cyclobutane pyrimidine dimers (CPD) was studied in the sessile intertidal anemone Actinia tenebrosa and the mobile intertidal gastropod Diloma aethiops through 27months at a mid-latitude New Zealand location. MAA were sequestered by A. tenebrosa and D. aethiops from their diet, although maximum total MAA levels in both species were not correlated with seasonal variation in maximum ambient UV-B levels recorded at the collection site. Temporal changes in total MAA in A. tenebrosa showed a six months lag-time in their concentration regarding to the environmental UV-B levels. This lag period corresponded to an observed increase in CPD production from spring to summer; suggesting that MAA do not completely protect the anemone from UV-B during summer. For D. aethiops, total MAA concentrations did not change significantly during the study, although qualitative changes in MAA were apparent. A month lag-time in MAA concentration in D. aethiops and possibly the physical barrier that the shell confers to the animal, can explain reduced CPD levels in comparative terms with A. tenebrosa. Although MAA are used by invertebrates for photoprotection, contrasting mobility characteristics and the presence of physical adaptations can confer them important protection levels during temporal changes of UV-B at mid-latitude places of the Southern Hemisphere.

  16. Electrophoretic deposition of chiral polymers and composites.

    PubMed

    Wang, Y; Pang, X; Zhitomirsky, I

    2011-10-15

    Electrophoretic deposition (EPD) method has been developed for the deposition of thin films of chiral polymers. EPD of poly-L-lysine (PLL) and poly-L-ornithine (PLO) films was performed for the first time on conductive substrates from aqueous and ethanol-water solutions. The deposition yield was monitored using a quartz crystal microbalance. The results demonstrated that the deposition yield can be varied by variation of the deposition time, voltage and polymer concentration in the solutions. It was shown that PLL and PLO provided stabilization and charging of hydroxyapatite (HA) nanoparticles in suspensions. Composite PLL-HA and PLO-HA films of controlled thickness were prepared by EPD. Electron microscopy investigations showed that the thickness of the PLL, PLO and composite films was varied in the range of 0-3 μm. The polymer and composite films can be used for biomedical applications.

  17. Electrophoretic Deposition on Porous Non-Conductors

    NASA Technical Reports Server (NTRS)

    Compson, Charles; Besra, Laxmidhar; Liu, Meilin

    2007-01-01

    A method of electrophoretic deposition (EPD) on substrates that are porous and electrically non-conductive has been invented. Heretofore, in order to perform an EPD, it has been necessary to either (1) use a substrate material that is inherently electrically conductive or (2) subject a non-conductive substrate to a thermal and/or chemical treatment to render it conductive. In the present method, instead of relying on the electrical conductivity of the substrate, one ensures that the substrate is porous enough that when it is immersed in an EPD bath, the solvent penetrates throughout the thickness, thereby forming quasi-conductive paths through the substrate. By making it unnecessary to use a conductive substrate, this method simplifies the overall EPD process and makes new applications possible. The method is expected to be especially beneficial in enabling deposition of layers of ceramic and/or metal for chemical and electrochemical devices, notably including solid oxide fuel cells.

  18. Recent patents on electrophoretic displays and materials.

    PubMed

    Christophersen, Marc; Phlips, Bernard F

    2010-11-01

    Electrophoretic displays (EPDs) have made their way into consumer products. EPDs enable displays that offer the look and form of a printed page, often called "electronic paper". We will review recent apparatus and method patents for EPD devices and their fabrication. A brief introduction into the basic display operation and history of EPDs is given, while pointing out the technological challenges and difficulties for inventors. Recently, the majority of scientific publications and patenting activity has been directed to micro-segmented EPDs. These devices exhibit high optical reflectance and contrast, wide viewing angle, and high image resolution. Micro-segmented EPDs can also be integrated with flexible transistors technologies into flexible displays. Typical particles size ranges from 200 nm to 2 micrometer. Currently one very active area of patenting is the development of full-color EPDs. We summarize the recent patenting activity for EPDs and provide comments on perceiving factors driving intellectual property protection for EPD technologies.

  19. SPAR electrophoretic separation experiments, part 2

    NASA Technical Reports Server (NTRS)

    Cosmi, F. M.

    1978-01-01

    The opportunity to use a sounding rocket for separation experiments is a logical continuation of earlier electrophoresis demonstrations and experiments. A free-flow electrophoresis system, developed under the Advanced Applications Flight Experiment (AAFE) Program, was designed so that it would fit into a rocket payload. The SPAR program provides a unique opportunity to complete the intial stages of microgravity testing prior to any Shuttle applications. The objective of the work described in this report was to ensure proper operating parameters for the defined experimental samples to be used in the SPAR Electrophoretic Separation Experiment. Ground based experiments were undertaken not only to define flight parameters but also to serve as a point of comparison for flight results. Possible flight experiment problem areas were also studied such as sample interaction due to sedimentation, concentration effects and storage effects. Late in the program anomalies of field strengths and buffer conductivities were also investigated.

  20. Investigation of the free flow electrophoretic process

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1980-01-01

    The effects of gravity on the free flow electrophoretic process was demonstrated. The free flow electrophoresis chamber used to demonstrate the effects of gravity on the process was of a proprietary design. This chamber was 120 cm long, 16 cm wide, and 0.15 cm thick. Flow in this chamber was in the upward direction and exited through 197 outlets at the top of the chamber. During electrophoresis a stream of sample was injected into the flow near the bottom of the chamber and an electrical field was applied across the width of the chamber. The field caused a lateral force on particles in the sample proportional to the inherent change of the particle and the electric field strength. Particle lateral velocity was then dependent on the force due to viscous drag which was proportional to particle size and particle shape dependent.

  1. A probe-based mapping strategy for DNA sequencing with mobile primers

    SciTech Connect

    Strausbaugh, L.D.; Berg, C.M.

    1991-01-01

    Research on DNA sequencing continued. The specific areas of research targeted for the period of this Progress Report included three general phases: (1) optimization of probe-mapping by both the development of new transposons and the design of stream-lined methods for mapping; (2) application of transposon-based methods to larger plasmids and cosmids; and (3) initiation of PCR-based applications of transposons.

  2. A probe-based mapping strategy for DNA sequencing with mobile primers. Progress report

    SciTech Connect

    Strausbaugh, L.D.; Berg, C.M.

    1991-12-31

    Research on DNA sequencing continued. The specific areas of research targeted for the period of this Progress Report included three general phases: (1) optimization of probe-mapping by both the development of new transposons and the design of stream-lined methods for mapping; (2) application of transposon-based methods to larger plasmids and cosmids; and (3) initiation of PCR-based applications of transposons.

  3. All solution processed organic thin film transistor-backplane with printing technology for electrophoretic display

    USGS Publications Warehouse

    Lee, Myung W.; Song, C.K.

    2012-01-01

    In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).

  4. Asymmetric DNA binding by a homodimeric bHLH protein.

    PubMed

    Winston, R L; Ehley, J A; Baird, E E; Dervan, P B; Gottesfeld, J M

    2000-08-08

    Protein-DNA interactions that lie outside of the core recognition sequence for the Drosophila bHLH transcription factor Deadpan (Dpn) were investigated using minor groove binding pyrrole-imidazole polyamides. Electrophoretic mobility shift assays and DNase I footprinting demonstrate that hairpin polyamides bound immediately upstream, but not immediately downstream of the Dpn homodimer selectively inhibit protein-DNA complex formation. Mutation of the Dpn consensus binding site from the asymmetric sequence 5'-CACGCG-3' to the palindromic sequence 5'-CACGTG-3' abolishes asymmetric inhibition. A Dpn mutant containing the unnatural amino acid norleucine in place of lysine at position 80 in the bHLH loop region is not inhibited by the polyamide, suggesting that the epsilon amino group at this position is responsible for DNA contacts outside the major groove. We conclude that the nonpalindromic Dpn recognition site imparts binding asymmetry by providing unique contacts to the basic region of each monomer in the bHLH homodimer.

  5. DNA bending induced by cruciform formation.

    PubMed

    Gough, G W; Lilley, D M

    Cruciform structures in DNA are of considerable interest, both as extreme examples of sequence-dependent structural heterogeneity and as models for four-way junctions such as the Holliday junction of homologous genetic recombination. Cruciforms are of lower thermodynamic stability than regular duplex DNA, and have been observed only in negatively supercoiled molecules, where the unfavourable free energy of formation is offset by the topological relaxation of the torsionally stressed molecule. From an experimental viewpoint this can be a disadvantage, as cruciform structures can be studied only in relatively large supercoiled DNA circles, and are destabilized when a break is introduced at any point. We therefore set out to construct a pseudo-cruciform junction--by generating hereroduplex formation between two inverted repeat sequences. Stereochemically, this should closely resemble a true cruciform but remain stable in a linear DNA fragment. We have now created such a junction and find that it has the expected sensitivities to endonucleases. These DNA fragments exhibit extremely anomalous gel electrophoretic mobility, the extent of which depends on the relative position of the pseudo-cruciform along the length of the molecule. Our results are very similar to those obtained by Wu and Crothers using kinetoplast DNA, and we conclude that the pseudo-cruciform junction introduces a bend in the linear DNA molecule.

  6. OGG1-DNA interactions facilitate NF-κB binding to DNA targets

    PubMed Central

    Pan, Lang; Hao, Wenjing; Zheng, Xu; Zeng, Xianlu; Ahmed Abbasi, Adeel; Boldogh, Istvan; Ba, Xueqing

    2017-01-01

    DNA repair protein counteracting oxidative promoter lesions may modulate gene expression. Oxidative DNA bases modified by reactive oxygen species (ROS), primarily as 7, 8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair (BER) pathway. Because cellular response to oxidative challenge is accompanied by DNA damage repair, we tested whether the repair by OGG1 is compatible with transcription factor binding and gene expression. We performed electrophoretic mobility shift assay (EMSA) using wild-type sequence deriving from Cxcl2 gene promoter and the same sequence bearing a single synthetic 8-oxoG at defined 5′ or 3′ guanine in runs of guanines to mimic oxidative effects. We showed that DNA occupancy of NF-κB present in nuclear extracts from tumour necrosis factor alpha (TNFα) exposed cells is OGG1 and 8-oxoG position dependent, importantly, OGG1 counteracting 8-oxoG outside consensus motif had a profound influence on purified NF-κB binding to DNA. Furthermore, OGG1 is essential for NF-κB dependent gene expression, prior to 8-oxoG excised from DNA. These observations imply that pre-excision step(s) during OGG1 initiated BER evoked by ROS facilitates NF-κB DNA occupancy and gene expression. PMID:28266569

  7. Mobilization of Nuclear Copper by Green Tea Polyphenol Epicatechin-3-Gallate and Subsequent Prooxidant Breakage of Cellular DNA: Implications for Cancer Chemotherapy

    PubMed Central

    Farhan, Mohd; Oves, Mohammad; Chibber, Sandesh; Hadi, Sheikh Mumtaz; Ahmad, Aamir

    2016-01-01

    Epidemiological as well as experimental evidence exists in support of chemopreventive and anticancer properties of green tea and its constituents. The gallocatechin, epicatechin-3-gallate is a major polyphenol present in green tea, shown responsible for these effects. Plant-derived polyphenolic compounds are established natural antioxidants which are capable of catalyzing oxidative DNA degradation of cellular DNA, alone as well as in the presence of transition metal ions, such as copper. Here we present evidence to support that, similar to various other polyphenoic compounds, epicatechin-3-gallate also causes oxidative degradation of cellular DNA. Single cell alkaline gel electrophoresis (Comet assay) was used to assess DNA breakage in lymphocytes that were exposed to various concentrations of epicatechin-3-gallate. Inhibition of DNA breakage in the presence of scavengers of reactive oxygen species (ROS) suggested involvement of ROS generation. Addition of neocuproine (a cell membrane permeable Cu(I) chelator) inhibited DNA degradation, dose-dependently, in intact lymphocytes. In contrast, bathocuproine, which does not permeate cell membrane, was observed to be ineffective. We further show that epicatechin-3-gallate degrades DNA in cell nuclei, which can also be inhibited by neocuproine, suggesting mobilization of nuclear copper in this reaction as well. Our results are indicative of ROS generation, possibly through mobilization of endogenous copper ions, and support our long-standing hypothesis of a prooxidant activity of plant-derived polyphenols as a mechanism for their documented anticancer properties. PMID:28035959

  8. Homodimer of p50 (NF kappa B1) does not introduce a substantial directed bend into DNA according to three different experimental assays.

    PubMed Central

    Kuprash, D V; Rice, N R; Nedospasov, S A

    1995-01-01

    Transcription factors can distort the conformation of the DNA double helix upon binding to their target sites. Previously, studies utilizing circular permutation--electrophoretic mobility shift assay suggested that the homodimer of p50 (NF kappa B1), canonical NF-kappa B (p65-p50), as well as several non-canonical NF-kappa B/Rel complexes, may induce substantial DNA bending at the binding site. Here we have applied three additional experimental approaches, helical phasing analysis, minicircle binding and cyclization kinetics, and conclude that the homodimer of p50 introduces virtually no directed bend into the consensus kappa B sequences GGGACTTTCC or GGGAATTCCC. Images PMID:7885838

  9. Small polydispersed circular DNA contains strains of mobile genetic elements and occurs more frequently in permanent cell lines of malignant tumors than in normal lymphocytes.

    PubMed

    Schmidt, Hannelore; Taubert, Helge; Lange, Heidemarie; Kriese, Karen; Schmitt, Wolfgang Daniel; Hoffmann, Steve; Bartel, Frank; Hauptmann, Steffen

    2009-08-01

    Small polydispersed circular DNA (spcDNA) belongs to the extrachromosomal pool of DNA and is composed of heterogeneous DNA circles. Whether spcDNA has a special function is currently unclear but their occurrence was suggested to be linked to genetic instability. In this study we investigated as to whether human lymphocytes from healthy volunteers also harbour spcDNA and whether spcDNA is present in all permanent cell lines from human normal and malignant tissues. Moreover, we were interested to see whether spcDNA contains sequences of mobile genetic elements. Our results show that spcDNA is present in all samples investigated yet the amount is lower in normal lymphocytes when compared to cancer cell lines (5.4 vs. 17.8%). Alu sequences were present in 12/16 cancer cell lines whereas LINE-1 (L1) sequences were present in 15 of them. Six tumor cell lines also contained telomeric sequences. In contrast to that, spcDNA of normal lymphocytes contains Alu and L1 sequences only in 3/16 cases and no telomeric sequences at all. Our findings suggest a direct dependency of the amount of Alu and L1 sequences on that of spcDNA. Beside these repetitive sequences, sequencing of spcDNA revealed in most cases chromosomal sequences of almost all chromosomes without an increased frequency of single regions. We suggest that the whole spcDNA including retrotranspositional elements and telomeric sequences may play a role for chromosomal rearrangements and genomic instability.

  10. Association of electrophoretic karyotype of Candida stellatoidea with virulence for mice

    SciTech Connect

    Kwon-Chung, K.J.; Wickes, B.L.; Merz, W.G.

    1988-07-01

    Seven isolates of Candida stellatoidea were studied for their electrophoretic karyotype, virulence for mice, sensitivity to UV radiation, growth rate in vitro, reaction on cycloheximide-indicator medium, and proteinase activity. The isolates exhibited one of two distinct electrophoretic karyotypes as determined by orthogonal field alternating gel electrophoresis (OFAGE). Four isolates, including the type culture of C. stellatoidea, belonged to electrophoretic karyotype type I by OFAGE, showing eight to nine bands of which at least two bands were less than 1,000 kilobases in size as estimated by comparison with the DNA bands of Saccharomyces cerevisiae. These isolates failed to produce fatal infection in mice within 20 days when 5 X 10(5) cells were injected intravenously. The yeasts were cleared from the kidneys of two of three mice tested by day 30. Type I showed proteinase activity on bovine serum albumin agar at pH 3.8 and produced a negative reaction on cycloheximide-bromcresol green medium within 48 h. The three grouped in type II by OFAGE showed banding patterns similar to those of a well-characterized isolate of Candida albicans. The isolates of type II had an electrophoretic karyotype of six to seven bands approximately 1,200 kilobases or greater in size. All three type II isolates were highly virulent for mice, producing fatality curves similar to those of a previously studied C. albicans isolate. From 80 to 90% of the mice injected with 5 X 10(5) cells intravenously died within 20 days. The type II isolates produced a positive reaction on cycloheximide-bromcresol green agar and showed no proteinase activity on bovine serum albumin agar at the low pH. In addition, the type II isolates grew faster and were significantly more resistant to UV irradiation than the type I isolates.

  11. Preparation and application of microcapsule-encapsulated color electrophortic fluid in Isopar M system for electrophoretic display

    NASA Astrophysics Data System (ADS)

    Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu

    2013-05-01

    The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.

  12. Molecular analysis and physicochemical properties of electrophoretic variants of wild soybean Glycine soja storage proteins.

    PubMed

    Fukuda, Takako; Maruyama, Nobuyuki; Kanazawa, Akira; Abe, Jun; Shimamoto, Yoshiya; Hiemori, Miki; Tsuji, Hideaki; Tanisaka, Takatoshi; Utsumi, Shigeru

    2005-05-04

    Cultivated soybeans (Glycine max) are derived from wild soybeans (Glycine soja) and can be crossed with them to produce fertile offspring. The latter exhibit greater genetic variation than the former, suggesting a possibility that wild soybeans contain storage proteins with properties different from and better than those of cultivated soybeans. To identify a wild soybean suitable for breeding a new soybean cultivar, we analyzed seed proteins from 390 lines of wild soybeans by electrophoresis. We found some lines containing electrophoretic variants of glycinin and beta-conglycinin subunits: one line containing a small alpha' subunit of beta-conglycinin and two and five lines containing small A3 and large A4 polypeptides of glycinin, respectively. Beta-Conglycinin and glycinin containing such variant subunits exhibited solubility and emulsifying ability similar to those of the predominant types of wild and cultivated soybeans. Glycinins containing small A3 and large A4 gave a shoulder derived from the start of denaturation at a temperature 4 degrees C lower than that of glycinin from the predominant types of wild and cultivated soybeans, although their thermal denaturation midpoint temperatures were very similar to each other. Cloning and sequencing of the predominant and variant subunit cDNAs revealed that the small alpha' and the small A3 lacked 24 amino acid residues in the extension region and four amino acid residues in the hypervariable region, respectively, and that the large A4 did not have an insert corresponding to the difference in the electrophoretic mobility but Arg279 and Gln305 were replaced by glutamine and histidine, respectively, in the hypervariable region. These suggest that small differences even in the hypervariable region can affect the thermal stability, as well as the electrophoretic mobilities, of the proteins.

  13. Asparagine deamidation reduces DNA-binding affinity of the Drosophila melanogaster Scr homeodomain.

    PubMed

    O'Connell, Nichole E; Lelli, Katherine; Mann, Richard S; Palmer, Arthur G

    2015-10-24

    Spontaneous deamidation of asparagine is a non-enzymatic post-translational modification of proteins. Residue Asn 321 is the main site of deamidation of the Drosophila melanogaster Hox transcription factor Sex Combs Reduced (Scr). Formation of iso-aspartate, the major deamidation product, is detected by HNCACB triple-resonance NMR spectroscopy. The rate of deamidation is quantified by fitting the decay of Asn NH2 side-chain signals in a time-series of (15)N-(1)H HSQC NMR spectra. The deamidated form of Scr binds to specific DNA target sequences with reduced affinity as determined by an electrophoretic mobility shift assay.

  14. The in vitro DNA binding properties of NDP kinase are related to its oligomeric state.

    PubMed

    Mesnildrey, S; Agou, F; Véron, M

    1997-11-24

    Genetic and biochemical evidences suggest that the enzymatic activity of NDP kinase is necessary but not sufficient for its biological function. While the human NDPK-B binds specifically single-strand polypyrimidines sequences, the hexameric enzyme from Dictyostelium does not. We demonstrated by electrophoretic mobility shift assay and filter binding assay that a dimeric mutant from Dictyostelium binds to an oligodesoxynucleotide while the wild-type does not. These data suggest that the differences in the DNA binding properties of several eucaryotic NDP kinases might be correlated to the differences in the stability of their hexameric structure.

  15. A Microfluidic Platform for Interfacial Electrophoretic Deposition

    NASA Astrophysics Data System (ADS)

    Joung, Young Soo; Moran, Jeffrey; Jones, Andrew; Bailey, Eric; Buie, Cullen

    2014-11-01

    Composite membranes of hydrogel and carbon nanotubes (CNTs) are fabricated using electrophoretic deposition (EPD) at the interface of two immiscible liquids in microfluidic channels. Microfluidic channels, which have two parallel electrodes at the walls, are used to create electric fields across the interface of oil and water continuously supplied into the channels. Depending on the Reynolds (Re) and Weber (We) numbers of oil and water, we observe different formations of the interface. Once we find the optimal Re and We to create a planar interface in the channel, we apply an electric field across the interface for EPD of CNTs and/or silver (Ag) nanorods dispersed in water. During EPD, particles migrate to the oil/water interface, where cross-linking of polymers is induced to form composite hydrogel membranes. Properties of the composite hydrogel films are controlled by electric fields, CNT concentrations, and both Re and We numbers, allowing for continuous production. This fabrication method is effective to create composite polymer membranes placed in microfluidic devices with tunable electrical, mechanical, and biological properties. Potential applications include fabrication of doped hydrogels for drug delivery, conductive hydrogels for biological sensing, and electron permeable membranes for water splitting and osmotic power generation.

  16. A lateral electrophoretic flow diagnostic assay.

    PubMed

    Lin, Robert; Skandarajah, Arunan; Gerver, Rachel E; Neira, Hector D; Fletcher, Daniel A; Herr, Amy E

    2015-03-21

    Immunochromatographic assays are a cornerstone tool in disease screening. To complement existing lateral flow assays (based on wicking flow) we introduce a lateral flow format that employs directed electrophoretic transport. The format is termed a "lateral e-flow assay" and is designed to support multiplexed detection using immobilized reaction volumes of capture antigen. To fabricate the lateral e-flow device, we employ mask-based UV photopatterning to selectively immobilize unmodified capture antigen along the microchannel in a barcode-like pattern. The channel-filling polyacrylamide hydrogel incorporates a photoactive moiety (benzophenone) to immobilize capture antigen to the hydrogel without a priori antigen modification. We report a heterogeneous sandwich assay using low-power electrophoresis to drive biospecimen through the capture antigen barcode. Fluorescence barcode readout is collected via a low-resource appropriate imaging system (CellScope). We characterize lateral e-flow assay performance and demonstrate a serum assay for antibodies to the hepatitis C virus (HCV). In a pilot study, the lateral e-flow assay positively identifies HCV+ human sera in 60 min. The lateral e-flow assay provides a flexible format for conducting multiplexed immunoassays relevant to confirmatory diagnosis in near-patient settings.

  17. Microencapsulated Electrophoretic Films for Electronic Paper Displays

    NASA Astrophysics Data System (ADS)

    Amundson, Karl

    2003-03-01

    Despite the dominance of liquid crystal displays, they do not perform some functions very well. While backlit liquid crystal displays can offer excellent color performance, they wash out in bright lighting and suffer from high power consumption. Reflective liquid crystal displays have limited brightness, making these devices challenging to read for long periods of time. Flexible liquid crystal displays are difficult to manufacture and keep stable. All of these attributes (long battery lifetime, bright reflective appearance, compatibility with flexible substrates) are traits that would be found in an ideal electronic paper display - an updateable substitute for paper that could be employed in electronic books, newspapers, and other applications. I will discuss technologies that are being developed for electronic-paper-like displays, and especially on particle-based technologies. A microencapsulated electrophoretic display technology is being developed at the E Ink corporation. This display film offers offer high brightness and an ink-on-paper appearance, compatibility with flexible substrates, and image stability that can lead to very low power consumption. I will present some of the physical and chemical challenges associated with making display films with high performance.

  18. Development of an electrophoretic image display

    NASA Astrophysics Data System (ADS)

    Liebert, R.; Lalak, J.

    1981-02-01

    The purpose of this work is to develop an X-Y addressed electrophoretic image display (DPID). At a recent DARPA/PL/ISI meeting it was agreed to increase the size of the display from 350 x 600 to 360 x 640 elements. Glass substrates with the required In2O3 thickness have been obtained commercially; it is now no longer necessary to deposit additional material. Better difinition of the row electrodes has been obtained by using this glass and using ion-beam milling rather than liquid etching. Techniques to identify and repair shorts in the row electrodes have been developed. The number of defects has been reduced by better filtration and proper outgassing of the photoresist. Aluminum spits were eliminated by using electron-beam evaporation rather than evaporation from a tungsten coil. Sputter deposition of ITO has been replaced by the more reproducible evaporation technique. To obtain better electrical contact between the display and the fan-out board, the homogeneous conductive elastomer was replaced with a laminated one. A device free of shorts or opens in the row electrodes and free of shorts between the column electrodes is now being tested.

  19. Barium hexaferrite suspensions for electrophoretic deposition.

    PubMed

    Ovtar, Simona; Lisjak, Darja; Drofenik, Miha

    2009-09-15

    In this investigation we have looked at the preparation of barium hexaferrite suspensions, with the stability of the magnetic barium hexaferrite particles being increased by the addition of a surfactant, dodecylbenzylsulfonic acid (DBSA). The influence of the solubility DBSA in different solvents and its adsorption onto the surfaces of particles with different sizes were determined from zeta-potential measurements. The most suitable and stable suspensions of barium hexaferrite particles, regardless of their sizes, were obtained in 1-butanol, and these were then used for a subsequent electrophoretic deposition. The microstructures of the deposits were examined with electron microscopy. The thickness and density of the deposits as a function of the electric field, the zeta-potential, the particle size, and the separation distance between the electrodes were investigated. The thickness of the deposits was found to increase with the increasing zeta-potential of the suspension and with the increasing separation distance between the electrodes. Denser deposits were obtained from the suspensions of smaller particles that had narrower particle size distributions.

  20. Fluid Delivery System For Capillary Electrophoretic Applications.

    SciTech Connect

    Li, Qingbo; Liu, Changsheng; Kane, Thomas E.; Kernan, John R.; Sonnenschein, Bernard; Sharer, Michael V.

    2002-04-23

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carrousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  1. Evaluation of aptamers as molecular recognition elements for pathogens using capillary electrophoretic analysis

    NASA Astrophysics Data System (ADS)

    McMasters, Sun; Stratis-Cullum, Dimitra N.

    2006-10-01

    The biomolecular interactions between a fluorescently labeled aptamer and whole cell Campylobacter jejuni(C. jejuni) have been characterized using capillary electrophoresis with laser-induced fluorescence detection. From electrophoretic analysis, the bound complex forms, unbound aptamer, and cells were visualized. The relative binding affinity of the DNA aptamer with C. jejuni was compared with other food-borne pathogens including Escherichia coli O157:H7 and Salmonella typhimurium. Preliminary data suggests that this aptamer exhibits strong binding affinity towards C. jejuni with minimal cross reactivity over other food pathogens when equivalent cell concentrations were used.

  2. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.

    2000-01-01

    The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.

  3. Hybrid nano-composites made of ss-DNA/wrapped carbon nanotubes and titania.

    PubMed

    Romio, Martina; Mesa, Camillo La

    2017-04-01

    Multi-walled carbon nanotubes, MWCNTs, are stabilized thanks to the surface wrapping of single-strand DNA, ss-DNA; the resulting adducts are kinetically and thermodynamically stable Such entities build up nano-hybrids with titania, TiO2, nano-particles, in presence of surfactant as an adjuvant. The conditions leading to TiO2 adsorption onto ss-DNA/CNTs were investigated, by optimizing the concentration of adducts, nano-particles (NPs), and of the cationic surfactant (CTAB). Controlling the working conditions makes possible to get homogeneously organized hybrids. Characterization by DLS, electro-phoretic mobility, SEM and AFM clarified the surfactant-assisted association modes between adducts and CTAB-functionalized TiO2. Nano-particles' clustering onto DNA-wrapped adducts gives hybrids trough electrostatic interactions. Surface coverage by TiO2 is significant and homogeneous. It is expected that the reported hybrids can be useful for applications in heterogeneous catalysis.

  4. Visualizing inhibition of nucleosome mobility and transcription by cisplatin-DNA interstrand crosslinks in live mammalian cells.

    PubMed

    Zhu, Guangyu; Song, Lina; Lippard, Stephen J

    2013-07-15

    Cisplatin is a widely used anticancer drug that acts by binding DNA and causing the formation of intrastrand and interstrand (ICL) crosslinks, but the precise downstream effects of the latter damage are not well understood. In this study, we investigated the influence of cisplatin ICLs on synthetic nucleosomes that were platinated in a site-specific manner in vitro and on gene transcription in live mammalian cells. Nucleosome core particles that we constructed contained site-specific cisplatin 5'-d(G*pC)/5'-d(G*pC) ICLs, where the asterisk denotes the platinated nucleoside, to examine the influence of platinum lesions on the dynamic behavior of nucleosomes in solution. A cisplatin ICL, but not a 1,2-d(GpG) crosslink, significantly inhibited ATP-independent histone octamer-DNA sliding. We also used a novel linearization-recircularization strategy described here to synthesize mammalian expression vectors containing site-specific cisplatin ICLs. Plasmid vectors were tested in live mammalian cells to study the transcription inhibition effects of cisplatin ICLs in the context of two different repair backgrounds. Cisplatin ICLs inhibit transcription as effectively as 1,2-d(GpG) crosslinks. We determined that nucleotide excision repair plays a key role in the removal of cisplatin ICLs, acting in a replication-independent fashion. We also found that loss of mismatch repair function dramatically attenuates the transcription inhibition effects by cisplatin ICLs but not 1,2-d(GpG) intrastrand crosslinks. Our results revealed the unique properties of cisplatin ICLs on nucleosome mobility and on transcription, and they defined how these adducts act in a manner completely different from that used for cisplatin 1,2-d(GpG) crosslinks. These new findings provide direct support for a role of ICLs in the pharmacologic activities of cisplatin, despite the lower frequency of their formation.

  5. Effect of long-term removal of iron from asbestos by desferrioxamine B on subsequent mobilization by other chelators and induction of DNA single-strand breaks.

    PubMed

    Chao, C C; Aust, A E

    1994-01-01

    The long-term removal of iron from crocidolite or amosite by desferrioxamine B (DF) at pH 7.5 or 5.0 was studied. Crocidolite or amosite (1 mg/ml) was suspended in 50 mM NaCl at pH 7.5 or 5.0 with the addition of 1 mM DF for up to 90 days. Although the rate of iron mobilization decreased with time, iron was continuously mobilized from both forms of asbestos at pH 5.0 or 7.5. The amount of iron mobilized from crocidolite was at least twice that mobilized from amosite at either pH. Iron was mobilized more rapidly from crocidolite at pH 5.0 than at 7.5 for the first 15 days, but at later times the amount being mobilized at pH 7.5 became equal to or slightly greater than that at 5.0. For amosite, the mobilization at pH 5.0 was always greater than that at pH 7.5. Next, the effect of iron removal from asbestos by DF on subsequent iron mobilization by a second chelator (EDTA or citrate) and on induction of DNA single-strand breaks (SSBs) was studied. Asbestos, treated for up to 15 days with DF at pH 7.5, was washed to remove ferrioxamine and excess DF, then incubated with EDTA or citrate (1 mM). The rates of iron mobilization from both forms of asbestos by a second chelator decreased as more and more iron was removed by DF. Induction of DNA SSBs also decreased, reflecting the unavailability of iron to catalyze the damage. The results suggest three things. First, if long-term mobilization of iron from asbestos occurs in vivo as has been observed in vitro, it may play a role in the long-term biological effects of asbestos. Second, more rapid mobilization of iron from asbestos fibers may occur when the fibers are phagocytized by cells and maintained in phagosomes where the pH is 4.0-5.0. Third, treatment of asbestos by iron chelators, such as DF, prior to exposure to cultured cells or whole animals, may reduce the biological effects of asbestos resulting from iron, but may not completely eliminate them.

  6. Capillary electrophoretic and computational study of the complexation of valinomycin with rubidium cation.

    PubMed

    Ehala, Sille; Dybal, Jirí; Makrlík, Emanuel; Kasicka, Václav

    2009-03-01

    This study is focused on the characterization of interactions of valinomycin (Val), a macrocyclic dodecadepsipeptide antibiotic ionophore, with rubidium cation, Rb(+). Capillary affinity electrophoresis was employed for the experimental evaluation of the strength of the Val-Rb(+) complex. The study involved the measurement of the change of effective electrophoretic mobility of Val at increasing concentration of Rb(+) cation in the BGE. From the dependence of Val effective electrophoretic mobility on the Rb(+) cation concentration in the BGE (methanolic solution of 100 mM Tris, 50 mM acetic acid, 0-1 mM RbCl), the apparent binding (stability) constant (K(b)) of the Val-Rb(+) complex in methanol was evaluated as log K(b)=4.63+/-0.27. According to the quantum mechanical density functional theory calculations employed to predict the most probable structure of Val-Rb(+) complex, Val is stabilized by strong non-covalent bond interactions of Rb(+) with six ester carbonyl oxygen atoms so that the position of the "central" Rb(+) cation in the Val cage is symmetric.

  7. Mediation of growth factor induced DNA synthesis and calcium mobilization by Gq and Gi2

    PubMed Central

    1993-01-01

    A newly identified subclass of the heterotrimeric GTP binding regulatory protein family, Gq, has been found to be expressed in a diverse range of cell types. We investigated the potential role of this protein in growth factor signal transduction pathways and its potential relationship to the function of other G alpha subclasses. Recent biochemical studies have suggested that Gq regulates the beta 1 isozyme of phospholipase C (PLC beta 1), an effector for some growth factors. By microinjection of inhibitory antibodies specific to distinct G alpha subunits into living cells, we have determined that G alpha q transduces bradykinin- and thrombin-stimulated intracellular calcium transients which are likely to be mediated by PLC beta 1. Moreover, we found that G alpha q function is required for the mitogenic action of both of these growth factors. These results indicate that both thrombin and bradykinin utilize Gq to couple to increases in intracellular calcium, and that Gq is a necessary component of the mitogenic action of these factors. While microinjection of antibodies against G alpha i2 did not abolish calcium transients stimulated by either of these factors, such microinjection prevented DNA synthesis in response to thrombin but not to bradykinin. These data suggest that thrombin- induced mitogenesis requires both Gq and Gi2, whereas bradykinin needs only the former. Thus, different growth factors operating upon the same cell type use overlapping yet distinct sets of G alpha subtypes in mitogenic signal transduction pathways. The direct identification of the coupling of both a pertussis toxin sensitive and insensitive G protein subtype in the mitogenic pathways utilized by thrombin offers an in vivo biochemical clarification of previous results obtained by pharmacologic studies. PMID:8458876

  8. Understanding local forces in electrophoretic ink systems: utilizing optical tweezers to explore electrophoretic display devices

    NASA Astrophysics Data System (ADS)

    Wei, David L.; Dickinson, Mark R.; Smith, N.; Gleeson, Helen F.

    2016-09-01

    Optical tweezers can be used as a valuable tool to characterize electrophoretic display (EPD) systems. EPDs are ubiquitous with e-readers and are becoming a commonplace technology where reflective, low-power displays are required; yet the physics of some features crucial to their operation remains poorly defined. We utilize optical tweezers as a tool to understand the motion of charged ink particles within the devices and show that the response of optically trapped electrophoretic particles can be used to characterize electric fields within these devices. This technique for mapping the force can be compared to simulations of the electric field in our devices, thus demonstrating that the electric field itself is the sole governor of the particle motion in an individual-particle regime. By studying the individual-particle response to the electric field, we can then begin to characterize particle motion in `real' systems with many particles. Combining optical tweezing with particle tracking techniques, we can investigate deviations in many particle systems from the single-particle case.

  9. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    PubMed

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery.

  10. Column-coupling strategies for multidimensional electrophoretic separation techniques.

    PubMed

    Kler, Pablo A; Sydes, Daniel; Huhn, Carolin

    2015-01-01

    Multidimensional electrophoretic separations represent one of the most common strategies for dealing with the analysis of complex samples. In recent years we have been witnessing the explosive growth of separation techniques for the analysis of complex samples in applications ranging from life sciences to industry. In this sense, electrophoretic separations offer several strategic advantages such as excellent separation efficiency, different methods with a broad range of separation mechanisms, and low liquid consumption generating less waste effluents and lower costs per analysis, among others. Despite their impressive separation efficiency, multidimensional electrophoretic separations present some drawbacks that have delayed their extensive use: the volumes of the columns, and consequently of the injected sample, are significantly smaller compared to other analytical techniques, thus the coupling interfaces between two separations components must be very efficient in terms of providing geometrical precision with low dead volume. Likewise, very sensitive detection systems are required. Additionally, in electrophoretic separation techniques, the surface properties of the columns play a fundamental role for electroosmosis as well as the unwanted adsorption of proteins or other complex biomolecules. In this sense the requirements for an efficient coupling for electrophoretic separation techniques involve several aspects related to microfluidics and physicochemical interactions of the electrolyte solutions and the solid capillary walls. It is interesting to see how these multidimensional electrophoretic separation techniques have been used jointly with different detection techniques, for intermediate detection as well as for final identification and quantification, particularly important in the case of mass spectrometry. In this work we present a critical review about the different strategies for coupling two or more electrophoretic separation techniques and the

  11. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  12. Cytogenetic evaluation and DNA interaction studies of the food colorants amaranth, erythrosine and tartrazine.

    PubMed

    Mpountoukas, Panagiotis; Pantazaki, Anastasia; Kostareli, Efterpi; Christodoulou, Pantelitsa; Kareli, Dimitra; Poliliou, Stamatia; Mourelatos, Costas; Lambropoulou, Vasso; Lialiaris, Theodore

    2010-10-01

    Food coloring agents, amaranth, erythrosine and tartrazine have been tested at 0.02-8mM in human peripheral blood cells in vitro, in order to investigate their genotoxic, cytotoxic and cytostatic potential. Amaranth at the highest concentration (8mM) demonstrates high genotoxicity, cytostaticity and cytotoxicity. The frequency of SCEs/cell was increased 1.7 times over the control level. Additionally, erythrosine at 8, 4 and 2mM shows a high cytotoxicity and cytostaticity. Finally, tartrazine seems to be toxic at 8 and 4mM. No signs of genotoxicity were observed. Reversely, tartrazine showed cytotoxicity at 1 and 2mM. Furthermore, spectroscopic titration studies for the interaction of these food additives with DNA showed that these dyes bind to calf thymus DNA and distinct isosbestic points are observed clearly suggesting binding of the dyes to DNA. Additionally DNA electrophoretic mobility experiments showed that these colorants are obviously capable for strong binding to linear dsDNA causing its degradation. PCR amplification of all DNA fragments (which previously were pre-treated with three different concentrations of the colorants, extracted from agarose gel after separation and then purified), seems to be attenuated with a manner dye concentration-dependent reflecting in a delayed electrophoretic mobility due to the possible binding of some molecules of the dyes. Evaluation of the data and curves were obtained after quantitative and qualitative analysis of the lanes of the gel by an analyzer computer program. Our results indicate that these food colorants had a toxic potential to human lymphocytes in vitro and it seems that they bind directly to DNA.

  13. Long DNA Molecules at Liquid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Li, B.; Sokolov, J.; Rafailovich, M.; Chu, B.

    2006-03-01

    The electrophoresis of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1] in the regime of strong electrostatic interaction. The mobility of lambda- DNA molecules on this surface was found to scale as the square root of the persistent length with the ionic strength at high buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2-4]. At low buffer concentrations the DNA chains are stretched .The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface as found to be higher then for the shorter ones in the electric field. [1]. N. Pernodet, V. Samuilov, K. Shin, et al. Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, et al. Electrophoresis, 23 (2002) 2618-2625. [3] Y.-S. Seo, H.. Luo, V. A. Samuilov, et al. DNA Electrophoresis on nanopatterned surfaces, Nano Letters, 4, 2004, 659-664.

  14. Long DNA Molecules at Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Seo, Young-Soo; Samuilov, Vladimir; Sokolov, John; Rafailovich, Miriam; Chu, Ben

    2003-03-01

    The electrical transport of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1]. We have shown that a flat silicon substrate, without any surface features, can be used to fractionate DNA on a liquid-solid interface. We determine that the ability of a flat surface to separate DNA molecules results from the local friction between the surface and the adsorbed DNA segments. The mobility of lambda- DNA molecules on this surface was found to scale as the persistent length with the ionic strength of the buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2]. At low buffer concentrations the adsorbed DNA move in the electrical field parallel to the surface, and also due the electroosmotic convection that drags the DNA chains and they are stretched . The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu. DNA Electrophoresis on a Flat Surface, Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, M. Rafailovich, B. Tinland, J. Kim, B. Chu. DNA separation at a liquid-solid interface, Electrophoresis, 23 (2002) 2618-2625.

  15. Electrophoretic gel image analysis software for the molecular biology laboratory.

    PubMed

    Redman, T; Jacobs, T

    1991-06-01

    We present GelReader 1.0, a microcomputer program designed to make precision, digital analysis of one-dimensional electrophoretic gels accessible to the molecular biology laboratory of modest means. Images of electrophoretic gels are digitized via a desktop flatbed scanner from instant photographs, autoradiograms or chromogenically stained blotting media. GelReader is then invoked to locate lanes and bands and generate a report of molecular weights of unknowns, based on specified sets of standards. Frequently used standards can be stored in the program. Lanes and bands can be added or removed, based upon users' subjective preferences. A unique lane histogram feature facilitates precise manual addition of bands missed by the software. Image enhancement features include palette manipulation, histogram equalization, shadowing and magnification. The user interface strikes a balance between program autonomy and user intervention, in recognition of the variability in electrophoretic gel quality and users' analytical needs.

  16. Electrophoretic interactions and aggregation of colloidal biological particles

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.; Nichols, Scott C.; Loewenberg, Michael; Todd, Paul

    1994-01-01

    The separation of cells or particles from solution has traditionally been accomplished with centrifuges or by sedimentation; however, many particles have specific densities close to unity, making buoyancy-driven motion slow or negligible, but most cells and particles carry surface charges, making them ideal for electrophoretic separation. Both buoyancy-driven and electrophoretic separation may be influenced by hydrodynamic interactions and aggregation of neighboring particles. Aggregation by electrophoresis was analyzed for two non-Brownian particles with different zeta potentials and thin double layers migrating through a viscous fluid. The results indicate that the initial rate of electrophoretically-driven aggregation may exceed that of buoyancy-driven aggregation, even under conditions in which buoyancy-driven relative motion of noninteracting particles is dominant.

  17. The yeast CDP1 gene encodes a triple-helical DNA-binding protein.

    PubMed

    Musso, M; Bianchi-Scarrà, G; Van Dyke, M W

    2000-11-01

    The formation of triple-helical DNA has been implicated in several cellular processes, including transcription, replication and recombination. While there is no direct evidence for triplexes in vivo, cellular proteins that specifically recognize triplex DNA have been described. Using a purine-motif triplex probe and southwestern library screening, we isolated five independent clones expressing the same C-terminal 210 amino acids of the Saccharomyces cerevisiae protein Cdp1p fused with beta-galactosidase. In electrophoretic mobility shift assays, recombinant Cdp1pDelta1-867 bound Pu-motif triplex DNAs with high affinity (K:(d) approximately 5 nM) and bound Py-motif triplex, duplex and single-stranded DNAs with far lower affinity (0.5-5.0 microM). Genetic analyses revealed that the CDP1 gene product was required for proper chromosome segregation. The possible involvement of triplex DNA in this process is discussed.

  18. Importance of temperature effect on the electrophoretic behavior of charge-regulated particles.

    PubMed

    Hsu, Jyh-Ping; Tai, Yi-Hsuan; Yeh, Li-Hsien; Tseng, Shiojenn

    2012-01-10

    The Joule heating effect is inevitable in electrophoresis operations. To assess its influence on the performance of electrophoresis, we consider the case of a charge-regulated particle in a solution containing multiple ionic species at temperatures ranging from 298 to 308 K. Using an aqueous SiO(2) dispersion as an example, we show that an increase in the temperature leads to a decrease in both the dielectric constant and the viscosity of the liquid phase, and an increase in both the diffusivity of ions and the particle surface potential. For a particle having a constant surface potential, its electrophoretic mobility is most influenced by the variation in the liquid viscosity as the temperature varies, but for a charged-regulated particle both the liquid viscosity and the surface potential can play an important role. Depending upon the level of pH, the degree of increase in the mobility can be on the order of 40% for a 5 K increase in the temperature. The presence of double-layer polarization, which is significant when the surface potential is sufficiently high, has the effect of inhibiting that increase in the mobility. This implies that the influence of the temperature on the mobility of the particle is most significant when the pH is close to the point of zero charge.

  19. The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    PubMed Central

    Abella, Marc; Rodríguez, Sonia; Paytubi, Sonia; Campoy, Susana; White, Malcolm F.; Barbé, Jordi

    2007-01-01

    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. PMID:17921500

  20. The greater negative charge density of DNA in tris-borate buffers does not enhance DNA condensation by multivalent cations.

    PubMed

    Schwinefus, J J; Bloomfield, V A

    2000-12-01

    As indicated by recent measurements of the electrophoretic free solution mobility, DNA appears to have a greater helical charge density in Tris-borate-EDTA (TBE) buffers than in Tris-acetate-EDTA (TAE) buffers. Since electrostatic forces play a major role in DNA packaging processes, we have investigated the condensation of closed circular plasmid DNA using total intensity and dynamic light scattering in Tris-borate, Tris-acetate, and Tris-cacodylate buffers with cobaltic hexa-amine (III) [Co(NH(3))(3+)(6)]. We find that neither the critical concentration of Co(NH(3))(3+)(6) nor the hydrodynamic radii of the resulting condensates vary significantly in the buffer systems studied here despite the prediction that DNA condensation should occur at significantly lower Co(NH(3))(3+)(6) concentrations in Tris-borate buffers. Assuming a persistence length behavior similar to B-DNA in the presence of multivalent cations, a decrease in the attractive counterion correlation pressure decay length in Tris-borate buffers does not account for our observations. It is possible that the binding of multivalent cations to DNA may hinder borate association with the DNA double helix.

  1. Electrophoretic and aggregation behavior of bovine, horse and human red blood cells in plasma and in polymer solutions.

    PubMed

    Bäumler, H; Neu, B; Mitlöhner, R; Georgieva, R; Meiselman, H J; Kiesewetter, H

    2001-01-01

    The electrophoretic mobility of native and glutaraldehyde-fixed bovine, human, and horse red blood cells (RBC) was investigated as a function of ionic strength (5-150 mM) and concentration of 464 kDa dextran (2 and 3 g/dl); RBC aggregation in autologous plasma and in dextran solutions was also measured. In agreement with previous observations, human and horse RBC form stable rouleaux whereas bovine RBC do not aggregate in either plasma or in dextran 464 kDa solutions. Electrophoretic measurements showed a species-dependent adsorption and depletion of dextran that can be theoretically evaluated. Adsorption of polymer is not a prerequisite for RBC aggregation (bovine RBC show the highest amount of adsorbed dextran yet do not aggregate). Aggregate formation thus occurs as long as the Gibbs free energy difference, given by the osmotic pressure difference between the bulk phase and the polymer-depleted region between two RBC, is larger than the steric and electrostatic repulsive energy contributed by the macromolecules present on the RBC surface. With increasing bulk-phase polymer concentration the depletion layer thickness decreases and the amount of adsorbed macromolecules increases, thereby resulting in an increase of the repulsive component of the interaction energy and decreased aggregation. We thus view electrophoretic measurements of RBC in various media as an important tool for understanding polymer behavior near the red cell surface and hence the mechanisms involved in RBC aggregation.

  2. Correlation between esterase electrophoretic polymorphism and virulence-associated traits in extra-intestinal invasive strains of Escherichia coli.

    PubMed Central

    Goullet, P.; Picard, B.; Contrepois, M.; De Rycke, J.; Barnouin, J.

    1994-01-01

    The electrophoretic variations of carboxylesterase B and of esterases A, C and I, the presence of mannose resistant haemagglutinin, alpha-haemolysin, cytotoxic necrotizing factor type 1 (CNF1) and certain O antigens were compared in 150 strains of Escherichia coli responsible for extra-intestinal infections. Electrophoretic mobilities of outer membrane proteins (OMP) were also studied for strains belonging to O4, O6, O7, O8 and O75 serogroups. Fast migrating allozymes of carboxylesterase B (pattern B1) were correlated with slow migrating allozymes of esterase C, serogroups O7 and O8, lack of virulence factor, and particular OMP patterns, whereas slow migrating allozymes of carboxylesterase B (pattern B2) were correlated with fast migrating allozymes of esterase C, serogroups O2, O4, O6, O18 and O75, virulence factor production, and distinct OMP patterns. Allozymes of esterases A and I were not clearly correlated with the distribution of virulence factors. The pattern B2 was more strongly associated with CNF1 than with alpha-haemolysin and mannose resistant haemagglutinin. These results substantiate the view that the electrophoretic pattern B2 of carboxylesterase B identified most of the highly pathogenic strains implicated in extra-intestinal infection of humans. Images Fig. 2 PMID:7509755

  3. Computer simulation of two electrophoretic columns coupled for isoelectric focusing in simple buffers

    NASA Technical Reports Server (NTRS)

    Tsai, Amos; Mosher, Richard A.; Bier, Milan

    1986-01-01

    Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.

  4. Investigation of the free flow electrophoretic process. Volume 2: Technical analysis

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1979-01-01

    The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.

  5. Electrophoretic separation of human kidney cells at zero gravity

    NASA Technical Reports Server (NTRS)

    Barlow, G. H.; Lazer, S. L.; Rueter, A.; Allen, R. E.

    1977-01-01

    Electrophoretic isolation of cells results in a loss of resolution power caused by the sedimentation of the cells in the media. The results of an experiment to extract urokinase from human embryos during the Apollo Soyuz mission are presented and discussed.

  6. Monodisperse light color nanoparticle ink toward chromatic electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Peng, Bo; Li, Yue; Li, Jian; Bi, Lei; Lu, Haipeng; Xie, Jianliang; Ren, Xiangling; Cao, Yonghai; Wang, Ning; Meng, Xianwei; Deng, Longjiang; Guo, Zhanhu

    2016-05-01

    The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays.The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02524b

  7. Genome-wide DNA methylation identifies trophoblast invasion-related genes: Claudin-4 and Fucosyltransferase IV control mobility via altering matrix metalloproteinase activity.

    PubMed

    Hu, Yuxiang; Blair, John D; Yuen, Ryan K C; Robinson, Wendy P; von Dadelszen, Peter

    2015-05-01

    Previously we showed that extravillous cytotrophoblast (EVT) outgrowth and migration on a collagen gel explant model were affected by exposure to decidual natural killer cells (dNK). This study investigates the molecular causes behind this phenomenon. Genome wide DNA methylation of exposed and unexposed EVT was assessed using the Illumina Infinium HumanMethylation450 BeadChip array (450 K array). We identified 444 differentially methylated CpG loci in dNK-treated EVT compared with medium control (P < 0.05). The genes associated with these loci had critical biological roles in cellular development, cellular growth and proliferation, cell signaling, cellular assembly and organization by Ingenuity Pathway Analysis (IPA). Furthermore, 23 mobility-related genes were identified by IPA from dNK-treated EVT. Among these genes, CLDN4 (encoding claudin-4) and FUT4 (encoding fucosyltransferase IV) were chosen for follow-up studies because of their biological relevance from research on tumor cells. The results showed that the mRNA and protein expressions of both CLDN4 and FUT4 in dNK-treated EVT were significantly reduced compared with control (P < 0.01 for both CLDN4 and FUT4 mRNA expression; P < 0.001 for CLDN4 and P < 0.01 for FUT4 protein expression), and were inversely correlated with DNA methylation. Knocking down CLDN4 and FUT4 by small interfering RNA reduced trophoblast invasion, possibly through the altered matrix metalloproteinase (MMP)-2 and/or MMP-9 expression and activity. Taken together, dNK alter EVT mobility at least partially in association with an alteration of DNA methylation profile. Hypermethylation of CLDN4 and FUT4 reduces protein expression. CLDN4 and FUT4 are representative genes that participate in modulating trophoblast mobility.

  8. Microwaves from UMTS/GSM mobile phones induce long-lasting inhibition of 53BP1/gamma-H2AX DNA repair foci in human lymphocytes.

    PubMed

    Belyaev, Igor Y; Markovà, Eva; Hillert, Lena; Malmgren, Lars O G; Persson, Bertil R R

    2009-02-01

    We have recently described frequency-dependent effects of mobile phone microwaves (MWs) of global system for mobile communication (GSM) on human lymphocytes from persons reporting hypersensitivity to electromagnetic fields and healthy persons. Contrary to GSM, universal global telecommunications system (UMTS) mobile phones emit wide-band MW signals. Hypothetically, UMTS MWs may result in higher biological effects compared to GSM signal because of eventual "effective" frequencies within the wideband. Here, we report for the first time that UMTS MWs affect chromatin and inhibit formation of DNA double-strand breaks co-localizing 53BP1/gamma-H2AX DNA repair foci in human lymphocytes from hypersensitive and healthy persons and confirm that effects of GSM MWs depend on carrier frequency. Remarkably, the effects of MWs on 53BP1/gamma-H2AX foci persisted up to 72 h following exposure of cells, even longer than the stress response following heat shock. The data are in line with the hypothesis that the type of signal, UMTS MWs, may have higher biological efficiency and possibly larger health risk effects compared to GSM radiation emissions. No significant differences in effects between groups of healthy and hypersensitive subjects were observed, except for the effects of UMTS MWs and GSM-915 MHz MWs on the formation of the DNA repair foci, which were different for hypersensitive (P < 0.02[53BP1]//0.01[gamma-H2AX]) but not for control subjects (P > 0.05). The non-parametric statistics used here did not indicate specificity of the differences revealed between the effects of GSM and UMTS MWs on cells from hypersensitive subjects and more data are needed to study the nature of these differences.

  9. Heteroduplex mobility assay-guided sequence discovery: elucidation of the small subunit (18S) rDNA sequences of Pfiesteria piscicida and related dinoflagellates from complex algal culture and environmental sample DNA pools.

    PubMed

    Oldach, D W; Delwiche, C F; Jakobsen, K S; Tengs, T; Brown, E G; Kempton, J W; Schaefer, E F; Bowers, H A; Glasgow, H B; Burkholder, J M; Steidinger, K A; Rublee, P A

    2000-04-11

    The newly described heterotrophic estuarine dinoflagellate Pfiesteria piscicida has been linked with fish kills in field and laboratory settings, and with a novel clinical syndrome of impaired cognition and memory disturbance among humans after presumptive toxin exposure. As a result, there is a pressing need to better characterize the organism and these associations. Advances in Pfiesteria research have been hampered, however, by the absence of genomic sequence data. We employed a sequencing strategy directed by heteroduplex mobility assay to detect Pfiesteria piscicida 18S rDNA "signature" sequences in complex pools of DNA and used those data as the basis for determination of the complete P. piscicida 18S rDNA sequence. Specific PCR assays for P. piscicida and other estuarine heterotrophic dinoflagellates were developed, permitting their detection in algal cultures and in estuarine water samples collected during fish kill and fish lesion events. These tools should enhance efforts to characterize these organisms and their ecological relationships. Heteroduplex mobility assay-directed sequence discovery is broadly applicable, and may be adapted for the detection of genomic sequence data of other novel or nonculturable organisms in complex assemblages.

  10. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  11. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    SciTech Connect

    Lu, Xun; Guanga, Gerald P; Wan, Cheng; Rose, Robert B

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G–5C–4 and central C0/G0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.

  12. Structure-function relationships in human testis-determining factor SRY: an aromatic buttress underlies the specific DNA-bending surface of a high mobility group (HMG) box.

    PubMed

    Racca, Joseph D; Chen, Yen-Shan; Maloy, James D; Wickramasinghe, Nalinda; Phillips, Nelson B; Weiss, Michael A

    2014-11-21

    Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic "buttress" beneath its specific DNA-bending surface.

  13. Cloning of human Ca2+ homoeostasis endoplasmic reticulum protein (CHERP): regulated expression of antisense cDNA depletes CHERP, inhibits intracellular Ca2+ mobilization and decreases cell proliferation.

    PubMed Central

    Laplante, J M; O'Rourke, F; Lu, X; Fein, A; Olsen, A; Feinstein, M B

    2000-01-01

    A monoclonal antibody which blocks InsP(3)-induced Ca(2+) release from isolated endoplasmic reticulum was used to isolate a novel 4.0 kb cDNA from a human erythroleukaemia (HEL) cell cDNA expression library. A corresponding mRNA transcript of approx. 4.2 kb was present in all human cell lines and tissues examined, but cardiac and skeletal muscle had an additional transcript of 6.4 kb. The identification in GenBank(R) of homologous expressed sequence tags from many tissues and organisms suggests that the gene is ubiquitously expressed in higher eukaryotes. The gene was mapped to human chromosome 19p13.1. The cDNA predicts a 100 kDa protein, designated Ca(2+) homoeostasis endoplasmic reticulum protein (CHERP), with two putative transmembrane domains, multiple consensus phosphorylation sites, a polyglutamine tract of 12 repeats and regions of imperfect tryptophan and histadine octa- and nona-peptide repeats. In vitro translation of the full-length cDNA produced proteins of M(r) 128000 and 100000, corresponding to protein bands detected by Western blotting of many cell types. CHERP was co-localized in HEL cells with the InsP(3) receptor by two-colour immunofluorescence. Transfection of HEL cells with antisense cDNA led to an 80% decline in CHERP within 5 days of antisense induction, with markedly decreased intracellular Ca(2+) mobilization by thrombin, decreased DNA synthesis and growth arrest, indicating that the protein has an important function in Ca(2+) homoeostasis, growth and proliferation. PMID:10794731

  14. A high mobility group box 1 (HMGB1) gene from Chlamys farreri and the DNA-binding ability and pro-inflammatory activity of its recombinant protein.

    PubMed

    Wang, Mengqiang; Wang, Lingling; Guo, Ying; Zhou, Zhi; Yi, Qilin; Zhang, Daoxiang; Zhang, Huan; Liu, Rui; Song, Linsheng

    2014-02-01

    High-mobility group box 1 (HMGB1) protein, a highly conserved DNA binding protein, plays an important role in maintaining nucleosome structures, transcription, and inflammation. In the present research, a cDNA of 1268 bp for the Zhikong scallop Chlamys farreri HMGB1 (designed as CfHMGB1) was cloned via rapid amplification of cDNA ends (RACE) technique and expression sequence tag (EST) analysis. The complete cDNA sequence of CfHMGB1 contained an open reading frame (ORF) of 648 bp, which encoded a protein of 215 amino acids. The amino acid sequence of CfHMGB1 shared 53-57% similarity with other identified HMGB1s. There were two HMG domains, two low complexity regions and a conserved acidic tail in the amino acid sequence of CfHMGB1. The mRNA transcripts of CfHMGB1 were constitutively expressed in all the tested tissues, including haemocytes, muscle, mantle, gill, hepatopancreas, kidney and gonad, with the highest expression level in hepatopancreas. The mRNA expression profiles of CfHMGB1 in haemocytes after the stimulation with different pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (Glu), were similar with an up-regulation in the early stage and then recovered to the original level. The recombinant CfHMGB1 protein could bind double-stranded DNA and induce the release of TNF-α activity in mixed primary culture of scallop haemocytes. These results collectively indicated that CfHMGB1, with DNA-binding ability and pro-inflammatory activity, could play an important role in the immune response of scallops.

  15. An Investigation of Methods of Isolation of β2M1 Globulin (Syn.: Iota Protein, 19S γ Globulin, γ1 Macroglobulin, β2M Globulin) and its Association with Isoagglutinin Activity, together with Preliminary Observations on Other Macroglobulins of Slow Electrophoretic Mobility in Normal Human Serum

    PubMed Central

    Walton, K. W.; Rowe, D. S.; Soothill, J. F.; Stanworth, D. R.

    1963-01-01

    demonstrable in ultracentrifugal concentrates of normal serum. Evidence is presented to suggest that these proteins are nevertheless present as trace components of normal serum. The solubility and electrophoretic characteristics of these proteins resemble those of β2M1 globulin, but they can be distinguished by immunological methods from β2M1 globulin and each other. Attention is drawn to the evidence that β2M2 and β2M3 globulins may also be increased in the serum of some cases of macroglobulinaemia. ImagesFIG. 1FIG. 2FIG. 7FIG. 10FIG. 11FIG. 12FIG. 13

  16. Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

    NASA Astrophysics Data System (ADS)

    Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

    2016-04-01

    This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

  17. PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity

    PubMed Central

    Leal, JFM; Martínez-Díez, M; García-Hernández, V; Moneo, V; Domingo, A; Bueren-Calabuig, JA; Negri, A; Gago, F; Guillén-Navarro, MJ; Avilés, P; Cuevas, C; García-Fernández, LF; Galmarini, CM

    2010-01-01

    BACKGROUND AND PURPOSE PM01183 is a new synthetic tetrahydroisoquinoline alkaloid that is currently in phase I clinical development for the treatment of solid tumours. In this study we have characterized the interactions of PM01183 with selected DNA molecules of defined sequence and its in vitro and in vivo cytotoxicity. EXPERIMENTAL APPROACH DNA binding characteristics of PM01183 were studied using electrophoretic mobility shift assays, fluorescence-based melting kinetic experiments and computational modelling methods. Its mechanism of action was investigated using flow cytometry, Western blot analysis and fluorescent microscopy. In vitro anti-tumour activity was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and the in vivo activity utilized several human cancer models. KEY RESULTS Electrophoretic mobility shift assays demonstrated that PM01183 bound to DNA. Fluorescence-based thermal denaturation experiments showed that the most favourable DNA triplets providing a central guanine for covalent adduct formation are AGC, CGG, AGG and TGG. These binding preferences could be rationalized using molecular modelling. PM01183–DNA adducts in living cells give rise to double-strand breaks, triggering S-phase accumulation and apoptosis. The potent cytotoxic activity of PM01183 was ascertained in a 23-cell line panel with a mean GI50 value of 2.7 nM. In four murine xenograft models of human cancer, PM01183 inhibited tumour growth significantly with no weight loss of treated animals. CONCLUSIONS AND IMPLICATIONS PM01183 is shown to bind to selected DNA sequences and promoted apoptosis by inducing double-strand breaks at nanomolar concentrations. The potent anti-tumour activity of PM01183 in several murine models of human cancer supports its development as a novel anti-neoplastic agent. PMID:20977459

  18. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

    PubMed

    Morris, Gavin; Fanucchi, Sylvia

    2016-04-05

    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  19. Nanomaterials for sample pretreatment prior to capillary electrophoretic analysis.

    PubMed

    Adam, Vojtech; Vaculovicova, Marketa

    2017-02-16

    Nanomaterials are, in analytical science, used for a broad range of purposes, covering the area of sample pretreatment as well as separation, detection and identification of target molecules. This review covers the application of nanomaterials for sample pretreatment in capillary electrophoresis. It targets the utilization of nanomaterials for sample purification, preconcentration and/or extraction coupled both off-line and on-line with capillary electrophoretic analysis. Especially due to their large surface area, nanoparticles and nanomaterials are exceptionally helpful in making up for the limited concentration detection limits provided by capillary electrophoresis. This method possesses excellent separation power; however, its sensitivity may be problematic in some cases. Therefore, this review is focused on utilization of nanomaterials as a powerful tool for sample preconcentration, which is so often required prior to capillary electrophoretic analysis.

  20. A New DNA Binding Protein Highly Conserved in Diverse Crenarchaeal Viruses

    SciTech Connect

    Larson, E.T.; Eilers, B.J.; Reiter, D.; Ortmann, A.C.; Young, M.J.; Lawrence, C.M.; /Montana State U. /Tubingen U.

    2007-07-09

    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays.

  1. Electrical Transport of Long DNA Molecules on Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Seo, Young-Soo; Sokolov, Jonathan; Rafailovich, Miriam; Chu, Benjamin

    2002-03-01

    The electrical transport properties of long DNA molecules were studied based upon a newly developed method of electrophoresis on flat surfaces [1]. The electrophoretic mobilities of DNA in the presence of Si surface were found to be approximately one order less than in free solution. The electropherogram peaks of 1 kb- and Hind III DNA ladders have been clearly identified. The experimental dependencies of the mobilities on molecular weight were found to be scaled with power law with the exponents of an opposite sign at 2 different buffer concentrations: negative for surface transport at 10 -2 M concentration of TBE buffer and positive at 10 -3 M. A novel mechanism responsible for DNA molecules separation in the presence of the surface at low buffer concentrations has been developed. The multi-ion system is governed by the Nernst-Planck equations (ion movement due to convection, migration and diffusion), in combination with the Poisson-Boltzmann equation. The discrepancy from charge neutrality that occurs in the diffuse double layer very close to the substrate is the driving force for the Navier-Stokes equation, which finally results in a liquid movement very close to the surface that is denoted as electro-osmosis. The adsorbed DNA move due to the electrical field parallel to the surface, and also due the electro-osmotic convection that drags the DNA chains if they are only partly adsorbed. The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. The main features of the electro-hydrodynamic instability related to λ and T2 DNA molecules aggregation, observed in our system, are consistent with our model. This work was supported by NSF-MRSEC Program. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu, DNA Electrophoresis on a

  2. Jet-Printed Active-Matrix Backplanes and Electrophoretic Displays

    NASA Astrophysics Data System (ADS)

    Daniel, Jurgen; Arias, Ana Claudia; Wong, William; Lujan, Rene; Ready, Steve; Krusor, Brent; Street, Robert

    2007-03-01

    The fabrication of large-area electronics, such as active-matrix pixel circuits in flat-panel displays, is becoming increasingly challenging. Particularly for applications such as electronic paper, flexibility of the display and fabrication at extremely low cost is important. Therefore, novel fabrication methods have to be explored. We have developed jet-printing technology to fabricate active-matrix backplanes for paper-like electrophoretic displays. In three approaches we implement several stages of evolution of the printing technology. First, the photolithographic patterning of photoresist used in conventional fabrication is replaced by digital printing of a wax etch mask. Second, the amorphous silicon semiconductor for the thin-film-transistors is replaced with a printed organic semiconductor. Third, the active-matrix pixel circuit is fabricated in an all-additive printing process. In order to test our backplanes we are developing electrophoretic display media. The media is based on microfabricated cell-structures which contain the electrophoretic ink. Particularly for flexible displays, the cells have to be individually sealed and several methods are being explored.

  3. Atomic-force-controlled capillary electrophoretic nanoprinting of proteins.

    PubMed

    Lovsky, Yulia; Lewis, Aaron; Sukenik, Chaim; Grushka, Eli

    2010-01-01

    The general nanoprinting and nanoinjection of proteins on non-conducting or conducting substrates with a high degree of control both in terms of positional and timing accuracy is an important goal that could impact diverse fields from biotechnology (protein chips) to molecular electronics and from fundamental studies in cell biology to nanophotonics. In this paper, we combine capillary electrophoresis (CE), a separation method with considerable control of protein movement, with the unparalleled positional accuracy of an atomic force microscope (AFM). This combination provides the ability to electrophoretically or electroosmotically correlate the timing of protein migration with AFM control of the protein deposition at a high concentration in defined locations and highly confined volumes estimated to be 2 al. Electrical control of bovine serum albumin printing on standard protein-spotting glass substrates is demonstrated. For this advance, fountain pen nanolithography (FPN) that uses cantilevered glass-tapered capillaries is amended with the placement of electrodes on the nanopipette itself. This results in imposed voltages that are three orders of magnitude less than what is normally used in capillary electrophoresis. The development of atomic-force-controlled capillary electrophoretic printing (ACCEP) has the potential for electrophoretic separation, with high resolution, both in time and in space. The large voltage drop at the tip of the tapered nanopipettes allows for significant increases in concentration of protein in the small printed volumes. All of these attributes combine to suggest that this methodology should have a significant impact in science and technology.

  4. Tilted hexagonal post arrays: DNA electrophoresis in anisotropic media.

    PubMed

    Chen, Zhen; Dorfman, Kevin D

    2014-02-01

    Using Brownian dynamics simulations, we show that DNA electrophoresis in a hexagonal array of micron-sized posts changes qualitatively when the applied electric field vector is not coincident with the lattice vectors of the array. DNA electrophoresis in such "tilted" post arrays is superior to the standard "un-tilted" approach; while the time required to achieve a resolution of unity in a tilted post array is similar to an un-tilted array at a low-electric field strengths, this time (i) decreases exponentially with electric field strength in a tilted array and (ii) increases exponentially with electric field strength in an un-tilted array. Although the DNA dynamics in a post array are complicated, the electrophoretic mobility results indicate that the "free path," i.e. the average distance of ballistic trajectories of point-sized particles launched from random positions in the unit cell until they intersect the next post, is a useful proxy for the detailed DNA trajectories. The analysis of the free path reveals a fundamental connection between anisotropy of the medium and DNA transport therein that goes beyond simply improving the separation device.

  5. A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1.

    PubMed Central

    Sebastian, J; Sancar, G B

    1991-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. We report here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 upstream repression sequence, that together regulate induction of PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. A prominent feature of the foot-printed region is a 22-base-pair palindrome. Deletion of the PHR1 upstream repression sequence increased the basal level expression of PHR1 in vivo and decreased induction after exposure of cells to UV radiation or methyl methanesulfonate, whereas insertion of the PRP binding site between the CYC1 upstream activation sequence and "TATA" sequence reduced basal level expression and conferred damage responsiveness upon a reporter gene. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription. Images PMID:1763039

  6. Study on the interaction of catechins with human serum albumin using spectroscopic and electrophoretic techniques

    NASA Astrophysics Data System (ADS)

    Trnková, Lucie; Boušová, Iva; Staňková, Veronika; Dršata, Jaroslav

    2011-01-01

    The interaction between eight naturally occurring flavanols (catechin, epicatechin, gallocatechin, epigallocatechin, catechin gallate, epicatechin gallate, gallocatechin gallate, and epigallocatechin gallate) and human serum albumin (HSA) has been investigated by spectroscopic (fluorescence quenching and UV-Vis absorption) and electrophoretic (native and SDS PAGE) techniques under simulated physiological conditions (pH 7.40, 37 °C). The spectroscopic results confirmed the complex formation for the tested systems. The binding constants and the number of binding sites were obtained by analysis of fluorescence data. The strongest binding affinity to HSA was found for epicatechin gallate and decreased in the order epicatechin gallate ⩾ catechin gallate > epigallocatechin gallate > gallocatechin gallate ≫ epicatechin ⩾ catechin > gallocatechin ⩾ epigallocatechin. All free energy changes possessed negative sign indicating the spontaneity of catechin-HSA systems formation. The binding distances between the donor (HSA) and the acceptors (catechins) estimated by the Förster theory revealed that non-radiation energy transfer from HSA to catechins occurred with high possibility. According to results obtained by native PAGE, the galloylated catechins increased the electrophoretic mobility of HSA, which indicated the change in the molecular charge of HSA, whilst the non-galloylated catechins caused no changes. The ability of aggregation and cross-linking of tested catechins with HSA was not proved by SDS-PAGE. The relationship between the structure characteristics of all tested catechins (e.g. presence of the galloyl moiety on the C-ring, the number of hydroxyl groups on the B-ring, and the spatial arrangement of the substituents on the C-ring) and their binding properties to HSA is discussed. The presented study contributes to the current knowledge in the area of protein-ligand binding, particularly catechin-HSA interactions.

  7. Electromigration of single molecules of DNA in a crystalline array of 300-nm silica colloids.

    PubMed

    Zhang, Hui; Wirth, Mary J

    2005-03-01

    The velocities and conformations of single DNA chains were probed as they electromigrated at varying electric field strength through a crystalline array of silica colloids. An optically transparent film consisting of 300-nm silica colloids was formed on glass as a transparent crystalline layer of 7 mum thickness with an effective pore size of 45 nm. The behaviors of individual lambda-DNA molecules (48,502 base pairs) electromigrating through this material were observed to be analogous to the behaviors of long DNA chains in electrophoresis gels, including chain extension, hooking of chains around the matrix, and hernia formation. The electrophoretic mobility of lambda-DNA in this dense, narrow-pore material is surprisingly high: 1.8 cm2/Vs at 10 V/cm, which is at least as high as for much wider-pore gels. Imaging of the single molecules revealed that higher field strength caused increased chain extension and increased mobility, which reached an apparent plateau just above 2.0 cm2/Vs at 200 V/cm. Pulsed, crossed electric fields of 200 V/cm at 120 degrees to one another were applied to the material. The DNA chains were observed by imaging to electromigrate in an orderly fashion, and the migration rate was found to be length-dependent. The results indicate that these thin, robust, self-assembling inorganic materials are interesting as possible alternatives to polymeric gels for higher speed electrophoresis.

  8. [Characterization of recombinant single-stranded DNA-binding protein from Escherichia coli and its application in accurate pyrosequencing].

    PubMed

    Wang, Jianping; Zou, Bingjie; Chen, Zhiyao; Ma, Yinjiao; Xu, Shu; Zhou, Guohua

    2011-10-01

    We expressed recombinant single-stranded DNA-binding protein (r-SSBP) from Escherichia coli with the molecular weight of 24-kDa by using genetic engineering strategy, and demonstrated the single-stranded DNA (ssDNA)-binding activity of r-SSBP by electrophoretic mobility shift assay (EMSA). To further characterize r-SSBP, we studied the effects of r-SSBP on melting temperature (T(m)) of DNA. The results showed that r-SSBP could bind to ssDNA, and lower the T(m) of DNA, especially for single-base mismatched DNA. Therefore, r-SSBP significantly increased the T(m) difference between single-base mismatched DNA and perfect matched DNA. These results are very beneficial for single-nucleotide polymorphism detection. Moreover, we applied r-SSBP in high sensitive pyrosequencing system developed by our group. The results suggest that the r-SSBP decreased non-specific signals, corrected the proportion of signal peak height and improved the performance of pyrosequencing.

  9. Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.

    PubMed

    Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime

    2017-01-01

    A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.

  10. Mechanism of spacer integration links the CRISPR/Cas system to transposition as a form of mobile DNA.

    PubMed

    Dyda, Fred; Hickman, Alison B

    2015-01-01

    It has recently become clear that many bacterial and archaeal species possess adaptive immune systems. These are typified by multiple copies of DNA sequences known as clustered regularly interspaced short palindromic repeats (CRISPRs). These CRISPR repeats are the sites at which short spacers containing sequences of previously encountered foreign DNA are integrated, and the spacers serve as the molecular memory of previous invaders. In vivo work has demonstrated that two CRISPR-associated proteins - Cas1 and Cas2 - are required for spacer integration, but the mechanism by which this is accomplished remained unclear. Here we review a recent paper describing the in vitro reconstitution of CRISPR spacer integration using purified Cas1 and Cas2 and place the results in context of similar DNA transposition reactions and the crystal structure of the Cas1/Cas2 complex.

  11. Triblock copolymer matrix-based capillary electrophoretic microdevice for high-resolution multiplex pathogen detection.

    PubMed

    Kim, Se Jin; Shin, Gi Won; Choi, Seok Jin; Hwang, Hee Sung; Jung, Gyoo Yeol; Seo, Tae Seok

    2010-03-01

    Rapid and simple analysis for the multiple target pathogens is critical for patient management. CE-SSCP analysis on a microchip provides high speed, high sensitivity, and a portable genetic analysis platform in molecular diagnostic fields. The capability of separating ssDNA molecules in a capillary electrophoretic microchannel with high resolution is a critical issue to perform the precise interpretation in the electropherogram. In this study, we explored the potential of poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) (PEO-PPO-PEO) triblock copolymer as a sieving matrix for CE-SSCP analysis on a microdevice. To demonstrate the superior resolving power of PEO-PPO-PEO copolymers, 255-bp PCR amplicons obtained from 16S ribosomal RNA genes of four bacterial species, namely Proteus mirabilis, Haemophilus ducreyi, Pseudomonas aeruginosa, and Neisseria meningitidis, were analyzed in the PEO-PPO-PEO matrix in comparison with 5% linear polyacrylamide and commercial GeneScan gel. Due to enhanced dynamic coating and sieving ability, PEO-PPO-PEO copolymer displayed fourfold enhancement of resolving power in the CE-SSCP to separate same-sized DNA molecules. Fivefold input of genomic DNA of P. aeruginosa and/or N. meningitidis produced proportionally increased corresponding amplicon peaks, enabling correct quantitative analysis in the pathogen detection. Besides the high-resolution sieving capability, a facile loading and replenishment of gel in the microchannel due to thermally reversible gelation property makes PEO-PPO-PEO triblock copolymer an excellent matrix in the CE-SSCP analysis on the microdevice.

  12. High flow-resolution for mobility estimation in 2D-ENMR of proteins using maximum entropy method (MEM-ENMR).

    PubMed

    Thakur, Sunitha B; He, Qiuhong

    2006-11-01

    Multidimensional electrophoretic NMR (nD-ENMR) is a potentially powerful tool for structural characterization of co-existing proteins and protein conformations. By applying a DC electric field pulse, the electrophoretic migration rates of different proteins were detected experimentally in a new dimension of electrophoretic flow. The electrophoretic mobilities were employed to differentiate protein signals. In U-shaped ENMR sample chambers, individual protein components in a solution mixture followed a cosinusoidal electrophoretic interferogram as a function of its unique electrophoretic migration rate. After Fourier transformation in the electrophoretic flow dimension, the protein signals were resolved at different resonant frequencies proportional to their electrophoretic mobilities. Currently, the mobility resolution of the proteins in the electrophoretic flow dimension is limited by severe truncations of the electrophoretic interferograms due to the finite electric field strength available before the onset of heat-induced convection. In this article, we present a successful signal processing method, the Burg's maximum entropy method (MEM), to analyze the truncated ENMR signals (MEM-ENMR). Significant enhancement in flow resolution was demonstrated using two-dimensional ENMR of two protein samples: a lysozyme solution and a solution mixture of bovine serum albumin (BSA) and ubiquitin. The electrophoretic mobilities of lysozyme, BSA and ubiquitin were measured from the MEM analysis as 7.5x10(-5), 1.9x10(-4) and 8.7x10(-5) cm2 V-1 s-1, respectively. Results from computer simulations confirmed a complete removal of truncation artifacts in the MEM-ENMR spectra with 3- to 6-fold resolution enhancement.

  13. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

    PubMed Central

    2012-01-01

    Background Etoposide (epipodophyllotoxin) is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs). However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L.) genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36) and two protein-encoding genes (Homeobox and CDPK-related genes) were detected in the etoposide-treated plants (S0 generation) in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae) and the indica cultivar (93-11). DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36). Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2) of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar genotoxic stress on

  14. DNA Damage-Induced HSPC Malfunction Depends on ROS Accumulation Downstream of IFN-1 Signaling and Bid Mobilization.

    PubMed

    Tasdogan, Alpaslan; Kumar, Suresh; Allies, Gabriele; Bausinger, Julia; Beckel, Franziska; Hofemeister, Helmut; Mulaw, Medhanie; Madan, Vikas; Scharfetter-Kochanek, Karin; Feuring-Buske, Michaela; Doehner, Konstanze; Speit, Günter; Stewart, A Francis; Fehling, Hans Joerg

    2016-12-01

    Mouse mutants with an impaired DNA damage response frequently exhibit a set of remarkably similar defects in the HSPC compartment that are of largely unknown molecular basis. Using Mixed-Lineage-Leukemia-5 (Mll5)-deficient mice as prototypical examples, we have identified a mechanistic pathway linking DNA damage and HSPC malfunction. We show that Mll5 deficiency results in accumulation of DNA damage and reactive oxygen species (ROS) in HSPCs. Reduction of ROS efficiently reverses hematopoietic defects, establishing ROS as a major cause of impaired HSPC function. The Ink4a/Arf locus also contributes to HSPC phenotypes, at least in part via promotion of ROS. Strikingly, toxic ROS levels in Mll5(-/-) mice are critically dependent on type 1 interferon (IFN-1) signaling, which triggers mitochondrial accumulation of full-length Bid. Genetic inactivation of Bid diminishes ROS levels and reverses HSPC defects in Mll5(-/-) mice. Overall, therefore, our findings highlight an unexpected IFN-1 > Bid > ROS pathway underlying DNA damage-associated HSPC malfunction.

  15. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    SciTech Connect

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  16. Carbon dots based FRET for the detection of DNA damage.

    PubMed

    Kudr, Jiri; Richtera, Lukas; Xhaxhiu, Kledi; Hynek, David; Heger, Zbynek; Zitka, Ondrej; Adam, Vojtech

    2017-02-09

    Here, we aimed our attention at the synthesis of carbon dots (C-dots) with the ability to interact with DNA to suggest an approach for the detection of DNA damage. Primarily, C-dots modified with amine moieties were synthesized using the one-step microwave pyrolysis of citric acid in the presence of diethylenetriamine. The C-dots showed strong photoluminescence with a quantum yield of 4%. In addition, the C-dots (2.8±0.8nm) possessed a good colloidal stability and exhibited a positive surface charge (ζ=36mV) at a neutral pH. An interaction study of the C-dots and the DNA fragment of λ bacteriophage was performed, and the DNA binding resulted in changes to the photoluminescent and absorption properties of the C-dots. A binding of the C-dots to DNA was also observed as a change to DNA electrophoretic mobility and a decreased ability to intercalate ethidium bromide (EtBr). Moreover, the Förster (or fluorescence) resonance energy transfer (FRET) between the C-dots and EtBr was studied, in which the C-dots serve as an excitation energy donor and the EtBr serves as an acceptor. When DNA was damaged using ultraviolet (UV) radiation (λ=254nm) and hydroxyl radicals, the intensity of the emitted photoluminescence at 612nm significantly decreased. The concept was proved on analysis of the genomic DNA from PC-3 cells and DNA isolated from melanoma tissues.

  17. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi

    2013-01-01

    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  18. Molecular Dynamics Simulation of DNA Capture and Transport in Heated Nanopores

    PubMed Central

    2016-01-01

    The integration of local heat sources with solid-state nanopores offers new means for controlling the transmembrane transport of charged biomacromolecules. In the case of electrophoretic transport of DNA, recent experimental studies revealed unexpected temperature dependences of the DNA capture rate, the DNA translocation velocity, and the ionic current blockades produced by the presence of DNA in the nanopore. Here, we report the results of all-atom molecular dynamics simulations that elucidated the effect of temperature on the key microscopic processes governing electric field-driven transport of DNA through nanopores. Mimicking the experimental setup, we simulated the capture and subsequent translocation of short DNA duplexes through a locally heated nanopore at several temperatures and electrolyte conditions. The temperature dependence of ion mobility at the DNA surface was found to cause the dependence of the relative conductance blockades on temperature. To the first order, the effective force on DNA in the nanopore was found to be independent of temperature, despite a considerable reduction of solution viscosity. The temperature dependence of the solution viscosity was found to make DNA translocations faster for a uniformly heated system but not in the case of local heating that does not affect viscosity of solution surrounding the untranslocated part of the molecule. Increasing solution temperature was also found to reduce the lifetime of bonds formed between cations and DNA. Using a flow suppression algorithm, we were able to separate the effects of electro-osmotic flow and direct ion binding, finding the reduced durations of DNA–ion bonds to increase, albeit weakly, the effective force experienced by DNA in an electric field. Unexpectedly, our simulations revealed a considerable temperature dependence of solvent velocity at the DNA surface—slip velocity, an effect that can alter hydrodynamic coupling between the motion of DNA and the surrounding fluid

  19. Replication of DNA minicircles in kinetoplasts isolated from Crithidia fasciculata: structure of nascent minicircles.

    PubMed

    Sheline, C; Melendy, T; Ray, D S

    1989-01-01

    We have previously described an isolated kinetoplast system from Crithidia fasciculata capable of ATP-dependent replication of kinetoplast DNA minicircles (L. Birkenmeyer and D.S. Ray, J. Biol. Chem. 261: 2362-2368, 1986). We present here the identification of two new minicircle species observed in short pulse-labeling experiments in this system. The earliest labeled minicircle species (component A) contains both nascent H and L strands and is heterogeneous in sedimentation and electrophoretic migration. Component A has characteristics consistent with a Cairns-type structure in which the L strand is the leading strand and the H strand is the lagging strand. The other new species (component B) has a nascent 2.5-kilobase linear L strand with a single discontinuity that mapped to either of two alternative origins located 180 degrees apart on the minicircle map. Component B could be repaired to a covalently closed form by Escherichia coli polymerase I and T4 ligase but not by T4 polymerase and T4 ligase. Even though component B has a single gap in one strand, it had an electrophoretic mobility on an agarose gel (minus ethidium bromide) similar to that of a supercoiled circle with three supertwists. Treatment of component B with topoisomerase II converted it to a form that comigrated with a nicked open circular form (replicative form II). These results indicate that component B is a knotted topoisomer of a kinetoplast DNA minicircle with a single gap in the L strand.

  20. A small (58-nm) attached sphere perturbs the sieving of 40-80-kilobase DNA in 0.2-2.5% agarose gels: analysis of bacteriophage T7 capsid-DNA complexes by use of pulsed field electrophoresis.

    PubMed

    Serwer, P; Hayes, S J; Moreno, E T; Park, C Y

    1992-09-15

    Although the icosahedral bacteriophage T7 capsid has a diameter (58 nm) that is 234-fold smaller than the length of the linear, double-stranded T7 DNA, binding of a T7 capsid to T7 DNA is found here to have dramatic effects on the migration of the DNA during both pulsed field agarose gel electrophoresis (PFGE; the field inversion mode is used) and constant field agarose gel electrophoresis (CFGE). For these studies, capsid-DNA complexes were obtained by expelling DNA from mature bacteriophage T7; this procedure yields DNA with capsids bound at a variable position on the DNA. When subjected to CFGE at 2-6 V/cm in 0.20-2.5% agarose gels, capsid-DNA complexes arrest at the electrophoretic origin. Progressively lowering the electrical potential gradient to 0.5 V/cm results in migration; most complexes form a single band. The elevated electrical potential gradient (3 V/cm) induced arrest of capsid-DNA complexes is reversed when PFGE is used instead of CFGE. For some conditions of PFGE, the mobility of capsid-DNA complexes is a function of the position of the capsid on the DNA. During either CFGE (0.5 V/cm) or PFGE, capsid-DNA complexes increasingly separate from capsid-free DNA as the percentage of agarose increases. During these studies, capsid-DNA complexes are identified by electron microscopy of enzymatically-digested pieces of agarose gel; this is apparently the first successful electron microscopy of DNA from an agarose gel.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Power and limitations of electrophoretic separations in proteomics strategies.

    PubMed

    Rabilloud, Thierry; Vaezzadeh, Ali R; Potier, Noelle; Lelong, Cécile; Leize-Wagner, Emmanuelle; Chevallet, Mireille

    2009-01-01

    Proteomics can be defined as the large-scale analysis of proteins. Due to the complexity of biological systems, it is required to concatenate various separation techniques prior to mass spectrometry. These techniques, dealing with proteins or peptides, can rely on chromatography or electrophoresis. In this review, the electrophoretic techniques are under scrutiny. Their principles are recalled, and their applications for peptide and protein separations are presented and critically discussed. In addition, the features that are specific to gel electrophoresis and that interplay with mass spectrometry (i.e., protein detection after electrophoresis, and the process leading from a gel piece to a solution of peptides) are also discussed.

  2. Antisera against electrophoretically purified tubulin stimulate colchicine-binding activity.

    PubMed Central

    Aubin, J E; Subrahmanyan, L; Kalnins, V I; Ling, V

    1976-01-01

    Several rabbit antisera have been prepared against reduced and alkylated, electrophoretically purified tubulin isolated from chick brain. These antisera give a single precipitin line in Ouchterlony double diffusion plates when tested against partially purified tubulin, and label specifically microtubule- and tubulin-containing structures, such as mitotic spindles, cilia, and vinblastine-induced crystals, in a variety of cells. The same antisera also display the unique ability to stimulate the colchicine-binding activity of tubulin preparations from chick brain and Chinese hamster ovary tissue culture cells. This specific stimulation of colchicine binding activity is also obtained with the gamma globulin fractions purified by ammonium sulfate precipitation of these antisera. Images PMID:57619

  3. AN ELECTROPHORETIC STUDY OF NEPHROTIC SERA AND URINE

    PubMed Central

    Longsworth, L. G.; MacInnes, D. A.

    1940-01-01

    The electrophoretic patterns of the sera and urine of two cases of lipoid nephrosis have been obtained and have been compared with a typical pattern of normal serum. The patterns of the pathological sera deviated widely from the normal, indicating relatively low albumin and high globulin content. The comparison of the patterns of nephrotic sera cleared by centrifugation and by ether extraction shows that a large portion of the β globulin consisted of a labile lipo-protein. The pattern of the nephrotic urine proteins resembled that of normal serum, with, however, significant differences. PMID:19870946

  4. Selectively-etched nanochannel electrophoretic and electrochemical devices

    DOEpatents

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2004-11-16

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  5. Selectively-etched nanochannel electrophoretic and electrochemical devices

    DOEpatents

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2006-06-27

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  6. Liposome-induced DNA compaction and reentrant condensation investigated by dielectric relaxation spectroscopy and dynamic light scattering techniques

    NASA Astrophysics Data System (ADS)

    Zuzzi, S.; Cametti, C.; Onori, G.; Sennato, S.

    2007-07-01

    Interaction of DNA with oppositely charged objects, such as multivalent ions, cationic surfactants, cationic liposomes, basic proteins, and alcohols, up to nano- or mesoscopic particles, gives rise to a very interesting and fascinating phenomenology, where the shape, size, and stability of the resulting aggregates depend on a delicate balance between different driving forces, mainly of electrostatic origin. We have studied the cationic liposome-DNA complexes during the whole complexation process, below, close to, and above the isoelectric condition, where the number of cationic lipids equals the number of phosphate groups on the DNA chain. We took advantage of the combined use of dynamic light scattering, laser Doppler electrophoretic mobility, and radio-wave dielectric relaxation measurements in order to characterize both the structural parameters (hydrodynamic radius) and the electrical parameters (charge and counterion concentration) of the resulting structures. These structures are fundamentally of two types, clusters of liposomes stuck together by DNA chains (cluster phase in low-density colloidal suspension) and coexisting DNA coils and DNA globules, according to the procedure through which interactions occur (liposomes in excess DNA solution or DNA in excess liposome suspension).

  7. Targeting the DNA-binding activity of the human ERG transcription factor using new heterocyclic dithiophene diamidines

    PubMed Central

    Nhili, Raja; Peixoto, Paul; Depauw, Sabine; Flajollet, Sébastien; Dezitter, Xavier; Munde, Manoj M.; Ismail, Mohamed A.; Kumar, Arvind; Farahat, Abdelbasset A.; Stephens, Chad E.; Duterque-Coquillaud, Martine; David Wilson, W.; Boykin, David W.; David-Cordonnier, Marie-Hélène

    2013-01-01

    Direct modulation of gene expression by targeting oncogenic transcription factors is a new area of research for cancer treatment. ERG, an ETS-family transcription factor, is commonly over-expressed or translocated in leukaemia and prostate carcinoma. In this work, we selected the di-(thiophene-phenyl-amidine) compound DB1255 as an ERG/DNA binding inhibitor using a screening test of synthetic inhibitors of the ERG/DNA interaction followed by electrophoretic mobility shift assays (EMSA) validation. Spectrometry, footprint and biosensor-surface plasmon resonance analyses of the DB1255/DNA interaction evidenced sequence selectivity and groove binding as dimer. Additional EMSA evidenced the precise DNA-binding sequence required for optimal DB1255/DNA binding and thus for an efficient ERG/DNA complex inhibition. We further highlighted the structure activity relationships from comparison with derivatives. In cellulo luciferase assay confirmed this modulation both with the constructed optimal sequences and the Osteopontin promoter known to be regulated by ERG and which ERG-binding site was protected from DNaseI digestion on binding of DB1255. These data showed for the first time the ERG/DNA complex modulation, both in vitro and in cells, by a heterocyclic diamidine that specifically targets a portion of the ERG DNA recognition site. PMID:23093599

  8. Simulated null-gravity environments as applied to electrophoretic separations of biological species

    NASA Technical Reports Server (NTRS)

    Giannovario, J. A.; Griffin, R. N.

    1978-01-01

    The scale-up of electrophoretic separations to provide preparative quantities of materials has been hampered by gravity induced convection and sedimentation. The separation of biologically important species may be significantly enhanced by electrophoretic space processing. Simple demonstrations on past space flights have proven some principles. Several techniques have been evolved to study electrophoretic separations where the effects of gravity have been nullified or significantly reduced. These techniques employ mechanical design, density gradients and computer modeling. Utilization of these techniques for ground based studies will yield clues as to which biological species can be considered prime candidates for electrophoretic processing in zero-G.

  9. μ-Opioid Receptor-Induced Ca2+ Mobilization and Astroglial Development: Morphine Inhibits DNA Synthesis and Stimulates Cellular Hypertrophy through a Ca2+-Dependent Mechanism

    PubMed Central

    Hauser, Kurt F.; Stiene-Martin, Anne; Mattson, Mark P.; Elde, Robert P.; Ryan, S. Eric; Godleske, Chrystal C.

    2015-01-01

    Morphine, a preferential μ opioid receptor agonist, alters astroglial development by inhibiting cell proliferation and by promoting cellular differentiation. Although morphine affects cellular differentiation through a Ca2+-dependent mechanism, few studies have examined whether Ca2+ mediates the effect of opioids on cell proliferation, or whether a particular Ca2+ signal transduction pathway mediates opioid actions. Moreover, it is uncertain whether one or more opioid receptor types mediates the developmental effects of opioids. To address these questions, the present study examined the role of μ opioid receptors and Ca2+ mobilization in morphine-induced astrocyte development. Morphine (1 μM) and non-morphine exposed cultures enriched in murine astrocytes were incubated in Ca2+-free media supplemented with < 0.005, 0.3, 1.0, or 3.0 mM Ca2+ ([Ca2+]o), or in unmodified media containing Ca2+ ionophore (A23187), nifedipine (1 μM), dantrolene (10 μM), thapsigargin (100 nM), or L-glutamate (100 μM) for 0–72 h. μ-Opioid receptor expression was examined immunocytochemically using specific (MOR1) antibodies. Intracellular Ca2+ ([Ca2+]i) was measured by microfluorometric analysis using fura-2. Astrocyte morphology and bromodeoxyuridine (BrdU) incorporation (DNA synthesis) were assessed in glial fibrillary acidic protein (GFAP) immunoreactive astrocytes. The results showed that morphine inhibited astroglial growth by activating μ opioid receptors. Astrocytes expressed MOR1 immunoreactivity and morphine’s actions were mimicked by the selective μ agonist PL017. In addition, morphine inhibited DNA synthesis by mobilizing [Ca2+]i in developing astroglia. At normal [Ca2+]o, morphine attenuated DNA synthesis by increasing [Ca2+]i; low [Ca2+]o (0.3 mM) blocked this effect, while treatment with Ca2+ ionophore or glutamate mimicked morphine’s actions. At extremely low [Ca2+]o (<0.005 mM), morphine paradoxically increased BrdU incorporation. Although opioids can increase

  10. Effects of Tris and Hepes buffers on the interaction of palladium-diaminopropane complexes with DNA.

    PubMed

    Akdi, Khalid; Vilaplana, Rosario A; Kamah, Sanae; González-Vílchez, Francisco

    2005-06-01

    The Pd(II) complexes, [PdCl(2)(1,2-pn)] and [PdCl(2)(1,3-pn)] (pn is diaminopropane), were synthesized and characterized by analytical and spectroscopic (FT-IR, (1)H NMR and (13)C NMR) techniques. UV difference spectral study performed on Pd-pn/DNA systems, indicate a pronounced interaction of palladium complexes with DNA in cell-free media; comparison of lambda(max), Abs(max) and %H values observed for the two compounds might be attributed to structural differences of the chelated ligand rings. Results obtained from electrophoretic analysis of Pd complexes in presence of pBR322 plasmid DNA show a clear decreasing of the supercoiled (SC) DNA form mobility, that could be attributed to unwinding of the double helix; a parallel increasing of the open-circular (OC) DNA form mobility is also noted, this fact implying that the binding of complexes either shortens or condenses the DNA helix. Interaction studies of Pd complexes with plasmid DNA in different buffer systems indicate that DNA binding efficiency capable of modifying the tertiary structure of pBR322 decreased from NaClO(4) to Hepes 2, Hepes 1 [Hepes=4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid], and Tris [(hydroxymethyl)aminomethane] buffers, in this order. Moreover, the level of DNA modifications produced by palladium complexes in 10 mM NaClO(4) remains unchanged after transferring the samples into the medium required for subsequent biophysical or biochemical analyses.

  11. High-Mobility Group 1/2 Proteins Are Essential for Initiating Rolling-Circle-Type DNA Replication at a Parvovirus Hairpin Origin

    PubMed Central

    Cotmore, Susan F.; Tattersall, Peter

    1998-01-01

    Rolling-circle replication is initiated by a replicon-encoded endonuclease which introduces a single-strand nick into specific origin sequences, becoming covalently attached to the 5′ end of the DNA at the nick and providing a 3′ hydroxyl to prime unidirectional, leading-strand synthesis. Parvoviruses, such as minute virus of mice (MVM), have adapted this mechanism to amplify their linear single-stranded genomes by using hairpin telomeres which sequentially unfold and refold to shuttle the replication fork back and forth along the genome, creating a continuous, multimeric DNA strand. The viral initiator protein, NS1, then excises individual genomes from this continuum by nicking and reinitiating synthesis at specific origins present within the hairpin sequences. Using in vitro assays to study ATP-dependent initiation within the right-hand (5′) MVM hairpin, we have characterized a HeLa cell factor which is absolutely required to allow NS1 to nick this origin. Unlike parvovirus initiation factor (PIF), the cellular complex which activates NS1 endonuclease activity at the left-hand (3′) viral origin, the host factor which activates the right-hand hairpin elutes from phosphocellulose in high salt, has a molecular mass of around 25 kDa, and appears to bind preferentially to structured DNA, suggesting that it might be a member of the high-mobility group 1/2 (HMG1/2) protein family. This prediction was confirmed by showing that purified calf thymus HMG1 and recombinant human HMG1 or murine HMG2 could each substitute for the HeLa factor, activating the NS1 endonuclease in an origin-specific nicking reaction. PMID:9765384

  12. Novel DNA Polymer for Amplification Pretargeting

    PubMed Central

    2015-01-01

    In this Letter, different from conventional pretargeting, an additional novel DNA polymer with multiple copies of a target was first designed to be administrated between the antitumor antibody, and the labeled effector served as an amplification pretargeting strategy. Two phosphorothioate DNA strands, a bridging and a target strand, were hybridized to form a polymer. Polymer size, as a function of molar ratios, was then monitored by size exclusion HPLC and electrophoretic mobility shift assay. Moreover, binding efficiency of polymers with the radiolabeled effector and polymer size after hybridization were measured by HPLC as well. As the polymer was expected to produce more binding sites that would be targeted by effectors, amplification pretargeting can greatly improve accumulation of effectors in tumor. This novel proof-of-concept was then well demonstrated by the in vitro test of signal amplification in antibody-binding protein L coated plate and LS174T cells. Compared to conventional pretargeting, significantly increasing radioactive signal was observed in this designed amplification pretargeting, which would serve as a useful paradigm of the potential of oligomer polymers to improve pretargeting and other related approaches. PMID:26396682

  13. Electrophoretic deposition of composite hydroxyapatite-chitosan coatings

    SciTech Connect

    Pang Xin; Zhitomirsky, Igor . E-mail: zhitom@mcmaster.ca

    2007-04-15

    Cathodic electrophoretic deposition has been utilized for the fabrication of composite hydroxyapatite-chitosan coatings on 316L stainless steel substrates. The addition of chitosan to the hydroxyapatite suspensions promoted the electrophoretic deposition of the hydroxyapatite nanoparticles and resulted in the formation of composite coatings. The obtained coatings were investigated by X-ray diffraction, thermogravimetric and differential thermal analysis, scanning and transmission electron microscopy, potentiodynamic polarization measurements, and electrochemical impedance spectroscopy. It was shown that the deposit composition can be changed by a variation of the chitosan or hydroxyapatite concentration in the solutions. Experimental conditions were developed for the fabrication of hydroxyapatite-chitosan nanocomposites containing 40.9-89.8 wt.% hydroxyapatite. The method enabled the formation of adherent and uniform coatings of thicknesses up to 60 {mu}m. X-ray studies revealed that the preferred orientation of the hydroxyapatite nanoparticles in the chitosan matrix increases with decreasing hydroxyapatite content in the composite coatings. The obtained coatings provided the corrosion protection for the 316L stainless steel substrates00.

  14. Recent innovations in protein separation on microchips by electrophoretic methods.

    PubMed

    Peng, Youyuan; Pallandre, Antoine; Tran, N Thuy; Taverna, Myriam

    2008-01-01

    Microchips for analytical purposes have attracted great attention over the last 20 years. In the present review, we focus on the most recent development of microchips for electrophoretic separation of proteins. This review starts with a short recalling about the microchips covering the basic microchip layout for CE and the commercial chips and microchip platforms. A short paragraph is dedicated to the surface treatment of microchips, which is of paramount importance in protein analysis. One section is dedicated to on-line sample pretreatment in microchips and summarizes different strategies to pre-concentrate or to purify proteins from complex matrixes. Most of the common modes used for CE of proteins have already been adapted to the chip format, while multidimensional approaches are still in progress. The different routes to achieve detection in microchip are also presented with a special attention to derivatization or labeling of proteins. Finally, several recent applications are mentioned. They highlight the great potential of electrophoretic separations of proteins in numerous fields such as biological, pharmaceutical or agricultural and food analysis. A bibliography with 151 references is provided covering papers published from 2000 to the early 2007.

  15. Electrophoretic motion of ideally polarizable particles in a microchannel.

    PubMed

    Wu, Zhemin; Gao, Yandong; Li, Dongqing

    2009-03-01

    The induced-charge electrophoretic (ICEP) motion of ideally polarizable particles in a microchannel is numerically studied in this paper. A complete 3-D multi-physics model is set up to simulate the transient ICEP motion of spherical ideally polarizable particles in a microchannel. The study shows that a non-uniform distribution of induced surface charge occurs when an ideally polarizable particle is immersed in an externally applied electric field, resulting in a varying slipping (EOF) velocity along the particle's surface and hence producing micro vortexes in the liquid. The numerical results verify that the steady-state ICEP velocity of an ideally polarizable particle does not differ from the electrophoretic velocity of a non-conducting particle, although the flow field near the particle does. A strong wall-repelling effect of ICEP is found when the polarizable particle is placed close to the channel wall. This is due to the lifting effect generated from the interaction between the induced micro vortexes and the channel wall and depends on the electric field and the particle size. The wall effects on ICEP motion can be used for focusing particles and for separation of particle by density.

  16. Electrophoretic deposition of zinc-substituted hydroxyapatite coatings.

    PubMed

    Sun, Guangfei; Ma, Jun; Zhang, Shengmin

    2014-06-01

    Zinc-substituted hydroxyapatite nanoparticles synthesized by the co-precipitation method were used to coat stainless steel plates by electrophoretic deposition in n-butanol with triethanolamine as a dispersant. The effect of zinc concentration in the synthesis on the morphology and microstructure of coatings was investigated. It is found that the deposition current densities significantly increase with the increasing zinc concentration. The zinc-substituted hydroxyapatite coatings were analyzed by X-ray diffraction, scanning electron microscopy and Fourier transform infrared spectroscopy. It is inferred that hydroxyapatite and triethanolamine predominate in the chemical composition of coatings. With the increasing Zn/Ca ratios, the contents of triethanolamine decrease in the final products. The triethanolamine can be burnt out by heat treatment. The tests of adhesive strength have confirmed good adhesion between the coatings and substrates. The formation of new apatite layer on the coatings has been observed after 7days of immersion in a simulated body fluid. In summary, the results show that dense, uniform zinc-substituted hydroxyapatite coatings are obtained by electrophoretic deposition when the Zn/Ca ratio reaches 5%.

  17. Electrophoretic analysis of coniferyl alcohol oxidase and related laccases.

    PubMed

    Udagama-Randeniya, P; Savidge, R

    1994-01-01

    Gradient gel electrophoretic methods enabled a distinction to be made between coniferyl alcohol oxidase (CAO) of lignifying cell walls and a pI approximately 9 pine "laccase" recently implicated in lignification (Science 1993 260, 672). Following treatment of a partially purified protein mixture from developing xylem of Pinus strobus with 2-[N-morpholine]ethanesulfonic acid (MES) buffer, isoelectric focusing and sodium dodecyl sulphate-polyacrylamide gel electrophoresis indicated that CAO had been selectively precipitated by MES and thereby purified to electrophoretic homogeneity. Purified CAO was determined to be a cell-wall-bound glycoprotein (38% glycan), M(r) 107,500, pI 7.6, pH and temperature optima 6.3 and 30 degrees C, respectively. By graphite-furnace atomic-absorption analysis, CAO contained one copper atom per protein molecule. Proteins obtained from lignifying cambial derivatives of conifers (family Pinaceae) and from Rhus typhina bark were compared with CAO and the pI approximately 9 pine "laccase" following electrophoresis and Western blotting. For Abies balsamea, Larix laricina, Picea rubens, Pinus banksiana, Pinus taeda, and R. typhina, the isoelectric points of oxidatively active bands were identical to those of purified CAO. In addition, for all species only the pI 7.6 band was immunoreactive with antibodies against periodate-deglycosylated CAO.

  18. Electrophoretic fingerprinting of benzodiazepine tablets in spike drinks.

    PubMed

    Sáiz, Jorge; Ortega-Ojeda, Fernando; López-Melero, Lucía; Montalvo, Gema; García-Ruiz, Carmen

    2014-11-01

    Over the last few years, there has been an increase in the reports of drug-facilitated crimes. The list of drugs associated with these crimes is extensive and benzodiazepines constitute one of the groups of substances more commonly used. The sedative properties, which characterize benzodiazepines, are enhanced when such drugs are combined with alcohol, being more attractive for committing these types of crimes. In this work, a capillary electrophoresis method was applied to the analysis of 63 different samples of club drinks spiked with benzodiazepine tablets. The resulting electropherograms were processed and analyzed with the chemometric multivariate techniques: principal component analysis (PCA) and soft independent modeling of class analogies (SIMCA) classification. The PCA results allowed a clear differentiation of each drug class in a 3D plot. In addition, the SIMCA classification model (5% significance level) showed that eight out of nine test samples were automatically assigned by software to their proper sample class. The conflicting sample was correctly classified in the Coomans' plot (95% confidence). This novel approach based on the comparison of electrophoretic profiles of spiked drinks by chemometric tools allows determining the benzodiazepine used for drink spiking without the use of drug standards. Moreover, it provides an opportunity for the forensic laboratories to incorporate the identification capability provided by the electrophoretic fingerprinting of benzodiazepine solutions in existing or new databases.

  19. SEM Analysis of Electrophoretically-Deposited Nanoparticle Films

    NASA Astrophysics Data System (ADS)

    Verma, Neil

    Cobalt ferrite nanoparticles (20 nm) were synthesized and electrophoretically deposited onto aluminum foil, graphite paper, and carbon felt in order to study its potential as a cost-effective electrocatalyst for the oxidation of ammonium sulfite to ammonium sulfate in a proposed sulfur ammonia thermochemical cycle. Scanning electron microscopy and linear sweep voltammetry were used to characterize the deposited films and investigate their electrochemical activity. Furthermore, the effects of electrophoretic deposition conditions on deposit morphology and subsequently the effects of deposit morphology on electrochemical activity in 2 M ammonium sulfite were studied to better understand how to improve electrocatalysts. It was found that there is a critical deposit thickness for each substrate, where additional deposited particles reduce overall electrocatalytic activity of the deposits. For graphite paper, this thickness was estimated to be 3 particle layers for the EPD conditions studied. The 3 particle layer film on graphite paper resulted in a 5.5 fold increase in current density from a blank graphite paper substrate. For carbon felt, the deposit thickness threshold was calculated to be 0.13 of a particle layer for the EPD conditions studied. Moreover, this film was found to have a 4.3 fold increase in current density from a blank carbon felt substrate.

  20. Identification of a telomeric DNA-binding protein in Eimeria tenella.

    PubMed

    Zhao, Na; Gong, Pengtao; Li, Zhipeng; Cheng, Baiqi; Li, Jianhua; Yang, Zhengtao; Li, He; Yang, Ju; Zhang, Guocai; Zhang, Xichen

    2014-09-05

    Coccidiosis is considered to be a major problem for the poultry industry, and coccidiosis control is yet urgent. Due to the roles in telomere length regulation and end protection, telomere-binding proteins have been considered as a good target for drug design. In this work, a putative Gbp1p that is similar to telomeric DNA-binding protein Gbp (G-strand binding protein) of Cryptosporidium parvum, was searched in the database of Eimeria tenella. Sequence analysis indicated E.tenella Gbp1p (EtGbp1p) has significant sequence similarity to other eukaryotic Gbps in their RNA recognition motif (RRM) domains. Electrophoretic mobility shift assays (EMSAs) demonstrated recombinant EtGbp1p bound G-rich telomeric DNA, but not C-rich or double-stranded telomeric DNA sequences. Competition and antibody supershift assays confirmed the interaction of DNA-protein complex. Chromatin immunoprecipitation assays confirmed that EtGbp1p interacted with telomeric DNA in vivo. Collectively, these evidences suggest that EtGbp1p represents a G-rich single-stranded telomeric DNA-binding protein in E.tenella.

  1. The mitochondrial transcription termination factor mTERF modulates replication pausing in human mitochondrial DNA

    PubMed Central

    Hyvärinen, Anne K.; Pohjoismäki, Jaakko L. O.; Reyes, Aurelio; Wanrooij, Sjoerd; Yasukawa, Takehiro; Karhunen, Pekka J.; Spelbrink, Johannes N.; Holt, Ian J.; Jacobs, Howard T.

    2007-01-01

    The mammalian mitochondrial transcription termination factor mTERF binds with high affinity to a site within the tRNALeu(UUR) gene and regulates the amount of read through transcription from the ribosomal DNA into the remaining genes of the major coding strand of mitochondrial DNA (mtDNA). Electrophoretic mobility shift assays (EMSA) and SELEX, using mitochondrial protein extracts from cells induced to overexpress mTERF, revealed novel, weaker mTERF-binding sites, clustered in several regions of mtDNA, notably in the major non-coding region (NCR). Such binding in vivo was supported by mtDNA immunoprecipitation. Two-dimensional neutral agarose gel electrophoresis (2DNAGE) and 5′ end mapping by ligation-mediated PCR (LM-PCR) identified the region of the canonical mTERF-binding site as a replication pause site. The strength of pausing was modulated by the expression level of mTERF. mTERF overexpression also affected replication pausing in other regions of the genome in which mTERF binding was found. These results indicate a role for TERF in mtDNA replication, in addition to its role in transcription. We suggest that mTERF could provide a system for coordinating the passage of replication and transcription complexes, analogous with replication pause-region binding proteins in other systems, whose main role is to safeguard the integrity of the genome whilst facilitating its efficient expression. PMID:17884915

  2. Thermodynamic characterization of specific interactions between the human Lon protease and G-quartet DNA

    PubMed Central

    Chen, Si-Han; Suzuki, Carolyn K.; Wu, Shih-Hsiung

    2008-01-01

    Lon is an ATP-powered protease that binds DNA. However, the function of DNA binding by Lon remains elusive. Studies suggest that human Lon (hLon) binds preferentially to a G-rich single-stranded DNA (ssDNA) sequence overlapping the light strand promoter of mitochondrial DNA. This sequence is contained within a 24-base oligonucleotide referred to as LSPas. Here, we use biochemical and biophysical approaches to elucidate the structural properties of ssDNAs bound by hLon, as well as the thermodynamics of DNA binding by hLon. Electrophoretic mobility shift assay and circular dichroism show that ssDNAs with a propensity for forming parallel G-quartets are specifically bound by hLon. Isothermal titration calorimetry demonstrates that hLon binding to LSPas is primarily driven by enthalpy change associated with a significant reduction in heat capacity. Differential scanning calorimetry pinpoints an excess heat capacity upon hLon binding to LSPas. By contrast, hLon binding to an 8-base G-rich core sequence is entropically driven with a relatively negligible change in heat capacity. A considerable enhancement of thermal stability accompanies hLon binding to LSPas as compared to the G-rich core. Taken together, these data support the notion that hLon binds G-quartets through rigid-body binding and that binding to LSPas is coupled with structural adaptation. PMID:18174225

  3. Ku antigen displays the AP lyase activity on a certain type of duplex DNA.

    PubMed

    Kosova, Anastasiya A; Khodyreva, Svetlana N; Lavrik, Olga I

    2016-09-01

    In the search for proteins reactive to apurinic/apyrimidinic (AP) sites, it has been earlier found that proteins of human cell extracts formed the Schiff-base-dependent covalent adduct with an apparent molecular mass of 100kDa with a partial DNA duplex containing an AP site and 5'- and 3'-protruding ends (DDE-AP DNA). The adduct of such electrophoretic mobility was characteristic of only DDE-AP DNA (Ilina et al., Biochem. Biophys. Acta 1784 (2008) 1777-1785). The protein in this unusual adduct was identified as the Ku80 subunit of Ku antigen by peptide mass mapping based on MALDI-TOF MS data (Kosova et al., Biopolym. Cell 30 (2014) 42-46). Here we studied the interaction of Ku with DDE-AP DNA in details. Purified Ku (the Ku80 subunit) was shown to form the 100-kDa adduct highly specific for AP DNA with a certain length of protruding ends, base opposite the AP site and AP site location. Ku is capable of AP site cleavage in DDE-AP DNA unlike in analogous AP DNA with blunt ends. Ku cleaves AP sites via β-elimination and prefers apurinic sites over apyrimidinic ones. The AP site in DDE-DNA can be repaired in an apurinic/apyrimidinic endonuclease-independent manner via the successive action of Ku (cleavage of the AP site), tyrosyl-DNA phosphodiesterase 1 (removal of the 3'-deoxyribose residue), polynucleotide kinase 3'-phosphatase (removal of the 3'-phosphate), DNA polymerase β (incorporation of dNMP), and DNA ligase (sealing the nick). These results provide a new insight into the role of Ku in the repair of AP sites.

  4. Demonstrating Electrophoretic Separation in a Straight Paper Channel Delimited by a Hydrophobic Wax Barrier

    ERIC Educational Resources Information Center

    Xu, Chunxiu; Lin, Wanqi; Cai, Longfei

    2016-01-01

    A demonstration is described of electrophoretic separation of carmine and sunset yellow with a paper-based device. The channel in the paper device was fabricated by hand with a wax pen. Electrophoretic separation of carmine and sunset yellow was achieved within a few minutes by applying potential on the channel using a simple and inexpensive power…

  5. Electrophoretically detectable protein variation in natural populations of the lone star tick, Amblyomma americanum (Acari: Ixodidae).

    PubMed

    Hilburn, L R; Sattler, P W

    1986-08-01

    Nine populations of Amblyomma americanum (L.) were examined electrophoretically for variation of 21 enzymes. Only three enzymes were not polymorphic and the average heterozygosity per individual (h) for the species was 0.085 with a range of 0.077 to 0.110, comparing well with values in other arthropods. The average Nei identity value for pairwise comparisons among the nine populations was high, 0.994 +/- 0.004 (I +/- SD). These high identity values and the absence of geographic structuring of the protein variation suggest that this species is genetically homogeneous. Normal levels of genic variability within and a lack of divergence between populations were not predicted by models developed to describe these genetic characteristics on the basis of the heterogeneities encountered by parasites in their environment. An analysis of data from several different species of ticks suggests host mobility and abundance, as well as tick abundance and selectivity in choosing a host, are important parameters in determining genetic variation in these ectoparasites.

  6. Ionic liquids in chromatographic and electrophoretic techniques: toward additional improvements in the separation of natural compounds

    PubMed Central

    Freire, Carmen S. R.; Coutinho, João A. P.; Silvestre, Armando J. D.; Freire, Mara G.

    2016-01-01

    Due to their unique properties, in recent years, ionic liquids (ILs) have been largely investigated in the field of analytical chemistry. Particularly during the last sixteen years, they have been successfully applied in the chromatographic and electrophoretic analysis of value-added compounds extracted from biomass. Considering the growing interest in the use of ILs in this field, this critical review provides a comprehensive overview on the improvements achieved using ILs as constituents of mobile or stationary phases in analytical techniques, namely in capillary electrophoresis and its different modes, in high performance liquid chromatography, and in gas chromatography, for the separation and analysis of natural compounds. The impact of the IL chemical structure and the influence of secondary parameters, such as the IL concentration, temperature, pH, voltage and analysis time (when applied), are also critically addressed regarding the achieved separation improvements. Major conclusions on the role of ILs in the separation mechanisms and the performance of these techniques in terms of efficiency, resolution and selectivity are provided. Based on a critical analysis of all published results, some target-oriented ILs are suggested. Finally, current drawbacks and future challenges in the field are highlighted. In particular, the design and use of more benign and effective ILs as well as the development of integrated (and thus more sustainable) extraction–separation processes using IL aqueous solutions are suggested within a green chemistry perspective. PMID:27667965

  7. Ionic liquids in chromatographic and electrophoretic techniques: toward additional improvements in the separation of natural compounds.

    PubMed

    Soares, Belinda; Passos, Helena; Freire, Carmen S R; Coutinho, João A P; Silvestre, Armando J D; Freire, Mara G

    2016-09-07

    Due to their unique properties, in recent years, ionic liquids (ILs) have been largely investigated in the field of analytical chemistry. Particularly during the last sixteen years, they have been successfully applied in the chromatographic and electrophoretic analysis of value-added compounds extracted from biomass. Considering the growing interest in the use of ILs in this field, this critical review provides a comprehensive overview on the improvements achieved using ILs as constituents of mobile or stationary phases in analytical techniques, namely in capillary electrophoresis and its different modes, in high performance liquid chromatography, and in gas chromatography, for the separation and analysis of natural compounds. The impact of the IL chemical structure and the influence of secondary parameters, such as the IL concentration, temperature, pH, voltage and analysis time (when applied), are also critically addressed regarding the achieved separation improvements. Major conclusions on the role of ILs in the separation mechanisms and the performance of these techniques in terms of efficiency, resolution and selectivity are provided. Based on a critical analysis of all published results, some target-oriented ILs are suggested. Finally, current drawbacks and future challenges in the field are highlighted. In particular, the design and use of more benign and effective ILs as well as the development of integrated (and thus more sustainable) extraction-separation processes using IL aqueous solutions are suggested within a green chemistry perspective.

  8. Detection of Macromolecular Fractions in HCN Polymers Using Electrophoretic and Ultrafiltration Techniques.

    PubMed

    Marín-Yaseli, Margarita R; Cid, Cristina; Yagüe, Ana I; Ruiz-Bermejo, Marta

    2017-02-01

    Elucidating the origin of life involves synthetic as well as analytical challenges. Herein, for the first time, we describe the use of gel electrophoresis and ultrafiltration to fractionate HCN polymers. Since the first prebiotic synthesis of adenine by Oró, HCN polymers have gained much interest in studies on the origins of life due to the identification of biomonomers and related compounds within them. Here, we demonstrate that macromolecular fractions with electrophoretic mobility can also be detected within HCN polymers. The migration of polymers under the influence of an electric field depends not only on their sizes (one-dimensional electrophoresis) but also their different isoelectric points (two-dimensional electrophoresis, 2-DE). The same behaviour was observed for several macromolecular fractions detected in HCN polymers. Macromolecular fractions with apparent molecular weights as high as 250 kDa were detected by tricine-SDS gel electrophoresis. Cationic macromolecular fractions with apparent molecular weights as high as 140 kDa were also detected by 2-DE. The HCN polymers synthesized were fractionated by ultrafiltration. As a result, the molecular weight distributions of the macromolecular fractions detected in the HCN polymers directly depended on the synthetic conditions used to produce these polymers. The implications of these results for prebiotic chemistry will be discussed.

  9. Xeroderma pigmentosum complementation group A protein is driven to nucleotide excision repair sites by the electrostatic potential of distorted DNA.

    PubMed

    Camenisch, Ulrike; Dip, Ramiro; Vitanescu, Mirela; Naegeli, Hanspeter

    2007-12-01

    The presumed DNA-binding cleft of xeroderma pigmentosum group A (XPA) protein, a key regulatory subunit of the eukaryotic nucleotide excision repair complex, displays a distinctive array of 6 positively charged amino acid side chains. Here, the molecular function of these closely spaced electropositive residues has been tested by systematic site-directed mutagenesis. After the introduction of single amino acid substitutions, the mutants were probed for protein-DNA interactions in electrophoretic mobility shift and photochemical crosslinking assays. This analysis led to the identification of a critical hot-spot for DNA substrate recognition composed of two neighboring lysines at codons 141 and 179 of the human XPA sequence. The replacement of other basic side chains in the DNA interaction domain conferred more moderate defects of substrate binding. When the function of XPA was tested as a fusion product with either mCherry or green-fluorescent protein, a glutamate substitution of one of the positively charged residues at positions 141 and 179 was sufficient to decrease DNA repair activity in human fibroblasts. Thus, the removal of a single cationic side chain abolished DNA-binding activity and significant excision repair defects could be induced by single charge inversions on the XPA surface, indicating that this molecular sensor participates in substrate recognition by monitoring the electrostatic potential of distorted DNA repair sites.

  10. Biochemical Characterization of Kat1: a Domesticated hAT-Transposase that Induces DNA Hairpin Formation and MAT-Switching

    PubMed Central

    Chiruvella, Kishore K.; Rajaei, Naghmeh; Jonna, Venkateswara Rao; Hofer, Anders; Åström, Stefan U.

    2016-01-01

    Kluyveromyces lactis hAT-transposase 1 (Kat1) generates hairpin-capped DNA double strand breaks leading to MAT-switching (MATa to MATα). Using purified Kat1, we demonstrate the importance of terminal inverted repeats and subterminal repeats for its endonuclease activity. Kat1 promoted joining of the transposon end into a target DNA molecule in vitro, a biochemical feature that ties Kat1 to transposases. Gas-phase Electrophoretic Mobility Macromolecule analysis revealed that Kat1 can form hexamers when complexed with DNA. Kat1 point mutants were generated in conserved positions to explore structure-function relationships. Mutants of predicted catalytic residues abolished both DNA cleavage and strand-transfer. Interestingly, W576A predicted to be impaired for hairpin formation, was active for DNA cleavage and supported wild type levels of mating-type switching. In contrast, the conserved CXXH motif was critical for hairpin formation because Kat1 C402A/H405A completely blocked hairpinning and switching, but still generated nicks in the DNA. Mutations in the BED zinc-finger domain (C130A/C133A) resulted in an unspecific nuclease activity, presumably due to nonspecific DNA interaction. Kat1 mutants that were defective for cleavage in vitro were also defective for mating-type switching. Collectively, this study reveals Kat1 sharing extensive biochemical similarities with cut and paste transposons despite being domesticated and evolutionary diverged from active transposons. PMID:26902909

  11. Biochemical Characterization of Kat1: a Domesticated hAT-Transposase that Induces DNA Hairpin Formation and MAT-Switching.

    PubMed

    Chiruvella, Kishore K; Rajaei, Naghmeh; Jonna, Venkateswara Rao; Hofer, Anders; Åström, Stefan U

    2016-02-23

    Kluyveromyces lactis hAT-transposase 1 (Kat1) generates hairpin-capped DNA double strand breaks leading to MAT-switching (MATa to MATα). Using purified Kat1, we demonstrate the importance of terminal inverted repeats and subterminal repeats for its endonuclease activity. Kat1 promoted joining of the transposon end into a target DNA molecule in vitro, a biochemical feature that ties Kat1 to transposases. Gas-phase Electrophoretic Mobility Macromolecule analysis revealed that Kat1 can form hexamers when complexed with DNA. Kat1 point mutants were generated in conserved positions to explore structure-function relationships. Mutants of predicted catalytic residues abolished both DNA cleavage and strand-transfer. Interestingly, W576A predicted to be impaired for hairpin formation, was active for DNA cleavage and supported wild type levels of mating-type switching. In contrast, the conserved CXXH motif was critical for hairpin formation because Kat1 C402A/H405A completely blocked hairpinning and switching, but still generated nicks in the DNA. Mutations in the BED zinc-finger domain (C130A/C133A) resulted in an unspecific nuclease activity, presumably due to nonspecific DNA interaction. Kat1 mutants that were defective for cleavage in vitro were also defective for mating-type switching. Collectively, this study reveals Kat1 sharing extensive biochemical similarities with cut and paste transposons despite being domesticated and evolutionary diverged from active transposons.

  12. The influence of chitosan valence on the complexation and transfection of DNA: the weaker the DNA-chitosan binding the higher the transfection efficiency.

    PubMed

    Alatorre-Meda, Manuel; Taboada, Pablo; Hartl, Florian; Wagner, Tobias; Freis, Michael; Rodríguez, Julio R

    2011-01-01

    The DNA-chitosan polyplexes have attracted for some years now the attention of physical-chemists and biologists for their potential use in gene therapy, however, the correlation between the physicochemical properties of these polyplexes with their transfection efficiency remains still unclear. In a recent paper we demonstrated by means of DLS that the DNA-chitosan complexation is favored at acidic conditions considering that fewer amounts of chitosan were required to compact the DNA. As a second study, in the present work we analyze the influence of chitosan valence on the complexation and transfection of DNA. Three chitosans of different molecular weights (three different valences) are characterized as gene carriers at 25°C and pH 5 over a wide range of chitosan-Nitrogen to DNA-Phosphate molar ratios, N/P, by means of conductometry, electrophoretic mobility, isothermal titration calorimetry (ITC), transmission electron microscopy (TEM), atomic force microscopy (AFM), and β-galactosidase and luciferase expression assays.

  13. The bcr1 DNA Repeat Element Is Specific to the Bacillus cereus Group and Exhibits Mobile Element Characteristics

    PubMed Central

    Økstad, Ole Andreas; Tourasse, Nicolas J.; Stabell, Fredrik B.; Sundfær, Cathrine K.; Egge-Jacobsen, Wolfgang; Risøen, Per Arne; Read, Timothy D.; Kolstø, Anne-Brit

    2004-01-01

    Bacillus cereus strains ATCC 10987 and ATCC 14579 harbor a ∼155-bp repeated element, bcr1, which is conserved in B. cereus, B. anthracis, B. thuringiensis, and B. mycoides but not in B. subtilis and B. licheniformis. In this study, we show by Southern blot hybridizations that bcr1 is present in all 54 B. cereus group strains tested but absent in 11 Bacillus strains outside the group, suggesting that bcr1 may be specific and ubiquitous to the B. cereus group. By comparative analysis of the complete genome sequences of B. cereus ATCC 10987, B. cereus ATCC 14579, and B. anthracis Ames, we show that bcr1 is exclusively present in the chromosome but absent from large plasmids carried by these strains and that the numbers of full-length bcr1 repeats for these strains are 79, 54, and 12, respectively. Numerous copies of partial bcr1 elements are also present in the three genomes (91, 128, and 53, respectively). Furthermore, the genomic localization of bcr1 is not conserved between strains with respect to chromosomal position or organization of gene neighbors, as only six full-length bcr1 loci are common to at least two of the three strains. However, the intergenic sequence surrounding a specific bcr1 repeat in one of the three strains is generally strongly conserved in the other two, even in loci where bcr1 is found exclusively in one strain. This finding indicates that bcr1 either has evolved by differential deletion from a very high number of repeats in a common ancestor to the B. cereus group or is moving around the chromosome. The identification of bcr1 repeats interrupting genes in B. cereus ATCC 10987 and ATCC 14579 and the presence of a flanking TTTAT motif in each end show that bcr1 exhibits features characteristic of a mobile element. PMID:15516586

  14. Electrochemical and spectroscopic study of octadecyltrimethylammonium bromide/DNA surfoplexes.

    PubMed

    Rodríguez-Pulido, Alberto; Aicart, Emilio; Junquera, Elena

    2009-04-21

    The use of cationic micelles consisting of octadecyltrimethylammonium bromide (C18TAB) to compact calf thymus DNA has been investigated in aqueous buffered solution at 310.15 K by means of conductometry, electrophoretic mobility, and several fluorescence spectroscopy methods. The results indicate that C18TAB micelles, consisting of 44 monomers on average, may compact DNA molecule by an electrostatic interaction that takes place at the cationic spherical micelle surface. The surfoplexes thus formed show a surface density charge that goes from negative to positive values at a Lmic/D mass ratio of around 1.0 (where Lmic and D are the masses of micellized cationic surfactant and DNA), called the isoneutrality ratio (Lmic/D)phi. Values of this characteristic parameter, determined in this work not only from the electrochemical experimental data but also from spectroscopic measurements, are in very good agreement with those ones calculated from molecular parameters and some other properties also obtained in this work. The electrostatic character of the DNA-micelle interaction has been confirmed by analyzing the decrease in fluorescence emission of the fluorophore ethidium bromide, EtBr, initially intercalated between DNA base pairs, as long as the surfoplexes are formed. Fluorescence anisotropy experiments have revealed that micelle packing becomes more rigid in the presence of DNA, but once the surfoplex is formed, the fluidity increases with the Lmic/D mass ratio, attaining its maximum when the isoneutrality ratio is exceeded. This fact, together with the net positive charge of the surfoplexes with the Lmic/D mass ratio over the isoneutrality ratio, makes this regimen of lipid and DNA content the optimum for efficiency in the transfection process.

  15. Characterization of electrophoretic suspension for thin polymer film deposition

    NASA Astrophysics Data System (ADS)

    Mladenova, D.; Weiter, M.; Stepanek, P.; Ouzzane, I.; Vala, M.; Sinigersky, V.; Zhivkov, I.

    2012-03-01

    The optical absorption and fluorescence spectra of poly [2-methoxy-5-(3',7'-dimethyloctyloxy)-1,4-phenylenevinylene] toluene solutions and 50:50% toluene/acetonitrile suspensions show clearly distinguishable differences (e.g., peak broadening and shifting), which could be used for characterization of suspensions with different acetonitrile content. The dynamic light scattering (DLS) measurement of the suspensions prepared showed a particle size of 90 nm. Thin films with thicknesses of about 400 nm were prepared by electrophoretic deposition (EPD) and spin coating. As the films are very soft, a contactless optical profilometry techique based on chromatic aberration was used to measure their thickness. AFM imaging of spin coated and EPD films revealed film roughness of 20÷40 nm and 40÷80 nm, respectively. The EPD film roughness seems to be less than the suspension particle size obtained by DLS, probably due to the partial film dissolving by the toluene present in the suspension.

  16. Preparation of sol-gel coatings by electrophoretic deposition

    SciTech Connect

    Hirashima, Hiroshi; Obu, Yusuke; Nagai, Takayuki; Imai, Hiroaki

    1994-12-31

    Thin films of ZrO{sub 2} and lead zirconate-titanate, PZT, about 100 to 1,000 nm in thickness, were prepared by electrophoretic deposition from transparent sols obtained by hydrolysis of metal alkoxides. Stainless steel plates and Pt-coated glass plates were used as substrates/electrodes. The applied field was up to 20 V/cm. The refractive indices of as dried films were higher than those of dip-coated films. High temperature oxidation of stainless steel plates was suppressed by the ZrO{sub 2} coatings. Uniformity of the chemical composition of the as-dried PZT films, determined by Auger electron spectroscopy, was better than the dip-coated PZT films.

  17. Electrophoretically pure mouse interferon exerts multiple biologic effects.

    PubMed Central

    Gresser, I; De Maeyer-Guignard, J; Tovey, M G; De Maeyer, E

    1979-01-01

    Electrophoretically pure mouse interferon was examined for a number of biologic effects previously ascribed to crude or partially purified interferon preparations. These effects include: inhibition of the growth of a transplantable tumor in mice; inhibition of cell multiplication of mouse tumor cells in vitro; enhancement of the expression of histocompatibility antigens on mouse tumor cells in vitro; inhibition of antibody formation in vitro; inhibition of sensitization to sheep erythrocytes and the expression of delayed type hypersensitivity in mice; enhancement of natural killer cell activity in vivo and in vitro; enhancement of cell sensitivity to the toxicity of poly(I)-poly(C); and enhanced production ("priming") of interferon production in vitro. Our results establish that the molecules responsible for the antiviral action of interferon are also responsible for these varied biologic effects. PMID:291948

  18. Formation of diamond nanoparticle thin films by electrophoretic deposition

    NASA Astrophysics Data System (ADS)

    Goto, Yosuke; Ohishi, Fujio; Tanaka, Kuniaki; Usui, Hiroaki

    2016-03-01

    Thin films of diamond nanoparticles were prepared by electrophoretic deposition (EPD) using 0.5 wt % dispersions in water, ethanol, and 2-propanol. The film growth rate increased with increasing voltage applied to the electrodes. However, an excessive increase in voltage caused the degradation of film morphology. The optimum voltage was 4 V with an electrode separation of 5 mm. The film growth rate was higher in organic solvents than in water. The deposited film had a smooth surface with an average surface roughness comparable to the size of primary particles of the source material. It is notable that the EPD films had a considerably higher physical stability than spin-coated and cast films. The stability was further improved by thermally annealing the films. IR analysis revealed that the diamond nanoparticles have carboxy and amino groups on their surfaces. It is considered that the stability of the EPD films originate from a chemical reaction between these functional groups.

  19. New capabilities and applications for electrophoretically deposited coatings

    SciTech Connect

    Sharp, D.J.

    1991-01-01

    Our primary purpose in this test is to provide a brief general description of a few applications of various electrophoretic systems which have been investigated and have found use in various coating applications at Sandia National Laboratories. Both organic and inorganic suspensions in aqueous and non-aqueous media have been considered in these studies. Applications include high voltage insulating dielectrics, thermally conductive/electrically insulating films, adherent lubricating films, uniform photoresist films, glass coatings, and fissile uranium oxide/carbon composite films for studies of nuclear powered lasers. More recently, we have become interested in the beneficial environmental aspects of being able to provide protective polymer coatings which reduce or minimize the use of organic solvents required by traditional spray coat processes. Important practical factors which relate to film uniformity, adhesion, and composition are related to unique coating or plating capabilities and applications. 6 refs., 2 figs., 1 tab.

  20. Capillary electrophoretic and mass spectrometric analysis of a polydisperse fluorosurfactant.

    PubMed

    Al-Jarah, Suhair Yousif; Sjödahl, Johan; Woldegiorgis, Andreas; Emmer, Asa

    2005-02-01

    A fluorosurfactant has been studied using capillary electrophoresis and mass spectrometry. The fluorosurfactant, FC134, can be used as a buffer additive in capillary electrophoresis in order to decrease wall adsorption of proteins and in micellar electrokinetic chromatography. However, it has been discovered that this fluorosurfactant is polydisperse, thus containing substances with different lengths and structures. In this work, the fluorosurfactant sample components were separated by capillary electrophoresis. An uncoated as well as a poly(vinyl alcohol)-coated capillary were used with running electrolytes containing methanol and acetic acid. Following the capillary electrophoretic separation, fractions were collected for further analysis by MALDI-MS. Non-fractionated samples were also analyzed both by MALDI-MS and by ESI-MS.

  1. Simulations of Electrophoretic RNA Transport Through Transmembrane Carbon Nanotubes

    PubMed Central

    Zimmerli, Urs; Koumoutsakos, Petros

    2008-01-01

    The study of interactions between carbon nanotubes and cellular components, such as membranes and biomolecules, is fundamental for the rational design of nanodevices interfacing with biological systems. In this work, we use molecular dynamics simulations to study the electrophoretic transport of RNA through carbon nanotubes embedded in membranes. Decorated and naked carbon nanotubes are inserted into a dodecane membrane and a dimyristoylphosphatidylcholine lipid bilayer, and the system is subjected to electrostatic potential differences. The transport properties of this artificial pore are determined by the structural modifications of the membrane in the vicinity of the nanotube openings and they are quantified by the nonuniform electrostatic potential maps at the entrance and inside the nanotube. The pore is used to transport electrophoretically a short RNA segment and we find that the speed of translocation exhibits an exponential dependence on the applied potential differences. The RNA is transported while undergoing a repeated stacking and unstacking process, affected by steric interactions with the membrane headgroups and by hydrophobic interaction with the walls of the nanotube. The RNA is structurally reorganized inside the nanotube, with its backbone solvated by water molecules near the axis of the tube and its bases aligned with the nanotube walls. Upon exiting the pore, the RNA interacts with the membrane headgroups and remains attached to the dodecane membrane while it is expelled into the solvent in the case of the lipid bilayer. The results of the simulations detail processes of molecular transport into cellular compartments through manufactured nanopores and they are discussed in the context of applications in biotechnology and nanomedicine. PMID:18178663

  2. Simulations of electrophoretic RNA transport through transmembrane carbon nanotubes.

    PubMed

    Zimmerli, Urs; Koumoutsakos, Petros

    2008-04-01

    The study of interactions between carbon nanotubes and cellular components, such as membranes and biomolecules, is fundamental for the rational design of nanodevices interfacing with biological systems. In this work, we use molecular dynamics simulations to study the electrophoretic transport of RNA through carbon nanotubes embedded in membranes. Decorated and naked carbon nanotubes are inserted into a dodecane membrane and a dimyristoylphosphatidylcholine lipid bilayer, and the system is subjected to electrostatic potential differences. The transport properties of this artificial pore are determined by the structural modifications of the membrane in the vicinity of the nanotube openings and they are quantified by the nonuniform electrostatic potential maps at the entrance and inside the nanotube. The pore is used to transport electrophoretically a short RNA segment and we find that the speed of translocation exhibits an exponential dependence on the applied potential differences. The RNA is transported while undergoing a repeated stacking and unstacking process, affected by steric interactions with the membrane headgroups and by hydrophobic interaction with the walls of the nanotube. The RNA is structurally reorganized inside the nanotube, with its backbone solvated by water molecules near the axis of the tube and its bases aligned with the nanotube walls. Upon exiting the pore, the RNA interacts with the membrane headgroups and remains attached to the dodecane membrane while it is expelled into the solvent in the case of the lipid bilayer. The results of the simulations detail processes of molecular transport into cellular compartments through manufactured nanopores and they are discussed in the context of applications in biotechnology and nanomedicine.

  3. Electrophoretic deposition of ultrasonicated and functionalized nanomaterials for multifunctional composites

    NASA Astrophysics Data System (ADS)

    An, Qi

    Recent advances in the synthesis and characterization of nanostructured composite materials have enabled a broad range of opportunities for engineering the properties of polymer-matrix materials. Carbon nanotubes (CNTs) are known to have exceptional mechanical, electrical and thermal properties. Because of their small size, CNTs can occupy regions between traditional micro-scale reinforcements and create a hierarchical micro/nano structure spanning several orders of magnitude. Since CNTs possess critical reinforcement dimensions below 100 nm, new opportunities exist for tailoring the fiber/matrix interphase regions and ultimately the mechanical and electrical performance of advanced fiber-composites with minimal impact on the fiber-dominated properties. This growing interest in nanoscale hybridization with conventional fiber reinforcement has highlighted the need to develop new processing techniques for successful CNT integration. In this work, a novel and industrially scalable approach for producing multi-scale hybrid carbon nanotube/fiber composites using an electrophoretic deposition (EPD) technique has been studied as an alternative to in situ chemical vapor deposition growth (CVD). EPD is a widely used industrial coating process employed in areas ranging from automotive to electronics production. The method has a number of benefits which include low energy use and the ability to homogenously coat complex shapes with well adhered films of controlled thickness and density. A stable aqueous dispersion of multi-walled carbon nanotubes (MWCNTs) was produced using a novel ozonolysis and ultrasonication (USO) technique that results in dispersion and functionalization in a single step. Networks of CNTs span between adjacent fibers and the resulting composites exhibit significant increases in electrical conductivity and considerable improvements in the interlaminar shear strength and fracture toughness. In order to better understand the underlying mechanisms behind the

  4. Comparative analysis of the DNA staining efficiencies of different fluorescent dyes in preparative agarose gel electrophoresis.

    PubMed

    Huang, Qing; Fu, Wei-Ling

    2005-01-01

    Ethidium bromide (EB) is a mutagen and toxin that is widely used in the laboratory for visualization of nucleic acids. Safer nucleic acid stains, such as SYBR Gold, SYBR Green, GoldView, GeneFinder, and GoldStar, have been developed. However, there has been no systematic comparative analysis of the staining efficiencies of these dyes. In the present study, SYBR Gold, SYBR Green I, GoldView and EB were compared. Although both SYBR Gold and SYBR Green alter electrophoretic mobility and thus DNA size estimates, they are cost-effective alternatives to EB. SYBR Gold was more sensitive than SYBR Green I at detecting short fragments, but 50-bp bands were clearly visible using either dye when visualized with a long integration time. SYBR Gold or SYBR Green I are sensitive and relatively safe alternatives to EB. In our laboratory, the SYBR Gold method is now used routinely by all members of our group with great consistency and success.

  5. Occurrence of antibiotic resistance genes and mobile genetic elements in enterococci and genomic DNA during anaerobic digestion of pharmaceutical waste sludge with different pretreatments.

    PubMed

    Tong, Juan; Lu, XueTing; Zhang, JunYa; Sui, Qianwen; Wang, Rui; Chen, Meixue; Wei, Yuansong

    2017-03-22

    Pharmaceutical waste sludge harbors large amounts of antibiotic resistance genes (ARGs) and mobile genetic elements (MGEs), and it is necessary to study the reduction of ARGs and MGEs during sludge treatment. Therefore, the antibiotic resistance phenotypes and genotypes of enterococci, and the ARGs and MGEs in genomic DNA were investigated during anaerobic digestion (AD) with microwave (MW), thermal hydrolysis (TH) and ozone pretreatment. Results showed that sludge pretreatment increased the occurrence of the resistance phenotypes and genotypes of enterococci. During AD, the resistance of enterococci to macrolides decreased, except for in the MW-pretreated sludge. Horizontal gene transfer and co-occurrence of ermB and tetM in enterococci resulted in increased tetracycline resistance of enterococci throughout the sludge treatment. MGEs such as intI1, ISCR1 and Tn916/1545 had a significant effect on the distribution of ARGs. AD with pretreatment, especially TH pretreatment, resulted in greater ARGs and MGEs reduction and improved methane production.

  6. DNA-METAFECTENE PRO complexation: a physical chemistry study.

    PubMed

    Alatorre-Meda, Manuel; González-Pérez, Alfredo; Rodríguez, Julio R

    2010-07-21

    Complexes formed between cationic liposomes and DNA (also known as lipoplexes or genosomes) have proven, for years now, to be a suitable option for gene delivery to cells, transfection, however, some aspects regarding the liposome-DNA interaction mechanism and complex stability remain still unclear. This work aims to improve the understanding of the poorly defined mechanisms and structural conformation associated with the interaction of METAFECTENE PRO (MEP), a commercial liposomal transfection reagent, with poly-anion DNA at mass ratios around the mass ratio recommended for transfection (L/D congruent with 700). A physical chemistry characterization was conducted at a pH of 6.5 and at a temperature of 25 degrees C by means of dynamic light scattering (DLS), electrophoretic mobility (zeta-potential), transmission electron microscopy (TEM), and atomic force microscopy (AFM). Five parameters important for transfection were determined for the lipoplexes: (i) the hydrodynamic radius, R(H), (ii) the stability with time, (iii) the mass ratio of at which both moieties start to interact, (L/D)(i), (iv) the overall charge, and (v) the morphology. Results in ensemble point to a "beads on a string" conformation, with the lipoplex formation occurring well below isoneutrality from (L/D)(i) congruent with 600. The lipoplexes were found to be stable within at least seven days presenting an average R(H) of 135 nm.

  7. Novel DNA-binding properties of the RNA-binding protein TIAR.

    PubMed

    Suswam, Esther A; Li, Yan Yan; Mahtani, Harry; King, Peter H

    2005-01-01

    TIA-1 related protein binds avidly to uridine-rich elements in mRNA and pre-mRNAs of a wide range of genes, including interleukin (IL)-8 and vascular endothelial growth factor (VEGF). The protein has diverse regulatory roles, which in part depend on the locus of binding within the transcript, including translational control, splicing and apoptosis. Here, we observed selective and potent inhibition of TIAR-RNP complex formation with IL-8 and VEGF 3'-untranslated regions (3'-UTRs) using thymidine-rich deoxyoligonucleotide (ODN) sequences derived from the VEFG 3'-UTR. We show by ultraviolet crosslinking and electrophoretic mobility shift assays that TIAR can bind directly to single-stranded, thymidine-rich ODNs but not to double-stranded ODNs containing the same sequence. TIAR had a nearly 6-fold greater affinity for DNA than RNA (K(d)app = 1.6x10(-9) M versus 9.4 x 10(-9) M). Truncation of TIAR indicated that the high affinity DNA-binding site overlaps with the RNA-binding site involving RNA recognition motif 2 (RRM2). However, RRM1 alone could also bind to DNA. Finally, we show that TIAR can be displaced from single-stranded DNA by active transcription through the binding site. These results provide a potential mechanism by which TIAR can shuttle between RNA and DNA ligands.

  8. Photoaffinity Labeling Reveals Nuclear Proteins that Uniquely Recognize Cisplatin-DNA Interstrand Cross-Links

    PubMed Central

    Zhu, Guangyu; Lippard, Stephen J.

    2009-01-01

    The DNA-binding inorganic compound cisplatin is one of the most successful anticancer drugs. The detailed mechanism by which cells recognize and process of cisplatin-DNA damage is of great interest. Although the family of proteins that bind cisplatin 1,2- and 1,3-intrastrand cross-links has been identified, much less is known about cellular protein interactions with cisplatin interstrand cross-links (ICLs). In order to address this question, a photoreactive analogue of cisplatin, PtBP6, was used to construct a DNA duplex containing a site-specific platinum ICL. This DNA probe was characterized and used in photo-cross-linking experiments to separate and identify nuclear proteins that bind to the ICL by peptide mass fingerprint analysis. Several such proteins were discovered, including PARP-1, hMutSβ, DNA ligase III, XRCC1, and PNK. The photo-cross-linking approach was independently validated by an electrophoretic mobility shift assay demonstrating hMutSβ binding to a cisplatin ICL. Proteins that recognize the platinum ICL were also identified in cisplatin resistant cells, cells halted at various phases of the cell cycle, and in different carcinoma cells. Nuclear proteins that bind to the platinum ICL differ from those binding to intrastrand cross-links, indicating different mechanisms for disruption of cellular functions. PMID:19364127

  9. FRET-based protein-DNA binding assay for detection of active NF-kappa B

    SciTech Connect

    Giannetti, Ambra; Baldini, Francesco; Wabuyele, Musundi B; Vo Dinh, Tuan

    2006-01-01

    A novel method to detect the active form of NF-{kappa}B, a transcription factor regulating a battery of inflammatory genes and playing a fundamental role in the development of numerous pathological states, has been developed. In the present work, we used fluorescence resonance energy transfer (FRET) to study DNA-protein binding interaction taking place between double-strand (ds) DNA immobilized in a glass capillary wall and p50 proteins. For this purpose, we developed a regenerable FRET-based system comprising of a single-strand (ss) DNA with auto-complementary sequence that is end-labeled with Cy5 dye and is highly specific for p50 proteins. The proteins were labeled with a Black Hole Quencher (BHQ-3) to be used as FRET pair. The interaction of p50/p50 homodimer active form with its DNA binding site was demonstrated by both electrophoretic mobility shift assays and FRET studies. These preliminary results demonstrated the feasibility of the FRET-based DNA technique to detect the active form of NF-{kappa}B protein with 90% detection efficiency. In addition, we show that the system is stable and highly regenerable.

  10. A laser scanner for imaging fluorophore labeled molecules in electrophoretic gels

    SciTech Connect

    Fisk, D.J.; Sutherland, J.C.

    1995-08-01

    A laser scanner for imaging electrophoretic gels was constructed and tested. The scanner incorporates a green helium-neon (HeNe) laser (543.5nm wavelength) and can achieve a spatial resolution of 19{micro}m. The instrument can function in two modes : snap-shot and finish-line. In snapshot mode, all samples are electrophoresed for the same time and the gel is scanned after completion of electrophoresis, while in finish-line mode, fluorophore labeled samples are electrophoresed for a constant distance and the image is formed as the samples pass under the detector. The resolving power of the finish-line mode of imaging is found to be greater than that of the snapshot mode of imaging. This laser scanner is also compared with a Charge Coupled Device (CCD) camera and in terms of resolving power is found to be superior. Sensitivity of the instrument is presented in terms of the minimum amount of DNA that can be detected verses its molecular length.

  11. Electrokinetically-driven transport of DNA through focused ion beam milled nanofluidic channels.

    PubMed

    Menard, Laurent D; Ramsey, J Michael

    2013-01-15

    The electrophoretically driven transport of double-stranded λ-phage DNA through focused ion beam (FIB) milled nanochannels is described. Nanochannels were fabricated having critical dimensions (width and depth) corresponding to 0.5×, 1×, and 2× the DNA persistence length, or 25 nm, 50 nm, and 100 nm, respectively. The threshold field strength required to drive transport, the threading mobility, and the transport mobility were measured as a function of nanochannel size. As the nanochannel dimensions decreased, the entropic barrier to translocation increased and transport became more constrained. Equilibrium models of confinement provide a framework in which to understand the observed trends, although the dynamic nature of the experiments resulted in significant deviations from theory. It was also demonstrated that the use of dynamic wall coatings for the purpose of electroosmotic flow suppression can have a significant impact on transport dynamics that may obfuscate entropic contributions. The nonintermittent DNA transport through the FIB milled nanochannels demonstrates that they are well suited for use in nanofluidic devices. We expect that an understanding of the dynamic transport properties reported here will facilitate the incorporation of FIB-milled nanochannels in devices for single molecule and ensemble analyses.

  12. The electrophoretically 'slow' and 'fast' forms of the alpha 2-macroglobulin molecule.

    PubMed Central

    Barrett, A J; Brown, M A; Sayers, C A

    1979-01-01

    alpha 2-Macroglobulin (alpha 2M) was isolated from human plasma by a four-step procedure: poly(ethylene glyco) fractionation, gel chromatography, euglobulin precipitation and immunoadsorption. No contaminants were detected in the final preparations by electrophoresis or immunoprecipitation. The protein ran as a single slow band in gel electrophoresis, and was designated 'S-alpha 2M'. S-alpha 2M bound about 2 mol of trypsin/mol. Treatment of S-alpha 2M with a proteinase or ammonium salts produced a form of the molecule more mobile in electrophoresis, and lacking proteinase-binding activity (F-alpha 2M). The electrophoretic mobility of the F-alpha 2M resulting from reaction with NH4+ salts was identical with that of proteinase complexes. We attribute the change in electrophoretic mobility of the alpha 2M to a conformation change, but there was no evidence of a change in pI or Strokes radius. Electrophoresis of S-alpha 2M in the presence of sodium dodecylsulphate gave results consistent with the view that the alpha 2M molecule is a tetramer of identical subunits, assembled as a non-covalent pair of disulphide-linked dimers. Some of the subunits seemed to be 'nicked' into two-thires-length and one-third-length chains, however. This was not apparent with F-alpha 2M produced by ammonium salts. F-alpha 2M produced by trypsin showed two new bands attributable to cleavage of the subunit polypeptide chain near the middle. Immunoassays of F-alpha 2M gave 'rockets' 12-29% lower than those with S-alpha 2M. The nature of the interactions between subunits in S-alpha 2M and F-alpha 2M was investigated by treating each form with glutaraldehyde before electrophoresis in the presence of sodium dodecyl sulphate. A much greater degree of cross-linking was observed with the F-alpha 2M, indicating that the subunits interact most closely in this form of the molecule. Exposure of S-alpha 2M to 3 M-urea or pH3 resulted in dissociation to the disulphide-bonded half-molecules; these did not

  13. Biochemical Analysis of Autophagy in Algae and Plants by Monitoring the Electrophoretic Mobility of ATG8.

    PubMed

    Pérez-Pérez, María Esther; Andrés-Garrido, Ascensión; Crespo, José L

    2016-01-01

    Identification of specific autophagy markers has been fundamental to investigate autophagy as catabolic process. Among them, the ATG8 protein turned out to be one of the most widely used and specific molecular markers of autophagy both in higher and lower eukaryotes. Here, we describe how ATG8 can be used to monitor autophagy in Chlamydomonas and Arabidopsis by western blot analysis.

  14. Effects of method of detachment on electrophoretic mobility of mammalian cells grown in monolayer culture

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    A variety of proteolytic and micolytic enzumes, mechanical procedures, and changes in the ionic environment, especially Ca chelation, are used for dispersal of monolayer grown cells. If either chelating agents or mechanical dispersion are used alone, the cell yield is often low and suspensions of single cells are difficult to obtain. Confluent monolayers treated with EDTA tend to be released from their surfaces in sheets, and clumps of cells remain even after further incubation in EDTA. Crude trypsin is the most popular dispersal agent and is known to contain a variety of contaminating enzymes which contribute to the dispersal of cells. A variety of cell injuries resulting from the activity of proteolytic enzymes are reported. It is shown that crystalline trypsin is least harmful to cell integrity as judged by trypan blue uptake.

  15. Characterization of U(VI)-carbonato ternary complexes on hematite: EXAFS and electrophoretic mobility measurements

    USGS Publications Warehouse

    Bargar, John R.; Reitmeyer, Rebecca; Lenhart, John J.; Davis, James A.

    2000-01-01

    We have measured U(VI) adsorption on hematite using EXAFS spectroscopy and electrophoresis under conditions relevant to surface waters and aquifers (0.01 to 10 μM dissolved uranium concentrations, in equilibrium with air, pH 4.5 to 8.5). Both techniques suggest the existence of anionic U(VI)-carbonato ternary complexes. Fits to EXAFS spectra indicate that U(VI) is simultaneously coordinated to surface FeO6 octahedra and carbonate (or bicarbonate) ligands in bidentate fashions, leading to the conclusion that the ternary complexes have an inner-sphere metal bridging (hematite-U(VI)-carbonato) structure. Greater than or equal to 50% of adsorbed U(VI) was comprised of monomeric hematite-U(VI)-carbonato ternary complexes, even at pH 4.5. Multimeric U(VI) species were observed at pH ≥ 6.5 and aqueous U(VI) concentrations approximately an order of magnitude more dilute than the solubility of crystalline β-UO2(OH)2. Based on structural constraints, these complexes were interpreted as dimeric hematite-U(VI)-carbonato ternary complexes. These results suggest that Fe-oxide-U(VI)-carbonato complexes are likely to be important transport-limiting species in oxic aquifers throughout a wide range of pH values.

  16. Identification of small molecule inhibitors of ERCC1-XPF that inhibit DNA repair and potentiate cisplatin efficacy in cancer cells.

    PubMed

    Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M; Chalfin, Elaine M; Bepler, Gerold; Patrick, Steve M

    2016-11-15

    ERCC1-XPF heterodimer is a 5'-3' structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy.

  17. Identification of small molecule inhibitors of ERCC1-XPF that inhibit DNA repair and potentiate cisplatin efficacy in cancer cells

    PubMed Central

    Arora, Sanjeevani; Heyza, Joshua; Zhang, Hao; Kalman-Maltese, Vivian; Tillison, Kristin; Floyd, Ashley M.; Chalfin, Elaine M.; Bepler, Gerold; Patrick, Steve M.

    2016-01-01

    ERCC1-XPF heterodimer is a 5′-3′ structure-specific endonuclease which is essential in multiple DNA repair pathways in mammalian cells. ERCC1-XPF (ERCC1-ERCC4) repairs cisplatin-DNA intrastrand adducts and interstrand crosslinks and its specific inhibition has been shown to enhance cisplatin cytotoxicity in cancer cells. In this study, we describe a high throughput screen (HTS) used to identify small molecules that inhibit the endonuclease activity of ERCC1-XPF. Primary screens identified two compounds that inhibit ERCC1-XPF activity in the nanomolar range. These compounds were validated in secondary screens against two other non-related endonucleases to ensure specificity. Results from these screens were validated using an in vitro gel-based nuclease assay. Electrophoretic mobility shift assays (EMSAs) further show that these compounds do not inhibit the binding of purified ERCC1-XPF to DNA. Next, in lung cancer cells these compounds potentiated cisplatin cytotoxicity and inhibited DNA repair. Structure activity relationship (SAR) studies identified related compounds for one of the original Hits, which also potentiated cisplatin cytotoxicity in cancer cells. Excitingly, dosing with NSC16168 compound potentiated cisplatin antitumor activity in a lung cancer xenograft model. Further development of ERCC1-XPF DNA repair inhibitors is expected to sensitize cancer cells to DNA damage-based chemotherapy. PMID:27650543

  18. A clinical correlation of anti-DNA-AGE autoantibodies in type 2 diabetes mellitus with disease duration.

    PubMed

    Ashraf, Jalaluddin M; Arfat, Mir Yasir; Arif, Zarina; Ahmad, Jamal; Moinuddin; Alam, Khursheed

    2015-02-01

    Nonenzymatic glycation of amino groups of DNA bases by reducing sugars can generate advanced glycation end products (AGEs). Cellular formation of AGEs under normal physiology is continuously scanned and removed by efficient system in the cells. However, excess formation and accumulation of AGEs may be cause or consequence of some human diseases. Mammalian DNA incubated with d-glucose for 28 days at 37°C showed structural changes in DNA as confirmed by UV, fluorescence, CD, melting temperature, S1 nuclease sensitivity and gel electrophoresis. Formation of DNA-AGE was confirmed by HPLC and LC-MS. Enzyme immunoassay and electrophoretic mobility shift assay of autoantibodies in type 2 diabetes patients' sera with disease duration of 5-15 years exhibited significantly high binding with DNA-AGE as compared to patients with 1-5 years of disease duration. Autoantibodies against aberrant DNA-AGE may be important in the assessment of initiation/progression of secondary complications in type 2 diabetes mellitus patients.

  19. Sizing Large Proteins and Protein Complexes by Electrospray Ionization Mass Spectrometry and Ion Mobility

    PubMed Central

    Kaddis, Catherine S.; Lomeli, Shirley H.; Yin, Sheng; Berhane, Beniam; Apostol, Marcin I.; Kickhoefer, Valerie A.; Rome, Leonard H.; Loo, Joseph A.

    2009-01-01

    Mass spectrometry (MS) and ion mobility with electrospray ionization (ESI) have the capability to measure and detect large noncovalent protein-ligand and protein-protein complexes. Using an ion mobility method termed GEMMA (Gas-Phase Electrophoretic Mobility Molecular Analysis), protein particles representing a range of sizes can be separated by their electrophoretic mobility in air. Highly charged particles produced from a protein complex solution using electrospray can be manipulated to produce singly charged ions which can be separated and quantified by their electrophoretic mobility. Results from ESI-GEMMA analysis from our laboratory and others were compared to other experimental and theoretically determined parameters, such as molecular mass and cryoelectron microscopy and x-ray crystal structure dimensions. There is a strong correlation between the electrophoretic mobility diameter determined from GEMMA analysis and the molecular mass for protein complexes up to 12 MDa, including the 93 kDa enolase dimer, the 480 kDa ferritin 24-mer complex, the 4.6 MDa cowpea chlorotic mottle virus (CCMV), and the 9 MDa MVP-vault assembly. ESI-GEMMA is used to differentiate a number of similarly sized vault complexes that are composed of different N-terminal protein tags on the MVP subunit. The average effective density of the proteins and protein complexes studied was 0.6 g/cm3. Moreover, there is evidence that proteins and protein complexes collapse or become more compact in the gas phase in the absence of water. PMID:17434746

  20. Crystal Structure of Human Thymine DNA Glycosylase Bound to DNA Elucidates Sequence-Specific Mismatch Recognition

    SciTech Connect

    Maiti, A.; Morgan, M.T.; Pozharski, E.; Drohat, A.C.

    2009-05-19

    Cytosine methylation at CpG dinucleotides produces m{sup 5}CpG, an epigenetic modification that is important for transcriptional regulation and genomic stability in vertebrate cells. However, m{sup 5}C deamination yields mutagenic G{center_dot}T mispairs, which are implicated in genetic disease, cancer, and aging. Human thymine DNA glycosylase (hTDG) removes T from G{center_dot}T mispairs, producing an abasic (or AP) site, and follow-on base excision repair proteins restore the G{center_dot}C pair. hTDG is inactive against normal A{center_dot}T pairs, and is most effective for G{center_dot}T mispairs and other damage located in a CpG context. The molecular basis of these important catalytic properties has remained unknown. Here, we report a crystal structure of hTDG (catalytic domain, hTDG{sup cat}) in complex with abasic DNA, at 2.8 {angstrom} resolution. Surprisingly, the enzyme crystallized in a 2:1 complex with DNA, one subunit bound at the abasic site, as anticipated, and the other at an undamaged (nonspecific) site. Isothermal titration calorimetry and electrophoretic mobility-shift experiments indicate that hTDG and hTDG{sup cat} can bind abasic DNA with 1:1 or 2:1 stoichiometry. Kinetics experiments show that the 1:1 complex is sufficient for full catalytic (base excision) activity, suggesting that the 2:1 complex, if adopted in vivo, might be important for some other activity of hTDG, perhaps binding interactions with other proteins. Our structure reveals interactions that promote the stringent specificity for guanine versus adenine as the pairing partner of the target base and interactions that likely confer CpG sequence specificity. We find striking differences between hTDG and its prokaryotic ortholog (MUG), despite the relatively high (32%) sequence identity.

  1. Electrophoretically deposited reduced graphene oxide platform for food toxin detection

    NASA Astrophysics Data System (ADS)

    Srivastava, Saurabh; Kumar, Vinod; Ali, Md Azahar; Solanki, Pratima R.; Srivastava, Anchal; Sumana, Gajjala; Saxena, Preeti Suman; Joshi, Amish G.; Malhotra, B. D.

    2013-03-01

    Reduced graphene oxide (RGO) due to its excellent electrochemical properties and large surface area, has recently aroused much interest for electrochemical biosensing application. Here, the chemically active RGO has been synthesized and deposited onto an indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. This novel platform has been utilized for covalent attachment of the monoclonal antibodies of aflatoxin B1 (anti-AFB1) for food toxin (AFB1) detection. The electron microscopy, X-ray diffraction, and UV-visible studies reveal successful synthesis of reduced graphene oxide while the XPS and FTIR studies suggest its carboxylic functionalized nature. The electrochemical sensing results of the anti-AFB1/RGO/ITO based immunoelectrode obtained as a function of aflatoxin concentration show high sensitivity (68 μA ng-1 mL cm-2) and improved detection limit (0.12 ng mL-1). The association constant (ka) for antigen-antibody interaction obtained as 5 × 10-4 ng mL-1 indicates high affinity of antibodies toward the antigen (AFB1).Reduced graphene oxide (RGO) due to its excellent electrochemical properties and large surface area, has recently aroused much interest for electrochemical biosensing application. Here, the chemically active RGO has been synthesized and deposited onto an indium tin oxide (ITO) coated glass substrate by the electrophoretic deposition technique. This novel platform has been utilized for covalent attachment of the monoclonal antibodies of aflatoxin B1 (anti-AFB1) for food toxin (AFB1) detection. The electron microscopy, X-ray diffraction, and UV-visible studies reveal successful synthesis of reduced graphene oxide while the XPS and FTIR studies suggest its carboxylic functionalized nature. The electrochemical sensing results of the anti-AFB1/RGO/ITO based immunoelectrode obtained as a function of aflatoxin concentration show high sensitivity (68 μA ng-1 mL cm-2) and improved detection limit (0.12 ng mL-1). The

  2. Electrophoretic and antigenic characterisation of Dermatophilus congolensis extracellular products.

    PubMed

    Ambrose, N C; el Jack, M A; McOrist, S; Boid, R

    1997-12-01

    Dermatophilus congolensis is the causative agent of bovine dermatophilosis and lumpy wool in sheep. Two field isolates of D. congolensis, one each from a cow in Ghana and a sheep in Scotland, were cultured for 24-72 h in a synthetic medium based on RPMI-1640. Culture filtrates were examined by SDS-PAGE and considered to contain extracellular products released by growing hyphae and filaments. Electrophoretic profiles of culture filtrates of the two isolates contained common bands and bands that were unique to each isolate. The composition of extracellular products altered with increasing culture periods indicating that specific products were released at different stages of growth. Culture filtrate prepared in the presence of serine protease and metalloprotease inhibitors contained more and better defined bands than that prepared without protease inhibitors indicating the presence of proteases in culture filtrates. Western blot analysis of extracellular products using a panel of sera showed that the two isolates from different host species and distant geographical locations contained cross-reactive antigens. Natural and experimental infections stimulated antibody responses to antigens in culture filtrates, sera from animals that were disease free but in-contact with dermatophilosis-infected animals also contained antibodies to extracellular antigens. The antigens recognised by most sera had molecular weights of 200 kDa in the bovine isolate, 170 kDa in the ovine isolate and 67, 27 and 52-55 kDa in both isolates. The number of antigenic bands of both isolates was positively correlated with the intensity of challenge and the severity of infection: antibodies in sera from disease-free cattle in Ghana recognised more antigens than sera from disease-free sheep in Scotland and more antigens were recognised by sera from chronically-infected Ghanaian cattle than by sera from experimentally-infected calves and sheep. The latter developed antibodies to antigens of 27 and 24 k

  3. Luteolin, an emerging anti-cancer flavonoid, poisons eukaryotic DNA topoisomerase I.

    PubMed Central

    Chowdhury, Arnab Roy; Sharma, Shalini; Mandal, Suparna; Goswami, Anindya; Mukhopadhyay, Sibabrata; Majumder, Hemanta K

    2002-01-01

    Luteolin, a naturally occurring flavonoid, is abundant in our daily dietary intake. It exhibits a wide spectrum of pharmacological properties, but little is known about its biochemical targets other than the fact that it induces topoisomerase II-mediated apoptosis. In the present study, we show that luteolin completely inhibits the catalytic activity of eukaryotic DNA topoisomerase I at a concentration of 40 microM, with an IC50 of 5 microM. Preincubation of enzyme with luteolin before adding a DNA substrate increases the inhibition of the catalytic activity (IC50=0.66 microM). Treatment of DNA with luteolin before addition of topoisomerase I reduces this inhibitory effect. Subsequent fluorescence tests show that luteolin not only interacts directly with the enzyme but also with the substrate DNA, and intercalates at a very high concentration (>250 microM) without binding to the minor groove. Direct interaction between luteolin and DNA does not affect the assembly of the enzyme-DNA complex, as evident from the electrophoretic mobility-shift assays. Here we show that the inhibition of topoisomerase I by luteolin is due to the stabilization of topoisomerase-I DNA-cleavable complexes. Hence, luteolin is similar to camptothecin, a class I inhibitor, with respect to its ability to form the topoisomerase I-mediated 'cleavable complex'. But, unlike camptothecin, luteolin interacts with both free enzyme and substrate DNA. The inhibitory effect of luteolin is translated into concanavalin A-stimulated mouse splenocytes, with the compound inducing SDS-K+-precipitable DNA-topoisomerase complexes. This is the first report on luteolin as an inhibitor of the catalytic activity of topoisomerase I, and our results further support its therapeutic potential as a lead anti-cancer compound that poisons topoisomerases. PMID:12027807

  4. Probing DNA with micro- and nanocapillaries and optical tweezers

    NASA Astrophysics Data System (ADS)

    Steinbock, L. J.; Otto, O.; Skarstam, D. R.; Jahn, S.; Chimerel, C.; Gornall, J. L.; Keyser, U. F.

    2010-11-01

    We combine for the first time optical tweezer experiments with the resistive pulse technique based on capillaries. Quartz glass capillaries are pulled into a conical shape with tip diameters as small as 27 nm. Here, we discuss the translocation of λ-phage DNA which is driven by an electrophoretic force through the nanocapillary. The resulting change in ionic current indicates the folding state of single λ-phage DNA molecules. Our flow cell design allows for the straightforward incorporation of optical tweezers. We show that a DNA molecule attached to an optically trapped colloid is pulled into a capillary by electrophoretic forces. The detected electrophoretic force is in good agreement with measurements in solid-state nanopores.

  5. Solubilization and electrophoretic characterization of select edible nut seed proteins.

    PubMed

    Sathe, Shridhar K; Venkatachalam, Mahesh; Sharma, Girdhari M; Kshirsagar, Harshal H; Teuber, Suzanne S; Roux, Kenneth H

    2009-09-09

    The solubility of almond, Brazil nut, cashew nut, hazelnut, macadamia, pecan, pine nut, pistachio, walnut, and peanut proteins in several aqueous solvents was qualitatively and quantitatively assessed. In addition, the effects of extraction time and ionic strength on protein solubility were also investigated. Electrophoresis and protein determination (Lowry, Bradford, and micro-Kjeldahl) methods were used for qualitative and quantitative assessment of proteins, respectively. Depending on the seed, buffer type and ionic strength significantly affected protein solubility. The results suggest that buffered sodium borate (BSB; 0.1 M H(3)BO(3), 0.025 M Na(2)B(4)O(7), 0.075 M NaCl, pH 8.45) optimally solubilizes nut seed proteins. Qualitative differences in seed protein electrophoretic profiles were revealed. For a specific seed type, these differences were dependent on the solvent(s) used to solubilize the seed proteins. SDS-PAGE results suggest the polypeptide molecular mass range for the tree nut seed proteins to be 3-100 kDa. The results of native IEF suggested that the proteins were mainly acidic, with a pI range from >4.5 to <7.0. Western immunoblotting experiments indicated that rabbit polyclonal antibodies recognized substantially the same polypeptides as those recognized by the corresponding pooled patient sera IgE.

  6. Study of polymer particles suspensions for electrophoretic deposition.

    PubMed

    De Riccardis, M Federica; Martina, Virginia; Carbone, Daniela

    2013-02-14

    Recently a great interest has been expressed in electrophoretic deposition (EPD) of polymers, both as particles and as chains. It is generally accepted that also for polymer particles, the Derjaguin-Landau-Verwey-Overbeek (DLVO) theory is valid, therefore, in principle, polymer suspensions suitable for EPD could be easily obtained by dispersing polymer particles in an aqueous or nonaqueous medium. Nevertheless, this work demonstrated that in order to obtain good quality deposits based on poly(ether ether ketone) (PEEK) and poly(tetrafluoroethylene) (PTFE), some additives have to be used. In the case of PEEK, a dispersant providing citrate anions was successfully used, whereas for PTFE a steric suspension stabilization was reached by adding polyvinylpyrrolidone (PVP). In such a way, codeposition of PEEK and PTFE was achieved. The efficiency of the EPD process was demonstrated by means of differential scanning calorimetry (DSC) measurements. A thermal program consisting of heat/cool/heat cycles at a low rate was used in order to evaluate the crystalline amount of each polymer in the deposits. In order to explain the obtained results, it needed to also consider the dimension and structural characteristic of the polymer particles.

  7. AC electrophoretic deposition of organic-inorganic composite coatings.

    PubMed

    Yoshioka, T; Chávez-Valdez, A; Roether, J A; Schubert, D W; Boccaccini, A R

    2013-02-15

    Alternating current electrophoretic deposition (AC-EPD) of polyacrylic acid (PAA)-titanium oxide (TiO(2)) nanoparticle composites on stainless steel electrodes was investigated in basic aqueous solution. AC square wave with duty cycle of 80% was applied at a frequency of 1 kHz. FTIR-ATR spectra showed that both AC and direct current (DC) EPD successfully deposited PAA-TiO(2) composites. The deposition rate using AC-EPD was lower than that obtained in direct current DC-EPD. However, the microstructure and surface morphology of the deposited composite coatings were different depending on the type of electric field applied. AC-EPD applied for not more than 5 min led to smooth films without bubble formation, while DC-EPD for 1 min or more showed deposits with microstructural defects possibly as result of water electrolysis. AC-EPD was thus for the first time demonstrated to be a suitable technique to deposit organic-inorganic composite coatings from aqueous suspensions, showing that applying a square wave and frequency of 1 kHz leads to uniform PAA-TiO(2) composite coatings on conductive materials.

  8. Electrophoretic deposition of biological macromolecules, drugs, and cells.

    PubMed

    Seuss, Sigrid; Boccaccini, Aldo R

    2013-10-14

    The use of biological entities in biotechnology and the biomedical field is of great interest as the biocompatibility and the functionality of naturally occurring is usually higher compared to other biomaterials, for example, synthetic polymers. Processing of natural biomolecules, including proteins like collagen and also living cells and bacteria, to develop medical devices, bioactive coatings, functionalized implants, tissue scaffolds, or biosensors, is however challenging. Electrophoretic deposition, a technique that takes advantage of the presence of charged particles or molecules in suitable solvents, is a low-temperature process suitable for manipulating a wide range of biomolecules and biological entities preserving their bioactivity, which could be otherwise lost by processing at high temperatures. Another advantage of EPD is the possibility to use aqueous suspensions to process biological entities given that organic solvents also could lead to degradation of biomolecules. This paper gives an overview of the available literature on the application of EPD to process different biomolecules and biological entities, like proteins, bacteria cells, hyaluronic acid, and therapeutic drugs, aiming at using such biomaterials in numerous applications ranging from biosensors to orthopedic implants, tissue scaffolds, and drug delivery devices.

  9. Electrophoretic coating of amphiphilic chitosan colloids on regulating cellular behaviour

    PubMed Central

    Wang, Yen-Jen; Lo, Teng-Yuan; Wu, Chieh-Hsi; Liu, Dean-Mo

    2013-01-01

    In this communication, we report a facile nanotopographical control over a stainless steel surface via an electrophoretic deposition of colloidal amphiphilic chitosan for preferential growth, proliferation or migration of vascular smooth muscle cells (VSMCs) and human umbilical vein endothelial cells (HUVECs). Atomic force microscopy revealed that the colloidal surface exhibited a deposition time-dependent nanotopographical evolution, wherein two different nanotopographic textures indexed by ‘kurtosis’ (Rkur) value were easily designed, which were termed as ‘sharp’ (i.e. high peak-to-valley texture) surface and ‘flat’ (i.e. low peak-to-valley texture) surface. Cellular behaviour of VSMCs and HUVECs on both surfaces demonstrated topographically dependent morphogenesis, adherent responses and biochemical properties in comparison with bare stainless steel. The formation of a biofunctionalized surface upon a facile colloidal chitosan deposition envisions the potential application towards numerous biomedical devices, and this is especially promising for cardiovascular stents wherein a new surface with optimized texture can be designed and is expected to create an advantageous environment to stimulate HUVEC growth for improved healing performance. PMID:23804439

  10. Electrophoretic deposition of tannic acid-polypyrrolidone films and composites.

    PubMed

    Luo, Dan; Zhang, Tianshi; Zhitomirsky, Igor

    2016-05-01

    Thin films of polyvinylpyrrolidone (PVP)-tannic acid (TA) complexes were prepared by a conceptually new strategy, based on electrophoretic deposition (EPD). Proof of concept investigations involved the analysis of the deposition yield, FTIR and UV-vis spectroscopy of the deposited material, and electron microscopy studies. The analysis of the deposition mechanism indicated that the limitations of the EPD in the deposition of small phenolic molecules, such as TA, and electrically neutral polymers, similar to PVP, containing hydrogen-accepting carbonyl groups, can be avoided. The remarkable adsorption properties of TA and film forming properties of the PVP-TA complexes allowed for the EPD of materials of different types, such as huntite mineral platelets and hydrotalcite clay particles, TiO2 and MnO2 oxide nanoparticles, multiwalled carbon nanotubes, TiN and Pd nanoparticles. Moreover, PVP-TA complexes were used for the co-deposition of different materials and formation of composite films. In another approach, TA was used as a capping agent for the hydrothermal synthesis of ZnO nanorods, which were then deposited by EPD using PVP-TA complexes. The fundamental adsorption and interaction mechanisms of TA involved chelation of metal atoms on particle surfaces with galloyl groups, π-π interactions and hydrogen bonding. The films prepared by EPD can be used for various applications, utilizing functional properties of TA, PVP, inorganic and organic materials of different types and their composites.

  11. Nanotube-grafted polyacrylamide hydrogels for electrophoretic protein separation.

    PubMed

    Gunavadhi, Murugappan; Maria, Lourdusamy Arul Antony; Chamundeswari, Vidya N; Parthasarathy, Meera

    2012-04-01

    Multiwalled carbon nanotube-modified polyacrylamide gels have been employed for the electrophoretic separation of proteins. Two approaches are compared in this investigation, one using nanotubes only as fillers inside the gel matrix and the other using nanotubes as catalyst for polymerization of acrylamide. In both the cases, polymerization of acryl-amide/bisacrylamide has been carried out in situ in the presence of nanotubes dispersed in the gel buffer containing monomer and cross-linker. In the former case, initiator and catalyst have been added after ultrasonication of nanotubes in the gel buffer mixture where the nanotubes play the role of filler. On the other hand, the second approach precludes use of catalyst and involves addition of initiator alone during ultrasonication of nanotubes in the gel buffer containing monomer and cross-linker, which leads to the formation of nanotube-grafted gel after 25 min. When nanotubes are used as a catalyst instead of N,N,N',N'-tetramethylethylenediamine, pore size distribution of the gel matrix and linearity of molecular weight calibration plots are found to be improved. In addition, other issues associated with the use of an external catalyst like handling the moisture-sensitive and corrosive reagent and associated irreproducibility are addressed in this approach.

  12. Origami paper-based fluidic batteries for portable electrophoretic devices.

    PubMed

    Chen, Sung-Sheng; Hu, Chih-Wei; Yu, I-Fan; Liao, Ying-Chih; Yang, Jing-Tang

    2014-06-21

    A manufacturing approach for paper-based fluidic batteries was developed based on the origami principle (three-dimension paper folding). Microfluidic channels were first created on a filter paper by a wax-printing method. Copper and aluminium sheets were then glued onto the paper as electrodes for the redox reaction. After the addition of copper sulphate and aluminium chloride, commonly available cellophane paper was attached as a membrane to separate the two electrodes. The resulting planar paper sheets were then folded into three-dimensional structures and compiled as a single battery with glue. The two half reactions (Al/Al(3+) and Cu/Cu(2+)) in the folded batteries provided an open-circuit potential from 0.82 V (one cell) to 5.0 V (eight cells in series) depending on the origami design. The prepared battery can provide a stable current of 500 μA and can light a regular LED for more than 65 min. These paper-based fluidic batteries in a set can also be compiled into a portable power bank to provide electric power for many electric or biomedical applications, such as LED lights and electrophoretic devices, as we report here.

  13. Interfacial bond strength of electrophoretically deposited hydroxyapatite coatings on metals.

    PubMed

    Wei, M; Ruys, A J; Swain, M V; Kim, S H; Milthorpe, B K; Sorrell, C C

    1999-07-01

    Hydroxyapatite (HAp) coatings were deposited onto substrates of metal biomaterials (Ti, Ti6Al4V, and 316L stainless steel) by electrophoretic deposition (EPD). Only ultra-high surface area HAp powder, prepared by the metathesis method 10Ca(NO3)2 + 6(NH4)2HPO4 + 8NH4OH), could produce dense coatings when sintered at 875-1000degreesC. Single EPD coatings cracked during sintering owing to the 15-18% sintering shrinkage, but the HAp did not decompose. The use of dual coatings (coat, sinter, coat, sinter) resolved the cracking problem. Scanning electron microscopy/energy dispersive spectroscopy (SEM/EDS) inspection revealed that the second coating filled in the "valleys" in the cracks of the first coating. The interfacial shear strength of the dual coatings was found, by ASTM F1044-87, to be approximately 12 MPa on a titanium substrate and approximately 22 MPa on 316L stainless steel, comparing quite favorably with the 34 MPa benchmark (the shear strength of bovine cortical bone was found to be 34 MPa). Stainless steel gave the better result since -316L (20.5 microm mK(-1)) > alpha-HAp (approximately 14 microm mK(-1)), resulting in residual compressive stresses in the coating, whereas alpha-titanium (approximately 10.3 microm mK(-1)) < alpha-HAp, resulting in residual tensile stresses in the coating.

  14. Electrophoretic field gradient focusing: an investigation of the experimental parameters.

    PubMed

    Tuñón, Pilar González; Wang, Yating; Myers, Peter; Bartle, Keith D; Bowhill, Larry; Ivory, Cornelius F; Ansell, Richard J

    2008-01-01

    Electrophoretic field gradient focusing has been used to separate the two oxidation states of myoglobin (Mb), and to separate Mb from bromophenol blue (BPB). Polyacrylamide and Sephadex were shown to be suitable packing materials whilst silica led to band broadening with Mb. BPB and Mb could be simultaneously focused apart using either a fixed 21-electrode setup or a dynamic 6-electrode setup. Using a dynamic three-electrode setup either analyte could be focused but not both simultaneously. It was shown that a higher ionic strength buffer in the separation channel compared to the coolant channel enhanced focusing between electrodes due to a conductivity gradient. Different running buffers were investigated and it was found that using a pH 8.6 buffer containing N,N,N-tris(hydroxymethyl)aminomethane (Tris) and phosphate ions the oxidation states of Mb could be separated but the separation of Mb from BPB was not as good as would be hoped for. Using a pH 8.6 buffer containing Tris, N-2-hydroxyethylpiperazine-N'-3-propanesulphonate and chloride ions as running buffer, BPB and Mb could be well separated but the two oxidation states of Mb merged.

  15. Electrophoretic deposition of composite hydroxyapatite-silica-chitosan coatings

    SciTech Connect

    Grandfield, K.; Zhitomirsky, I.

    2008-01-15

    Electrophoretic deposition (EPD) method has been developed for the fabrication of nanocomposite silica-chitosan coatings. Cathodic deposits were obtained on various conductive substrates using suspensions of silica nanoparticles in a mixed ethanol-water solvent, containing dissolved chitosan. Co-deposition of silica and hydroxyapatite (HA) nanoparticles resulted in the fabrication of HA-silica-chitosan coatings. The deposition yield has been studied at a constant voltage mode at various deposition durations. The method enabled the formation of coatings of different thickness in the range of up to 100 {mu}m. Deposit composition, microstructure and porosity can be varied by variation of HA and silica concentration in the suspensions. It was demonstrated that EPD can be used for the fabrication of HA-silica-chitosan coatings of graded composition and laminates. The method enabled the deposition of coatings containing layers of silica-chitosan and HA-chitosan nanocomposites using suspensions with different HA and silica content. Obtained coatings were studied by X-ray diffraction, thermogravimetric and differential thermal analysis, scanning electron microscopy and energy dispersive spectroscopy. The mechanism of deposition is discussed.

  16. [Electrophoretic studies of serum protein fractions in horses with laminitis].

    PubMed

    Edinger, H; Miller, I; Stanek, C; Gemeiner, M

    1992-10-01

    The spectrum of serum proteins was evaluated in 46 horses affected with spontaneous laminitis and correlations between the severity of the disease and changes of the protein pattern were analyzed. The investigation was made in two groups; group A consisted of 21 horses of various breeds (warmblood, thoroughbred, standardbred) and group B of 25 ponys. Each group was subdivided according to the severity of the disease, using the OBEL-grade (OG) classification system. Serum proteins were separated by different one- and two-dimensional electrophoretic methods. Sera analysed by cellulose acetate electrophoresis showed a significant difference in the alpha 1-globulin fraction between OG II and OG IV affected horses. An increasing severity of the disease was correlated with a decrease of the alpha 1-globulins. The other protein fractions didn't show a uniform tendency. In group B there was a significant difference in the alpha 1-globulin fractions of OG II and OG III and in the beta 2-globulin fractions of OG I and OG II affected ponys. The acute phase proteins C3c, C4, Hp and fibronectin could be determined in a preliminary study in horse serum using the cross-reactivity of antibodies against the homologous human proteins.

  17. Fabrication of Electrophoretic Display Driven by Membrane Switch Array

    NASA Astrophysics Data System (ADS)

    Senda, Kazuo; Usui, Hiroaki

    2010-04-01

    Electrophoretic devices (EPDs) and organic light-emitting diodes (OLEDs) have potential application in a large-area flexible displays, such as digital signage. For this purpose, a new backplane is capable of driving a large unit is required instead of thin-film transistors. In this paper we describe the fabrication of a membrane switch array suitable for driving large-scale flat-panel displays. An array of membrane switches was prepared using flexible printed circuit (FPC) technology of polyimide films, by combining low-temperature processes of lamination and copper electroplating methods. An array of 256 matrix switches with a pixel size of 7 mm2 was prepared to drive the EPD front panel. The switches were driven at a voltage of about 40 V and a frequency of 10 Hz. The operation characteristics agreed well with the result of the theoretical calculation. The calculation also suggested that driving voltage can be lowered by increasing pixel size. The contact resistance of the membrane switch was as low as 0.2 Ω, which implies the wide applicability of this device for driving a variety of elements.

  18. The N-terminal Region of Chromodomain Helicase DNA-binding Protein 4 (CHD4) Is Essential for Activity and Contains a High Mobility Group (HMG) Box-like-domain That Can Bind Poly(ADP-ribose)*

    PubMed Central

    Silva, Ana P. G.; Ryan, Daniel P.; Galanty, Yaron; Low, Jason K. K.; Vandevenne, Marylene; Jackson, Stephen P.; Mackay, Joel P.

    2016-01-01

    Chromodomain Helicase DNA-binding protein 4 (CHD4) is a chromatin-remodeling enzyme that has been reported to regulate DNA-damage responses through its N-terminal region in a poly(ADP-ribose) polymerase-dependent manner. We have identified and determined the structure of a stable domain (CHD4-N) in this N-terminal region. The-fold consists of a four-α-helix bundle with structural similarity to the high mobility group box, a domain that is well known as a DNA binding module. We show that the CHD4-N domain binds with higher affinity to poly(ADP-ribose) than to DNA. We also show that the N-terminal region of CHD4, although not CHD4-N alone, is essential for full nucleosome remodeling activity and is important for localizing CHD4 to sites of DNA damage. Overall, these data build on our understanding of how CHD4-NuRD acts to regulate gene expression and participates in the DNA-damage response. PMID:26565020

  19. Improved design of electrophoretic equipment for rapid sickle-cell-anemia screening

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1974-01-01

    Effective mass screening may be accomplished by modifying existing electrophoretic equipment in conjunction with multisample applicator used with cellulose-acetate-matrix test paper. Using this method, approximately 20 to 25 samples can undergo electrophoresis in 5 to 6 minutes.

  20. The role of cell size in density gradient electrophoretic separation of mouse leukemia cells according to position in the cell cycle

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Cultured mouse leukemia cells line L5178Y were subjected to upward electrophoresis in a density gradient and the slower migrating cell populations were enriched in G2 cells. It is indicated that this cell line does not change electrophoretic mobility through the cell cycle. The possibility that increased sedimentation downward on the part of the larger G2 cells caused this separation was explored. Two different cell populations were investigated. The log phase population was found to migrate upward faster than the G2 population, and a similar difference between their velocities and calculated on the basis of a 1 um diameter difference between the two cell populations. The G2 and G1 enriched populations were isolated by Ficoll density gradient sedimentation. The bottom fraction was enriched in G2 cells and the top fraction was enriched with G1 cells, especially when compared with starting materials. The electrophoretic mobilities of these two cell populations did not differ significantly from one another. Cell diameter dependent migration curves were calculated and were found to be different. Families of migration curves that differ when cell size is considered as a parameter are predicted.

  1. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components.

    PubMed

    Gerling, Thomas; Wagenbauer, Klaus F; Neuner, Andrea M; Dietz, Hendrik

    2015-03-27

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components' interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  2. Dynamic DNA devices and assemblies formed by shape-complementary, non-base pairing 3D components

    NASA Astrophysics Data System (ADS)

    Gerling, Thomas; Wagenbauer, Klaus F.; Neuner, Andrea M.; Dietz, Hendrik

    2015-03-01

    We demonstrate that discrete three-dimensional (3D) DNA components can specifically self-assemble in solution on the basis of shape-complementarity and without base pairing. Using this principle, we produced homo- and heteromultimeric objects, including micrometer-scale one- and two-stranded filaments and lattices, as well as reconfigurable devices, including an actuator, a switchable gear, an unfoldable nanobook, and a nanorobot. These multidomain assemblies were stabilized via short-ranged nucleobase stacking bonds that compete against electrostatic repulsion between the components’ interfaces. Using imaging by electron microscopy, ensemble and single-molecule fluorescence resonance energy transfer spectroscopy, and electrophoretic mobility analysis, we show that the balance between attractive and repulsive interactions, and thus the conformation of the assemblies, may be finely controlled by global parameters such as cation concentration or temperature and by an allosteric mechanism based on strand-displacement reactions.

  3. DNA strand breaks are not induced in human cells exposed to 2.1425 GHz band CW and W-CDMA modulated radiofrequency fields allocated to mobile radio base stations.

    PubMed

    Sakuma, N; Komatsubara, Y; Takeda, H; Hirose, H; Sekijima, M; Nojima, T; Miyakoshi, J

    2006-01-01

    We conducted a large-scale in vitro study focused on the effects of low level radiofrequency (RF) fields from mobile radio base stations employing the International Mobile Telecommunication 2000 (IMT-2000) cellular system in order to test the hypothesis that modulated RF fields may act as a DNA damaging agent. First, we evaluated the responses of human cells to microwave exposure at a specific absorption rate (SAR) of 80 mW/kg, which corresponds to the limit of the average whole body SAR for general public exposure defined as a basic restriction in the International Commission on Non-Ionizing Radiation Protection (ICNIRP) guidelines. Second, we investigated whether continuous wave (CW) and Wideband Code Division Multiple Access (W-CDMA) modulated signal RF fields at 2.1425 GHz induced different levels of DNA damage. Human glioblastoma A172 cells and normal human IMR-90 fibroblasts from fetal lungs were exposed to mobile communication frequency radiation to investigate whether such exposure produced DNA strand breaks in cell culture. A172 cells were exposed to W-CDMA radiation at SARs of 80, 250, and 800 mW/kg and CW radiation at 80 mW/kg for 2 and 24 h, while IMR-90 cells were exposed to both W-CDMA and CW radiations at a SAR of 80 mW/kg for the same time periods. Under the same RF field exposure conditions, no significant differences in the DNA strand breaks were observed between the test groups exposed to W-CDMA or CW radiation and the sham exposed negative controls, as evaluated immediately after the exposure periods by alkaline comet assays. Our results confirm that low level exposures do not act as a genotoxicant up to a SAR of 800 mW/kg.

  4. Inhibition of HhaI DNA (Cytosine-C5) methyltransferase by oligodeoxyribonucleotides containing 5-aza-2'-deoxycytidine: examination of the intertwined roles of co-factor, target, transition state structure and enzyme conformation.

    PubMed

    Brank, Adam S; Eritja, Ramon; Garcia, Ramon Guimil; Marquez, Victor E; Christman, Judith K

    2002-10-11

    The presence of 5-azacytosine (ZCyt) residues in DNA leads to potent inhibition of DNA (cytosine-C5) methyltranferases (C5-MTases) in vivo and in vitro. Enzymatic methylation of cytosine in mammalian DNA is an epigenetic modification that can alter gene activity and chromosomal stability, influencing both differentiation and tumorigenesis. Thus, it is important to understand the critical mechanistic determinants of ZCyt's inhibitory action. Although several DNA C5-MTases have been reported to undergo essentially irreversible binding to ZCyt in DNA, there is little agreement as to the role of AdoMet and/or methyl transfer in stabilizing enzyme interactions with ZCyt. Our results demonstrate that formation of stable complexes between HhaI methyltransferase (M.HhaI) and oligodeoxyribonucleotides containing ZCyt at the target position for methylation (ZCyt-ODNs) occurs in both the absence and presence of co-factors, AdoMet and AdoHcy. Both binary and ternary complexes survive SDS-PAGE under reducing conditions and take on a compact conformation that increases their electrophoretic mobility in comparison to free M.HhaI. Since methyl transfer can occur only in the presence of AdoMet, these results suggest (1) that the inhibitory capacity of ZCyt in DNA is based on its ability to induce a stable, tightly closed conformation of M.HhaI that prevents DNA and co-factor release and (2) that methylation of ZCyt in DNA is not required for inhibition of M.HhaI.

  5. A Nanoscale, Liquid-Phase DNA Separation Device Based on Brownian Ratchets

    NASA Astrophysics Data System (ADS)

    Bader, Joel S.

    1998-03-01

    Realizing the goals of the Human Genome Project depends on the ability to perform size-based separations of DNA molecules. DNA analysis has traditionally required inconvenient gel-based electrophoretic separations. We describe a novel, micromachined, non-electrophoretic device suitable for lab-on-a-chip applications. The device is designed to transport DNA using an asymmetric, periodic potential to rectify Brownian motion. The separation occurs in a homogeneous liquid, avoiding the use of gels or other special media. Experimental results from a working prototype NanoNiagara device validate theoretical predictions of its ability to transport DNA molecules based on size.

  6. The conserved lymphokine element-0 in the IL5 promoter binds to a high mobility group-1 protein.

    PubMed

    Marrugo, J; Marsh, D G; Ghosh, B

    1996-10-01

    The conserved lymphokine elements-0 (CLE0) in the IL5 promoter is essential for the expression of IL-5. Here, we report the cloning and expression of a cDNA encoding a novel CLE0-binding protein, CLEBP-1 from a mouse Th2 clone, D10.G4.1. Interestingly, it was found that the CLEBP1 cDNA sequence was almost identical to the sequences of known high mobility group-1 (HMG1) cDNAs. When expressed as a recombinant fusion protein in Escherichia coli, CLEBP-1 was shown to bind to the IL5-CLE0 element in electrophoretic mobility-shift assays (EMSA) and southwestern blot analysis. The CLEBP-1 fusion protein cross-reacts with and-HMG-1/2 in Western blot analysis. It also binds to the CLE0 elements of IL4, GMCSF and GCSF genes. CLEBP-1 and closely related HMG-1 and HMG-2 proteins may play key roles in facilitating the expression of the lymphokine genes that contain CLE0 elements.

  7. Drosophila distal-less negatively regulates dDREF by inhibiting its DNA binding activity.

    PubMed

    Hayashi, Yuko; Kato, Masaki; Seto, Hirokazu; Yamaguchi, Masamitsu

    2006-07-01

    The Drosophila DNA replication-related element binding factor (dDREF) is required for expression of many proliferation-related genes carrying the DRE sequence, 5'-TATCGATA. Over-expression of dDREF in the eye imaginal disc induces ectopic DNA synthesis, apoptosis and inhibition of photoreceptor cell specification, and results in rough eye phenotype in adults. In the present study, half dose reduction of the Distal-less (Dll) gene enhanced the dDREF-induced rough eye phenotype, suggesting that Dll negatively regulates dDREF activity in eye imaginal disc cells. Biochemical analyses revealed the N-terminal (30aa to 124aa) and C-terminal (190aa to 327aa) regions of Dll to interact with the DNA binding domain (16aa to 125aa) of dDREF, although it is not clear yet whether the interaction is direct or indirect. Electrophoretic mobility shift assays showed that Dll thereby inhibits DNA binding. The repression of this dDREF-function by a homeodomain protein like Dll may contribute to the differentiation-coupled repression of cell proliferation during development.

  8. DNA-poly(diallyldimethylammonium chloride) complexation and transfection efficiency.

    PubMed

    Alatorre-Meda, Manuel; Taboada, Pablo; Krajewska, Barbara; Willemeit, Markus; Deml, Alexander; Klösel, Roland; Rodríguez, Julio R

    2010-07-29

    The present work assesses the influence of the cationic charge density (CD) and the cationic valence of poly(diallyldimethylammonium chloride) (pDADMAC) on the DNA compaction and subsequent transfection. Four homopolymers (CD = 1, with different valences) and one copolymer, poly(acrylamide-co-diallyldimethylammonium chloride) (coDADMAC) (CD < 1, equivalent in valence to one of the homopolymers), were studied. The characterization of the DNA-pDADMAC complexes (polyplexes) as a function of the polycation nitrogen to DNA phosphate molar ratios, N/P, was done by means of conductometry, electrophoretic mobility (zeta-potential), dynamic light scattering (DLS), isothermal titration calorimetry (ITC), atomic force microscopy (AFM), and beta-galactosidase (ONPG) and luciferase expression assays at 25 degrees C and physiological pH. In general, all polyplexes rendered compact and stable structures (R(H) approximately 100 nm) with positive surface charges ( approximately 11 mV) but low transfection efficiencies. As revealed by ITC, the DNA-pDADMAC complexation was characterized by a high binding affinity, the process being entropically driven. In particular, two characteristic ratios ((N/P)c and (N/P)*) were detected. Conductometry and ITC data demonstrated that the DNA compaction ratio, (N/P)c, was mainly governed by CD. Meanwhile the ratio from which the polyplex size remained constant, (N/P)*, was found to be valence-dependent as revealed by DLS. On the other hand, the low transfer rate of the polyplexes appeared to be correlated with the high binding affinity observed throughout the complexation process and with a core-shell structure the complexes presumably adopt.

  9. Effect of micelles and mixed micelles on efficiency and selectivity of antibiotic-based capillary electrophoretic enantioseparations

    SciTech Connect

    Rundlett, K.L.; Armstrong, D.W.

    1995-07-01

    Vancomycin (an oligophenolic, glycopeptide, macrocyclic antibiotic) has been shown to be a superb chiral selector for anionic and neutral compounds. It was found that adding sodium dodecyl sulfate to the run buffer increased efficiency by over 1 order of magnitude, decreased analysis times, and reversed the elution order of the enantiomers. This allows for control of the retention order as well as the resolution of enantiomers in complex mixtures in a single run. A mechanism is proposed which explains all of the observed effects and is verified experimentally. Since vancomycin is present in both the micelle and in free solution, previously proposed micelle-selector models are, at best, limiting cases. A general equation is derived which can be used to describe all possible interactions, including those with the capillary wall, if needed. Also, it is shown that electrophoretic mobilities and not migration times must be used to calculate binding constants of a solute to the micelle, the chiral selector, or both. Furthermore, it is shown that a neutral marker molecule cannot be used to accurately correct mobilities that have been altered due to changes in solution viscosity. While this work utilizes the practical vancomycin-micelle system, the general conclusions and theory apply to most other analogous CE systems as well. 48 refs., 4 figs., 5 tabs.

  10. The novel p.E89K mutation in the SRY gene inhibits DNA binding and causes the 46,XY disorder of sex development.

    PubMed

    Cunha, J L; Soardi, F C; Bernardi, R D; Oliveira, L E C; Benedetti, C E; Guerra-Junior, G; Maciel-Guerra, A T; de Mello, M P

    2011-04-01

    Male sex determination in humans is controlled by the SRY gene, which encodes a transcriptional regulator containing a conserved high mobility group box domain (HMG-box) required for DNA binding. Mutations in the SRY HMG-box affect protein function, causing sex reversal phenotypes. In the present study, we describe a 19-year-old female presenting 46,XY karyotype with hypogonadism and primary amenorrhea that led to the diagnosis of 46,XY complete gonadal dysgenesis. The novel p.E89K missense mutation in the SRY HMG-box was identified as a de novo mutation. Electrophoretic mobility shift assays showed that p.E89K almost completely abolished SRY DNA-binding activity, suggesting that it is the cause of SRY function impairment. In addition, we report the occurrence of the p.G95R mutation in a 46,XY female with complete gonadal dysgenesis. According to the three-dimensional structure of the human SRY HMG-box, the substitution of the conserved glutamic acid residue by the basic lysine at position 89 introduces an extra positive charge adjacent to and between the positively charged residues R86 and K92, important for stabilizing the HMG-box helix 2 with DNA. Thus, we propose that an electrostatic repulsion caused by the proximity of these positive charges could destabilize the tip of helix 2, abrogating DNA interaction.

  11. Capillary electrophoretic enantioselective determination of zopiclone and its impurities.

    PubMed

    Tonon, Milena Araújo; Bonato, Pierina Sueli

    2012-06-01

    A capillary electrophoretic enantioselective method with UV detection was developed and validated for the simultaneous quantification of zopiclone enantiomers and its impurities, zopiclone-N-oxide enantiomers, and 2-amino-5-chloropyridine, in tablets. The analytes were extracted from the tablets using ACN and were separated in an uncoated fused-silica capillary (50 μm, 42 cm effective length, 50 cm total length) using 80 mM sodium phosphate buffer pH 2.5 and 5 mM carboxymethyl-β-cyclodextrin as running buffer. The analytes and the internal standard (trimethoprim) were detected at 305 and 200 nm, respectively. A voltage of 27 kV was applied and the capillary temperature was maintained at 25°C. All enantiomers were analyzed within 8 min and linear calibration curves over the concentration range of 0.4-0.8 mg mL⁻¹ for each zopiclone enantiomer, 0.8-1.6 μg mL⁻¹ for 2-amino-5-chloropyridine and 0.4-0.8 μg mL⁻¹ for each zopiclone-N-oxide enantiomer were obtained. The coefficients of correlation obtained for the linear curves were greater than 0.99. The intra-day and inter-day accuracy and precision were lower than 2% for all analytes. This validated method was employed to study the degradation and racemization of zopiclone under stress conditions. This application demonstrated the importance of a stability-indicating assay method for this drug.

  12. Optimization of a microfluidic electrophoretic immunoassay using a Peltier cooler.

    PubMed

    Mukhitov, Nikita; Yi, Lian; Schrell, Adrian M; Roper, Michael G

    2014-11-07

    Successful analysis of electrophoretic affinity assays depends strongly on the preservation of the affinity complex during separations. Elevated separation temperatures due to Joule heating promotes complex dissociation leading to a reduction in sensitivity. Affinity assays performed in glass microfluidic devices may be especially prone to this problem due to poor heat dissipation due to the low thermal conductivity of glass and the large amount of bulk material surrounding separation channels. To address this limitation, a method to cool a glass microfluidic chip for performing an affinity assay for insulin was achieved by a Peltier cooler localized over the separation channel. The Peltier cooler allowed for rapid stabilization of temperatures, with 21°C the lowest temperature that was possible to use without producing detrimental thermal gradients throughout the device. The introduction of cooling improved the preservation of the affinity complex, with even passive cooling of the separation channel improving the amount of complex observed by 2-fold. Additionally, the capability to thermostabilize the separation channel allowed for utilization of higher separation voltages than what was possible without temperature control. Kinetic CE analysis was utilized as a diagnostic of the affinity assay and indicated that optimal conditions were at the highest separation voltage, 6 kV, and the lowest separation temperature, 21°C, leading to 3.4% dissociation of the complex peak during the separation. These optimum conditions were used to generate a calibration curve and produced 1 nM limits of detection, representing a 10-fold improvement over non-thermostated conditions. This methodology of cooling glass microfluidic devices for performing robust and high sensitivity affinity assays on microfluidic systems should be amenable in a number of applications.

  13. Optimization of A Microfluidic Electrophoretic Immunoassay Using a Peltier Cooler

    PubMed Central

    Mukhitov, Nikita; Yi, Lian; Schrell, Adrian M.; Roper, Michael G.

    2014-01-01

    Successful analysis of electrophoretic affinity assays depends strongly on the preservation of the affinity complex during separations. Elevated separation temperatures due to Joule heating promotes complex dissociation leading to a reduction in sensitivity. Affinity assays performed in glass microfluidic devices may be especially prone to this problem due to poor heat dissipation due to the low thermal conductivity of glass and the large amount of bulk material surrounding separation channels. To address this limitation, a method to cool a glass microfluidic chip for performing an affinity assay for insulin was achieved by a Peltier cooler localized over the separation channel. The Peltier cooler allowed for rapid stabilization of temperatures, with 21 °C the lowest temperature that was possible to use without producing detrimental thermal gradients throughout the device. The introduction of cooling improved the preservation of the affinity complex, with even passive cooling of the separation channel improving the amount of complex observed by 2-fold. Additionally, the capability to thermostabilize the separation channel allowed for utilization of higher separation voltages than what was possible without temperature control. Kinetic CE analysis was utilized as a diagnostic of the affinity assay and indicated that optimal conditions were at the highest separation voltage, 6 kV, and the lowest separation temperature, 21 °C, leading to 3.4% dissociation of the complex peak during the separation. These optimum conditions were used to generate a calibration curve and produced 1 nM limits of detection, representing a 10-fold improvement over non-thermostated conditions. This methodology of cooling glass microfluidic devices for performing robust and high sensitivity affinity assays on microfluidic systems should be amenable in a number of applications. PMID:25263064

  14. Kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants with ssDNA

    SciTech Connect

    Priyadarshini, C.G. Poornima; Savithri, H.S.

    2009-04-10

    Gemini viral assembly and transport of viral DNA into nucleus for replication, essentially involve DNA-coat protein interactions. The kinetics of interaction of Cotton Leaf Curl Kokhran Virus-Dabawali recombinant coat protein (rCP) with DNA was studied by electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR). The rCP interacted with ssDNA with a K{sub A}, of 2.6 +- 0.29 x 10{sup 8} M{sup -1} in a sequence non-specific manner. The CP has a conserved C2H2 type zinc finger motif composed of residues C68, C72, H81 and H85. Mutation of these residues to alanine resulted in reduced binding to DNA probes. The H85A mutant rCP showed the least binding with approximately 756 fold loss in the association rate and a three order magnitude decrease in the binding affinity as compared to rCP. The CP-DNA interactions via the zinc finger motif could play a crucial role in virus assembly and in nuclear transport.

  15. Impact of molecular weight and degree of conjugation on the thermodynamics of DNA complexation and stability of polyethylenimine-graft-poly(ethylene glycol) copolymers.

    PubMed

    Smith, Ryan J; Beck, Rachel W; Prevette, Lisa E

    2015-01-01

    Poly(ethylene glycol) (PEG) is often conjugated to polyethylenimine (PEI) to provide colloidal stability to PEI-DNA polyplexes and shield charge leading to toxicity. Here, a library of nine cationic copolymers was synthesized by grafting three molecular weights (750, 2000, 5000Da) of PEG to linear PEI at three conjugation ratios. Using isothermal titration calorimetry, we have quantified the thermodynamics of the associations between the copolymers and DNA and determined the extent to which binding is hindered as a function of PEG molecular weight and conjugation ratio. Low conjugation ratios of 750Da PEG to PEI resulted in little decrease in DNA affinity, but a significant decrease-up to two orders of magnitude-was found for the other copolymers. We identified limitations in determination of affinity using indirect assays (electrophoretic mobility shift and ethidium bromide exclusion) commonly used in the field. Dynamic light scattering of the DNA complexes at physiological ionic strength showed that PEI modifications that did not reduce DNA affinity also did not confer significant colloidal stability, a finding that was supported by calorimetric data on the aggregation process. These results quantify the DNA interaction thermodynamics of PEGylated polycations for the first time and indicate that there is an optimum PEG chain length and degree of substitution in the design of agents that have desirable properties for effective in vivo gene delivery.

  16. [Expression and purification of FOXO1 DNA binding domain and its DNA properties].

    PubMed

    Ha, Yinuer; Li, Jun; Chen, Yongheng; Chen, Lin; Chen, Zhuchu

    2017-01-28

    目的:探讨翼螺旋转录因子FOXO1的DNA结合域(FOXO1 DNA binding domain,FOXO1-DBD)的表达、纯化及与DNA的结合特性。方法:采用优化FOXO1-DNA的基因序列和低温诱导的方式实现FOXO1-DBD蛋白的可溶性表达,通过镍亲和层析及阳离子交换层析进行纯化,并经凝胶迁移实验(electrophoretic mobility shift assay,EMSA)验证FOXO1-DBD的DNA结合特性。结果:优化后的FOXO1基因在21 ℃时编码的蛋白大多以可溶性方式表达,通过两步纯化即可获得95%以上纯度的FOXO1-DBD蛋白,纯化的蛋白与含FOX家族DNA结合基序(G/ATAAACA)的DNA序列显示良好的结合特性。结论:建立了FOXO1-DBD蛋白高效表达、纯化的方法,验证了FOXO1蛋白在识别DNA上的复杂性。.

  17. Electrokinetic Stretching of Tethered DNA

    PubMed Central

    Ferree, Sean; Blanch, Harvey W.

    2003-01-01

    During electrophoretic separations of DNA in a sieving medium, DNA molecules stretch from a compact coil into elongated conformations when encountering an obstacle and relax back to a coil upon release from the obstacle. These stretching dynamics are thought to play an important role in the separation mechanism. In this article we describe a silicon microfabricated device to measure the stretching of tethered DNA in electric fields. Upon application of an electric field, electro-osmosis generates bulk fluid flow in the device, and a protocol for eliminating this flow by attaching a polymer brush to all silicon oxide surfaces is shown to be effective. Data on the steady stretching of DNA in constant electric fields is presented. The data corroborate the approximate theory of hydrodynamic equivalence, indicating that DNA is not free-draining in the presence of both electric and nonelectric forces. Finally, these data provide the first quantitative test of a Stigter and Bustamante's detailed theory of electrophoretic stretching of DNA without adjustable parameters. The agreement between theory and experiment is good. PMID:14507716

  18. Extracting DNA from submerged pine wood.

    PubMed

    Reynolds, M Megan; Williams, Claire G

    2004-10-01

    A DNA extraction protocol for submerged pine logs was developed with the following properties: (i) high molecular weight DNA, (ii) PCR amplification of chloroplast and nuclear sequences, and (iii) high sequence homology to voucher pine specimens. The DNA extraction protocol was modified from a cetyltrimehtylammonium bromide (CTAB) protocol by adding stringent electrophoretic purification, proteinase K, RNAse, polyvinyl pyrrolidone (PVP), and Gene Releaser. Chloroplast rbcL (ribulose-1,5-bisphosphate carboxylase) could be amplified. Nuclear ribosomal sequences had >95% homology to Pinus taeda and Pinus palustris. Microsatellite polymorphism for PtTX2082 matched 2 of 14 known P. taeda alleles. Our results show DNA analysis for submerged conifer wood is feasible.

  19. Mechanism of the electrophoretic assembly of cadmium selenide nanocrystal films and their mechanical properties

    NASA Astrophysics Data System (ADS)

    Jia, Shengguo

    This thesis consists of two closely related experimental studies of electrophoretically deposited CdSe nanocrystal films. In the first part of this thesis, the charging of CdSe nanocrystal in non-aqueous solvent and the mechanism of electrophoretic deposition (EPD) are discussed from the point of view of the influence of the nanocrystal surface. Our experiments show that the charge of these nanocrystals originates from the surface defects of the nanocrystal. EPD leads to equally thick films of CdSe nanocrystals on both positive and negative electrodes due to the deposition of equal numbers of negatively and positively charged nanocrystals, even though their concentrations are not equal in solution. The deposition stops when the charged nanocrystals with lower concentration are depleted. The second part of this thesis focuses on the mechanical and optical properties of these electrophoretically deposited CdSe nanocrystal films. Approaches to measure and analyze the mechanical parameters and fracture properties of electrophoretically deposited CdSe nanocrystal films are described in this part. The values of the elastic modulus of electrophoretically deposited CdSe nanocrystal films composed of 3.2 nm diameter nanocrystals measured by Raman microprobe scattering (˜9.7 GPa) and nanoindentation (˜10 GPa) match each other. The mechanical response of nanocrystal films suggests polymeric features that are attributable to the organic ligand on the nanocrystal cores. After nanocrystal cross-linking and partial ligand removal, the nanocrystal films exhibit more features of granularity. The fracture, strain, and stress of electrophoretically deposited CdSe nanocrystal films are studied as a function of the film thickness, nanocrystal size, and drying method. In addition to Raman microprobe scattering, optical methods such as photoluminescence, high-spatial resolution infrared spectroscopy, and ellipsometry are used to investigate the properties of these electrophoretically

  20. Mobile Learning Using Mobile Phones

    ERIC Educational Resources Information Center

    Vicente, Paula

    2013-01-01

    The participation in mobile learning programs is conditioned by having/using mobile communication technology. Those who do not have or use such technology cannot participate in mobile learning programs. This study evaluates who are the most likely participants of mobile learning programs by examining the demographic profile and mobile phone usage…

  1. The T4 phage DNA mimic protein Arn inhibits the DNA binding activity of the bacterial histone-like protein H-NS.

    PubMed

    Ho, Chun-Han; Wang, Hao-Ching; Ko, Tzu-Ping; Chang, Yuan-Chih; Wang, Andrew H-J

    2014-09-26

    The T4 phage protein Arn (Anti restriction nuclease) was identified as an inhibitor of the restriction enzyme McrBC. However, until now its molecular mechanism remained unclear. In the present study we used structural approaches to investigate biological properties of Arn. A structural analysis of Arn revealed that its shape and negative charge distribution are similar to dsDNA, suggesting that this protein could act as a DNA mimic. In a subsequent proteomic analysis, we found that the bacterial histone-like protein H-NS interacts with Arn, implying a new function. An electrophoretic mobility shift assay showed that Arn prevents H-NS from binding to the Escherichia coli hns and T4 p8.1 promoters. In vitro gene expression and electron microscopy analyses also indicated that Arn counteracts the gene-silencing effect of H-NS on a reporter gene. Because McrBC and H-NS both participate in the host defense system, our findings suggest that T4 Arn might knock down these mechanisms using its DNA mimicking properties.

  2. Role of pH controlled DNA secondary structures in the reversible dispersion/precipitation and separation of metallic and semiconducting single-walled carbon nanotubes.

    PubMed

    Maji, Basudeb; Samanta, Suman K; Bhattacharya, Santanu

    2014-04-07

    Single-stranded DNA (ss-DNA) oligomers (dA20, d[(C3TA2)3C3] or dT20) are able to disperse single-walled carbon nanotubes (SWNTs) in water at pH 7 through non-covalent wrapping on the nanotube surface. At lower pH, an alteration of the DNA secondary structure leads to precipitation of the SWNTs from the dispersion. The structural change of dA20 takes place from the single-stranded to the A-motif form at pH 3.5 while in case of d[(C3TA2)3C3] the change occurs from the single-stranded to the i-motif form at pH 5. Due to this structural change, the DNA is no longer able to bind the nanotube and hence the SWNT precipitates from its well-dispersed state. However, this could be reversed on restoring the pH to 7, where the DNA again relaxes in the single-stranded form. In this way the dispersion and precipitation process could be repeated over and over again. Variable temperature UV-Vis-NIR and CD spectroscopy studies showed that the DNA-SWNT complexes were thermally stable even at ∼90 °C at pH 7. Broadband NIR laser (1064 nm) irradiation also demonstrated the stability of the DNA-SWNT complex against local heating introduced through excitation of the carbon nanotubes. Electrophoretic mobility shift assay confirmed the formation of a stable DNA-SWNT complex at pH 7 and also the generation of DNA secondary structures (A/i-motif) upon acidification. The interactions of ss-DNA with SWNTs cause debundling of the nanotubes from its assembly. Selective affinity of the semiconducting SWNTs towards DNA than the metallic ones enables separation of the two as evident from spectroscopic as well as electrical conductivity studies.

  3. Structure, antimicrobial activity, DNA- and albumin-binding of manganese(II) complexes with the quinolone antimicrobial agents oxolinic acid and enrofloxacin.

    PubMed

    Zampakou, Marianthi; Akrivou, Melpomeni; Andreadou, Eleni G; Raptopoulou, Catherine P; Psycharis, Vassilis; Pantazaki, Anastasia A; Psomas, George

    2013-04-01

    The reaction of MnCl2 with the quinolone antibacterial drug oxolinic acid (Hoxo) results to the formation of [KMn(oxo)3(MeOH)3]. Interaction of MnCl2 with the quinolone Hoxo or enrofloxacin (Herx) and the N,N'-donor heterocyclic ligand 1,10-phenanthroline (phen) results in the formation of metal complexes with the general formula [Mn(quinolonato)2(phen)]. The crystal structures of [KMn(oxo)3(MeOH)3] and [Mn(erx)2(phen)], exhibiting a 1D polymeric and a mononuclear structure, respectively, have been determined by X-ray crystallography. In these complexes, the deprotonated bidentate quinolonato ligands are coordinated to manganese(II) ion through the pyridone oxygen and a carboxylato oxygen. All complexes can act as potential antibacterial agents with [Mn(erx)2(phen)] exhibiting the most pronounced antimicrobial activity against five different microorganisms. Interaction of the complexes with calf-thymus DNA (CT DNA), studied by UV spectroscopy, has shown that they bind to CT DNA. Competitive study with ethidium bromide (EB) has shown that all complexes can displace the DNA-bound EB indicating their binding to DNA in strong competition with EB. Intercalative binding mode is proposed for the interaction of the complexes with CT DNA and has also been verified by DNA solution viscosity measurements and cyclic voltammetry. DNA electrophoretic mobility experiments suggest that [Mn(erx)2(phen)] binds strongly to supercoiled pDNA and to linearized pDNA possibly by an intercalative manner provoking double-stranded cleavage reflecting in a nuclease-like activity. The complexes exhibit good binding propensity to human or bovine serum albumin protein showing relatively high binding constant values. The binding constants of the complexes towards CT DNA and albumins have been compared to their corresponding zinc(II) and nickel(II) complexes.

  4. DNA Binding and Condensation Properties of the Herpes Simplex Virus Type 1 Triplex Protein VP19C

    PubMed Central

    Bera, Alakesh; Perkins, Edward M.; Zhu, Jian; Zhu, Heng; Desai, Prashant

    2014-01-01

    Herpesvirus capsids are regular icosahedrons with a diameter of a 125 nm and are made up of 162 capsomeres arranged on a T = 16 lattice. The capsomeres (VP5) interact with the triplex structure, which is a unique structural feature of herpesvirus capsid shells. The triplex is a heterotrimeric complex; one molecule of VP19C and two of VP23 form a three-pronged structure that acts to stabilize the capsid shell through interactions with adjacent capsomeres. VP19C interacts with VP23 and with the major capsid protein VP5 and is required for the nuclear localization of VP23. Mutation of VP19C results in the abrogation of capsid shell synthesis. Analysis of the sequence of VP19C showed the N-terminus of VP19C is very basic and glycine rich. It was hypothesized that this domain could potentially bind to DNA. In this study an electrophoretic mobility shift assay (EMSA) and a DNA condensation assay were performed to demonstrate that VP19C can bind DNA. Purified VP19C was able to bind to both a DNA fragment of HSV-1 origin as well as a bacterial plasmid sequence indicating that this activity is non-specific. Ultra-structural imaging of the nucleo-protein complexes revealed that VP19C condensed the DNA and forms toroidal DNA structures. Both the DNA binding and condensing properties of VP19C were mapped to the N-terminal 72 amino acids of the protein. Mutational studies revealed that the positively charged arginine residues in this N-terminal domain are required for this binding. This DNA binding activity, which resides in a non-conserved region of the protein could be required for stabilization of HSV-1 DNA association in the capsid shell. PMID:25121591

  5. Integrated affinity capture, purification, and capillary electrophoresis microdevice for quantitative double-stranded DNA analysis.

    PubMed

    Toriello, Nicholas M; Liu, Chung N; Blazej, Robert G; Thaitrong, Numrin; Mathies, Richard A

    2007-11-15

    A novel injection method is developed that utilizes a thermally switchable oligonucleotide affinity capture gel to mediate the concentration, purification, and injection of dsDNA for quantitative microchip capillary electrophoresis analysis. The affinity capture matrix consists of a 20 base acrydite modified oligonucleotide copolymerized into a 6% linear polyacrylamide gel that captures ssDNA or dsDNA analyte including PCR amplicons and synthetic oligonucleotides. Double stranded PCR amplicons with complementarity to the capture probe up to 81 bases from their 5' terminus are reproducibly captured via helix invasion. By integrating the oligo capture matrix directly with the CE separation channel, the electrophoretically mobilized target fragments are quantitatively captured and injected after thermal release for unbiased, efficient, and quantitative analysis. The capture process exhibits optimal efficiency at 44 degrees C and 100 V/cm with a 20 microM affinity capture probe (TM = 57.7 degrees C). A dsDNA titration assay with 20 bp fragments validated that dsDNA is captured at the same efficiency as ssDNA. Dilution studies with a duplex 20mer show that targets can be successfully captured and analyzed with a limit of detection of 1 pM from 250 nL of solution (approximately 150,000 fluorescent molecules). Simultaneous capture and injection of amplicons from E. coli K12 and M13mp18 using a mixture of two different capture probes demonstrates the feasibility of multiplex target capture. Unlike the traditional cross-injector, this method enables efficient capture and injection of dsDNA amplicons which will facilitate the quantitative analysis of products from integrated nanoliter-scale PCR reactors.

  6. Functionalizing Designer DNA Crystals

    NASA Astrophysics Data System (ADS)

    Chandrasekaran, Arun Richard

    nucleotides is usually pH dependent (pH < 6) four different TFOs were examined: TFO-1 was unmodified while TFOs 2-4 contained additional stabilizing analogues capable of extending triplex formation to pH 7. In addition, each of the TFOs contained a Cy5 dye at the 5'-end of the oligonucleotide to aid in characterization of TFO binding - crystals were obtained with all four variations of TFOs. Formation of DNA triplex in the motif was characterized by an electrophoretic mobility shift assay (EMSA), UV melting studies and FRET. Crystals containing TFO-1 (unmodified) and TFO-2 (with 2'-amino ethoxy modification) were isolated and flash-frozen in liquid nitrogen for X-ray data collection at beam line NSLS-X25. X-ray data was also collected for crystals of the 3-turn triangle without any TFO bound to it. Difference maps were done between the crystals with TFO against the one without to identify any additional electron density corresponding to the third strand in the triplex binding region. The data from the crystal containing TFO-2 was used to further analyze if the additional density can match the expected position of the TFO on the triangle motif. Since the additional density did not correspond to the entire binding region, 2Fo-Fc, 3Fo-2Fc and 4Fo-3Fc maps were done to check for missing pieces of the electron density. From the resulting 2Fo-Fc map, the asymmetric unit from the 3-turn triangle (31-bp duplex model based on previous structure 3UBI) was inserted into the density as a reference. However, the electron density corresponding to the TFO was still not continuous throughout the 13-nt triplex binding region and allowed only a partial fit of the TFO. The third nucleotide in positions 1, 3, 4, 6, 7 were fit into the density in the major groove of the underlying duplex with proper triplex configuration. The third chapter describes the triplex approach to position a functional group (the UV cross-linking agent psoralen) within a pre-formed DNA motif. Triplex formation and

  7. Theory of DNA electrophoresis in physical gels and entangled polymer solutions

    NASA Astrophysics Data System (ADS)

    Duke, Thomas; Viovy, Jean Louis

    1994-03-01

    A scaling theory is presented for the electrophoretic mobility of DNA in sieving media that form dynamically evolving meshworks, such as physical gels and solutions of entangled polymers. In such media, the topological constraints on the DNA's motion are perpetually changing as cross links break and rejoin or as the polymers diffuse. It is shown that if the rate of constraint release falls within a certain range (which depends on the field strength), fractionation can be extended to higher molecular weights than would be feasible using a permanent gel of equivalent pore size. This improvement is a consequence of the disruptive effect that constraint release has on the mechanism of molecular orientation. Numerical simulations support the predictions of the theory. The possibility of realizing such a system in practice, with the aim of improving on current electrophoresis methods, is commented upon. It is suggested that semidilute polymer solutions may be a versatile medium for the rapid separation of long single-stranded DNA molecules, and the particular quality of solution required is identified.

  8. PCR/SSCP detects reliably and efficiently DNA sequence variations in large scale screening projects.

    PubMed

    Miterski, B; Krüger, R; Wintermeyer, P; Epplen, J T

    2000-06-01

    A simple and fast method with high reliability is necessary for the identification of mutations, polymorphisms and sequence variants (MPSV) within many genes and many samples, e.g. for clarifying the genetic background of individuals with multifactorial diseases. Here we review our experience with the polymerase chain reaction/single-strand conformation polymorphism (PCR/SSCP) analysis to identify MPSV in a number of genes thought to be involved in the pathogenesis of multifactorial neurological disorders, including autoimmune diseases like multiple sclerosis (MS) and neurodegenerative disorders like Parkinson s disease (PD). The method is based on the property of the DNA that the electrophoretic mobility of single stranded nucleic acids depends not only on their size but also on their sequence. The target sequences were amplified, digested into fragments ranging from 50-240 base pairs (bp), heat-denatured and analysed on native polyacrylamide (PAA) gels of different composition. The analysis of a great number of different PCR products demonstrates that the detection rate of MPSV depends on the fragment lengths, the temperature during electrophoresis and the composition of the gel. In general, the detection of MPSV is neither influenced by their location within the DNA fragment nor by the type of substitution, i.e., transitions or transversions. The standard PCR/SSCP system described here provides high reliability and detection rates. It allows the efficient analysis of a large number of DNA samples and many different genes.

  9. Electrical characterization of electrophoretically coated aluminum samples for photovoltaic concentrator application

    SciTech Connect

    Sugimura, R.S.; Mon, G.R.; Ross, R.G. Jr.

    1992-10-01

    The practicality of using a thin-film styrene/acrylate copolymer electrophoretic coating to isolate concentrator cells electrically from their surroundings in a photovoltaic concentrator module is assessed. Only the electrical isolation problem was investigated. The approach was to subject various types of EP-coated aluminum specimens to electrical stress testing and to aging tests while monitoring coating electrical resistivity properties. It was determined that, in general, longer processing times--i.e., thicker electrophoretic layers--resulted in better voltage-withstand properties. In particular, a two-minute processing time seemed sufficient to provide the electrical isolation required in photovoltaic concentrator application applications. Even though electrophoretic coatings did not seem to fill voids in porous-anodized aluminum substrates, breakdown voltages generally exceeded hi-pot pass-fail voltage levels with a comfortable margin. 6 refs, 11 figs, 5 tabs.

  10. Electrophoretic separation techniques and their hyphenation to mass spectrometry in biological inorganic chemistry.

    PubMed

    Holtkamp, Hannah; Grabmann, Gerlinde; Hartinger, Christian G

    2016-04-01

    Electrophoretic methods have been widely applied in research on the roles of metal complexes in biological systems. In particular, CE, often hyphenated to a sensitive MS detector, has provided valuable information on the modes of action of metal-based pharmaceuticals, and more recently new methods have been added to the electrophoretic toolbox. The range of applications continues to expand as a result of enhanced CE-to-MS interfacing, with sensitivity often at picomolar level, and evolved separation modes allowing for innovative sample analysis. This article is a followup to previous reviews about CE methods in metallodrug research (Electrophoresis, 2003, 24, 2023-2037; Electrophoresis, 2007, 28, 3436-3446; Electrophoresis, 2012, 33, 622-634), also providing a comprehensive overview of metal species studied by electrophoretic methods hyphenated to MS. It highlights the latest CE developments, takes a sneak peek into gel electrophoresis, traces biomolecule labeling, and focuses on the importance of early-stage drug development.

  11. Mechanism for attenuation of DNA binding by MarR family transcriptional regulators by small molecule ligands.

    PubMed

    Perera, Inoka C; Lee, Yong-Hwan; Wilkinson, Steven P; Grove, Anne

    2009-07-31

    Members of the multiple antibiotic resistance regulator (MarR) family control gene expression in a variety of metabolic processes in bacteria and archaea. Hypothetical uricase regulator (HucR), which belongs to the ligand-responsive branch of the MarR family, regulates uricase expression in Deinococcus radiodurans by binding a shared promoter region between uricase and HucR genes. We show here that HucR responds only to urate and, to a lesser extent, to xanthine by attenuated DNA binding, compared to other intermediates of purine degradation. Using molecular-dynamics-guided mutational analysis, we identified the ligand-binding site in HucR. Electrophoretic mobility shift assays and intrinsic Trp fluorescence have identified W20 from the N-terminal helix and R80 from helix 3, which serves as a scaffold for the DNA recognition helix, as being essential for ligand binding. Using structural data combined with in silico and in vitro analyses, we propose a mechanism for the attenuation of DNA binding in which a conformational change initiated by charge repulsion due to a bound ligand propagates to DNA recognition helices. This mechanism may apply generally to MarR homologs that bind anionic phenolic ligands.

  12. Single Molecule Screening of Disease DNA Without Amplification

    SciTech Connect

    Lee, Ji-Young

    2006-01-01

    The potential of single molecule detection as an analysis tool in biological and medical fields is well recognized today. This fast evolving technique will provide fundamental sensitivity to pick up individual pathogen molecules, and therefore contribute to a more accurate diagnosis and a better chance for a complete cure. Many studies are being carried out to successfully apply this technique in real screening fields. In this dissertation, several attempts are shown that have been made to test and refine the application of the single molecule technique as a clinical screening method. A basic applicability was tested with a 100% target content sample, using electrophoretic mobility and multiple colors as identification tools. Both electrophoretic and spectral information of individual molecule were collected within a second, while the molecule travels along the flow in a capillary. Insertion of a transmission grating made the recording of the whole spectrum of a dye-stained molecule possible without adding complicated instrumental components. Collecting two kinds of information simultaneously and combining them allowed more thorough identification, up to 98.8% accuracy. Probing mRNA molecules with fluorescently labeled cDNA via hybridization was also carried out. The spectral differences among target, probe, and hybrid were interpreted in terms of dispersion distances after transmission grating, and used for the identification of each molecule. The probes were designed to have the least background when they are free, but have strong fluorescence after hybridization via fluorescence resonance energy transfer. The mRNA-cDNA hybrids were further imaged in whole blood, plasma, and saliva, to test how far a crude preparation can be tolerated. Imaging was possible with up to 50% of clear bio-matrix contents, suggesting a simple lysis and dilution would be sufficient for imaging for some cells. Real pathogen DNA of human papillomavirus (HPV) type-I6 in human genomic DNA

  13. Cloning the genes and DNA binding properties of High Mobility Group B1 (HMGB1) proteins from the human blood flukes Schistosoma mansoni and Schistosoma japonicum.

    PubMed

    de Oliveira, Francisco Meirelles Bastos; de Abreu da Silva, Isabel Caetano; Rumjanek, Franklin David; Dias-Neto, Emmanuel; Guimarães, Pedro Edson Moreira; Verjovski-Almeida, Sergio; Stros, Michal; Fantappié, Marcelo Rosado

    2006-08-01

    The parasitic helminth Schistosoma mansoni contains three HMGB proteins, HMGB1, HMGB2 and HMGB3, of primary amino acid sequences highly similar to vertebrate proteins. In this report we describe the characterization of the HMGB1 proteins and their genes from S. mansoni and Schistosoma japonicum. The deduced amino acid sequences of HMGB1 proteins from both schistosome species are identical, and comprise 176 residues. The proteins contain the two evolutionarily highly conserved HMG-box domains, A and B, exhibiting 60% similarity to mammalian HMGB1. Unlike the human HMGB1 which contains an unbroken run of 30 glutamic or aspartic residues, the SmHMGB1 or SjHMGB1 proteins possess unusually short acidic C-terminal tails (5 acidic residues interrupted by 2 serines). Southern hybridization and DNA sequencing revealed a single copy HMGB1 gene, composed of 3 exons and two introns, in S. mansoni. The exon/intron boundaries are identical to those of the human HMGB1 gene, with the exception that the second exon of the SmHMGB1 gene which is not split into two exons as in the human HMGB1 gene. RNA blot analysis revealed that the SmHMGB1 gene is constitutively expressed in similar levels both in male and female worms. The single-sized mRNA for SmHMGB1 is consistent with the size derived from the cDNA. Although DNA binding properties of SmHMGB1 (or SjHMGB1) protein seem to be similar to those previously reported with human HMGB1, i.e., preferential binding to supercoiled DNA over linear DNA, specific recognition of DNA four-way junctions, DNA-induced supercoiling in the presence of topoisomerase I, and DNA bending, we have observed two important differences relative to those observed with the human HMGB1: (i) the inability of the isolated SmHMGB1 domain A to bend DNA (as revealed by T4 ligase-mediated circularization assay), and (ii) higher DNA supercoiling and bending potential of the SmHMGB1 protein as compared to its human counterpart. The latter finding may indicate that the

  14. Electrophoretic deposition onto an insulator for thin film preparation toward electronic device fabrication

    NASA Astrophysics Data System (ADS)

    Miyajima, Shougo; Nagamatsu, Shuichi; Pandey, Shyam S.; Hayase, Shuzi; Kaneto, Keiichi; Takashima, Wataru

    2012-11-01

    An electrostatic film fabrication method utilizing the dielectric layer, entitled dielectric barrier electrophoretic deposition (DBEPD) has been proposed. We demonstrated the fabrication of uniform organic semiconductor thin film onto any kind of substrate by DBEPD. Optical absorption spectra of colloidal poly(3-hexylthiophene) (P3HT) film prepared by DBEPD exhibited the clear vibrational structure attributed to highly ordered domains. It was in contrast to the relatively disordered structure as shown in the case of P3HT film prepared by conventional electrophoretic deposition (EPD). Organic field effect transistors fabricated by each method showed similar organic field effect transistor characteristics, however, the uniformity of DBEPD film was superior to EPD film.

  15. Electrophoretic deposition of hyaluronic acid and composite films for biomedical applications

    NASA Astrophysics Data System (ADS)

    Ma, R.; Li, Y.; Zhitomirsky, I.

    2010-06-01

    Hyaluronic acid (HYH) is a natural biopolymer, which has tremendous potential for various biomedical applications. Electrophoretic deposition (EPD) methods have been developed for the fabrication of HYH films and composites. New methods for the immobilization of drugs and proteins have been utilized for the fabrication of organic composites. Electrophoretic deposition enabled the fabrication of organic-inorganic composites containing bioceramics and bioglass in the HYH matrix. It was shown that the deposition yield, microstructure, and composition of the films can be controlled. Potential applications of EPD for the surface modification of biomedical implants and fabrication of biosensors are highlighted.

  16. Polyacrylamide gel electrophoretic methods in the separation of structural muscle proteins.

    SciTech Connect

    Barany, K.; Barany, M.; Giometti, C. S.; Center for Mechanistic Biology and Biotechnology; Univ. of Illinois at Chicago

    1995-04-28

    Polyacrylamide gel electrophoresis plays a major role in analyzing the function of muscle structural proteins. This review describes one- and two-dimensional gel electrophoretic methods for qualitative and quantitative investigation of the muscle proteins, with special emphasis on determination of protein phosphorylation. The electrophoretic studies established the subunit structures of the muscle proteins, characterized their multiple forms, revealed changes in subunit composition or shifts in isoform distribution of specific proteins during development, upon stimulation or denervation of the muscle. Protein phosphorylation during muscle contraction is preferentially studied by two-dimensional gel electrophoresis. The same method demonstrated protein alterations in human neuromuscular diseases.

  17. Alternating-current electrophoretic adhesion of biodegradable hydrogel utilizing intermediate polymers.

    PubMed

    Asoh, Taka-Aki; Kawai, Wataru; Kikuchi, Akihiko

    2014-11-01

    The adhesion of anionic charged biodegradable hydrogels each other utilizing oppositely charged water-soluble polymers as a binder has been achieved by applying alternating-current (AC) electric fields. The two gelatin based dextran sulfate gels (DS gels) were molecularly sutured together by AC electrophoretic adhesion when cationic charged quaternary ammonium chitosan (TMC) was applied between and held in contact with the two DS gels. The adhesive strength of the gels increased with increasing periodicity when a square wave was applied. Hydrogel constructs composed of DS microgels were prepared simply by AC electrophoretic adhesion utilizing intermediate TMC.

  18. Advancement in Preparation of Hydroxyapatite/bioglass Graded Coatings by Electrophoretic Deposition

    NASA Astrophysics Data System (ADS)

    Yao, Liang; Chen, Chuanzhong; Wang, Diangang; Bao, Quanhe; Ma, Jie

    Electrophoretic deposition is a good method in the preparation of hydroxyapatite/bioglass graded coatings. Its processing parameters are easy to be operated. As it is nonbeeline process, it can be used in the deposition of complex shape and porous surface. This paper reviewed the advancement of the graded coatings in recent years, concluded the principles, characters, steps of electrophoretic deposition of bioceramic coatings and analyzed influencing factors in detail, such as granularity of suspension, aging of suspension, dispersion media, PH of suspension, electricity, voltage, deposition time, pretreatment of substrate and sintering. The foreground of hydroxyapatite/bioglass graded coatings is expected.

  19. Electrophoretic deposition of graphene oxide as a corrosion inhibitor for sintered NdFeB

    NASA Astrophysics Data System (ADS)

    He, Wenting; Zhu, Liqun; Chen, Haining; Nan, Haiyang; Li, Weiping; Liu, Huicong; Wang, Yan

    2013-08-01

    Graphene oxide (GO) was deposited uniformly on the surface of permanent magnet material NdFeB by electrophoretic deposition (EPD). Electrophoretic deposited graphene oxide (EPD-GO) coating was reduced partially after EPD process, owing to the removal of oxygen functional groups. And EPD-GO coating showed excellent adhesion to the NdFeB matrix. According to the results of electrochemical tests, the decrease in corrosion current density and the positive shift in corrosion potential have both demonstrated that EPD-GO coating served as a corrosion inhibitor, protecting NdFeB from NaCl aqueous solution.

  20. Development and validation of InnoQuant™, a sensitive human DNA quantitation and degradation assessment method for forensic samples using high copy number mobile elements Alu and SVA.

    PubMed

    Pineda, Gina M; Montgomery, Anne H; Thompson, Robyn; Indest, Brooke; Carroll, Marion; Sinha, Sudhir K

    2014-11-01

    There is a constant need in forensic casework laboratories for an improved way to increase the first-pass success rate of forensic samples. The recent advances in mini STR analysis, SNP, and Alu marker systems have now made it possible to analyze highly compromised samples, yet few tools are available that can simultaneously provide an assessment of quantity, inhibition, and degradation in a sample prior to genotyping. Currently there are several different approaches used for fluorescence-based quantification assays which provide a measure of quantity and inhibition. However, a system which can also assess the extent of degradation in a forensic sample will be a useful tool for DNA analysts. Possessing this information prior to genotyping will allow an analyst to more informatively make downstream decisions for the successful typing of a forensic sample without unnecessarily consuming DNA extract. Real-time PCR provides a reliable method for determining the amount and quality of amplifiable DNA in a biological sample. Alu are Short Interspersed Elements (SINE), approximately 300bp insertions which are distributed throughout the human genome in large copy number. The use of an internal primer to amplify a segment of an Alu element allows for human specificity as well as high sensitivity when compared to a single copy target. The advantage of an Alu system is the presence of a large number (>1000) of fixed insertions in every human genome, which minimizes the individual specific variation possible when using a multi-copy target quantification system. This study utilizes two independent retrotransposon genomic targets to obtain quantification of an 80bp "short" DNA fragment and a 207bp "long" DNA fragment in a degraded DNA sample in the multiplex system InnoQuant™. The ratio of the two quantitation values provides a "Degradation Index", or a qualitative measure of a sample's extent of degradation. The Degradation Index was found to be predictive of the observed loss

  1. Application of microfluidic chip with integrated optics for electrophoretic separations of proteins.

    PubMed

    Vieillard, Julien; Mazurczyk, Radoslaw; Morin, Christophe; Hannes, Benjamin; Chevolot, Yann; Desbène, Paul-Louis; Krawczyk, Stanislas

    2007-01-15

    This paper describes the fabrication, the characterization and the applications of a capillary electrophoresis microchip. This hybrid device (glass/PDMS) features channels and optical waveguides integrated in one common substrate. It can be used for electrophoretic separation and fluorimetric detection of molecules. The microfluidic performance of the device is demonstrated by capillary zone and gel electrophoresis of proteins.

  2. Protein Electrophoretic Profiles and the Origin of the B Genome of Wheat

    PubMed Central

    Johnson, B. Lennart

    1972-01-01

    Protein electrophoretic profiles cast doubt upon the prevalent theory that the B genome of the polyploid wheats was derived from a species of Aegilops. They suggest, instead, that the wild tetraploid wheats comprise a complex, whose components were derived from various combinations of diploid Triticum types, which evidently include the B-genome type. Images PMID:4504349

  3. Electrophoretic variation in muscle lactate dehydrogenase in Snake Valley cutthroat trout, Salmo clarki subsp.

    PubMed

    Klar, G T; Stalnaker, C B

    1979-01-01

    1. Electrophoretic variation observed in muscle A group lactate dehydrogenase in Snake Valley cutthroat trout (Salmo clarki subsp.) suggested the presence of two variant alleles at the A1 locus and a null allele at the A2 locus. 2. The taxonomic status of the Snake Valley cutthroat trout was reviewed.

  4. The electrophoretic banding pattern of the chromosomes of Pichia stipitis and Candida shehatae.

    PubMed

    Passoth, V; Hansen, M; Klinner, U; Emeis, C C

    1992-11-01

    The electrophoretic karyotype of fu1ur strains of P. stipitis and five strains of C. shehatae were compared by means of OFAGE and TAFE techniques. Although the number of chromosomal bands was six in all cases except one, P. stipitis revealed a clearly distinct pattern in comparison to C. shehatae. Both yeasts showed remarkable chromosome length polymorphism.

  5. Differentiation of species in the Bacillus brevis group and the Bacillus aneurinolyticus group based on the electrophoretic whole-cell protein pattern.

    PubMed

    Shida, O; Takagi, H; Kadowaki, K; Yano, H; Komagata, K

    1996-07-01

    Ninety strains of eleven Bacillus species in the Bacillus brevis group and the Bacillus aneurinolyticus group were compared with the electrophoretic whole-cell protein pattern. The strains were separated into two clusters at the similarity of 55%. One cluster (cluster 1) was consisted of strains from the B. brevis group, and another cluster (cluster 2) was composed of strains from the B. aneurinolyticus group. The cluster 1 was separated into eight subclusters. Out of eight subclusters, seven subclusters contain strains from B. brevis, B. laterosporus, B. agri, B. reuszeri, B. choshinensis, B. formosus, and B. borstelensis. Another subcluster was further separated into two related clusters, which corresponded to B. centrosporus and B. parabrevis, and they were fused at the similarity of 76%. Cluster 2 was separated into two subclusters, which corresponded to B. aneurinolyticus and B. migulanus. The above eleven species showed characteristic patterns distinct from one another, and this correlated well with the published DNA relatedness data. The comparison of the electrophoretic whole-cell protein pattern proved to be useful for evaluation of taxonomic relationships among these taxa.

  6. High-mobility-group a-like CarD binds to a DNA site optimized for affinity and position and to RNA polymerase to regulate a light-inducible promoter in Myxococcus xanthus.

    PubMed

    García-Heras, Francisco; Abellón-Ruiz, Javier; Murillo, Francisco J; Padmanabhan, S; Elías-Arnanz, Montserrat

    2013-01-01

    The CarD-CarG complex controls various cellular processes in the bacterium Myxococcus xanthus including fruiting body development and light-induced carotenogenesis. The CarD N-terminal domain, which defines the large CarD_CdnL_TRCF protein family, binds to CarG, a zinc-associated protein that does not bind DNA. The CarD C-terminal domain resembles eukaryotic high-mobility-group A (HMGA) proteins, and its DNA binding AT hooks specifically recognize the minor groove of appropriately spaced AT-rich tracts. Here, we investigate the determinants of the only known CarD binding site, the one crucial in CarD-CarG regulation of the promoter of the carQRS operon (P(QRS)), a light-inducible promoter dependent on the extracytoplasmic function (ECF) σ factor CarQ. In vitro, mutating either of the 3-bp AT tracts of this CarD recognition site (TTTCCAGAGCTTT) impaired DNA binding, shifting the AT tracts relative to P(QRS) had no effect or marginally lowered DNA binding, and replacing the native site by the HMGA1a binding one at the human beta interferon promoter (with longer AT tracts) markedly enhanced DNA binding. In vivo, however, all of these changes deterred P(QRS) activation in wild-type M. xanthus, as well as in a strain with the CarD-CarG pair replaced by the Anaeromyxobacter dehalogenans CarD-CarG (CarD(Ad)-CarG(Ad)). CarD(Ad)-CarG(Ad) is functionally equivalent to CarD-CarG despite the lower DNA binding affinity in vitro of CarD(Ad), whose C-terminal domain resembles histone H1 rather than HMGA. We show that CarD physically associates with RNA polymerase (RNAP) specifically via interactions with the RNAP β subunit. Our findings suggest that CarD regulates a light-inducible, ECF σ-dependent promoter by coupling RNAP recruitment and binding to a specific DNA site optimized for affinity and position.

  7. Properties of electrophoretically homogeneous phenobarbital-inducible and beta-naphthoflavone-inducible forms of liver microsomal cytochrome P-450.

    PubMed

    Haugen, D A; Coon, M J

    1976-12-25

    Procedures are described for the isolation of two forms of rabbit liver microsomal liver microsomal cytochrome P-450 (P-450LM) in homogeneous state. They are designated by their relative electrophoretic mobilities on polyacrylamide gel in the presence of sodium dodecyl sulfate as P-450LM2 and P-450LM4. P-450LM2, which was isolated from phenobarbital-induced animals, has a subunit molecular weight of 48,700. The best preparations contain 20 nmol of the cytochrome per mg of protein and 1 molecule of heme per polypeptide chain. P-450LM4, which is induced by beta-naphthoflavone but is also present in phenobarbital-induced and untreated animals, was isolated from all three sources and found to have a subunit molecular weight of 55,300. The best preparations contain 17nmol of the cytochrome per mg of protein and 1 molecule of heme per polypeptide chain. Some of the purified preparations of the cytochromes, although electrophoretically homogeneous, contain apoenzyme due to heme loss during purification. The purified proteins contain no detectable NADPH-cytochrome P-450 reductase, cytochrome b5, or NADH-cytochrome b5 reductase, and only low levels of phospholipid (about 1 molecule per subunit). Amino acid analysis indicated that P-450LM2 and P-450LM4 are similar in composition, but the latter protein has about 60 additional residues. The COOH-terminal amino acid of P-450LM2 is arginine, as shown by carboxypeptidase treatment, whereas that of P-450LM4 is lysine. NH2-terminal amino acid residues could not be detected. Carbohydrate analysis indicated that both cytochromes contain 1 residue of glucosamine and 2 of mannose per polypeptide subunit. The optical spectra of the oxidized and reduced cytochromes and carbon monoxide complexes were determined. Oxidized P-450LM2 has maxima at 568, 535, and 418 nm characteristic of a low spin hemeprotein, and P450LM4 from beta-naphthoflavone-induced, phenobarbital-induced, or control microsomes has maxima at 645 and 394 nm

  8. Use of ion mobility mass spectrometry and a collision cross-section algorithm to study an organometallic ruthenium anticancer complex and its adducts with a DNA oligonucleotide.

    PubMed

    Williams, Jonathan P; Lough, Julie Ann; Campuzano, Iain; Richardson, Keith; Sadler, Peter J

    2009-11-01

    We report the development of an enhanced algorithm for the calculation of collision cross-sections in combination with Travelling-Wave ion mobility mass spectrometry technology and its optimisation and evaluation through the analysis of an organoruthenium anticancer complex [(eta6-biphenyl)Ru(II)(en)Cl]+. Excellent agreement was obtained between the experimentally determined and theoretically determined collision cross-sections of the complex and its major product ion formed via collision-induced dissociation. Collision cross-sections were also experimentally determined for adducts of this ruthenium complex with the single-stranded oligonucleotide hexamer d(CACGTG). Ion mobility tandem mass spectrometry measurements have allowed the binding sites for ruthenium on the oligonucleotide to be determined.

  9. Electrophoretic Particle Guidance Significantly Enhances Olfactory Drug Delivery: A Feasibility Study

    PubMed Central

    Xi, Jinxiang; Si, Xiuhua A.; Gaide, Rachel

    2014-01-01

    Background Intranasal olfactory drug delivery provides a non-invasive method that bypasses the Blood-Brain-Barrier and directly delivers medication to the brain and spinal cord. However, a device designed specifically for olfactory delivery has not yet been found. Methods In this study, a new delivery method was proposed that utilized electrophoretic forces to guide drug particles to the olfactory region. The feasibility of this method was numerically evaluated in both idealized 2-D and anatomically accurate 3-D nose models. The influence of nasal airflow, electrode strength, and drug release position were also studied on the olfactory delivery efficiency. Findings Results showed that by applying electrophoretic forces, the dosage to the olfactory region was significantly enhanced. In both 2-D and 3-D cases, electrophoretic-guided delivery achieved olfactory dosages nearly two orders of magnitude higher than that without electrophoretic forces. Furthermore, releasing drugs into the upper half of the nostril (i.e., partial release) led to olfactory dosages two times higher than releasing drugs over the entire area of the nostril. By combining the advantages of pointed drug release and appropriate electrophoretic guidance, olfactory dosages of more than 90% were observed as compared to the extremely low olfactory dosage (<1%) with conventional inhaler devices. Conclusion Results of this study have important implications in developing personalized olfactory delivery protocols for the treatment of neurological disorders. Moreover, a high sensitivity of olfactory dosage was observed in relation to different pointed release positions, indicating the importance of precise particle guidance for effective olfactory delivery. PMID:24497957

  10. Characterization of the DNA binding properties of the bHLH domain of Deadpan to single and tandem sites.

    PubMed

    Winston, R L; Millar, D P; Gottesfeld, J M; Kent, S B

    1999-04-20

    The basic helix-loop-helix domain of the Drosophila transcription factor Deadpan (Dpn) was prepared by total chemical protein synthesis in order to characterize its DNA binding properties. Circular dichroism spectroscopy was used to correlate structural changes in Dpn with physiologically relevant monovalent (KCl) and divalent (MgCl2) cation concentrations. In addition, we have used electrophoretic mobility shift assay (EMSA) and fluorescence anisotropy methods to determine equilibrium dissociation constants for the interaction of Dpn with two biologically relevant promoters involved in neural development and sex determination pathways. In this study, we have optimized DNA binding conditions for Dpn, and we have found a markedly higher DNA binding affinity for Dpn than reported for other bHLH domain transcription factors. Dpn binds as a homodimer (Kd = 2.6 nM) to double-stranded oligonucleotides containing the binding site CACGCG. In addition, we found that Dpn bound with the same affinity to a single or tandem binding site, indicating no cooperativity between adjacent DNA-bound Dpn dimers. DNA binding was also monitored as a function of physiologically relevant KCl and MgCl2 concentrations, and we found that this activity was significantly different in the presence and absence of the nonspecific competitor poly(dI-dC). Moreover, Dpn displayed moderate sequence selectivity, exhibiting a 100-fold higher binding affinity for specific DNA than for poly(dI-dC). This study constitutes the first detailed biophysical characterization of the DNA binding properties of a bHLH protein.

  11. Effect of long-term exposure to mobile phone radiation on alpha-Int1 gene sequence of Candida albicans

    PubMed Central

    Shahin-jafari, Ariyo; Bayat, Mansour; Shahhosseiny, Mohammad Hassan; Tajik, Parviz; Roudbar-mohammadi, Shahla

    2015-01-01

    Over the last decade, communication industries have witnessed a tremendous expansion, while, the biological effects of electromagnetic waves have not been fully elucidated. Current study aimed at evaluating the mutagenic effect of long-term exposure to 900-MHz radiation on alpha-Int1 gene sequences of Candida albicans. A standard 900 MHz radiation generator was used for radiation. 10 ml volumes from a stock suspension of C. albicans were transferred into 10 polystyrene tubes. Five tubes were exposed at 4 °C to a fixed magnitude of radiation with different time periods of 10, 70, 210, 350 and 490 h. The other 5 tubes were kept far enough from radiation. The samples underwent genomic DNA extraction. PCR amplification of alpha-Int1 gene sequence was done using one set of primers. PCR products were resolved using agarose gel electrophoresis and the nucleotide sequences were determined. All samples showed a clear electrophoretic band around 441 bp and further sequencing revealed the amplified DNA segments are related to alpha-Int1 gene of the yeast. No mutations in the gene were seen in radiation exposed samples. Long-term exposure of the yeast to mobile phone radiation under the above mentioned conditions had no mutagenic effect on alpha-Int1 gene sequence. PMID:27081370

  12. Beyond the dna: a prototype for functional genomics

    SciTech Connect

    Albala, J

    2000-03-02

    differences in gene expression among different cell populations; disease states and following drug treatments or toxic insult to whole cells. However, these technologies have yet to be extended beyond the examination of DNA/RNA molecules to dissect gene function. One of the most critical component of cellular biochemistry is the integrity of interaction between proteins and DNA. Protein-nucleic acid interactions are essential for the structural organization, replication, repair and expression of genetic information. Understanding the complexities of protein-DNA interactions is a fundamental step towards comprehending key aspects of disease biochemistry. The complexity of these cellular processes generally makes it necessary to analyze these interactions in vitro. Many techniques have been designed to offer insight into these processes including filter binding studies, electrophoretic mobility shift assays and footprinting technologies. But these techniques are laborious and time-consuming, and the development of high-throughput strategies for analysis of protein-DNA interactions would greatly propel these areas of research. Using an oligonucleotide chip approach, novel proteins can be analyzed for DNA binding or enzymatic characteristics. Proteins can be screened against the ''functional chip'' both individually and in combination.

  13. Hb A2-Pasteur-Tunis [delta59(E3)Lys-->Asn, AAG-->AAC]: a new delta chain variant detected by DNA sequencing in a Tunisian carrier of the codon 39 (C-->T) beta0-Thalassemia mutation.

    PubMed

    Moumni, Imen; Zorai, Amine; Daoued, Bechir Ben; Mosbahi, Ikbel; Omar, Souheil; Kaabachi, Neziha; Dellagi, Koussay; Abbes, Salem

    2007-01-01

    We describe a new delta-globin variant, Hb A2-Pasteur-Tunis [delta59(E3)Lys-->Asn, AAG-->AAC]. This hemoglobin (Hb) displayed an electrophoretic mobility faster than normal Hb A2 and was expressed at 2.2 %. The molecular defect was characterized by DNA sequencing and confirmed by a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)-designed protocol. Hb A2-Pasteur-Tunis was found in a carrier of a codon 39 (C-->T) beta0-thalassemia (thal), presenting with a normal Hb A2 level. Phenotype and genotype investigations revealed that the total Hb A2 level of the patient was that expected for a minor beta-thal (4.8%).

  14. Modulation of pyridinium cationic lipid-DNA complex properties by pyridinium gemini surfactants and its impact on lipoplex transfection properties.

    PubMed

    Sharma, Vishnu Dutt; Lees, Julia; Hoffman, Nicholas E; Brailoiu, Eugen; Madesh, Muniswamy; Wunder, Stephanie L; Ilies, Marc A

    2014-02-03

    The study presents the effects of blending a cationic gemini surfactant into cationic lipid bilayers and its impact on the plasmid DNA compaction and delivery process. Using nanoDSC, dynamic light scattering, zeta potential, and electrophoretic mobility measurements, together with transfection (2D- and 3D-) and viability assays, we identified the main physicochemical parameters of the lipid bilayers, liposomes, and lipoplexes that are affected by the gemini surfactant addition. We also correlated the cationic bilayer composition with the dynamics of the DNA compaction process and with transfection efficiency, cytotoxicity, and the internalization mechanism of the resultant nucleic acid complexes. We found that the blending of gemini surfactant into the cationic bilayers fluidized the supramolecular assemblies, reduced the amount of positive charge required to fully compact the plasmid DNA and, in certain cases, changed the internalization mechanism of the lipoplexes. The transfection efficiency of select ternary lipoplexes derived from cationic gemini surfactants and lipids was several times superior to the transfection efficiency of corresponding binary lipoplexes, also surpassing standard transfection systems. The overall impact of gemini surfactants into the formation and dynamic of cationic bilayers was found to depend heavily on the presence of colipids, their nature, and amount present in lipoplexes. The study confirmed the possibility of combining the specific properties of pyridinium gemini surfactants and cationic lipids synergistically to obtain efficient synthetic transfection systems with negligible cytotoxicity useful for therapeutic gene delivery.

  15. Malten, a new synthetic molecule showing in vitro antiproliferative activity against tumour cells and induction of complex DNA structural alterations

    PubMed Central

    Amatori, S; Bagaloni, I; Macedi, E; Formica, M; Giorgi, L; Fusi, V; Fanelli, M

    2010-01-01

    Background: Hydroxypyrones represent several classes of molecules known for their high synthetic versatility. This family of molecules shows several interesting pharmaceutical activities and is considered as a promising source of new antineoplastic compounds. Methods: In the quest to identify new potential anticancer agents, a new maltol (3-hydroxy-2-methyl-4-pyrone)-derived molecule, named malten (N,N′-bis((3-hydroxy-4-pyron-2-yl)methyl)-N,N′-dimethylethylendiamine), has been synthesised and analysed at both biological and molecular levels for its antiproliferative activity in eight tumour cell lines. Results: Malten exposure led to a dose-dependent reduction in cell survival in all the neoplastic models studied. Sublethal concentrations of malten induce profound cell cycle changes, particularly affecting the S and/or G2-M phases, whereas exposure to lethal doses causes the induction of programmed cell death. The molecular response to malten was also investigated in JURKAT and U937 cells. It showed the modulation of genes having key roles in cell cycle progression and apoptosis. Finally, as part of the effort to clarify the action mechanism, we showed that malten is able to impair DNA electrophoretic mobility and drastically reduce both PCR amplificability and fragmentation susceptibility of DNA. Conclusion: Taken together, these results show that malten may exert its antiproliferative activity through the induction of complex DNA structural modifications. This evidence, together with the high synthetic versatility of maltol-derived compounds, makes malten an interesting molecular scaffold for the future design of new potential anticancer agents. PMID:20571494

  16. The BR domain of PsrP interacts with extracellular DNA to promote bacterial aggregation; structural insights into pneumococcal biofilm formation

    PubMed Central

    Schulte, Tim; Mikaelsson, Cecilia; Beaussart, Audrey; Kikhney, Alexey; Deshmukh, Maya; Wolniak, Sebastian; Pathak, Anuj; Ebel, Christine; Löfling, Jonas; Fogolari, Federico; Henriques-Normark, Birgitta; Dufrêne, Yves F.; Svergun, Dmitri; Nygren, Per-Åke; Achour, Adnane

    2016-01-01

    The major human pathogen Streptococcus pneumoniae is a leading cause of disease and death worldwide. Pneumococcal biofilm formation within the nasopharynx leads to long-term colonization and persistence within the host. We have previously demonstrated that the capsular surface-associated pneumococcal serine rich repeat protein (PsrP), key factor for biofilm formation, binds to keratin-10 (KRT10) through its microbial surface component recognizing adhesive matrix molecule (MSCRAMM)-related globular binding region domain (BR187–385). Here, we show that BR187–385 also binds to DNA, as demonstrated by electrophoretic mobility shift assays and size exclusion chromatography. Further, heterologous expression of BR187–378 or the longer BR120–378 construct on the surface of a Gram-positive model host bacterium resulted in the formation of cellular aggregates that was significantly enhanced in the presence of DNA. Crystal structure analyses revealed the formation of BR187–385 homo-dimers via an intermolecular β-sheet, resulting in a positively charged concave surface, shaped to accommodate the acidic helical DNA structure. Furthermore, small angle X-ray scattering and circular dichroism studies indicate that the aggregate-enhancing N-terminal region of BR120–166 adopts an extended, non-globular structure. Altogether, our results suggest that PsrP adheres to extracellular DNA in the biofilm matrix and thus promotes pneumococcal biofilm formation. PMID:27582320

  17. Altering the GTP binding site of the DNA/RNA-binding protein, Translin/TB-RBP, decreases RNA binding and may create a dominant negative phenotype.

    PubMed

    Chennathukuzhi, V M; Kurihara, Y; Bray, J D; Yang, J; Hecht, N B

    2001-11-01

    The DNA/RNA-binding protein, Translin/Testis Brain RNA-binding protein (Translin/TB-RBP), contains a putative GTP binding site in its C-terminus which is highly conserved. To determine if guanine nucleotide binding to this site functionally alters nucleic acid binding, electrophoretic mobility shift assays were performed with RNA and DNA binding probes. GTP, but not GDP, reduces RNA binding by approximately 50% and the poorly hydrolyzed GTP analog, GTPgammaS, reduces binding by >90% in gel shift and immunoprecipitation assays. No similar reduction of DNA binding is seen. When the putative GTP binding site of TB-RBP, amino acid sequence VTAGD, is altered to VTNSD by site directed mutagenesis, GTP will no longer bind to TB-RBP(GTP) and TB-RBP(GTP) no longer binds to RNA, although DNA binding is not affected. Yeast two-hybrid assays reveal that like wild-type TB-RBP, TB-RBP(GTP) will interact with itself, with wild-type TB-RBP and with Translin associated factor X (Trax). Transfection of TB-RBP(GTP) into NIH 3T3 cells leads to a marked increase in cell death suggesting a dominant negative function for TB-RBP(GTP) in cells. These data suggest TB-RBP is an RNA-binding protein whose activity is allosterically controlled by nucleotide binding.

  18. Structure–function relationships of two paralogous single-stranded DNA-binding proteins from Streptomyces coelicolor: implication of SsbB in chromosome segregation during sporulation

    PubMed Central

    Paradzik, Tina; Ivic, Nives; Filic, Zelimira; Manjasetty, Babu A.; Herron, Paul; Luic, Marija; Vujaklija, Dusica

    2013-01-01

    The linear chromosome of Streptomyces coelicolor contains two paralogous ssb genes, ssbA and ssbB. Following mutational analysis, we concluded that ssbA is essential, whereas ssbB plays a key role in chromosome segregation during sporulation. In the ssbB mutant, ∼30% of spores lacked DNA. The two ssb genes were expressed differently; in minimal medium, gene expression was prolonged for both genes and significantly upregulated for ssbB. The ssbA gene is transcribed as part of a polycistronic mRNA from two initiation sites, 163 bp and 75 bp upstream of the rpsF translational start codon. The ssbB gene is transcribed as a monocistronic mRNA, from an unusual promoter region, 73 bp upstream of the AUG codon. Distinctive DNA-binding affinities of single-stranded DNA-binding proteins monitored by tryptophan fluorescent quenching and electrophoretic mobility shift were observed. The crystal structure of SsbB at 1.7 Å resolution revealed a common OB-fold, lack of the clamp-like structure conserved in SsbA and previously unpublished S-S bridges between the A/B and C/D subunits. This is the first report of the determination of paralogous single-stranded DNA-binding protein structures from the same organism. Phylogenetic analysis revealed frequent duplication of ssb genes in Actinobacteria, whereas their strong retention suggests that they are involved in important cellular functions. PMID:23393191

  19. Suppression of FOXM1 Transcriptional Activities via a Single-Stranded DNA Aptamer Generated by SELEX.

    PubMed

    Xiang, Qin; Tan, Guixiang; Jiang, Xia; Wu, Kuangpei; Tan, Weihong; Tan, Yongjun

    2017-03-30

    The transcription factor FOXM1 binds to its consensus sequence at promoters through its DNA binding domain (DBD) and activates proliferation-associated genes. The aberrant overexpression of FOXM1 correlates with tumorigenesis and progression of many cancers. Inhibiting FOXM1 transcriptional activities is proposed as a potential therapeutic strategy for cancer treatment. In this study, we obtained a FOXM1-specific single stranded DNA aptamer (FOXM1 Apt) by SELEX with a recombinant FOXM1 DBD protein as the target of selection. The binding of FOXM1 Apt to FOXM1 proteins were confirmed with electrophoretic mobility shift assays (EMSAs) and fluorescence polarization (FP) assays. Phosphorthioate-modified FOXM1 Apt (M-FOXM1 Apt) bound to FOXM1 as wild type FOXM1 Apt, and co-localized with FOXM1 in nucleus. M-FOXM1-Apt abolished the binding of FOXM1 on its consensus binding sites and suppressed FOXM1 transcriptional activities. Compared with the RNA interference of FOXM1 in cancer cells, M-FOXM1 Apt repressed cell proliferation and the expression of FOXM1 target genes without changing FOXM1 levels. Our results suggest that the obtained FOXM1 Apt could be used as a probe for FOXM1 detection and an inhibitor of FOXM1 transcriptional functions in cancer cells at the same time, providing a potential reagent for cancer diagnosis and treatment in the future.

  20. Using in situ rheology to characterize the microstructure in photopolymerized polyacrylamide gels for DNA electrophoresis.

    PubMed

    Wang, Jian; Ugaz, Victor M

    2006-09-01

    Photopolymerized cross-linked polyacrylamide hydrogels are attractive sieving matrix formulations for DNA electrophoresis owing to their rapid polymerization times and the potential to locally tailor the gel pore structure through spatial variation of illumination intensity. This capability is especially important in microfluidic systems, where photopolymerization allows gel matrices to be precisely positioned within complex microchannel networks. Separation performance is also directly related to the nanoscale gel pore structure, which is in turn strongly influenced by polymerization kinetics. Unfortunately, detailed studies of the interplay among polymerization kinetics, mechanical properties, and structural morphology are lacking in photopolymerized hydrogel systems. In this paper, we address this issue by performing a series of in situ dynamic small-amplitude oscillatory shear measurements during photopolymerization of cross-linked polyacrylamide electrophoresis gels to investigate the relationship between rheology and parameters associated with the gelation environment including UV intensity, monomer and cross-linker composition, and reaction temperature. In general, we find that the storage modulus G' increases with increasing initial monomer concentration, cross-linker concentration, and polymerization temperature. The steady-state value of G', however, exhibits a more complex dependence on UV intensity that varies with gel concentration. A simple model based on rubber elasticity theory is used to obtain estimates of the average gel pore size that are in surprisingly good agreement with corresponding data obtained from analysis of DNA electrophoretic mobility in gels cast under identical polymerization conditions.

  1. Suppression of FOXM1 Transcriptional Activities via a Single-Stranded DNA Aptamer Generated by SELEX

    PubMed Central

    Xiang, Qin; Tan, Guixiang; Jiang, Xia; Wu, Kuangpei; Tan, Weihong; Tan, Yongjun

    2017-01-01

    The transcription factor FOXM1 binds to its consensus sequence at promoters through its DNA binding domain (DBD) and activates proliferation-associated genes. The aberrant overexpression of FOXM1 correlates with tumorigenesis and progression of many cancers. Inhibiting FOXM1 transcriptional activities is proposed as a potential therapeutic strategy for cancer treatment. In this study, we obtained a FOXM1-specific single stranded DNA aptamer (FOXM1 Apt) by SELEX with a recombinant FOXM1 DBD protein as the target of selection. The binding of FOXM1 Apt to FOXM1 proteins were confirmed with electrophoretic mobility shift assays (EMSAs) and fluorescence polarization (FP) assays. Phosphorthioate-modified FOXM1 Apt (M-FOXM1 Apt) bound to FOXM1 as wild type FOXM1 Apt, and co-localized with FOXM1 in nucleus. M-FOXM1-Apt abolished the binding of FOXM1 on its consensus binding sites and suppressed FOXM1 transcriptional activities. Compared with the RNA interference of FOXM1 in cancer cells, M-FOXM1 Apt repressed cell proliferation and the expression of FOXM1 target genes without changing FOXM1 levels. Our results suggest that the obtained FOXM1 Apt could be used as a probe for FOXM1 detection and an inhibitor of FOXM1 transcriptional functions in cancer cells at the same time, providing a potential reagent for cancer diagnosis and treatment in the future. PMID:28358012

  2. Inhibitory Effects of Bangladeshi Medicinal Plant Extracts on Interactions between Transcription Factors and Target DNA Sequences

    PubMed Central

    Lampronti, Ilaria; Khan, Mahmud T.H.; Borgatti, Monica; Bianchi, Nicoletta

    2008-01-01

    Several transcription factors (TFs) play crucial roles in governing the expression of different genes involved in the immune response, embryo or cell lineage development, cell apoptosis, cell cycle progression, oncogenesis, repair and fibrosis processes and inflammation. As far as inflammation, TFs playing pivotal roles are nuclear factor kappa B (NF-kB), activator protein (AP-1), signal transducer and activator of transcription (STATs), cAMP response element binding protein (CREB) and GATA-1 factors. All these TFs regulate the expression of pro-inflammatory cytokines and are involved in the pathogenesis of a number of human disorders, particularly those with an inflammatory component. Since several medicinal plants can be employed to produce extracts exhibiting biological effects and because alteration of gene transcription represents a very interesting approach to control the expression of selected genes, this study sought to verify the ability of several extracts derived from Bangladeshi medicinal plants in interfering with molecular interactions between different TFs and specific DNA sequences. We first analyzed the antiproliferative activity of 19 medicinal plants on different human cell lines, including erythroleukemia K562, B lymphoid Raji and T lymphoid Jurkat cell lines. Secondly, we employed the electrophoretic mobility shift assay as a suitable technique for a fast screening of plant extracts altering the binding between NF-kB, AP-1, GATA-1, STAT-3, CREB and the relative target DNA elements. PMID:18830455

  3. DNA Aptamers against Taiwan Banded Krait α-Bungarotoxin Recognize Taiwan Cobra Cardiotoxins.

    PubMed

    Chen, Ying-Jung; Tsai, Chia-Yu; Hu, Wan-Ping; Chang, Long-Sen

    2016-03-05

    Bungarus multicinctus α-bungarotoxin (α-Bgt) and Naja atra cardiotoxins (CTXs) share a common structural scaffold, and their tertiary structures adopt three-fingered loop motifs. Four DNA aptamers against α-Bgt have been reported previously. Given that the binding of aptamers with targeted proteins depends on structural complementarity, in this study, we investigated whether DNA aptamers against α-Bgt could also recognize CTXs. It was found that N. atra cardiotoxin 3 (CTX3) reduced the electrophoretic mobility of aptamers against α-Bgt. Analysis of the changes in the fluorescence intensity of carboxyfluorescein-labeled aptamers upon binding toxin molecules revealed that CTX3 and α-Bgt could bind the tested aptamers. Moreover, the aptamers inhibited the membrane-damaging activity and cytotoxicity of CTX3. In addition to CTX3, other N. atra CTX isotoxins also bound to the aptamer against α-Bgt. Taken together, our data indicate that aptamers against α-Bgt show cross-reactivity with CTXs. The findings that aptamers against α-Bgt also suppress the biological activities of CTX3 highlight the potential utility of aptamers in regard to the broad inhibition of snake venom three-fingered proteins.

  4. Modulations of DNA Contacts by Linker Histones and Post-translational Modifications Determine the Mobility and Modifiability of Nucleosomal H3 Tails.

    PubMed

    Stützer, Alexandra; Liokatis, Stamatios; Kiesel, Anja; Schwarzer, Dirk; Sprangers, Remco; Söding, Johannes; Selenko, Philipp; Fischle, Wolfgang

    2016-01-21

    Post-translational histone modifications and linker histone incorporation regulate chromatin structure and genome activity. How these systems interface on a molecular level is unclear. Using biochemistry and NMR spectroscopy, we deduced mechanistic insights into the modification behavior of N-terminal histone H3 tails in different nucleosomal contexts. We find that linker histones generally inhibit modifications of different H3 sites and reduce H3 tail dynamics in nucleosomes. These effects are caused by modulations of electrostatic interactions of H3 tails with linker DNA and largely depend on the C-terminal domains of linker histones. In agreement, linker histone occupancy and H3 tail modifications segregate on a genome-wide level. Charge-modulating modifications such as phosphorylation and acetylation weaken transient H3 tail-linker DNA interactions, increase H3 tail dynamics, and, concomitantly, enhance general modifiability. We propose that alterations of H3 tail-linker DNA interactions by linker histones and charge-modulating modifications execute basal control mechanisms of chromatin function.

  5. Genetic organization of a DNA-processing region required for mobilization of a non-self-transmissible plasmid, pEC3, isolated from Erwinia carotovora subsp. carotovora.

    PubMed

    Nomura, N; Yamashita, M; Murooka, Y

    1996-04-17

    A non-self-transmissible multiple-copy plasmid, pEC3, isolated from the phytopathogenic bacterium, Erwinia carotovora subsp. carotovora, can be mobilized by an IncP-type plasmid. The hybrid plasmid vector, pETC3, constructed from pEC3 by fusion to markers conferring TcR and CmR, was transferred by conjugation from Escherichia coli (Ec) to various genera of Enterobacteriaceae and to other genera of Gram(-) bacteria which included Xanthomonas, Agrobacterium and Rhizobium. Deletion analysis and successive subcloning of pEC3 revealed that a cis-acting locus, oriT and a trans-acting locus, mob, were involved in mobilization of pEC3. Five open reading frames (ORFs) were found in the mob region, of which four were identified as mobA, B, C and D. The mobA gene overlapped with mobC, B, D and ORF1 that were transcribed polycistronically from upstream from mobC. The nature of the four products of mob genes, MobA, B, C and D, was verified by use of the T7 promoter system in Ec.

  6. Nanolaminate microfluidic device for mobility selection of particles

    SciTech Connect

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2006-10-10

    A microfluidic device made from nanolaminate materials that are capable of electrophoretic selection of particles on the basis of their mobility. Nanolaminate materials are generally alternating layers of two materials (one conducting, one insulating) that are made by sputter coating a flat substrate with a large number of layers. Specific subsets of the conducting layers are coupled together to form a single, extended electrode, interleaved with other similar electrodes. Thereby, the subsets of conducting layers may be dynamically charged to create time-dependent potential fields that can trap or transport charge colloidal particles. The addition of time-dependence is applicable to all geometries of nanolaminate electrophoretic and electrochemical designs from sinusoidal to nearly step-like.

  7. DNA ligases ensure fidelity by interrogating minor groove contacts.

    PubMed

    Liu, Pingfang; Burdzy, Artur; Sowers, Lawrence C

    2004-01-01

    the ligase junction. The NAD+-dependent ligase, Tth, is more sensitive to the DFT analog on the unligated strand whereas the ATP-dependent T4 ligase is more sensitive to substitutions in the template strand. Electrophoretic gel mobility-shift assays demonstrate that the Tth ligase binds poorly to oligonucleotide substrates containing analogs with altered minor groove contacts.

  8. DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel

    PubMed Central

    2013-01-01

    A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements. PMID:23414121

  9. Fabrication of fluoroalkylsilane modified ZnO nanorod films for electrode protection of electrophoretic displays.

    PubMed

    Li, Zhengyuan; Meng, Xianwei; Tang, Fangqiong

    2011-11-01

    The electrode protection has gained importance because of its positive robust role for the long term display quality of electrophoretic displays. A simple method of zinc oxide nanorod films prepared by electrochemical deposition and coupling with fluoroalkylsilane (FAS) is introduced to fabricate electrode protection films for Indium Tin Oxide (ITO) electrodes. The surface microstructures of zinc oxide films were characterized by scanning electron microscopy, showing a regular nanorods array. After treated by FAS the surface showed extremely low surface free energy with a water contact angle of 148.0 +/- 2.0 degrees. The settlement of pigments was considerably reduced according to the reflectance measurement by ultraviolet spectrophotometer. A weight experiment further confirmed that 90% of the pigment conglutination was prevented by the surface modification. This research can provide an economical approach to improve reliability and long-term image quality of the electrophoretic displays.

  10. Fabrication of nanoelectrodes for neurophysiology: cathodic electrophoretic paint insulation and focused ion beam milling

    PubMed Central

    Qiao, Yi; Chen, Jie; Guo, Xiaoli; Cantrell, Donald; Ruoff, Rodney; Troy, John

    2005-01-01

    The fabrication and characterization of tungsten nanoelectrodes insulated with cathodic electrophoretic paint is described together with their application within the field of neurophysiology. The tip of a 127 μm diameter tungsten wire was etched down to less than 100 nm and then insulated with cathodic electrophoretic paint. Focused ion beam (FIB) polishing was employed to remove the insulation at the electrode’s apex, leaving a nanoscale sized conductive tip of 100–1000 nm. The nanoelectrodes were examined by scanning electron microscopy (SEM) and their electrochemical properties characterized by steady state linear sweep voltammetry. Electrode impedance at 1 kHz was measured too. The ability of a 700 nm tipped electrode to record well-isolated action potentials extracellularly from single visual neurons in vivo was demonstrated. Such electrodes have the potential to open new populations of neurons to study. PMID:16467926

  11. Non-vanishing ponderomotive AC electrophoretic (ACEP) effect for particle trapping

    PubMed Central

    Guan, Weihua; Park, Jae Hyun; Krsticć, Predrag S.; Reed, Mark A.

    2011-01-01

    We present here a study on overlooked aspects of alternating current (AC) electrokinetics-AC electrophoretic (ACEP) phenomena. The dynamics of a particle with both polarizability and net charges in a non-uniform AC electric trapping field is investigated. It is found that either electrophoretic (EP) or dielectrophoretic (DEP) effects can dominate the trapping dynamics, depending on experimental conditions. A dimensionless parameter γ is developed to predict the relative strength of EP and DEP effect in a quadrupole AC field. An ACEP trap is feasible for charged particles in ‘salt-free’ or low salt concentration solutions. In contrast to DEP traps, an ACEP trap favors the down scaling of the particle size. PMID:21508497

  12. Stabilization of green bodies via sacrificial gelling agent during electrophoretic deposition

    DOEpatents

    Worsley, Marcus A.; Kuntz, Joshua D.; Rose, Klint A.

    2016-03-22

    In one embodiment, a method for electrophoretic deposition of a three-dimensionally patterned green body includes suspending a first material in a gelling agent above a patterned electrode of an electrophoretic deposition (EPD) chamber, and gelling the suspension while applying a first electric field to the suspension to cause desired patterning of the first material in a resulting gelation. In another embodiment, a ceramic, metal, or cermet includes a plurality of layers, wherein each layer includes a gradient in composition, microstructure, and/or density in an x-y plane oriented parallel to a plane of deposition of the plurality of layers along a predetermined distance in a z-direction perpendicular to the plane of deposition.

  13. Development of a DNA vaccine for chicken infectious anemia and its immunogenicity studies using high mobility group box 1 protein as a novel immunoadjuvant indicated induction of promising protective immune responses.

    PubMed

    Sawant, Pradeep Mahadev; Dhama, Kuldeep; Rawool, Deepak Bhiva; Wani, Mohd Yaqoob; Tiwari, Ruchi; Singh, Shambhu Dayal; Singh, Raj Kumar

    2015-01-03

    Chicken infectious anaemia (CIA) is an economically important and emerging poultry disease reported worldwide. Current CIA vaccines have limitations like, the inability of the virus to grow to high titres in embryos/cell cultures, possession of residual pathogenicity and a risk of reversion to virulence. In the present study, a DNA vaccine, encoding chicken infectious anaemia virus (CIAV) VP1 and VP2 genes, was developed and co-administered with truncated chicken high mobility group box 1 (HMGB1ΔC) protein in young chicks for the evaluation of vaccine immune response. CIAV VP1 and VP2 genes were cloned in pTARGET while HMGB1ΔC in PET32b vector. In vitro expression of these gene constructs was evaluated by Western blotting. Further, recombinant HMGB1ΔC was evaluated for its biological activity. The CIAV DNA vaccine administration in specific pathogen free chicks resulted in moderately protective ELISA antibody titres in the range of 4322.87 ± 359.72 to 8288.19 ± 136.38, increased CD8(+) cells, and a higher titre was observed by co-administration of novel adjuvant (HMGB1ΔC) and booster immunizations. The use of vaccine with adjuvant showed achieving antibody titres nearly 8500, titre considered as highly protective, which indicates that co-immunization of HMGB1ΔC may have a strong adjuvant activity on CIAV DNA vaccine induced immune responses. The able potential of HMGB1 protein holding strong adjuvant activity could be exploited further with trials with vaccines for other important pathogens for achieving the required protective immune responses.

  14. Summary electrophoretic data base on human embryonic kidney cell strain 8514

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Arquiza, M. V.; Morrison, D. R.; Todd, P. W.

    1985-01-01

    To properly plan the electrophoresis equipment verification test (EEVT) and continuous flow electrophoresis system (CFES) experiments with human embryonic kidney cells, first a candidate cell lot had to be chosen on the basis of electrophoretic heterogeneity, growth potential, cytogenetics, and urokinase production. Cell lot 8514 from MA Bioproducts, Inc. was chosen for this purpose, and several essential analytical electrophoresis experiments were performed to test its final suitability for these experiments.

  15. Theory of electrophoretic separations. II - Construction of a numerical simulation scheme and its applications

    NASA Technical Reports Server (NTRS)

    Palusinski, O. A.; Graham, A.; Mosher, R. A.; Bier, M.; Saville, D. A.

    1986-01-01

    The implementation of a previously derived model describing electrophoretic transport processes is reformulated, and its usefulness is demonstrated by simulating moving boundary electrophoresis and isoelectric focusing with immobilized species. The resulting solution is stable, evolves smoothly when suitable small step sizes are used, and has a loosely defined convergence as the step sizes are made smaller. The major computational problem involves a need to use small spatial step sizes at high current levels.

  16. Hypotrichosis with keratosis pilaris: electrophoretical study of hair fibrous proteins from a patient.

    PubMed

    Dekio, S; Nagashima, T; Watanabe, Y; Jidoi, J

    1989-01-01

    S-carboxymethylated (SCM) fibrous proteins from the scalp hair of a patient with hypotrichosis with keratosis pilaris (HTKP) and from that of a normal individual were analyzed using two-dimensional electrophoresis. One SCM fibrous protein component was different electrophoretically in the HTKP patient. It is suggested that the brittleness of the HTKP hair might result from this alteration of the fibrous protein composition of the hair.

  17. Investigation of the free flow electrophoretic process. Volume 1: Executive summary

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1979-01-01

    The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible.

  18. Differential electrophoretic separation of cells and its effect on cell viability

    NASA Technical Reports Server (NTRS)

    Leise, E. M.; Lesane, F.

    1974-01-01

    An electrophoretic separation method was applied to the separation of cells. To determine the efficiency of the separation, it was necessary to apply existing methodology and develop new methods to assess the characteristics and functions of the separated subpopulations. Through appropriate application of the widely used isoelectric focusing procedure, a reproducible separation method was developed. Cells accumulated at defined pH and 70-80% remained viable. The cells were suitable for further biologic, biochemical and immunologic studies.

  19. Kinetics of monolayer and bilayer nanoparticle film formation during electrophoretic deposition

    DTIC Science & Technology

    2014-01-01

    and Astronomy , Vanderbilt University, Nashville, TN 37235, USA 2Vanderbilt Institute for Nanoscale Science and Engineering, Vanderbilt University...crystal microbalance or X- ray scattering measurements. Another possible route to increasing time resolution and repeatability is by acquiring in-situ...suppression, and inhibition in the electrophoretic deposition of nanocrystal mixture films for CdSe nanocrystals with gamma -Fe2O3 and Au nanocrystals’, Nano

  20. Sample injection and electrophoretic separation on a simple laminated paper based analytical device.

    PubMed

    Xu, Chunxiu; Zhong, Minghua; Cai, Longfei; Zheng, Qingyu; Zhang, Xiaojun

    2016-02-01

    We described a strategy to perform multistep operations on a simple laminated paper-based separation device by using electrokinetic flow to manipulate the fluids. A laminated crossed-channel paper-based separation device was fabricated by cutting a filter paper sheet followed by lamination. Multiple function units including sample loading, sample injection, and electrophoretic separation were integrated on a single paper based analytical device for the first time, by applying potential at different reservoirs for sample, sample waste, buffer, and buffer waste. As a proof-of-concept demonstration, mixed sample solution containing carmine and sunset yellow were loaded in the sampling channel, and then injected into separation channel followed by electrophoretic separation, by adjusting the potentials applied at the four terminals of sampling and separation channel. The effects of buffer pH, buffer concentration, channel width, and separation time on resolution of electrophoretic separation were studied. This strategy may be used to perform multistep operations such as reagent dilution, sample injection, mixing, reaction, and separation on a single microfluidic paper based analytical device, which is very attractive for building micro total analysis systems on microfluidic paper based analytical devices.