Science.gov

Sample records for dna electrophoretic mobility

  1. Helical repeat and chirality effects on DNA gel electrophoretic mobility.

    PubMed Central

    Drak, J; Crothers, D M

    1991-01-01

    We determined a value of 10.34 +/- 0.04 base pairs (bp) per turn for the helical repeat of bent DNA sequences of the form A6N4-A6N5 by estimating the sequence repeat required to produce a planar curve, as judged from the maximum in the electrophoretic mobility anomaly of multimers containing different sequence repeats (10.00, 10.33, 10.50, 10.67, and 11.00 bp per turn). This result provides the basis for a method to evaluate the helical repeat of any DNA segment by comparative electrophoresis measurements. The sequence of interest is placed between two A-tract bends and the phasing is varied over an entire helical turn. Knowledge of the number of base pairs between the bends in the cis isomer, which has the lowest electrophoretic mobility, allows calculation of the average helical repeat of the inserted sequence. In the course of these experiments we observed an unexpected dependence of electrophoretic mobility on the shape of DNA molecules: in high-percentage polyacrylamide gels, those bent molecules for which we deduced a right-handed superhelical form are less retarded than their homologous left-handed isomers. To explain this finding we propose that superhelical chirality influences the choice of DNA migration pathway, leading to rotation of the DNA molecule relative to the local coordinate frame in the gel. High-percentage gels have sufficiently close contact with the right-handed DNA helical twist to differentiate the frictional consequences of right- and left-handed twisting motions. Images PMID:2014227

  2. Electrophoretic mobility shift assays for the analysis of DNA-protein interactions.

    PubMed

    Gaudreault, Manon; Gingras, Marie-Eve; Lessard, Maryse; Leclerc, Steeve; Guérin, Sylvain L

    2009-01-01

    Electromobility shift assay is a simple, efficient, and rapid method for the study of specific DNA-protein interactions. It relies on the reduction in the electrophoretic mobility conferred to a DNA fragment by an interacting protein. The technique is suitable to qualitative, quantitative, and kinetic analyses. It can also be used to analyze conformational changes.

  3. Determination of electroosmotic and electrophoretic mobility of DNA and dyes in low ionic strength solutions.

    PubMed

    Lallman, Joshua; Flaugh, Rachel; Kounovsky-Shafer, Kristy L

    2017-08-23

    Nanocoding, a genome analysis platform, relies on very low ionic strength conditions to elongate DNA molecules up to 1.06 (fully stretched DNA = 1). Understanding how electroosmotic and electrophoretic forces vary, as ionic strength decreases, will enable better Nanocoding devices, or other genome analysis platforms, to be developed. Using gel electrophoresis to determine overall mobility (includes contributions from electrophoretic and electroosmotic forces) in different ionic strength conditions, linear DNA molecules (pUC19 (2.7 kb), pBR322 (4.4 kb), ΦX174 (5.4 kb), and PSNAPf-H2B (6.2 kb)) were analyzed in varying gel concentrations (1.50, 1.25, 1.00, 0.75, and 0.50%). Additionally, buffer concentration (Tris-EDTA, TE) was varied to determine free solution mobility at different ionic strength solutions. As ionic strength decreased from 13.8 to 7.3 mM, overall mobility increased. As TE buffer decreased (< 7.3 mM), overall mobility drastically decreased as ionic strength decreased. Rhodamine B dye was utilized to determine the electroosmotic mobility. As the ionic strength decreased, electroosmotic mobility increased. The experimental electrophoretic mobility was compared to theoretical considerations for electrophoretic mobility (Pitts and Debye-Hückel-Onsager). Electroosmotic forces decreased the overall mobility of DNA molecules and bromophenol blue migration in a gel matrix as ionic strength decreased. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

    ERIC Educational Resources Information Center

    Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

  5. Using Electrophoretic Mobility Shift Assays to Measure Equilibrium Dissociation Constants: GAL4-p53 Binding DNA as a Model System

    ERIC Educational Resources Information Center

    Heffler, Michael A.; Walters, Ryan D.; Kugel, Jennifer F.

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K[subscript D]) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel;…

  6. Fluorescence-based electrophoretic mobility shift assay in the analysis of DNA-binding proteins.

    PubMed

    Steiner, Sebastian; Pfannschmidt, Thomas

    2009-01-01

    Changes in gene expression mediated by DNA-binding protein factors are a crucial part of many signal transduction pathways. Generally, these regulatory proteins are low abundant and thus their purification and characterisation is labour- and time-intensive. Here we describe a workflow for purification, characterisation and identification of DNA-binding proteins. We show the use of a fluorescence-based electrophoretic mobility shift assay (fEMSA) and describe its advantages for a rapid and convenient screening for regulatory cis-elements. This involves a crude enrichment of nucleic acid binding proteins by heparin-Sepharose chromatography and the characterisation of fractions using overlapping fluorescence-labelled DNA probes spanning the promoter region of interest. The determined protein-binding sites can then be used for sequence-specific DNA-affinity chromatography to purify specifically interacting proteins. Finally, the DNA-binding complexes can be characterised and identified using two-dimensional EMSA, UV-cross-linking and mass spectrometry.

  7. Predicting Electrophoretic Mobility of Protein-Ligand Complexes for Ligands from DNA-Encoded Libraries of Small Molecules.

    PubMed

    Bao, Jiayin; Krylova, Svetlana M; Cherney, Leonid T; Hale, Robert L; Belyanskaya, Svetlana L; Chiu, Cynthia H; Shaginian, Alex; Arico-Muendel, Christopher C; Krylov, Sergey N

    2016-05-17

    Selection of target-binding ligands from DNA-encoded libraries of small molecules (DELSMs) is a rapidly developing approach in drug-lead discovery. Methods of kinetic capillary electrophoresis (KCE) may facilitate highly efficient homogeneous selection of ligands from DELSMs. However, KCE methods require accurate prediction of electrophoretic mobilities of protein-ligand complexes. Such prediction, in turn, requires a theory that would be applicable to DNA tags of different structures used in different DELSMs. Here we present such a theory. It utilizes a model of a globular protein connected, through a single point (small molecule), to a linear DNA tag containing a combination of alternating double-stranded and single-stranded DNA (dsDNA and ssDNA) regions of varying lengths. The theory links the unknown electrophoretic mobility of protein-DNA complex with experimentally determined electrophoretic mobilities of the protein and DNA. Mobility prediction was initially tested by using a protein interacting with 18 ligands of various combinations of dsDNA and ssDNA regions, which mimicked different DELSMs. For all studied ligands, deviation of the predicted mobility from the experimentally determined value was within 11%. Finally, the prediction was tested for two proteins and two ligands with a DNA tag identical to those of DELSM manufactured by GlaxoSmithKline. Deviation between the predicted and experimentally determined mobilities did not exceed 5%. These results confirm the accuracy and robustness of our model, which makes KCE methods one step closer to their practical use in selection of drug leads, and diagnostic probes from DELSMs.

  8. Analysis of In Vitro DNA Interactions of Brassinosteroid-Controlled Transcription Factors Using Electrophoretic Mobility Shift Assay.

    PubMed

    Unterholzner, Simon J; Rozhon, Wilfried; Poppenberger, Brigitte

    2017-01-01

    Most signaling cascades ultimately lead to changes in gene expression by modulating the activity of transcription factors (TFs). The electrophoretic mobility shift assay (EMSA) is a simple but powerful in vitro method for investigation of specific protein-DNA interactions. It makes use of the fact that protein-DNA complexes have a lower electrophoretic mobility in gels than free DNA has. The application of labeled probes in combination with unlabeled competitors allows investigation of DNA-binding specificity and identification of binding motifs with single base-pair resolution. Here we describe the application of EMSAs for the study of interactions of the brassinosteroid-regulated TFs, BRASSINAZOLE-RESISTANT1, (BZR1), BRI1-ETHYL METHANESULFONATE-SUPPRESSOR1 (BES1)/BZR2, and CESTA with putative binding sites. The classical approach using radiolabeled probes, as well as the more recent application of fluorescent probes, is described and the advantages and disadvantages of both methods are discussed.

  9. Electrophoretic Mobilities of the Charge Variants of DNA and Other Polyelectrolytes: Similarities, Differences, and Comparison with Theory.

    PubMed

    Stellwagen, Nancy C

    2017-03-09

    Free solution electrophoretic mobilities of polyelectrolytes with different charge densities have been analyzed using data taken from the literature. The polyions include single- and double-stranded DNA oligomers, small aromatic molecules, peptides, proteins, and synthetic copolymers. Mobility variations due to differences in the background electrolytes were minimized by calculating mobility ratios, dividing the mobility of each charge variant in each data set by the mobility of the most highly charged polyion in that data set. In all cases, the mobility ratios increase linearly with the logarithm of the fractional charge, not the first power of the charge as usually assumed. In addition, the mobility ratios observed for all polyelectrolytes, except for the synthetic copolymers, exhibit a common dependence on the logarithm of fractional charge. The unique results observed for the synthetic copolymers may be due to the flexibility of their hydrocarbon backbones, in contrast to the relatively rigid hydrophilic backbones of the other polyelectrolytes. The mobilities observed for the DNA charge variants are well predicted by the Manning electrophoresis equation, whereas the mobilities predicted by zeta potential theories are higher. However, mobility ratios calculated from both theories agree with the observed results.

  10. Field and pore size dependence of the electrophoretic mobility of DNA: a combination of fluorescence recovery after photobleaching and electric birefringence measurements.

    PubMed

    Tinland, B; Pernodet, N; Weill, G

    1996-06-01

    By combining an electrophoretic cell with a setup of fluorescence recovery after photobleaching (FRAP) we can measure the electrophoretic mobility mu of double-stranded lambda DNA in agarose gel as a function of electric field E and gel concentration C. Mobility varies linearly with the field in agreement with the biased reptation model with fluctuations. The slopes are analyzed in term of orientation and compared with birefringence results. The mobility extrapolated at zero field follows the prediction of the reptation theory; we deduced the variation of the pore size with the agarose concentration. With a special use of our setup, we measure directly the free-mobility mu 0 of the DNA.

  11. Using electrophoretic mobility shift assays to measure equilibrium dissociation constants: GAL4-p53 binding DNA as a model system.

    PubMed

    Heffler, Michael A; Walters, Ryan D; Kugel, Jennifer F

    2012-01-01

    An undergraduate biochemistry laboratory experiment is described that will teach students the practical and theoretical considerations for measuring the equilibrium dissociation constant (K(D) ) for a protein/DNA interaction using electrophoretic mobility shift assays (EMSAs). An EMSA monitors the migration of DNA through a native gel; the DNA migrates more slowly when bound to a protein. To determine a K(D) the amount of unbound and protein-bound DNA in the gel is measured as the protein concentration increases. By performing this experiment, students will be introduced to making affinity measurements and gain experience in performing quantitative EMSAs. The experiment describes measuring the K(D) for the interaction between the chimeric protein GAL4-p53 and its DNA recognition site; however, the techniques are adaptable to other DNA binding proteins. In addition, the basic experiment described can be easily expanded to include additional inquiry-driven experimentation. © 2012 by The International Union of Biochemistry and Molecular Biology.

  12. Electrophoretic mobility of linear and star-branched DNA in semidilute polymer solutions.

    PubMed

    Saha, Sourav; Heuer, Daniel M; Archer, Lynden A

    2006-08-01

    Electrophoresis of large linear T2 (162 kbp) and 3-arm star-branched (N(Arm) = 48.5 kbp) DNA in linear polyacrylamide (LPA) solutions above the overlap concentration c* has been investigated using a fluorescence visualization technique that allows both the conformation and mobility mu of the DNA to be determined. LPA solutions of moderate polydispersity index (PI approximately 1.7-2.1) and variable polymer molecular weight Mw (0.59-2.05 MDa) are used as the sieving media. In unentangled semidilute solutions (c* < c < c(e)), we find that the conformational dynamics of linear and star-branched DNA in electric fields are strikingly different; the former migrating in predominantly U- or I-shaped conformations, depending on electric field strength E, and the latter migrating in a squid-like profile with the star-arms outstretched in the direction opposite to E and dragging the branch point through the sieving medium. Despite these visual differences, mu for linear and star-branched DNA of comparable size are found to be nearly identical in semidilute, unentangled LPA solutions. For LPA concentrations above the entanglement threshold (c > c(e)), the conformation of migrating linear and star-shaped DNA manifest only subtle changes from their unentangled solution features, but mu for the stars decreases strongly with increasing LPA concentration and molecular weight, while mu for linear DNA becomes nearly independent of c and Mw. These findings are discussed in the context of current theories for electrophoresis of large polyelectrolytes.

  13. Sedimentation of macroscopic rigid knots and its relation to gel electrophoretic mobility of DNA knots.

    PubMed

    Weber, Cédric; Carlen, Mathias; Dietler, Giovanni; Rawdon, Eric J; Stasiak, Andrzej

    2013-01-01

    We address the general question of the extent to which the hydrodynamic behaviour of microscopic freely fluctuating objects can be reproduced by macrosopic rigid objects. In particular, we compare the sedimentation speeds of knotted DNA molecules undergoing gel electrophoresis to the sedimentation speeds of rigid stereolithographic models of ideal knots in both water and silicon oil. We find that the sedimentation speeds grow roughly linearly with the average crossing number of the ideal knot configurations, and that the correlation is stronger within classes of knots. This is consistent with previous observations with DNA knots in gel electrophoresis.

  14. Electrophoretic mobilities of erythrocytes in various buffers

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.

  15. Electrophoretic mobilities of erythrocytes in various buffers

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    The calibration of space flight equipment depends on a source of standard test particles, this test particle of choice is the fixed erythrocyte. Erythrocytes from different species have different electrophoretic mobilities. Electrophoretic mobility depends upon zeta potential, which, in turn depends upon ionic strength. Zeta potential decreases with increasing ionic strength, so cells have high electrophoretic mobility in space electrophoresis buffers than in typical physiological buffers. The electrophoretic mobilities of fixed human, rat, and rabbit erythrocytes in 0.145 M salt and buffers of varying ionic strength, temperature, and composition, to assess the effects of some of the unique combinations used in space buffers were characterized. Several effects were assessed: glycerol or DMSO (dimethylsulfoxide) were considered for use as cryoprotectants. The effect of these substances on erythrocyte electrophoretic mobility was examined. The choice of buffer depended upon cell mobility. Primary experiments with kidney cells established the choice of buffer and cryoprotectant. A nonstandard temperature of EPM in the suitable buffer was determined. A loss of ionic strength control occurs in the course of preparing columns for flight, the effects of small increases in ionic strength over the expected low values need to be evaluated.

  16. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...

  17. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...

  18. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms were measured. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1s-1, and the EPMs of fifteen environmental isolates ranged from -1...

  19. ELECTROPHORETIC MOBILITY OF MYCOBACTERIUM AVIUM COMPLEX ORGANISMS

    EPA Science Inventory

    The electrophoretic mobilities (EPMs) of thirty Mycobacterium avium Complex (MAC) organisms isolated from clinical and environmental sources were measured in 9.15 mM KH2PO4 buffered water. The EPMs of fifteen clinical isolates ranged from -1.9 to -5.0 µm cm V-1 ...

  20. Electrophoretic mobility of semi-flexible double-stranded DNA in defect-controlled polymer networks: Mechanism investigation and role of structural parameters.

    PubMed

    Khairulina, Kateryna; Li, Xiang; Nishi, Kengo; Shibayama, Mitsuhiro; Chung, Ung-il; Sakai, Takamasa

    2015-06-21

    Our previous studies have reported an empirical model, which explains the electrophoretic mobility (μ) of double-stranded DNA (dsDNA) as a combination of a basic migration term (Rouse-like or reptation) and entropy loss term in polymer gels with ideal network structure. However, this case is of exception, considering a large amount of heterogeneity in the conventional polymer gels. In this study, we systematically tune the heterogeneity in the polymer gels and study the migration of dsDNA in these gels. Our experimental data well agree with the model found for ideal networks. The basic migration mechanism (Rouse-like or reptation) persists perfectly in the conventional heterogeneous polymer gel system, while the entropy loss term continuously changes with increase in the heterogeneity. Furthermore, we found that in the limit where dsDNA is shorter than dsDNA persistence length, the entropy loss term may be related to the collisional motions between DNA fragments and the cross-links.

  1. Sequence-specific nucleic acid mobility using a reversible block copolymer gel matrix and DNA amphiphiles (lipid-DNA) in capillary and microfluidic electrophoretic separations.

    PubMed

    Wagler, Patrick; Minero, Gabriel Antonio S; Tangen, Uwe; de Vries, Jan Willem; Prusty, Deepak; Kwak, Minseok; Herrmann, Andreas; McCaskill, John S

    2015-10-01

    Reversible noncovalent but sequence-dependent attachment of DNA to gels is shown to allow programmable mobility processing of DNA populations. The covalent attachment of DNA oligomers to polyacrylamide gels using acrydite-modified oligonucleotides has enabled sequence-specific mobility assays for DNA in gel electrophoresis: sequences binding to the immobilized DNA are delayed in their migration. Such a system has been used for example to construct complex DNA filters facilitating DNA computations. However, these gels are formed irreversibly and the choice of immobilized sequences is made once off during fabrication. In this work, we demonstrate the reversible self-assembly of gels combined with amphiphilic DNA molecules, which exhibit hydrophobic hydrocarbon chains attached to the nucleobase. This amphiphilic DNA, which we term lipid-DNA, is synthesized in advance and is blended into a block copolymer gel to induce sequence-dependent DNA retention during electrophoresis. Furthermore, we demonstrate and characterize the programmable mobility shift of matching DNA in such reversible gels both in thin films and microchannels using microelectrode arrays. Such sequence selective separation may be employed to select nucleic acid sequences of similar length from a mixture via local electronics, a basic functionality that can be employed in novel electronic chemical cell designs and other DNA information-processing systems.

  2. Theory for the capillary electrophoretic separation of DNA in polymer solutions.

    PubMed

    Jung, Ho Jin; Bae, Young Chan

    2002-08-23

    We present a mathematical model based on the models of Hubert et al. [Macromolecules 29 (1996) 1006] and Sunada and Blanch [Electrophoresis, 19 (1998) 3128] to describe the electrophoretic mobility of DNA by a transient entanglement coupling mechanism. The proposed model takes into account the interactions between molecules in the capillary and the cross-section of collision between DNA and polymer molecules. The results show that the calculated values agree remarkably well with our electrophoretic mobility data.

  3. A fluorescence based non-radioactive electrophoretic mobility shift assay.

    PubMed

    Ruscher, K; Reuter, M; Kupper, D; Trendelenburg, G; Dirnagl, U; Meisel, A

    2000-03-10

    Electrophoretic mobility shift assay (EMSA) or gel shift assay is one of the most powerful methods for studying protein-DNA interactions. Typically, 32P-labeled DNA probes containing the sequence bound by the protein of interest are used in EMSA (rEMSA). Although rEMSA is sensitive and practicable, it relies on the handling of hazardous radioisotopes, and does not easily allow quantification. We developed a non-radioactive procedure using fluorescence (Cyano dye Cy5) labeled oligodeoxynucleotide duplexes as specific probes (fEMSA) and an automatic DNA sequencer for analysis. Testing different DNA-binding proteins (restriction endonuclease EcoRII, transcription factor NFkappaB and it's subunit p50) the results in fEMSA and rEMSA are similar in regard to quality, reproducibility, and sensitivity. fEMSA allows a semiquantitative screening of large amounts of samples for specific DNA binding activities and is, therefore, a high throughput technology for semiquantitative analysis of DNA-protein interaction.

  4. Gel electrophoretic mobility of charged particles in a medium with curved channels.

    PubMed

    Fridrikh, S; Gotlib, Y; Belenkij, B

    1997-01-01

    A model of electrophoretic mobility of small charged particles (for example short DNA fragments) in media with curved channels is proposed. The medium is represented by a dense material embedding the curved channels accessible to the charged particles. The steady flow method is used to obtain an analytical expression of the particles' electrophoretic mobility as a function of the channel's shape. The analogy between the statistical properties of the channels and polymer chains (free-jointed and with the persistent mobility mechanism) is used.

  5. Electrophoretic mobility of spherical nanoparticles confined in nanochannels

    NASA Astrophysics Data System (ADS)

    Liu, Yu-Wei; Wynne, Tom; Pennathur, Sumita; Meinhart, Carl

    2013-11-01

    We investigate the mobility of a charged spherical nanoparticle driven by weak electric fields that are confined in nanochannels. Factors affecting mobility include particle zeta potential, electrolyte concentration, and channel size. Classic models for electrophoretic mobility (e.g. Smoluchowski and Huckel) are valid only in the linear regime of small particle zeta potential, and for an unbounded fluid domain. The classical models fail to predict electrophoretic mobility estimated from experiments using ~ 42 nm diameter particles confined in a ~ 100 nm nanochannel. We adopt the asymptotically-expanded formulations of Khair and Squires (Phys. Fluids, 2009), and solve the fully-coupled equations on a well-resolved 3D finite element domain. For a charged 42 nm diameter nanoparticle, confined in a 100 nm high nanochannel, the electrophoretic mobility increases nonlinearly when particle zeta potential is greater than thermal potential kB T / e . When the channel size is decreased from 2.5 um to 100 nm, the mobility is reduced by up to 20%. The result suggests that particle/wall interactions, including overlapping double layers may affect electrophoretic mobility in a non-linear manner.

  6. Reliable electrophoretic mobilities free from Joule heating effects using CE.

    PubMed

    Evenhuis, Christopher J; Hruska, Vlastimil; Guijt, Rosanne M; Macka, Miroslav; Gas, Bohuslav; Marriott, Philip J; Haddad, Paul R

    2007-10-01

    Ionic electrophoretic mobilities determined by means of CE experiments are sometimes different when compared to generally accepted values based on limiting ionic conductance measurements. While the effect of ionic strength on electrophoretic mobility has been long understood, the increase in the mobility that results from Joule heating (the resistive heating that occurs when a current passes through an electrolyte) has been largely overlooked. In this work, a simple method for obtaining reliable and reproducible values of electrophoretic mobility is described. The electrophoretic mobility is measured over a range of driving powers and the extrapolation to zero power dissipation is employed to eliminate the effect of Joule heating. These extrapolated values of electrophoretic mobility can then be used to calculate limiting ionic mobilities by making a correction for ionic strength; this somewhat complicated calculation is conveniently performed by using the freeware program PeakMaster 5. These straightforward procedures improve the agreement between experimentally determined and literature values of limiting ionic mobility by at least one order of magnitude. Using Tris-chromate BGE with a value of conductivity 0.34 S/m and ionic strength 59 mM at a modest dissipated power per unit length of 2.0 W/m, values of mobility for inorganic anions were increased by an average of 12.6% relative to their values free from the effects of Joule heating. These increases were accompanied by a reduction in mobilities due to the ionic strength effect, which was 11% for univalent and 28% for divalent inorganic ions compared to their limiting ionic mobilities. Additionally, it was possible to determine the limiting ionic mobility for a number of aromatic anions by using PeakMaster 5 to perform an ionic strength correction. A major significance of this work is in being able to use CE to obtain reliable and accurate values of electrophoretic mobilities with all its benefits, including

  7. Electrophoretic mobility of oil droplets in electrolyte and surfactant solutions.

    PubMed

    Wuzhang, Jiachen; Song, Yongxin; Sun, Runzhe; Pan, Xinxiang; Li, Dongqing

    2015-10-01

    Electrophoretic mobility of oil droplets of micron sizes in PBS and ionic surfactant solutions was measured in this paper. The experimental results show that, in addition to the applied electric field, the speed and the direction of electrophoretic motion of oil droplets depend on the surfactant concentration and on if the droplet is in negatively charged SDS solutions or in positively charged hexadecyltrimethylammonium bromide (CTAB) solutions. The absolute value of the electrophoretic mobility increases with increased surfactant concentration before the surfactant concentration reaches to the CMC. It was also found that there are two vortices around the oil droplet under the applied electric field. The size of the vortices changes with the surfactant and with the electric field. The vortices around the droplet directly affect the drag of the flow field to the droplet motion and should be considered in the studies of electrophoretic mobility of oil droplets. The existence of the vortices will also influence the determination and the interpretation of the zeta potential of the oil droplets based on the measured mobility data. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Controlled method of reducing electrophoretic mobility of various substances

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1989-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and the like is provided. The method comprises interacting the particles or cells with a polymer-linked affinity compound composed of: a hydrophilic neutral polymer such as polyethylene glycol, and an affinity component consisting of a hydrophobic compound such as a fatty acid ester, an immunocompound such as an antibody or active fragment thereof or simular macromolecule, or other ligands. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and the mobility reduction obtainable is up to 100 percent for particular particles and cells. The present invention is advantageous in that analytical electrophoretic separation can not be achieved for macromolecules, particles, and cells whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions. The present method is also advantageous in that it can be used in a variety of standard laboratory electrophoresis equipment.

  9. A novel method of measuring electrophoretic mobility of gas bubbles.

    PubMed

    Najafi, Aref Seyyed; Drelich, Jaroslaw; Yeung, Anthony; Xu, Zhenghe; Masliyah, Jacob

    2007-04-15

    Accurate measurement of electrophoretic mobility for gas bubbles is a challenging task as it requires the creation of a desired number of very small air bubbles to ensure negligible rise velocities during the course of the measurement. Here, we report a simple and reliable method for generating stable dispersions of "nano-bubbles." Preparation of such dispersions relies on the nucleation of nano-bubbles in solutions supersaturated with gas. Electrophoretic mobility of these nano-bubbles is determined by the ZetaPALS technique (Brookhaven Instruments) using Uzgiris electrodes coated with palladium. The Smoluchowski limit is assumed in the calculation of zeta potentials. In regard to reproducibility and reliability, this novel method shows a clear advantage over other existing techniques of zeta potential measurement for bubbles.

  10. Method for Single-Cell Mass and Electrophoretic Mobility Measurement

    DTIC Science & Technology

    2010-02-01

    machining of the many custom components that were needed to conduct the research described in this thesis. This work has been funded by the National Cancer ...Characterization of Bacteria by Buoyant Mass and Electrophoretic Mobility 5.1 Introduction Bacterial biofilms , layers of bacterial cells attached to solid...descriptions of the initial adhesion kinetics of biofilm formation. [19, 20] One approach to this problem is to model the dependence of cellular EPM

  11. Electrophoretic mobility of spherical particles in bounded domain.

    PubMed

    Liu, Yu-Wei; Pennathur, Sumita; Meinhart, Carl D

    2016-01-01

    In this study, we improve on our 3D steady-state model of electrophoretic motion of spherical particles in bounded fluidic channels (Liu et al., 2014) to include the effect of nonsymmetric electrolytes, and further validate this improved model with detailed comparisons to experimental data. Specifically, we use the experimentally-measured particle mobilities from the work of Semenov et al. (2013), Napoli et al. (2011), and Wynne et al. (2012) to determine the corresponding particle zeta potentials using our model, and compare these results with classical theory. Incorporating the effects of nonsymmetric electrolytes, EDL polarization, and confinement, we show that our improved model is applicable to a wide range of practical experimental conditions, for example, particles that have high zeta potentials in a bounded channel filled with nonsymmetric electrolyte solutions, where classical theory is not applicable. In addition, we find that when electrolyte concentration is comparable to the concentration of hydronium or hydroxide ions, the complicated composition of ions increases the particle mobility. Finally, increased electrophoretic mobility can be observed when buffer solutions (phosphate or borate) were used as electrolyte solutions in experiments as opposed to simple symmetric electrolytes.

  12. Brownian dynamics simulations of electrophoretic DNA separations in a sparse ordered post array.

    PubMed

    Cho, Jaeseol; Dorfman, Kevin D

    2010-08-20

    We use Brownian dynamics simulations to analyze the electrophoretic separation of lambda-DNA (48.5kbp) and T4-DNA (169kbp) in a hexagonal array of 1microm diameter posts with a 3microm center-to-center distance. The simulation method takes advantage of an efficient interpolation algorithm for the non-uniform electric field to reach an ensemble size (100 molecules) and simulation length scale (1mm) that produces meaningful results for the average electrophoretic mobility and effective diffusion (dispersion) coefficient of these macromolecules as they move through the array. While the simulated electrophoretic mobility for lambda-DNA is close to the experimental data, the simulation underestimates the magnitude of the corresponding dispersion coefficient. The simulations predict baseline resolution in a 15mm device after 7min using an electric field around 30V/cm, with the resolution increasing exponentially as the electric field further decreases. The mobility and dispersivity data point out two essential phenomena that have been overlooked in previous models of DNA electrophoresis in post arrays: the relaxation time between collisions and simultaneous collisions with multiple posts.

  13. Electrophoretic dynamics of self-assembling branched DNA structures

    NASA Astrophysics Data System (ADS)

    Heuer, Daniel Milton

    This study advances our understanding of the electrophoretic dynamics of branched biopolymers and explores technologies designed to exploit their unique properties. New self-assembly techniques were developed to create branched DNA for visualization via fluorescence microscopy. Experiments in fixed gel networks reveal a distinct trapping behavior, in contrast with linear topologies. The finding that detection can be achieved by introducing a branch point contributes significantly to the field of separation science and can be exploited to develop new applications. Results obtained in polymer solutions point to identical mobilities for branched and linear topologies, despite large differences in their dynamics. This finding led to a new description of electrophoresis based on non-Newtonian viscoelastic effects in the electric double layer surrounding a charged object. This new theoretical framework presents a new outlook important not only to the electrophoretic physics of nucleic acids, but all charged objects including proteins, colloids, and nanoparticles. To study the behavior of smaller biopolymers, such as restriction fragments and recombination intermediates, a library of symmetrically branched DNA was synthesized followed by characterization in gels. The experimental results contribute a large body of information relating molecular architecture and the dynamics of rigid structures in an electric field. The findings allow us to create new separation technologies based on topology. These contributions can also be utilized in a number of different applications including the study of recombination intermediates and the separation of proteins according to structure. To demonstrate the importance of these findings, a sequence and mutation detection technique was envisioned and applied for genetic analysis. Restriction fragments from mutation "hotspots" in the p53 tumor suppressor gene, known to play a role in cancer development, were analyzed with this technique

  14. Electrophoretic mobilities of counterions and a polymer in cylindrical pores

    PubMed Central

    Singh, Sunil P.; Muthukumar, M.

    2014-01-01

    We have simulated the transport properties of a uniformly charged flexible polymer chain and its counterions confined inside cylindrical nanopores under an external electric field. The hydrodynamic interaction is treated by describing the solvent molecules explicitly with the multiparticle collision dynamics method. The chain consisting of charged monomers and the counterions interact electrostatically with themselves and with the external electric field. We find rich behavior of the counterions around the polymer under confinement in the presence of the external electric field. The mobility of the counterions is heterogeneous depending on their location relative to the polymer. The adsorption isotherm of the counterions on the polymer depends nonlinearly on the electric field. As a result, the effective charge of the polymer exhibits a sigmoidal dependence on the electric field. This in turn leads to a nascent nonlinearity in the chain stretching and electrophoretic mobility of the polymer in terms of their dependence on the electric field. The product of the electric field and the effective polymer charge is found to be the key variable to unify our simulation data for various polymer lengths. Chain extension and the electrophoretic mobility show sigmoidal dependence on the electric field, with crossovers from the linear response regime to the nonlinear regime and then to the saturation regime. The mobility of adsorbed counterions is nonmonotonic with the electric field. For weaker and moderate fields, the adsorbed counterions move with the polymer and at higher fields they move opposite to the polymer's direction. We find that the effective charge and the mobility of the polymer decrease with a decrease in the pore radius. PMID:25240366

  15. Electrophoretic mobility of cells in a vertical Ficoll gradiant

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Todd, P. W.; Kunze, M. E.; Gaines, R. A.

    1985-01-01

    The upward migration of living cells and test particles under the influence of a constant electric field in a low conductivity Ficoll gradient occurs at nearly constant velocity. Viscosity and neutral polymer concentration affect migration rate. Decreasing viscosity speeds up the particle migration, decreasing neutral polymer (Ficoll) concentration, slows particle migration, since electrophoretic mobility increases approximately linearly with neutral polymer concentration. Neutral polymers interact with the cell surface to effectively raise its zeta potential. An analytic function was developed from the known dependence of these physical variables on migration distance; the analysis expresses migration velocity as an explicit function of position in the density gradient. It predicts an almost linear increase in velocity of about 12 to 16% over the working region of the gradient. It was numerically integrated and correctly predicts cell migration distance vs time curves without the use of any fitted parameters. The resulting migration curves follow the expected slowly varying exponential form that closely resembles a straight line. The ability to determine standard electrophoretic mobilities from such curves depends on knowledge of the effect of Ficoll on the zeta potential of the cell type that is separated.

  16. Electrophoretic mobility of cells in a vertical Ficoll gradiant

    NASA Technical Reports Server (NTRS)

    Plank, L. D.; Todd, P. W.; Kunze, M. E.; Gaines, R. A.

    1985-01-01

    The upward migration of living cells and test particles under the influence of a constant electric field in a low conductivity Ficoll gradient occurs at nearly constant velocity. Viscosity and neutral polymer concentration affect migration rate. Decreasing viscosity speeds up the particle migration, decreasing neutral polymer (Ficoll) concentration, slows particle migration, since electrophoretic mobility increases approximately linearly with neutral polymer concentration. Neutral polymers interact with the cell surface to effectively raise its zeta potential. An analytic function was developed from the known dependence of these physical variables on migration distance; the analysis expresses migration velocity as an explicit function of position in the density gradient. It predicts an almost linear increase in velocity of about 12 to 16% over the working region of the gradient. It was numerically integrated and correctly predicts cell migration distance vs time curves without the use of any fitted parameters. The resulting migration curves follow the expected slowly varying exponential form that closely resembles a straight line. The ability to determine standard electrophoretic mobilities from such curves depends on knowledge of the effect of Ficoll on the zeta potential of the cell type that is separated.

  17. Interplay between electrophoretic mobility and intrinsic viscosity of polypeptide chains.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, María V

    2012-03-01

    The present work is motivated specifically by the need to find a simple interplay between experimental values of electrophoretic mobility and intrinsic viscosity (IV) of polypeptides. The connection between these two properties, as they are evaluated experimentally in a formulated dilute solution, may provide relevant information concerning the physicochemical characterization and separation of electrically charged chains such as polypeptides. Based on this aspect, a study on the relation between the effective electrophoretic mobility and the IV of the following globular proteins is carried out: bovine carbonic anhydrase, staphylococcal nuclease, human carbonic anhydrase, lysozyme, human serum albumin. The basic interpretation of the IV through polypeptide chain conformations involves two unknowns: one is the Flory characteristic ratio involving short-range intramolecular interactions and the other is the Mark-Houwink exponent associated with large-range intramolecular interactions. Here, it will be shown via basic and well-established electrokinetic theories and scaling concepts that the IV and global chain flexibility of polypeptides in dilute solutions may be estimated from capillary zone electrophoresis, in addition to classical transport properties. The polypeptide local chain flexibility may change due to electrostatic interactions among closer chain ionizing groups and the hindrance effect of their associated structural water.

  18. Microfluidic devices for DNA sequencing: sample preparation and electrophoretic analysis.

    PubMed

    Paegel, Brian M; Blazej, Robert G; Mathies, Richard A

    2003-02-01

    Modern DNA sequencing 'factories' have revolutionized biology by completing the human genome sequence, but in the race to completion we are left with inefficient, cumbersome, and costly macroscale processes and supporting facilities. During the same period, microfabricated DNA sequencing, sample processing and analysis devices have advanced rapidly toward the goal of a 'sequencing lab-on-a-chip'. Integrated microfluidic processing dramatically reduces analysis time and reagent consumption, and eliminates costly and unreliable macroscale robotics and laboratory apparatus. A microfabricated device for high-throughput DNA sequencing that couples clone isolation, template amplification, Sanger extension, purification, and electrophoretic analysis in a single microfluidic circuit is now attainable.

  19. Relationship between electrophoretic mobility of erythrocytes and blood erythrocyte count in rats.

    PubMed

    Matyushichev, V B; Shamratova, V G

    2005-03-01

    A significant curvilinear relationship was found between erythrocyte count in rat blood and electrokinetic characteristics of these cells. Electrophoretic mobility of erythrocytes remained unchanged, slightly increased, or decreased with increasing cell count in the vascular bed depending on animal state. Excessive increase in the number of erythrocytes was accompanied by accumulation of cells with low electrophoretic mobility in the electric field.

  20. Electrophoretic High Molecular Weight DNA Purification Enables Optical Mapping

    PubMed Central

    Maydan, Jason; Thomas, Matthew; Tabanfar, Leyla; Mai, Laura; Poon, Hau-Ling; Pe, Joel; Hahn, Kristen; Goji, Noriko; Amoako, Kingsley; Marziali, Andre; Hanson, Dan

    2013-01-01

    Optical mapping generates an ordered restriction map from single, long DNA molecules. By overlapping restriction maps from multiple molecules, a physical map of entire chromosomes and genomes is constructed, greatly facilitating genome assembly in next generation sequencing projects, comparative genomics and strain typing. However, optical mapping relies on a method of preparing high quality DNA >250 kb in length, which can be challenging from some organisms and sample types. Here we demonstrate the ability of Boreal Genomics' Aurora instrument to provide pure, high molecular weight (HMW) DNA 250-1,100 kb in length, ideally suited for optical mapping. The Aurora performs electrophoretic DNA purification within an agarose gel in reusable cartridges, protecting long DNA molecules from shearing forces associated with liquid handling steps common to other purification methods. DNA can be purified directly from intact cells embedded and lysed within an agarose gel, preserving the highest molecular weight DNA possible while achieving exceptional levels of purity. The Aurora delivers DNA in a buffer solution, where DNA can be condensed and protected from shearing during recovery with a pipette. DNA is then returned to its regular coiled state by simple dilution prior to optical mapping. Here we present images showing HMW DNA purification taking place in the Aurora and subsequent images of single DNA molecules on OpGen's Argus® Optical Mapping System. Future work will focus on further optimizing Aurora HMW DNA purification to bias DNA recovery in favor of only the longest molecules in a sample, maximizing the benefits of optical mapping.

  1. Electrophoretic mobility patterns of collagen following laser welding

    NASA Astrophysics Data System (ADS)

    Bass, Lawrence S.; Moazami, Nader; Pocsidio, Joanne O.; Oz, Mehmet C.; LoGerfo, Paul; Treat, Michael R.

    1991-06-01

    Clinical application of laser vascular anastomosis in inhibited by a lack of understanding of its mechanism. Whether tissue fusion results from covalent or non-covalent bonding of collagen and other structural proteins is unknown. We compared electrophoretic mobility of collagen in laser treated and untreated specimens of rat tail tendon (>90% type I collagen) and rabbit aorta. Welding was performed, using tissue shrinkage as the clinical endpoint, using the 808 nm diode laser (power density 14 watts/cm2) and topical indocyanine green dye (max absorption 805 nm). Collagen was extracted with 8 M urea (denaturing), 0.5 M acetic acid (non-denaturing) and acetic acid/pepsin (cleaves non- helical protein). Mobility patterns on gel electrophoresis (SDS-PAGE) after urea or acetic acid extraction were identical in the lasered and control tendon and vessel (confirmed by optical densitometry), revealing no evidence of formation of novel covalent bonds. Alpha and beta band intensity was diminished in pepsin incubated lasered specimens compared with controls (optical density ratio 0.00 +/- 9 tendon, 0.65 +/- 0.12 aorta), indicating the presence of denatured collagen. With the laser parameters used, collagen is denatured without formation of covalent bonds, suggesting that non-covalent interaction between denatured collagen molecules may be responsible for the weld. Based on this mechanism, welding parameters can be chosen which produce collagen denaturation without cell death.

  2. Evaluation of DNA bending models in their capacity to predict electrophoretic migration anomalies of satellite DNA sequences.

    PubMed

    Matyášek, Roman; Fulneček, Jaroslav; Kovařík, Aleš

    2013-09-01

    DNA containing a sequence that generates a local curvature exhibits a pronounced retardation in electrophoretic mobility. Various theoretical models have been proposed to explain relationship between DNA structural features and migration anomaly. Here, we studied the capacity of 15 static wedge-bending models to predict electrophoretic behavior of 69 satellite monomers derived from four divergent families. All monomers exhibited retarded mobility in PAGE corresponding to retardation factors ranging 1.02-1.54. The curvature varied both within and across the groups and correlated with the number, position, and lengths of A-tracts. Two dinucleotide models provided strong correlation between gel mobility and curvature prediction; two trinucleotide models were satisfactory while remaining dinucleotide models provided intermediate results with reliable prediction for subsets of sequences only. In some cases, similarly shaped molecules exhibited relatively large differences in mobility and vice versa. Generally less accurate predictions were obtained in groups containing less homogeneous sequences possessing distinct structural features. In conclusion, relatively universal theoretical models were identified suitable for the analysis of natural sequences known to harbor relatively moderate curvature. These models could be potentially applied to genome wide studies. However, in silico predictions should be viewed in context of experimental measurement of intrinsic DNA curvature. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.

    1985-01-01

    A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

  4. Effect of passage number on electrophoretic mobility distributions of cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.

    1985-01-01

    A systematic investigation was undertaken to characterize population shifts that occur in cultured human embryonic kidney cells as a function of passage number in vitro after original explantation. This approach to cell population shift analysis follows the suggestion of Mehreshi, Klein and Revesz that perturbed cell populations can be characterized by electrophoretic mobility distributions if they contain subpopulations with different electrophoretic mobilities. It was shown that this is the case with early passage cultured human embryo cells.

  5. Electrophoretic mobilities of cultured human embryonic kidney cells in various buffers

    NASA Technical Reports Server (NTRS)

    1985-01-01

    Data on the electrophoretic mobility distributions of cells in the new D-1 buffer and the interlaboratory standardization of urokinase assay methods are presented. A table of cell strains and recent data on cell dispersal methods are also included. It was decided that glycerol in A-1 electrophoretic mobility data on cultured human embryonic kidney cells subjected to electrophoresis in this buffer. The buffer composition is presented.

  6. Enhanced electrophoretic DNA separation in photonic crystal fiber.

    PubMed

    Sun, Yi; Nguyen, Nam-Trung; Kwok, Yien Chian

    2009-07-01

    Joule heating generated by the electrical current in capillary electrophoresis leads to a temperature gradient along the separation channel and consequently affects the separation quality. We describe a method of reducing the Joule heating effect by incorporating photonic crystal fiber into a micro capillary electrophoresis chip. The photonic crystal fiber consists of a bundle of extremely narrow hollow channels, which ideally work as separation columns. Electrophoretic separation of DNA fragments was simultaneously but independently carried out in 54 narrow capillaries with a diameter of 3.7 microm each. The capillary bundle offers more efficient heat dissipation owing to the high surface-to-volume ratio. Under the same electrical field strength, notable improvement in resolution was obtained in the capillary bundle chip.

  7. Effective Electrophoretic Mobilities and Charges of Anti-VEGF Proteins Determined by Capillary Zone Electrophoresis

    PubMed Central

    Li, S. Kevin; Liddell, Mark R.; Wen, He

    2011-01-01

    Macromolecules such as therapeutic proteins currently serve an important role in the treatment of eye diseases such as wet age-related macular degeneration and diabetic retinopathy. Particularly, bevacizumab and ranibizumab have been shown to be effective in the treatment of these diseases. Iontophoresis can be employed to enhance ocular delivery of these macromolecules, but the lack of information on the properties of these macromolecules has hindered its development. The objectives of the present study were to determine the effective electrophoretic mobilities and charges of bevacizumab, ranibizumab, and model compound polystyrene sulfonate (PSS) using capillary zone electrophoresis. Salicylate, lidocaine, and bovine serum albumin (BSA), which have known electrophoretic mobilities in the literature, were also studied to validate the present technique. The hydrodynamic radii and diffusion coefficients of BSA, bevacizumab, ranibizumab, and PSS were measured by dynamic light scattering. The effective charges were calculated using the Einstein relation between diffusion coefficient and electrophoretic mobility and the Henry equation. The results show that bevacizumab and ranibizumab have low electrophoretic mobilities and are net negatively charged in phosphate buffered saline (PBS) of pH 7.4 and 0.16 M ionic strength. PSS has high negative charge but the electrophoretic mobility in PBS is lower than that expected from the polymer structure. The present study demonstrated that capillary electrophoresis could be used to characterize the mobility and charge properties of drug candidates in the development of iontophoretic drug delivery. PMID:21269789

  8. Effective electrophoretic mobilities and charges of anti-VEGF proteins determined by capillary zone electrophoresis.

    PubMed

    Li, S Kevin; Liddell, Mark R; Wen, He

    2011-06-01

    Macromolecules such as therapeutic proteins currently serve an important role in the treatment of eye diseases such as wet age-related macular degeneration and diabetic retinopathy. Particularly, bevacizumab and ranibizumab have been shown to be effective in the treatment of these diseases. Iontophoresis can be employed to enhance ocular delivery of these macromolecules, but the lack of information on the properties of these macromolecules has hindered its development. The objectives of the present study were to determine the effective electrophoretic mobilities and charges of bevacizumab, ranibizumab, and model compound polystyrene sulfonate (PSS) using capillary zone electrophoresis. Salicylate, lidocaine, and bovine serum albumin (BSA), which have known electrophoretic mobilities in the literature, were also studied to validate the present technique. The hydrodynamic radii and diffusion coefficients of BSA, bevacizumab, ranibizumab, and PSS were measured by dynamic light scattering. The effective charges were calculated using the Einstein relation between diffusion coefficient and electrophoretic mobility and the Henry equation. The results show that bevacizumab and ranibizumab have low electrophoretic mobilities and are net negatively charged in phosphate buffered saline (PBS) of pH 7.4 and 0.16M ionic strength. PSS has high negative charge but the electrophoretic mobility in PBS is lower than that expected from the polymer structure. The present study demonstrated that capillary electrophoresis could be used to characterize the mobility and charge properties of drug candidates in the development of iontophoretic drug delivery.

  9. An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides.

    PubMed

    Hsieh, Yi-Wen; Alqadah, Amel; Chuang, Chiou-Fen

    2016-11-29

    Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2(G73E) protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2(G73E) proteins) as a biological example.

  10. Electrophoretic transfer of DNA, RNA and protein onto diazobenzyloxymethyl (DBM) - paper.

    PubMed Central

    Stellwag, E J; Dahlberg, A E

    1980-01-01

    A method has been developed for the electrophoretic transfer of DNA, RNA, protein and ribonucleoprotein particles from a variety of gels onto diazobenzyloxymethyl (DBM) - paper. Conditions for the electrophoretic transfer of these macromolecules have been optimized to allow for nearly quantitative transfer and covalent coupling. DNA and RNA electrophoretically transferred to DBM-paper retain their ability to hybridize with specific probes. The high efficiency of transfer and the high capacity of DBM-paper for nucleic acids makes possible the sensitive detection of specific nucleotide sequences. Similar efficiency is achieved in electrophoretic transfer and covalent coupling of proteins to DBM-paper. Macromolecules can also be electrophoretically transferred and bound to DBM-paper incapable of covalent bond formation. Their elution from the paper in high salt provides a new and useful preparative method for isolation of DNA, RNA and protein. Images PMID:6158735

  11. A DC electrophoresis method for determining electrophoretic mobility through the pressure driven negation of electro osmosis

    NASA Astrophysics Data System (ADS)

    Karam, Pascal; Pennathur, Sumita

    2016-11-01

    Characterization of the electrophoretic mobility and zeta potential of micro and nanoparticles is important for assessing properties such as stability, charge and size. In electrophoretic techniques for such characterization, the bulk fluid motion due to the interaction between the fluid and the charged surface must be accounted for. Unlike current industrial systems which rely on DLS and oscillating potentials to mitigate electroosmotic flow (EOF), we propose a simple alternative electrophoretic method for optically determining electrophoretic mobility using a DC electric fields. Specifically, we create a system where an adverse pressure gradient counters EOF, and design the geometry of the channel so that the flow profile of the pressure driven flow matches that of the EOF in large regions of the channel (ie. where we observe particle flow). Our specific COMSOL-optimized geometry is two large cross sectional areas adjacent to a central, high aspect ratio channel. We show that this effectively removes EOF from a large region of the channel and allows for the accurate optical characterization of electrophoretic particle mobility, no matter the wall charge or particle size.

  12. Characterization of the Cell Surface Properties of Drinking Water Pathogens by Microbial Adhesion to Hydrocarbon and Electrophoretic Mobility Measurements

    EPA Science Inventory

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...

  13. Characterization of the Cell Surface Properties of Drinking Water Pathogens by Microbial Adhesion to Hydrocarbon and Electrophoretic Mobility Measurements

    EPA Science Inventory

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregati...

  14. ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS

    EPA Science Inventory

    The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...

  15. ELECTROPHORETIC MOBILITIES OF ESCHERICHIA COLI 0157:H7 AND WILD-TYPE ESCHERICHIA COLI STRAINS

    EPA Science Inventory

    The electrophoretic mobility (EPM) of a number of human-virulent and "wild-type" Escherichia coli strains in phosphate buffered water was measured. The impact of pH, ionic strength, cation type (valence) and concentration, and bacterial strain on the EPM was investigated. Resul...

  16. Controlled method of reducing electrophoretic mobility of macromolecules, particles, or cells

    NASA Technical Reports Server (NTRS)

    Vanalstine, James M. (Inventor)

    1992-01-01

    A method of reducing electrophoretic mobility of macromolecules, particles, cells, and other substances is provided which comprises interacting in a conventional electrophoretic separating procedure, the substances with a polymer-linked affinity compound comprised of a hydrophilic neutral polymer such as polyethylene glycol bound to a second component such as a hydrophobic compound, an immunocompound such as an antibody or antibody active fragment, or a ligand such as a hormone, drug, antigen, or a hapten. The reduction of electrophoretic mobility achieved is directly proportional to the concentration of the polymer-linked affinity compound employed, and such reduction can comprise up to 100 percent for particular particles and cells. The present invention is advantageous in that electrophoretic separation can now be achieved for substances whose native surface charge structure had prevented them from being separated by normal electrophoretic means. Depending on the affinity component utilized, separation can be achieved on the basis of the specific/irreversible, specific/reversible, semi-specific/reversible, relatively nonspecific/reversible, or relatively nonspecific/irreversible ligand-substance interactions.

  17. Computer-controlled pulsed magnetic field gradient NMR system for electrophoretic mobility measurements

    NASA Astrophysics Data System (ADS)

    Saarinen, Timothy R.; Woodward, W. Stephen

    1988-05-01

    A computer-controlled pulsed magnetic field gradient NMR (PFGNMR) system for making electrophoretic mobility and diffusion measurements is described. Emphasis is placed on the design and capabilities of the gradient and electrophoretic pulse generators. Various pulse sequences can be applied by the programmable gradient generator that can produce 0- to 10-A current pulses for 0 to 13 ms and continuous currents from 0 to 50 mA. The pulse areas are reproducible to within approximately 1 ppm. A pair of opposed Helmholtz coils in the probe create linear magnetic field gradients during the current pulses. Electric fields are applied across a U-tube electrophoretic cell by a 550-V constant current generator.

  18. Simultaneous sizing and electrophoretic mobility measurement of sub-micron particles using Brownian motion

    PubMed Central

    Palanisami, Akilan; Miller, John H.

    2011-01-01

    The size and surface chemistry of micron scale particles are of fundamental importance in studies of biology and air particulate pollution. However, typical electrophoretic measurements of these and other sub-micron scale particles (300 nm – 1 μm) cannot resolve size information within heterogeneous mixtures unambiguously. Using optical microscopy, we monitor electrophoretic motion together with the Brownian velocity fluctuations—using the latter to measure size by either the Green-Kubo relation or by calibration from known size standards. Particle diameters are resolved to ±12% with 95% confidence. Strikingly, the size resolution improves as particle size decreases due to the increased Brownian motion. The sizing ability of the Brownian assessed electrophoresis method described here complements the electrophoretic mobility resolution of traditional capillary electrophoresis. PMID:20882556

  19. Size and DNA distributions of electrophoretically separated cultured human kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Todd, P. W.

    1985-01-01

    Electrophoretic purification of purifying cultured cells according to function presumes that the size of cycle phase of a cell is not an overriding determinant of its electrophoretic velocity in an electrophoretic separator. The size distributions and DNA distributions of fractions of cells purified by density gradient electrophoresis were determined. No systematic dependence of electrophoretic migration upward in a density gradient column upon either size or DNA content were found. It was found that human leukemia cell populations, which are more uniform function and found in all phases of the cell cycle during exponential growth, separated on a vertical sensity gradient electrophoresis column according to their size, which is shown to be strictly cell cycle dependent.

  20. Electrophoretic mobilities of neutral analytes and electroosmotic flow markers in aqueous solutions of Hofmeister salts.

    PubMed

    Křížek, Tomáš; Kubíčková, Anna; Hladílková, Jana; Coufal, Pavel; Heyda, Jan; Jungwirth, Pavel

    2014-03-01

    Small neutral organic compounds have traditionally the role of EOF markers in electrophoresis, as they are expected to have zero electrophoretic mobility in external electric fields. The BGE contains, however, ions that have unequal affinities to the neutral molecules, which in turn results in their mobilization. In this study we focused on two EOF markers-thiourea and DMSO, as well as on N-methyl acetamide (NMA) as a model of the peptide bond. By means of CE and all atom molecular dynamics simulations we explored mobilization of these neutral compounds in large set of Hofmeister salts. Employing a statistical mechanics approach, we were able to reproduce by simulations the experimental electrophoretic mobility coefficients. We also established the role of the chemical composition of marker and the BGE on the measured electrophoretic mobility coefficient. For NMA, we interpreted the results in terms of the relative affinities of cations versus anions to the peptide bond. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Cobalt ferrite nanoparticles with improved aqueous colloidal stability and electrophoretic mobility

    SciTech Connect

    Munjal, Sandeep Khare, Neeraj

    2016-04-13

    We have synthesized CoFe{sub 2}O{sub 4} (CFO) nanoparticles of size ∼ 12.2 nm by hydrothermal synthesis method. To control the size of these CFO nanoparticles, oleic acid was used as a surfactant. The inverse spinel phase of the synthesized nanoparticles was confirmed by X-ray diffraction method. As synthesized oleic acid coated CFO (OA@CFO) nanoparticles has very less electrophoretic mobility in the water and are not water dispersible. These OA@CFO nanoparticles were successfully turned into water soluble phase with a better colloidal aqueous stability, through a chemical treatment using citric acid. The modified citric acid coated CFO (CA@CFO) nanoparticles were dispersible in water and form a stable aqueous solution with high electrophoretic mobility.

  2. Electrophoretic mobility of silica particles in a mixture of toluene and ethanol at different particle concentrations.

    PubMed

    Medrano, M; Pérez, A T; Lobry, L; Peters, F

    2009-10-20

    In this paper we present measurements of the electrophoretic mobility of colloidal particles by using heterodyne detection of light scattering. The measurements have been made up to concentrations of 5.4% silica nanoparticles, with a diameter on the order of 80 nm, in a mixture of 70% toluene and 30% ethanol. To make possible the measurements at these concentrations, the liquid mixture is chosen so as to match the index of refraction of the particles, thus resulting in a transparent suspension.

  3. Electrophoretic Mobilities of Escherichia coli O157:H7 and Wild-Type Escherichia coli Strains

    PubMed Central

    Lytle, Darren A.; Rice, Eugene W.; Johnson, Clifford H.; Fox, Kim R.

    1999-01-01

    The electrophoretic mobilities (EPMs) of a number of Escherichia coli O157:H7 and wild-type E. coli strains were measured. The effects of pH and ionic strength on the EPMs were investigated. The EPMs of E. coli O157:H7 strains differed from those of wild-type strains. As the suspension pH decreased, the EPMs of both types of strains increased. PMID:10388724

  4. Some Properties of the Chloroplast Envelope as Revealed by Electrophoretic Mobility Studies of Intact Chloroplasts 1

    PubMed Central

    Stocking, C. Ralph; Franceschi, Vincent R.

    1982-01-01

    The electrophoretic mobility of mature spinach (Spinacia oleracea L. var. Americana) chloroplasts sampled over a 7-month period was between −2.03 and −2.45 micrometers per second per volt per centimeter when suspended in a solution containing 1 millimolar CaCl2. The surface charge density of EDTA-treated chloroplasts was calculated to be −7,400 electrostatic units per square centimeter representing, on the average, one electronic charge per 645 square Angstroms. Electrophoretic mobility increases during plastid maturation. Calcium, but not magnesium, generally stabilized the envelope of isolated plastids against small increases in surface charge that occur with time in the absence of calcium. Pronase caused a sharp, but temporary, decrease in the electrophoretic mobility of chloroplasts. This was interpreted as representing a transient binding of pronase to the envelope surface during proteolysis. No −SH groups were detected on the surface of the plastid envelope. Inasmuch as the isoelectric point of intact chloroplasts was found to be at pH 4.5, it is likely that the major part of the total surface charge results from the presence of exposed carboxyl groups of intrinsic envelope proteins that are not readily hydrolyzed by mild pronase treatment. PMID:16662663

  5. Fenton fragmentation for faster electrophoretic on chip purification of amplifiable genomic DNA.

    PubMed

    Hakenberg, S; Hügle, M; Meyer, P; Behrmann, O; Dame, G; Urban, G A

    2015-05-15

    With a rapid and simple actuation protocol electrophoretic nucleic acid extraction is easy automatable, requires no moving parts, is easy to miniaturize and furthermore possesses a size dependent cut-off filter adjustable by the pore size of the hydrogel. However electrophoretic nucleic acid extraction from bacteria has so far been applied mainly for short RNA targets. One of the reasons is that electrophoretic processing of unfragmented genomic DNA strands is time-consuming, because of the length. Here DNA fragmentation would accelerate extraction and isolation. We introduce on-chip lysis and non-enzymatic DNA cleavage directly followed by a purifying step for receiving amplifiable DNA fragments from bacteria in less than 25 min. In contrast to restriction enzymes the Fenton reaction is known to cleave DNA without nucleotide specificity. The reaction mix contains iron(II) EDTA, sodium ascorbate, hydrogen peroxide and lysozyme. The degree of fragmentation can be adjusted by the concentration of reagents. The results enable electrophoretic extraction methods to unspecifically process long genomic DNA in a short time frame, e.g. for pathogen detection in a lab-on-a-chip format. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. The 'Densitometric Image Analysis Software' and its application to determine stepwise equilibrium constants from electrophoretic mobility shift assays.

    PubMed

    van Oeffelen, Liesbeth; Peeters, Eveline; Nguyen Le Minh, Phu; Charlier, Daniël

    2014-01-01

    Current software applications for densitometric analysis, such as ImageJ, QuantityOne (BioRad) and the Intelligent or Advanced Quantifier (Bio Image) do not allow to take the non-linearity of autoradiographic films into account during calibration. As a consequence, quantification of autoradiographs is often regarded as problematic, and phosphorimaging is the preferred alternative. However, the non-linear behaviour of autoradiographs can be described mathematically, so it can be accounted for. Therefore, the 'Densitometric Image Analysis Software' has been developed, which allows to quantify electrophoretic bands in autoradiographs, as well as in gels and phosphorimages, while providing optimized band selection support to the user. Moreover, the program can determine protein-DNA binding constants from Electrophoretic Mobility Shift Assays (EMSAs). For this purpose, the software calculates a chosen stepwise equilibrium constant for each migration lane within the EMSA, and estimates the errors due to non-uniformity of the background noise, smear caused by complex dissociation or denaturation of double-stranded DNA, and technical errors such as pipetting inaccuracies. Thereby, the program helps the user to optimize experimental parameters and to choose the best lanes for estimating an average equilibrium constant. This process can reduce the inaccuracy of equilibrium constants from the usual factor of 2 to about 20%, which is particularly useful when determining position weight matrices and cooperative binding constants to predict genomic binding sites. The MATLAB source code, platform-dependent software and installation instructions are available via the website http://micr.vub.ac.be.

  7. Electrophoretic Mobility Study of the Adsorption of Alkyl Xanthate Ions on Galena and Sphalerite.

    PubMed

    Song, S.; Lopez-Valdivieso, A.; Ojeda-Escamilla, M. C.

    2001-05-01

    The adsorption of ethyl and amyl xanthate ions on galena and sphalerite fines has been studied using electrophoretic light-scattering (ELS) measurements. It was performed on galena and sphalerite (<2&mgr;m) in aqueous solution at different potassium ethyl xanthate (PEX) and potassium amyl xanthate (PAX) concentrations. It has been observed that the presence of PEX or PAX caused the isoelectric points (IEP) of galena and sphalerite fines to shift and the electrophoretic mobility to reverse in sign, indicating that the xanthate ions chemisorbed on galena and sphalerite surfaces. This adsorption markedly broadened the electrophoretic mobility distribution of the mineral fines, suggesting that the populations of the particles have quite different adsorption densities of xanthate ions, and therefore the particle hydrophobicity was different. This phenomenon might be attributable to the effect of the hemimicelle adsorption of the xanthate ions on the minerals, the nonuniform distribution of active sites and their degree of activity, the effect of particle size and shape, etc. The nonuniform adsorption has been found to increase with increasing PEX or PAX concentration, reaching a maximum at a medium concentration followed by a decline. Also, experimental results have demonstrated that the nonuniform adsorption of the xanthate ions is much stronger on sphalerite than on galena, which may explain why sphalerite has a worse flotation response than galena when alkyl xanthates are used as collectors in flotation systems. Copyright 2001 Academic Press.

  8. Assessing 2D electrophoretic mobility spectroscopy (2D MOSY) for analytical applications.

    PubMed

    Fang, Yuan; Yushmanov, Pavel V; Furó, István

    2016-12-08

    Electrophoretic displacement of charged entity phase modulates the spectrum acquired in electrophoretic NMR experiments, and this modulation can be presented via 2D FT as 2D mobility spectroscopy (MOSY) spectra. We compare in various mixed solutions the chemical selectivity provided by 2D MOSY spectra with that provided by 2D diffusion-ordered spectroscopy (DOSY) spectra and demonstrate, under the conditions explored, a superior performance of the former method. 2D MOSY compares also favourably with closely related LC-NMR methods. The shape of 2D MOSY spectra in complex mixtures is strongly modulated by the pH of the sample, a feature that has potential for areas such as in drug discovery and metabolomics. Copyright © 2016 The Authors. Magnetic Resonance in Chemistry published by John Wiley & Sons Ltd. StartCopTextCopyright © 2016 The Authors. Magnetic Resonance in Chemistry published by John Wiley & Sons Ltd.

  9. High-Throughput Electrophoretic Mobility Shift Assays for Quantitative Analysis of Molecular Binding Reactions

    PubMed Central

    2015-01-01

    We describe a platform for high-throughput electrophoretic mobility shift assays (EMSAs) for identification and characterization of molecular binding reactions. A photopatterned free-standing polyacrylamide gel array comprised of 8 mm-scale polyacrylamide gel strips acts as a chassis for 96 concurrent EMSAs. The high-throughput EMSAs was employed to assess binding of the Vc2 cyclic-di-GMP riboswitch to its ligand. In optimizing the riboswitch EMSAs on the free-standing polyacrylamide gel array, three design considerations were made: minimizing sample injection dispersion, mitigating evaporation from the open free-standing polyacrylamide gel structures during electrophoresis, and controlling unit-to-unit variation across the large-format free-standing polyacrylamide gel array. Optimized electrophoretic mobility shift conditions allowed for 10% difference in mobility shift baseline resolution within 3 min. The powerful 96-plex EMSAs increased the throughput to ∼10 data/min, notably more efficient than either conventional slab EMSAs (∼0.01 data/min) or even microchannel based microfluidic EMSAs (∼0.3 data/min). The free-standing polyacrylamide gel EMSAs yielded reliable quantification of molecular binding and associated mobility shifts for a riboswitch–ligand interaction, thus demonstrating a screening assay platform suitable for riboswitches and potentially a wide range of RNA and other macromolecular targets. PMID:25233437

  10. Passive trapping of rigid rods due to conformation-dependent electrophoretic mobility.

    PubMed

    Pandey, Harsh; Szafran, Sylvia A; Underhill, Patrick T

    2016-03-28

    We present computer simulations of a rigid rod in a combination of an extensional fluid flow and extensional electric field. The electrophoretic mobility of the rod is different parallel or perpendicular to the rod. The dependence of the mobility on the conformation (orientation) leads to a new phenomenon where the rods can be passively trapped in all directions at the stagnation point. This contrasts with the behavior in either fluid flow or electric field alone, in which an object can be pushed towards the stagnation point along some directions but is pushed away in others. We have determined the state space where trapping occurs and have developed a model that describes the strength of trapping when it does occur. This new phenomenon could be used in the future to separate objects based on a coupling between their mobility and ability to be oriented.

  11. Electrophoretic mobility of a growing cell studied by photonic force microscope

    NASA Astrophysics Data System (ADS)

    Tonin, Mario; Bálint, Stefan; Mestres, Pau; Martınez, Ignacio A.; Petrov, Dmitri

    2010-11-01

    Living cells have spatially localized charged groups such as nucleus, cell walls, and others that can move in an external electric field providing the cell electrophoretic mobility (EPM). We suggest to monitor the EPM of a single living cell during its growth using optical tweezers combined with a position detector. As an example, we studied the EPM during the yeast growth, and we observed a nonmonotonic behavior of the EPM during the cell cycle, such as that the maximal EPM was observed at the initial stage of the growth, strongly reducing when the cell cycle is near its final stage.

  12. A quantitative structure property relationship study of electrophoretic mobility of analytes in capillary zone electrophoresis.

    PubMed

    Jouyban, A; Yousefi, B H

    2003-07-01

    A quantitative structure property relationship (QSPR) is proposed to calculate the electrophoretic mobility of analytes in capillary zone electrophoresis. The proposed model employs logarithm of the electrophoretic mobility (ln micro) as dependent variable and partial charge (PQ), surface area (V(2/3)), total energy (TE), heat of formation (DeltaH(f)) and molecular refractivity (MR) as independent variables whose calculated using AM1 (Austin model 1) semi-empirical quantum mechanics method by HyperChem 7.0 software. The general form of the model is: ln micro =K(0)+K(1)PQ+K(2)V(2/3)+K(3)TE+K(4)DeltaH(f)+K(5)MR, where K(0)-K(5) are the model constants computed using a least-square method. The applicability of the model on real mobility data has been studied employing five experimental data sets of beta-blockers, benzoate derivatives, non-steroidal anti-inflammatory drugs, sulfonamides and amines in different buffers. The accuracy of the model is assessed using absolute average relative deviation (AARD) and the overall AARD value. The obtained AARD for the sets studied are 1.0 (N=10), 2.1 (N=26), 0.8 (N=11), 0.6 (N=13) and 2.7% (N=18), respectively, and the overall AARD is 1.4%. The model is cross-validated using one leave out technique and the obtained overall AARD is 1.8%. To further investigate on the applicability of the proposed model, the prediction capability of the model is evaluated by employing a minimum number of six experimental data points as training set, and predicting the mobility of other data points using trained models. The obtained overall AARD (for 48 predicted data points) is 5.6%.

  13. The ‘Densitometric Image Analysis Software’ and Its Application to Determine Stepwise Equilibrium Constants from Electrophoretic Mobility Shift Assays

    PubMed Central

    van Oeffelen, Liesbeth; Peeters, Eveline; Nguyen Le Minh, Phu; Charlier, Daniël

    2014-01-01

    Current software applications for densitometric analysis, such as ImageJ, QuantityOne (BioRad) and the Intelligent or Advanced Quantifier (Bio Image) do not allow to take the non-linearity of autoradiographic films into account during calibration. As a consequence, quantification of autoradiographs is often regarded as problematic, and phosphorimaging is the preferred alternative. However, the non-linear behaviour of autoradiographs can be described mathematically, so it can be accounted for. Therefore, the ‘Densitometric Image Analysis Software’ has been developed, which allows to quantify electrophoretic bands in autoradiographs, as well as in gels and phosphorimages, while providing optimized band selection support to the user. Moreover, the program can determine protein-DNA binding constants from Electrophoretic Mobility Shift Assays (EMSAs). For this purpose, the software calculates a chosen stepwise equilibrium constant for each migration lane within the EMSA, and estimates the errors due to non-uniformity of the background noise, smear caused by complex dissociation or denaturation of double-stranded DNA, and technical errors such as pipetting inaccuracies. Thereby, the program helps the user to optimize experimental parameters and to choose the best lanes for estimating an average equilibrium constant. This process can reduce the inaccuracy of equilibrium constants from the usual factor of 2 to about 20%, which is particularly useful when determining position weight matrices and cooperative binding constants to predict genomic binding sites. The MATLAB source code, platform-dependent software and installation instructions are available via the website http://micr.vub.ac.be. PMID:24465496

  14. The Electrophoretic Mobility of a Polyelectrolyte within a Radially Confining Potential Well

    NASA Astrophysics Data System (ADS)

    Shendruk, Tyler; Bertrand, Martin; Slater, Gary W.

    2013-03-01

    We demonstrate that a polyelectrolyte electrophoresing while radially confined by a mechanical force has a conformationally dependent electrophoretic mobility that differs from its free-draining value. The mobility increases as a function of the confining harmonic potential and in the absence of solid walls. Mesoscale MPCD-MD hybrid simulations that include electro-hydrodynamics through a mean-field Debye Hückel approximation will be presented for a variety of well widths and contour lengths, demonstrating that mobility increases with confinement after a critical point but remains independent of polymerization. For this reason, models based on a change of monomer friction coefficient at the confinement boundary (such as those recently put forward to explain experimentally measured mobility polyelectrolytes confined within nano- and microfluidic channels) are not sufficient to explain our observations. Since the potential acts perpendicular to the electric field and only on the monomers, the Electro-Hydrodynamic Equivalence Principle does not predict the mobility to differ. We present a course-grained theory explaining these findings in terms of hydrodynamic coupling within overlapping diffuse layers.

  15. [Morphometry and electrophoretic mobility of red blood cells from patients with asthma in the intravenous blood laser irradiation].

    PubMed

    Sarycheva, T G; Tsybzhitova, E B; Popova, O V; Aleksandrov, O V

    2009-03-01

    The morphometry and electrophoretic mobility of red blood cells from patients with infection-dependent asthma were comparatively studied prior to and following treatment. The patients who had underwent intravenous laser irradiation of blood (ILIB) in addition to conventional therapy had better morphofunctional parameters of red blood cells, by restoring their normal forms, decreasing their transitional ones, and increasing their electrophoretic mobility to normal values. Those who received traditional drug therapy showed no considerable morphofunctional changes of erythrocytes. Thus, in asthmatic patients, the changes in the morphology and function of red blood cells may suggest their membranous structural changes for whose correction ILIB should used.

  16. Direct visualization of electrophoretic mobility shift assays using nanoparticle-aptamer conjugates.

    PubMed

    Wang, Min S; Reed, Scott M

    2012-01-01

    Here, we demonstrate that aptamers tethered to gold nanoparticles enable direct visualization of protein-oligonucleotide interactions during gel electrophoresis. This technique is used to confirm that an aptamer previously identified as binding to C-reactive protein (CRP) only binds to the monomeric form of CRP. While native, pentameric CRP (pCRP) is used in clinical assays to predict cardiovascular disease (CVD) risk, it is the monomeric isoform that is more strongly associated with pro-inflammatory and pro-atherogenic effects. To visualize this selectivity, the CRP-aptamer was conjugated to streptavidin-coated gold nanoparticles and the mobility of the free oligonucleotide-nanoparticle conjugate (ON-NP) and the protein/ON-NP complex bands were visualized and recorded during electrophoresis using a simple digital camera. At a concentration of 6 μg/mL, monomeric CRP showed a significant decrease in the observed ON-NP mobility, whereas no change in mobility was observed with pCRP up to 18 μg/mL. Advantages of this nanoparticle-based electrophoretic mobility shift assay (NP-EMSA) over the traditional EMSA include real-time detection of protein-oligonucleotide interactions, the avoidance of harmful radioisotopes, and elimination of the need for expensive gel imagers. The availability of both the NP-EMSA technique and an mCRP-specific probe will allow for improved clinical diagnostic to more accurately predict future CVD risk.

  17. Electrophoretic chip for high-fidelity fractionation of double-stranded DNA.

    PubMed

    Sun, Kai; Li, Zheyu; Ueno, Kosei; Juodkazis, Saulius; Noji, Sumihare; Misawa, Hiroaki

    2007-05-01

    We report the high fidelity, on-chip fractionation of selected segments from an electrophoretic flow of separated fragments. dsDNA fragments (10-330 base pairs (bp)) were initially separated using a 6.5 cm long channel with an electric field strength of 150 V/cm. As an example of the fractionation process, a target fragment of 20 bp was selected and extracted from the separation channel. The extraction was confirmed and evaluated by fluorescence imaging. High resolution and extraction fidelity were achieved by introducing new procedures for (i) extraction channel-blocking and (ii) segment transfer with cleaning. These procedures are necessary for the development of a practical, fully automated multitarget fractionation electrophoretic chip. A kind of CCD image processing method was introduced to monitor, control, and evaluate the procedure of fractionation. The resolution limits of the separation and extraction are discussed.

  18. Difference in microchip electrophoretic mobility between partially and fully PEGylated poly(amidoamine) dendrimers.

    PubMed

    Park, Eun Ji; Na, Dong Hee

    2015-11-01

    The objective of this study was to investigate the difference in electrophoretic mobility between partially and fully poly(ethylene glycol)-conjugated poly(amidoamine) dendrimers (part-PEG-PAMAM and full-PEG-PAMAM, respectively) using a microchip capillary gel electrophoresis (MCGE). While MCGE allowed size-based separation of PEG-PAMAMs prepared with monomethoxy PEG-nitrophenyl carbonate, full-PEG-PAMAMs migrated slower than part-PEG-PAMAMs that were similar in size or larger. When the measured molecular weights obtained from MCGE analysis and the calculated molecular weights were plotted, each part-PEG-PAMAM and full-PEG-PAMAM showed correlation coefficients greater than 0.98. This study indicates that MCGE would be useful for characterizing PEG-PAMAMs with different PEGylation degrees. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. A substrate-optimized electrophoretic mobility shift assay for ADAM12.

    PubMed

    Kotzsch, Alexander; Skovgaard, Tine; Buus, Uwe; Andersen, Simon; Devkota, Kanchan; Berthelsen, Jens

    2014-05-01

    ADAM12 belongs to the A disintegrin and metalloprotease (ADAM) family of secreted sheddases activating extracellular growth factors such as epidermal growth factor receptor (EGFR) ligands and tumor necrosis factor-alpha (TNF-α). ADAM proteases, most notably ADAM17 (TNF-α-converting enzyme), have long been investigated as pharmaceutical drug targets; however, due to lack of potency and in vivo side effects, none of the small-molecule inhibitors discovered so far has made it beyond clinical testing. Ongoing research on novel selective inhibitors of ADAMs requires reliable biochemical assays to validate molecular probes from large-scale screening efforts. Here we describe an electrophoretic mobility shift assay for ADAM12 based on the identification of an optimized peptide substrate that is characterized by excellent performance and reproducibility.

  20. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    EPA Science Inventory

    Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...

  1. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    PubMed Central

    Popovici, Jonathan; Lytle, Darren A.; Adcock, Noreen J.; Rice, Eugene W.

    2012-01-01

    The electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates was measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here provide new insight for Bacillus anthracis surrogate selection and for attachment/detachment and transport studies. PMID:23001659

  2. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    EPA Science Inventory

    Electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates were measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here prov...

  3. DNA mobility modifier

    DOEpatents

    Barron, Annelise

    2002-01-01

    Polyamides comprising at least one hydrophilic C.sub.1 -C.sub.10 hydrocarbyl substituent on an amide nitrogen atom, and methods for producing and using the same is provided. In particular, polyamides of the formula: ##STR1## and methods for using the same for altering the ratio of charge/translational frictional drag of binding polymers to allow electrophoretic separation of polynucleotides or analogs thereof in a non-sieving liquid medium is provided, where a, q, L.sup.1, P.sup.1, Q.sup.1, R, R.sup.1, R.sup.10 and R.sup.11 are those described herein.

  4. The ePrep-System: A new electrophoretic approach for DNA isolation from biological samples.

    PubMed

    Kueppers, Corinna; Schlappa, Sabine; Bogdoll, Annette; Breitkopf, Lothar; Seip, Nicole; Singer, Thorsten

    2017-09-01

    We present a new free-flow electrophoretic separation system that extends the established concepts of nucleic acid migration in an electric field to a broadly applicable preparative scale. The system comprises a disposable flow tube in which the target nucleic acids are separated from impurities by a balanced combination of electrophoretic migration and counter-streaming electroosmotic flow under the influence of an applied external electric field. Despite the complex theoretical background the introduced electrophoretic technology offers simple hardware setup and handling protocols. A variable number of small and disposable flow tubes can be processed in parallel, which largely eliminates the cumulative increase in extraction times inherent to batch processing methods and allows faster throughput of intermediate sample numbers. We demonstrate easy isolation of nucleic acids without user interaction during the run by using existing and well established lysis chemistries. Sample loading is realized by concentrated transfer of DNA-loaded magnetic beads from a lysis reaction into the extraction flow tube. The present study centers on the development of a functional model for the device and the flow tube as well as a preliminary standard extraction protocol. The system is compatible with a broad range of sample types and we present proof of principle data demonstrating its suitability for biomarker detection in translational research applications. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  5. Measurements of the electrophoretic mobility with a new laser Doppler cytopherometer (Lazypher) and critical evaluation of the Electrophorese Mobility Test (EMT)

    NASA Astrophysics Data System (ADS)

    Hoffmann, W.

    1982-01-01

    The new developed Laser Doppler Cytopherometer (Lazypher) allows the exact and objective measurement of the electrophoretic mobility of particles. Comparative experiments with the Free Flow Cell Electrophoresis instrument of Hannig showed identical results. The impression that the electrophoretic Mobility Test is not valid for cancer diagnosis has been substantiated. But in its present form with the new instrument (Lazypher) possible improvements, e.g. isolation of lymphocytes, purification of ""antigens'' or indicator particles, can be estimated objectively for their value for the test system.

  6. Assessment of Carbon- and Metal-Based Nanoparticle DNA Damage with Microfluidic Electrophoretic Separation Technology.

    PubMed

    Schrand, Amanda M; Powell, Thomas; Robertson, Tiffany; Hussain, Saber M

    2015-02-01

    In this study, we examined the feasibility of extracting DNA from whole cell lysates exposed to nanoparticles using two different methodologies for evaluation of fragmentation with microfluidic electrophoretic separation. Human lung macrophages were exposed to five different carbon- and metal-based nanoparticles at two different time points (2 h, 24 h) and two different doses (5 µg/ml, 100 µg/ml). The primary difference in the banding patterns after 2 h of nanoparticle exposure is more DNA fragmentation at the higher NP concentration when examining cells exposed to nanoparticles of the same composition. However, higher doses of carbon and silver nanoparticles at both short and long dosing periods can contribute to erroneous or incomplete data with this technique. Also comparing DNA isolation methodologies, we recommend the centrifugation extraction technique, which provides more consistent banding patterns in the control samples compared to the spooling technique. Here we demonstrate that multi-walled carbon nanotubes, 15 nm silver nanoparticles and the positive control cadmium oxide cause similar DNA fragmentation at the short time point of 2 h with the centrifugation extraction technique. Therefore, the results of these studies contribute to elucidating the relationship between nanoparticle physicochemical properties and DNA fragmentation results while providing the pros and cons of altering the DNA isolation methodology. Overall, this technique provides a high throughput way to analyze subcellular alterations in DNA profiles of cells exposed to nanomaterials to aid in understanding the consequences of exposure and mechanistic effects. Future studies in microfluidic electrophoretic separation technologies should be investigated to determine the utility of protein or other assays applicable to cellular systems exposed to nanoparticles.

  7. Dynamic electrophoretic mobility of spherical colloidal particles in realistic aqueous salt-free concentrated suspensions.

    PubMed

    Carrique, Félix; Ruiz-Reina, Emilio; Arroyo, Francisco J; Delgado, Angel V

    2010-05-13

    In this contribution, the dynamic (or alternating current (AC)) electrophoretic mobility of spherical colloidal particles in a realistic salt-free concentrated suspension subjected to an oscillating electric field is studied theoretically using a cell model approach. Such a suspension is a concentrated one (in charged solid particles) in an aqueous solution without any electrolyte added during the preparation. The ionic species in solution can solely be: (i) the "added counterions" stemming from the particles (for example, by ionization of particle surface ionizable groups), (ii) the H(+) and OH(-) ions from water dissociation, and (iii) the ions produced by the atmospheric CO(2) contamination. The corrections related to water dissociation and CO(2) contamination in suspensions open to the atmosphere have turned out to be tremendous in many of the experimental situations of interest in direct current (DC) electric fields. Thus, it is mandatory to explore their influence in the more complex situation of AC electrophoresis. The results confirm the importance of ions produced by water dissociation and those originated by the acidification of the aqueous solution in suspensions contaminated with atmospheric CO(2), for low to moderate particle volume fractions, where the role of the added counterions is screened by the other ionic species. It is worth mentioning that, for high particle charges, two Maxwell-Wagner processes develop in the mobility frequency spectrum, respectively linked to the diffuse layer relaxation and to the relaxation of a condensed layer of counterions located very close to the particle surface. This is the so-called ionic condensation effect for highly charged particles, already described in the literature, and which for the first time will be studied in detail in realistic salt-free systems. The dynamic electrophoretic mobility will be numerically computed throughout a wide frequency range and compared with the cases of pure and realistic salt

  8. Dynamic electrophoretic mobility and electric permittivity of concentrated suspensions of plate-like gibbsite particles.

    PubMed

    Ahualli, S; González, M A; Delgado, A V; Jiménez, M L

    2017-09-15

    In this paper we present experimental results on the electrokinetic behavior of planar gibbsite particles in concentrated suspensions. The dc electrophoretic mobility measurements are in this case of little significance, as they are scarcely informative. In the present investigation, we show that the dielectric dispersion and dynamic electrophoresis can in contrast provide such information. The complicating factors are of course the non-spherical shape and the finite particle concentration, as no complete theory of these phenomena exists for such systems. We propose to use first of all a model of dynamic electrophoresis of spheroids in which the effect of volume fraction is considered by means of an approximate theory previously obtained for spheres, based on the evaluation of electrical and hydrodynamic interactions between particles. In addition, the role of volume fraction on the high frequency inertial relaxation is also ascertained and used to obtain a volume fraction-independent radius of the gibbsite spheroids. A similar approach is used for the evaluation of dielectric dispersion data. Both the dynamic mobility and dielectric constant dependencies on frequency were obtained for gibbsite suspensions of different volume fractions in 0.5mMKCl. The theoretical treatments elaborated were applied to these data, and a coherent picture of the geometrical and electrical characteristics of the particles was obtained. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Measurement of the position-dependent electrophoretic force on DNA in a glass nanocapillary.

    PubMed

    Bulushev, Roman D; Steinbock, Lorenz J; Khlybov, Sergey; Steinbock, Julian F; Keyser, Ulrich F; Radenovic, Aleksandra

    2014-11-12

    The electrophoretic force on a single DNA molecule inside a glass nanocapillary depends on the opening size and varies with the distance along the symmetrical axis of the nanocapillary. Using optical tweezers and DNA-coated beads, we measured the stalling forces and mapped the position-dependent force profiles acting on DNA inside nanocapillaries of different sizes. We showed that the stalling force is higher in nanocapillaries of smaller diameters. The position-dependent force profiles strongly depend on the size of the nanocapillary opening, and for openings smaller than 20 nm, the profiles resemble the behavior observed in solid-state nanopores. To characterize the position-dependent force profiles in nanocapillaries of different sizes, we used a model that combines information from both analytical approximations and numerical calculations.

  10. Electrophoretic and field-effect graphene for all-electrical DNA array technology

    NASA Astrophysics Data System (ADS)

    Xu, Guangyu; Abbott, Jeffrey; Qin, Ling; Yeung, Kitty Y. M.; Song, Yi; Yoon, Hosang; Kong, Jing; Ham, Donhee

    2014-09-01

    Field-effect transistor biomolecular sensors based on low-dimensional nanomaterials boast sensitivity, label-free operation and chip-scale construction. Chemical vapour deposition graphene is especially well suited for multiplexed electronic DNA array applications, since its large two-dimensional morphology readily lends itself to top-down fabrication of transistor arrays. Nonetheless, graphene field-effect transistor DNA sensors have been studied mainly at single-device level. Here we create, from chemical vapour deposition graphene, field-effect transistor arrays with two features representing steps towards multiplexed DNA arrays. First, a robust array yield—seven out of eight transistors—is achieved with a 100-fM sensitivity, on par with optical DNA microarrays and at least 10 times higher than prior chemical vapour deposition graphene transistor DNA sensors. Second, each graphene acts as an electrophoretic electrode for site-specific probe DNA immobilization, and performs subsequent site-specific detection of target DNA as a field-effect transistor. The use of graphene as both electrode and transistor suggests a path towards all-electrical multiplexed graphene DNA arrays.

  11. Electrophoretic and field-effect graphene for all-electrical DNA array technology.

    PubMed

    Xu, Guangyu; Abbott, Jeffrey; Qin, Ling; Yeung, Kitty Y M; Song, Yi; Yoon, Hosang; Kong, Jing; Ham, Donhee

    2014-09-05

    Field-effect transistor biomolecular sensors based on low-dimensional nanomaterials boast sensitivity, label-free operation and chip-scale construction. Chemical vapour deposition graphene is especially well suited for multiplexed electronic DNA array applications, since its large two-dimensional morphology readily lends itself to top-down fabrication of transistor arrays. Nonetheless, graphene field-effect transistor DNA sensors have been studied mainly at single-device level. Here we create, from chemical vapour deposition graphene, field-effect transistor arrays with two features representing steps towards multiplexed DNA arrays. First, a robust array yield--seven out of eight transistors--is achieved with a 100-fM sensitivity, on par with optical DNA microarrays and at least 10 times higher than prior chemical vapour deposition graphene transistor DNA sensors. Second, each graphene acts as an electrophoretic electrode for site-specific probe DNA immobilization, and performs subsequent site-specific detection of target DNA as a field-effect transistor. The use of graphene as both electrode and transistor suggests a path towards all-electrical multiplexed graphene DNA arrays.

  12. On the ionic strength dependence of the electrophoretic mobility: From 2D to 3D slope-plots.

    PubMed

    Cottet, Hervé; Wu, Hengfu; Allison, Stuart A

    2017-03-01

    Determining the charge and the nature (small ion, nanoparticle, or polyelectrolyte) of an unknown solute from its electrophoretic characteristics remains a challenging issue. In this work, we demonstrate that, if the knowledge of the effective electrophoretic mobility (μep ) at a given ionic strength is not sufficient to characterize a given solute, the combination of this parameter with (i) the relative decrease of the electrophoretic mobility with the ionic strength (S), and (ii) the hydrodynamic radius (Rh ), is sufficient (in most cases) to deduce the nature of the solute and its charge. These three parameters are experimentally accessible by CZE and Taylor dispersion analysis performed on the same instrumentation. 3D representation of the three aforementioned parameters (μep ; S and Rh ) is proposed to visualize the differences in the electrophoretic behavior between solutes according to their charge and nature. Surprisingly, such 3D slope plot in the case of small ions and nanoparticles looks like a "whale-tail," while polyelectrolyte contour plot represents a rather simple and monotonous map that is independent of solute size. This work also sets how to estimate the effective charge of a solute from a given experimental (S,Rh,μ ep 5 mM ) triplet, which is not possible to obtain unambiguously with only (Rh,μ ep 5 mM ) or (S,μ ep 5 mM ) doublet, where μ ep 5 mM is the effective electrophoretic mobility at 5 mM ionic strength. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. On-chip pressure injection for integration of infrared-mediated DNA amplification with electrophoretic separation.

    PubMed

    Easley, Christopher J; Karlinsey, James M; Landers, James P

    2006-05-01

    Poly(dimethylsiloxane) (PDMS) membrane valves were utilized for diaphragm pumping on a PDMS-glass hybrid microdevice in order to couple infrared-mediated DNA amplification with electrophoretic separation of the products in a single device. Specific amplification products created during non-contact, infrared (IR) mediated polymerase chain reaction (PCR) were injected via chip-based diaphragm pumping into an electrophoretic separation channel. Channel dimensions were designed for injection plug shaping via preferential flow paths, which aided in minimizing the plug widths. Unbiased injection of sample could be achieved in as little as 190 ms, decreasing the time required with electrokinetic injection by two orders of magnitude. Additionally, sample stacking was promoted using laminar or biased-laminar loading to co-inject either water or low ionic strength DNA marker solution along with the PCR-amplified sample. Complete baseline resolution (Res = 2.11) of the 80- and 102-bp fragments of pUC-18 DNA marker solution was achieved, with partially resolved 257- and 267-bp fragments (Res = 0.56), in a separation channel having an effective length of only 3.0 cm. This resolution was deemed adequate for many PCR amplicon separations, with the added advantage of short separation time-typically complete in <120 s. Decreasing the amount of glass surrounding the PCR chamber reduced the DNA amplification time, yielding a further enhancement in analysis speed, with heating and cooling rates as high as 13.4 and -6.4 degrees C s(-1), respectively. With the time requirements greatly reduced for each step, it was possible to seamlessly couple IR-mediated amplification, sample injection, and separation/detection of a 278-bp fragment from the invA gene of <1000 starting copies of Salmonella typhimurium DNA in approximately 12 min on a single device, representing the fastest PCR-ME integration achieved to date.

  14. Simulation of electrophoretic stretching of DNA in a microcontraction using an obstacle array for conformational preconditioning

    PubMed Central

    Trahan, Daniel W.; Doyle, Patrick S.

    2009-01-01

    Recently our group has reported experiments using an obstacle array to precondition the conformations of DNA molecules to facilitate their stretch in a microcontraction. Based upon previous successes simulating electrophoretic stretching in microcontractions without obstacles, we use our simulation model to study the deformation of DNA chains in a microcontraction preceded by an array of cylindrical obstacles. We compare our data to the experimental results and find good qualitative, and even quantitative, agreement concerning the behavior of the chains in the array; however, the simulations overpredict the mean stretch of the chains as they leave the contraction. We examine the amount of stretch gained between leaving the array and reaching the end of the contraction and speculate that the differences seen are caused by nonlinear electrokinetic effects that become important in the contraction due to a combination of field gradients and high field strengths. PMID:19693392

  15. Polar Residues in Transmembrane Helices can Decrease Electrophoretic Mobility in Polyacrylamide Gels Without Causing Helix Dimerization

    PubMed Central

    Walkenhorst, William F.; Merzlyakov, Mikhail; Hristova, Kalina; Wimley, William C.

    2010-01-01

    There are only a few available methods to study lateral interactions and self assembly of transmembrane helices. One of the most frequently used methods is sodium dodecylsulfate polyacrylamide gel electrophoresis (SDS-PAGE) which can report on strong interactions between peptides in SDS solution. Here we offer a cautionary tale about studying the folding and assembly of membrane proteins using peptides and SDS-PAGE experiments as membrane mimetic systems. At least for the specific peptide and detergent systems studied here, we show that a polar asparagine residue in the 12th position of an otherwise hydrophobic helical segment of 20 amino acids causes a peptide to migrate on SDS-PAGE gels with an apparent molecular weight that is twice its true molecular weight, suggesting dimerization. However when examined carefully in SDS solutions and in situ in the polyacrylamide gel itself using Forster resonance energy transfer no interaction can be detected. Instead we show evidence suggesting that differential interactions between peptide and detergent drive the differences in electrophoretic mobility without any interaction between peptides. These results emphasize the need to apply multiple independent techniques to the study of membrane protein folding, and they highlight the usefulness of studying folding and structure of membrane proteins in lipid membranes rather than in detergents. PMID:19265670

  16. Rapid agarose gel electrophoretic mobility shift assay for quantitating protein: RNA interactions.

    PubMed

    Ream, Jennifer A; Lewis, L Kevin; Lewis, Karen A

    2016-10-15

    Interactions between proteins and nucleic acids are frequently analyzed using electrophoretic mobility shift assays (EMSAs). This technique separates bound protein:nucleic acid complexes from free nucleic acids by electrophoresis, most commonly using polyacrylamide gels. The current study utilizes recent advances in agarose gel electrophoresis technology to develop a new EMSA protocol that is simpler and faster than traditional polyacrylamide methods. Agarose gels are normally run at low voltages (∼10 V/cm) to minimize heating and gel artifacts. In this study we demonstrate that EMSAs performed using agarose gels can be run at high voltages (≥20 V/cm) with 0.5 × TB (Tris-borate) buffer, allowing for short run times while simultaneously yielding high band resolution. Several parameters affecting band and image quality were optimized for the procedure, including gel thickness, agarose percentage, and applied voltage. Association of the siRNA-binding protein p19 with its target RNA was investigated using the new system. The agarose gel and conventional polyacrylamide gel methods generated similar apparent binding constants in side-by-side experiments. A particular advantage of the new approach described here is that the short run times (5-10 min) reduce opportunities for dissociation of bound complexes, an important concern in non-equilibrium nucleic acid binding experiments.

  17. Determination of electrokinetic and hydrodynamic parameters of proteins by modeling their electrophoretic mobilities through the electrically charged spherical soft particle.

    PubMed

    Deiber, Julio A; Piaggio, María V; Peirotti, Marta B

    2013-03-01

    This work explores the possibility of using the electrically charged "spherical soft particle" (SSP) to model the electrophoretic mobility of proteins in the low charge regime. The general framework concerning the electrophoretic mobility of the SSP already presented in the literature is analyzed and discussed here in particular for polyampholyte-polypeptide chains. In this regard, this theory is applied to BSA for different protocol pH values. The physicochemical conditions required to model proteins as SSP from their experimentally determined electrophoretic mobilities are established. In particular, the protein charge regulation phenomenon and the SSP particle core are included to study BSA having isoelectric point pI ≈ 5.71, within a wide range of bulk pH values. The results of this case study are compared with previous ones concerning the spherical porous particle and the spherical hard particle with occluded water. A discussion of chain conformations in the SSP polyampholyte layer is presented through estimations of the packing and friction fractal dimensions.

  18. Determination of electrokinetic and hydrodynamic parameters of proteins by modeling their electrophoretic mobilities through the electrically charged spherical porous particle.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2013-03-01

    This work explores the possibility of using the electrically charged "spherical porous particle" (SPP) to model the electrophoretic mobility of proteins in the low charge regime. In this regard, the electrophoretic mobility expression of the charged SPP (Hermans-Fujita model) is used and applied here to BSA and staphylococcal nuclease for different protocol pH values. The SPP is presented within the general framework of the "spherical soft particle" as described in the literature. The physicochemical conditions required to model proteins as SPP from their experimentally determined electrophoretic mobilities are established. It is shown that particle permeability and porosity and chain packing and friction fractal dimensions are relevant structural properties of proteins when hydrodynamic interaction between amino acid residues is present. The charge regulation phenomenon of BSA and staphylococcal nuclease with pIs ≈ 5.71 and 9.63, respectively, is described through the SPP within a wide range of bulk pH values. These case studies illustrate when the average regulating {pH} of the protein domain is lower and higher than the protocol pH. Further research for using the general spherical soft particle is also proposed on the basis of results and main conclusions.

  19. Easy measurement and analysis method of zeta potential and electrophoretic mobility of water-dispersed colloidal particles by using a self-mixing solid-state laser

    NASA Astrophysics Data System (ADS)

    Sudo, S.; Ohtomo, T.; Otsuka, K.

    2013-08-01

    We describe a highly sensitive method of measuring electrophoretic mobility and zeta potential of water-dispersed colloidal particles by using a self-mixing laser Doppler velocimeter with a laser-diode-pumped, thin-slice solid-state laser with extremely high optical sensitivity. The power spectra of laser output modulated by reinjected laser light scattered by the electrophoretic particles were observed. The power spectrum cannot be described by the well-known formula for translational motion or flowing Brownian motion, i.e., a combination of Doppler shift, diffusion, and translation. The power spectra shape is found to reflect the velocity distribution of electrophoretic particles in a capillary tube due to the electro-osmotic flow contribution. Not only evaluation of the electrophoretic mobility and zeta potential but also the particle diameter undergoing electrophoretic motion can be performed from the shape of the power spectrum.

  20. Optimization and application of electrophoretic mobility analysis of human red blood cells to study their in vitro stability, interaction with polycations and proteolytic enzymes.

    PubMed

    Grandfils, Christian; Foresto, Patricia; Riquelme, Bibiana; Valverde, Juana; Sondag-Thull, Danièle

    2008-02-01

    Electrophoretic light scattering method has been considered to determine both the mean and polydispersity of electrophoretic mobility of normal human red blood cells. The final goal of our study was to optimize an in vitro test allowing us to investigate the interaction of xenobiotics, in particular polyelectrolytes, with blood cells. The feasibility of our method has been evaluated based on the reproducibility of our technique to analyze the native electrophoretic mobility of human RBCs, as well as their evolution in the presence of polycationic compounds, i.e. a natural polyamine, spermine, and a synthetic polycation, a polyethylenimine (PEI). Additionally, the follow-up of the human RBCs electrophoretic mobility has been controlled after their incubation with neuraminidase. (c) 2007 Wiley Periodicals, Inc. J Biomed Mater Res, 2008.

  1. Use of conventional taxonomy, electrophoretic karyotyping and DNA-DNA hybridization for the classification of fermentative apiculate yeasts.

    PubMed

    Vaughan-Martini, A; Angelini, P; Cardinali, G

    2000-07-01

    A taxonomic study was conducted that considered strains of the genera Hanseniaspora/Kloeckera held in the Industrial Yeasts Collection (DBVPG) of the Dipartimento di Biologia Vegetale of the Università di Perugia, Italy. Standard phenotypic as well as molecular criteria were considered in a effort to revisit the classification of these strains, some of which have been in the collection for about 50 years. Results of salient physiological tests showed that some of the DBVPG and type strains could not be identified by current taxonomic keys. Electrophoretic karyotypes were identical for some species, with the type strains of the seven accepted species showing only five distinct chromosomal patterns. DNA-DNA hybridization analyses, using a non-radioactive dot-blot technique, allowed for the distinction of taxa. The taxonomic implications of these results are discussed.

  2. Electrophoretic concentration of DNA at nanoporous polymer membranes for separations and diagnostics.

    SciTech Connect

    Thaitrong, Numrin; Meagher, Robert J.; Singh, Anup K.

    2010-11-01

    We report on the use of thin ({approx}30 micron) photopatterned polymer membranes for on-line preconcentration of single- or double-stranded DNA samples prior to electrophoretic analysis. Shaped UV laser light is used to quickly ({approx}10 seconds) polymerize a highly crosslinked polyacrylamide plug. By applying an electric field across the membrane, DNA from a dilute sample can be concentrated into a narrow zone (<100 micron wide) at the outside edge of the membrane. The field at the membrane can then be reversed, allowing the narrow plug to be cleanly injected into a separation channel filled with a sieving polymer for analysis. Concentration factors >100 are possible, increasing the sensitivity of analysis for dilute samples. We have fabricated both neutral membranes (purely size-based exclusion) as well as anionic membranes (size and charge exclusion), and characterized the rate of preconcentration as well as the efficiency of injection from both types of membrane, for DNA, ranging from a 20 base ssDNA oligonucleotide to >14 kbp dsDNA. We have also investigated the effects of concentration polarization on device performance for the charged membrane. Advantages of the membrane preconcentration approach include the simplicity of device fabrication and operation, and the generic (non-sequence specific) nature of DNA capture, which is useful for complex or poorly characterized samples where a specific capture sequence is not present. The membrane preconcentration approach is well suited to simple single-level etch glass chips, with no need for patterned electrodes, integrated heaters, valves, or other elements requiring more complex chip fabrication. Additionally, the ability to concentrate multiple charged analytes into a narrow zone enables a variety of assay functionalities, including enzyme-based and hybridization-based analyses.

  3. Electrophoretic Transport of Single DNA Nucleotides through Nanoslits: A Molecular Dynamics Simulation Study.

    PubMed

    Xia, Kai; Novak, Brian R; Weerakoon-Ratnayake, Kumuditha M; Soper, Steven A; Nikitopoulos, Dimitris E; Moldovan, Dorel

    2015-09-03

    There is potential for flight time based DNA sequencing involving disassembly into individual nucleotides which would pass through a nanochannel with two or more detectors. We performed molecular dynamics simulations of electrophoretic motion of single DNA nucleotides through 3 nm wide hydrophobic slits with both smooth and rough walls. The electric field (E) varied from 0.0 to 0.6 V/nm. The nucleotides adsorb and desorb from walls multiple times during their transit through the slit. The nucleotide-wall interactions differed due to nucleotide hydrophobicities and wall roughness which determined duration and frequency of nucleotide adsorptions and their velocities while adsorbed. Transient association of nucleotides with one, two, or three sodium ions occurred, but the mean association numbers (ANs) were weak functions of nucleotide type. Nucleotide-wall interactions contributed more to separation of nucleotide flight time distributions than ion association and thus indicate that nucleotide-wall interactions play a defining role in successfully discriminating between nucleotides on the basis of their flight times through nanochannels/slits. With smooth walls, smaller nucleotides moved faster, but with rough walls larger nucleotides moved faster due to fewer favorable wall adsorption sites. This indicates that roughness, or surface patterning, might be exploited to achieve better time-of-flight based discrimination between nucleotides.

  4. [The relationship of the acid-base status of the blood to the electrophoretic mobility of the erythrocytes in liver pathology].

    PubMed

    Matiushichev, V B; Shamratova, C G; Gutsaeva, D R

    1995-01-01

    With cholestatic hepatite, the relationship between acid-alkaline condition of blood and electrophoretic mobility of erythrocytes was studied. It is shown that changes in parameters of the individual mobility distribution are translated into reality independently, and are directed to maintain the steadiness of the index middle level. Dependence of this sign on the pH value, hemoglobin content and bicarbonate-ion concentrating in blood, an on partial pressure of oxygen and carbonic gas was discovered. The intravenous infusion of patients with hemodese restored the middle level of cell electrophoretic mobility previously reduced due to liver pathology. Membrane mechanisms controlling stability of erythrocyte electrokinetic characteristics are discussed.

  5. Effects of supercoiling in electrophoretic trapping of circular DNA in polyacrylamide gels.

    PubMed Central

    Akerman, B

    1998-01-01

    Electrophoretic velocity and orientation have been used to study the electric-field-induced trapping of supercoiled and relaxed circular DNA (2926 and 5386 bp) in polyacrylamide gels (5% T, 3.3% C) at 7.5-22.5 V/cm, using as controls linear molecules of either the same contour length or the same radius of gyration. The circle-specific trapping is reversible. From the duration of the reverse pulse needed to detrap the molecules, the average trap depth is estimated to be 90 A, which is consistent with the molecular charge and the field strengths needed to keep molecules trapped. Trapped circles exhibit a strong field alignment compared to the linear form, and there is a good correlation between the enhanced field alignment for the circles and the onset of trapping in both constant and pulsed fields. The circles do not exhibit the orientation overshoot response to a field pulse seen with linear DNA, and the rate of orientation growth scales as E(-2+/-0.1) with the field, as opposed to E(-1.1+/-0.1) for the linear form. These results show that the linear form migrates by cyclic reptation, whereas the circles most likely are trapped by impalement on gel fibers. This proposal is supported by very similar velocity and orientation behavior of circular DNA in agarose gels, where impalement has been deemed more likely because of stiffer gel fibers. The trapping efficiency is sensitive to DNA topology, as expected for impalement. In polyacrylamide the supercoiled form (superhelical density sigma = -0.05) has a two- to fourfold lower probability of trapping than the corresponding relaxed species, whereas in agarose gels the supercoiled form is not trapped at all. These results are consistent with existing data on the average holes in the plectonemic supercoiled structures and the fiber thicknesses in the two gel types. On the basis of the topology effect, it is argued that impalement during pulsed-field electrophoresis in polyacrylamide gels may be useful for the separation of

  6. Liquid phase separation of proteins based on electrophoretic effects in an electrospray setup during sample introduction into a gas-phase electrophoretic mobility molecular analyzer (CE-GEMMA/CE-ES-DMA).

    PubMed

    Weiss, Victor U; Kerul, Lukas; Kallinger, Peter; Szymanski, Wladyslaw W; Marchetti-Deschmann, Martina; Allmaier, Günter

    2014-09-02

    Nanoparticle characterization is gaining importance in food technology, biotechnology, medicine, and pharmaceutical industry. An instrument to determine particle electrophoretic mobility (EM) diameters in the single-digit to double-digit nanometer range receiving increased attention is the gas-phase electrophoretic mobility molecular analyzer (GEMMA) separating electrophoretically single charged analytes in the gas-phase at ambient pressure. A fused-silica capillary is used for analyte transfer to the gas-phase by means of a nano electrospray (ES) unit. The potential of this capillary to separate analytes electrophoretically in the liquid phase due to different mobilities is, at measurement conditions recommended by the manufacturer, eliminated due to elevated pressure applied for sample introduction. Measurements are carried out upon constant feeding of analytes to the system. Under these conditions, aggregate formation is observed for samples including high amounts of non-volatile components or complex samples. This makes the EM determination of individual species sometimes difficult, if not impossible. With the current study we demonstrate that liquid phase electrophoretic separation of proteins (as exemplary analytes) occurs in the capillary (capillary zone electrophoresis, CE) of the nano ES unit of the GEMMA. This finding was consecutively applied for on-line desalting allowing EM diameter determination of analytes despite a high salt concentration within samples. The present study is to our knowledge the first report on the use of the GEMMA to determine EM diameters of analytes solubilized in the ES incompatible electrolyte solutions by the intended use of electrophoresis (in the liquid phase) during sample delivery. Results demonstrate the proof of concept of such an approach and additionally illustrate the high potential of a future on-line coupling of a capillary electrophoresis to a GEMMA instrument. Copyright © 2014 The Authors. Published by Elsevier B

  7. Separation of very hydrophobic analytes by micellar electrokinetic chromatography IV. Modeling of the effective electrophoretic mobility from carbon number equivalents and octanol-water partition coefficients.

    PubMed

    Huhn, Carolin; Pyell, Ute

    2008-07-11

    It is investigated whether those relationships derived within an optimization scheme developed previously to optimize separations in micellar electrokinetic chromatography can be used to model effective electrophoretic mobilities of analytes strongly differing in their properties (polarity and type of interaction with the pseudostationary phase). The modeling is based on two parameter sets: (i) carbon number equivalents or octanol-water partition coefficients as analyte descriptors and (ii) four coefficients describing properties of the separation electrolyte (based on retention data for a homologous series of alkyl phenyl ketones used as reference analytes). The applicability of the proposed model is validated comparing experimental and calculated effective electrophoretic mobilities. The results demonstrate that the model can effectively be used to predict effective electrophoretic mobilities of neutral analytes from the determined carbon number equivalents or from octanol-water partition coefficients provided that the solvation parameters of the analytes of interest are similar to those of the reference analytes.

  8. Determination of electrolyte friction from measurements of the tracer diffusion coefficients, mutual diffusion coefficients, and electrophoretic mobilities of charged spheres

    NASA Astrophysics Data System (ADS)

    Gorti, Sridhar; Plank, Lindsay; Ware, B. R.

    1984-07-01

    The technique of fluorescence recovery after photobleaching has been used to measure the tracer diffusion coefficient of fluorescein-labeled charged polystyrene spheres in dilute solutions as a function of solution ionic strength. As the ratio of the particle radius (a) to the Debye-Hückel screening length (κ-1) was varied from 13 to 0.6, a 20% reduction in tracer diffusion coefficient was observed. The mutual diffusion coefficient, measured by quasielastic light scattering, increased as κa was reduced, demonstrating the dominant effect of thermodynamic factors on this parameter. The tracer data have been compared with theoretical predictions of other workers describing the influence of small-ion interactions with a charge sphere on its translational friction. The theoretical results of Schurr, and Booth, involve an explicit dependence on the electrokinetic charge of the sphere and yield estimates of this parameter (by least squares) which are significantly smaller than those obtained from laser Doppler electrophoretic light scattering results for the electrophoretic mobility of the labeled spheres. Approximations in the theoretical analyses are expected to account for these discrepancies.

  9. Affinity Capillary Electrophoresis for Selective Control of Electrophoretic Mobility of Sialic Acid Using Lanthanide-Hexadentate Macrocyclic Polyazacarboxylate Complexes.

    PubMed

    Goto, Daiki; Ouchi, Kazuki; Shibukawa, Masami; Saito, Shingo

    2015-01-01

    It is difficult to control the electrophoretic mobility in order to obtain high resolution among saccharides in complex samples. We report herein on a new affinity capillary electrophoresis (ACE) method for an anionic monosaccharide, N-acetylneuraminic acid (Neu5Ac), which is important in terms of pathological diagnosis, using lanthanide-hexadentate macrocyclic polyazacarboxylate complexes (Ln-NOTA) as affinity reagents. It was shown that Ln-NOTA complexes increased the anionic mobility of Neu5Ac by approximately 40% through selective complexation with Neu5Ac. The extent of change in the mobility strongly depended on the type of central metal ion of Ln-NOTA. The stability constant (K) of Lu-NOTA with Neu5Ac was determined by ACE to be log Kb = 3.62 ± 0.04, which is the highest value among artificial receptors for Neu5Ac reported so far. Using this ACE, the Neu5Ac content in a glycoprotein sample, α1-acid glycoprotein (AGP), was determined after acid hydrolysis. Complete separation between Neu5Ac and hydrolysis products was successful by controlling the mobility to determine the concentration of Neu5Ac.

  10. Patterns of Molecular Variation. II. Associations of Electrophoretic Mobility and Larval Substrate within Species of the DROSOPHILA MULLERI Complex

    PubMed Central

    Richardson, R. H.; Smouse, Peter E.; Richardson, Martha E.

    1977-01-01

    Electromorphic variation among populations of Drosophila mojavensis, D. arizonensis and D. longicornis was examined for seven genetic loci. The average electrophoretic mobility for a population was used as the metric. D. mojavensis and D. arizonensis use larval substrates in different parts of their geographic ranges, while D. longicornis is more narrowly restricted to different species of the cactus Opuntia in different localities. There is marked electromorphic variation among populations of either D. mojavensis or D. arizonensis, and the bulk of this variation is accounted for by differences in laval substrate. There is somewhat less variation among populations of D. longicornis, and only a moderate portion of this is accounted for by larval substrate differences. There appears to be an association between the taxonomic diversity of the larval substrates and the electromorphic diversity of the Drosophila populations utilizing those substrates. Evidence is reviewed that suggests physiological mechanisms for these possibly adaptive associations. PMID:838268

  11. [Erythrocyte sedimentation rate in diluted suspensions and their electrophoretic mobility in a vertical electrical field].

    PubMed

    Balmukhanov, B S; Basenova, A T; Bulegenov, K E

    1989-01-01

    The sedimentation rates (SR) of human red blood cells (RBC) were measured in diluted suspensions using the thin plate chamber. If the suspension medium was phosphate buffer saline or 0,18 M NaCl the SR-dependence on the distance to the chambers wall corresponded to SR distribution of small particles without interaction. The more NaCl content was decreased down to 0.145 M, the more temperature-dependent variations of SR were noted, while SR distribution became distinct with the predicted one for the non-interacting particles. The use of SR distribution is discussed for testing the RBC interaction in diluted suspensions caused by sedimentation. The electrophoretic measurements carried out under vertical oriented electrical field showed the rate of RBC movement to be the linear function of the field gradient and to be not influenced under the SR modifying conditions.

  12. Determination of the microenvironment-pH and charge and size characteristics of amino acids through their electrophoretic mobilities determined by CZE.

    PubMed

    Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A

    2007-10-01

    Effective electrophoretic mobility data of 20 amino acids reported in the literature are analyzed and interpreted through simple physicochemical models, which are able to provide estimates of coupled quantities like hydrodynamic shape factor, equivalent hydrodynamic radius (size), net charge, actual pK values of ionizing groups, partial charges of ionizing groups, hydration number, and pH near molecule (microenvironment-pH of the BGE). It is concluded that the modeling of the electrophoretic mobility of these analytes requires a careful consideration of hydrodynamic shape coupled to hydration. In the low range of pH studied here, distinctive hydrodynamic behaviors of amino acids are found. For instance, amino acids with basic polar and ionizing side chain remain with prolate shape for pH values varying from 1.99 to 3.2. It is evident that as the pH increases from low values, amino acids get higher hydrations as a consequence each analyte total charge also increases. This result is consistent with the monotonic increase of the hydrodynamic radius, which accounts for both the analyte and the quite immobilized water molecules defining the electrophoretic kinematical unit. It is also found that the actual or effective pK value of the alpha-carboxylic ionizing group of amino acids increases when the pH is changed from 1.99 to 3.2. Several limitations concerning the simple modeling of the electrophoretic mobility of amino acids are presented for further research.

  13. Electrophoretic mobility shift assay on poly(ethylene glycol)-modified glass microchips for the study of estrogen responsive element binding.

    PubMed

    Chuang, Yen-Jun; Huang, Jia-Wei; Makamba, Honest; Tsai, Mei-Ling; Li, Chun-Wei; Chen, Shu-Hui

    2006-11-01

    The binding of estrogen receptor (ER) to estrogen response element (ERE) is essential for genomic pathways of estrogens and gel-based electrophoretic mobility shift assay (EMSA) is commonly used for analyzing ERE binding. Gel-based EMSA, however, requires the use of hazard radio isotopes and they are slow, labor-intensive and difficult to quantify. Here, we present quantitative affinity assays based on microchip electrophoresis using PEG-modified glass microchannels, which bear neutral surfaces against the adsorption of acidic DNA molecules and basic ER proteins. We first demonstrated the feasibility of the method by measuring binding constants of recombinant ERalpha and ERbeta with a consensus ERE sequence (cERE, 5'-GGTCAGAGTGACC-3') as well as with an ERE-like sequence (ERE 1576, 5'-GACCGGTCAGCGGACTCAC-3'). Changes in mobility as a function of protein-DNA molar ratios were plotted and the dissociation constants were determined based on non-linear curve fitting. The minimum amount of ER proteins required for one assay was around 0.2 ng and the run time for one chip analysis was less than 2 min. We further measured the estrogenic compound-mediated dissociation constants with recombinant ER proteins as well as with the extracted ERbeta from treated and untreated A549 bronchioloalveolar carcinoma cells. Dissociation constants determined by this method agree with the fact that agonist compounds such as 17beta-estradiol (1.70 nM), diethylstilbestrol (0.14 nM), and genistein (0.80 nM) assist ERE binding by decreasing the constants; while antagonist compounds such as testosterone (140.4 nM) and 4-hydroxytamoxifen (10.5 nM) suppress the binding by increasing the dissociation constant.

  14. Characterization of the cell surface properties of drinking water pathogens by microbial adhesion to hydrocarbon and electrophoretic mobility measurements.

    PubMed

    Popovici, Jonathan; White, Colin P; Hoelle, Jill; Kinkle, Brian K; Lytle, Darren A

    2014-06-01

    The surface characteristics of microbial cells directly influence their mobility and behavior within aqueous environments. The cell surface hydrophobicity (CSH) and electrophoretic mobility (EPM) of microbial cells impact a number of interactions and processes including aggregation, adhesion to surfaces, and stability of the cells within the aqueous environments. These cell characteristics are unique to the bacterial species and are a reflection of the large diversity of surface structures, proteins, and appendages of microorganisms. CSH and EPM of bacterial cells contribute substantially to the effectiveness of drinking water treatment to remove them, and therefore an investigation of these properties will be useful in predicting their removal through drinking water treatment processes and transport through drinking water distribution systems. EPM and CSH measurements of six microbiological pathogen or surrogate species suspended in phosphate-buffered water are reported in this work. Two strains of Vibrio cholerae were hydrophobic, while three strains of Escherichia coli were hydrophilic. Bacillus cereus was categorized as moderately hydrophobic. The strains of E. coli had the highest (most negative) EPM. Based on the measurements, E. coli species is predicted to be most difficult to remove from water while V. cholerae will be the easiest to remove.

  15. Label-Free Determination of the Number of Biomolecules Attached to Cells by Measurement of the Cell's Electrophoretic Mobility in a Microchannel

    PubMed Central

    Aki, Atsushi; Nair, Baiju G.; Morimoto, Hisao; Kumar, D. Sakthi; Maekawa, Toru

    2010-01-01

    We developed a label-free method for a determination of the number of biomolecules attached to individual cells by measuring the electrophoretic mobility of the cells in a microchannel. The surface of a biological cell, which is dispersed in aqueous solution, is normally electrically charged and the charge quantity at the cell's surface is slightly changed once antibody molecules are attached to the cell, based on which we detect the attachment of antibody molecules to the surface of individual red blood cells by electrophoretic mobility measurement. We also analyzed the number of antibody molecules attached to the cell's surface using a flow cytometer. We found that there is a clear correlation between the number of antibody molecules attached to the individual cells and the electophoretic mobility of the cells. The present technique may well be utilized not only in the field of cell biology but also in the medical and pharmaceutical industries. PMID:21206908

  16. Lateral ink mobility and fringe field effects across the porous matrix of an electrophoretic display

    NASA Astrophysics Data System (ADS)

    Li Tsui, Kelly; Ahumada, Manuel; Bryning, Mateusz; Hartono, Michelle; Lee, Sang-Joon J.

    2013-03-01

    This investigation studies fringe field between laterally adjacent electrodes in a reverse-emulsion electrophoretic display (REED). The display consists of a nanodroplet ink and a porous matrix that serves as the "paper" between planar electrodes. One relative advantage of this type of electronic paper display is that it can be produced with lowcost materials and manufacturing processes. A concern for image resolution, however, is the fringe field effect that occurs in the gaps between neighboring electrodes. Ideally the dye-containing nanodroplets in the ink move in a direction that is strictly perpendicular to the opposing pairs of electrodes. However, nanodroplet saturation and potential gradients from neighboring electrodes may result in lateral displacement of the nanodroplets as well. Accordingly, this study examines how fringe field between neighboring electrodes is affected by lateral spacing and applied voltage. Transient and steady-state effects were studied by fabricating and testing devices that were patterned with different lateral spacing between electrodes, and switching under different voltage levels. Relative luminance was extracted from digital microscope images, captured in the vicinity between neighboring electrodes. Measurements were recorded for electrode spacing of 20 μm, 40 μm, 60 μm, and 80 μm with devices switched at ±1.5 V and ±2.5 V. Gradients in luminance overlapped at lateral distances below 60 μm, and became distinct for left and right electrodes spaced by at least 80 μm. Higher applied voltage resulted in steeper transition between light and dark states, but exhibited distortion at electrode edges.

  17. A 502-Base Free-Solution Electrophoretic DNA Sequencing Method Using End-Attached Wormlike Micelles.

    PubMed

    Istivan, Stephen B; Bishop, Daniel K; Jones, Angela L; Grosser, Shane T; Schneider, James W

    2015-11-17

    We demonstrate that the use of wormlike nonionic micelles as drag-tags in end-labeled free-solution electrophoresis ("micelle-ELFSE") provides single-base resolution of Sanger sequencing products up to 502 bases in length, a nearly 2-fold improvement over reported ELFSE separations. "CiEj" running buffers containing 48 mM C12E5, 6 mM C10E5, and 3 M urea (32.5 °C) form wormlike micelles that provide a drag equivalent to an uncharged DNA fragment with a length (α) of 509 bases (effective Rh = 27 nm). Runtime in a 40 cm capillary (30 kV) was 35 min for elution of all products down to the 26-base primer. We also show that smaller Triton X-100 micelles give a read length of 103 bases in a 4 min run, so that a combined analysis of the Sanger products using the two buffers in separate capillaries could be completed in 14 min for the full range of lengths. A van Deemter analysis shows that resolution is limited by diffusion-based peak broadening and wall adsorption. Effects of drag-tag polydispersity are not observed, despite the inherent polydispersity of the wormlike micelles. We ascribe this to a stochastic size-sampling process that occurs as micelle size fluctuates rapidly during the runtime. A theoretical model of the process suggests that fluctuations occur with a time scale less than 10 ms, consistent with the monomer exchange process in nonionic micelles. The CiEj buffer has a low viscosity (2.7 cP) and appears to be semidilute in micelle concentration. The large drag-tag size of the CiEj buffers leads to steric segregation of the DNA and tag for short fragments and attendant mobility shifts.

  18. Gel mobilities of linking-number topoisomers and their dependence on DNA helical repeat and elasticity

    PubMed Central

    Vetcher, Alexandre A.; McEwen, Abbye E.; Abujarour, Ramzey; Hanke, Andreas; Levene, Stephen D.

    2010-01-01

    Agarose-gel electrophoresis has been used for more than thirty years to characterize the linking-number (Lk) distribution of closed-circular DNA molecules. Although the physical basis of this technique remains poorly understood, the gel-electrophoretic behavior of covalently closed DNAs has been used to determine the local unwinding of DNA by proteins and small-molecule ligands, characterize supercoiling-dependent conformational transitions in duplex DNA, and to measure helical-repeat changes due to shifts in temperature and ionic strength. Those results have been analyzed by assuming that the absolute mobility of a particular topoisomer is mainly a function of the integral number of superhelical turns, and thus a slowly varying function of plasmid molecular weight. In examining the mobilities of Lk topoisomers for a series of plasmids that differ incrementally in size over more than one helical turn, we found that the size-dependent agarose-gel mobility of individual topoisomers with identical values of Lk (but different values of the excess linking number, ΔLk) vary dramatically over a duplex turn. Our results suggest that a simple semi-empirical relationship holds between the electrophoretic mobility of linking-number topoisomers and their average writhe in solution. PMID:20346570

  19. Exploring the evaluation of net charge, hydrodynamic size and shape of peptides through experimental electrophoretic mobilities obtained from CZE.

    PubMed

    Piaggio, Maria V; Peirotti, Marta B; Deiber, Julio A

    2006-12-01

    This work explores the validity of simple CZE models to analyze the electrophoretic mobilities of 102 peptides reported in literature. These models are based mainly on fundamental physicochemical theories providing analytical expressions amenable to relatively simple numerical analysis. Thus, the Linderstrøm-Lang capillary electrophoresis model (LLCEM) and its perturbed version (PLLCEM), proposed and applied previously to the CZE of globular proteins, are adapted and used here for peptides. Also the effects of pK-shifts on net charge, hydration and hydrodynamic size and shape of peptides are analyzed and discussed. Emphasis is placed on the fact that these parameters are physically coupled, and thus a variation in the net charge may produce an appreciable change in the hydrodynamic size of peptides. Within the framework of CZE, peptides may be assumed as having a hydrodynamic volume associated with either spherical or spheroidal particles. The effects on peptide net charge and hydrodynamic size, of electrostatic interaction between a pair of charged groups in the chain and electrical permitivitty around the peptide domain are studied. The predictions of the PLLCEM and LLCEM are in good agreement with results reported previously in the literature. Several limitations concerning these models and some needs for further research are also described.

  20. Surface charge of trypanosoma cruzi. Binding of cationized ferritin and measurement of cellular electrophoretic mobility.

    PubMed

    De Souza, W; Arguello, C; Martinez-Paloma, A; Trissl, D; Gonzáles-Robles, A; Chiari, E

    1977-08-01

    The surface charge of epimastigote and trypomastigote forms of Trypanosoma cruzi was evaluated by means of binding of cationized ferritin to the cell surface as visualized by electron microscopy, and by direct measurements of the cellular microelectrophoretic mobility (EPM). Epimastigote forms had a mean EPM of -0.52 micrometer-s-1-V-1-cm and were lightly labeled with cationized ferritin. In contrast, bloodstream trypomastigotes had a much higher EPM (-1.14), and the surface was heavily labeled with cationized ferritin. When trypomastigotes from staionary phase cultures were isolated on DEAE cellulose columns, the mean EPM was found to be significantly lower (-0.63), and labeling with cationized ferritin decreased. With a mixed population containing epimastigote, trypomastigote, and intermediate forms, EPM values ranging between -0.70 to -1.14 were found. From these observations we conclude that there is a definite increase in negative surface charge during development from epi- to trypomastigote forms of T. cruzi.

  1. Poly(styrene/alpha-tert-butoxy-omega-vinylbenzylpolyglycidol) microspheres for immunodiagnostics. Principle of a novel latex test based on combined electrophoretic mobility and particle aggregation measurements.

    PubMed

    Radomska-Galant, Izabela; Basinska, Teresa

    2003-01-01

    The principle of a novel latex agglutination test based on combined results of electrophoretic mobility and particle aggregation measurements is described. Poly(styrene/alpha-tert-butoxy-omega-vinylbenzylpolyglycidol) (P(S/PGL)) microspheres were synthesized by a one step soap-free emulsion copolymerization of styrene and alpha-tert-butoxy-omega-vinylbenzylpolyglycidol macromonomer with number average molecular weight Mn = 2700 (polydispersity [Mw]/[Mn] = 1.10). Particles with monomodal size distribution (number average diameter Dn = 220 nm) and surface fraction of polyglycidol equal to f = 0.42 mol % were obtained. Human serum albumin (HSA) was covalently bound onto the surface of P(S/PGL) microspheres activated with 1,3,5-trichlorotriazine. In a model immunodiagnostic assay for anti-HSA, in which P(S/PGL) particles with covalently bound HSA have been used, the electrophoretic mobility and aggregation of microspheres were measured simultaneously. This approach allowed detection of anti-HSA in the serum in the range of anti-HSA concentrations from 0.1 to 150 microg/mL. The highest changes in electrophoretic mobility were registered for microspheres with surface concentration of immobilized HSA equal to Gamma = 9.2 x 10(-4) g/m2.

  2. Evaluation of the Stepwise Mutation Model of Electrophoretic Mobility: Comparison of the Gel Sieving Behavior of Alleles at the Esterase-5 Locus of DROSOPHILA PSEUDOOBSCURA

    PubMed Central

    Johnson, George B.

    1977-01-01

    Seven alleles at the esterase-5 locus of Drosophila pseudoobscura appear approximately uniformly spaced on 5% acrylamide gels. Such stepwise "ladders" in mobility have been used to argue for the charge-state model of electrophoretic mobility. To evaluate this interpretation, flies of the seven strains were examined in replicate electrophoresis on polyacrylamide gels of differing pore size, permitting estimation of the relative contributions of charge and of size/conformation to electrophoretic mobility. Six of the seven strains examined proved to be heterogeneous, containing multiple variants that migrate to similar positions on 5% acrylamide gels. In the one strain genetically analyzed to date, the hidden variants segregate in crosses. A total of fourteen variants are detected by this gel sieving analysis, many of them involving apparent conformational differences. Thus, protein properties in addition to net charge appear to play an important role in determining the degree of mobility difference between alleles. Examining estimates of free mobility, uniform charge differences are the rule within conformational classes. However, the superposition of conformational heterogeneity renders interpretation of mobility spacing solely in terms of such charge differences inappropriate. PMID:17248754

  3. Cell electrophoresis on a chip: what can we know from the changes in electrophoretic mobility?

    PubMed

    Akagi, Takanori; Ichiki, Takanori

    2008-08-01

    An overview of both experimental and theoretical studies of cell electrophoresis mobility (EPM) over the past fifty years and the relevance of cell EPM measurement are presented and discussed from the viewpoint of exploring the potential use of cell EPM as an index of the biological condition of cells. Physical measurements of the optical and/or electrical properties of cells have been attracting considerable attention as noninvasive cell-evaluation methods that are essential for the future of cell-based application technologies such as cell-based drug screening and cell therapy. Cell EPM, which can be measured in a noninvasive manner by cell electrophoresis, reflects the electrical and mechanical properties of the cell surface. Although the importance of cell EPM has been underestimated for a long time, mostly owing to the technical difficulties associated with its measurement, recent improvements in measurement technology using microcapillary chips have been changing the situation: cell EPM measurement has become more reliable and faster. Recent studies using the automated microcapillary cell electrophoresis system have revealed the close correlation between cell EPM and important biological phenomena including cell cycle, apoptosis, enzymatic treatment, and immune reaction. In particular, the converged EPM distribution observed for synchronized cells has altered the conventional belief that cell EPMs vary considerably. Finding a new significance of cell EPM is likely to lead to noninvasive cell evaluation methods essential for the next-generation of cell engineering.

  4. Electrophoretic mobility, catalytic rate, and activation energy of catalysis of single molecules of the enzyme β-glucuronidase from Escherichia coli.

    PubMed

    Craig, Douglas B; King, Steffany D; Reinfelds, Gundars; Henderson, Anna R P; Wood, Tabitha E H

    2017-03-01

    Single molecule assays were performed on the enzyme E. coli β-glucuronidase using a capillary electrophoresis-based protocol. Electrophoretic mobility, catalytic rate and activation energy of catalysis were all found to be heterogeneous. The average mobility at 22°C was -1.1×10(-8)±0.1m(2)V(-1)s(-1) (N=49) with a total range of -0.6 to -1.3×10(-8)m(2)V(-1)s(-1). The range in electrophoretic mobility suggests that the differences in shape or charge of the individual molecules underlying the heterogeneity are likely minimal. The average catalytic rate at 22°C was 37,000±19,000min(-1) (N=49) with a total range of 14,000 to 130,000min(-1). Both of these properties were measured simultaneously for each of the molecules. There was a weak correlation (r(2)=0.43) between mobility and rate with the molecules with a less negative mobility having a tendency to have a higher rate. The average activation energy of catalysis, as determined by comparing rates at 22 and 35°C, was found to be 48±18kJmol(-1) (N=7) with a total range of 18-66kJmol(-1). Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Alpha chain hemoglobins with electrophoretic mobility similar to that of hemoglobin S in a newborn screening program.

    PubMed

    Silva, Marcilene Rezende; Sendin, Shimene Mascarenhas; Araujo, Isabela Couto de Oliveira; Pimentel, Fernanda Silva; Viana, Marcos Borato

    2013-01-01

    To characterize alpha-chain variant hemoglobins with electric mobility similar to that of hemoglobin S in a newborn screening program. β(S) allele and alpha-thalassemia deletions were investigated in 14 children who had undefined hemoglobin at birth and an electrophoretic profile similar to that of hemoglobin S when they were six months old. Gene sequencing and restriction enzymes (DdeI, BsaJI, NlaIV, Bsu36I and TaqI) were used to identify hemoglobins. Clinical and hematological data were obtained from children who attended scheduled medical visits. THE FOLLOWING ALPHA CHAIN VARIANTS WERE FOUND: seven children with hemoglobin Hasharon [alpha2 47(CE5) Asp>His, HbA2:c.142G>C], all associated with alpha-thalassemia, five with hemoglobin Ottawa [alpha1 15(A13) Gly>Arg, HBA1:c.46G>C], one with hemoglobin St Luke's [alpha1 95(G2) Pro>Arg, HBA1:c.287C>G] and another one with hemoglobin Etobicoke [alpha212 84(F5) Ser>Arg, HBA212:c.255C>G]. Two associations with hemoglobin S were found: one with hemoglobin Ottawa and one with hemoglobin St Luke's. The mutation underlying hemoglobin Etobicoke was located in a hybrid α212 allele in one child. There was no evidence of clinically relevant hemoglobins detected in this study. Apparently these are the first cases of hemoglobin Ottawa, St Luke's, Etobicoke and the α212 gene described in Brazil. The hemoglobins detected in this study may lead to false diagnosis of sickle cell trait or sickle cell disease when only isoelectric focusing is used in neonatal screening. Additional tests are necessary for the correct identification of hemoglobin variants.

  6. Capillary electrophoretic separation of DNA restriction fragments using dilute polymer solutions

    SciTech Connect

    Braun, B.; Blanch, W.; Prausnitz, J.M.

    1997-02-01

    Because the mechanism of DNA separation in capillary electrophoresis is not well understood, selection of polymers is a {open_quotes}trial-and-error{close_quotes} procedure. We investigated dilute-solution DNA separations by capillary electrophoresis using solutions of four polymers that differ in size, shape and stiffness. Hydroxyethylcellulose of high molecular weight provides excellent separation of large DNA fragments (2027 bp - 23130 bp). Polyvinylpyrrolidone separates DNA from 72 bp to 23 kbp and star-(polyethylene oxide), like linear poly (ethylene oxide), provides separation of fragments up to 1353 bp.

  7. Simulation guided design of a microfluidic device for electrophoretic stretching of DNA

    PubMed Central

    Hsieh, Chih-Chen; Lin, Tsung-Hsien; Huang, Chiou-De

    2012-01-01

    We have used Brownian dynamics-finite element method (BD-FEM) to guide the optimization of a microfluidic device designed to stretch DNA for gene mapping. The original design was proposed in our previous study [C. C. Hsieh and T. H. Lin, Biomicrofluidics 5(4), 044106 (2011)] for demonstrating a new pre-conditioning strategy to facilitate DNA stretching through a microcontraction using electrophoresis. In this study, we examine the efficiency of the original device for stretching DNA with different sizes ranging from 48.5 kbp (λ-DNA) to 166 kbp (T4-DNA). The efficiency of the device is found to deteriorate with increasing DNA molecular weight. The cause of the efficiency loss is determined by BD-FEM, and a modified design is proposed by drawing an analogy between an electric field and a potential flow. The modified device does not only regain the efficiency for stretching large DNA but also outperforms the original device for stretching small DNA. PMID:24155866

  8. Simulation of conformational preconditioning strategies for electrophoretic stretching of DNA in a microcontraction

    PubMed Central

    Hsieh, Chih-Chen; Lin, Tsung-Hsien

    2011-01-01

    We have used Brownian dynamics-finite element method to examine two conformational preconditioning approaches for improving DNA stretching in a microcontraction for the purpose of direct gene analysis. The newly proposed “pre-stretching” strategy is found to significantly improve the degree of DNA extension at the exit of the contraction. On the other hand, applying an oscillating extensional field to DNA yields no preconditioning effect. Detailed analysis of the evolution of DNA extension and conformation reveals that the success of our “pre-stretching” strategy relies on the “non-local” effect that cannot be predicted using simple kinematics analysis. In other words, accurate prediction can only be obtained using detailed simulations. Comparing to the existing preconditioning strategies, our “pre-stretching” method is easy to implement while still providing a very good performance. We hope that the insight gained from this study can be useful for future design of biomicrofluidic devices for DNA manipulation. PMID:22662058

  9. DNA Electrophoretic Migration Patterns Change after Exposure of Jurkat Cells to a Single Intense Nanosecond Electric Pulse

    PubMed Central

    Romeo, Stefania; Zeni, Luigi; Sarti, Maurizio; Sannino, Anna; Scarfì, Maria Rosaria; Vernier, P. Thomas; Zeni, Olga

    2011-01-01

    Intense nanosecond pulsed electric fields (nsPEFs) interact with cellular membranes and intracellular structures. Investigating how cells respond to nanosecond pulses is essential for a) development of biomedical applications of nsPEFs, including cancer therapy, and b) better understanding of the mechanisms underlying such bioelectrical effects. In this work, we explored relatively mild exposure conditions to provide insight into weak, reversible effects, laying a foundation for a better understanding of the interaction mechanisms and kinetics underlying nsPEF bio-effects. In particular, we report changes in the nucleus of Jurkat cells (human lymphoblastoid T cells) exposed to single pulses of 60 ns duration and 1.0, 1.5 and 2.5 MV/m amplitudes, which do not affect cell growth and viability. A dose-dependent reduction in alkaline comet-assayed DNA migration is observed immediately after nsPEF exposure, accompanied by permeabilization of the plasma membrane (YO-PRO-1 uptake). Comet assay profiles return to normal within 60 minutes after pulse delivery at the highest pulse amplitude tested, indicating that our exposure protocol affects the nucleus, modifying DNA electrophoretic migration patterns. PMID:22164287

  10. Sequence Dependent Electrophoretic Separations of DNA in Pluronic F127 Gels

    NASA Astrophysics Data System (ADS)

    You, Seungyong; van Winkle, David H.

    2010-03-01

    Two-dimensional (2-D) electrophoresis has successfully been used to visualize the separation of DNA fragments of the same length. We electrophorese a double-stranded DNA ladder in an Agarose gel for the first dimension and in gels of Pluronic F127 for the second dimension at room temperature. The 1000 bp band that travels together as a single band in an Agarose gel is split into two bands in Pluronic gels. The slower band follows the exponential decay trend that the other ladder constituents do. After sequencing the DNA fragments, the faster band has an apparently random sequence, while the slower band and the others have two A-tracts in each 250 bp segment. The A-tracts consist of a series of at least five adenine bases pairing with thymine bases. This result leads to the conclusion that the migration of the DNA molecules bent with A-tracts is more retarded in Pluronic gels than the wild-type of DNA molecules.

  11. [Determination of the electrophoretic mobility of peripheral red blood cells from healthy individuals, by using ethylene-2-amine-4-chloroacetic acid as a preservative].

    PubMed

    Iastrubinetskaia, O I; Popova, O V; Sarycheva, T G; Tentsova, I A; Kozinets, G I

    2009-01-01

    It is now known that the electric charge of a surface cellular membrane is a rather characteristic value for each type of a cell. Cellular electrophoresis may be used to study the electrokinetic properties of red blood cells in each specific case, thereby obtaining indirect information on the state of a surface membrane as the electrophoretic mobility (EPM) rate is directly proportional to the value of a cellular electric charge. The study was undertaken to compare the EPM rates of peripheral red blood cells from donors, by employing two different preservatives: EDTCHA and sodium citrate. No statistically significant differences were found in the groups under study and these parameters were comparable.

  12. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, Barry L.; Thilly, William G.; Foret, Frantisek; Khrapko, Konstaintin; Koehavong, Phouthone; Cohen, Aharon S.; Giese, Roger W.

    1997-01-01

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability.

  13. Electrophoretic detection and separation of mutant DNA using replaceable polymer matrices

    DOEpatents

    Karger, B.L.; Thilly, W.G.; Foret, F.; Khrapko, K.; Koehavong, P.; Cohen, A.S.; Giese, R.W.

    1997-05-27

    The disclosure relates to a method for resolving double-stranded DNA species differing by at least one base pair. Each of the species is characterized by an iso-melting domain with a unique melting temperature contiguous with a melting domain of higher thermal stability. 18 figs.

  14. [Electrophoretic karyotypes and genomic DNA restriction fragment analysis: their usefulness as tools in the epidemiological study of Candid parapsilosis].

    PubMed

    Perrotta, D; Rodero, L; Demkura, H; Canteros, C; Davel, G

    2002-01-01

    During the past decades, several studies have reported an increase in the incidence of nosocomial candidosis. In a prospective study, performed at the Departamento de Micología, INEI, ANLIS Dr. C. G. Malbrán and the Servicio de Neonatología and Microbiología, Hospital de Niños Sor María Ludovica, from October 1995 to December 1996, 167 patients with candidosis were detected. Candida species isolated were C. albicans (53.1%), C. parapsilosis (26.5%) and C. tropicalis (14.8%). The aim of this work was to characterize the clinical C. parapsilosis isolates from pediatric patients hospitalized in two neonatal intensive care units from the same hospital and to evaluate the usefulness of electrophoretic karyotype (EK) and restriction endonuclease analysis of genomic DNA (REAG) using a low frequency digestion enzyme. EK of all isolates disclosed 12 banding patterns and REAG with endonuclease Sfi I showed only 5 groups. However, isolates from the control group could not be separated from the clinical isolates. The isolates within each dendogram group for EK or REAG were apparently unrelated. Our results show that EK yields better results than REAG, but that it falls short of the desired discrimination, which suggests that these techniques do not seem to be useful for studying nosocomial C. parapsilosis outbreaks.

  15. Gas-phase electrophoretic molecular mobility analysis of size and stoichiometry of complexes of a common cold virus with antibody and soluble receptor molecules.

    PubMed

    Laschober, Christian; Wruss, Juergen; Blaas, Dieter; Szymanski, Wladyslaw W; Allmaier, Günter

    2008-03-15

    Attachment of a nonaggregating monoclonal antibody and of a soluble recombinant receptor molecule to the icosahedral nonenveloped human rhinovirus serotype 2 was studied with a nanoelectrospray ionization gas-phase electrophoretic molecular mobility analyzer (nESI-GEMMA). The virus mass, as determined via nESI-GEMMA, was within instrument accuracy (+/-6%) close to the theoretical value (8 x 10(6) Da) calculated from the sum of all constituents of one virus particle (60 copies of each of the four viral capsid proteins, the RNA genome, and one copy of the RNA-linked protein VpG). The formation of virus-antibody complexes of different stoichiometries (up to a mass 12.5 x 10(6) Da corresponding to 30 attached antibodies) and virus-receptor complexes (up to a mass 8.8 x 10(6) Da corresponding to 12 attached receptor molecules) was monitored. Via the volume derived from the electrophoretic mobility diameter (EMD), the stoichiometry of the HRV complexes was calculated. The accuracy of the EMD was within +/-0.5 nm, which corresponds to an accuracy of +/-4 antibodies and +/-5 receptor molecules in the respective complexes. For the first time, we here demonstrate the use of nESI-GEMMA for the analysis of the size and stoichiometry of biomolecules in high-order complexes in real time under normal pressure conditions.

  16. The mobility minima in pulsed-field capillary electrophoresis of large DNA.

    PubMed Central

    Sudor, J; Novotny, M

    1995-01-01

    Pulsed-field capillary electrophoresis represents a new tool for rapid and highly efficient separations of large biopolymers. The method has been utilized here to study dependencies of the electrophoretic mobility upon the frequency and pulse shape of applied voltage for large, double-stranded DNA molecules (5-100 kb) migrating in neutral polymer solutions. Two different shapes of alternating electric field (sine- and square-wave impulses) were examined with the frequency values ranging from 1 to 30 Hz. The linear dependence between duration of the forward pulse (at which the DNA molecule experiences a minimum mobility) and the product N.In(N) (where N is the number of base pairs) was experienced in field-inversion gel electrophoresis, while exponential dependence was found with the sinusoidal electric field. The mobility minima were lower in field-inversion electrophoresis than with the biased sinusoidal-field technique. The DNA (5 kb concatamers) was adequately separated using a ramp of frequency in the square-wave electric field, in approximately 1 h. The migration order of DNA fragments was referenced through adding a monodisperse DNA (48.5 kb) into the sample. The band inversion phenomena were not observed under any experimental conditions used in this work. PMID:7630733

  17. On the electrophoretic mobility of succinoglycan modelled as a spherical polyelectrolyte: From Hermans-Fujita theory to charge regulation in multi-component electrolytes.

    PubMed

    Hill, Reghan J

    2016-11-15

    Literature interpretations of the electrophoretic mobility of spherical polyelectrolytes are revisited using the capillary-electrophoresis data of Duval et al. (2006) for the extracellular polysaccharide succinoglycan as an example. Subtle changes in the polyelectrolyte mobility have recently been attributed to new electrokinetic theories that feature multi-component electrolytes, charge regulation, and the so-called polarization and relaxation phenomena. However, these calculations exhibit several unusual trends that have yet to be explained, and so the conclusions drawn from them are controversial. Here, independent computations strengthen conclusions drawn from the original model of Duval et al., i.e., the discrepancies between experiments and all the presently available electrokinetic theories reflect changes in the conformation of succinoglycan arising from changes in the electrolyte pH and ionic strength.

  18. Determination of pKa values of tenoxicam from 1H NMR chemical shifts and of oxicams from electrophoretic mobilities (CZE) with the aid of programs SQUAD and HYPNMR.

    PubMed

    Rodríguez-Barrientos, Damaris; Rojas-Hernández, Alberto; Gutiérrez, Atilano; Moya-Hernández, Rosario; Gómez-Balderas, Rodolfo; Ramírez-Silva, María Teresa

    2009-12-15

    In this work it is explained, by the first time, the application of programs SQUAD and HYPNMR to refine equilibrium constant values through the fit of electrophoretic mobilities determined by capillary zone electrophoresis experiments, due to the mathematical isomorphism of UV-vis absorptivity coefficients, NMR chemical shifts and electrophoretic mobilities as a function of pH. Then, the pK(a) values of tenoxicam in H(2)O/DMSO 1:4 (v/v) have been obtained from (1)H NMR chemical shifts, as well as of oxicams in aqueous solution from electrophoretic mobilities determined by CZE, at 25 degrees C. These values are in very good agreement with those reported by spectrophotometric and potentiometric measurements.

  19. Impact of Chemical and Structural Anisotropy on the Electrophoretic Mobility of Spherical Soft Multilayer Particles: The Case of Bacteriophage MS2

    PubMed Central

    Langlet, Jérémie; Gaboriaud, Fabien; Gantzer, Christophe; Duval, Jérôme F. L.

    2008-01-01

    We report a theoretical investigation of the electrohydrodynamic properties of spherical soft particles composed of permeable concentric layers that differ in thickness, soft material density, chemical composition, and flow penetration degree. Starting from a recent numerical scheme developed for the computation of the direct-current electrophoretic mobility (μ) of diffuse soft bioparticles, the dependence of μ on the electrolyte concentration and solution pH is evaluated taking the known three-layered structure of bacteriophage MS2 as a supporting model system (bulk RNA, RNA-protein bound layer, and coat protein). The electrokinetic results are discussed for various layer thicknesses, hydrodynamic flow penetration degrees, and chemical compositions, and are discussed on the basis of the equilibrium electrostatic potential and hydrodynamic flow field profiles that develop within and around the structured particle. This study allows for identifying the cases where the electrophoretic mobility is a function of the inner structural and chemical specificity of the particle and not only of its outer surface properties. Along these lines, we demonstrate the general inapplicability of the notions of zeta potential (ζ) and surface charge for quantitatively interpreting electrokinetic data collected for such systems. We further shed some light on the physical meaning of the isoelectric point. In particular, numerical and analytical simulations performed on structured soft layers in indifferent electrolytic solution demonstrate that the isoelectric point is a complex ionic strength-dependent signature of the flow permeation properties and of the chemical and structural details of the particle. Finally, the electrophoretic mobilities of the MS2 virus measured at various ionic strength levels and pH values are interpreted on the basis of the theoretical formalism aforementioned. It is shown that the electrokinetic features of MS2 are to a large extent determined not only by

  20. Impact of chemical and structural anisotropy on the electrophoretic mobility of spherical soft multilayer particles: the case of bacteriophage MS2.

    PubMed

    Langlet, Jérémie; Gaboriaud, Fabien; Gantzer, Christophe; Duval, Jérôme F L

    2008-04-15

    We report a theoretical investigation of the electrohydrodynamic properties of spherical soft particles composed of permeable concentric layers that differ in thickness, soft material density, chemical composition, and flow penetration degree. Starting from a recent numerical scheme developed for the computation of the direct-current electrophoretic mobility (mu) of diffuse soft bioparticles, the dependence of mu on the electrolyte concentration and solution pH is evaluated taking the known three-layered structure of bacteriophage MS2 as a supporting model system (bulk RNA, RNA-protein bound layer, and coat protein). The electrokinetic results are discussed for various layer thicknesses, hydrodynamic flow penetration degrees, and chemical compositions, and are discussed on the basis of the equilibrium electrostatic potential and hydrodynamic flow field profiles that develop within and around the structured particle. This study allows for identifying the cases where the electrophoretic mobility is a function of the inner structural and chemical specificity of the particle and not only of its outer surface properties. Along these lines, we demonstrate the general inapplicability of the notions of zeta potential (zeta) and surface charge for quantitatively interpreting electrokinetic data collected for such systems. We further shed some light on the physical meaning of the isoelectric point. In particular, numerical and analytical simulations performed on structured soft layers in indifferent electrolytic solution demonstrate that the isoelectric point is a complex ionic strength-dependent signature of the flow permeation properties and of the chemical and structural details of the particle. Finally, the electrophoretic mobilities of the MS2 virus measured at various ionic strength levels and pH values are interpreted on the basis of the theoretical formalism aforementioned. It is shown that the electrokinetic features of MS2 are to a large extent determined not only

  1. Analysis of a common cold virus and its subviral particles by gas-phase electrophoretic mobility molecular analysis and native mass spectrometry.

    PubMed

    Weiss, Victor U; Bereszcazk, Jessica Z; Havlik, Marlene; Kallinger, Peter; Gösler, Irene; Kumar, Mohit; Blaas, Dieter; Marchetti-Deschmann, Martina; Heck, Albert J R; Szymanski, Wladyslaw W; Allmaier, Günter

    2015-09-01

    Gas-phase electrophoretic mobility molecular analysis (GEMMA) separates nanometer-sized, single-charged particles according to their electrophoretic mobility (EM) diameter after transition to the gas-phase via a nano electrospray process. Electrospraying as a soft desorption/ionization technique preserves noncovalent biospecific interactions. GEMMA is therefore well suited for the analysis of intact viruses and subviral particles targeting questions related to particle size, bioaffinity, and purity of preparations. By correlating the EM diameter to the molecular mass (Mr) of standards, the Mr of analytes can be determined. Here, we demonstrate (i) the use of GEMMA in purity assessment of a preparation of a common cold virus (human rhinovirus serotype 2, HRV-A2) and (ii) the analysis of subviral HRV-A2 particles derived from such a preparation. (iii) Likewise, native mass spectrometry was employed to obtain spectra of intact HRV-A2 virions and empty viral capsids (B-particles). Charge state resolution for the latter allowed its Mr determination. (iv) Cumulatively, the data measured and published earlier were used to establish a correlation between the Mr and EM diameter for a range of globular proteins and the intact virions. Although a good correlation resulted from this analysis, we noticed a discrepancy especially for the empty and subviral particles. This demonstrates the influence of genome encapsulation (preventing analytes from shrinking upon transition into the gas-phase) on the measured analyte EM diameter. To conclude, GEMMA is useful for the determination of the Mr of intact viruses but needs to be employed with caution when subviral particles or even empty viral capsids are targeted. The latter could be analyzed by native MS.

  2. Comprehensive Size-Determination of Whole Virus Vaccine Particles Using Gas-Phase Electrophoretic Mobility Macromolecular Analyzer, Atomic Force Microscopy, and Transmission Electron Microscopy

    PubMed Central

    Havlik, Marlene; Marchetti-Deschmann, Martina; Friedbacher, Gernot; Winkler, Wolfgang; Messner, Paul; Perez-Burgos, Laura; Tauer, Christa; Allmaier, Günter

    2015-01-01

    Biophysical properties including particle size distribution, integrity, and shape of whole virus vaccine particles at different stages in tick-borne encephalitis (TBE) vaccines formulation were analyzed by a new set of methods. Size-exclusion chromatography (SEC) was used as a conservative sample preparation for vaccine particle fractionation and gas-phase electrophoretic mobility macromolecular analyzer (GEMMA) for analyzing electrophoretic mobility diameters of isolated TBE virions. The derived particle diameter was then correlated with molecular weight. The diameter of the TBE virions determined after SEC by GEMMA instrumentation was 46.8 ± 1.1 nm. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were implemented for comparison purposes and to gain morphological information on the virion particle. Western blotting (Dot Blot) as an immunological method confirmed biological activity of the particles at various stages of the developed analytical strategy. AFM and TEM measurements revealed higher diameters with much higher SD for a limited number of virions, 60.4 ± 8.5 and 53.5 ± 5.3 nm, respectively. GEMMA instrumentation was also used for fractionation of virions with specifically selected diameters in the gas-phase, which were finally collected by means of an electrostatic sampler. At that point (i.e., after particle collection), AFM and TEM showed that the sampled virions were still intact, exhibiting a narrow size distribution (i.e., 59.8 ± 7.8 nm for AFM and 47.5 ± 5.2 nm for TEM images), and most importantly, dot blotting confirmed immunological activity of the collected samples. Furthermore dimers and virion artifacts were detected, too. PMID:26266988

  3. Comprehensive size-determination of whole virus vaccine particles using gas-phase electrophoretic mobility macromolecular analyzer, atomic force microscopy, and transmission electron microscopy.

    PubMed

    Havlik, Marlene; Marchetti-Deschmann, Martina; Friedbacher, Gernot; Winkler, Wolfgang; Messner, Paul; Perez-Burgos, Laura; Tauer, Christa; Allmaier, Günter

    2015-09-01

    Biophysical properties including particle size distribution, integrity, and shape of whole virus vaccine particles at different stages in tick-borne encephalitis (TBE) vaccines formulation were analyzed by a new set of methods. Size-exclusion chromatography (SEC) was used as a conservative sample preparation for vaccine particle fractionation and gas-phase electrophoretic mobility macromolecular analyzer (GEMMA) for analyzing electrophoretic mobility diameters of isolated TBE virions. The derived particle diameter was then correlated with molecular weight. The diameter of the TBE virions determined after SEC by GEMMA instrumentation was 46.8 ± 1.1 nm. Atomic force microscopy (AFM) and transmission electron microscopy (TEM) were implemented for comparison purposes and to gain morphological information on the virion particle. Western blotting (Dot Blot) as an immunological method confirmed biological activity of the particles at various stages of the developed analytical strategy. AFM and TEM measurements revealed higher diameters with much higher SD for a limited number of virions, 60.4 ± 8.5 and 53.5 ± 5.3 nm, respectively. GEMMA instrumentation was also used for fractionation of virions with specifically selected diameters in the gas-phase, which were finally collected by means of an electrostatic sampler. At that point (i.e., after particle collection), AFM and TEM showed that the sampled virions were still intact, exhibiting a narrow size distribution (i.e., 59.8 ± 7.8 nm for AFM and 47.5 ± 5.2 nm for TEM images), and most importantly, dot blotting confirmed immunological activity of the collected samples. Furthermore dimers and virion artifacts were detected, too.

  4. Electrophoretic cell separation by means of immunomicrospheres

    NASA Technical Reports Server (NTRS)

    Rembaum, A.; Smolka, A. J. K.

    1980-01-01

    The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.

  5. Electrophoretic cell separation by means of microspheres

    NASA Technical Reports Server (NTRS)

    Smolka, A. J. K.; Nerren, B. H.; Margel, S.; Rembaum, A.

    1979-01-01

    The electrophoretic mobility of fixed human erythrocytes immunologically labeled with poly(vinylpyridine) or poly(glutaraldehyde) microspheres was reduced by approximately 40%. This observation was utilized in preparative scale electrophoretic separations of fixed human and turkey erythrocytes, the mobilities of which under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. We suggest that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immunospecific labeling of target populations using microspheres.

  6. Electrophoretic cell separation by means of immunomicrospheres

    NASA Technical Reports Server (NTRS)

    Rembaum, A.; Smolka, A. J. K.

    1980-01-01

    The electrophoretic mobility of fixed human red blood cells immunologically labeled with polymeric (4-vinyl)pyridine or polyglutaraldehyde microspheres was altered to a considerable extent. This observation was utilized in the preparative scale electrophoretic separation of human and turkey fixed red blood cells, whose mobilities under normal physiological conditions do not differ sufficiently to allow their separation by continuous flow electrophoresis. It is suggested that resolution in the electrophoretic separation of cell subpopulations, currently limited by finite and often overlapping mobility distributions, may be significantly enhanced by immuno-specific labeling of target populations using microspheres.

  7. Electrophoretic Focusing

    NASA Technical Reports Server (NTRS)

    Snyder, Robert S.

    2001-01-01

    Electrophoretic focusing is a new method of continuous flow electrophoresis that introduces precision flow control to achieve high resolution separations. The electric field is applied perpendicular to an incoming sample lamina and buffer but also perpendicular to the broad faces of the thin rectangular chamber. A uniform fluid cross-flow then enters and exits the separation chamber through the same broad faces which are porous. A balance is achieved by adjusting either the electric field or the cross-flow so the desired sample fraction with its specific migration velocity encounters an opposing flow of the same velocity. Applying an electric field transverse to the incoming sample lamina and opposing this field with a carefully configured buffer flow, a sample constituent can be selected and focused into a narrow stream for subsequent analysis. Monotonically changing either electric field or buffer cross-flow will yield a scan of all constituents of the sample. Stopping the scan increases the collection time for minor constituents to improve their analysis. Using the high voltage gradients and/or cross-flow to rapidly deflect extraneous sample through the porous screens and into either of the side (purge) chambers, the selected sample is focused in the center plane of the separation chamber and collected without contact or interaction with the separation chamber walls. Results will be presented on the separation of a range of materials including dyes, proteins, and monodisperse polystyrene latexes. Sources of sample dispersion inherent in other electrokinetic techniques will be shown to be negligible for a variety of sample concentrations, buffer properties and operating conditions.

  8. Electrophoretically mediated microanalysis of ethanol.

    PubMed

    Harmon, B J; Patterson, D H; Regnier, F E

    1993-12-31

    Capillary electrophoresis was used to determine ethanol by the methodology of electrophoretically mediated microanalysis (EMMA). In EMMA, spatially distinct analyte and analytical reagent zones of differing electrophoretic mobility are merged under the influence of an electric field, and the resulting product is transported to the detector. The enzymatic oxidation of ethanol to acetaldehyde by alcohol dehydrogenase was utilized, and the concurrent reduction of NAD+ to NADH was monitored at 340 nm as a measure of the quantity of ethanol injected. Quantitation using an internal standard and normalization for peak migration time yielded a R.S.D. of 2.7%, and the linear range extended to that quantity of ethanol which could be reacted prior to passing by the detection window. Comparison of the EMMA technique to the Sigma spectrophotometric procedure revealed that the two methods do not yield significantly different values for the determination of ethanol. The EMMA method offered the advantages of electrophoretic mixing and miniaturization.

  9. Relatedness Analyses of Histoplasma capsulatum Isolates from Mexican Patients with AIDS-Associated Histoplasmosis by Using Histoplasmin Electrophoretic Profiles and Randomly Amplified Polymorphic DNA Patterns

    PubMed Central

    Reyes-Montes, M. R.; Bobadilla-Del Valle, M.; Martínez-Rivera, M. A.; Rodríguez-Arellanes, G.; Maravilla, E.; Sifuentes-Osornio, J.; Taylor, M. L.

    1999-01-01

    The present paper analyzes the histoplasmin electrophoretic profiles and the randomly amplified polymorphic DNA (RAPD) patterns of the fungus Histoplasma capsulatum isolated from Mexican patients with AIDS-associated histoplasmosis. Clinical isolates from Guatemala, Colombia, and Panama, as well as H. capsulatum isolates from different sources in nature, were also processed. All histoplasmin samples shared four antigenic fractions of 200, 49, 10.5, and 8.5 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). According to their percentage of relatedness, based on SDS-PAGE histoplasmin electrophoretic image analysis, H. capsulatum isolates were divided in two groups: group A contained all AIDS-associated isolates studied and two human reference strains from Mexican histoplasmosis patients without AIDS; group B included bat guano, infected bat, and cock excreta isolates from the State of Guerrero, Mexico, plus three human histoplasmosis strains from Guatemala, Panama, and Colombia. Polymorphic DNA patterns evaluated by RAPD-PCR showed three major bands of 4.4, 3.2, and 2.3 kb in most H. capsulatum isolates studied. Four groups were related by DNA polymorphisms: group I was formed by most of the AIDS-associated H. capsulatum isolates studied, one human histoplasmosis strain from Colombia, two human reference strains from Mexican patients without AIDS, and one human histoplasmosis strain from Guatemala. Group II consisted of only a single strain from Panama. Group III included three strains: one from a Mexican patient with AIDS and two isolated from nature in Guerrero (cock excreta and bat guano). The last, group IV, consisted of only one strain isolated from an infected bat, captured in Guerrero. A tight relationship between phenotypic and genotypic characterization was observed, and both analyses could be useful tools for typing H. capsulatum from different sources and geographic origins. PMID:10203495

  10. Charge regulation phenomenon predicted from the modeling of polypeptide electrophoretic mobilities as a relevant mechanism of amyloid-beta peptide oligomerization.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2016-03-01

    Electrophoretic mobilities of amyloid-beta (1-40) and (1-42) peptides and their aggregates are modeled to study the amyloidogenic pathway associated with Alzheimer´s Disease. The near molecule pH generated by the intraparticle charge regulation phenomenon during the oligomerization of amyloid-beta (1-40) and (1-42) peptides is evaluated and discussed as a relevant mechanism supporting the "amyloid cascade hypothesis" proposed in the literature. A theoretical framework associated with the oligomerization of amyloid-beta peptides including simple scaling laws and the consideration of electrokinetic and hydrodynamic global properties of oligomers is presented. The central finding is the explanation of the near molecule pH change toward the pI when the oligomerization number increases. These results allow one to rationalize consecutive physical stages that validate the amyloid cascade hypothesis. Concluding remarks involving mainly the effects of pair and intraparticle charge regulation phenomena on the amyloidogenic pathway with some suggestions for future research are provided.

  11. Combining gas-phase electrophoretic mobility molecular analysis (GEMMA), light scattering, field flow fractionation and cryo electron microscopy in a multidimensional approach to characterize liposomal carrier vesicles.

    PubMed

    Urey, Carlos; Weiss, Victor U; Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland

    2016-11-20

    For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  12. Nano electrospray gas-phase electrophoretic mobility molecular analysis (nES GEMMA) of liposomes: applicability of the technique for nano vesicle batch control.

    PubMed

    Weiss, Victor U; Urey, Carlos; Gondikas, Andreas; Golesne, Monika; Friedbacher, Gernot; von der Kammer, Frank; Hofmann, Thilo; Andersson, Roland; Marko-Varga, György; Marchetti-Deschmann, Martina; Allmaier, Günter

    2016-10-17

    Liposomes are biodegradable nanoparticle vesicles consisting of a lipid bilayer encapsulating an aqueous core. Entrapped cargo material is shielded from the extra-vesicular medium and sustained release of encapsulated material can be achieved. However, application of liposomes as nano-carriers demands their characterization concerning size and size distribution, particle-number concentration, occurrence of vesicle building blocks in solution and determination of the resulting vesicle encapsulation capacity. These questions can be targeted via gas-phase electrophoretic mobility molecular analysis (GEMMA) based on a nano electrospray (nES) charge-reduction source. This instrument separates single-charged nanoparticles in the gas-phase according to size in a high-laminar sheath-flow by means of an orthogonal, tunable electric field. nES GEMMA analysis enables to confirm liposome integrity after passage through the instrument (in combination with atomic force microscopy) as well as to exclude vesicle aggregation. Additionally, nanoparticle diameters at peak apexes and size distribution data are obtained. Differences of hydrodynamic and dry particle diameter values, as well as the effect of number- and mass-based concentration data analysis on obtained liposome diameters are shown. Furthermore, the repeatability of liposome preparation is studied, especially upon incorporation of PEGylated lipids in the bilayer. Finally, the instruments applicability to monitor mechanical stress applied to vesicles is demonstrated.

  13. Nano electrospray gas-phase electrophoretic mobility molecular analysis (nES GEMMA) of liposomes: applicability of the technique for nano vesicle batch control

    PubMed Central

    Weiss, Victor U.; Urey, Carlos; Gondikas, Andreas; Golesne, Monika; Friedbacher, Gernot; von der Kammer, Frank; Hofmann, Thilo; Andersson, Roland; Marko-Varga, György; Marchetti-Deschmann, Martina

    2016-01-01

    Liposomes are biodegradable nanoparticle vesicles consisting of a lipid bilayer encapsulating an aqueous core. Entrapped cargo material is shielded from the extra-vesicular medium and sustained release of encapsulated material can be achieved. However, application of liposomes as nano-carriers demands their characterization concerning size and size distribution, particle-number concentration, occurrence of vesicle building blocks in solution and determination of the resulting vesicle encapsulation capacity. These questions can be targeted via gas-phase electrophoretic mobility molecular analysis (GEMMA) based on a nano electrospray (nES) charge-reduction source. This instrument separates single-charged nanoparticles in the gas-phase according to size in a high-laminar sheath-flow by means of an orthogonal, tunable electric field. nES GEMMA analysis enables to confirm liposome integrity after passage through the instrument (in combination with atomic force microscopy) as well as to exclude vesicle aggregation. Additionally, nanoparticle diameters at peak apexes and size distribution data are obtained. Differences of hydrodynamic and dry particle diameter values, as well as the effect of number- and mass-based concentration data analysis on obtained liposome diameters are shown. Furthermore, the repeatability of liposome preparation is studied, especially upon incorporation of PEGylated lipids in the bilayer. Finally, the instruments applicability to monitor mechanical stress applied to vesicles is demonstrated. PMID:27549027

  14. Rapid preparation of high-purity nuclear proteins from a small number of cultured cells for use in electrophoretic mobility shift assays.

    PubMed

    Luo, Yuqian; Hara, Takeshi; Ishido, Yuko; Yoshihara, Aya; Oda, Kenzaburo; Makino, Masahiko; Ishii, Norihisa; Hiroi, Naoki; Suzuki, Koichi

    2014-12-20

    Highly purified nuclear protein is required when using an electrophoretic mobility shift assay (EMSA) to study transcription factors, e.g. nuclear factor-κB (NF-κB), a major transcription factor that regulates both innate and adaptive immune responses following infection. Although many protocols have been developed for nuclear protein extraction, they are not necessarily optimized for use in EMSA, often require a large number of cells and long processing times, and do not always result in complete separation of the nuclear and cytoplasmic fractions. We have developed a simple, rapid and cost-effective method to prepare highly purified nuclear proteins from a small number of both suspended and adherent cultured cells that yields nuclear proteins comparable to those prepared by a standard large-scale method. The efficiency of the method was demonstrated by using EMSA to show the successful detection, in multilple concurrent samples, of NF-κB activation upon tetradecanoyl phorbol acetate (TPA) stimulation. This method requires only a small number of cells and no specialized equipment. The steps have been simplified, resulting in a short processing time, which allows researchers to process multiple samples simultaneously and quickly. This method is especially optimized for use in EMSA, and may be useful for other applications that include proteomic analysis.

  15. High Sensitivity Method to Estimate Distribution of Hyaluronan Molecular Sizes in Small Biological Samples Using Gas-Phase Electrophoretic Mobility Molecular Analysis

    PubMed Central

    Do, Lan; Dahl, Christen P.; Kerje, Susanne; Hansell, Peter; Mörner, Stellan; Lindqvist, Ulla; Engström-Laurent, Anna; Larsson, Göran; Hellman, Urban

    2015-01-01

    Hyaluronan is a negatively charged polydisperse polysaccharide where both its size and tissue concentration play an important role in many physiological and pathological processes. The various functions of hyaluronan depend on its molecular size. Up to now, it has been difficult to study the role of hyaluronan in diseases with pathological changes in the extracellular matrix where availability is low or tissue samples are small. Difficulty to obtain large enough biopsies from human diseased tissue or tissue from animal models has also restricted the study of hyaluronan. In this paper, we demonstrate that gas-phase electrophoretic molecular mobility analyzer (GEMMA) can be used to estimate the distribution of hyaluronan molecular sizes in biological samples with a limited amount of hyaluronan. The low detection level of the GEMMA method allows for estimation of hyaluronan molecular sizes from different parts of small organs. Hence, the GEMMA method opens opportunity to attain a profile over the distribution of hyaluronan molecular sizes and estimate changes caused by disease or experimental conditions that has not been possible to obtain before. PMID:26448761

  16. A simple method for assessment and minimization of errors in determination of electrophoretic or electroosmotic mobilities and velocities associated with the axial electric field distortion.

    PubMed

    Nowak, Paweł Mateusz; Woźniakiewicz, Michał; Kościelniak, Paweł

    2015-12-01

    It is commonly accepted that the modern CE instruments equipped with efficient cooling system enable accurate determination of electrophoretic or electroosmotic mobilities. It is also often assumed that velocity of migration in a given buffer is constant throughout the capillary length. It is simultaneously neglected that the noncooled parts of capillary produce extensive Joule heating leading to an axial electric field distortion, which contributes to a difference between the effective and nominal electric field potentials and between velocities in the cooled and noncooled parts of capillary. This simplification introduces systematic errors, which so far were however not investigated experimentally. There was also no method proposed for their elimination. We show a simple and fast method allowing for estimation and elimination of these errors that is based on combination of a long-end and short-end injections. We use it to study the effects caused by variation of temperature, electric field, capillary length, and pH. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Combining gas-phase electrophoretic mobility molecular analysis (GEMMA), light scattering, field flow fractionation and cryo electron microscopy in a multidimensional approach to characterize liposomal carrier vesicles

    PubMed Central

    Gondikas, Andreas; von der Kammer, Frank; Hofmann, Thilo; Marchetti-Deschmann, Martina; Allmaier, Günter; Marko-Varga, György; Andersson, Roland

    2017-01-01

    For drug delivery, characterization of liposomes regarding size, particle number concentrations, occurrence of low-sized liposome artefacts and drug encapsulation are of importance to understand their pharmacodynamic properties. In our study, we aimed to demonstrate the applicability of nano Electrospray Gas-Phase Electrophoretic Mobility Molecular Analyser (nES GEMMA) as a suitable technique for analyzing these parameters. We measured number-based particle concentrations, identified differences in size between nominally identical liposomal samples, and detected the presence of low-diameter material which yielded bimodal particle size distributions. Subsequently, we compared these findings to dynamic light scattering (DLS) data and results from light scattering experiments coupled to Asymmetric Flow-Field Flow Fractionation (AF4), the latter improving the detectability of smaller particles in polydisperse samples due to a size separation step prior detection. However, the bimodal size distribution could not be detected due to method inherent limitations. In contrast, cryo transmission electron microscopy corroborated nES GEMMA results. Hence, gas-phase electrophoresis proved to be a versatile tool for liposome characterization as it could analyze both vesicle size and size distribution. Finally, a correlation of nES GEMMA results with cell viability experiments was carried out to demonstrate the importance of liposome batch-to-batch control as low-sized sample components possibly impact cell viability. PMID:27639623

  18. Estimation of electrokinetic and hydrodynamic global properties of relevant amyloid-beta peptides through the modeling of their effective electrophoretic mobilities and analysis of their propensities to aggregation.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2014-09-01

    Neuronal activity loss may be due to toxicity caused by amyloid-beta peptides forming soluble oligomers. Here amyloid-beta peptides (1-42, 1-40, 1-39, 1-38, and 1-37) are characterized through the modeling of their experimental effective electrophoretic mobilities determined by a capillary zone electrophoresis method as reported in the literature. The resulting electrokinetic and hydrodynamic global properties are used to evaluate amyloid-beta peptide propensities to aggregation through pair particles interaction potentials and Brownian aggregation kinetic theories. Two background electrolytes are considered at 25°C, one for pH 9 and ionic strength I = 40 mM (aggregation is inhibited through NH4OH) the other for pH 10 and I = 100 mM (without NH4OH). Physical explanations of peptide oligomerization mechanisms are provided. The effect of hydration, electrostatic, and dispersion forces in the amyloidogenic process of amyloid-beta peptides (1-40 and 1-42) are quantitatively presented. The interplay among effective charge number, hydration, and conformation of chains is described. It is shown that amyloid-beta peptides (1-40 and 1-42) at pH 10, I = 100 mM and 25°C, may form soluble oligomers, mainly of order 2 and 4, after an incubation of 48 h, which at higher times evolve and end up in complex structures (protofibrils and fibrils) found in plaques associated with Alzheimer's disease.

  19. Electrophoretic mobility of cell nuclei (EMN index) as a biomarker of the biological aging process: Considering the association between EMN index and age.

    PubMed

    Czapla, Z; McPhail, S M

    2015-12-01

    The present study examined whether a specific property of cell microstructures may be useful as a biomarker of aging. Specifically, the association between age and changes of cellular structures reflected in electrophoretic mobility of cell nuclei index (EMN index) values across the adult lifespan was examined. This report considers findings from cross sections of females (n=1273) aged 18-98 years, and males (n=506) aged 19-93 years. A Biotest apparatus was used to perform intracellular microelectrophoresis on buccal epithelial cells collected from each individual. EMN index was calculated on the basis of the number of epithelial cells with mobile nuclei in reference to the cells with immobile nuclei per 100cells. Regression analyses indicated a significant negative association between EMN index value and age for men (r=-0.71, p<0.001) and women (r=-0.60, p<0.001); demonstrating a key requirement that must be met by a biomarker of aging. The strength of association observed between EMN index and age for both men and women was encouraging and supports the potential use of EMN index for determining a biological age of an individual (or a group). In this study, a new attempt of complex explanation of cellular mechanisms contributing to age related changes of the EMN index was made. In this study, a new attempt of complex explanation of cellular mechanisms contributing to age related changes of the EMN index was made. EMN index has demonstrated potential to meet criteria proposed for biomarkers of aging and further investigations are necessary.

  20. Properties of poly(styrene/alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol) microspheres suspended in water. Effect of sodium chloride and temperature on particle diameters and electrophoretic mobility.

    PubMed

    Basinska, Teresa; Slomkowski, Stanislaw; Kazmierski, Slawomir; Chehimi, Mohamed M

    2008-08-19

    Hydrodynamic and electrophoretic properties of core-shell poly(styrene/alpha- tert-butoxy-omega-vinylbenzyl-polyglycidol) (P(S/PGL)) microspheres suspended in water are described. The microspheres were obtained by surfactant-free emulsion copolymerization of styrene and alpha- tert-butoxy-omega-vinylbenzyl-polyglycidol macromonomer ( M n = 2800, M w/ M n = 1.05). The process yielded microspheres with number average diameter D n = 270 nm and with low diameter dispersity index D w/ D n = 1.01. Shells of P(S/PGL) microspheres were enriched in polyglycidol. Molar fraction of polyglycidol monomeric units in the shells (determined by X-ray photoelectron spectroscopy) was equal to 0.34, which is much higher than the average molar fraction of polyglycidol monomeric units in whole particles of 0.048. Influences of NaCl concentration and temperature on P(S/PGL) microsphere diameters and on their electrophoretic mobility were investigated. It was found that hydrodynamic diameter of P(S/PGL) microspheres, determined by photon correlation spectroscopy, decreased significantly when temperature did exceed a certain value (transition temperature, T t). It has been found that the decrease is more pronounced for higher concentrations of NaCl in the medium. For microspheres suspended in 10 (-1) M NaCl, the hydrodynamic diameter decreased by 8% whereas for the same particles in pure water the diameter decreased by 5.2%. The process of shrinkage was fully reversible. Values of T t for P(S/PGL) microspheres were lower for higher concentrations of NaCl. Adjustment of salt concentration allowed controlling T t in a range from 44.4 to 49.9 degrees C. 13C NMR relaxation time measurements (T 1) for carbon atoms in polyglycidol macromonomer revealed that T 1 did increase with increasing temperature (in temperature range from 25 to 75 degrees C) indicating higher motion of chains at higher temperature. Addition of NaCl did not induce a substantial change of T 1 in the mentioned temperature

  1. Principle of a new immunoassay based on electrophoretic mobility of poly(styrene/alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol) microspheres: application for the determination of helicobacter pylori IgG in blood serum.

    PubMed

    Basinska, Teresa; Wisniewska, Monika; Chmiela, Magdalena

    2005-01-14

    The principle of a novel latex diagnostic test for the determination of antibodies against Helicobacter pylori in blood sera is described. The test is based on the measurement of the electrophoretic mobility of the microspheres with immobilized H. pylori antigens. The electrophoretic mobility of these microspheres depends on the concentration of the antibodies against H. pylori in suspending medium. Particles with hydrophilic polyglycidol in the surface layer were used for the test. The microspheres were obtained by an emulsifier-free emulsion copolymerization of styrene and alpha-tert-butoxy-omega-vinylbenzyl-polyglycidol macromonomer (D(n) = 220 nm, diameter polydispersity factor D(w)//D(n) = 1.02). Activation of polyglycidol hydroxyl groups with cyanuric chloride allowed for covalent immobilization of H. pylori antigens. The fraction of H. pylori not specifically adsorbed onto the microspheres was negligible. Changes of the electrophoretic mobility of the microspheres with the surface concentration of the covalently immobilized H. pylori antigens Gamma = (1.6 +/- 0.3) . 10(-3) g m(-2) were suitable for the detection of the antibodies in the sera of patients with titer in the range (determined by the indirect ELISA test) from 1:500 to 1:32 000.

  2. Effects of non-equilibrium association-dissociation processes in the dynamic electrophoretic mobility and dielectric response of realistic salt-free concentrated suspensions.

    PubMed

    Carrique, Félix; Ruiz-Reina, Emilio; Lechuga, Luis; Arroyo, Francisco J; Delgado, Ángel V

    2013-12-01

    Electrokinetic investigations in nanoparticle suspensions in aqueous media are most often performed assuming that the liquid medium is a strong electrolyte solution with specified concentration. The role of the ions produced by the process of charging the surfaces of the particles is often neglected or, at most, the concentrations of such ions are estimated in some way and added to the concentrations of the ions in the externally prepared solution. The situation here considered is quite different: no electrolyte is dissolved in the medium, and ideally only the counterions stemming from the particle charging are assumed to be in solution. This is the case of so-called salt-free systems. With the aim of making a model for such kind of dispersions as close to real situations as possible, it was previously found to consider the unavoidable presence of H(+) and OH(-) coming from water dissociation, as well as the (almost unavoidable) ions stemming from the dissolution of atmospheric CO2. In this work, we extend such approach by considering that the chemical reactions involved in dissociation and recombination of the (weak) electrolytes in solution must not necessarily be in equilibrium conditions (equal rates of forward and backward reactions). To that aim, we calculate the frequency spectra of the electric permittivity and dynamic electrophoretic mobility of salt-free suspensions considering realistic non-equilibrium conditions, using literature values for the rate constants of the reactions. Four species are linked by such reactions, namely H(+) (from water, from the--assumed acidic--groups on the particle surfaces, and from CO2 dissolution), OH(-) (from water), HCO3(-) and H2CO3 (again from CO2). A cell model is used for the calculations, which are extended to arbitrary values of the surface charge, the particle size, and particle volume fraction, in a wide range of the field frequency ω. Both approaches predict a high frequency relaxation of the counterion

  3. Nonmonotonic DNA-length-dependent mobility in pluronic gels

    NASA Astrophysics Data System (ADS)

    You, Seungyong; Wei, Ling; Shanbhag, Sachin; Van Winkle, David H.

    2017-04-01

    Two-dimensional electrophoresis was used to analyze the mobility of DNA fragments in micellar gels of pluronic F127 (E O100P O70E O100 ) and pluronic P123 (E O20P O70E O20 ) . The 20-3500 base pair DNA fragments were separated by size first in agarose gels, and then in pluronic gels at room temperature. In agarose gels, the DNA mobility decreases monotonically with increasing DNA length. In pluronic gels, however, the mobility varies nonmonotonically according to fragment lengths that are strongly correlated with the diameter of the spherical micelles. Brownian dynamics (BD) simulations with short-ranged intra-DNA hydrodynamic interactions were performed to numerically calculate the length-dependent mobility in pluronic lattices. The rising and falling trends, as well as the oscillations of mobility, were captured by the coarse-grained BD simulations. Molecular dynamics simulations in pluronic F127, with explicitly modeled micelle coronas, justified that the hydrodynamic interactions mediated by the complex fluid of hydrated poly(ethylene oxide) are a possible reason for the initial rise of mobility with DNA length.

  4. Experimental test of new theoretical models for the electrokinetic properties of biological membranes. The effect of UO/sup 2 + +/ and tetracaine on the electrophoretic mobility of bilayer membranes and human erythrocytes

    SciTech Connect

    Pasquale, L.; Winiski, A.; Oliva, C.; Vaio, G.; McLaughlin, S.

    1986-12-01

    For a large smooth particle with charges at the surface, the electrophoretic mobility is proportional to the zeta potential, which is related to the charge density by the Gouy-Chapman theory of the diffuse double layer. This classical model adequately describes the dependence of the electrophoretic mobility of phospholipid vesicles on charge density and salt concentration, but it is not applicable to most biological cells, for which new theoretical models have been developed. We tested these new models experimentally by measuring the effect of UO/sup 2 + +/ on the electrophoretic mobility of model membranes and human erythrocytes in 0.15 M NaCl at pH 5. We used UO/sup 2 + +/ for these studies because it should adsorb specifically to the bilayer surface of the erythrocyte and should not change the density of fixed charges in the glycocalyx. Our experiments demonstrate that it forms high-affinity complexes with the phosphate groups of several phospholipids in a bilayer but does not bind significantly to sialic acid residues. As observed previously, UO/sup 2 + +/ adsorbs strongly to egg phosphatidylcholine (PC) vesicles: 0.1 mM UO/sup 2 + +/ changes the zeta potential of PC vesicles from 0 to +40 mV. It also has a large effect on the electrophoretic mobility of vesicles formed from mixtures of PC and the negative phospholipid phosphatidylserine (PS): 0.1 mM UO/sup 2 + +/ changes the zeta potential of PC/PS vesicles (10 mol % PS) from -13 to +37 mV. In contrast, UO/sup 2 + +/ has only a small effect on the electrophoretic mobility of either vesicles formed from mixtures of PC and the negative ganglioside GM1 or erythrocytes: 0.1 mM UO/sup 2 + +/ changes the apparent zeta potential of PC/GM1 vesicles (17 mol % GM1) from -11 to +5 mV and the apparent zeta potential of erythrocytes from -12 to -4 mV.

  5. Electrophoretic detection of protein p53 in human leukocytes

    SciTech Connect

    Paponov, V.D.; Kupsik, E.G.; Shcheglova, E.G.; Yarullin, N.N.

    1986-01-01

    The authors have found an acid-soluble protein with mol. wt. of about 53 kD in peripheral blood leukocytes of persons with Down's syndrome. It was present in different quantities in all 20 patients tested, but was virtually not discovered in 12 healthy blood donors. This paper determines the possible identity of this protein with protein p53 from mouse ascites carcinoma by comparing their electrophoretic mobilities, because the accuracy of electrophoretic determination of the molecular weight of proteins is not sufficient to identify them. The paper also describes experiments to detect a protein with electrophoretic mobility identical with that of a protein in the leukocytes of patients with Down's syndrome in leukocytes of patients with leukemia. To discover if protein p53 is involved in cell proliferation, the protein composition of leukocytes from healthy blood donors, cultured in the presence and absence of phytohemagglutinin (PHA), was compared. Increased incorporation of H 3-thymidine by leukocytes of patients with Down's syndrome is explained by the presence of a population of immature leukocytes actively synthesizing DNA in the peripheral blood of these patients, and this can also explain the presence of protein p53 in the leukocytes of these patients.

  6. Mobility of Electron in DNA Crystals by Laser Radiation

    NASA Technical Reports Server (NTRS)

    Zhang, Kaixi; Zhao, Qingxun; Cui, Zhiyun; Zhang, Ping; Dong, Lifang

    1996-01-01

    The mobility of electrons in laser radiated DNA is closed to the energy transfer and energy migration of a biological molecule. Arrhenius has studied the conductivity of the electrons in a biological molecule. But his result is far from the experimental result and meanwhile the relation between some parameters in his theory and the micro-quantities in DNA is not very clear. In this paper, we propose a new phonon model of electron mobility in DNA and use Lippman-Schwinger equation and S-matrix theory to study the mobility of electrons in DNA crystal. The result is relatively close to the experiment result and some parameters in Arrhenius theory are explained in our work.

  7. DNA electrophoresis in agarose gels: effects of field and gel concentration on the exponential dependence of reciprocal mobility on DNA length.

    PubMed

    Rill, Randolph L; Beheshti, Afshin; Van Winkle, David H

    2002-08-01

    Electrophoretic mobilities of DNA molecules ranging in length from 200 to 48 502 base pairs (bp) were measured in agarose gels with concentrations T = 0.5% to 1.3% at electric fields from E = 0.71 to 5.0 V/cm. This broad data set determines a range of conditions over which the new interpolation equation nu(L) = (beta+alpha(1+exp(-L/gamma))(-1) can be used to relate mobility to length with high accuracy. Mobility data were fit with chi(2) > 0.999 for all gel concentrations and fields ranging from 2.5 to 5 V/cm, and for lower fields at low gel concentrations. Analyses using so-called reptation plots (Rousseau, J., Drouin, G., Slater, G. W., Phys. Rev. Lett. 1997, 79, 1945-1948) indicate that this simple exponential relation is obeyed well when there is a smooth transition from the Ogston sieving regime to the reptation regime with increasing DNA length. Deviations from this equation occur when DNA migration is hindered, apparently by entropic-trapping, which is favored at low fields and high gel concentrations in the ranges examined.

  8. Electrophoretic and electro-optical studies on the conformation and susceptibility to psoralen crosslinking of magnetically oriented DNA

    SciTech Connect

    Roots, R.J.; Kraft, G.H.; Farinato, R.S.; Tenforde, T.S.

    1982-08-01

    Gel electrophoresis and electro-optical birefringence measurements were performed on the replicative form of bacteriophage phi X-174 DNA subjected to orientation in a homogeneous stationary magnetic field. The conformation of this superhelical double-stranded form of DNA, and its sensitivity to intercalation and crosslinking by a psoralen derivative, were found to be unaffected by a 1 h exposure to a 2.15 Tesla field. In addition, no alteration was detected in the infectivity of the exposed phi X-174 DNA in E. coli bacterial hosts.

  9. Electrophoretic study of Clostridium species.

    PubMed Central

    Cato, E P; Hash, D E; Holdeman, L V; Moore, W E

    1982-01-01

    Polyacrylamide gel electrophoretic analysis of soluble cellular proteins (without sodium dodecyl sulfate) of 70 Clostridium species indicated that the procedure was readily applicable to the differentiation of species in the genus. The protein patterns correlated well with the available DNA homology data and with most accepted differential tests. Results indicated that several earlier names for species were synonyms of those of accepted species and that two accepted species may be synonymous. Images PMID:6175658

  10. Mobile DNA in the pathogenic Neisseria

    PubMed Central

    Obergfell, Kyle P.; Seifert, H. Steven

    2015-01-01

    The genus Neisseria contains two pathogenic species of notable public health concern: Neisseria gonorrhoeae and Neisseria meningitidis. These pathogens display a notable ability to undergo frequent programmed recombination events. The recombination mediated pathways of transformation and pilin antigenic variation in the Neisseria are well studied systems that are critical for pathogenesis. Here we will detail the conserved and unique aspects of transformation and antigenic variation in the Neisseria. Transformation will be followed from initial DNA binding through recombination into the genome with consideration to the factors necessary at each step. Additional focus is paid to the unique type IV secretion system that mediates donation of transforming DNA in the pathogenic Neisseria. The pilin antigenic variation system uses programed recombinations to alter a major surface determinant which allows immune avoidance and promotes infection. We discuss the trans- and cis- acting factors which facilitate pilin antigenic variation and present the current understanding of the mechanisms involved in the process. PMID:25866700

  11. Mobile units of DNA in phytoplasma genomes.

    PubMed

    Dickinson, Matt

    2010-09-01

    Phytoplasmas are obligate symbionts of plants and insects that are responsible for significant yield losses in diverse crops. Genome sequencing has revealed that many phytoplasma genomes appear to contain repeated genes organized in units of approximately 20 kb. These 'potential mobile units' (PMUs) resemble composite replicative transposons. PMUs contain several genes for recombination and some also contain putative 'virulence genes'. Genome alignments suggest that PMUs are involved in phytoplasma genome instability and recombination. In this edition of Molecular Microbiology, Hogenhout and colleagues report that one PMU from the aster yellows phytoplasma strain Witches' Broom (AY-WB) can exist as both a linear PMU within the chromosome and as an extrachromosomal circular form. The copy number of the circular form is much higher in the insect vector compared with the plant, and expression levels of genes present on the PMU are also higher in the insect. These observations suggest not only that this PMU could be a mobile element, but that it could also be involved in a phase-variation mechanism that allows the phytoplasma to adapt to its different hosts.

  12. Electrophoretic analysis of sequence variability in three mitochondrial DNA regions for ascaridoid parasites of human and animal health significance.

    PubMed

    Li, Ming-Wei; Lin, Rui-Qing; Song, Hui-Qun; Sani, Rehana A; Wu, Xiang-Yun; Zhu, Xing-Quan

    2008-07-01

    Sequence variability in three mitochondrial DNA (mtDNA) regions, namely cytochrome c oxidase subunit 1 (cox1), NADH dehydrogenase subunits 1 and 4 (nad1 and nad4), among and within Toxocara canis, T. cati, T. malaysiensis, T. vitulorum and Toxascaris leonina from different geographical origins was examined by a mutation-scanning approach. A portion of the cox1 gene (pcox1), a portion of the nad1 and nad4 genes (pnad1 and pnad4) were amplified separately from individual ascaridoid nematodes by polymerase chain reaction and the amplicons analyzed by single-strand conformation polymorphism (SSCP). Representative samples displaying sequence variation in SSCP profiles were subjected to sequencing in order to define genetic markers for their specific identification and differentiation. While the intra-specific sequence variations within each of the five ascaridoid species were 0.2-3.7% for pcox1, 0-2.8% for pnad1 and 0-2.3% for pnad4, the inter-specific sequence differences were significantly higher, being 7.9-12.9% for pcox1, 10.7-21.1% for pnad1 and 12.9-21.7% for pnad4, respectively. Phylogenetic analyses based on the combined sequences of pcox1, pnad1 and pnad4 revealed that the recently described species T. malaysiensis was more closely related to T. cati than to T. canis. These findings provided mtDNA evidence for the validity of T. malaysiensis and also demonstrated clearly the usefulness and attributes of the mutation-scanning sequencing approach for studying the population genetic structures of these and other nematodes of socio-economic importance.

  13. Global chain properties of an all l-α-eicosapeptide with a secondary α-helix and its all retro d-inverso-α-eicosapeptide estimated through the modeling of their CZE-determined electrophoretic mobilities.

    PubMed

    Deiber, Julio A; Piaggio, Maria V; Peirotti, Marta B

    2014-03-01

    Several global chain properties of relatively long peptides composed of 20 amino acid residues are estimated through the modeling of their experimental effective electrophoretic mobilities determined by CZE for 2 < pH < 6. In this regard, an all l-α-eicosapeptide, including a secondary α-helix (Peptide 1) and its all retro d-inverso-α-eicosapeptide (Peptide 2), are considered. Despite Peptides 1 and 2 are isomeric chains, they do not present similar global conformations in the whole range of pH studied. These peptides may also differ in the quality of BGE components chain interactions depending on the pH value. Three Peptide 1 fragments (Peptides 3, 4, and 5) are also analyzed in this framework with the following purposes: (i) visualization of the effects of initial and final strands at each side of the α-helix on the global chain conformations of Peptide 1 at different pHs and (ii) analysis of global chain conformations of Peptides 1 and 2, and Peptide 1 fragments in relation to their pI values. Also, the peptide maximum and minimum hydrations predicted by the model, compatible with experimental effective electrophoretic mobilities at different pHs, are quantified and discussed, and needs for further research concerning chain hydration are proposed. It is shown that CZE is a useful analytical tool for peptidomimetic designs and purposes.

  14. Global properties and propensity to dimerization of the amyloid-beta (12-28) peptide fragment through the modeling of its monomer and dimer diffusion coefficients and electrophoretic mobilities.

    PubMed

    Deiber, Julio A; Peirotti, Marta B; Piaggio, Maria V

    2015-03-01

    Neuronal activity loss may be due to toxicity caused mainly by amyloid-beta (1-40) and (1-42) peptides forming soluble oligomers. Here the amyloid-beta (12-28) peptide fragment (monomer) and its dimer are characterized at low pH through the modeling of their diffusion coefficients and effective electrophoretic mobilities. Translational diffusion coefficient experimental values of monomer and dimer analogs of this peptide fragment and monomer and dimer mixtures at thermodynamic equilibrium are used as reported in the literature for different monomer initial concentrations. The resulting electrokinetic and hydrodynamic global properties are employed to evaluate the amyloid-beta (12-28) peptide fragment propensity to dimerization through a thermodynamic theoretical framework. Therefore equilibrium constants are considered at pH 2.9 to elucidate one of the amyloidogenic mechanisms involving the central hydrophobic region LVFFA of the peptide spanning residues 17-21 associated with phenylalanine at positions 19 and 20 in the amino acid sequence of amyloid-beta peptides. An analysis demonstrating that peptide aggregation is a concentration-dependent process is provided, where both pair and intraparticle charge regulation phenomena become relevant. It is shown that the modeling of the effective electrophoretic mobility of the amyloid-beta (12-28) peptide fragment is crucial to understand the effect of hydrophobic region LVFFA in the amyloidogenic process.

  15. Mobility of long-chain DNA in two-dimensional artificial gels

    NASA Astrophysics Data System (ADS)

    Turner, Stephen W. P.; Han, Jongyoon; Craighead, Harold G.

    2000-03-01

    In this study, a two-dimensional array of nanofabricated obstacles is used as an artificial gel to study the electrophoretic mobility dependence of DNA as a function of pore size, molecule length and electric field. Limitations in feature size have prevented previous studies from testing the crossover from the separating to the non-separating regime predicted by the biased reptation model of Lumpkin, Dejardin and Zimm[1] and the modified model of Duke, Semenov and Viovy.[2] That limitation is overcome in this work with the use of electron beam lithography to define features as small as 30 nm. Attainment of these feature sizes was made possible by the use of a sacrificial-layer-based technique for fluidics fabrication.[3] A novel band-launching strategy is used to provide band separation data for the first time in this system. Molecule lengths between 5 and 150 kilobases are studied for electric field strengths from 0.1 to 20 Volts per meter. [1] O. Lumpkin, P. Dejardin and B. Zimm, Biopolymers, Vol. 24, 1573-1593 (1985) [2] T. Duke, A. Semenov and J. Viovy, Phys. Rev. Lett. Vol. 69, No. 22, 3260-3263 (1992) [3] S. Turner, A. Perez, A. Lopez, and H. Craighead, J. Vac. Sci. Technol. B 16(6) 3835-3840 (1998)

  16. Mobile DNA elements in T4 and related phages

    PubMed Central

    2010-01-01

    Mobile genetic elements are common inhabitants of virtually every genome where they can exert profound influences on genome structure and function in addition to promoting their own spread within and between genomes. Phage T4 and related phage have long served as a model system for understanding the molecular mechanisms by which a certain class of mobile DNA, homing endonucleases, promote their spread. Homing endonucleases are site-specific DNA endonucleases that initiate mobility by introducing double-strand breaks at defined positions in genomes lacking the endonuclease gene, stimulating repair and recombination pathways that mobilize the endonuclease coding region. In phage T4, homing endonucleases were first discovered as encoded within the self-splicing td, nrdB and nrdD introns of T4. Genomic data has revealed that homing endonucleases are extremely widespread in T-even-like phage, as evidenced by the astounding fact that ~11% of the T4 genome encodes homing endonuclease genes, with most of them located outside of self-splicing introns. Detailed studies of the mobile td intron and its encoded endonuclease, I-TevI, have laid the foundation for genetic, biochemical and structural aspects that regulate the mobility process, and more recently have provided insights into regulation of homing endonuclease function. Here, we summarize the current state of knowledge regarding T4-encoded homing endonucleases, with particular emphasis on the td/I-TevI model system. We also discuss recent progress in the biology of free-standing endonucleases, and present areas of future research for this fascinating class of mobile genetic elements. PMID:21029434

  17. Group II Introns: Mobile Ribozymes that Invade DNA

    PubMed Central

    Lambowitz, Alan M.; Zimmerly, Steven

    2011-01-01

    SUMMARY Group II introns are mobile ribozymes that self-splice from precursor RNAs to yield excised intron lariat RNAs, which then invade new genomic DNA sites by reverse splicing. The introns encode a reverse transcriptase that stabilizes the catalytically active RNA structure for forward and reverse splicing, and afterwards converts the integrated intron RNA back into DNA. The characteristics of group II introns suggest that they or their close relatives were evolutionary ancestors of spliceosomal introns, the spliceosome, and retrotransposons in eukaryotes. Further, their ribozyme-based DNA integration mechanism enabled the development of group II introns into gene targeting vectors (“targetrons”), which have the unique feature of readily programmable DNA target specificity. PMID:20463000

  18. Mobile linkers on DNA-coated colloids: valency without patches.

    PubMed

    Angioletti-Uberti, Stefano; Varilly, Patrick; Mognetti, Bortolo M; Frenkel, Daan

    2014-09-19

    Colloids coated with single-stranded DNA (ssDNA) can bind selectively to other colloids coated with complementary ssDNA. The fact that DNA-coated colloids (DNACCs) can bind to specific partners opens the prospect of making colloidal "molecules." However, in order to design DNACC-based molecules, we must be able to control the valency of the colloids, i.e., the number of partners to which a given DNACC can bind. One obvious, but not very simple approach is to decorate the colloidal surface with patches of single-stranded DNA that selectively bind those on other colloids. Here we propose a design principle that exploits many-body effects to control the valency of otherwise isotropic colloids. Using a combination of theory and simulation, we show that we can tune the valency of colloids coated with mobile ssDNA, simply by tuning the nonspecific repulsion between the particles. Our simulations show that the resulting effective interactions lead to low-valency colloids self-assembling in peculiar open structures, very different from those observed in DNACCs with immobile DNA linkers.

  19. Variation of electrophoretic karyotypes among clinical isolates of Candida albicans.

    PubMed Central

    Merz, W G; Connelly, C; Hieter, P

    1988-01-01

    Orthogonal-field-alternation gel electrophoresis was used to compare clinical isolates of Candida albicans by resolving chromosome-sized DNA molecules into an electrophoretic karyotype. Seven to nine bands were observed among isolates recovered from 17 patients. In addition, 14 distinct electrophoretic patterns were noted among the isolates from these patients. In a given individual, isolates were likely to have identical electrophoretic patterns. Therefore, the electrophoretic karyotype patterns demonstrated by orthogonal-field-alternation gel electrophoresis can be used to designate a strain for epidemiologic studies. Images PMID:3290238

  20. Mobile DNA and evolution in the 21st century

    PubMed Central

    2010-01-01

    Scientific history has had a profound effect on the theories of evolution. At the beginning of the 21st century, molecular cell biology has revealed a dense structure of information-processing networks that use the genome as an interactive read-write (RW) memory system rather than an organism blueprint. Genome sequencing has documented the importance of mobile DNA activities and major genome restructuring events at key junctures in evolution: exon shuffling, changes in cis-regulatory sites, horizontal transfer, cell fusions and whole genome doublings (WGDs). The natural genetic engineering functions that mediate genome restructuring are activated by multiple stimuli, in particular by events similar to those found in the DNA record: microbial infection and interspecific hybridization leading to the formation of allotetraploids. These molecular genetic discoveries, plus a consideration of how mobile DNA rearrangements increase the efficiency of generating functional genomic novelties, make it possible to formulate a 21st century view of interactive evolutionary processes. This view integrates contemporary knowledge of the molecular basis of genetic change, major genome events in evolution, and stimuli that activate DNA restructuring with classical cytogenetic understanding about the role of hybridization in species diversification. PMID:20226073

  1. Electrophoretic behavior of d(GGAAAAAAGG)n, d(CCAAAAAACC)n, and (CCAAAAAAGG)n and implications for a DNA bending model.

    PubMed Central

    Abagyan, R A; Mironov, V N; Chernov, B K; Chuprina, V P; Ulyanov, A V

    1990-01-01

    Double stranded multimers (C2A6C2)n, (C2A6G2)n and (G2A6G2)n were prepared from chemically synthesized oligonucleotides to study the influence of sequences flanking the An tract on the curvature of DNA. All these duplexes, including polypurine.polypyrimidine one, exhibit strong retardation in polyacrylamide gel which is indicative of pronounced DNA curvature. It has been proposed previously that among the bends at the boundary with the oligo(A) tract two types should be distinguished: 5'-bends and 3'-bends (Koo et al., 1986) This distinction was deduced from different relative mobilities of two specially designed sequences having phased 5'-bends and 3'-bends, respectively. Our data indicate that the substitutions of nucleotides at both 5' and 3' boundaries of A6 tract result in comparable changes in relative mobility. Therefore, for B-B' bends it is important to take into account not only whether they are at the 5' or 3' end of an oligo(dA) tract, but also the particular sequences at the boundaries of this tract. Images PMID:2315048

  2. Electrophoresis of end-labeled DNA: Theory and experiment

    NASA Astrophysics Data System (ADS)

    Lau, Henry W.; Archer, Lynden A.

    2010-03-01

    The dynamic behavior of end-labeled DNA during free-solution electrophoresis is investigated using a simple dumbbell model for the labeled DNA. We study the effect of the applied field, label size, and chain stiffness on DNA conformation and electrophoretic mobility. High applied fields are predicted to magnify the size-dependence of mobility and to yield a nonmonotonic dependence of electrophoretic mobility on applied field. The effectiveness of leveraging label size and DNA chain stiffness for improving resolution is also discussed in the context of DNA deformation. To evaluate the most salient model predictions, we use capillary electrophoresis experiments to characterize the size- and field-dependent mobility of dsDNA fragments (300 bp-2 kbp) end-functionalized with streptavidin. Our experimental results are found to be in generally good accord with expectations based on the dumb-bell model. We discuss implications of these findings for fast, size-based separation of DNA in free solution.

  3. An evaluation of the SPIFE 3000 semi-automated gel electrophoresis system for the identification of hemoglobin variants and comparison of relative electrophoretic mobilities with manual gel electrophoresis methods.

    PubMed

    Hoyer, J D; Markley, K M; Savedra, M E; Kubik, K S; Scheidt, R M

    2010-06-01

    Laboratory identification of hemoglobin (Hb) variants can involve multiple techniques. The use of semi-automated instruments that perform gel electrophoresis and staining, such as the SPIFE 3000 electrophoresis system, can greatly reduce the labor required for these commonly used techniques. We performed a comparison of the method involved in SPIFE 3000 system with those of manual gel electrophoresis. A total of 22 540 samples were analyzed using the SPIFE 3000, and compared with mobilities on cellulose acetate and citrate agar gels using standard manual methods. The results were compared using relative electrophoretic mobilities (REM). Of the 191 Hb variants identified, only 13 had REM that differed from manual electrophoresis when analyzed using the SPIFE 3000 system. One variant (Hb O-Indonesia) showed different mobility on both acid and alkaline gels, two (Hb E, Hb Sunshine Seth) on alkaline gel only, and 10 (Hbs N-Baltimore, N-Seattle, O-Arab, Shelby, Summer Hill, Tak, Hasharon, M-Iwate, Q-Iran, and Setif) on acid gels only. The SPIFE 3000 semi-automated electrophoresis system produces similar results when compared with those of standard manual electrophoresis methods.

  4. Arylsulfatase A: Relationship of genotype to variant electrophoretic properties

    SciTech Connect

    Park, D.S.; Poretz, R.D.; Ricketts, M.H.; Manowitz, P.

    1996-04-01

    Previous work has shown that specific electrophoretic variants of arylsulfatase A occur more frequently among alcoholic patients than among psychiatric and normal controls. The present study sequenced the gene for two of these electrophoretic variants, IIIa and IIIb. Both contain an A-to-G transition corresponding to substitution of Asn{sub 350} by Ser, with the resulting loss of an N -glycosylation site. The difference in electrophoretic mobility of their gene products is due to a mutation in the IIIb gene resulting in the replacement of Arg{sub 496} by His. Evidence is presented that individuals posessing either of two other electrophoretic variants, Va and Vb, are heterozygous for a normal ASA allele and either a IIIa or IIIb allele, respectively. Thus, the relationship between the phenotype of the electrophoretic banding patterns, IIIa, IIIb, Va, and Vb, and their corresponding genotypes has been elucidated. 18 refs., 5 figs., 1 tab.

  5. Mobile DNA elements in the generation of diversity and complexity in the brain.

    PubMed

    Erwin, Jennifer A; Marchetto, Maria C; Gage, Fred H

    2014-08-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia.

  6. Mobile DNA elements in the generation of diversity and complexity in the brain

    PubMed Central

    Erwin, Jennifer A.; Marchetto, Maria C.; Gage, Fred H.

    2015-01-01

    Mobile elements are DNA sequences that can change their position (retrotranspose) within the genome. Although its biological function is largely unappreciated, DNA derived from mobile elements comprises nearly half of the human genome. It has long been thought that neuronal genomes are invariable; however, recent studies have demonstrated that mobile elements actively retrotranspose during neurogenesis, thereby creating genomic diversity between neurons. In addition, mounting data demonstrate that mobile elements are misregulated in certain neurological disorders, including Rett syndrome and schizophrenia. PMID:25005482

  7. Mobile DNA Elements: The Seeds of Organic Complexity on Earth.

    PubMed

    Habibi, Laleh; Pedram, Mehrdad; AmirPhirozy, Akbar; Bonyadi, Khadijeh

    2015-10-01

    Mobile DNA or transposable elements (TEs) are genomic sequences capable of moving themselves independently into different parts of the genome. Viral invasion of eukaryotic genomes is assumed to be the main source of TEs. Selfish transposition of these elements could be a serious threat to the host cell, as they can insert themselves into the middle of coding genes and/or induce genomic instability. In response, through millions of years of evolution, cells have come up with various mechanisms such as genomic imprinting, DNA methylation, heterochromatin formation, and RNA interference to deactivate them. Interestingly, these processes have also greatly contributed to important cellular functions involved in cell differentiation, development, and differential gene expression. Propagation of TE copies during the course of evolution have resulted in increasing the genome size and providing proper space and flexibility in shaping the genome by creating new genes and establishing essential cellular structures such as heterochromatin, centromere, and telomeres. Yet, these elements are mostly labeled for playing a role in pathogenesis of human diseases. Here, we attempt to introduce TEs as factors necessary for making us human rather than just selfish sequences or obligatory guests invading our DNA.

  8. Multistage Electrophoretic Separators

    NASA Technical Reports Server (NTRS)

    Thomas, Nathan; Doyle, John F.; Kurk, Andy; Vellinger, John C.; Todd, Paul

    2006-01-01

    A multistage electrophoresis apparatus has been invented for use in the separation of cells, protein molecules, and other particles and solutes in concentrated aqueous solutions and suspensions. The design exploits free electrophoresis but overcomes the deficiencies of prior free-electrophoretic separators by incorporating a combination of published advances in mathematical modeling of convection, sedimentation, electro-osmotic flow, and the sedimentation and aggregation of droplets. In comparison with other electrophoretic separators, these apparatuses are easier to use and are better suited to separation in relatively large quantities characterized in the art as preparative (in contradistinction to smaller quantities characterized in the art as analytical). In a multistage electrophoretic separator according to the invention, an applied vertical steady electric field draws the electrically charged particles of interest from within a cuvette to within a collection cavity that has been moved into position of the cuvette. There are multiple collection cavities arranged in a circle; each is aligned with the cuvette for a prescribed short time. The multistage, short-migration-path character of the invention solves, possibly for the first time, the fluid-instability problems associated with free electrophoresis. The figure shows a prototype multistage electrophoretic separator that includes four sample stations and five collection stages per sample. At each sample station, an aqueous solution or suspension containing charged species to be separated is loaded into a cuvette, which is machined into a top plate. The apparatus includes a lower plate, into which 20 collection cavities have been milled. Each cavity is filled with an electrophoresis buffer solution. For the collection of an electrophoretic fraction, the lower plate is rotated to move a designated collection cavity into alignment with the opening of the cuvette. An electric field is then applied between a non

  9. A plasmid containing the human metallothionein II gene can function as an antibody-assisted electrophoretic biosensor for heavy metals.

    PubMed

    Wooten, Dennis C; Starr, Clarise R; Lyon, Wanda J

    2016-01-01

    Different forms of heavy metals affect biochemical systems in characteristic ways that cannot be detected with typical metal analysis methods like atomic absorption spectrometry. Further, using living systems to analyze interaction of heavy metals with biochemical systems can be laborious and unreliable. To generate a reliable easy-to-use biologically-based biosensor system, the entire human metallothionein-II (MT-II) gene was incorporated into a plasmid (pUC57-MT) easily replicated in Escherichia coli. In this system, a commercial polyclonal antibody raised against human metal-responsive transcription factor-1 protein (MTF-1 protein) could modify the electrophoretic migration patterns (i.e. cause specific decreases in agarose gel electrophoretic mobility) of the plasmid in the presence or absence of heavy metals other than zinc (Zn). In the study here, heavy metals, MTF-1 protein, and polyclonal anti-MTF-1 antibody were used to assess pUC57-MT plasmid antibody-assisted electrophoretic mobility. Anti-MTF-1 antibody bound both MTF-1 protein and pUC57-MT plasmid in a non-competitive fashion such that it could be used to differentiate specific heavy metal binding. The results showed that antibody-inhibited plasmid migration was heavy metal level-dependent. Zinc caused a unique mobility shift pattern opposite to that of other metals tested, i.e. Zn blocked the antibody ability to inhibit plasmid migration, despite a greatly increased affinity for DNA by the antibody when Zn was present. The Zn effect was reversed/modified by adding MTF-1 protein. Additionally, antibody inhibition of plasmid mobility was resistant to heat pre-treatment and trypsinization, indicating absence of residual DNA extraction-resistant bacterial DNA binding proteins. DNA binding by anti-DNA antibodies may be commonly enhanced by xenobiotic heavy metals and elevated levels of Zn, thus making them potentially effective tools for assessment of heavy metal bioavailability in aqueous solutions and

  10. DNA electrophoresis in agarose gels: A new mobility vs. DNA length dependence

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin

    2002-04-01

    Separations were performed on double stranded DNA (dsDNA) using electrophoresis. Electrophoresis is the steady transport of particles under the influence of an external electric field. Double stranded DNA fragments ranging in length from 200 base pairs (bp) to 194,000 bp (0.34 nm = 1 bp) were electrophoresed at agarose gel concentrations T = 0.4%--1.5%. The electric field was varied from 0.62 V/cm to 6.21 V/cm. A wide range of electric fields and gel concentrations were used to study the usefulness of a new interpolation equation, 1mL =1mL-( 1mL-1 ms)e-L/g , where mL,ms , and g are independent free fitting parameters. The long length mobility limit is interpreted as mL , the short length mobility limit is ms , and g is the crossover between the long length limit and the short length limit. This exponential relation fit very well (chi2 ≥ 0.999) when there are two smooth transitions observed in the "reptation plots" (plotting 3mL/m∘ vs. L) (J. Rousseau, G. Drouin, and G. W. Slater, Phys Rev Lett. 1997, 79, 1945--1948). Fits deviate from the data when three different slopes were observed in the reptation plots. Reptation plots were used to determine a phase diagram for dsDNA migration regimes. The phase diagrams define different regions where mechanisms for molecular transport affect the migration of dsDNA in agarose gels during electrophoresis. The parameters from the equation have also been interpreted to provide a physical description of the structure of the agarose gel by calculating the pore sizes. The relations between the values for the pore sizes and the phase diagrams are interpreted to better understand the migration of the DNA through agarose gels.

  11. Electrophoretic heterogeneity limits the utility of streptavidin-β-galactosidase as a probe in free zone capillary electrophoresis separations.

    PubMed

    Craig, Douglas B; Henderson, Anna

    2013-02-01

    Single molecule assays were performed on streptavidin-β-galactosidase using a capillary electrophoresis-based protocol in order to assess the suitability of single molecule β-galactosidase assays for adaptation to the detection of single copies of target DNA. The conjugate was found to have a heterogeneous catalytic rate, showing an average rate of 44,000 ± 24,000 min(-1), which is similar to that of the unmodified enzyme. Electrophoretic mobility was also measured on individual molecules and determined to be -1.32 × 10(-4) ± 0.19 × 10(-4) cm(2)V(-1)s(-1). The variance in mobility was several times that reported for the unmodified enzyme. The electrophoretic heterogeneity was found to result in the formation of a broad window of peaks in the resultant electropherograms of free zone separations of small plugs of streptavidin-β-galactosidase. This range of mobilities largely overlapped with that of the conjugate bound to primer and plasmid containing a target DNA sequence. This overlap suggests that the separation of free conjugate from that bound to target DNA, which is a requirement for application of the single enzyme molecule assay to the detection of target DNA sequences, is not plausible using free zone capillary electrophoresis.

  12. Optimization of the southern electrophoretic transfer method

    SciTech Connect

    Allison, M.A.; Fujimura, R.K.

    1987-01-01

    The technique of separating DNA fragments using agarose gel electrophoresis is essential in the analysis of nucleic acids. Further, after the method of transferring specific DNA fragments from those agarose gels to cellulose nitrate membranes was developed in 1975, a method was developed to transfer DNA, RNA, protein and ribonucleoprotein particles from various gels onto diazobenzyloxymethyl (DBM) paper using electrophoresis as well. This paper describes the optimum conditions for quantitative electrophoretic transfer of DNA onto nylon membranes. This method exemplifies the ability to hybridize the membrane more than once with specific RNA probes by providing sufficient retention of the DNA. Furthermore, the intrinsic properties of the nylon membrane allow for an increase in the efficiency and resolution of transfer while using somewhat harsh alkaline conditions. The use of alkaline conditions is of critical importance since we can now denature the DNA during transfer and thus only a short pre-treatment in acid is required for depurination. 9 refs., 7 figs.

  13. Disappearance of the negative charge in giant DNA with a folding transition.

    PubMed Central

    Yamasaki, Y; Teramoto, Y; Yoshikawa, K

    2001-01-01

    In the present study we measure the electrophoretic mobility of giant T4 DNA (166 kbp) by electrophoretic light scattering for the elongated and folded compact states at different spermidine (trivalent cation) concentrations in 50 mM sodium maleate buffer (pH 6.0). It is found that the electrophoretic mobility of elongated DNA in the absence of the multivalent cation is seven times greater than that of fully folded compact DNA, where, with the increase of the concentration of spermidine, an abrupt transition is generated after a gradual decrease of the mobility. An analysis of the electrophoretic mobility suggests that the folded compact DNA chains almost completely lose their negative charges, by taking into account the difference of friction mechanism between an elongated and folded compact state. From the single chain observation by use of fluorescence microscopy, it is found that a phase-segregated structure is generated at intermediate concentrations of spermidine. The gradual decrease of the electrophoretic mobility in the transition region is, thus, attributed to the formation of the segregated state, exhibiting partial electroneutralization in the folded part. Disappearance of the negative charges in the completely folded compact DNAs is discussed in relation to the mechanism of transition, in terms of a first-order phase transition. PMID:11371456

  14. Electrophoretic Transport of Biomolecules through Carbon Nanotube Membranes

    PubMed Central

    Sun, Xinghua; Su, Xin; Wu, Ji; Hinds, Bruce J.

    2013-01-01

    Electrophoretic transport of proteins across electrochemically oxidized multi-walled carbon nanotube (MWCNT) membranes has been investigated. Small charged protein, lysozyme, was successfully pumped across MWCNT membranes by electric field while rejecting larger bovine serum albumin (BSA). Transport of the lysozome was reduced by a factor of about 30 in comparison to bulk mobility and consistent with prediction for hindered transport. Mobilities between 0.33-1.4×10-9 m2/V-s were observed and are approximately 10 fold faster than comparable ordered nanoporous membranes and are consistent with continuum models. For mixtures of BSA and lysozyme, complete rejection of BSA is seen with electrophoretic separations PMID:21338104

  15. Determination of the dissociation constants (pKa) of secondary and tertiary amines in organic media by capillary electrophoresis and their role in the electrophoretic mobility order inversion.

    PubMed

    Cantu, Marcelo Delmar; Hillebranda, Sandro; Carrilho, Emanuel

    2005-03-11

    Non-aqueous capillary electrophoresis (NACE) may provide a selectivity enhancement in separations since the analyte dissociation constants (pKa) in organic media are different from those in aqueous solutions. In this work, we have studied the inversion in mobility order observed in the separation of tertiary (imipramine (IMI) and amitryptiline (AMI)) and secondary amines (desipramine (DES) and nortryptiline (NOR)) in water, methanol, and acetonitrile. We have determined the pKa values in those solvents and the variation of dissociation constants with the temperature. From these data, and applying the Van't Hoff equation, we have calculated the thermodynamic parameters deltaH and deltaS. The pKa values found in methanol for DES, NOR, IMI, and AMI were 10.80, 10.79, 10.38, and 10.33, respectively. On the other hand, in acetonitrile an opposite relation was found since the values were 20.60, 20.67, 20.74, and 20.81 for DES, NOR, IMI, and AMI. This is the reason why a migration order inversion is observed in NACE for these solvents. The thermodynamic parameters were evaluated and presented a tendency that can be correlated with that observed for pKa values.

  16. Electrophoretic Light Scattering: Instrumentation and Application to the Measurement of the Electric Charge of Human Blood Cells.

    DTIC Science & Technology

    1982-03-15

    blood cells Human Blood cells- . . .. . Platelets Electric charge Electrophoretic mobility 20. ABSTRACT (Continue on reverse side If necessary and...the electrophoretic mobility of human blood cells and platelets . The technique is called Electrophoretic Light Scattering (ELS), and the measurement...predictive value in ascertaining the quality of preserved red blood cells and platelets . It was found that neither liquid storage (up to 30 days) nor

  17. Pulsed-Field Electrophoresis: Application of a Computer Model to the Separation of Large DNA Molecules

    NASA Astrophysics Data System (ADS)

    Lalande, Marc; Noolandi, Jaan; Turmel, Chantal; Rousseau, Jean; Slater, Gary W.

    1987-11-01

    The biased reptation theory has been applied to the pulsed-field electrophoresis of DNA in agarose gels. A computer simulation of the theoretical model that calculates the mobility of large DNA molecules as a function of agarose pore size, DNA chain properties, and electric field conditions has been used to generate mobility curves for DNA molecules in the size range of the larger yeast chromosomes. Pulsed-field electrophoresis experiments resulting in the establishment of an electrophoretic karyotype for yeast, where the mobility of the DNA fragments is a monotonic function of molecular size for the entire size range that is resolved (200-2200 kilobase pairs), has been compared to the theoretical mobility curves generated by the computer model. The various physical mechanisms and experimental conditions responsible for band inversion and improved electrophoretic separation are identified and discussed in the framework of the model.

  18. Analysis of the interfacial properties of fibrillated and nonfibrillated oral streptococcal strains from electrophoretic mobility and titration measurements: evidence for the shortcomings of the 'classical soft-particle approach'.

    PubMed

    Duval, Jérôme F L; Busscher, Henk J; van de Belt-Gritter, Betsy; van der Mei, Henny C; Norde, Willem

    2005-11-22

    Chemical and structural intricacies of bacterial cells complicate the quantitative evaluation of the physicochemical properties pertaining to the cell surface. The presence of various types of cell surface appendages has a large impact on those properties and therefore on various interfacial phenomena, such as aggregation and adhesion. In this paper, an advanced analysis of the electrophoretic mobilities of fibrillated and nonfibrillated strains (Streptococcus salivarius HB and Streptococcus salivarius HB-C12, respectively) is performed over a wide range of pH and ionic strength conditions on the basis of a recent electrokinetic theory for soft particles. The latter extends the approximate formalism originally developed by Ohshima by solving rigorously the fundamental electrokinetic equations without restrictions on the bacterial size, charge, and double layer thickness. It further allows (i) a straightforward implementation of the dissociation characteristics, as evaluated from titration experiments, of the ionogenic charged groups distributed throughout the bacterial cell wall and/or the surrounding exopolymer layer and (ii) the inclusion of possible specific interactions between the charged groups and ions from the background electrolyte other than charge-determining ions. The theory also enables an estimation of possible swelling/shrinking processes operating on the outer polymeric layer of the bacterium. Application of the electrokinetic model to HB and HB-C12 clearly shows a significant discrepancy between the amount of surface charges probed by electrophoresis and by protolytic titration. This is ascribed to the specific adsorption of cations onto pristine charged sites in the cell wall. Physicochemical parameters pertaining to the hydrodynamics (softness degree) and electrostatics of the bacterial cell wall (HB-C12) and soft polymeric layer (HB) are quantitatively derived.

  19. The toxic effects of mobile phone radiofrequency (940 MHz) on the structure of calf thymus DNA.

    PubMed

    Hekmat, Azadeh; Saboury, Ali Akbar; Moosavi-Movahedi, Ali Akbar

    2013-02-01

    Currently, the biological effects of nonionizing electromagnetic fields (EMFs) including radiofrequency (RF) radiation have been the subject of numerous experimental and theoretical studies. The aim of this study is to evaluate the possible biological effects of mobile phone RF (940 MHz, 15 V/m and SAR=40 mW/kg) on the structure of calf thymus DNA (ct DNA) immediately after exposure and 2 h after 45 min exposure via diverse range of spectroscopic instruments. The UV-vis and circular dichroism (CD) experiments depict that mobile phone EMFs can remarkably cause disturbance on ct DNA structure. In addition, the DNA samples, immediately after exposure and 2 h after 45 min exposure, are relatively thermally unstable compared to the DNA solution, which was placed in a small shielded box (unexposed ct DNA). Furthermore, the exposed DNA samples (the DNA samples that were exposed to 940 MHz EMF) have more fluorescence emission when compared with the unexposed DNA, which may have occurred attributable to expansion of the exposed DNA structure. The results of dynamic light scattering (DLS) and zeta potential experiments demonstrate that RF-EMFs lead to increment in the surface charge and size of DNA. The structure of DNA immediately after exposure is not significantly different from the DNA sample 2 h after 45 min exposure. In other words, the EMF-induced conformational changes are irreversible. Collectively, our results reveal that 940 MHz can alter the structure of DNA. The displacement of electrons in DNA by EMFs may lead to conformational changes of DNA and DNA disaggregation. Results from this study could have an important implication on the health effects of RF-EMFs exposure. In addition, this finding could proffer a novel strategy for the development of next generation of mobile phone. Copyright © 2012 Elsevier Inc. All rights reserved.

  20. Effects of Crowder Structure and Salt on DNA Mobility and Conformation in Crowded Environments

    NASA Astrophysics Data System (ADS)

    Gorczyca, Stephanie M.; Robertson-Anderson, Rae M.

    Biological cells are crowded environments in which DNA must move through to perform specific functions. We study how the properties of crowded cell-like environments impact DNA dynamics by tracking individual 115 kbp ring and linear DNA in different crowded environments using single-molecule fluorescence microscopy. We determine the role of crowder structure and salt on DNA diffusion and conformation by measuring the mean-squared center-of-mass displacements, as well as the conformational shape, size, and fluctuations of each molecule. Previously, we used 10 and 500 kDa dextran as crowders and showed that mobility of both ring and linear DNA decreased exponentially with increased crowding, but rings compact while linear DNA elongate. These effects were dependent solely on the reduction in available volume for DNA rather than size or number of crowders. Here we use crowders of similar molecular weight, but different structure to dextran (10 kDa PEG and 400 kDa Ficoll). We find that DNA mobility reduction is independent of crowder structure and that ring and linear DNA undergo more significant compaction. Finally, we characterize the role of salt on DNA mobility and conformation to determine the relative roles of enthalpic versus entropic effects on crowding-induced DNA dynamics. This research was funded by the AFOSR Young Investigator Program, Grant No. FA95550-12-1-0315 and the Arnold and Mabel Beckman Scholarship Foundation.

  1. High-performance capillary electrophoretic method for the quantification of 5-methyl 2'-deoxycytidine in genomic DNA: application to plant, animal and human cancer tissues.

    PubMed

    Fraga, Mario F; Uriol, Esther; Borja Diego, L; Berdasco, María; Esteller, Manel; Cañal, María Jesús; Rodríguez, Roberto

    2002-06-01

    A new approach to the evaluation of the relative degree of genomic DNA methylation through the quantification of 2'-deoxynucleosides is proposed. Detection and quantification of 5-methyl 2'-deoxycytidine in genomic DNA has been performed using micellar high-performance capillary electrophoresis (HPCE) with UV-Vis detection. This approach has been demonstrated to be more sensitive and specific than other HPCE methods for the quantification of DNA methylation degree and also to be faster than other HPLC-based methods. The detection and quantification of nucleosides through enzymatic hydrolyses notably increases the specificity of the technique and allows its exploitation in the analysis of poorly purified and/or concentrated DNA samples such as those obtained from meristematic plant regions and paraffin-embedded tissues.

  2. Evolutionary Mobility of the Ribosomal DNA Array in Yeasts

    PubMed Central

    Proux-Wéra, Estelle; Byrne, Kevin P.; Wolfe, Kenneth H.

    2013-01-01

    The ribosomal DNA (rDNA) of eukaryotes is organized as large tandem arrays. Here, we compare the genomic locations of rDNA among yeast species and show that, despite its huge size (>1 Mb), the rDNA array has moved around the genome several times within the family Saccharomycetaceae. We identify an ancestral, nontelomeric, rDNA site that is conserved across many species including Saccharomyces cerevisiae. Within the genus Lachancea, however, the rDNA apparently transposed from the ancestral site to a new site internal to a different chromosome, becoming inserted into a short intergenic region beside a tRNA gene. In at least four other yeast lineages, the rDNA moved from the ancestral site to telomeric locations. Remarkably, both the ancestral rDNA site and the new site in Lachancea are adjacent to protein-coding genes whose products maintain the specialized chromatin structure of rDNA (HMO1 and CDC14, respectively). In almost every case where the rDNA was lost from the ancestral site, the entire array disappeared without any other rearrangements in the region, leaving just an intergenic spacer of less than 2 kb. The mechanism by which this large and complex locus moves around the genome is unknown, but we speculate that it may involve the formation of double-strand DNA breaks by Fob1 protein or the formation of extrachromosomal rDNA circles. PMID:23419706

  3. Electrophoretic deposition of biomaterials

    PubMed Central

    Boccaccini, A. R.; Keim, S.; Ma, R.; Li, Y.; Zhitomirsky, I.

    2010-01-01

    Electrophoretic deposition (EPD) is attracting increasing attention as an effective technique for the processing of biomaterials, specifically bioactive coatings and biomedical nanostructures. The well-known advantages of EPD for the production of a wide range of microstructures and nanostructures as well as unique and complex material combinations are being exploited, starting from well-dispersed suspensions of biomaterials in particulate form (microsized and nanoscale particles, nanotubes, nanoplatelets). EPD of biological entities such as enzymes, bacteria and cells is also being investigated. The review presents a comprehensive summary and discussion of relevant recent work on EPD describing the specific application of the technique in the processing of several biomaterials, focusing on (i) conventional bioactive (inorganic) coatings, e.g. hydroxyapatite or bioactive glass coatings on orthopaedic implants, and (ii) biomedical nanostructures, including biopolymer–ceramic nanocomposites, carbon nanotube coatings, tissue engineering scaffolds, deposition of proteins and other biological entities for sensors and advanced functional coatings. It is the intention to inform the reader on how EPD has become an important tool in advanced biomaterials processing, as a convenient alternative to conventional methods, and to present the potential of the technique to manipulate and control the deposition of a range of nanomaterials of interest in the biomedical and biotechnology fields. PMID:20504802

  4. CRISPR-Cas immunity and mobile DNA: a new superfamily of DNA transposons encoding a Cas1 endonuclease.

    PubMed

    Hickman, Alison B; Dyda, Fred

    2014-01-01

    Mobile genetic elements such as DNA transposons are a feature of most genomes. The existence of novel DNA transposons can be inferred when whole genome sequencing reveals the presence of hallmarks of mobile elements such as terminal inverted repeats (TIRs) flanked by target site duplications (TSDs). A recent report describes a new superfamily of DNA transposons in the genomes of a few bacteria and archaea that possess TIRs and TSDs, and encode several conserved genes including a cas1 endonuclease gene, previously associated only with CRISPR-Cas adaptive immune systems. The data strongly suggests that these elements, designated 'casposons', are likely to be bona fide DNA transposons and that their Cas1 nucleases act as transposases and are possibly still active.

  5. INFLUENCE OF BORATE BUFFERS ON THE ELECTROPHORETIC BEHAVIOR OF HUMIC SUBSTANCES IN CAPILLARY ZONE ELECTROPHORESIS

    EPA Science Inventory

    The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...

  6. INFLUENCE OF BORATE BUFFERS ON THE ELECTROPHORETIC BEHAVIOR OF HUMIC SUBSTANCES IN CAPILLARY ZONE ELECTROPHORESIS

    EPA Science Inventory

    The influence of tetrahydroxyborate ions on the electrophoretic mobility of humic acids was evaluated by capillary electrophoresis (CE). Depending on the molarity of borate ions in the separation buffer, the humic acids exhibit electropherograms with sharp peaks consistently exte...

  7. Draft Genome Sequences of Eight Nontypeable Haemophilus influenzae Strains Previously Characterized Using an Electrophoretic Typing Scheme.

    PubMed

    Mussa, Huda J; VanWagoner, Timothy M; Morton, Daniel J; Seale, Thomas W; Whitby, Paul W; Stull, Terrence L

    2015-11-25

    Nontypeable Haemophilus influenzae is an important cause of human disease. Strains were selected for genome sequencing to represent the breadth of nontypeable strains within the species, as previously defined by the electrophoretic mobility of 16 metabolic enzymes.

  8. Draft Genome Sequences of Eight Nontypeable Haemophilus influenzae Strains Previously Characterized Using an Electrophoretic Typing Scheme

    PubMed Central

    Mussa, Huda J.; VanWagoner, Timothy M.; Seale, Thomas W.; Whitby, Paul W.; Stull, Terrence L.

    2015-01-01

    Nontypeable Haemophilus influenzae is an important cause of human disease. Strains were selected for genome sequencing to represent the breadth of nontypeable strains within the species, as previously defined by the electrophoretic mobility of 16 metabolic enzymes. PMID:26607889

  9. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Astrophysics Data System (ADS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Todd, P.; Wilfinger, W.; Grindeland, R.; Lewis, M. L.

    A Continuous Flow Electrophoresis System (CFES) was used on Space Shuttle flight STS-8 to separate specific secretory cells from suspensions of cultured primary human embryonic kidney cells and rat pituitary cells. The objectives were to isolate the subfractions of kidney cells that produce the largest amounts of urokinase (plasminogen activator), and to isolate the subfractions of rat pituitary cells that secrete growth hormone, prolactin, and other hormones. Kidney cells were separated into more than 32 fractions in each of two electrophoretic runs. Electrophoretic mobility distributions in flight experiments were spread more than the ground controls. Multiple assay methods confirmed that all cultured kidney cell fractions produced some urokinase, and five to six fractions produced significantly more urokinase than the other fractions. Several fractions also produced tissue plasminogen activator. The pituitary cells were separated into 48 fractions in each of the two electrophoretic runs, and the amounts of growth hormone (GH) and prolactin (PRL) released into the medium for each cell fraction were determined. Cell fractions were grouped into eight mobility classes and immunocytochemically assayed for the presence of GH, PRL, ACTH, LH, TSH, and FSH. The patterns of hormone distribution indicate that the specialized cells producing GH and PRL are isolatable due to the differences in electrophoretic mobilities.

  10. Electrophoretically unique amylases in rat livers: phylogenic and ontogenic study on the mammalian liver.

    PubMed

    Koyama, Iwao; Komine, Shin-Ichi; Hokari, Shigeru; Matsunaga, Toshiyuki; Nakamura, Koh-Ich; Komoda, Tsugikazu

    2002-09-01

    Liver amylase activity in rodents was assayed with Blue Starch as substrate, and found to be higher than in humans or pigs. Based on the result of concanavalin A affinity chromatography, we found that the sugar moieties of amylase molecules increased in parallel with amylase activity in the tested mammals. However, the amounts of amylase proteins determined by Western bloting with anti-human salivary-type antibody as the probe, were similar to the levels in mammalian livers. Moreover, a similar expression of amylase mRNA was also detected in the mammalian livers by a reverse transcriptional-polymerase chain reaction using primers specific for the human salivary and/or pancreatic amylase complementary DNA (cDNA) sequences. The amylase was detected at the catalytic activity, protein molecule and mRNA levels in rat liver at all ages from fetus to adult. Salivary-type liver amylase activity increased up to one week after birth, and was maintained at the adult level thereafter. However, based on the results of the electrophoretic mobility test, livers with accelerated amylase activity, e.g., at 2-4 weeks after birth or during liver regeneration after partial hepatectomy, were also found to express an amylase electrophoretical identical to pancreatic-type amylase in addition to salivary-type activity. These results suggest that the liver may express an etopic amylase in a certain condition.

  11. Electrophoretic approach to the biochemical systematics of gammarids

    NASA Astrophysics Data System (ADS)

    Bulnheim, H.-P.; Scholl, A.

    1981-12-01

    By utilizing the techniques for electrophoretic separation of proteins by vertical starch gels, the biochemical systematics of 10 Gammaridae species obtained from marine, brackish and freshwater habitats was studied. They included Chaetogammarus marinus, Gammarus zaddachi, G. salinus, G. oceanicus, G. tigrinus, G. chevreuxi, G. locusta, G. duebeni duebeni, G. d. celticus, G. pulex pulex, and G. fossarum. For comparison of electrophoretic mobilities selected enzymes (phosphoglucose isomerase, glutamate oxalacetate transaminase, arginine phosphokinase, hexokinase, leucine amino peptidase, mannose 6-phosphate isomerase) were assayed. They were used as diagnostic characters in terms of electrophoretic identities or diversities of most frequent alleles at polymorphic gene loci. These criteria could be applied to estimate intrageneric enzymic variation and degrees of genetic relatedness between the crustacean amphipod species under consideration, thereby complementing traditional morphological classification.

  12. Mobile phone radiofrequency exposure has no effect on DNA double strand breaks (DSB) in human lymphocytes.

    PubMed

    Danese, Elisa; Lippi, Giuseppe; Buonocore, Ruggero; Benati, Marco; Bovo, Chiara; Bonaguri, Chiara; Salvagno, Gian Luca; Brocco, Giorgio; Roggenbuck, Dirk; Montagnana, Martina

    2017-07-01

    The use of mobile phones has been associated with an increased risk of developing certain type of cancer, especially in long term users. Therefore, this study was aimed to investigate the potential genotoxic effect of mobile phone radiofrequency exposure on human peripheral blood mononuclear cells in vitro. The study population consisted in 14 healthy volunteers. After collection of two whole blood samples, the former was placed in a plastic rack, 1 cm from the chassis of a commercial mobile phone (900 MHz carrier frequency), which was activated by a 30-min call. The second blood sample was instead maintained far from mobile phones or other RF sources. The influence of mobile phone RF on DNA integrity was assessed by analyzing γ-H2AX foci in lymphocytes using immunofluorescence staining kit on AKLIDES. No measure of γ-H2AX foci was significantly influenced by mobile phone RF exposure, nor mobile phone exposure was associated with significant risk of genetic damages in vitro (odds ratio comprised between 0.27 and 1.00). The results of this experimental study demonstrate that exposure of human lymphocytes to a conventional 900 MHz RF emitted by a commercial mobile phone for 30 min does not significantly impact DNA integrity.

  13. Facilitated diffusion on mobile DNA: configurational traps and sequence heterogeneity.

    PubMed

    Brackley, C A; Cates, M E; Marenduzzo, D

    2012-10-19

    We present Brownian dynamics simulations of the facilitated diffusion of a protein, modeled as a sphere with a binding site on its surface, along DNA, modeled as a semiflexible polymer. We consider both the effect of DNA organization in three dimensions and of sequence heterogeneity. We find that in a network of DNA loops, which are thought to be present in bacterial DNA, the search process is very sensitive to the spatial location of the target within such loops. Therefore, specific genes might be repressed or promoted by changing the local topology of the genome. On the other hand, sequence heterogeneity creates traps which normally slow down facilitated diffusion. When suitably positioned, though, these traps can, surprisingly, render the search process much more efficient.

  14. Two high-mobility group box domains act together to underwind and kink DNA

    SciTech Connect

    Sánchez-Giraldo, R.; Acosta-Reyes, F. J.; Malarkey, C. S.; Saperas, N.; Churchill, M. E. A.; Campos, J. L.

    2015-06-30

    The crystal structure of HMGB1 box A bound to an unmodified AT-rich DNA fragment is reported at a resolution of 2 Å. A new mode of DNA recognition for HMG box proteins is found in which two box A domains bind in an unusual configuration generating a highly kinked DNA structure. High-mobility group protein 1 (HMGB1) is an essential and ubiquitous DNA architectural factor that influences a myriad of cellular processes. HMGB1 contains two DNA-binding domains, box A and box B, which have little sequence specificity but have remarkable abilities to underwind and bend DNA. Although HMGB1 box A is thought to be responsible for the majority of HMGB1–DNA interactions with pre-bent or kinked DNA, little is known about how it recognizes unmodified DNA. Here, the crystal structure of HMGB1 box A bound to an AT-rich DNA fragment is reported at a resolution of 2 Å. Two box A domains of HMGB1 collaborate in an unusual configuration in which the Phe37 residues of both domains stack together and intercalate the same CG base pair, generating highly kinked DNA. This represents a novel mode of DNA recognition for HMGB proteins and reveals a mechanism by which structure-specific HMG boxes kink linear DNA.

  15. Photoconducting Charge Mobility, and Nonlinear Optical Properties of DNA

    DTIC Science & Technology

    2007-08-21

    solutions. For the rotational and charge mobility measurements the films will be deposited on ITO coated glass substrates ith an over deposited aluminium ...wavelength will allow to measure also enhancement of cubic susceptibility due to eventual multiphoton excitations. 3. Dynamic holography to measure the... recrystallization from an absolute methanol solution. The hexadecyltrimethylammonium chloride (CTMA), poly(9-vinylcarbazole) (PVK), poly

  16. The free solution mobility of DNA and other analytes varies as the logarithm of the fractional negative charge.

    PubMed

    Stellwagen, Nancy C; Peters, Justin P; Dong, Qian; Maher, L James; Stellwagen, Earle

    2014-07-01

    The free solution mobilities of ssDNA and dsDNA molecules with variable charge densities have been measured by CE. DNA charge density was modified either by appending positively or negatively charged groups to the thymine residues in a 98 bp DNA molecule, or by replacing some of the negatively charged phosphate internucleoside linkers in small ssDNA or dsDNA oligomers with positively charged phosphoramidate linkers. Mobility ratios were calculated for each dataset by dividing the mobility of a charge variant by the mobility of its unmodified parent DNA. Mobility ratios essentially eliminate the effect of the BGE on the observed mobility, making it possible to compare analytes measured under different experimental conditions. Neutral moieties attached to the thymine residues in the 98-bp DNA molecule had little or no effect on the mobility ratios, indicating that bulky substituents in the DNA major groove do not affect the mobility significantly. The mobility ratios observed for the thymine-modified and linker-modified DNA charge variants increased approximately linearly with the logarithm of the fractional negative charge of the DNA. Mobility ratios calculated from previous studies of linker-modified DNA charge variants and small multicharged organic molecules also increased approximately linearly with the logarithm of the fractional negative charge of the analyte. The results do not agree with the Debye-Hückel-Onsager theory of electrophoresis, which predicts that the mobility of an analyte should depend linearly on analyte charge, not the logarithm of the charge, when the frictional coefficient is held constant. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    NASA Astrophysics Data System (ADS)

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies.

  18. Targeted DNA sequencing and in situ mutation analysis using mobile phone microscopy

    PubMed Central

    Kühnemund, Malte; Wei, Qingshan; Darai, Evangelia; Wang, Yingjie; Hernández-Neuta, Iván; Yang, Zhao; Tseng, Derek; Ahlford, Annika; Mathot, Lucy; Sjöblom, Tobias; Ozcan, Aydogan; Nilsson, Mats

    2017-01-01

    Molecular diagnostics is typically outsourced to well-equipped centralized laboratories, often far from the patient. We developed molecular assays and portable optical imaging designs that permit on-site diagnostics with a cost-effective mobile-phone-based multimodal microscope. We demonstrate that targeted next-generation DNA sequencing reactions and in situ point mutation detection assays in preserved tumour samples can be imaged and analysed using mobile phone microscopy, achieving a new milestone for tele-medicine technologies. PMID:28094784

  19. SWI/SNF- and RSC-catalyzed nucleosome mobilization requires internal DNA loop translocation within nucleosomes.

    PubMed

    Liu, Ning; Peterson, Craig L; Hayes, Jeffrey J

    2011-10-01

    The multisubunit SWI/SNF and RSC complexes utilize energy derived from ATP hydrolysis to mobilize nucleosomes and render the DNA accessible for various nuclear processes. Here we test the idea that remodeling involves intermediates with mobile DNA bulges or loops within the nucleosome by cross-linking the H2A N- or C-terminal tails together to generate protein "loops" that constrict separation of the DNA from the histone surface. Analyses indicate that this intranucleosomal cross-linking causes little or no change in remodeling-dependent exposure of DNA sequences within the nucleosome to restriction enzymes. However, cross-linking inhibits nucleosome mobilization and blocks complete movement of nucleosomes to extreme end positions on the DNA fragments. These results are consistent with evidence that nucleosome remodeling involves intermediates with DNA loops on the nucleosome surface but indicate that such loops do not freely diffuse about the surface of the histone octamer. We propose a threading model for movement of DNA loops around the perimeter of the nucleosome core.

  20. Epigenetic control of mobile DNA as an interface between experience and genome change

    PubMed Central

    Shapiro, James A.

    2014-01-01

    Mobile DNA in the genome is subject to RNA-targeted epigenetic control. This control regulates the activity of transposons, retrotransposons and genomic proviruses. Many different life history experiences alter the activities of mobile DNA and the expression of genetic loci regulated by nearby insertions. The same experiences induce alterations in epigenetic formatting and lead to trans-generational modifications of genome expression and stability. These observations lead to the hypothesis that epigenetic formatting directed by non-coding RNA provides a molecular interface between life history events and genome alteration. PMID:24795749

  1. A Dynamic Mobile DNA Family in the Yeast Mitochondrial Genome.

    PubMed

    Wu, Baojun; Hao, Weilong

    2015-04-20

    Transposable elements (TEs) are an important factor shaping eukaryotic genomes. Although a significant body of research has been conducted on the abundance of TEs in nuclear genomes, TEs in mitochondrial genomes remain elusive. In this study, we successfully assembled 28 complete yeast mitochondrial genomes and took advantage of the power of population genomics to determine mobile DNAs and their propensity. We have observed compelling evidence of GC clusters propagating within the mitochondrial genome and being horizontally transferred between species. These mitochondrial TEs experience rapid diversification by nucleotide substitution and, more importantly, undergo dynamic merger and shuffling to form new TEs. Given the hyper mobile and transformable nature of mitochondrial TEs, our findings open the door to a deeper understanding of eukaryotic mitochondrial genome evolution and the origin of nonautonomous TEs. Copyright © 2015 Wu and Hao.

  2. Using Measurements of Mobility, Diffusion, and Dispersion to Predict Separation Resolution in DNA Electrophoresis

    NASA Astrophysics Data System (ADS)

    Lo, Roger

    2005-03-01

    Electrophoresis of DNA continues to be a key component in a wide variety of genomic analysis assays. In order to customize and optimize these assay systems, much effort has been directed to improve and predict separation resolution using various sieving matrices and experimental platforms. Predicting separation resolution requires a much more detailed understanding of mobility, diffusion, and dispersion phenomena of DNA fragments migrating in the sieving matrix than is currently available in literature. In this study, we address this issue by obtaining a series of systematic measurements of mobility, diffusion, and dispersion using an automated DNA sequencer. Using this data, we are able to isolate key factors governing separation performance, and make comparisons with biased reptation theory to extract information on gel structure and predict achievable resolution under each set of operating conditions. We are also able to predict the separation resolution under specific run conditions, thereby giving researchers and engineers the ability to easily tailor DNA separation systems for required separation performance.

  3. Electrophoretic Deposition for Fabricating Microbatteries

    NASA Technical Reports Server (NTRS)

    West, William; Whitacre, Jay; Bugga, Ratnakumar

    2003-01-01

    An improved method of fabrication of cathodes of microbatteries is based on electrophoretic deposition. Heretofore, sputtering (for deposition) and the use of photoresist and liftoff (for patterning) have been the primary methods of fabricating components of microbatteries. The volume of active electrode material that can be deposited by sputtering is limited, and the discharge capacities of prior microbatteries have been limited accordingly. In addition, sputter deposition is slow. In contrast, electrophoretic deposition is much faster and has shown promise for increasing discharge capacities by a factor of 10, relative to those of microbatteries fabricated by prior methods.

  4. Single DNA imaging and length quantification through a mobile phone microscope

    NASA Astrophysics Data System (ADS)

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan L.; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2016-03-01

    The development of sensitive optical microscopy methods for the detection of single DNA molecules has become an active research area which cultivates various promising applications including point-of-care (POC) genetic testing and diagnostics. Direct visualization of individual DNA molecules usually relies on sophisticated optical microscopes that are mostly available in well-equipped laboratories. For POC DNA testing/detection, there is an increasing need for the development of new single DNA imaging and sensing methods that are field-portable, cost-effective, and accessible for diagnostic applications in resource-limited or field-settings. For this aim, we developed a mobile-phone integrated fluorescence microscopy platform that allows imaging and sizing of single DNA molecules that are stretched on a chip. This handheld device contains an opto-mechanical attachment integrated onto a smartphone camera module, which creates a high signal-to-noise ratio dark-field imaging condition by using an oblique illumination/excitation configuration. Using this device, we demonstrated imaging of individual linearly stretched λ DNA molecules (48 kilobase-pair, kbp) over 2 mm2 field-of-view. We further developed a robust computational algorithm and a smartphone app that allowed the users to quickly quantify the length of each DNA fragment imaged using this mobile interface. The cellphone based device was tested by five different DNA samples (5, 10, 20, 40, and 48 kbp), and a sizing accuracy of <1 kbp was demonstrated for DNA strands longer than 10 kbp. This mobile DNA imaging and sizing platform can be very useful for various diagnostic applications including the detection of disease-specific genes and quantification of copy-number-variations at POC settings.

  5. Analysis of electrophoretic patterns of arbitrarily primed PCR profiling.

    PubMed

    Trifunović, Dragana; Radović, Milan; Ristić, Zoran; Guzvić, Miodrag; Dimitrijević, Bogomir

    2005-11-01

    We present a mathematical algorithm for the analysis of electrophoretic patterns resulting from arbitrarily primed PCR profiling. The algorithm is based on the established mathematical procedures applied to the analysis of digital images of gel patterns. The algorithm includes (a) transformation of the image into a matrix form, (b) identification of every electrophoretic lane as a set of matrix columns that are further mathematically processed, (c) averaging of matrix columns corresponding to electrophoretic lanes that define lane representatives, (d) elimination of "smiling" bands, (e) solving the problem of a lane offset, and (f) removal of the background. Representation of individual electrophoretic lanes in the form of functions allows interlane comparisons and further mathematical analysis. Direct comparison of selected lanes was obtained by employing correlation analysis. Gel images were those obtained after arbitrarily primed PCR analysis of DNA that underwent damage induced by gamma radiation from a (60)Co source. The applied method proved to be useful for elimination of subjectivity of visual inspection. It offers the possibility to avoid overlooking important differences in case of suboptimal electrophoretic resolution. In addition, higher precision is achieved in the assessment of quantitative differences due to better insight into experimental artifacts. These simple mathematical methods offer an open-type algorithm, i.e., this algorithm enables easy implementation of different parameters that may be useful for other analytical needs.

  6. Effect of ultrasound on the separation of DNA fragments in agarose gel electrophoresis

    SciTech Connect

    Ma, Yinfa; Yeung, E.S. )

    1990-06-01

    Since its first use in 1966 interest in and the applications of electrophoresis of DNA fragments in agarose gel have grown rapidly. Nowadays, agarose gel electrophoresis has become a standard technique with high resolving power for the analysis of DNA structure, for example for the determination of the length of DNA fragments obtained by the action of restriction enzymes. The electrophoretic mobility ({mu}) of DNA fragments is influenced by various parameters-molecular weight, gel concentration, temperature, electric field, and DNA-agarose affinity. A comprehensive study of the influence of these main parameters has been reported. In this paper, the authors investigate a new effect on the electrophoretic mobility of DNA fragments in agarose gels, viz. the influence of ultrasound.

  7. Electrophoretic Retardation of Colloidal Particles in Nonpolar Liquids

    NASA Astrophysics Data System (ADS)

    Strubbe, Filip; Beunis, Filip; Brans, Toon; Karvar, Masoumeh; Woestenborghs, Wouter; Neyts, Kristiaan

    2013-04-01

    We have measured the electrophoretic mobility of single, optically trapped colloidal particles, while gradually depleting the co-ions and counterions in the liquid around the particle by applying a dc voltage. This is achieved in a nonpolar liquid, where charged reverse micelles act as co-ions and counterions. By increasing the dc voltage, the mobility first increases when the concentrations of co-ions and counterions near the particle start to decrease. At sufficiently high dc voltage (around 2 V), the mobility reaches a saturation value when the co-ions and counterions are fully separated. The increase in mobility is larger when the equilibrium ionic strength is higher. The dependence of the experimental data on the equilibrium ionic strength and on the applied voltage is in good agreement with the standard theory of electrophoretic retardation, assuming that the bare particle charge remains constant. This method is useful for studying the electrophoretic retardation effect and charging mechanisms for nonpolar colloids, and it sheds light on previously unexplained particle acceleration in electronic ink devices.

  8. Skeleton versus fine earth: what information is stored in the mobile extracellular soil DNA fraction?

    NASA Astrophysics Data System (ADS)

    Ascher, Judith; Ceccherini, Maria Teresa; Agnelli, Alberto; Corti, Guiseppe; Pietramellara, Giacomo

    2010-05-01

    The soil genome consists of an intracellular and an extracellular fraction. Recently, soil extracellular DNA (eDNA) has been shown to be quantitatively relevant, with a high survival capacity and mobility, playing a crucial role in the gene transfer by transformation, in the formation of bacterial biofilm and as a source of nutrients for soil microorganisms. The eDNA fraction can be discriminated and classified by its interaction with clay minerals, humic acids and Al/Fe oxihydroxides, resulting in differently mobile components. The eDNA extractable in water, classified as DNA free in the extracellular soil environment or adsorbed on soil colloids (eDNAfree/adsorbed), is hypothesized to be the most mobile DNA in soil. Challenging to assess the information stored in this DNA fraction, eDNAfree/adsorbed was recovered from fine earth (< 4 mm) and highly altered rock fragments or skeleton (4-10 mm) of six consecutive horizons (A1-BCb2) of a forest soil profile by washing the two soil fractions with H2O. Quantitative analysis have been conducted in terms of DNA yields (fluorimeter and spectrophotometer), molecular weight and fragment length distribution (gel electrophoresis), and qualitative analysis in terms of the composition and distribution of fungal and bacterial communities (Denaturing Gradient Gel Electrophoresis- fingerprinting). The mobile soil eDNA, extracted from each horizon, was characterised by low molecular weight (< 2 kb) and amounts ranging from 3.96 (±0.179) to 0.17 (±0.023) µg g-1 for the fine earth and from 1.42 (±0.111) to 0.11 (±0.007) µg g-1 for the skeleton. Genetic fingerprinting of eDNA recovered from fine earth and skeleton revealed characteristic fungal and bacterial communities of each horizon, but also similarities among the microbial communities of both soil fractions and horizons. This could be interpreted also as a result of the movement of eDNA along the soil profile and from fine earth to skeleton. The molecular characterization

  9. The free solution mobility of DNA and other analytes varies as the logarithm of the fractional negative charge

    PubMed Central

    Stellwagen, Nancy C.; Peters, Justin P.; Dong, Qian; Maher, L. James; Stellwagen, Earle

    2015-01-01

    The free solution mobilities of single- and double-stranded DNA molecules with variable charge densities have been measured by capillary electrophoresis. DNA charge density was modified either by appending positively or negatively charged groups to the thymine residues in a 98 base pair (bp) DNA molecule, or by replacing some of the negatively charged phosphate internucleoside linkers in small single-or double-stranded DNA oligomers with positively charged phosphoramidate linkers. Mobility ratios were calculated for each data set by dividing the mobility of a charge variant by the mobility of its unmodified parent DNA. Mobility ratios essentially eliminate the effect of the background electrolyte on the observed mobility, making it possible to compare analytes measured under different experimental conditions. Neutral moieties attached to the thymine residues in the 98-bp DNA molecule had little or no effect on the mobility ratios, indicating that bulky substituents in the DNA major groove do not affect the mobility significantly. The mobility ratios observed for the thymine-modified and linker-modified DNA charge variants increased approximately linearly with the logarithm of the fractional negative charge of the DNA. Mobility ratios calculated from previous studies of linker-modified DNA charge variants and small multi-charged organic molecules also increased approximately linearly with the logarithm of the fractional negative charge of the analyte. The results do not agree with the Debye-Hückel-Onsager theory of electrophoresis, which predicts that the mobility of an analyte should depend linearly on analyte charge, not the logarithm of the charge, when the frictional coefficient is held constant. PMID:24648187

  10. Electrophoretic Process For Purifying Wastewater

    NASA Technical Reports Server (NTRS)

    Sammons, David W.; Twitty, Garland E.; Sharnez, Rizwan; Egen, Ned B.

    1992-01-01

    Microbes, poisonous substances, and colloidal particles removed by combination of electric fields. Electrophoretic process removes pathogenicorganisms, toxins, toxic metals, and cooloidal soil particles from wastewater. Used to render domestic, industrial, and agricultural wastewater streams potable. Process also useful in bioregenerative and other closed systems like in space stations and submarines, where water must be recycled.

  11. Electrophoretic Process For Purifying Wastewater

    NASA Technical Reports Server (NTRS)

    Sammons, David W.; Twitty, Garland E.; Sharnez, Rizwan; Egen, Ned B.

    1992-01-01

    Microbes, poisonous substances, and colloidal particles removed by combination of electric fields. Electrophoretic process removes pathogenicorganisms, toxins, toxic metals, and cooloidal soil particles from wastewater. Used to render domestic, industrial, and agricultural wastewater streams potable. Process also useful in bioregenerative and other closed systems like in space stations and submarines, where water must be recycled.

  12. ELECTROPHORETIC HOMOGENEITY OF PREGNANT MARE SERUM GONADOTROPHIN

    PubMed Central

    Li, Choh Hao; Evans, Herbert M.; Wonder, Donald H.

    1940-01-01

    A highly purified and potent gonadotrophin in pregnant mare serum has been prepared. The preparation has been shown to be electrophoretically homogeneous in the Tiselius apparatus. The mobilities of the substance have been determined over a wide range of hydrogen ion concentrations. The isoelectric point lies at pH 2.60–2.65 and the value of See PDF for Equation is 4.0 x 10–5. Some chemical constituents have been studied. From the tryptophane and tyrosine content the molecular weight of the hormone is estimated to be 30,000. The hormone has been subjected to acetylation by ketene in aqueous solution at room temperature and the result suggests again the essentiality of free amino groups for the biological activity of the hormone. In this respect it is to be contrasted with human chorionic gonadotrophin. PMID:19873189

  13. A DNA-Inspired Encryption Methodology for Secure, Mobile Ad Hoc Networks

    NASA Technical Reports Server (NTRS)

    Shaw, Harry

    2012-01-01

    Users are pushing for greater physical mobility with their network and Internet access. Mobile ad hoc networks (MANET) can provide an efficient mobile network architecture, but security is a key concern. A figure summarizes differences in the state of network security for MANET and fixed networks. MANETs require the ability to distinguish trusted peers, and tolerate the ingress/egress of nodes on an unscheduled basis. Because the networks by their very nature are mobile and self-organizing, use of a Public Key Infra structure (PKI), X.509 certificates, RSA, and nonce ex changes becomes problematic if the ideal of MANET is to be achieved. Molecular biology models such as DNA evolution can provide a basis for a proprietary security architecture that achieves high degrees of diffusion and confusion, and resistance to cryptanalysis. A proprietary encryption mechanism was developed that uses the principles of DNA replication and steganography (hidden word cryptography) for confidentiality and authentication. The foundation of the approach includes organization of coded words and messages using base pairs organized into genes, an expandable genome consisting of DNA-based chromosome keys, and a DNA-based message encoding, replication, and evolution and fitness. In evolutionary computing, a fitness algorithm determines whether candidate solutions, in this case encrypted messages, are sufficiently encrypted to be transmitted. The technology provides a mechanism for confidential electronic traffic over a MANET without a PKI for authenticating users.

  14. Electrophoretic Analysis of Histones from Gibberellic Acid-treated Dwarf Peas

    PubMed Central

    Spiker, Steven; Chalkley, Roger

    1971-01-01

    Histones from the epicotyls of light-grown dwarf peas (Pisum sativum L. cv. Little Marvel) which had been treated with gibberellic acid were compared to histones from control dwarf peas by the method of polyacrylamide gel electrophoresis. The histone complements were found to be unaltered in the electrophoretic mobility and relative quantity of the individual fractions. The ratio of histone to DNA was also unaffected by treatment with gibberellic acid. The investigation confirmed earlier reports that over 95% of the histone of peas is contained in seven molecular species and that one of these can exist both as an oxidized disulfide dimer and as a reduced monomer. Evidence is presented which indicates that only the monomer form exists in vivo in the pea epicotyl tissue and that the oxidized dimer is an artifact of extraction. The implications of the data concerning the mechanism of action of gibberellic acid are discussed. Images PMID:16657619

  15. Imaging and sizing of single DNA molecules on a mobile phone.

    PubMed

    Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

    2014-12-23

    DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

  16. Melting transition in lipid vesicles functionalised by mobile DNA linkers.

    PubMed

    Bachmann, Stephan Jan; Kotar, Jurij; Parolini, Lucia; Šarić, Anđela; Cicuta, Pietro; Di Michele, Lorenzo; Mognetti, Bortolo Matteo

    2016-09-20

    We study phase behaviour of lipid-bilayer vesicles functionalised by ligand-receptor complexes made of synthetic DNA by introducing a modelling framework and a dedicated experimental platform. In particular, we perform Monte Carlo simulations that combine a coarse grained description of the lipid bilayer with state of art analytical models for multivalent ligand-receptor interactions. Using density of state calculations, we derive the partition function in pairs of vesicles and compute the number of ligand-receptor bonds as a function of temperature. Numerical results are compared to microscopy and fluorimetry experiments on large unilamellar vesicles decorated by DNA linkers carrying complementary overhangs. We find that vesicle aggregation is suppressed when the total number of linkers falls below a threshold value. Within the model proposed here, this is due to the higher configurational costs required to form inter-vesicle bridges as compared to intra-vesicle loops, which are in turn related to membrane deformability. Our findings and our numerical/experimental methodologies are applicable to the rational design of liposomes used as functional materials and drug delivery applications, as well as to study inter-membrane interactions in living systems, such as cell adhesion.

  17. Electrophoretic separation of serum proteins from gray squirrels.

    PubMed

    Chan, M S; Hoff, G L; Bigler, W J; Tomas, J A; Schneider, N J

    1976-10-01

    Serum proteins of gray squirrels were electrophoretically separated into 7 fractions as compared with the 5 fractions obtained from human serum. The mobility of the albumin fraction was approximately the same for both human and squirrel serums. The prealbumin fraction did not vary significantly in the percentage for squirrels bled at different times of the year. Immunoelectrophoresis patterns showed squirrel serum had a small number of fractions with the same antigenic characteristics as human serum.

  18. Electrophoretic separation of a class of nucleosomes enriched in HMG 14 and 17 and actively transcribed globin genes.

    PubMed Central

    Albanese, I; Weintraub, H

    1980-01-01

    Monomer nucleosomes from chick erythrocytes can be fractionated according to their electrophoretic mobility in (comparatively) high salt acrylamide gels. We show that the fractionation is based predominantly on differences in charge. The monomer heterogeneity persists even when the nucleosomes are trimmed down to 145 bp with Exo III or when H1 and H5 are removed. The slowest migrating monomers are associated with HMG 14 and 17; however, we do not believe that these proteins are entirely responsible for the altered mobility since the nucleosome heterogeneity persists even after removal of HMG 14 and 17. The DNA associated with the HMG 14 and 17 containing nucleosomes is shown to be enriched in actively transcribed globin sequences. Images PMID:6448987

  19. Characterization of exogenous DNA mobility in live cells through fluctuation correlation spectroscopy.

    PubMed

    Mieruszynski, Stephen; Digman, Michelle A; Gratton, Enrico; Jones, Mark R

    2015-09-10

    The spatial-temporal dynamics of delivered DNA is a critical aspect influencing successful gene delivery. A comprehensive model of DNA lipoplex trafficking through live cells has yet to be demonstrated. Here the bioimaging approaches Raster Image Correlation Spectroscopy (RICS) and image-Means Square Displacement (iMSD) were applied to quantify DNA mechanical dynamics in live cells. DNA lipoplexes formed from DNA with a range of 21 bp to 5.5 kbp exhibited a similar range of motion within the cytoplasm of myoblast cells regardless of size. However, the rate of motion was dictated by the intracellular location, and DNA cluster size. This analysis demonstrated that the different transport mechanisms either had a size dependent mobility, including random diffusion, whereas other mechanisms were not influenced by the DNA size such as active transport. The transport mechanisms identified followed a spatial dependence comparable to viral trafficking of non-active transport mechanism upon cellular entry, active transport within the cytoplasm and further inactive transportation along the peri-nuclear region. This study provides the first real-time insight into the trafficking of DNA delivered through lipofection using image-based fluctuation correlation spectroscopy approaches. Thereby, gaining information with single particle sensitivity to develop a deeper understanding of DNA lipoplex delivery through the cell.

  20. Characterization of exogenous DNA mobility in live cells through fluctuation correlation spectroscopy

    PubMed Central

    Mieruszynski, Stephen; Digman, Michelle A.; Gratton, Enrico; Jones, Mark R

    2015-01-01

    The spatial-temporal dynamics of delivered DNA is a critical aspect influencing successful gene delivery. A comprehensive model of DNA lipoplex trafficking through live cells has yet to be demonstrated. Here the bioimaging approaches Raster Image Correlation Spectroscopy (RICS) and image-Means Square Displacement (iMSD) were applied to quantify DNA mechanical dynamics in live cells. DNA lipoplexes formed from DNA with a range of 21 bp to 5.5 kbp exhibited a similar range of motion within the cytoplasm of myoblast cells regardless of size. However, the rate of motion was dictated by the intracellular location, and DNA cluster size. This analysis demonstrated that the different transport mechanisms either had a size dependent mobility, including random diffusion, whereas other mechanisms were not influenced by the DNA size such as active transport. The transport mechanisms identified followed a spatial dependence comparable to viral trafficking of non-active transport mechanism upon cellular entry, active transport within the cytoplasm and further inactive transportation along the peri-nuclear region. This study provides the first real-time insight into the trafficking of DNA delivered through lipofection using image-based fluctuation correlation spectroscopy approaches. Thereby, gaining information with single particle sensitivity to develop a deeper understanding of DNA lipoplex delivery through the cell. PMID:26354725

  1. Mobility analysis of super-resolved proteins on optically stretched DNA: comparing imaging techniques and parameters.

    PubMed

    Heller, Iddo; Sitters, Gerrit; Broekmans, Onno D; Biebricher, Andreas S; Wuite, Gijs J L; Peterman, Erwin J G

    2014-03-17

    Fluorescence microscopy in conjunction with optical tweezers is well suited to the study of protein mobility on DNA. Here, we evaluate the benefits and drawbacks of super-resolution and conventional imaging techniques for the analysis of one-dimensional (1D) protein diffusion as commonly observed for DNA-binding proteins. In particular, we demonstrate the visualization of DNA-bound proteins using wide-field, confocal, and stimulated emission depletion (STED) microscopy. We review the suitability of these techniques to conditions of high protein density, and quantify their performance in terms of spatial and temporal resolution. Tracking proteins on DNA forces one to make a choice between localization precision on the one hand, and the number and rate of localizations on the other, by altering imaging modality, excitation intensity, and acquisition rate. Using simulated diffusion data, we quantify the effect of these imaging conditions on the accuracy of 1D diffusion analysis. In addition, we consider the case of diffusion confined between local roadblocks, a case particularly relevant for proteins bound to DNA. Together these results provide guidelines that can assist in judiciously optimizing the experimental conditions required for the analysis of protein mobility on DNA and other 1D systems. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Single-molecule studies of high-mobility group B architectural DNA bending proteins.

    PubMed

    Murugesapillai, Divakaran; McCauley, Micah J; Maher, L James; Williams, Mark C

    2017-02-01

    Protein-DNA interactions can be characterized and quantified using single molecule methods such as optical tweezers, magnetic tweezers, atomic force microscopy, and fluorescence imaging. In this review, we discuss studies that characterize the binding of high-mobility group B (HMGB) architectural proteins to single DNA molecules. We show how these studies are able to extract quantitative information regarding equilibrium binding as well as non-equilibrium binding kinetics. HMGB proteins play critical but poorly understood roles in cellular function. These roles vary from the maintenance of chromatin structure and facilitation of ribosomal RNA transcription (yeast high-mobility group 1 protein) to regulatory and packaging roles (human mitochondrial transcription factor A). We describe how these HMGB proteins bind, bend, bridge, loop and compact DNA to perform these functions. We also describe how single molecule experiments observe multiple rates for dissociation of HMGB proteins from DNA, while only one rate is observed in bulk experiments. The measured single-molecule kinetics reveals a local, microscopic mechanism by which HMGB proteins alter DNA flexibility, along with a second, much slower macroscopic rate that describes the complete dissociation of the protein from DNA.

  3. Nanoscale histone localization in live cells reveals reduced chromatin mobility in response to DNA damage

    PubMed Central

    Liu, Jing; Vidi, Pierre-Alexandre; Lelièvre, Sophie A.; Irudayaraj, Joseph M. K.

    2015-01-01

    ABSTRACT Nuclear functions including gene expression, DNA replication and genome maintenance intimately rely on dynamic changes in chromatin organization. The movements of chromatin fibers might play important roles in the regulation of these fundamental processes, yet the mechanisms controlling chromatin mobility are poorly understood owing to methodological limitations for the assessment of chromatin movements. Here, we present a facile and quantitative technique that relies on photoactivation of GFP-tagged histones and paired-particle tracking to measure chromatin mobility in live cells. We validate the method by comparing live cells to ATP-depleted cells and show that chromatin movements in mammalian cells are predominantly energy dependent. We also find that chromatin diffusion decreases in response to DNA breaks induced by a genotoxic drug or by the ISceI meganuclease. Timecourse analysis after cell exposure to ionizing radiation indicates that the decrease in chromatin mobility is transient and precedes subsequent increased mobility. Future applications of the method in the DNA repair field and beyond are discussed. PMID:25501817

  4. Two-dimensional agarose gel electrophoresis of DNA topoisomers.

    PubMed

    Roca, Joaquim

    2009-01-01

    The electrophoretic velocity of a duplex DNA ring is mainly determined by its overall shape. Consequently, DNA topoisomers of opposite supercoiling handedness can have identical gel velocity, and topoisomers highly supercoiled cannot be separated beyond some point. These problems are overcome by two-dimensional agarose gel electrophoresis, which involves two successive electrophoresis steps in one gel slab. The first and second electrophoresis steps are conducted in orthogonal directions with different concentrations of DNA intercalating agents. These compounds alter the overall shape of the DNA and, thereby, change the relative mobility of individual DNA topoisomers.

  5. Identification and quantitation of morphological cell types in electrophoretically separated human embryonic kidney cell cultures

    NASA Technical Reports Server (NTRS)

    Williams, K. B.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.

  6. Identification and quantitation of morphological cell types in electrophoretically separated human embryonic kidney cell cultures

    NASA Technical Reports Server (NTRS)

    Williams, K. B.; Kunze, M. E.; Todd, P. W.

    1985-01-01

    Four major cell types were identified by phase microscopy in early passage human embryonic kidney cell cultures. They are small and large epithelioid, domed, and fenestrated cells. Fibroblasts are also present in some explants. The percent of each cell type changes with passage number as any given culture grows. As a general rule, the fraction of small epithelioid cells increases, while the fraction of fenestrated cells, always small, decreases further. When fibroblasts are present, they always increase in percentage of the total cell population. Electrophoretic separation of early passage cells showed that the domed cells have the highest electrophoretic mobility, fibroblasts have an intermediate high mobility, small epithelioid cells have a low mobility, broadly distributed, and fenestrated cells have the lowest mobility. All cell types were broadly distributed among electrophoretic subfractions, which were never pure but only enriched with respect to a given cell type.

  7. On the flow field about an electrophoretic particle

    NASA Astrophysics Data System (ADS)

    Orsini, Gabriele; Tricoli, Vincenzo

    2012-10-01

    The flow field about an electrophoretic body is theoretically investigated by analytical methods. An effective boundary condition for the electric potential at particle surface is derived. This condition, which generalizes the one obtained by Levich [Physicochemical Hydrodynamics (Prentice-Hall, Englewood Cliffs, 1962), Chap. 9, p. 475], captures the effect of (convective and electromigratory) surface current in the Debye layer and is valid as far as it is legitimate to neglect ion-concentration gradient in the bulk liquid. Conditions for negligible concentration gradients are also presented and discussed. The effect of surface current determines a deviation from Morrison's "classical" theory, which predicts irrotational flow-field for any particle shape with electrophoretic velocity given by the well-known Smoluchowski formula and always directed along the applied electric field. It is shown here that in the presence of the above effect the irrotationality of the flow field is not preserved if the particle surface has non-uniform curvature. However, irrotational flow-field still subsists for a sphere and a cylinder and is analytically determined in terms of a new non-dimensional parameter, referred to as the electrophoretic number. The case of spheroidal objects is also examined in detail. In this case the flow field, though not strictly irrotational, is shown to be nearly approximated by an irrotational flow-field, which is also determined over wide ranges of electrophoretic number and spheroid aspect ratio. The quality of this approximation is expressed as a relative error on the Helmholtz-Smoluchowski condition and numerically evaluated both in longitudinal and transverse configuration. The limiting cases of spheroid degenerating into a needle and a disk are also addressed. In all above cases the respective mobilities deviate from Smoluchowski's formula and depend on the electrophoretic number. An important effect of surface ion-transport in the double layer is

  8. 53BP1 and the LINC Complex Promote Microtubule-Dependent DSB Mobility and DNA Repair.

    PubMed

    Lottersberger, Francisca; Karssemeijer, Roos Anna; Dimitrova, Nadya; de Lange, Titia

    2015-11-05

    Increased mobility of chromatin surrounding double-strand breaks (DSBs) has been noted in yeast and mammalian cells but the underlying mechanism and its contribution to DSB repair remain unclear. Here, we use a telomere-based system to track DNA damage foci with high resolution in living cells. We find that the greater mobility of damaged chromatin requires 53BP1, SUN1/2 in the linker of the nucleoskeleton, and cytoskeleton (LINC) complex and dynamic microtubules. The data further demonstrate that the excursions promote non-homologous end joining of dysfunctional telomeres and implicated Nesprin-4 and kinesins in telomere fusion. 53BP1/LINC/microtubule-dependent mobility is also evident at irradiation-induced DSBs and contributes to the mis-rejoining of drug-induced DSBs in BRCA1-deficient cells showing that DSB mobility can be detrimental in cells with numerous DSBs. In contrast, under physiological conditions where cells have only one or a few lesions, DSB mobility is proposed to prevent errors in DNA repair.

  9. Sensitive and robust electrophoretic NMR: instrumentation and experiments.

    PubMed

    Hallberg, Fredrik; Furó, István; Yushmanov, Pavel V; Stilbs, Peter

    2008-05-01

    Although simple as a concept, electrophoretic NMR (eNMR) has so far failed to find wider application. Problems encountered are mainly due to disturbing and partly irreproducible convection-like bulk flow effects from both electro-osmosis and thermal convection. Additionally, bubble formation at the electrodes and rf noise pickup has constrained the typical sample geometry to U-tube-like arrangements with a small filling factor and a low resulting NMR sensitivity. Furthermore, the sign of the electrophoretic mobility cancels out in U-tube geometries. We present here a new electrophoretic sample cell based on a vertically placed conventional NMR sample tube with bubble-suppressing palladium metal as electrode material. A suitable radiofrequency filter design prevents noise pickup by the NMR sample coil from the high-voltage leads which extend into the sensitive sample volume. Hence, the obtained signal-to-noise ratio of this cell is one order of magnitude higher than that of our previous U-tube cells. Permitted by the retention of the sign of the displacement-related signal phase in the new cell design, an experimental approach is described where bulk flow effects by electro-osmosis and/or thermal convection are compensated through parallel monitoring of a reference signal from a non-charged species in the sample. This approach, together with a CPMG-like pulse train scheme provides a superior first-order cancellation of non-electrophoretic bulk flow effects.

  10. Sensitive and robust electrophoretic NMR: Instrumentation and experiments

    NASA Astrophysics Data System (ADS)

    Hallberg, Fredrik; Furó, István; Yushmanov, Pavel V.; Stilbs, Peter

    2008-05-01

    Although simple as a concept, electrophoretic NMR (eNMR) has so far failed to find wider application. Problems encountered are mainly due to disturbing and partly irreproducible convection-like bulk flow effects from both electro-osmosis and thermal convection. Additionally, bubble formation at the electrodes and rf noise pickup has constrained the typical sample geometry to U-tube-like arrangements with a small filling factor and a low resulting NMR sensitivity. Furthermore, the sign of the electrophoretic mobility cancels out in U-tube geometries. We present here a new electrophoretic sample cell based on a vertically placed conventional NMR sample tube with bubble-suppressing palladium metal as electrode material. A suitable radiofrequency filter design prevents noise pickup by the NMR sample coil from the high-voltage leads which extend into the sensitive sample volume. Hence, the obtained signal-to-noise ratio of this cell is one order of magnitude higher than that of our previous U-tube cells. Permitted by the retention of the sign of the displacement-related signal phase in the new cell design, an experimental approach is described where bulk flow effects by electro-osmosis and/or thermal convection are compensated through parallel monitoring of a reference signal from a non-charged species in the sample. This approach, together with a CPMG-like pulse train scheme provides a superior first-order cancellation of non-electrophoretic bulk flow effects.

  11. Design Modification of Electrophoretic Equipment

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1973-01-01

    The improved design of a zone electrophoretic sampler is reported that can be used in mass screening for hemoglobin S, the cause of sickle cell anemia. Considered is a high voltage multicell cellulose acetate device that requires 5 to 6 minutes electrophoresis periods; cells may be activitated individually or simultaneously. A multisample hemoglobin applicator standardizes the amount of sample applied and transfers the homolysate to the electrical wires.

  12. New directions in electrophoretic methods

    SciTech Connect

    Forgensen, J.W.; Phillips, M.

    1987-01-01

    This text presents the state of art of electrophoretic technology and applications. Included are electrophoresis in polyacrylamide gels; immobilized pH gradients; rehydratable polyacrylamide gels; silver-stain detection of proteins; color silver staining of polypeptides; electrophoresis and electrofocusing standards; standardization in isoelectric focusing, high-resolution, two-dimensional electrophoresis; applications of isoelectric focusing; agarose gel electrophoresis; pulsed electrophoresis; capillary zone electrophoresis; capillary isotachophoresis; isotachophoresis of synthetic ion-containing polymers; and preparative electrophoresis.

  13. Design Modification of Electrophoretic Equipment

    NASA Technical Reports Server (NTRS)

    Reddick, J. M.; Hirsch, I.

    1973-01-01

    The improved design of a zone electrophoretic sampler is reported that can be used in mass screening for hemoglobin S, the cause of sickle cell anemia. Considered is a high voltage multicell cellulose acetate device that requires 5 to 6 minutes electrophoresis periods; cells may be activitated individually or simultaneously. A multisample hemoglobin applicator standardizes the amount of sample applied and transfers the homolysate to the electrical wires.

  14. Electrophoretic separator for purifying biologicals

    NASA Technical Reports Server (NTRS)

    1975-01-01

    Mathematical expressions were developed to describe the interrelationships between operating requirements (capabilities), cell parameters, and system constraints in terms of design criteria definition. The mathematical model was programmed for computer solution. The model was exercised to identify performance-limiting characteristics, and analyses were conducted to predict operation in space of an experiment involving separation of four components. An engineering model of a flowing electrophoretic separator was constructed. The design is directed toward verifying improvements in resolution and throughput of a thicker cell than can be used on earth.

  15. Preparation of Panel and Charged Particles for Electrophoretic Display

    NASA Astrophysics Data System (ADS)

    Choi, Hyung Suk; Park, Jin Woo; Park, Lee Soon; Lee, Jung Kyung; Han, Yoon Soo; Kwon, Younghwan

    Studies on the formulation of photosensitive paste for transparent soft mold press (TSMP) method have been performed. With the optimum formulation of the photosensitive paste the box-type barrier rib with good flexibility and high solvent resistance was fabricated, suitable for the panel material of the electrophoretic display. Cationically-charged white particles were prepared by using TiO2 nanoparticles, silane coupling agent with amino groups, dispersant and acetic acid. The cationically charged TiO2 particles exhibited 74.09 mV of zeta potential and 3.11 × 10-5 cm2/Vs of mobility. Electrophoretic display fabricated with the charged TiO2 particles exhibited 10 V of low driving voltage and maximum contrast ratio (5.3/1) at 30 V.

  16. Mobile Phone Radiation Induces Reactive Oxygen Species Production and DNA Damage in Human Spermatozoa In Vitro

    PubMed Central

    De Iuliis, Geoffry N.; Newey, Rhiannon J.; King, Bruce V.; Aitken, R. John

    2009-01-01

    Background In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. Principal Findings Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR) tuned to 1.8 GHz and covering a range of specific absorption rates (SAR) from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001). Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. Conclusions RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications for the safety of

  17. Mobile phone radiation induces reactive oxygen species production and DNA damage in human spermatozoa in vitro.

    PubMed

    De Iuliis, Geoffry N; Newey, Rhiannon J; King, Bruce V; Aitken, R John

    2009-07-31

    In recent times there has been some controversy over the impact of electromagnetic radiation on human health. The significance of mobile phone radiation on male reproduction is a key element of this debate since several studies have suggested a relationship between mobile phone use and semen quality. The potential mechanisms involved have not been established, however, human spermatozoa are known to be particularly vulnerable to oxidative stress by virtue of the abundant availability of substrates for free radical attack and the lack of cytoplasmic space to accommodate antioxidant enzymes. Moreover, the induction of oxidative stress in these cells not only perturbs their capacity for fertilization but also contributes to sperm DNA damage. The latter has, in turn, been linked with poor fertility, an increased incidence of miscarriage and morbidity in the offspring, including childhood cancer. In light of these associations, we have analyzed the influence of RF-EMR on the cell biology of human spermatozoa in vitro. Purified human spermatozoa were exposed to radio-frequency electromagnetic radiation (RF-EMR) tuned to 1.8 GHz and covering a range of specific absorption rates (SAR) from 0.4 W/kg to 27.5 W/kg. In step with increasing SAR, motility and vitality were significantly reduced after RF-EMR exposure, while the mitochondrial generation of reactive oxygen species and DNA fragmentation were significantly elevated (P<0.001). Furthermore, we also observed highly significant relationships between SAR, the oxidative DNA damage bio-marker, 8-OH-dG, and DNA fragmentation after RF-EMR exposure. RF-EMR in both the power density and frequency range of mobile phones enhances mitochondrial reactive oxygen species generation by human spermatozoa, decreasing the motility and vitality of these cells while stimulating DNA base adduct formation and, ultimately DNA fragmentation. These findings have clear implications for the safety of extensive mobile phone use by males of

  18. DSB (Im)mobility and DNA repair compartmentalization in mammalian cells.

    PubMed

    Lemaître, Charlène; Soutoglou, Evi

    2015-02-13

    Chromosomal translocations are considered as causal in approximately 20% of cancers. Therefore, understanding their mechanisms of formation is crucial in the prevention of carcinogenesis. The first step of translocation formation is the concomitant occurrence of double-strand DNA breaks (DSBs) in two different chromosomes. DSBs can be repaired by different repair mechanisms, including error-free homologous recombination (HR), potentially error-prone non-homologous end joining (NHEJ) and the highly mutagenic alternative end joining (alt-EJ) pathways. Regulation of DNA repair pathway choice is crucial to avoid genomic instability. In yeast, DSBs are mobile and can scan the entire nucleus to be repaired in specialized DNA repair centers or if they are persistent, in order to associate with the nuclear pores or the nuclear envelope where they can be repaired by specialized repair pathways. DSB mobility is limited in mammals; therefore, raising the question of whether the position at which a DSB occurs influences its repair. Here, we review the recent literature addressing this question. We first present the reports describing the extent of DSB mobility in mammalian cells. In a second part, we discuss the consequences of non-random gene positioning on chromosomal translocations formation. In the third part, we discuss the mobility of heterochromatic DSBs in light of our recent data on DSB repair at the nuclear lamina, and finally, we show that DSB repair compartmentalization at the nuclear periphery is conserved from yeast to mammals, further pointing to a role for gene positioning in the outcome of DSB repair. When regarded as a whole, the different studies reviewed here demonstrate the importance of nuclear architecture on DSB repair and reveal gene positioning as an important parameter in the study of tumorigenesis.

  19. Universal scaling of crowding-induced DNA mobility is coupled with topology-dependent molecular compaction and elongation.

    PubMed

    Gorczyca, Stephanie M; Chapman, Cole D; Robertson-Anderson, Rae M

    2015-10-21

    Using single-molecule fluorescence microscopy and particle-tracking techniques, we elucidate the role DNA topology plays in the diffusion and conformational dynamics of crowded DNA molecules. We focus on large (115 kbp), double-stranded ring and linear DNA crowded by varying concentrations (0-40%) of dextran (10, 500 kDa) that mimic cellular conditions. By tracking the center-of-mass and measuring the lengths of the major and minor axes of single DNA molecules, we characterize both DNA mobility reduction as well as crowding-induced conformational changes (from random spherical coils). We reveal novel topology-dependent conformations, with single ring molecules undergoing compaction to ordered spherical configurations ∼20% smaller than dilute random coils, while linear DNA elongates by ∼2-fold. Surprisingly, these highly different conformations result in nearly identical exponential mobility reduction dependent solely on crowder volume fraction Φ, revealing a universal critical crowding concentration of Φc≅ 2.3. Beyond Φc DNA exhibits topology-independent conformational relaxation dynamics despite highly distinct topology-driven conformations. Our collective results reveal that topology-dependent conformational changes, unique to crowded environments, enable DNA to overcome the classically expected mobility reduction that high-viscosity crowded environments impose. Such coupled universal dynamics suggest a mechanism for DNA to maintain sufficient mobility required for wide-ranging biological processes despite severe cellular crowding.

  20. Remosomes: RSC generated non-mobilized particles with approximately 180 bp DNA loosely associated with the histone octamer

    PubMed Central

    Shukla, Manu Shubhdarshan; Syed, Sajad Hussain; Montel, Fabien; Faivre-Moskalenko, Cendrine; Bednar, Jan; Travers, Andrew; Angelov, Dimitar; Dimitrov, Stefan

    2010-01-01

    Chromatin remodelers are sophisticated nano-machines that are able to alter histone-DNA interactions and to mobilize nucleosomes. Neither the mechanism of their action nor the conformation of the remodeled nucleosomes are, however, yet well understood. We have studied the mechanism of Remodels Structure of Chromatin (RSC)-nucleosome mobilization by using high-resolution microscopy and biochemical techniques. Atomic force microscopy and electron cryomicroscopy (EC-M) analyses show that two types of products are generated during the RSC remodeling: (i) stable non-mobilized particles, termed remosomes that contain about 180 bp of DNA associated with the histone octamer and, (ii) mobilized particles located at the end of DNA. EC-M reveals that individual remosomes exhibit a distinct, variable, highly-irregular DNA trajectory. The use of the unique “one pot assays” for studying the accessibility of nucleosomal DNA towards restriction enzymes, DNase I footprinting and ExoIII mapping demonstrate that the histone-DNA interactions within the remosomes are strongly perturbed, particularly in the vicinity of the nucleosome dyad. The data suggest a two-step mechanism of RSC-nucleosome remodeling consisting of an initial formation of a remosome followed by mobilization. In agreement with this model, we show experimentally that the remosomes are intermediate products generated during the first step of the remodeling reaction that are further efficiently mobilized by RSC. PMID:20080697

  1. Nanopore detection of DNA molecules in magnesium chloride solutions

    PubMed Central

    2013-01-01

    High translocation speed of a DNA strand through a nanopore is a major bottleneck for nanopore detection of DNA molecules. Here, we choose MgCl2 electrolyte as salt solution to control DNA mobility. Experimental results demonstrate that the duration time for straight state translocation events in 1 M MgCl2 solution is about 1.3 ms which is about three times longer than that for the same DNA in 1 M KCl solution. This is because Mg2+ ions can effectively reduce the surface charge density of the negative DNA strands and then lead to the decrease of the DNA electrophoretic speed. It is also found that the Mg2+ ions can induce the DNA molecules binding together and reduce the probability of straight DNA translocation events. The nanopore with small diameter can break off the bound DNA strands and increase the occurrence probability of straight DNA translocation events. PMID:23688283

  2. Mobile elements and viral integrations prompt considerations for bacterial DNA integration as a novel carcinogen

    PubMed Central

    Robinson, Kelly M.; Hotopp, Julie C. Dunning

    2014-01-01

    Insertional mutagenesis has been repeatedly demonstrated in cancer genomes and has a role in oncogenesis. Mobile genetic elements can induce cancer development by random insertion into cancer related genes or by inducing translocations. L1s are typically implicated in cancers of an epithelial cell origin, while Alu elements have been implicated in leukemia as well as epithelial cell cancers. Likewise, viral infections have a significant role in cancer development predominantly through integration into the human genome and mutating or deregulating cancer related genes. Human papilloma virus is the best-known example of viral integrations contributing to carcinogenesis. However, hepatitis B virus, Epstein-Barr virus, and Merkel cell polyomavirus also integrate into the human genome and disrupt cancer related genes. Thus far, the role of microbes in cancer has primarily been attributed to mutations induced through chronic inflammation or toxins, as is the case with Helicobacter pylori and enterotoxigenic Bacteroides fragilis. We hypothesize that like mobile elements and viral DNA, bacterial and parasitic DNA may also integrate into the human somatic genome and be oncogenic. Until recently it was believed that bacterial DNA could not integrate into the human genome, but new evidence demonstrates that bacterial insertional mutagenesis may occur in cancer cells. Although this work does not show causation between bacterial insertions and cancer, it prompts more research in this area. Promising new sequencing technologies may reduce the risk of artifactual chimeric sequences, thus diminishing some of the challenges of identifying novel insertions in the somatic human genome. PMID:24956175

  3. Electrophoretic separator for purifying biologicals, part 1

    NASA Technical Reports Server (NTRS)

    Mccreight, L. R.

    1978-01-01

    A program to develop an engineering model of an electrophoretic separator for purifying biologicals is summarized. An extensive mathematical modeling study and numerous ground based tests were included. Focus was placed on developing an actual electrophoretic separator of the continuous flow type, configured and suitable for flight testing as a space processing applications rocket payload.

  4. Hole mobilities of periodic models of DNA double helices in the nucleosomes at different temperatures

    NASA Astrophysics Data System (ADS)

    Bende, Attila; Bogár, Ferenc; Ladik, János

    2013-04-01

    Using the Hartree-Fock crystal orbital method band structures of poly(G˜-C˜) and poly(A˜-T˜) were calculated (G˜, etc. means a nucleotide) including water molecules and Na+ ions. Due to the close packing of DNA in the ribosomes the motion of the double helix and the water molecules around it are strongly restricted, therefore the band picture can be used. The mobilities were calculated from the highest filled bands. The hole mobilities increase with decreasing temperatures. They are of the same order of magnitude as those of poly(A˜) and poly(T˜). For poly(G˜) the result is ˜5 times larger than in the poly(G˜-C˜) case.

  5. Urokinase production by electrophoretically separated cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.

    1985-01-01

    Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.

  6. Urokinase production by electrophoretically separated cultured human embryonic kidney cells

    NASA Technical Reports Server (NTRS)

    Kunze, M. E.; Plank, L. D.; Giranda, V.; Sedor, K.; Todd, P. W.

    1985-01-01

    Urokinase is a plasminogen activator found in urine. Relatively pure preparations have been tested in Europe, Japan and the United States for the treatment of deep vein thrombosis and other dangerous blood clots. Human embryonic kidney cell cultures have been found to produce urokinase at much higher concentrations, but less than 5% of the cells in typical cultures are producers. Since human diploid cells become senescent in culture the selection of clones derived from single cells will not provide enough material to be useful, so a bulk purification method is needed for the isolation of urokinase producing cell populations. Preparative cell electrophoresis was chosen as the method, since evidence exists that human embryonic cell cultures are richly heterogeneous with respect to electrophoretic mobility, and preliminary electrophoretic separations on the Apollo-Soyuz space flight produced cell populations that were rich in urokinase production. Similarly, erythropoietin is useful in the treatment of certain anemias and is a kidney cell duct, and electrophoretically enriched cell populations producing this product have been reported. Thus, there is a clear need for diploid human cells that produce these products, and there is evidence that such cells should be separable by free-flow cell electrophoresis.

  7. Nonlinear electrophoretic response yields a unique parameter for separation of biomolecules

    PubMed Central

    Pel, Joel; Broemeling, David; Mai, Laura; Poon, Hau-Ling; Tropini, Giorgia; Warren, René L.; Holt, Robert A.; Marziali, Andre

    2009-01-01

    We demonstrate a unique parameter for biomolecule separation that results from the nonlinear response of long, charged polymers to electrophoretic fields and apply it to extraction and concentration of nucleic acids from samples that perform poorly under conventional methods. Our method is based on superposition of synchronous, time-varying electrophoretic fields, which can generate net drift of charged molecules even when the time-averaged molecule displacement generated by each field individually is zero. Such drift can only occur for molecules, such as DNA, whose motive response to electrophoretic fields is nonlinear. Consequently, we are able to concentrate DNA while rejecting high concentrations of contaminants. We demonstrate one application of this method by extracting DNA from challenging samples originating in the Athabasca oil sands. PMID:19706437

  8. Capillary electrophoresis of DNA.

    PubMed

    Smith, Alan; Nelson, Robert J

    2003-08-01

    Capillary electrophoresis (CE) is an alternative to conventional slab gel electrophoresis for the separation of DNA fragments. CE offers a number of advantages over slab gel separations in terms of speed, resolution, sensitivity, and data handling. Separation times are generally only a few minutes and the DNA is detected either by UV absorption or by fluorescent labeling. The quantity of DNA required for separation is in the nanogram range. Single-base resolution can be obtained on fragments up to several hundred base pairs. In the presence of appropriate standards, fragments can be accurately sized based on relative electrophoretic mobility. A protocol for the analysis of synthetic oligonucleotides in a flowable matrix is described in this unit.

  9. Electrophoretic separation of kidney and pituitary cells on STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Nachtwey, D. S.; Barlow, G. H.; Cleveland, C.; Lanham, J. W.; Farrington, M. A.; Hatfield, J. M.; Hymer, W. C.; Grindeland, R.; Lewis, M. L.

    1984-01-01

    Specific secretory cells were separated from suspensions of cultured primary human embryonic cells and rat pituitary cells in microgravity conditions, with an objective of isolating the subfractions of kidney cells that produce the largest amount of urakinase, and the subfractions of rat pituitary cells that secrete growth hormones (GH), prolactin (PRL), and other hormones. It is inferred from the experimental observations that the surface charge distributions of the GH-containing cells differ from those of the PRL-containing cells, which is explained by the presence of secretory products on the surface of pituitary cells. For kidney cells, the electrophoretic mobility distributions in flight experiments were spread more than the ground controls.

  10. Diffusion, Dispersion, and Mobility of Single-stranded DNA in Polyacrylamide Gel Electrophoresis

    NASA Astrophysics Data System (ADS)

    Lo, Roger; Ugaz, Victor

    2004-03-01

    The ability to perform DNA electrophoresis in miniaturized microfluidic systems has the potential to provide a new generation of low-cost high-throughput genomic analysis technology. Further progress toward improving separation performance under these conditions, however, requires a more detailed understanding of diffusion and dispersion phenomena in the gel matrix. Unfortunately, it has thus far proven difficult to obtain extensive measurements of these quantities due in large part to the lack of a convenient experimental platform. In this paper, we demonstrate the use of microfabricated gel electrophoresis devices to measure diffusion, dispersion, and mobility of single-stranded DNA fragments in crosslinked and uncrosslinked polyacrylamide gels. The microdevice format allows a complete set of diffusion and dispersion data to be collected in approximately one hour, as opposed to experiment times lasting several days using conventional sequencing equipment. By comparing runs using identical DNA samples, gel formulations, and operating conditions in both microfabricated electrophoresis devices and an ALF Express automated DNA sequencer, we are able to isolate the key factors governing separation performance in each system. The results of these experiments are then compared with biased reptation theory to extract information about the gel structure and predict achievable resolution. The effects of gel composition and polymerization chemistry are also explored.

  11. The glucosaminidase domain of Atl – the major Staphylococcus aureus autolysin – has DNA-binding activity

    PubMed Central

    Grilo, Inês R; Ludovice, Ana Madalena; Tomasz, Alexander; de Lencastre, Hermínia; Sobral, Rita G

    2014-01-01

    In this communication, we describe evidence demonstrating the capacity of Atl, the major Staphylococcus aureus autolytic enzyme to bind DNA. Electrophoretic mobility shift assays (EMSA) show that both the Atl protein and the endo-β-N-acetylglucosaminidase (GL) domain were able to bind DNA of nonspecific sequence. The implications of this unexpected observation for the physiology of S. aureus remain to be explored. PMID:24585695

  12. Automated Parallel Capillary Electrophoretic System

    DOEpatents

    Li, Qingbo; Kane, Thomas E.; Liu, Changsheng; Sonnenschein, Bernard; Sharer, Michael V.; Kernan, John R.

    2000-02-22

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  13. Particle separations by electrophoretic techniques

    SciTech Connect

    Ballou, N.E.; Petersen, S.L.; Ducatte, G.R.; Remcho, V.T.

    1996-03-01

    A new method for particle separations based on capillary electrophoresis has been developed and characterized. It uniquely separates particles according to their chemical nature. Separations have been demonstrated with chemically modified latex particles and with inorganic oxide and silicate particles. Separations have been shown both experimentally and theoretically to be essentially independent of particle size in the range of about 0.2 {mu}m to 10 {mu}m. The method has been applied to separations of U0{sub 2} particles from environmental particulate material. For this, an integrated method was developed for capillary electrophoretic separation, collection of separated fractions, and determinations of U0{sub 2} and environmental particles in each fraction. Experimental runs with the integrated method on mixtures of UO{sub 2} particles and environmental particulate material demonstrated enrichment factors of 20 for UO{sub 2} particles in respect to environmental particles in the U0{sub 2}containing fractions. This enrichment factor reduces the costs and time for processing particulate samples by the lexan process by a factor of about 20.

  14. Dichotomous Life of DNA Binding High Mobility Group Box1 Protein in Human Health and Disease.

    PubMed

    Lohani, Neelam; Rajeswari, Moganty R

    2016-01-01

    The High mobility group box 1 (HMGB1) protein is an extremely versatile, highly conserved nuclear protein, with its unique intracellular and extracellular functions mediated by its relatively simple domain structure. Within the nucleus, HMGB1 binds to DNA minor groove in a nonspecific manner and causes bends in the double helix thus helps in recruiting a number of DNA binding protein and transcription factors, to facilitate transcription of various genes. HMGB1 also helps in DNA repair, chromatin remodeling, V (D) J recombination, and assembly of nucleosome on the chromatin. On contrary, under pathological conditions HMGB1 displays inflammatory response by interaction with specific cell surface receptors like RAGE, TLR-4, TLR9, and TLR2 and activates NF-kB downstream signaling pathways. The upregulation of HMGB1 is directly associated with the pathogenesis of cancer, sepsis, ischemia, hemorrhagic shock, anorexia, rheumatic disease, periodontal disease etc. Therefore, HMGB1 has been considered as a promising target in the treatment of various human diseases. The interest in HMGB1 is evident and reflected in the exponential increase in the recent publications, and therefore there is a need for an update on the understanding of the role of HMGB1 in pathogenesis and its potential application of HMGB1 as a therapeutic target in a number of human diseases.

  15. CAPILLARY ELECTROPHORETIC BEHAVIOR OF SEVEN SULFONYLUREAS

    EPA Science Inventory

    The electrophoretic behavior of bensulfuron Me, sulfometuron Me, nicosulfuron (Accent), chlorimuron Et, thifensulfuron Me (Harmony), metsulfuron Me, and chlorsulfuron was studied under capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) conditio...

  16. CAPILLARY ELECTROPHORETIC BEHAVIOR OF SEVEN SULFONYLUREAS

    EPA Science Inventory

    The electrophoretic behavior of bensulfuron Me, sulfometuron Me, nicosulfuron (Accent), chlorimuron Et, thifensulfuron Me (Harmony), metsulfuron Me, and chlorsulfuron was studied under capillary zone electrophoresis (CZE) and micellar electrokinetic chromatography (MEKC) conditio...

  17. Automated band mapping in electrophoretic gel images using background information

    PubMed Central

    Zerr, Troy; Henikoff, Steven

    2005-01-01

    Some popular methods for polymorphism and mutation discovery involve ascertainment of novel bands by the examination of electrophoretic gel images. Although existing strategies for mapping bands work well for specific applications, such as DNA sequencing, these strategies are not well suited for novel band detection. Here, we describe a general strategy for band mapping that uses background banding patterns to facilitate lane calling and size calibration. We have implemented this strategy in GelBuddy, a user-friendly Java-based program for PC and Macintosh computers, which includes several utilities to assist discovery of mutations and polymorphisms. We demonstrate the use of GelBuddy in applications based on single-base mismatch cleavage of heteroduplexed PCR products. Use of software designed to facilitate novel band detection can significantly shorten the time needed for image analysis and data entry in a high-throughput setting. Furthermore, the interactive strategy implemented in GelBuddy has been successfully applied to DNA fingerprinting applications, such as AFLP. GelBuddy promises to make electrophoretic gel analysis a viable alternative to DNA resequencing for discovery of mutations and polymorphisms. PMID:15894797

  18. Extreme dryness and DNA-protein cross-links

    NASA Astrophysics Data System (ADS)

    Bieger-Dose, A.; Dose, K.; Meffert, R.; Mehler, M.; Risi, S.

    Exposure of fungal conidia (Aspergillus ochraceus) or spores of Bacillus subtilis to extreme dryness or vacuum induces DNA lesions, including strand breaks and the formation of DNA-protein cross-links. In wet cells only a small amount of protein is bound to DNA, but exposure to conditions of lowered water activity results in an increasing number of cross-links between DNA and proteins. In fungal conidia these cross-links are detected after selective iodination (125J) of the DNA-bound proteins followed by gel electrophoresis and subsequent autoradiography. Another approach is the labelling of DNA with 32p by means of nick translation and the detection of differences in the electrophoretic mobility of DNA before and after digestion with proteinase K of proteins bound to DNA.

  19. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory

    NASA Astrophysics Data System (ADS)

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-01

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10-1 cm2 V-1 s-1 which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  20. Carrier mobility in double-helix DNA and RNA: A quantum chemistry study with Marcus-Hush theory.

    PubMed

    Wu, Tao; Sun, Lei; Shi, Qi; Deng, Kaiming; Deng, Weiqiao; Lu, Ruifeng

    2016-12-21

    Charge mobilities of six DNAs and RNAs have been computed using quantum chemistry calculation combined with the Marcus-Hush theory. Based on this simulation model, we obtained quite reasonable results when compared with the experiment, and the obtained charge mobility strongly depends on the molecular reorganization and electronic coupling. Besides, we find that hole mobilities are larger than electron mobilities no matter in DNAs or in RNAs, and the hole mobility of 2L8I can reach 1.09 × 10(-1) cm(2) V(-1) s(-1) which can be applied in the molecular wire. The findings also show that our theoretical model can be regarded as a promising candidate for screening DNA- and RNA-based molecular electronic devices.

  1. The structure of a chromosomal high mobility group protein-DNA complex reveals sequence-neutral mechanisms important for non-sequence-specific DNA recognition.

    PubMed

    Murphy, F V; Sweet, R M; Churchill, M E

    1999-12-01

    The high mobility group (HMG) chromosomal proteins, which are common to all eukaryotes, bind DNA in a non-sequence-specific fashion to promote chromatin function and gene regulation. They interact directly with nucleosomes and are believed to be modulators of chromatin structure. They are also important in V(D)J recombination and in activating a number of regulators of gene expression, including p53, Hox transcription factors and steroid hormone receptors, by increasing their affinity for DNA. The X-ray crystal structure, at 2.2 A resolution, of the HMG domain of the Drosophila melanogaster protein, HMG-D, bound to DNA provides the first detailed view of a chromosomal HMG domain interacting with linear DNA and reveals the molecular basis of non-sequence-specific DNA recognition. Ser10 forms water-mediated hydrogen bonds to DNA bases, and Val32 with Thr33 partially intercalates the DNA. These two 'sequence-neutral' mechanisms of DNA binding substitute for base-specific hydrogen bonds made by equivalent residues of the sequence-specific HMG domain protein, lymphoid enhancer factor-1. The use of multiple intercalations and water-mediated DNA contacts may prove to be generally important mechanisms by which chromosomal proteins bind to DNA in the minor groove.

  2. Objective data on DNA success rates can aid the selection process of crime samples for analysis by rapid mobile DNA technologies.

    PubMed

    Mapes, A A; Kloosterman, A D; Poot, C J de; van Marion, V

    2016-07-01

    Mobile Rapid-DNA devices have recently become available on the market. These devices can perform DNA analyses within 90min with an easy 'sample in-answer out' system, with the option of performing comparisons with a DNA database or reference profile. However, these fast mobile systems cannot yet compete with the sensitivity of the standard laboratory analysis. For the future this implies that Scene of Crime Officers (SoCOs) need to decide on whether to analyse a crime sample with a Rapid-DNA device and to get results within 2h or to secure and analyse the sample at the laboratory with a much longer throughput time but with higher sensitivity. This study provides SoCOs with evidence-based information on DNA success rates, which can improve their decisions at the crime scene on whether or not to use a Rapid-DNA device. Crime samples with a high success rate in the laboratory will also have the highest potential for Rapid-DNA analysis. These include samples from e.g. headwear, cigarette ends, articles of clothing, bloodstains, and drinking items.

  3. Properties of electrophoretic fractions of human embryonic kidney cells separated on space shuttle flight STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.

    1985-01-01

    Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.

  4. Properties of electrophoretic fractions of human embryonic kidney cells separated on space shuttle flight STS-8

    NASA Technical Reports Server (NTRS)

    Morrison, D. R.; Lewis, M. L.; Barlow, G. H.; Todd, P. W.; Kunze, M. E.; Sarnoff, B. E.; Li, Z. K.

    1985-01-01

    Suspensions of cultured primary human embryonic kidney cells were subjected to continuous flow electrophoresis on Space Shuttle flight STS-8. The objectives of the experiments were to obtain electrophoretically separated fractions of the original cell populations and to test these fractions for the amount and kind of urokinase (a kidney plasminogen activator that is used medically for digesting blood clots), the morphologies of cells in the individual fractions, and their cellular electrophoretic mobilities after separation and subsequent proliferation. Individual fractions were successfully cultured after return from orbit, and they were found to differ substantially from one another and from the starting sample with respect to all of these properties.

  5. Construction of a cDNA clone corresponding to mouse alpha 1(IV) procollagen.

    PubMed Central

    dos Santos, C L; Villa, L L; Sonohara, S; Brentani, R R

    1984-01-01

    A new procedure for the synthesis of double stranded cDNA, based upon release of mRNA by "in vitro" translation, was used to clone type IV collagen. Collagen synthesizing polysomes selectively isolated from a mouse parietal yolk sac carcinoma (PYS-2) were used for translation in an heterologous cell-free system. Translation products were collagenase-sensitive and displayed an electrophoretic mobility correspondent to type IV collagen. Translation released mRNA was employed to construct a 100 base pairs long cDNA clone which hybridized to a 7,800 nucleotides long mRNA. Peptides synthesized by "in vitro" translation of hybrid selected mRNA displayed an electrophoretic mobility compatible with that of alpha 1 (IV) collagen, were sensitive to collagenase and were immunoprecipitated by anti-type IV collagen antibody. Images PMID:6546618

  6. Human immunodeficiency virus type 1 evolution in vivo tracked by DNA heteroduplex mobility assays.

    PubMed Central

    Delwart, E L; Sheppard, H W; Walker, B D; Goudsmit, J; Mullins, J I

    1994-01-01

    High mutation rates and strong selective pressures imposed on human immunodeficiency viruses in vivo result in the formation of pools of genetic variants known as quasispecies. DNA heteroduplex mobility and tracking analyses were used to monitor the generation of HIV sequence diversity, to estimate quasispecies complexity, and to assess the turnover of genetic variants to approach an understanding of the relationship between viral quasispecies evolution in vivo and disease progression. Proviral DNA pools were nearly homogeneous soon after sexual transmission. The emergence and clearance of individual variants then occurred at different rates in different individuals. High quasispecies complexity was found in long-term-infected, asymptomatic individuals, while rapid CD4+ cell decline and AIDS were often, but not always, associated with lower quasispecies complexity. Proviral genetic variation was often low following in vitro culture, because of the outgrowth of one or a few variants that often became more abundant only later as proviruses in peripheral blood mononuclear cells. These studies provide insight into the dynamics of human immunodeficiency virus sequence changes in vivo and illustrate the utility of heteroduplex analysis for the study of phenomena associated with rapid genetic changes. Images PMID:8084001

  7. [Blocking 1800 MHz mobile phone radiation-induced reactive oxygen species production and DNA damage in lens epithelial cells by noise magnetic fields].

    PubMed

    Wu, Wei; Yao, Ke; Wang, Kai-jun; Lu, De-qiang; He, Ji-liang; Xu, Li-hong; Sun, Wen-jun

    2008-01-01

    To investigate whether the exposure to the electromagnetic noise can block reactive oxygen species (ROS) production and DNA damage of lens epithelial cells induced by 1800 MHz mobile phone radiation. The DCFH-DA method and comet assay were used respectively to detect the intracellular ROS and DNA damage of cultured human lens epithelial cells induced by 4 W/kg 1800 MHz mobile phone radiation or/and 2 muT electromagnetic noise for 24 h intermittently. 1800 MHz mobile phone radiation at 4 W/kg for 24 h increased intracellular ROS and DNA damage significantly (P<0.05). However, the ROS level and DNA damage of mobile phone radiation plus noise group were not significant enhanced (P>0.05) as compared to sham exposure group. Electromagnetic noise can block intracellular ROS production and DNA damage of human lens epithelial cells induced by 1800 MHz mobile phone radiation.

  8. Influence of electric field intensity, ionic strength, and migration distance on the mobility and diffusion in DNA surface electrophoresis.

    PubMed

    Li, Bingquan; Fang, Xiaohua; Luo, Haobin; Petersen, Eric; Seo, Young-Soo; Samuilov, Vladimir; Rafailovich, Miriam; Sokolov, Jonathan; Gersappe, Dilip; Chu, Benjamin

    2006-04-01

    In order to increase the separation rate of surface electrophoresis while preserving the resolution for large DNA chains, e.g., genomic DNA, the mobility and diffusion of Lambda DNA chains adsorbed on flat silicon substrate under an applied electric field, as a function of migration distance, ionic strength, and field intensity, were studied using laser fluorescence microscope. The mobility was found to follow a power law with the field intensity beyond a certain threshold. The detected DNA peak width was shown to be constant with migration distance, slightly smaller with stronger field intensity, but significantly decreased with higher ionic strength. The molecular dynamics simulation demonstrated that the peak width was strongly related with the conformation of DNA chains adsorbed onto surface. The results also implied that there was no diffusion of DNA during migration on surface. Therefore, the Nernst-Einstein relation is not valid in the surface electrophoresis and the separation rate could be improved without losing resolution by decreasing separation distance, increasing buffer concentration, and field intensity. The results indicate the fast separation of genomic DNA chains by surface electrophoresis is possible.

  9. BRCA2 diffuses as oligomeric clusters with RAD51 and changes mobility after DNA damage in live cells

    PubMed Central

    Reuter, Marcel; Zelensky, Alex; Smal, Ihor; Meijering, Erik; van Cappellen, Wiggert A.; de Gruiter, H. Martijn; van Belle, Gijsbert J.; van Royen, Martin E.; Houtsmuller, Adriaan B.; Essers, Jeroen; Kanaar, Roland

    2014-01-01

    Genome maintenance by homologous recombination depends on coordinating many proteins in time and space to assemble at DNA break sites. To understand this process, we followed the mobility of BRCA2, a critical recombination mediator, in live cells at the single-molecule level using both single-particle tracking and fluorescence correlation spectroscopy. BRCA2-GFP and -YFP were compared to distinguish diffusion from fluorophore behavior. Diffusive behavior of fluorescent RAD51 and RAD54 was determined for comparison. All fluorescent proteins were expressed from endogenous loci. We found that nuclear BRCA2 existed in oligomeric clusters, and exhibited heterogeneous mobility. DNA damage increased BRCA2 transient binding, presumably including binding to damaged sites. Despite its very different size, RAD51 displayed mobility similar to BRCA2, which indicates physical interaction between these proteins both before and after induction of DNA damage. We propose that BRCA2-mediated sequestration of nuclear RAD51 serves to prevent inappropriate DNA interactions and that all RAD51 is delivered to DNA damage sites in association with BRCA2. PMID:25488918

  10. Study of the Electrophoretic Behavior of Cephalosporins by Capillary Zone Electrophoresis

    PubMed Central

    Hancu, Gabriel; Sasebeşi, Adina; Rusu, Aura; Kelemen, Hajnal; Ciurba, Adriana

    2015-01-01

    Purpose: The aim of the study was the characterization of the electrophoretic behavior of cephalosporins from different generation having different structural characteristics in order to develop a rapid, simple and efficient capillary electrophoretic method for their identification and simultaneous separation from complex mixtures. Methods: Ten cephalosporin derivatives (cefaclor, cefadroxil, cefalexin, cefazolin, cefoxitin, cefuroxime, cefoperazone, cefotaxime, ceftazidime, ceftriaxone) were analyzed by capillary zone electrophoresis using different background electrolyte solutions at different pH values. Electrophoretic mobilities of the analytes were calculated, the influence of the electrophoretic parameteres on the separation was established and the analytical conditions were optimized. Results: Taking into consideration their structural and chemical properties cephalosporins can be detected over a pH range between 6 and 10. The best results were obtained using a buffer solution containing 25 mM disodium hydrogenophosphate - 25 mM sodium dihydrogenophosphate, at a pH – 7.00, + 25 kV voltage at a temperature of 25 °C, UV detection at 210 nm. Using the optimized analytical conditions we achieved the simultaneous baseline separation for seven cephalosporins in less then 10 minutes. Conclusion: Using the described optimized electrophoretic procedures, capillary electrophoresis can be used for the identification and determination of cephalosporins in formulated pharmaceutical products and for their separation from complex mixtures. PMID:26236661

  11. Mobilization

    DTIC Science & Technology

    1987-01-01

    istic and romantic emotionalism that typifies this genre. Longino, James C., et al. “A Study of World War Procurement and Industrial Mobilization...States. Harrisburg, PA: Military Service Publishing Co., 1941. CARL 355.22 J72b. Written in rough prose , this World War II era document explains the

  12. Functional analysis of DNA bending and unwinding by the high mobility group domain of LEF-1

    PubMed Central

    Giese, Klaus; Pagel, John; Grosschedl, Rudolf

    1997-01-01

    LEF-1 (lymphoid enhancer-binding factor 1) is a cell type-specific member of the family of high mobility group (HMG) domain proteins that recognizes a specific nucleotide sequence in the T cell receptor (TCR) α enhancer. In this study, we extend the analysis of the DNA-binding properties of LEF-1 and examine their contributions to the regulation of gene expression. We find that LEF-1, like nonspecific HMG-domain proteins, can interact with irregular DNA structures such as four-way junctions, albeit with lower efficiency than with specific duplex DNA. We also show by a phasing analysis that the LEF-induced DNA bend is directed toward the major groove. In addition, we find that the interaction of LEF-1 with a specific binding site in circular DNA changes the linking number of DNA and unwinds the double helix. Finally, we identified two nucleotides in the LEF-1-binding site that are important for protein-induced DNA bending. Mutations of these nucleotides decrease both the extent of DNA bending and the transactivation of the TCRα enhancer by LEF-1, suggesting a contribution of protein-induced DNA bending to the function of TCRα enhancer. PMID:9371763

  13. Photon Correlation Spectroscopy and Electrophoretic Light Scattering Using Optical Fibres.

    NASA Astrophysics Data System (ADS)

    MacFadyen, Allan John

    Available from UMI in association with The British Library. In photon correlation spectroscopy, the fast local fluctuations in the intensity of the light scattered by submicron particles in suspension are recorded and analysed in terms of the particle motion. These may then be related to the particle size, or, when the particles are subjected to an electric field, the electrophoretic mobility. Light scattering apparatus traditionally incorporates a fixed goniometer arrangement. Recently, however, systems have been reported which incorporate optical fibres for use in remote or on-line situations. In this thesis, recent advances in the development of fibre-based photon correlation systems are reviewed and the design and construction of two novel optical fibre apparatus prototypes, incorporating "SELFOC" lenses, miniature prisms and single mode detection fibre, is discussed. The final outcome, an optical fibre sensor, which combines both photon correlation and electrophoretic light scattering measurements in a single, compact dip -in probe for the first time, is described. Results are presented for a variety of colloidal particles in suspension including polystyrene and "Microsilica" spheres, PTFE ellipsoids and kaolinite platelets, all of which demonstrate the viability of the apparatus.

  14. Cohesin phosphorylation and mobility of SMC1 at ionizing radiation-induced DNA double-strand breaks in human cells

    SciTech Connect

    Bauerschmidt, Christina; Helleday, Thomas

    2011-02-01

    Cohesin, a hetero-tetrameric complex of SMC1, SMC3, Rad21 and Scc3, associates with chromatin after mitosis and holds sister chromatids together following DNA replication. Following DNA damage, cohesin accumulates at and promotes the repair of DNA double-strand breaks. In addition, phosphorylation of the SMC1/3 subunits contributes to DNA damage-induced cell cycle checkpoint regulation. The aim of this study was to determine the regulation and consequences of SMC1/3 phosphorylation as part of the cohesin complex. We show here that the ATM-dependent phosphorylation of SMC1 and SMC3 is mediated by H2AX, 53BP1 and MDC1. Depletion of RAD21 abolishes these phosphorylations, indicating that only the fully assembled complex is phosphorylated. Comparison of wild type SMC1 and SMC1S966A in fluorescence recovery after photo-bleaching experiments shows that phosphorylation of SMC1 is required for an increased mobility after DNA damage in G2-phase cells, suggesting that ATM-dependent phosphorylation facilitates mobilization of the cohesin complex after DNA damage.

  15. Patterns of prehistoric human mobility in Polynesia indicated by mtDNA from the Pacific rat

    PubMed Central

    Matisoo-Smith, E.; Roberts, R. M.; Irwin, G. J.; Allen, J. S.; Penny, D.; Lambert, D. M.

    1998-01-01

    Human settlement of Polynesia was a major event in world prehistory. Despite the vastness of the distances covered, research suggests that prehistoric Polynesian populations maintained spheres of continuing interaction for at least some period of time in some regions. A low level of genetic variation in ancestral Polynesian populations, genetic admixture (both prehistoric and post-European contact), and severe population crashes resulting from introduction of European diseases make it difficult to trace prehistoric human mobility in the region by using only human genetic and morphological markers. We focus instead on an animal that accompanied the ancestral Polynesians on their voyages. DNA phylogenies derived from mitochondrial control-region sequences of Pacific rats (Rattus exulans) from east Polynesia are presented. A range of specific hypotheses regarding the degree of interaction within Polynesia are tested. These include the issues of multiple contacts between central east Polynesia and the geographically distinct archipelagos of New Zealand and Hawaii. Results are inconsistent with models of Pacific settlement involving substantial isolation after colonization and confirm the value of genetic studies on commensal species for elucidating the history of human settlement. PMID:9844030

  16. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, Richard D.; Olivares, Jose A.

    1989-01-01

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5-100 KVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., .+-.2-8 KVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit.

  17. Preparation of guinea pig macrophage for electrophoretic experiments in space

    NASA Technical Reports Server (NTRS)

    1979-01-01

    Methods of storage and cultivation of macrophage cells in preparation for space experiments were investigated. Results show that freezing and thawing immediately after extraction did not cause any change in viability or electrophoretic mobility of the cells. A prolonged storage at -80 C did cause cell damage as indicated by a 95% reduction in variable cells. Cell damage was decreased when Glycerol or Dimethyl Sulfoxide (DMSO) was added as a cryogenic protective agent. A 100% viability was observed in cultivation experiments after two weeks due to the additional serum. Results from gamma-glutamyl transpeptidase study showed a zero activity rate. It is suggested that a flat stationary field be used for the collection and use of macrophage. It was found that a 24-hour delay in obtaining macrophage cells helps to maintain a pure culture.

  18. A simplified electrophoretic system for determining molecular weights of proteins.

    PubMed

    Manwell, C

    1977-09-01

    Electrophoresis of 31 different proteins in commercially prepared polyacrylamide gradient gels, Gradipore, yields a linear relationship between a hypothetical limiting pore size (the reciprocal of a limiting gel concentration, GL) and the cube root of the mol.wt., over the range 13 500-9000 000. A regression analysis of these data reveals that 98.6% of all variability in 1/GL is explained by the molecular weight, and this degree of accuracy compares favourably with existing methods for the determination of molecular weight by retardation of mobility in polyacrylamide. This new procedure has the additional advantages that molecular-weight standards can be obtained from readily available body fluids or tissue extracts by localizing enzymes and other proteins by standard histochemical methods, and that the same electrophoretic system can be used in determining molecular weights as is used in routine surveys of populations for individual and species variation in protein heterogeneity.

  19. Combined electrophoretic-separation and electrospray method and system

    DOEpatents

    Smith, R.D.; Olivares, J.A.

    1989-06-27

    A system and method for analyzing molecular constituents of a composition sample includes: forming a solution of the sample, separating the solution by capillary zone electrophoresis into an eluent of constituents longitudinally separated according to their relative electrophoretic mobilities, electrospraying the eluent to form a charged spray in which the molecular constituents have a temporal distribution; and detecting or collecting the separated constituents in accordance with the temporal distribution in the spray. A first high-voltage (e.g., 5--100 kVDC) is applied to the solution. The spray is charged by applying a second high voltage (e.g., [+-]2--8 kVDC) between the eluent at the capillary exit and a cathode spaced in front of the exit. A complete electrical circuit is formed by a conductor which directly contacts the eluent at the capillary exit. 10 figs.

  20. Survival rate of eukaryotic cells following electrophoretic nanoinjection

    PubMed Central

    Simonis, Matthias; Hübner, Wolfgang; Wilking, Alice; Huser, Thomas; Hennig, Simon

    2017-01-01

    Insertion of foreign molecules such as functionalized fluorescent probes, antibodies, or plasmid DNA to living cells requires overcoming the plasma membrane barrier without harming the cell during the staining process. Many techniques such as electroporation, lipofection or microinjection have been developed to overcome the cellular plasma membrane, but they all result in reduced cell viability. A novel approach is the injection of cells with a nanopipette and using electrophoretic forces for the delivery of molecules. The tip size of these pipettes is approximately ten times smaller than typical microinjection pipettes and rather than pressure pulses as delivery method, moderate DC electric fields are used to drive charged molecules out of the tip. Here, we show that this approach leads to a significantly higher survival rate of nanoinjected cells and that injection with nanopipettes has a significantly lower impact on the proliferation behavior of injected cells. Thus, we propose that injection with nanopipettes using electrophoretic delivery is an excellent alternative when working with valuable and rare living cells, such as primary cells or stem cells. PMID:28120926

  1. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 8 2014-04-01 2014-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass) due...

  2. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass) due...

  3. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 8 2013-04-01 2013-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass) due...

  4. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 8 2011-04-01 2011-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass) due...

  5. 21 CFR 864.7440 - Electrophoretic hemoglobin analysis system.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 8 2012-04-01 2012-04-01 false Electrophoretic hemoglobin analysis system. 864....7440 Electrophoretic hemoglobin analysis system. (a) Identification. An electrophoretic hemoglobin... hemoglobin types as an aid in the diagnosis of anemia or erythrocytosis (increased total red cell mass) due...

  6. Eccentric electrophoretic motion of a rectangular particle in a rectangular microchannel.

    PubMed

    Li, Dongquing; Daghighi, Yasaman

    2010-02-15

    Understanding of the effects of the boundary - the channel walls - on the electrophoretic motion of particles in microchannels is very important. This paper developed an analytical solution of the electrophoretic mobility for eccentric motion of a rectangular particle in a rectangular microchannel. The simple geometry of the system does not limit the generality of the qualitative prediction of the model and the analytical solution. Several special cases are studied, and the effects of the degree of the eccentricity, the particle's size relative to the channel's size, and the relative zeta potentials on the particle's mobility are discussed. For the case where the particle's cross-section area is close to the cross-section area of the microchannel, the model's predictions are compared with the published experimental results and good agreement was found.

  7. Molecular Dynamics Simulations Illuminate the Role of Counterion Condensation in the Electrophoretic Transport of Homogalacturonans.

    PubMed

    Irani, Amir H; Owen, Jessie L; Mercadante, Davide; Williams, Martin A K

    2017-02-13

    Homogalacturonans (HGs) are polysaccharide copolymers of galacturonic acid and its methylesterified counterpart. The inter- and intramolecular distributions of the methylesterifed residues are vital behavior-determining characteristics of a sample's structure, and much experimental effort has been directed to their measurement. While many techniques are able to measure the sample-averaged degree of methylesterification (DM), the measurement of inter- and intramolecular charge distributions are challenging. Here, molecular dynamics (MD) simulations are used to calculate the electrophoretic mobilities of HGs that have different amounts and distributions of charges placed along the backbone. The simulations are shown to capture experimental results well, even for low-DM samples that possess high charge densities. In addition, they illuminate the role that local counterion condensation can play in the determination of the electrophoretic mobility of heterogeneous blocky polyelectrolytes that cannot be adequately described by a single chain-averaged charge spacing.

  8. Electrophoretic purification of cells in space - Evaluation of results from STS-3

    NASA Technical Reports Server (NTRS)

    Sarnoff, B. E.; Kunze, M. E.; Todd, P.

    1983-01-01

    The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.

  9. Electrophoretic purification of cells in space - Evaluation of results from STS-3

    NASA Technical Reports Server (NTRS)

    Sarnoff, B. E.; Kunze, M. E.; Todd, P.

    1983-01-01

    The procedure and results of Electrophoresis Equipment Verification Test, designed to examine electrophoretic behavior of animal cells is suspension more concentrated than possible on earth and flown on the Shuttle flight STS-3, were discussed. Ground-based laboratory values of electrophoretic mobilities of a mixture of human and rabbit aldehyde-fixed red blood cells (RBC) were compared with those recorded at 11 minute intervals on the Shuttle STS-3. RBC migration and separation observed through photographic records were not as expected. However, cell mobilities and migrating band profiles were consistent with the results of laboratory simulation experiments. It was concluded that zero G electrophoresis of very high concentrations (1 x 10 to the 9th) is possible and similar to electrophoresis of normal cell concentrations on earth.

  10. Method for locating and purifying DNA containing single base mismatches

    SciTech Connect

    Ford, J.P.; Novack, D.F.; Casna, N.J.

    1988-12-27

    A method is described for detecting guanine and thymine bases which are unpaired according to the Watson-Crick base pairing scheme in a double stranded polynucleotide molecule, each unpaired guanine or thymine base being immediately preceded by at least one base which is paired, and immediately followed by at least one base which is paired, the preceding and following paired bases being on the same polynucleotide sequence as the unpaired guanine or thymine base comprising: (a) reacting the double stranded polynucleotide molecule with a reagent capable of altering the electrophoretic mobility of a double stranded polynucleotide molecule by derivatizing unpaired guanine and thymine bases in the double stranded polynucleotide molecule, wherein the double stranded polynucleotide molecule is not a covalently closed circular DNA; (b) observing the electrophoretic mobility of the double stranded polynucleotide molecule which has been reacted with the reagent; and (c) determining the presence or absence of an alteration in the electrophoretic mobility; whereby the presence or absence of unpaired guanine and thymine bases in the double stranded polynucleotide molecule is detected.

  11. Methylated DNA-binding protein is present in various mammalian cell types

    SciTech Connect

    Supakar, P.C.; Weist, D.; Zhang, D.; Inamdar, N.; Zhang, Xianyang; Khan, R.; Ehrlich, M. ); Ehrlich, K.C. )

    1988-08-25

    A DNA-binding protein from human placenta, methylated DNA-binding protein (MDBP), binds to certain DNA sequences only when they contain 5-methylcytosine (m{sup 5}C) residues at specific positions. The authors found a very similar DNA-binding activity in nuclear extracts of rat tissues, calf thymus, human embryonal carcinoma cells, HeLa cells, and mouse LTK cells. Like human placental MDBP, the analogous DNA-binding proteins from the above mammalian cell lines formed a number of different low-electrophoretic-mobility complexes with a 14-bp MDBP-specific oligonucleotide duplex. All of these complexes exhibited the same DNA methylation specificity and DNA sequence specificity. Although MDBP activity was found in various mammalian cell types, it was not detected in extracts of cultured mosquito cells and so may be associated only with cells with vertebrate-type DNA methylation.

  12. Method for in-situ calibration of electrophoretic analysis systems

    DOEpatents

    Liu, Changsheng; Zhao, Hequan

    2005-05-08

    An electrophoretic system having a plurality of separation lanes is provided with an automatic calibration feature in which each lane is separately calibrated. For each lane, the calibration coefficients map a spectrum of received channel intensities onto values reflective of the relative likelihood of each of a plurality of dyes being present. Individual peaks, reflective of the influence of a single dye, are isolated from among the various sets of detected light intensity spectra, and these can be used to both detect the number of dye components present, and also to establish exemplary vectors for the calibration coefficients which may then be clustered and further processed to arrive at a calibration matrix for the system. The system of the present invention thus permits one to use different dye sets to tag DNA nucleotides in samples which migrate in separate lanes, and also allows for in-situ calibration with new, previously unused dye sets.

  13. Microscopic Electrohydrodynamics of DNA electrophoresis

    NASA Astrophysics Data System (ADS)

    Aksimentiev, Aleksei; Luan, Binquan

    2008-03-01

    Gel electrophoresis is currently the most successful yet costly method to sequence DNA. Electrophoresis of DNA through solid-state nanopores holds promise for reducing the costs and making personal genomics a reality. The underlying physics of DNA electrophoresis, however, remains controversial. Theoretical models of this process often invoke the notion of the effective charge of a DNA molecule qeff to account for the reduced electric force on DNA in an external field E, i.e. F= qeffE. However, experimental estimates of qeff can differ from each other by as much as ten times. To clarify the physical origin of the reduction of an electric force on DNA in electrophoresis, we investigated this process through extensive all-atom molecular dynamics simulations. Our results demonstrate that the effective screening of the DNA charge arises from the hydrodynamic drag of the electroosmotic flow, not from the counterion condensation. We show that the effective driving force F of an applied electric field E in a nanopore obeys the same law as in a bulk electrolyte: F=ξμE. Here, ξ and μ are, respectively, the friction coefficient and electrophoretic mobility of DNA that depend on the surface properties of a nanopore, such as its roughness. Based on the above law, a method for determining the effective driving force is suggested that does not require a direct force measurement.

  14. RAG1/2 induces genomic insertions by mobilizing DNA into RAG1/2-independent breaks

    PubMed Central

    2017-01-01

    The RAG recombinase (RAG1/2) plays an essential role in adaptive immunity by mediating V(D)J recombination in developing lymphocytes. In contrast, aberrant RAG1/2 activity promotes lymphocyte malignancies by causing chromosomal translocations and DNA deletions at cancer genes. RAG1/2 can also induce genomic DNA insertions by transposition and trans-V(D)J recombination, but only few such putative events have been documented in vivo. We used next-generation sequencing techniques to examine chromosomal rearrangements in primary murine B cells and discovered that RAG1/2 causes aberrant insertions by releasing cleaved antibody gene fragments that subsequently reintegrate into DNA breaks induced on a heterologous chromosome. We confirmed that RAG1/2 also mobilizes genomic DNA into independent physiological breaks by identifying similar insertions in human lymphoma and leukemia. Our findings reveal a novel RAG1/2-mediated insertion pathway distinct from DNA transposition and trans-V(D)J recombination that destabilizes the genome and shares features with reported oncogenic DNA insertions. PMID:28179379

  15. High Mobility of Flap Endonuclease 1 and DNA Polymerase η Associated with Replication Foci in Mammalian S-Phase NucleusD⃞

    PubMed Central

    Solovjeva, Lioudmila; Svetlova, Maria; Sasina, Lioudmila; Tanaka, Kyoji; Saijo, Masafumi; Nazarov, Igor; Bradbury, Morton; Tomilin, Nikolai

    2005-01-01

    Originally detected in fixed cells, DNA replication foci (RFi) were later visualized in living cells by using green fluorescent protein (GFP)-tagged proliferating cell nuclear antigen (PCNA) and DNA ligase I. It was shown using fluorescence redistribution after photobleaching (FRAP) assay that focal GFP-PCNA slowly exchanged, suggesting the existence of a stable replication holocomplex. Here, we used the FRAP assay to study the dynamics of the GFP-tagged PCNA-binding proteins: Flap endonuclease 1 (Fen1) and DNA polymerase η (Polη). We also used the GFP-Cockayne syndrome group A (CSA) protein, which does associate with transcription foci after DNA damage. In normal cells, GFP-Polη and GFP-Fen1 are mobile with residence times at RFi (tm) ∼2 and ∼0.8 s, respectively. GFP-CSA is also mobile but does not concentrate at discrete foci. After methyl methanesulfonate (MMS) damage, the mobile fraction of focal GFP-Fen1 decreased and tm increased, but it then recovered. The mobilities of focal GFP-Polη and GFP-PCNA did not change after MMS. The mobility of GFP-CSA did not change after UV-irradiation. These data indicate that the normal replication complex contains at least two mobile subunits. The decrease of the mobile fraction of focal GFP-Fen1 after DNA damage suggests that Fen1 exchange depends on the rate of movement of replication forks. PMID:15758026

  16. Conductivity and electrophoretic mobility of dilute ionic solutions.

    PubMed

    Allison, Stuart; Wu, Hengfu; Twahir, Umar; Pei, Hongxia

    2010-12-01

    Two complementary continuum theories of electrokinetic transport are examined with particular emphasis on the equivalent conductance of binary electrolytes. The "small ion" model [R.M. Fuoss, L. Onsager, J. Phys. Chem. 61 (1957) 668] and "large ion" model [R.W. O'Brien, L.R. White, J. Chem. Soc. Faraday Trans. 2 (74) (1978) 1607] are both discussed and the "large ion" model is generalized to include an ion exclusion distance and to account in a simple but approximate way for the Brownian motion of all ions present. In addition, the "large ion" model is modified to treat "slip" hydrodynamic boundary conditions in addition to the standard "stick" boundary condition. Both models are applied to the equivalent conductance of dilute KCl, MgCl(2), and LaCl(3) solutions and both are able to reproduce experimental conductances to within an accuracy of several tenths of a percent. Despite fundamental differences in the "small ion" and "large ion" theories, they both work equally well in this application. In addition, both "stick-large ion" and "slip-large ion" models are equally capable of accounting for the equivalent conductances of the three electrolyte solutions.

  17. Electrophoretic mobility of magnetite particles in high temperature water

    SciTech Connect

    Vidojkovic, Sonja; Rodriguez-Santiago, V; Fedkin, Mark V.; Wesolowski, David J; Lvov, Serguei N.

    2011-01-01

    Magnetite(Fe3O4) isoneofthemostcommonoxidesformingdepositsandparticulatephasesin industrialhightemperaturewatercircuits.Itscolloidalcharacteristicsplayaprincipalroleinthe mechanismofdepositformationandcanbeusedascontrollingfactorstopreventorminimizedeposit formationanddamageofindustrialpipelinesduetounder-depositcorrosion.Inthisstudy,ahigh temperatureparticleelectrophoresistechniquewasemployedtomeasurethezetapotentialatthe magnetite/waterinterface the parameterthatcontrolscolloidalstabilityofparticles,theiraggrega- tion, anddeposition.Themeasurementsweremadeattemperaturesupto200 1C overawiderangeofpH. The isoelectricpointsofmagnetite,atwhichthedepositionofparticlesisincreased,weredeterminedatpH 6.35, 6.00,5.25,and5.05fortemperatures25,100,150,and200 1C, respectively.Theobserved temperaturedependenceofzetapotentialandtheisoelectricpHpointofmagnetitecanhelptoexplain the extentofinteractionsbetweenthecolloidalparticlesandthesteelwallsurfacesunderhydro- thermalconditions,andindicatemethodsforcontrollingandmitigatingoxidedepositioninhigh temperaturewatercycles.

  18. Electrophoretic identification of poritid species ( Anthozoa: Scleractinia)

    NASA Astrophysics Data System (ADS)

    Garthwaite, R. L.; Potts, D. C.; Veron, J. E. N.; Done, T. J.

    1994-01-01

    Electrophoretic surveys of 13 enzyme-coding loci distinguished unambiguously five morphologically defined species of Porites and two species of Goniopora. Each species was identifiable solely by unique, qualitative banding patterns at 1 6 loci. Genetic distances give preliminary estimates that these Porites species diverged from common ancestors 8 22 Ma during the Miocene, and that the two Goniopora species diverged about 3.5 Ma in the Pliocene, assuming Porites evolved from Goniopora 55 million years ago (Ma).

  19. Characterization and DNA sequence of the mobilization region of pLV22a from Bacteroides fragilis.

    PubMed

    Novicki, T J; Hecht, D W

    1995-08-01

    A 4.2-kb plasmid (pLV22a) native to Bacteroides fragilis LV22 became fused to a transfer-deficient Bacteroides spp.-Escherichia coli shuttle vector by an inverse transposition event, resulting in a transferrable phenotype. The transfer phenotype was attributable to pLV22a, which was also capable of mobilization within E. coli when coresident with the IncP beta R751 plasmid. Transposon mutagenesis with Tn1000 localized the mobilization region to a 1.5-kb DNA segment in pLV22a. The mobilization region has been sequenced, and five open reading frames have been identified. Mutants carrying disruptions in any of the three genes designated mbpA, mbpB, and mbpC and coding for deduced products of 11.3, 30.4, and 17.1 kDa, respectively, cannot be mobilized when coresident with R751. Mutations in all three genes can be complemented in the presence of the respective wild-type genes, indicating that the products of mbpA, mbpB, and mbpC have roles in the mobilization process and function in trans. The deduced 30.4-kDa MbpB protein contains a 14-amino-acid conserved motif that is also found in the DNA relaxases of a variety of conjugal and mobilizable plasmids and the conjugative transposon Tn4399. Deletion analysis and complementation experiments have localized a cis-acting region of pLV22a within mbpA.

  20. Characterization and DNA sequence of the mobilization region of pLV22a from Bacteroides fragilis.

    PubMed Central

    Novicki, T J; Hecht, D W

    1995-01-01

    A 4.2-kb plasmid (pLV22a) native to Bacteroides fragilis LV22 became fused to a transfer-deficient Bacteroides spp.-Escherichia coli shuttle vector by an inverse transposition event, resulting in a transferrable phenotype. The transfer phenotype was attributable to pLV22a, which was also capable of mobilization within E. coli when coresident with the IncP beta R751 plasmid. Transposon mutagenesis with Tn1000 localized the mobilization region to a 1.5-kb DNA segment in pLV22a. The mobilization region has been sequenced, and five open reading frames have been identified. Mutants carrying disruptions in any of the three genes designated mbpA, mbpB, and mbpC and coding for deduced products of 11.3, 30.4, and 17.1 kDa, respectively, cannot be mobilized when coresident with R751. Mutations in all three genes can be complemented in the presence of the respective wild-type genes, indicating that the products of mbpA, mbpB, and mbpC have roles in the mobilization process and function in trans. The deduced 30.4-kDa MbpB protein contains a 14-amino-acid conserved motif that is also found in the DNA relaxases of a variety of conjugal and mobilizable plasmids and the conjugative transposon Tn4399. Deletion analysis and complementation experiments have localized a cis-acting region of pLV22a within mbpA. PMID:7635830

  1. A unified mathematical theory of electrophoretic processes

    NASA Technical Reports Server (NTRS)

    Bier, M.; Palusinski, O. A.; Mosher, R. A.; Graham, A.; Saville, D. A.

    1983-01-01

    A mathematical theory is presented which shows that each of the four classical electrophoretic modes (zone electrophoresis, moving boundary electrophoresis, isotachophoresis, and isoelectric focusing) is based on the same general principles and can collectively be described in terms of a single set of equations. This model can predict the evolution of the four electrophoretic modes as a function of time. The model system is one-dimensional, neglecting the effects of electroosmosis, temperature gradients, and any bulk flows of liquid. The model is based on equations which express the components' dissociation equilibria, the mass transport due to electromigration and diffusion, electroneutrality, and the conservation of mass and charge. The model consists of a system of coupled partial differential and nonlinear algebraic equations which can be solved numerically by use of a computer. The versatility of this model was verified using an example of a three-component system containing cacodylate, tris hydroxylmethylaminomethane, and histidine. Results show that this model not only correctly predicts the characteristic features of each electrophoretic mode, but also gives details of the concentration, pH, and conductivity profiles not easily amenable to direct experimental measurement.

  2. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair.

    PubMed

    Pellarin, Ilenia; Arnoldo, Laura; Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens.

  3. The Architectural Chromatin Factor High Mobility Group A1 Enhances DNA Ligase IV Activity Influencing DNA Repair

    PubMed Central

    Costantini, Silvia; Pegoraro, Silvia; Ros, Gloria; Penzo, Carlotta; Triolo, Gianluca; Demarchi, Francesca; Sgarra, Riccardo; Vindigni, Alessandro; Manfioletti, Guidalberto

    2016-01-01

    The HMGA1 architectural transcription factor is an oncogene overexpressed in the vast majority of human cancers. HMGA1 is a highly connected node in the nuclear molecular network and the key aspect of HMGA1 involvement in cancer development is that HMGA1 simultaneously confers cells multiple oncogenic hits, ranging from global chromatin structural and gene expression modifications up to the direct functional alterations of key cellular proteins. Interestingly, HMGA1 also modulates DNA damage repair pathways. In this work, we provide evidences linking HMGA1 with Non-Homologous End Joining DNA repair. We show that HMGA1 is in complex with and is a substrate for DNA-PK. HMGA1 enhances Ligase IV activity and it counteracts the repressive histone H1 activity towards DNA ends ligation. Moreover, breast cancer cells overexpressing HMGA1 show a faster recovery upon induction of DNA double-strand breaks, which is associated with a higher survival. These data suggest that resistance to DNA-damaging agents in cancer cells could be partially attributed to HMGA1 overexpression thus highlighting the relevance of considering HMGA1 expression levels in the selection of valuable and effective pharmacological regimens. PMID:27723831

  4. Nickel-alumina composites and graded materials by electrophoretic deposition

    NASA Astrophysics Data System (ADS)

    Nagarajan, Nandakumar

    2005-07-01

    Nickel/Alumina composites and functionally-graded-materials (FGMs) were fabricated by the electrophoretic-deposition (EPD). NiO-Al 2O3 mixed suspensions were used rather than Ni-Al2O 3 since oxide powders are more stable in suspension and have higher electrophoretic mobilities than metals. The NiO reduced during sintering and the desired Ni-Al2O3 composites and graded materials formed. The EPD of FGMs was carried out in a flow-through cell, the NiO flow rate being varied to obtain different composition profiles. A model for the constant-current EPD of FGMs was developed via a continuously-stirred-tank-reactor approach thereby predicting composition profiles as a function of the deposition parameters. A single experimentally-measured parameter, k' was all the input necessary. The model predicted gradient profiles for different NiO inlet-stream flow rates, that agreed with the experimental profiles obtained. A systematic study of a dispersant-binder system (Phosphate-Ester/Poly-vinyl Butyral) was carried out to ensure crack-free, thick deposits. The binder/dispersant addition was optimized by balancing suspension-conductivity, rate-of-deposition and freedom from cracks. A pressureless sintering technique was developed incorporating a sintering aid (TiO2) to give dense, strong and tough composites. Ni-Al 2O3 composites with varying Ni content were fabricated. A mechanism was proposed for the reduction-sintering process and the improved flexural strength and fracture-toughness of the Ni-Al2O3 composites reported.

  5. Development of microfluidic modules for DNA purification via phenol extraction and analyte concentration using transverse electrokinetics

    NASA Astrophysics Data System (ADS)

    Morales, Mercedes C.

    In this work, microfluidic platforms have been designed and evaluated to demonstrate microscale DNA purification via organic (phenol) extraction as well as analyte trapping and concentration using a transverse electrokinetic force balance. First, in order to evaluate DNA purification via phenol extraction in a microdevice, an aqueous phase containing protein and DNA and an immiscible receiving organic phase were utilized to evaluate microfluidic DNA extraction under both stratified and droplet-based flow conditions using a serpentine microfluidic device. The droplet based flow resulted in a significant improvement of protein partitioning from the aqueous phase due to the flow recirculation inside each droplet improving material convective transport into the organic phase. The plasmid recovery from bacterial lysates using droplet-based flow was high (>92%) and comparable to the recovery achieved using commercial DNA purification kits and standard macroscale phenol extraction. Second, a converging Y-inlet microfluidic channel with integrated coplanar electrodes was used to investigate transverse DNA and protein migration under uniform direct current (DC) electric fields. Negatively charged samples diluted in low and high ionic strength buffers were co-infused with a receiving buffer of the same ionic strength into a main channel where transverse electric fields were applied. Experimental results demonstrated that charged analytes could traverse the channel width and accumulate at the positive bias electrode in a low electroosmotic mobility and high electrophoretic mobility condition (high ionic strength buffer) or migrated towards an equilibrium position within the channel when both electroosmotic mobility and electrophoretic mobility are high (low ionic strength buffer). The different behaviors are the result of a balance between the electrophoretic force and a drag force induced by a recirculating electroosmotic flow generated across the channel width due to the

  6. Heritable alteration in DNA methylation pattern occurred specifically at mobile elements in rice plants following hydrostatic pressurization.

    PubMed

    Long, Likun; Lin, Xiuyun; Zhai, Jinzuo; Kou, Hongping; Yang, Wei; Liu, Bao

    2006-02-10

    Intrinsic DNA methylation pattern is an integral component of the epigenetic network in many eukaryotes. Exploring the extent to which DNA methylation patterns can be altered under a specific condition is important for elucidating the biological functions of this epigenetic modification. This is of added significance in plants wherein the newly acquired methylation patterns can be inherited through organismal generations. We report here that DNA methylation patterns of mobile elements but not of cellular genes were specifically altered in rice plants following hydrostatic pressurization. This was evidenced by methylation-sensitive gel-blot analysis, which showed that 10 out of 10 studied low-copy transposons and retrotransposons manifested methylation alteration in at least one of the 8 randomly chosen pressure-treated plants, whereas none of the 16 studied low-copy cellular genes showed any change. Both gel-blotting and genome-wide fingerprinting indicated that the methylation alteration in mobile elements was not accompanied by a general genetic instability. Progeny analysis indicated retention of the altered methylation patterns in most progeny plants, underscoring early occurrence of the alterations, and their faithful epigenetic inheritance.

  7. Mobile DNA in cancer. Extensive transduction of nonrepetitive DNA mediated by L1 retrotransposition in cancer genomes.

    PubMed

    Tubio, Jose M C; Li, Yilong; Ju, Young Seok; Martincorena, Inigo; Cooke, Susanna L; Tojo, Marta; Gundem, Gunes; Pipinikas, Christodoulos P; Zamora, Jorge; Raine, Keiran; Menzies, Andrew; Roman-Garcia, Pablo; Fullam, Anthony; Gerstung, Moritz; Shlien, Adam; Tarpey, Patrick S; Papaemmanuil, Elli; Knappskog, Stian; Van Loo, Peter; Ramakrishna, Manasa; Davies, Helen R; Marshall, John; Wedge, David C; Teague, Jon W; Butler, Adam P; Nik-Zainal, Serena; Alexandrov, Ludmil; Behjati, Sam; Yates, Lucy R; Bolli, Niccolo; Mudie, Laura; Hardy, Claire; Martin, Sancha; McLaren, Stuart; O'Meara, Sarah; Anderson, Elizabeth; Maddison, Mark; Gamble, Stephen; Foster, Christopher; Warren, Anne Y; Whitaker, Hayley; Brewer, Daniel; Eeles, Rosalind; Cooper, Colin; Neal, David; Lynch, Andy G; Visakorpi, Tapio; Isaacs, William B; van't Veer, Laura; Caldas, Carlos; Desmedt, Christine; Sotiriou, Christos; Aparicio, Sam; Foekens, John A; Eyfjörd, Jórunn Erla; Lakhani, Sunil R; Thomas, Gilles; Myklebost, Ola; Span, Paul N; Børresen-Dale, Anne-Lise; Richardson, Andrea L; Van de Vijver, Marc; Vincent-Salomon, Anne; Van den Eynden, Gert G; Flanagan, Adrienne M; Futreal, P Andrew; Janes, Sam M; Bova, G Steven; Stratton, Michael R; McDermott, Ultan; Campbell, Peter J

    2014-08-01

    Long interspersed nuclear element-1 (L1) retrotransposons are mobile repetitive elements that are abundant in the human genome. L1 elements propagate through RNA intermediates. In the germ line, neighboring, nonrepetitive sequences are occasionally mobilized by the L1 machinery, a process called 3' transduction. Because 3' transductions are potentially mutagenic, we explored the extent to which they occur somatically during tumorigenesis. Studying cancer genomes from 244 patients, we found that tumors from 53% of the patients had somatic retrotranspositions, of which 24% were 3' transductions. Fingerprinting of donor L1s revealed that a handful of source L1 elements in a tumor can spawn from tens to hundreds of 3' transductions, which can themselves seed further retrotranspositions. The activity of individual L1 elements fluctuated during tumor evolution and correlated with L1 promoter hypomethylation. The 3' transductions disseminated genes, exons, and regulatory elements to new locations, most often to heterochromatic regions of the genome.

  8. Mobile phone radiation induces mode-dependent DNA damage in a mouse spermatocyte-derived cell line: a protective role of melatonin.

    PubMed

    Liu, Chuan; Gao, Peng; Xu, Shang-Cheng; Wang, Yuan; Chen, Chun-Hai; He, Min-Di; Yu, Zheng-Ping; Zhang, Lei; Zhou, Zhou

    2013-11-01

    To evaluate whether exposure to mobile phone radiation (MPR) can induce DNA damage in male germ cells. A mouse spermatocyte-derived GC-2 cell line was exposed to a commercial mobile phone handset once every 20 min in standby, listen, dialed or dialing modes for 24 h. DNA damage was determined using an alkaline comet assay. The levels of DNA damage were significantly increased following exposure to MPR in the listen, dialed and dialing modes. Moreover, there were significantly higher increases in the dialed and dialing modes than in the listen mode. Interestingly, these results were consistent with the radiation intensities of these modes. However, the DNA damage effects of MPR in the dialing mode were efficiently attenuated by melatonin pretreatment. These results regarding mode-dependent DNA damage have important implications for the safety of inappropriate mobile phone use by males of reproductive age and also suggest a simple preventive measure: Keeping mobile phones as far away from our body as possible, not only during conversations but during 'dialed' and 'dialing' operation modes. Since the 'dialed' mode is actually part of the standby mode, mobile phones should be kept at a safe distance from our body even during standby operation. Furthermore, the protective role of melatonin suggests that it may be a promising pharmacological candidate for preventing mobile phone use-related reproductive impairments.

  9. ProReg XL Tool: an easy-to-use computer tool suite for rapidly regrouping a large number of identical electrophoretic profiles.

    PubMed

    Massias, Bastien; Urdaci, Maria C

    2009-05-01

    The ProReg XL Tool (Profile Regrouping Excel Tool) is a new tool suite designed to rapidly regroup a large number of identical electrophoretic profiles. This tool suite is coded in Visual Basic Application for Microsoft Excel, and thus requires this spreadsheet software to operate. It was designed for use with a new screening strategy of clones from an rrs (16S rDNA) clone library, but it may also be helpful in other electrophoretic applications. ProReg XL Tool is organized in different steps where the user has the capability--in addition to regrouping electrophoretic profiles--to control gel quality, determine signal attenuation, and draw pie charts.

  10. Stretching and Controlled Motion of Single-Stranded DNA in Locally-Heated Solid-State Nanopores

    PubMed Central

    Belkin, Maxim; Maffeo, Christopher; Wells, David B.

    2013-01-01

    Practical applications of solid-state nanopores for DNA detection and sequencing require the electrophoretic motion of DNA through the nanopores to be precisely controlled. Controlling the motion of single-stranded DNA presents a particular challenge, in part because of the multitude of conformations that a DNA strand can adopt in a nanopore. Through continuum, coarse-grained and atomistic modeling, we demonstrate that local heating of the nanopore volume can be used to alter the electrophoretic mobility and conformation of single-stranded DNA. In the nanopore systems considered, the temperature near the nanopore is modulated via a nanometer-size heater element that can be radiatively switched on and off. The local enhancement of temperature produces considerable stretching of the DNA fragment confined within the nanopore. Such stretching is reversible, so that the conformation of DNA can be toggled between compact (local heating is off) and extended (local heating is on) states. The effective thermophoretic force acting on single-stranded DNA in the vicinity of the nanopore is found to be sufficiently large (4–8 pN) to affect such changes in the DNA conformation. The local heating of the nanopore volume is observed to promote single-file translocation of DNA strands at transmembrane biases as low as 10 mV, which opens new avenues for using solid-state nanopores for detection and sequencing of DNA. PMID:23876013

  11. The RmInt1 group II intron has two different retrohoming pathways for mobility using predominantly the nascent lagging strand at DNA replication forks for priming

    PubMed Central

    Martínez-Abarca, Francisco; Barrientos-Durán, Antonio; Fernández-López, Manuel; Toro, Nicolás

    2004-01-01

    Sinorhizobium meliloti RmInt1 is an efficient mobile group II intron that uses an unknown reverse transcriptase priming mechanism as the intron ribonucleoprotein complex can reverse splice into DNA target substrates but cannot carry out site-specific second strand cleavage due to the lack of a C- terminal DNA endonuclease domain. We show here that, like other mobile group II introns, RmInt1 moves around by an efficient RNA-based retrohoming mechanism. We found evidence of two distinct RmInt1 retrohoming pathways for mobility depending on the orientation of the target site relative to the direction of DNA replication. The preferred retrohoming pathway is consistent with reverse splicing of the intron RNA into single-stranded DNA at a replication fork, using a nascent lagging DNA strand as the primer for reverse transcription. This strand bias is the opposite of that reported for mobility of the lactococcal Ll.ltrB intron in the absence of second strand cleavage. The mobility mechanism found here for RmInt1 may be used for dissemination by many bacterial group II introns encoding proteins lacking the DNA endonuclease domain. PMID:15155857

  12. Electrophoretic separation of reptilian skeletal and cardiac muscle myosin heavy chain isoforms: dependence on gel format.

    PubMed

    Reiser, Peter J; Bicer, Sabahattin

    2014-09-01

    This report provides a comparison of multiple gel formats to study myosin heavy chain (MHC) isoforms that are expressed in reptilian skeletal and cardiac muscles of five turtle species, water monitor, and prehensile tailed skink. Three gel formats were tested. The results identify one format that is superior, for the overall extent of electrophoretic separation and for the assessment of the number of MHC isoforms in reptilian striated muscles. The same format was shown previously to separate MHC isoforms that are expressed in American alligator. The results also show that another gel format reveals the distinct electrophoretic mobility of MHC isoforms in atrial, ventricular, and jaw adductor samples, compared to those expressed in skeletal muscles in the limbs and elsewhere in the body. In addition, the results reveal that the electrophoretic mobility of specific MHC isoforms, relative to other isoforms, depends on the gel format, as shown previously for mammalian and avian species. The discovery of the expression of masticatory MHC, which is abundantly expressed in jaw adductors of members of Carnivora and several other vertebrate orders, in the homologous muscles of prehensile tailed skink, an herbivore, and the carnivorous water monitor, was made during the course of this study. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Characterizing and controlling the motion of ssDNA in a solid-state nanopore.

    PubMed

    Luan, Binquan; Martyna, Glenn; Stolovitzky, Gustavo

    2011-11-02

    Sequencing DNA in a synthetic solid-state nanopore is potentially a low-cost and high-throughput method. Essential to the nanopore-based DNA sequencing method is the ability to control the motion of a single-stranded DNA (ssDNA) molecule at single-base resolution. Experimental studies showed that the average translocation speed of DNA driven by a biasing electric field can be affected by ionic concentration, solvent viscosity, or temperature. Even though it is possible to slow down the average translocation speed, instantaneous motion of DNA is too diffusive to allow each DNA base to stay in front of a sensor site for its measurement. Using extensive all-atom molecular dynamics simulations, we study the diffusion constant, friction coefficient, electrophoretic mobility, and effective charge of ssDNA in a solid-state nanopore. Simulation results show that the spatial fluctuation of ssDNA in 1 ns is comparable to the spacing between neighboring nucleotides in ssDNA, which makes the sensing of a DNA base very difficult. We demonstrate that the recently proposed DNA transistor could potentially solve this problem by electrically trapping ssDNA inside the DNA transistor and ratcheting ssDNA base-by-base in a biasing electric field. When increasing the biasing electric field, we observed that the translocation of ssDNA changes from ratcheting to steady-sliding. The simulated translocation of ssDNA in the DNA transistor was theoretically characterized using Fokker-Planck analysis.

  14. Gel Electrophoresis of Gold-DNA Nanoconjugates

    DOE PAGES

    Pellegrino, T.; Sperling, R. A.; Alivisatos, A. P.; ...

    2007-01-01

    Gold-DNA conjugates were investigated in detail by a comprehensive gel electrophoresis study based on 1200 gels. A controlled number of single-stranded DNA of different length was attached specifically via thiol-Au bonds to phosphine-stabilized colloidal gold nanoparticles. Alternatively, the surface of the gold particles was saturated with single stranded DNA of different length either specifically via thiol-Au bonds or by nonspecific adsorption. From the experimentally determined electrophoretic mobilities, estimates for the effective diameters of the gold-DNA conjugates were derived by applying two different data treatment approaches. The first method is based on making a calibration curve for the relation between effectivemore » diameters and mobilities with gold nanoparticles of known diameter. The second method is based on Ferguson analysis which uses gold nanoparticles of known diameter as reference database. Our study shows that effective diameters derived from gel electrophoresis measurements are affected with a high error bar as the determined values strongly depend on the method of evaluation, though relative changes in size upon binding of molecules can be detected with high precision. Furthermore, in this study, the specific attachment of DNA via gold-thiol bonds to Au nanoparticles is compared to nonspecific adsorption of DNA. Also, the maximum number of DNA molecules that can be bound per particle was determined.« less

  15. The effect of pH on charge inversion and condensation of DNA.

    PubMed

    Guo, Zilong; Wang, Yanwei; Yang, Anthony; Yang, Guangcan

    2016-08-21

    Charge inversion and condensation of DNA in solutions of trivalent and quadrivalent counterions are significantly influenced by the pH value of the solution. We systematically investigated the condensation and charge compensation of DNA by spermidine, hexammine cobalt(iii) (cohex, [Co(NH3)6](3+)) and spermine in solutions of a wide range of pH values from 3 to 9.3 by dynamic light scattering, magnetic tweezers, and atomic force microscopy. In trivalent counterion solution, we found that there is a critical concentration (0.75 mM for cohex and 0.5 mM for spermidine), under which the electrophoresis mobility of DNA initially increases, reaches a maximum, and finally decreases when the pH value is decreased. In contrast, above the critical concentration, the electrophoretic mobility of DNA increases monotonously with decreasing pH value of the solution. The corresponding condensing force has the same dependence on the pH value. However, for the case of quadrivalent counterions, the electrophoretic mobility of DNA is monotonously promoted by lowering the pH value of the solution at any concentration of counterions in which charge inversion of DNA may occur. In atomic force microscopy images and force spectroscopy of magnetic tweezers, we found that maximal charge neutralization and condensation force correspond to the most compact DNA condensation. We propose a mechanism of promoting DNA charge neutralization: small and highly mobile hydrogen ions tend to attach to the DNA-counterion complex to further neutralize its remaining charge, which is related to the surface area of the complex. Therefore, this further neutralization is prominent when the complex is toroidal which corresponds to the case of mild ion concentration while it is less prominent for more compact globules or rod complexes at high counterion concentration.

  16. Rationally designed coiled-coil DNA looping peptides control DNA topology

    PubMed Central

    Gowetski, Daniel B.; Kodis, Erin J.; Kahn, Jason D.

    2013-01-01

    Artificial DNA looping peptides were engineered to study the roles of protein and DNA flexibility in controlling the geometry and stability of protein-mediated DNA loops. These LZD (leucine zipper dual-binding) peptides were derived by fusing a second, C-terminal, DNA-binding region onto the GCN4 bZip peptide. Two variants with different coiled-coil lengths were designed to control the relative orientations of DNA bound at each end. Electrophoretic mobility shift assays verified formation of a sandwich complex containing two DNAs and one peptide. Ring closure experiments demonstrated that looping requires a DNA-binding site separation of 310 bp, much longer than the length needed for natural loops. Systematic variation of binding site separation over a series of 10 constructs that cyclize to form 862-bp minicircles yielded positive and negative topoisomers because of two possible writhed geometries. Periodic variation in topoisomer abundance could be modeled using canonical DNA persistence length and torsional modulus values. The results confirm that the LZD peptides are stiffer than natural DNA looping proteins, and they suggest that formation of short DNA loops requires protein flexibility, not unusual DNA bendability. Small, stable, tunable looping peptides may be useful as synthetic transcriptional regulators or components of protein–DNA nanostructures. PMID:23825092

  17. Genetic population structure and mobility of two nectar-feeding bats from Venezuelan deserts: inferences from mitochondrial DNA.

    PubMed

    Newton, Lyndsay R; Nassar, Jafet M; Fleming, Theodore H

    2003-11-01

    Glossophaga longirostris and Leptonycteris curasoae are nectar-feeding bats associated with arid zones in northern South America. Despite their close phylogenetic relationship, sympatric condition and niche similarities, morphological and ecological evidence suggest that these species differ in dispersal capabilities. Using mitochondrial DNA, we tested the hypothesis that these species exhibit different levels of population structure that are congruent with their particular movement capabilities. We sequenced a section of the control region of mtDNA for 41 G. longirostris and 42 L. curasoae from 11 zones in Venezuela. Population subdivision in G. longirostris (FST = 0.725) was considerably higher than in L. curasoae (FST = 0.167). L. curasoae individuals shared haplotypes at greater distances (812 km) than G. longirostris (592 km). Our results offer preliminary evidence for one of two possible scenarios, either greater mobility in L. curasoae or a higher degree of female philopatry in G. longirostris.

  18. Scanning and storage of electrophoretic records

    DOEpatents

    McKean, Ronald A.; Stiegman, Jeff

    1990-01-01

    An electrophoretic record that includes at least one gel separation is mounted for motion laterally of the separation record. A light source is positioned to illuminate at least a portion of the record, and a linear array camera is positioned to have a field of view of the illuminated portion of the record and orthogonal to the direction of record motion. The elements of the linear array are scanned at increments of motion of the record across the field of view to develop a series of signals corresponding to intensity of light at each element at each scan increment.

  19. Electrophoretic Migration and Axial Diffusion of Individual Nanoparticles in Cylindrical Nanopores

    SciTech Connect

    Han, Rui; Wang, Gufeng; Qi, Shengda; Ma, Changbei; Yeung, Edward S.

    2012-08-01

    Membranes with straight, vertical nanopores have found widespread applications in chemical and biological sciences, including separation, detection, catalysis, and drug delivery. They can also serve as a model system to understand molecular behavior and fundamental mechanisms of separation, bridging the gap between conventional model systems such as flat surfaces and real chromatographic stationary phases such as micrometer-sized porous particles. We recently found that the axial motion of individual biomolecules inside nanopores can be significantly slower than in bulk solution. This suggests that either chromatographic adsorption was present and/or the viscosity inside the nanopores was unusually high. In this study, we measured the electrophoretic motion as well as the axial diffusion of individual nanoparticles in cylindrical alumina nanopores. We found that the electrophoretic mobilities and the diffusion coefficients of polystyrene nanoparticles were both substantially smaller compared to bulk solution independent of particle size or pore diameter. The results imply that the apparent solution viscosity in nanodomains is anomalous.

  20. Preparation and surface encapsulation of hollow TiO nanoparticles for electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Zhao, Qian; Tan, Tingfeng; Qi, Peng; Wang, Shirong; Bian, Shuguang; Li, Xianggao; An, Yong; Liu, Zhaojun

    2011-02-01

    Hollow black TiO nanosparticles were obtained via deposition of inorganic coating on the surface of hollow core-shell polymer latex with Ti(OBu)4 as precursor and subsequent calcination in ammonia gas. Hollow TiO particles were characterized by scanning electron microscope, transmission electronic microscopy, X-ray diffraction, and thermogravimetric analysis. Encapsulation of TiO via dispersion polymerization was promoved by pretreating the pigments with 3-(trimethoxysilyl) propyl methacrylate, making it possible to prepare hollow TiO-polymer particles. When St and DVB were used as polymerization monomer, hollow TiO-polymer core-shell particles came into being via dispersion polymerization, and the lipophilic degree is 28.57%. Glutin-arabic gum microcapsules containing TiO-polymer particles electrophoretic liquid were prepared using via complex coacervation. It was founded that hollow TiO-polymer particles had enough electrophoretic mobility after coating with polymer.

  1. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study.

    PubMed

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-11-09

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure-activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  2. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    PubMed Central

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  3. Polyacrylamide medium for the electrophoretic separation of biomolecules

    DOEpatents

    Madabhushi, Ramakrishna S.; Gammon, Stuart A.

    2003-11-11

    A polyacryalmide medium for the electrophoretic separation of biomolecules. The polyacryalmide medium comprises high molecular weight polyacrylamides (PAAm) having a viscosity average molecular weight (M.sub.v) of about 675-725 kDa were synthesized by conventional red-ox polymerization technique. Using this separation medium, capillary electrophoresis of BigDye DNA sequencing standard was performed. A single base resolution of .about.725 bases was achieved in .about.60 minute in a non-covalently coated capillary of 50 .mu.m i.d., 40 cm effective length, and a filed of 160 V/cm at 40.degree. C. The resolution achieved with this formulation to separate DNA under identical conditions is much superior (725 bases vs. 625 bases) and faster (60 min. vs. 75 min.) to the commercially available PAAm, such as supplied by Amersham. The formulation method employed here to synthesize PAAm is straight-forward, simple and does not require cumbersome methods such as emulsion polymerizaiton in order to achieve very high molecular weights. Also, the formulation here does not require separation of PAAm from the reaction mixture prior to reconstituting the polymer to a final concentration. Furthermore, the formulation here is prepared from a single average mol. wt. PAAm as opposed to the mixture of two different average mo. wt. PAAm previously required to achieve high resolution.

  4. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation.

    PubMed

    Kim, Jinho; Olsen, Timothy R; Zhu, Jing; Hilton, John P; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N; Lin, Qiao

    2016-05-24

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  5. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    NASA Astrophysics Data System (ADS)

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-05-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours.

  6. Integrated Microfluidic Isolation of Aptamers Using Electrophoretic Oligonucleotide Manipulation

    PubMed Central

    Kim, Jinho; Olsen, Timothy R.; Zhu, Jing; Hilton, John P.; Yang, Kyung-Ae; Pei, Renjun; Stojanovic, Milan N.; Lin, Qiao

    2016-01-01

    We present a microfluidic approach to integrated isolation of DNA aptamers via systematic evolution of ligands by exponential enrichment (SELEX). The approach employs a microbead-based protocol for the processes of affinity selection and amplification of target-binding oligonucleotides, and an electrophoretic DNA manipulation scheme for the coupling of these processes, which are required to occur in different buffers. This achieves the full microfluidic integration of SELEX, thereby enabling highly efficient isolation of aptamers in drastically reduced times and with minimized consumption of biological material. The approach as such also offers broad target applicability by allowing selection of aptamers with respect to targets that are either surface-immobilized or solution-borne, potentially allowing aptamers to be developed as readily available affinity reagents for a wide range of targets. We demonstrate the utility of this approach on two different procedures, respectively for isolating aptamers against a surface-immobilized protein (immunoglobulin E) and a solution-phase small molecule (bisboronic acid in the presence of glucose). In both cases aptamer candidates were isolated in three rounds of SELEX within a total process time of approximately 10 hours. PMID:27217242

  7. Electrophoretic Porosimetry of Sol-Gels

    NASA Technical Reports Server (NTRS)

    Snow, L. A.; Smith, D. D.; Sibille, L.; Hunt, A. J.; Ng, J.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    It has been hypothesized that gravity has an effect on the formation and resulting microstructure of sol-gels. In order to more clearly resolve the effect of gravity, pores may be non-destructively analyzed in the wet gel, circumventing the shrinkage and coarsening associated with the drying procedure. We discuss the development of an electrophoretic technique, analogous to affinity chromatography, for the determination of pore size distribution and its application to silica gels. Specifically a monodisperse charged dye is monitored by an optical densitometer as it moves through the wet gel under the influence of an electric field. The transmittance data (output) represents the convolution of the dye concentration profile at the beginning of the run (input) with the pore size distribution (transfer function), i.e. linear systems theory applies. Because of the practical difficulty in producing a delta function input dye profile we prefer instead to use a step function. Average pore size is then related to the velocity of this dye front, while the pore size distribution is related to the spreading of the front. Preliminary results of this electrophoretic porosimetry and its application to ground and space-grown samples will be discussed.

  8. Development of an electrophoretic image display

    NASA Astrophysics Data System (ADS)

    Liebert, R.; Lalak, J.; Wittig, K.

    1980-05-01

    The purpose of this work is to develop a 350 x 600 element X-Y addressed ElectroPhoretic Image Display (EPID). Development of the fabrication techniques for this display continues. Near-perfect seals between the substrate and grid dielectric were obtained. Ion-beam milling of Mylar in 70% oxygen: 30% argon has eliminated operational difficulties encountered with pure oxygen. No change in either the absolute or differential milling rates was observed as a result of the addition of the argon to the oxygen. Several tests have confirmed the compatibility between the materials used in fabricating the device and the components of the electrophoretic suspension. Digitization and ordering of the photolithographic masks for the 512 character display is complete. Design of the display electronics and packaging are in progress. A microprocessor interfaced to the IEEE-488 bus and an ASCII-to-5x7 character generator will provide the necessary signals to the integrated row and column drivers. The display will be mounted, using conductive elastomer interconnections, to a printed circuit board which will provide sockets for connection of the cables form the electronics package. This system will accept ASCII information from a computer connected to an IEEE-488 bus and display the printable information on the EPID as 16 lines of 32 characters each.

  9. Continuous-flow electrophoretic separator for biologicals

    NASA Technical Reports Server (NTRS)

    Mccreight, L. R.; Griffin, R. N.; Locker, R. J.

    1976-01-01

    In the near absence of gravity, a continuous-flow type of electrophoretic separator can be operated with a much thicker separation chamber than is possible under 1 g conditions. This should permit either better resolution or shorter separation time per unit of sample. An apparatus to perform experiments on sounding rockets is under development and will be described. The electrophoresis cell is 5 mm thick by 5 cm wide with 10 cm long electrodes. It is supplied with buffer, sample, and coolant at about 4 C through the use of a passive refrigerant system. UV sample detection and provision for recovery and cold storage of up to 50 sample fractions are now being added to the basic unit. A wide range of operating conditions are electronically programmable into the unit, even up to a short time before flight, and a further range of some parameters can be achieved by exchanging power supplies and by changing gears in the motor drive units of the pump. The preliminary results of some separation studies on various biological products using a commercially available electrophoretic separator are also presented.

  10. Electrophoretic Porosimetry of Sol-Gels

    NASA Technical Reports Server (NTRS)

    Snow, L. A.; Smith, D. D.; Sibille, L.; Hunt, A. J.; Ng, J.; Rose, M. Franklin (Technical Monitor)

    2000-01-01

    It has been hypothesized that gravity has an effect on the formation and resulting microstructure of sol-gels. In order to more clearly resolve the effect of gravity, pores may be non-destructively analyzed in the wet gel, circumventing the shrinkage and coarsening associated with the drying procedure. We discuss the development of an electrophoretic technique, analogous to affinity chromatography, for the determination of pore size distribution and its application to silica gels. Specifically a monodisperse charged dye is monitored by an optical densitometer as it moves through the wet gel under the influence of an electric field. The transmittance data (output) represents the convolution of the dye concentration profile at the beginning of the run (input) with the pore size distribution (transfer function), i.e. linear systems theory applies. Because of the practical difficulty in producing a delta function input dye profile we prefer instead to use a step function. Average pore size is then related to the velocity of this dye front, while the pore size distribution is related to the spreading of the front. Preliminary results of this electrophoretic porosimetry and its application to ground and space-grown samples will be discussed.

  11. Applications of graphene electrophoretic deposition. A review.

    PubMed

    Chavez-Valdez, A; Shaffer, M S P; Boccaccini, A R

    2013-02-14

    This Review summarizes research progress employing electrophoretic deposition (EPD) to fabricate graphene and graphene-based nanostructures for a wide range of applications, including energy storage materials, field emission devices, supports for fuel cells, dye-sensitized solar cells, supercapacitors and sensors, among others. These carbonaceous nanomaterials can be dispersed in organic solvents, or more commonly in water, using a variety of techniques compatible with EPD. Most deposits are produced under constant voltage conditions with deposition time also playing an important role in determining the morphology of the resulting graphene structures. In addition to simple planar substrates, it has been shown that uniform graphene-based layers can be deposited on three-dimensional, porous, and even flexible substrates. In general, electrophoretically deposited graphene layers show excellent properties, e.g., high electrical conductivity, large surface area, good thermal stability, high optical transparency, and robust mechanical strength. EPD also enables the fabrication of functional composite materials, e.g., graphene combined with metallic nanoparticles, with other carbonaceous materials (e.g., carbon nanotubes) or polymers, leading to novel nanomaterials with enhanced optical and electrical properties. In summary, the analysis of the available literature reveals that EPD is a simple and convenient processing method for graphene and graphene-based materials, which is easy to apply and versatile. EPD has, therefore, a promising future for applications in the field of advanced nanomaterials, which depend on the reliable manipulation of graphene and graphene-containing systems.

  12. DNA Damage of Lymphocytes in Volunteers after 4 hours Use of Mobile Phone.

    PubMed

    Ji, Seonmi; Oh, Eunha; Sul, Donggeun; Choi, Jae Wook; Park, Heechan; Lee, Eunil

    2004-11-01

    There has been gradually increasing concern about the adverse health effects of electromagnetic radiation originating from cell phones which are widely used in modern life. Cell phone radiation may affect human health by increasing free radicals of human blood cells. This study has been designed to identify DNA damage of blood cells by electromagnetic radiation caused by cell phone use. This study investigated the health effect of acute exposure to commercially available cell phones on certain parameters such as an indicator of DNA damage for 14 healthy adult volunteers. Each volunteer during the experiment talked over the cell phone with the keypad facing the right side of the face for 4 hours. The single cell gel electrophoresis assay (Comet assay), which is very sensitive in detecting the presence of DNA strand-breaks and alkali-labile damage in individual cells, was used to assess peripheral blood cells (T-cells, B-cells, granulocytes) from volunteers before and after exposure to cell phone radiation. The parameters of Comet assay measured were Olive Tail Moment and Tail DNA %. The Olive Tail Moment of B-cells and granulocytes and Tail DNA % of B-cells and granulocytes were increased by a statistically significant extent after 4- hour use of a cell phone compared with controls. It is concluded that cell phone radiation caused the DNA damage during the 4 hours of experimental condition. Nonetheless, this study suggested that cell phone use may increase DNA damage by electromagnetic radiation and other contributing factors.

  13. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  14. B-DNA to Z-DNA structural transitions in the SV40 enhancer: stabilization of Z-DNA in negatively supercoiled DNA minicircles

    NASA Technical Reports Server (NTRS)

    Gruskin, E. A.; Rich, A.

    1993-01-01

    During replication and transcription, the SV40 control region is subjected to significant levels of DNA unwinding. There are three, alternating purine-pyrimidine tracts within this region that can adopt the Z-DNA conformation in response to negative superhelix density: a single copy of ACACACAT and two copies of ATGCATGC. Since the control region is essential for both efficient transcription and replication, B-DNA to Z-DNA transitions in these vital sequence tracts may have significant biological consequences. We have synthesized DNA minicircles to detect B-DNA to Z-DNA transitions in the SV40 enhancer, and to determine the negative superhelix density required to stabilize the Z-DNA. A variety of DNA sequences, including the entire SV40 enhancer and the two segments of the enhancer with alternating purine-pyrimidine tracts, were incorporated into topologically relaxed minicircles. Negative supercoils were generated, and the resulting topoisomers were resolved by electrophoresis. Using an anti-Z-DNA Fab and an electrophoretic mobility shift assay, Z-DNA was detected in the enhancer-containing minicircles at a superhelix density of -0.05. Fab saturation binding experiments demonstrated that three, independent Z-DNA tracts were stabilized in the supercoiled minicircles. Two other minicircles, each with one of the two alternating purine-pyrimidine tracts, also contained single Z-DNA sites. These results confirm the identities of the Z-DNA-forming sequences within the control region. Moreover, the B-DNA to Z-DNA transitions were detected at superhelix densities observed during normal replication and transcription processes in the SV40 life cycle.

  15. Rice HMGB1 protein recognizes DNA structures and bends DNA efficiently.

    PubMed

    Wu, Qiang; Zhang, Wensheng; Pwee, Keng-Hock; Kumar, Prakash P

    2003-03-01

    We analyzed the DNA-binding and DNA-bending properties of recombinant HMGB1 proteins based on a rice HMGB1 cDNA. Electrophoretic mobility shift assay demonstrated that rice HMGB1 can bind synthetic four-way junction (4H) DNA and DNA minicircles efficiently but the binding to 4H can be completed out by HMGA and histone H1. Conformational changes were detected by circular dichroism analysis with 4H DNA bound to various concentrations of HMGB1 or its truncated forms. T4 ligase-mediated circularization assays with short DNA fragments of 123 bp showed that the protein is capable of increasing DNA flexibility. The 123-bp DNA formed closed circular monomers efficiently in its presence, similar to that in an earlier study on maize HMG. Additionally, our results show for the first time that the basic N-terminal domain enhances the affinity of the plant HMGB1 protein for 4H DNA, while the acidic C-terminal domain has the converse effects.

  16. DNA electrophoresis in agarose gels: Effects of electric field and gel concentration on the exponential dependence of reciprocal mobility on DNA length

    NASA Astrophysics Data System (ADS)

    Beheshti, Afshin; van Winkle, David; Randolph, Rill

    2002-03-01

    Electrophoresis was performed on double stranded DNA fragments ranging in length from 200 bp to 48502 bp at agarose gel concentrations T = 0.5% - 1.5% and electric fields E = 0.71 V/cm to 5 V/cm. A wide range of electric fields and gel concentrations were used to find what range of conditions work with the new interpolation equation, 1/μ(L) = 1/μl - (1/μl - 1/μ_s)e^-L/γ. The equation fit extremely well (\\chi^2 >= 0.999) to data with E = 2.5 V/cm to 5 V/cm and for lower fields (E < 2.5 V/cm) at low gel concentrations (T = 0.5% and 0.7%). This exponential relation seemed to hold when there is a smooth transition from the Ogston sieving regime to the reptation regime when looking at the “reptation plots” (plotting 3μL/μo vs. L) (Rousseau, J., Drouin, G., and Slater, G. W., Phys Rev Lett. 1997, 79, 1945-1948). For separations of single-stranded DNA in polyacrylamide, similar reptation plots have a region with a negative slope between the Ogston sieving regime and the reptation regime which has been interpreted as the signature of entropic trapping. When separating double-stranded DNA in agarose it was observed that fits deviate from the data when three different slopes are observed in the reptation plots. Failure of the simple exponential relationship between reciprocal mobility and DNA length appears to be the consequence of entropic trapping.

  17. Trapping of branched DNA in microfabricated structures.

    PubMed Central

    Volkmuth, W D; Duke, T; Austin, R H; Cox, E C

    1995-01-01

    We have observed electrostatic trapping of tribranched DNA molecules undergoing electrophoresis in a microfabricated pseudo-two-dimensional array of posts. Trapping occurs in a unique transport regimen in which the electrophoretic mobility is extremely sensitive to polymer topology. The arrest of branched polymers is explained by considering their center-of-mass motion; in certain conformations, owing to the constraints imposed by the obstacles a molecule cannot advance without the center of mass first moving a short distance backwards. The depth of the resulting local potential well can be much greater than the thermal energy so that escape of an immobilized molecule can be extremely slow. We summarize the expected behavior of the mobility as a function of field strength and topology and point out that the microfabricated arrays are highly suitable for detecting an extremely small number of branched molecules in a very large population of linear molecules. Images Fig. 2 PMID:7624337

  18. Visualizing ion relaxation in the transport of short DNA fragments.

    PubMed Central

    Allison, S A; Wang, H; Laue, T M; Wilson, T J; Wooll, J O

    1999-01-01

    Ion relaxation plays an important role in a wide range of phenomena involving the transport of charged biomolecules. Ion relaxation is responsible for reducing sedimentation and diffusion constants, reducing electrophoretic mobilities, increasing intrinsic viscosities, and, for biomolecules that lack a permanent electric dipole moment, provides a mechanism for orienting them in an external electric field. Recently, a numerical boundary element method was developed to solve the coupled Navier-Stokes, Poisson, and ion transport equations for a polyion modeled as a rigid body of arbitrary size, shape, and charge distribution. This method has subsequently been used to compute the electrophoretic mobilities and intrinsic viscosities of a number of model proteins and DNA fragments. The primary purpose of the present work is to examine the effect of ion relaxation on the ion density and fluid velocity fields around short DNA fragments (20 and 40 bp). Contour density as well as vector field diagrams of the various scalar and vector fields are presented and discussed at monovalent salt concentrations of 0.03 and 0.11 M. In addition, the net charge current fluxes in the vicinity of the DNA fragments at low and high salt concentrations are briefly examined and discussed. PMID:10233066

  19. Electrophoretic separation of lunar soils in a space manufacturing facility

    NASA Technical Reports Server (NTRS)

    Dunning, J. D.; Snyder, R. S.

    1981-01-01

    The feasibility of electrophoretic separation of lunar soil into its mineral constituents is discussed in this paper. The process and its applicability to lunar soil separation are considered in light of the special requirements of a space manufacturing effort. Data generated in studies at NASA-Marshall Space Flight Center, which assess the efficiency of electrophoretic separation of lunar soil, are discussed and evaluated.

  20. DNA binding of Jun and Fos bZip domains: homodimers and heterodimers induce a DNA conformational change in solution.

    PubMed Central

    John, M; Leppik, R; Busch, S J; Granger-Schnarr, M; Schnarr, M

    1996-01-01

    We constructed plasmids encoding the sequences for the bZip modules of c-Jun and c-Fos which could then be expressed as soluble proteins in Escherichia coli. The purified bZip modules were tested for their binding capacities of synthetic oligonucleotides containing either TRE or CRE recognition sites in electrophoretic mobility shift assays and circular dichroism (CD). Electrophoretic mobility shift assays showed that bZip Jun homodimers and bZip Jun/Fos heterodimers bind a collagenase-like TRE (CTGACTCAT) with dissociation constants of respectively 1.4 x 10(-7) M and 5 x 10(-8) M. As reported earlier [Patel et al. (1990) Nature 347, 572-575], DNA binding induces a marked change of the protein structure. However, we found that the DNA also undergoes a conformational change. This is most clearly seen with small oligonucleotides of 13 or 14 bp harboring respectively a TRE (TGACTCA) or a CRE (TGACGTCA) sequence. In this case, the positive DNA CD signal at 280 nm increases almost two-fold with a concomitant blue-shift of 3-4 nm. Within experimental error the same spectral changes are observed for TRE and CRE containing DNA fragments. The spectral changes observed with a non-specific DNA fragment are weaker and the signal of free DNA is recovered upon addition of much smaller salt concentrations than required for a specific DNA fragment. Surprisingly the spectral changes induced by Jun/Jun homodimers are not identical to those induced by Jun/Fos heterodimers. However, in both cases the increase of the positive CD band and the concomitant blue shift would be compatible with a B to A-transition of part of the binding site or a DNA conformation intermediate between the canonical A and B structures. PMID:8948639

  1. The dMi-2 chromodomains are DNA binding modules important for ATP-dependent nucleosome mobilization

    PubMed Central

    Bouazoune, Karim; Mitterweger, Angelika; Längst, Gernot; Imhof, Axel; Akhtar, Asifa; Becker, Peter B.; Brehm, Alexander

    2002-01-01

    Drosophila Mi-2 (dMi-2) is the ATPase subunit of a complex combining ATP-dependent nucleosome remodelling and histone deacetylase activities. dMi-2 contains an HMG box-like region, two PHD fingers, two chromodomains and a SNF2-type ATPase domain. It is not known which of these domains contribute to nucleosome remodelling. We have tested a panel of dMi-2 deletion mutants in ATPase, nucleosome mobilization and nucleosome binding assays. Deletion of the chromodomains impairs all three activities. A dMi-2 mutant lacking the chromodomains is incorporated into a functional histone deacetylase complex in vivo but has lost nucleosome-stimulated ATPase activity. In contrast to dHP1, dMi-2 does not bind methylated histone H3 tails and does not require histone tails for nucleosome binding. Instead, the dMi-2 chromodomains display DNA binding activity that is not shared by other chromodomains. Our results suggest that the chromodomains act at an early step of the remodelling process to bind the nucleosome substrate predominantly via protein–DNA interactions. Furthermore, we identify DNA binding as a novel chromodomain-associated activity. PMID:12006495

  2. Capillary electrophoretic study of green fluorescent hollow carbon nanoparticles.

    PubMed

    Liu, Lizhen; Feng, Feng; Hu, Qin; Paau, Man Chin; Liu, Yang; Chen, Zezhong; Bai, Yunfeng; Guo, Fangfang; Choi, Martin M F

    2015-09-01

    CE coupled with laser-induced fluorescence and UV absorption detections has been applied to study the complexity of as-synthesized green fluorescent hollow carbon nanoparticles (HC-NP) samples. The effects of pH, type, and concentration of the run buffer and SDS on the separation of HC-NP are studied in detail. It is observed that phosphate run buffer is more effective in separating the HC-NP and the optimal run buffer is found to be 30 mM phosphate and 10 mM SDS at pH 9.0. The CE separation of this HC-NP is based on the difference in size and electrophoretic mobility of HC-NP. Some selected HC-NP fractions are collected and further characterized by UV-visible absorption and photoluminescence (PL) spectroscopy, MS, and transmission electron microscopy. The fractionated HC-NP show profound differences in absorption, emission characteristics, and PL quantum yield that would have been otherwise misled by studying the complex mixture alone. It is anticipated that our CE methodology will open a new initiative on extensive studies of individual HC-NP species in the biomedical, catalysis, electronic, and optical device, energy storage, material, and sensing field.

  3. Cooperative assembly of a protein-DNA filament for nonhomologous end joining.

    PubMed

    Tsai, Chun J; Chu, Gilbert

    2013-06-21

    Nonhomologous end joining repairs DNA double-strand breaks created by ionizing radiation and V(D)J recombination. Ku, XRCC4/Ligase IV (XL), and XLF have a remarkable mismatched end (MEnd) ligase activity, particularly for ends with mismatched 3' overhangs, but the mechanism has remained obscure. Here, we showed XL required Ku to bind DNA, whereas XLF required both Ku and XL to bind DNA. We detected cooperative assembly of one or two Ku molecules and up to five molecules each of XL and XLF into a Ku-XL-XLF-DNA (MEnd ligase-DNA) complex. XLF mutations that disrupted its interactions with XRCC4 or DNA also disrupted complex assembly and end joining. Together with published co-crystal structures of truncated XRCC4 and XLF proteins, our data with full-length Ku, XL, and XLF bound to DNA indicate assembly of a filament containing Ku plus alternating XL and XLF molecules. By contrast, in the absence of XLF, we detected cooperative assembly of up to six molecules each of Ku and XL into a Ku-XL-DNA complex, consistent with a filament containing alternating Ku and XL molecules. Despite a lower molecular mass, MEnd ligase-DNA had a lower electrophoretic mobility than Ku-XL-DNA. The anomalous difference in mobility and difference in XL to Ku molar ratio suggests that MEnd ligase-DNA has a distinct structure that successfully aligns mismatched DNA ends for ligation.

  4. Cooperative Assembly of a Protein-DNA Filament for Nonhomologous End Joining*

    PubMed Central

    Tsai, Chun J.; Chu, Gilbert

    2013-01-01

    Nonhomologous end joining repairs DNA double-strand breaks created by ionizing radiation and V(D)J recombination. Ku, XRCC4/Ligase IV (XL), and XLF have a remarkable mismatched end (MEnd) ligase activity, particularly for ends with mismatched 3′ overhangs, but the mechanism has remained obscure. Here, we showed XL required Ku to bind DNA, whereas XLF required both Ku and XL to bind DNA. We detected cooperative assembly of one or two Ku molecules and up to five molecules each of XL and XLF into a Ku-XL-XLF-DNA (MEnd ligase-DNA) complex. XLF mutations that disrupted its interactions with XRCC4 or DNA also disrupted complex assembly and end joining. Together with published co-crystal structures of truncated XRCC4 and XLF proteins, our data with full-length Ku, XL, and XLF bound to DNA indicate assembly of a filament containing Ku plus alternating XL and XLF molecules. By contrast, in the absence of XLF, we detected cooperative assembly of up to six molecules each of Ku and XL into a Ku-XL-DNA complex, consistent with a filament containing alternating Ku and XL molecules. Despite a lower molecular mass, MEnd ligase-DNA had a lower electrophoretic mobility than Ku-XL-DNA. The anomalous difference in mobility and difference in XL to Ku molar ratio suggests that MEnd ligase-DNA has a distinct structure that successfully aligns mismatched DNA ends for ligation. PMID:23620595

  5. SPAR electrophoretic separation experiments, part 2

    NASA Technical Reports Server (NTRS)

    Cosmi, F. M.

    1978-01-01

    The opportunity to use a sounding rocket for separation experiments is a logical continuation of earlier electrophoresis demonstrations and experiments. A free-flow electrophoresis system, developed under the Advanced Applications Flight Experiment (AAFE) Program, was designed so that it would fit into a rocket payload. The SPAR program provides a unique opportunity to complete the intial stages of microgravity testing prior to any Shuttle applications. The objective of the work described in this report was to ensure proper operating parameters for the defined experimental samples to be used in the SPAR Electrophoretic Separation Experiment. Ground based experiments were undertaken not only to define flight parameters but also to serve as a point of comparison for flight results. Possible flight experiment problem areas were also studied such as sample interaction due to sedimentation, concentration effects and storage effects. Late in the program anomalies of field strengths and buffer conductivities were also investigated.

  6. Investigation of the free flow electrophoretic process

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1980-01-01

    The effects of gravity on the free flow electrophoretic process was demonstrated. The free flow electrophoresis chamber used to demonstrate the effects of gravity on the process was of a proprietary design. This chamber was 120 cm long, 16 cm wide, and 0.15 cm thick. Flow in this chamber was in the upward direction and exited through 197 outlets at the top of the chamber. During electrophoresis a stream of sample was injected into the flow near the bottom of the chamber and an electrical field was applied across the width of the chamber. The field caused a lateral force on particles in the sample proportional to the inherent change of the particle and the electric field strength. Particle lateral velocity was then dependent on the force due to viscous drag which was proportional to particle size and particle shape dependent.

  7. Electrophoretic Deposition on Porous Non-Conductors

    NASA Technical Reports Server (NTRS)

    Compson, Charles; Besra, Laxmidhar; Liu, Meilin

    2007-01-01

    A method of electrophoretic deposition (EPD) on substrates that are porous and electrically non-conductive has been invented. Heretofore, in order to perform an EPD, it has been necessary to either (1) use a substrate material that is inherently electrically conductive or (2) subject a non-conductive substrate to a thermal and/or chemical treatment to render it conductive. In the present method, instead of relying on the electrical conductivity of the substrate, one ensures that the substrate is porous enough that when it is immersed in an EPD bath, the solvent penetrates throughout the thickness, thereby forming quasi-conductive paths through the substrate. By making it unnecessary to use a conductive substrate, this method simplifies the overall EPD process and makes new applications possible. The method is expected to be especially beneficial in enabling deposition of layers of ceramic and/or metal for chemical and electrochemical devices, notably including solid oxide fuel cells.

  8. Chromatographic and electrophoretic approaches in ink analysis.

    PubMed

    Zlotnick, J A; Smith, F P

    1999-10-15

    Inks are manufactured from a wide variety of substances that exhibit very different chemical behaviors. Inks designed for use in different writing instruments or printing methods have quite dissimilar components. Since the 1950s chromatographic and electrophoretic methods have played important roles in the analysis of inks, where compositional information may have bearing on the investigation of counterfeiting, fraud, forgery, and other crimes. Techniques such as paper chromatography and electrophoresis, thin-layer chromatography, high-performance liquid chromatography, gas chromatography, gel electrophoresis, and the relatively new technique of capillary electrophoresis have all been explored as possible avenues for the separation of components of inks. This paper reviews the components of different types of inks and applications of the above separation methods are reviewed.

  9. Recent patents on electrophoretic displays and materials.

    PubMed

    Christophersen, Marc; Phlips, Bernard F

    2010-11-01

    Electrophoretic displays (EPDs) have made their way into consumer products. EPDs enable displays that offer the look and form of a printed page, often called "electronic paper". We will review recent apparatus and method patents for EPD devices and their fabrication. A brief introduction into the basic display operation and history of EPDs is given, while pointing out the technological challenges and difficulties for inventors. Recently, the majority of scientific publications and patenting activity has been directed to micro-segmented EPDs. These devices exhibit high optical reflectance and contrast, wide viewing angle, and high image resolution. Micro-segmented EPDs can also be integrated with flexible transistors technologies into flexible displays. Typical particles size ranges from 200 nm to 2 micrometer. Currently one very active area of patenting is the development of full-color EPDs. We summarize the recent patenting activity for EPDs and provide comments on perceiving factors driving intellectual property protection for EPD technologies.

  10. Electrophoretic deposition of chiral polymers and composites.

    PubMed

    Wang, Y; Pang, X; Zhitomirsky, I

    2011-10-15

    Electrophoretic deposition (EPD) method has been developed for the deposition of thin films of chiral polymers. EPD of poly-L-lysine (PLL) and poly-L-ornithine (PLO) films was performed for the first time on conductive substrates from aqueous and ethanol-water solutions. The deposition yield was monitored using a quartz crystal microbalance. The results demonstrated that the deposition yield can be varied by variation of the deposition time, voltage and polymer concentration in the solutions. It was shown that PLL and PLO provided stabilization and charging of hydroxyapatite (HA) nanoparticles in suspensions. Composite PLL-HA and PLO-HA films of controlled thickness were prepared by EPD. Electron microscopy investigations showed that the thickness of the PLL, PLO and composite films was varied in the range of 0-3 μm. The polymer and composite films can be used for biomedical applications.

  11. Dynamics of DNA molecules under gel electrophoresis

    SciTech Connect

    Kotaka, Tadao, Adachi, Shiro; Shikata, Toshiyuki

    1993-12-31

    Electrophoretic mobilities {mu} of double stranded linear DNAs were examined in agarose gels subjected to a biased sinusoidal field (BSF) that utilizes a sinusoidal field of strength E{sub s} and frequency f superposed on a steady bias field of strength E{sub b}. Under BSF with E{sub s} {much_gt} E{sub b}. DNA fragments with the size M > 20 kbp exhibited peculiar behavior which the authors called a pin down phenomenon in that the {mu} shows a minimum {mu}{sub p} at a particular f{sub p} (pin down frequency) specific to M, C{sub gel} and the field strengths. The dynamics of DNA molecules under such pin-down conditions were examined by direct observation via fluorescence microscopy as well as dynamic electric birefringence.

  12. The Electrophoretic Velocity of Human Red Cells, of Their Ghosts and Mechanically Produced Fragments, and of Certain Lipid Complexes

    PubMed Central

    Ponder, Eric; Ponder, Ruth V.

    1960-01-01

    Ghosts prepared in CO2-saturated water from unwashed human red cells can be fragmented mechanically, but ghosts from thrice washed cells cannot. If the ghosts are prepared by freezing and thawing, this difference is not observed. The electrophoretic velocity varies also with the way in which the ghosts are prepared. The pH-mobility dependence of washed red cells flatten off to a plateau at pH 9, and the electrophoretic velocity is zero at about pH 2. Ghosts prepared by freezing and thawing have almost the same pH-mobility dependence, but if the ghosts are prepared in CO2-saturated hyptonic saline, the mobility at pH 9.4 is 0.75 times that of washed cells. Fragments of ghosts of unwashed red cells have a smaller mobility than that of the red cells. Trypsin reduces the mobility of washed red cells and of ghosts. Sols of lipid complexes (lecithin, cephalin, and lipositol), at varying pH's, have a mobility 1.2 times that of the washed red cell. The pH-mobility relation is otherwise similar. These complexes can be coated with dextran and trypsin. PMID:14433990

  13. Single Molecular Demonstration of Modulating Charge Inversion of DNA

    NASA Astrophysics Data System (ADS)

    Wang, Yanwei; Wang, Ruxia; Cao, Bozhi; Guo, Zilong; Yang, Guangcan

    2016-12-01

    Charge inversion of DNA is a counterintuitive phenomenon in which the effective charge of DNA switches its sign from negative to positive in the presence of multivalent counterions. The underlying microscopic mechanism is still controversial whether it is driven by a specific chemical affinity or electrostatic ion correlation. It is well known that DNA shows no charge inversion in normal aqueous solution of trivalent counterions though they can induce the conformational compaction of DNA. However, in the same trivalent counterion condition, we demonstrate for the first time the occurrence of DNA charge inversion by decreasing the dielectric constant of solution to make the electrophoretic mobility of DNA increase from a negative value to a positive value. In contrast, the charge inversion of DNA induced by quadrivalent counterions can be canceled out by increasing the dielectric constant of solution. The physical modulation of DNA effective charge in two ways unambiguously demonstrates that charge inversion of DNA is a predominantly electrostatic phenomenon driven by the existence of a strongly correlated liquid (SCL) of counterions at the DNA surface. This conclusion is also supported by the measurement of condensing and unraveling forces of DNA condensates by single molecular MT.

  14. Single Molecular Demonstration of Modulating Charge Inversion of DNA

    PubMed Central

    Wang, Yanwei; Wang, Ruxia; Cao, Bozhi; Guo, Zilong; Yang, Guangcan

    2016-01-01

    Charge inversion of DNA is a counterintuitive phenomenon in which the effective charge of DNA switches its sign from negative to positive in the presence of multivalent counterions. The underlying microscopic mechanism is still controversial whether it is driven by a specific chemical affinity or electrostatic ion correlation. It is well known that DNA shows no charge inversion in normal aqueous solution of trivalent counterions though they can induce the conformational compaction of DNA. However, in the same trivalent counterion condition, we demonstrate for the first time the occurrence of DNA charge inversion by decreasing the dielectric constant of solution to make the electrophoretic mobility of DNA increase from a negative value to a positive value. In contrast, the charge inversion of DNA induced by quadrivalent counterions can be canceled out by increasing the dielectric constant of solution. The physical modulation of DNA effective charge in two ways unambiguously demonstrates that charge inversion of DNA is a predominantly electrostatic phenomenon driven by the existence of a strongly correlated liquid (SCL) of counterions at the DNA surface. This conclusion is also supported by the measurement of condensing and unraveling forces of DNA condensates by single molecular MT. PMID:27929107

  15. All solution processed organic thin film transistor-backplane with printing technology for electrophoretic display

    USGS Publications Warehouse

    Lee, Myung W.; Song, C.K.

    2012-01-01

    In this study, solution processes were developed for backplane using an organic thin film transistor (OTFT) as a driving device for an electrophoretic display (EPD) panel. The processes covered not only the key device of OTFTs but also interlayer and pixel electrodes. The various materials and printing processes were adopted to achieve the requirements of devices and functioning layers. The performance of OTFT of the backplane was sufficient to drive EPD sheet by producing a mobility of 0.12 cm2/v x sec and on/off current ratio of 10(5).

  16. The RNA polymerase I transactivator upstream binding factor requires its dimerization domain and high-mobility-group (HMG) box 1 to bend, wrap, and positively supercoil enhancer DNA.

    PubMed Central

    Putnam, C D; Copenhaver, G P; Denton, M L; Pikaard, C S

    1994-01-01

    Upstream binding factor (UBF) is an important transactivator of RNA polymerase I and is a member of a family of proteins that contain nucleic acid binding domains named high-mobility-group (HMG) boxes because of their similarity to HMG chromosomal proteins. UBF is a highly sequence-tolerant DNA-binding protein for which no binding consensus sequence has been identified. Therefore, it has been suggested that UBF may recognize preformed structural features of DNA, a hypothesis supported by UBF's ability to bind synthetic DNA cruciforms, four-way junctions, and even tRNA. We show here that full-length UBF can also bend linear DNA to mediate circularization of probes as small as 102 bp in the presence of DNA ligase. Longer probes in the presence of UBF become positively supercoiled when ligated, suggesting that UBF wraps the DNA in a right-handed direction, opposite the direction of DNA wrapping around a nucleosome. The dimerization domain and HMG box 1 are necessary and sufficient to circularize short probes and supercoil longer probes in the presence of DNA ligase. UBF's sequence tolerance coupled with its ability to bend and wrap DNA makes UBF an unusual eukaryotic transcription factor. However, UBF's ability to bend DNA might explain how upstream and downstream rRNA gene promoter domains interact. UBF-induced DNA wrapping could also be a mechanism by which UBF counteracts histone-mediated gene repression. Images PMID:7935371

  17. Salt dependence of DNA translocation dynamics through silicon nanopores detected by ultraviolet excitation

    NASA Astrophysics Data System (ADS)

    Ito, Shintaro; Yamazaki, Hirohito; Tsukahara, Mutsumi; Esashika, Keiko; Saiki, Toshiharu

    2016-04-01

    DNA translocation through nanopores was observed using ultraviolet excitation to investigate the effect of salt concentration and counterion species on the translocation speed. The translocation of 9.6-kbp DNA molecules was measured in an aqueous solvent containing KCl, NaCl, or LiCl. An increase in the KCl concentration from 0.5 to 2 M increased the DNA translocation time. Maintaining the salt concentration at 1.0 M but replacing KCl with NaCl or LiCl also increased the translocation time. These results suggest that the effective charge on the DNA changed due to the binding of counterions, decreasing the DNA electrophoretic mobility. Significant correlation was observed between the translocation time and the dwell time in the observation volume (time needed to move out of the observation volume), and a possible explanation for this observation is provided.

  18. The Myb domain of LUX ARRHYTHMO in complex with DNA: expression, purification and crystallization.

    PubMed

    Silva, Catarina S; Lai, Xuelei; Nanao, Max; Zubieta, Chloe

    2016-05-01

    LUX ARRHYTHMO (LUX) is a Myb-domain transcription factor that plays an important role in regulating the circadian clock. Lux mutations cause severe clock defects and arrhythmia in constant light and dark. In order to examine the molecular mechanisms underlying the function of LUX, the DNA-binding Myb domain was cloned, expressed and purified. The DNA-binding activity of the Myb domain was confirmed using electrophoretic mobility shift assays (EMSAs), demonstrating that the LUX Myb domain is able to bind to DNA with nanomolar affinity. In order to investigate the specificity determinants of protein-DNA interactions, the protein was co-crystallized with a 10-mer cognate DNA. Initial crystallization results for the selenomethionine-derivatized protein and data-set collection statistics are reported. Data collection was performed using the MeshAndCollect workflow available at the ESRF.

  19. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors

    PubMed Central

    He, Gaofei; Tolic, Ana; Bashkin, James K.; Poon, Gregory M. K.

    2015-01-01

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs’ binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs. PMID:25824951

  20. Heterogeneous dynamics in DNA site discrimination by the structurally homologous DNA-binding domains of ETS-family transcription factors.

    PubMed

    He, Gaofei; Tolic, Ana; Bashkin, James K; Poon, Gregory M K

    2015-04-30

    The ETS family of transcription factors exemplifies current uncertainty in how eukaryotic genetic regulators with overlapping DNA sequence preferences achieve target site specificity. PU.1 and Ets-1 represent archetypes for studying site discrimination by ETS proteins because their DNA-binding domains are the most divergent in sequence, yet they share remarkably superimposable DNA-bound structures. To gain insight into the contrasting thermodynamics and kinetics of DNA recognition by these two proteins, we investigated the structure and dynamics of site discrimination by their DNA-binding domains. Electrophoretic mobilities of complexes formed by the two homologs with circularly permuted binding sites showed significant dynamic differences only for DNA complexes of PU.1. Free solution measurements by dynamic light scattering showed PU.1 to be more dynamic than Ets-1; moreover, dynamic changes are strongly coupled to site discrimination by PU.1, but not Ets-1. Interrogation of the protein/DNA interface by DNA footprinting showed similar accessibility to dimethyl sulfate for PU.1/DNA and Ets-1/DNA complexes, indicating that the dynamics of PU.1/DNA complexes reside primarily outside that interface. An information-based analysis of the two homologs' binding motifs suggests a role for dynamic coupling in PU.1's ability to enforce a more stringent sequence preference than Ets-1 and its proximal sequence homologs. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Comparative Analysis of Interaction of Human and Yeast DNA Damage Recognition Complexes with Damaged DNA in Nucleotide Excision Repair*

    PubMed Central

    Krasikova, Yuliya S.; Rechkunova, Nadejda I.; Maltseva, Ekaterina A.; Pestryakov, Pavel E.; Petruseva, Irina O.; Sugasawa, Kaoru; Chen, Xuejing; Min, Jung-Hyun; Lavrik, Olga I.

    2013-01-01

    The human XPC-RAD23B complex and its yeast ortholog, Rad4-Rad23, are the primary initiators of global genome nucleotide excision repair. The interaction of these proteins with damaged DNA was analyzed using model DNA duplexes containing a single fluorescein-substituted dUMP analog as a lesion. An electrophoretic mobility shift assay revealed similarity between human and yeast proteins in DNA binding. Quantitative analyses of XPC/Rad4 binding to the model DNA structures were performed by fluorescent depolarization measurements. XPC-RAD23B and Rad4-Rad23 proteins demonstrate approximately equal binding affinity to the damaged DNA duplex (KD ∼ (0.5 ± 0.1) and (0.6 ± 0.3) nm, respectively). Using photoreactive DNA containing 5-iodo-dUMP in defined positions, XPC/Rad4 location on damaged DNA was shown. Under conditions of equimolar binding to DNA both proteins exhibited the highest level of cross-links to 5I-dUMP located exactly opposite the damaged nucleotide. The positioning of the XPC and Rad4 proteins on damaged DNA by photocross-linking footprinting is consistent with x-ray analysis of the Rad4-DNA crystal complex. The identity of the XPC and Rad4 location illustrates the common principles of structure organization of DNA damage-scanning proteins from different Eukarya organisms. PMID:23443653

  2. The relationship between UV-irradiance, photoprotective compounds and DNA damage in two intertidal invertebrates with contrasting mobility characteristics.

    PubMed

    Cubillos, Victor Mauricio; Burritt, David J; Lamare, Miles D; Peake, Barrie M

    2015-08-01

    The photoprotective role of mycosporine-like amino acids (MAA) against the generation of DNA cyclobutane pyrimidine dimers (CPD) was studied in the sessile intertidal anemone Actinia tenebrosa and the mobile intertidal gastropod Diloma aethiops through 27months at a mid-latitude New Zealand location. MAA were sequestered by A. tenebrosa and D. aethiops from their diet, although maximum total MAA levels in both species were not correlated with seasonal variation in maximum ambient UV-B levels recorded at the collection site. Temporal changes in total MAA in A. tenebrosa showed a six months lag-time in their concentration regarding to the environmental UV-B levels. This lag period corresponded to an observed increase in CPD production from spring to summer; suggesting that MAA do not completely protect the anemone from UV-B during summer. For D. aethiops, total MAA concentrations did not change significantly during the study, although qualitative changes in MAA were apparent. A month lag-time in MAA concentration in D. aethiops and possibly the physical barrier that the shell confers to the animal, can explain reduced CPD levels in comparative terms with A. tenebrosa. Although MAA are used by invertebrates for photoprotection, contrasting mobility characteristics and the presence of physical adaptations can confer them important protection levels during temporal changes of UV-B at mid-latitude places of the Southern Hemisphere.

  3. [DNA sequences from mobile genetic elements, a hidden half of the human genome].

    PubMed

    Medina, Julie; Perron, Hervé

    2017-02-01

    Current data estimate that mobile genetic elements represent more than one-half of the human genome. The literature is constantly updating data following the evolution of sequencing techniques and of algorithms for genome analyses. This review aims to provide an overview of the topic showing the complexity given by the various designations and classifications found in scientific papers. A particular focus is made on retrotransposons, including Endogenous RetroViruses (ERV), to introduce a second article focusing on their activation and their involvement in physiological functions and/or pathological mechanisms associated with diseases like multiple sclerosis (MS) or amyotrophic lateral sclerosis (ALS). © 2017 médecine/sciences – Inserm.

  4. A probe-based mapping strategy for DNA sequencing with mobile primers

    SciTech Connect

    Strausbaugh, L.D.; Berg, C.M.

    1991-01-01

    Research on DNA sequencing continued. The specific areas of research targeted for the period of this Progress Report included three general phases: (1) optimization of probe-mapping by both the development of new transposons and the design of stream-lined methods for mapping; (2) application of transposon-based methods to larger plasmids and cosmids; and (3) initiation of PCR-based applications of transposons.

  5. A probe-based mapping strategy for DNA sequencing with mobile primers. Progress report

    SciTech Connect

    Strausbaugh, L.D.; Berg, C.M.

    1991-12-31

    Research on DNA sequencing continued. The specific areas of research targeted for the period of this Progress Report included three general phases: (1) optimization of probe-mapping by both the development of new transposons and the design of stream-lined methods for mapping; (2) application of transposon-based methods to larger plasmids and cosmids; and (3) initiation of PCR-based applications of transposons.

  6. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Wang, Hua; Zeng, Shulin; Loewenberg, Michael; Todd, Paul; Davis, Robert H.

    1996-01-01

    The stability and pairwise aggregation rates of small spherical particles under the collective effects of buoyancy-driven motion and electrophoretic migration are analyzed. The particles are assumed to be non-Brownian, with thin double-layers and different zeta potentials. The particle aggregation rates may be enhanced or reduced, respectively, by parallel and antiparallel alignments of the buoyancy-driven and electrophoretic velocities. For antiparallel alignments, with the buoyancy-driven relative velocity exceeding the electrophoretic relative velocity between two widely-separated particles, there is a 'collision-forbidden region' in parameter space due to hydrodynamic interactions; thus, the suspension becomes stable against aggregation.

  7. Asymmetric DNA binding by a homodimeric bHLH protein.

    PubMed

    Winston, R L; Ehley, J A; Baird, E E; Dervan, P B; Gottesfeld, J M

    2000-08-08

    Protein-DNA interactions that lie outside of the core recognition sequence for the Drosophila bHLH transcription factor Deadpan (Dpn) were investigated using minor groove binding pyrrole-imidazole polyamides. Electrophoretic mobility shift assays and DNase I footprinting demonstrate that hairpin polyamides bound immediately upstream, but not immediately downstream of the Dpn homodimer selectively inhibit protein-DNA complex formation. Mutation of the Dpn consensus binding site from the asymmetric sequence 5'-CACGCG-3' to the palindromic sequence 5'-CACGTG-3' abolishes asymmetric inhibition. A Dpn mutant containing the unnatural amino acid norleucine in place of lysine at position 80 in the bHLH loop region is not inhibited by the polyamide, suggesting that the epsilon amino group at this position is responsible for DNA contacts outside the major groove. We conclude that the nonpalindromic Dpn recognition site imparts binding asymmetry by providing unique contacts to the basic region of each monomer in the bHLH homodimer.

  8. DNA bending induced by cruciform formation.

    PubMed

    Gough, G W; Lilley, D M

    Cruciform structures in DNA are of considerable interest, both as extreme examples of sequence-dependent structural heterogeneity and as models for four-way junctions such as the Holliday junction of homologous genetic recombination. Cruciforms are of lower thermodynamic stability than regular duplex DNA, and have been observed only in negatively supercoiled molecules, where the unfavourable free energy of formation is offset by the topological relaxation of the torsionally stressed molecule. From an experimental viewpoint this can be a disadvantage, as cruciform structures can be studied only in relatively large supercoiled DNA circles, and are destabilized when a break is introduced at any point. We therefore set out to construct a pseudo-cruciform junction--by generating hereroduplex formation between two inverted repeat sequences. Stereochemically, this should closely resemble a true cruciform but remain stable in a linear DNA fragment. We have now created such a junction and find that it has the expected sensitivities to endonucleases. These DNA fragments exhibit extremely anomalous gel electrophoretic mobility, the extent of which depends on the relative position of the pseudo-cruciform along the length of the molecule. Our results are very similar to those obtained by Wu and Crothers using kinetoplast DNA, and we conclude that the pseudo-cruciform junction introduces a bend in the linear DNA molecule.

  9. OGG1-DNA interactions facilitate NF-κB binding to DNA targets

    PubMed Central

    Pan, Lang; Hao, Wenjing; Zheng, Xu; Zeng, Xianlu; Ahmed Abbasi, Adeel; Boldogh, Istvan; Ba, Xueqing

    2017-01-01

    DNA repair protein counteracting oxidative promoter lesions may modulate gene expression. Oxidative DNA bases modified by reactive oxygen species (ROS), primarily as 7, 8-dihydro-8-oxo-2′-deoxyguanosine (8-oxoG), which is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair (BER) pathway. Because cellular response to oxidative challenge is accompanied by DNA damage repair, we tested whether the repair by OGG1 is compatible with transcription factor binding and gene expression. We performed electrophoretic mobility shift assay (EMSA) using wild-type sequence deriving from Cxcl2 gene promoter and the same sequence bearing a single synthetic 8-oxoG at defined 5′ or 3′ guanine in runs of guanines to mimic oxidative effects. We showed that DNA occupancy of NF-κB present in nuclear extracts from tumour necrosis factor alpha (TNFα) exposed cells is OGG1 and 8-oxoG position dependent, importantly, OGG1 counteracting 8-oxoG outside consensus motif had a profound influence on purified NF-κB binding to DNA. Furthermore, OGG1 is essential for NF-κB dependent gene expression, prior to 8-oxoG excised from DNA. These observations imply that pre-excision step(s) during OGG1 initiated BER evoked by ROS facilitates NF-κB DNA occupancy and gene expression. PMID:28266569

  10. Mobilization of Nuclear Copper by Green Tea Polyphenol Epicatechin-3-Gallate and Subsequent Prooxidant Breakage of Cellular DNA: Implications for Cancer Chemotherapy.

    PubMed

    Farhan, Mohd; Oves, Mohammad; Chibber, Sandesh; Hadi, Sheikh Mumtaz; Ahmad, Aamir

    2016-12-26

    Epidemiological as well as experimental evidence exists in support of chemopreventive and anticancer properties of green tea and its constituents. The gallocatechin, epicatechin-3-gallate is a major polyphenol present in green tea, shown responsible for these effects. Plant-derived polyphenolic compounds are established natural antioxidants which are capable of catalyzing oxidative DNA degradation of cellular DNA, alone as well as in the presence of transition metal ions, such as copper. Here we present evidence to support that, similar to various other polyphenoic compounds, epicatechin-3-gallate also causes oxidative degradation of cellular DNA. Single cell alkaline gel electrophoresis (Comet assay) was used to assess DNA breakage in lymphocytes that were exposed to various concentrations of epicatechin-3-gallate. Inhibition of DNA breakage in the presence of scavengers of reactive oxygen species (ROS) suggested involvement of ROS generation. Addition of neocuproine (a cell membrane permeable Cu(I) chelator) inhibited DNA degradation, dose-dependently, in intact lymphocytes. In contrast, bathocuproine, which does not permeate cell membrane, was observed to be ineffective. We further show that epicatechin-3-gallate degrades DNA in cell nuclei, which can also be inhibited by neocuproine, suggesting mobilization of nuclear copper in this reaction as well. Our results are indicative of ROS generation, possibly through mobilization of endogenous copper ions, and support our long-standing hypothesis of a prooxidant activity of plant-derived polyphenols as a mechanism for their documented anticancer properties.

  11. Mobilization of Nuclear Copper by Green Tea Polyphenol Epicatechin-3-Gallate and Subsequent Prooxidant Breakage of Cellular DNA: Implications for Cancer Chemotherapy

    PubMed Central

    Farhan, Mohd; Oves, Mohammad; Chibber, Sandesh; Hadi, Sheikh Mumtaz; Ahmad, Aamir

    2016-01-01

    Epidemiological as well as experimental evidence exists in support of chemopreventive and anticancer properties of green tea and its constituents. The gallocatechin, epicatechin-3-gallate is a major polyphenol present in green tea, shown responsible for these effects. Plant-derived polyphenolic compounds are established natural antioxidants which are capable of catalyzing oxidative DNA degradation of cellular DNA, alone as well as in the presence of transition metal ions, such as copper. Here we present evidence to support that, similar to various other polyphenoic compounds, epicatechin-3-gallate also causes oxidative degradation of cellular DNA. Single cell alkaline gel electrophoresis (Comet assay) was used to assess DNA breakage in lymphocytes that were exposed to various concentrations of epicatechin-3-gallate. Inhibition of DNA breakage in the presence of scavengers of reactive oxygen species (ROS) suggested involvement of ROS generation. Addition of neocuproine (a cell membrane permeable Cu(I) chelator) inhibited DNA degradation, dose-dependently, in intact lymphocytes. In contrast, bathocuproine, which does not permeate cell membrane, was observed to be ineffective. We further show that epicatechin-3-gallate degrades DNA in cell nuclei, which can also be inhibited by neocuproine, suggesting mobilization of nuclear copper in this reaction as well. Our results are indicative of ROS generation, possibly through mobilization of endogenous copper ions, and support our long-standing hypothesis of a prooxidant activity of plant-derived polyphenols as a mechanism for their documented anticancer properties. PMID:28035959

  12. Protein electrophoretic markers in Israel: compilation of data and genetic affinities.

    PubMed

    Zoossmann-Diskin, A; Joel, A; Liron, M; Kerem, B; Shohat, M; Peleg, L

    2002-01-01

    A considerable body of data has been accumulated since the 1960s on protein electrophoretic markers in the Jewish populations of Israel. However, in some Jewish communities and for some markers insufficient information has been available. In addition, studies that tried to explore the genetic affinities of various Jewish populations mainly employed antigenic markers and frequently used a small and unrepresentative number of non-Jewish populations as comparisons. The primary objectives of the present study were to create a comprehensive database for protein electrophoretic markers in Israel and thereby to explore the genetic affinities of different Jewish populations. Published information on red cell enzyme and serum protein polymorphisms in Israeli Jewish populations was combined with new data obtained by protein electrophoresis and DNA PCR (polymerase chain reaction) methods to create the database. The genetic affinities were investigated by two methods. Ten Jewish populations were classified in a discriminant analysis based on nine markers and 65 non-Jewish populations. The same markers and populations were also used in a genetic distance analysis. The database contains new information on 15 protein electrophoretic markers in 14 Israeli populations, including three Jewish populations from Turkey, Tunisia and the Caucasus region, for which no or only scarce data were previously available. The discriminant analysis resulted in only two Jewish populations, from Iraq and Yemen, being classified within the Middle Eastern group. According to their genetic distances, no particular genetic similarity was observed between the various Jewish study populations. In contrast to the conclusions of several previous studies, there was no evidence for close genetic affinities among the Jewish populations or for a Middle Eastern origin for most of them. Since the study is the first to use only the more reliable protein electrophoretic markers, and an appropriately comprehensive

  13. Association of electrophoretic karyotype of Candida stellatoidea with virulence for mice

    SciTech Connect

    Kwon-Chung, K.J.; Wickes, B.L.; Merz, W.G.

    1988-07-01

    Seven isolates of Candida stellatoidea were studied for their electrophoretic karyotype, virulence for mice, sensitivity to UV radiation, growth rate in vitro, reaction on cycloheximide-indicator medium, and proteinase activity. The isolates exhibited one of two distinct electrophoretic karyotypes as determined by orthogonal field alternating gel electrophoresis (OFAGE). Four isolates, including the type culture of C. stellatoidea, belonged to electrophoretic karyotype type I by OFAGE, showing eight to nine bands of which at least two bands were less than 1,000 kilobases in size as estimated by comparison with the DNA bands of Saccharomyces cerevisiae. These isolates failed to produce fatal infection in mice within 20 days when 5 X 10(5) cells were injected intravenously. The yeasts were cleared from the kidneys of two of three mice tested by day 30. Type I showed proteinase activity on bovine serum albumin agar at pH 3.8 and produced a negative reaction on cycloheximide-bromcresol green medium within 48 h. The three grouped in type II by OFAGE showed banding patterns similar to those of a well-characterized isolate of Candida albicans. The isolates of type II had an electrophoretic karyotype of six to seven bands approximately 1,200 kilobases or greater in size. All three type II isolates were highly virulent for mice, producing fatality curves similar to those of a previously studied C. albicans isolate. From 80 to 90% of the mice injected with 5 X 10(5) cells intravenously died within 20 days. The type II isolates produced a positive reaction on cycloheximide-bromcresol green agar and showed no proteinase activity on bovine serum albumin agar at the low pH. In addition, the type II isolates grew faster and were significantly more resistant to UV irradiation than the type I isolates.

  14. Recent progress in DNA analysis by capillary electrophoresis.

    PubMed

    Righetti, Pier Giorgio; Gelfi, Cecilia; D'Acunto, Maria Rosa

    2002-05-01

    A number of recent developments in DNA analysis by capillary electrophoresis are here reviewed. They include capillary arrays for fast, parallel DNA sequencing as well as microfabricated capillary arrays. Microfluidic chips for DNA sizing and quantitation are also covered, as well as microdevices containing arrays of regular obstacles acting as size-separators during DNA migration. Screening of DNA point mutations by two much improved techniques is also reported: in one case, such mutations are detected (but only on relative short, ca. 60-70 base-long fragments) by free electrophoresis in rather acidic (pH ca. 3) buffers; in the case of single-strand chain polymorphism, an improved technique is described based on near-neutral pH buffers with mixtures of Tris/MES cations/zwitterions. When studying the behavior of inorganic and organic cations in the Debye-Hückel layer of DNA, it was found that the latter (especially a large number of Good's buffers and other zwitterions, such as His) would bind to the DNA filament not only via charge interaction, but also via additional bonds, notably hydrogen bonds, thus altering the electrophoretic (and possibly the biological) behavior of DNA molecules. However, whether or not borate ions would bind to DNA remains still an unsettled question. Finally, capillary electrophoresis was found to be instrumental in measuring fine physicochemical parameters pertaining to DNA polyelectrolytes, such as their free mobility and their translational diffusion coefficients.

  15. A lateral electrophoretic flow diagnostic assay.

    PubMed

    Lin, Robert; Skandarajah, Arunan; Gerver, Rachel E; Neira, Hector D; Fletcher, Daniel A; Herr, Amy E

    2015-03-21

    Immunochromatographic assays are a cornerstone tool in disease screening. To complement existing lateral flow assays (based on wicking flow) we introduce a lateral flow format that employs directed electrophoretic transport. The format is termed a "lateral e-flow assay" and is designed to support multiplexed detection using immobilized reaction volumes of capture antigen. To fabricate the lateral e-flow device, we employ mask-based UV photopatterning to selectively immobilize unmodified capture antigen along the microchannel in a barcode-like pattern. The channel-filling polyacrylamide hydrogel incorporates a photoactive moiety (benzophenone) to immobilize capture antigen to the hydrogel without a priori antigen modification. We report a heterogeneous sandwich assay using low-power electrophoresis to drive biospecimen through the capture antigen barcode. Fluorescence barcode readout is collected via a low-resource appropriate imaging system (CellScope). We characterize lateral e-flow assay performance and demonstrate a serum assay for antibodies to the hepatitis C virus (HCV). In a pilot study, the lateral e-flow assay positively identifies HCV+ human sera in 60 min. The lateral e-flow assay provides a flexible format for conducting multiplexed immunoassays relevant to confirmatory diagnosis in near-patient settings.

  16. Microencapsulated Electrophoretic Films for Electronic Paper Displays

    NASA Astrophysics Data System (ADS)

    Amundson, Karl

    2003-03-01

    Despite the dominance of liquid crystal displays, they do not perform some functions very well. While backlit liquid crystal displays can offer excellent color performance, they wash out in bright lighting and suffer from high power consumption. Reflective liquid crystal displays have limited brightness, making these devices challenging to read for long periods of time. Flexible liquid crystal displays are difficult to manufacture and keep stable. All of these attributes (long battery lifetime, bright reflective appearance, compatibility with flexible substrates) are traits that would be found in an ideal electronic paper display - an updateable substitute for paper that could be employed in electronic books, newspapers, and other applications. I will discuss technologies that are being developed for electronic-paper-like displays, and especially on particle-based technologies. A microencapsulated electrophoretic display technology is being developed at the E Ink corporation. This display film offers offer high brightness and an ink-on-paper appearance, compatibility with flexible substrates, and image stability that can lead to very low power consumption. I will present some of the physical and chemical challenges associated with making display films with high performance.

  17. Fluid Delivery System For Capillary Electrophoretic Applications.

    DOEpatents

    Li, Qingbo; Liu, Changsheng; Kane, Thomas E.; Kernan, John R.; Sonnenschein, Bernard; Sharer, Michael V.

    2002-04-23

    An automated electrophoretic system is disclosed. The system employs a capillary cartridge having a plurality of capillary tubes. The cartridge has a first array of capillary ends projecting from one side of a plate. The first array of capillary ends are spaced apart in substantially the same manner as the wells of a microtitre tray of standard size. This allows one to simultaneously perform capillary electrophoresis on samples present in each of the wells of the tray. The system includes a stacked, dual carrousel arrangement to eliminate cross-contamination resulting from reuse of the same buffer tray on consecutive executions from electrophoresis. The system also has a gel delivery module containing a gel syringe/a stepper motor or a high pressure chamber with a pump to quickly and uniformly deliver gel through the capillary tubes. The system further includes a multi-wavelength beam generator to generate a laser beam which produces a beam with a wide range of wavelengths. An off-line capillary reconditioner thoroughly cleans a capillary cartridge to enable simultaneous execution of electrophoresis with another capillary cartridge. The streamlined nature of the off-line capillary reconditioner offers the advantage of increased system throughput with a minimal increase in system cost.

  18. Development of an electrophoretic image display

    NASA Astrophysics Data System (ADS)

    Liebert, R.; Lalak, J.

    1981-02-01

    The purpose of this work is to develop an X-Y addressed electrophoretic image display (DPID). At a recent DARPA/PL/ISI meeting it was agreed to increase the size of the display from 350 x 600 to 360 x 640 elements. Glass substrates with the required In2O3 thickness have been obtained commercially; it is now no longer necessary to deposit additional material. Better difinition of the row electrodes has been obtained by using this glass and using ion-beam milling rather than liquid etching. Techniques to identify and repair shorts in the row electrodes have been developed. The number of defects has been reduced by better filtration and proper outgassing of the photoresist. Aluminum spits were eliminated by using electron-beam evaporation rather than evaporation from a tungsten coil. Sputter deposition of ITO has been replaced by the more reproducible evaporation technique. To obtain better electrical contact between the display and the fan-out board, the homogeneous conductive elastomer was replaced with a laminated one. A device free of shorts or opens in the row electrodes and free of shorts between the column electrodes is now being tested.

  19. A Microfluidic Platform for Interfacial Electrophoretic Deposition

    NASA Astrophysics Data System (ADS)

    Joung, Young Soo; Moran, Jeffrey; Jones, Andrew; Bailey, Eric; Buie, Cullen

    2014-11-01

    Composite membranes of hydrogel and carbon nanotubes (CNTs) are fabricated using electrophoretic deposition (EPD) at the interface of two immiscible liquids in microfluidic channels. Microfluidic channels, which have two parallel electrodes at the walls, are used to create electric fields across the interface of oil and water continuously supplied into the channels. Depending on the Reynolds (Re) and Weber (We) numbers of oil and water, we observe different formations of the interface. Once we find the optimal Re and We to create a planar interface in the channel, we apply an electric field across the interface for EPD of CNTs and/or silver (Ag) nanorods dispersed in water. During EPD, particles migrate to the oil/water interface, where cross-linking of polymers is induced to form composite hydrogel membranes. Properties of the composite hydrogel films are controlled by electric fields, CNT concentrations, and both Re and We numbers, allowing for continuous production. This fabrication method is effective to create composite polymer membranes placed in microfluidic devices with tunable electrical, mechanical, and biological properties. Potential applications include fabrication of doped hydrogels for drug delivery, conductive hydrogels for biological sensing, and electron permeable membranes for water splitting and osmotic power generation.

  20. Barium hexaferrite suspensions for electrophoretic deposition.

    PubMed

    Ovtar, Simona; Lisjak, Darja; Drofenik, Miha

    2009-09-15

    In this investigation we have looked at the preparation of barium hexaferrite suspensions, with the stability of the magnetic barium hexaferrite particles being increased by the addition of a surfactant, dodecylbenzylsulfonic acid (DBSA). The influence of the solubility DBSA in different solvents and its adsorption onto the surfaces of particles with different sizes were determined from zeta-potential measurements. The most suitable and stable suspensions of barium hexaferrite particles, regardless of their sizes, were obtained in 1-butanol, and these were then used for a subsequent electrophoretic deposition. The microstructures of the deposits were examined with electron microscopy. The thickness and density of the deposits as a function of the electric field, the zeta-potential, the particle size, and the separation distance between the electrodes were investigated. The thickness of the deposits was found to increase with the increasing zeta-potential of the suspension and with the increasing separation distance between the electrodes. Denser deposits were obtained from the suspensions of smaller particles that had narrower particle size distributions.

  1. Preparation and application of microcapsule-encapsulated color electrophortic fluid in Isopar M system for electrophoretic display

    NASA Astrophysics Data System (ADS)

    Sun, Cui; Feng, Ya-Qing; Zhang, Bao; Li, Xiang-Gao; Shao, Ji-Zhou; Han, Jing-Jing; Chen, Xu

    2013-05-01

    The use of Isopar M as a liquid suspending fluid for electrophoretic display was studied. The dispersion stability and chargeability of pigments suspended in Isopar M were investigated. Polyisobutylene monosuccinimide (T-151) as the charge control additive in Isopar M electrophoretic fluid can provide a good electrophoretic mobility to the particles. The wall materials of a series of blue-white, red-white and yellow-white dual-particle microcapsules were prepared by in situ polymerization of urea and formaldehyde. The mass ratio of wall/core material was a key factor in influencing the yield of microcapsules. The concentration of resorcinol has an impact on the surface morphology and mechanical strength of microcapsule wall. Microcapsules' surface morphologies were characterized by optical microscopy and scanning electron microscopy. The performance of the microcapsules with different binder materials and adhesive layers were investigated. Contrast ratio of microcapsules display device were tested every 10 days for a period of 90 days. The compatibility of Isopar M with both the electrophoretic particles and bounding capsule was studied.

  2. Molecular analysis and physicochemical properties of electrophoretic variants of wild soybean Glycine soja storage proteins.

    PubMed

    Fukuda, Takako; Maruyama, Nobuyuki; Kanazawa, Akira; Abe, Jun; Shimamoto, Yoshiya; Hiemori, Miki; Tsuji, Hideaki; Tanisaka, Takatoshi; Utsumi, Shigeru

    2005-05-04

    Cultivated soybeans (Glycine max) are derived from wild soybeans (Glycine soja) and can be crossed with them to produce fertile offspring. The latter exhibit greater genetic variation than the former, suggesting a possibility that wild soybeans contain storage proteins with properties different from and better than those of cultivated soybeans. To identify a wild soybean suitable for breeding a new soybean cultivar, we analyzed seed proteins from 390 lines of wild soybeans by electrophoresis. We found some lines containing electrophoretic variants of glycinin and beta-conglycinin subunits: one line containing a small alpha' subunit of beta-conglycinin and two and five lines containing small A3 and large A4 polypeptides of glycinin, respectively. Beta-Conglycinin and glycinin containing such variant subunits exhibited solubility and emulsifying ability similar to those of the predominant types of wild and cultivated soybeans. Glycinins containing small A3 and large A4 gave a shoulder derived from the start of denaturation at a temperature 4 degrees C lower than that of glycinin from the predominant types of wild and cultivated soybeans, although their thermal denaturation midpoint temperatures were very similar to each other. Cloning and sequencing of the predominant and variant subunit cDNAs revealed that the small alpha' and the small A3 lacked 24 amino acid residues in the extension region and four amino acid residues in the hypervariable region, respectively, and that the large A4 did not have an insert corresponding to the difference in the electrophoretic mobility but Arg279 and Gln305 were replaced by glutamine and histidine, respectively, in the hypervariable region. These suggest that small differences even in the hypervariable region can affect the thermal stability, as well as the electrophoretic mobilities, of the proteins.

  3. Cell and Particle Interactions and Aggregation During Electrophoretic Motion

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.

    2000-01-01

    The objectives of this research were (i) to perform experiments for observing and quantifying electrophoretic aggregation, (ii) to develop a theoretical description to appropriately analyze and compare with the experimental results, (iii) to study the combined effects of electrophoretic and gravitational aggregation of large particles, and the combined effects of electrophoretic and Brownian aggregation of small particles, and (iv) to perform a preliminary design of a potential future flight experiment involving electrophoretic aggregation. Electrophoresis refers to the motion of charged particles, droplets or molecules in response to an applied electric field. Electrophoresis is commonly used for analysis and separation of biological particles or molecules. When particles have different surface charge densities or potentials, they will migrate at different velocities in an electric field. This differential migration leads to the possibility that they will collide and aggregate, thereby preventing separation.

  4. Homodimer of p50 (NF kappa B1) does not introduce a substantial directed bend into DNA according to three different experimental assays.

    PubMed Central

    Kuprash, D V; Rice, N R; Nedospasov, S A

    1995-01-01

    Transcription factors can distort the conformation of the DNA double helix upon binding to their target sites. Previously, studies utilizing circular permutation--electrophoretic mobility shift assay suggested that the homodimer of p50 (NF kappa B1), canonical NF-kappa B (p65-p50), as well as several non-canonical NF-kappa B/Rel complexes, may induce substantial DNA bending at the binding site. Here we have applied three additional experimental approaches, helical phasing analysis, minicircle binding and cyclization kinetics, and conclude that the homodimer of p50 introduces virtually no directed bend into the consensus kappa B sequences GGGACTTTCC or GGGAATTCCC. Images PMID:7885838

  5. Evaluation of aptamers as molecular recognition elements for pathogens using capillary electrophoretic analysis

    NASA Astrophysics Data System (ADS)

    McMasters, Sun; Stratis-Cullum, Dimitra N.

    2006-10-01

    The biomolecular interactions between a fluorescently labeled aptamer and whole cell Campylobacter jejuni(C. jejuni) have been characterized using capillary electrophoresis with laser-induced fluorescence detection. From electrophoretic analysis, the bound complex forms, unbound aptamer, and cells were visualized. The relative binding affinity of the DNA aptamer with C. jejuni was compared with other food-borne pathogens including Escherichia coli O157:H7 and Salmonella typhimurium. Preliminary data suggests that this aptamer exhibits strong binding affinity towards C. jejuni with minimal cross reactivity over other food pathogens when equivalent cell concentrations were used.

  6. Small polydispersed circular DNA contains strains of mobile genetic elements and occurs more frequently in permanent cell lines of malignant tumors than in normal lymphocytes.

    PubMed

    Schmidt, Hannelore; Taubert, Helge; Lange, Heidemarie; Kriese, Karen; Schmitt, Wolfgang Daniel; Hoffmann, Steve; Bartel, Frank; Hauptmann, Steffen

    2009-08-01

    Small polydispersed circular DNA (spcDNA) belongs to the extrachromosomal pool of DNA and is composed of heterogeneous DNA circles. Whether spcDNA has a special function is currently unclear but their occurrence was suggested to be linked to genetic instability. In this study we investigated as to whether human lymphocytes from healthy volunteers also harbour spcDNA and whether spcDNA is present in all permanent cell lines from human normal and malignant tissues. Moreover, we were interested to see whether spcDNA contains sequences of mobile genetic elements. Our results show that spcDNA is present in all samples investigated yet the amount is lower in normal lymphocytes when compared to cancer cell lines (5.4 vs. 17.8%). Alu sequences were present in 12/16 cancer cell lines whereas LINE-1 (L1) sequences were present in 15 of them. Six tumor cell lines also contained telomeric sequences. In contrast to that, spcDNA of normal lymphocytes contains Alu and L1 sequences only in 3/16 cases and no telomeric sequences at all. Our findings suggest a direct dependency of the amount of Alu and L1 sequences on that of spcDNA. Beside these repetitive sequences, sequencing of spcDNA revealed in most cases chromosomal sequences of almost all chromosomes without an increased frequency of single regions. We suggest that the whole spcDNA including retrotranspositional elements and telomeric sequences may play a role for chromosomal rearrangements and genomic instability.

  7. Capillary electrophoretic and computational study of the complexation of valinomycin with rubidium cation.

    PubMed

    Ehala, Sille; Dybal, Jirí; Makrlík, Emanuel; Kasicka, Václav

    2009-03-01

    This study is focused on the characterization of interactions of valinomycin (Val), a macrocyclic dodecadepsipeptide antibiotic ionophore, with rubidium cation, Rb(+). Capillary affinity electrophoresis was employed for the experimental evaluation of the strength of the Val-Rb(+) complex. The study involved the measurement of the change of effective electrophoretic mobility of Val at increasing concentration of Rb(+) cation in the BGE. From the dependence of Val effective electrophoretic mobility on the Rb(+) cation concentration in the BGE (methanolic solution of 100 mM Tris, 50 mM acetic acid, 0-1 mM RbCl), the apparent binding (stability) constant (K(b)) of the Val-Rb(+) complex in methanol was evaluated as log K(b)=4.63+/-0.27. According to the quantum mechanical density functional theory calculations employed to predict the most probable structure of Val-Rb(+) complex, Val is stabilized by strong non-covalent bond interactions of Rb(+) with six ester carbonyl oxygen atoms so that the position of the "central" Rb(+) cation in the Val cage is symmetric.

  8. Identification of AML-1 and the (8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins: the runt homology domain is required for DNA binding and protein-protein interactions.

    PubMed Central

    Meyers, S; Downing, J R; Hiebert, S W

    1993-01-01

    The AML1 gene on chromosome 21 is disrupted in the (8;21)(q22;q22) translocation associated with acute myelogenous leukemia and encodes a protein with a central 118-amino-acid domain with 69% homology to the Drosophila pair-rule gene, runt. We demonstrate that AML-1 is a DNA-binding protein which specifically interacts with a sequence belonging to the group of enhancer core motifs, TGT/cGGT. Electrophoretic mobility shift analysis of cell extracts identified two AML-1-containing protein-DNA complexes whose electrophoretic mobilities were slower than those of complexes formed with AML-1 produced in vitro. Mixing of in vitro-produced AML-1 with cell extracts prior to gel mobility shift analysis resulted in the formation of higher-order complexes. Deletion mutagenesis of AML-1 revealed that the runt homology domain mediates both sequence-specific DNA binding and protein-protein interactions. The hybrid product, AML-1/ETO, which results from the (8;21) translocation and retains the runt homology domain, both recognizes the AML-1 consensus sequence and interacts with other cellular proteins. Images PMID:8413232

  9. The in vitro DNA binding properties of NDP kinase are related to its oligomeric state.

    PubMed

    Mesnildrey, S; Agou, F; Véron, M

    1997-11-24

    Genetic and biochemical evidences suggest that the enzymatic activity of NDP kinase is necessary but not sufficient for its biological function. While the human NDPK-B binds specifically single-strand polypyrimidines sequences, the hexameric enzyme from Dictyostelium does not. We demonstrated by electrophoretic mobility shift assay and filter binding assay that a dimeric mutant from Dictyostelium binds to an oligodesoxynucleotide while the wild-type does not. These data suggest that the differences in the DNA binding properties of several eucaryotic NDP kinases might be correlated to the differences in the stability of their hexameric structure.

  10. Understanding local forces in electrophoretic ink systems: utilizing optical tweezers to explore electrophoretic display devices

    NASA Astrophysics Data System (ADS)

    Wei, David L.; Dickinson, Mark R.; Smith, N.; Gleeson, Helen F.

    2016-09-01

    Optical tweezers can be used as a valuable tool to characterize electrophoretic display (EPD) systems. EPDs are ubiquitous with e-readers and are becoming a commonplace technology where reflective, low-power displays are required; yet the physics of some features crucial to their operation remains poorly defined. We utilize optical tweezers as a tool to understand the motion of charged ink particles within the devices and show that the response of optically trapped electrophoretic particles can be used to characterize electric fields within these devices. This technique for mapping the force can be compared to simulations of the electric field in our devices, thus demonstrating that the electric field itself is the sole governor of the particle motion in an individual-particle regime. By studying the individual-particle response to the electric field, we can then begin to characterize particle motion in `real' systems with many particles. Combining optical tweezing with particle tracking techniques, we can investigate deviations in many particle systems from the single-particle case.

  11. Visualizing inhibition of nucleosome mobility and transcription by cisplatin-DNA interstrand crosslinks in live mammalian cells.

    PubMed

    Zhu, Guangyu; Song, Lina; Lippard, Stephen J

    2013-07-15

    Cisplatin is a widely used anticancer drug that acts by binding DNA and causing the formation of intrastrand and interstrand (ICL) crosslinks, but the precise downstream effects of the latter damage are not well understood. In this study, we investigated the influence of cisplatin ICLs on synthetic nucleosomes that were platinated in a site-specific manner in vitro and on gene transcription in live mammalian cells. Nucleosome core particles that we constructed contained site-specific cisplatin 5'-d(G*pC)/5'-d(G*pC) ICLs, where the asterisk denotes the platinated nucleoside, to examine the influence of platinum lesions on the dynamic behavior of nucleosomes in solution. A cisplatin ICL, but not a 1,2-d(GpG) crosslink, significantly inhibited ATP-independent histone octamer-DNA sliding. We also used a novel linearization-recircularization strategy described here to synthesize mammalian expression vectors containing site-specific cisplatin ICLs. Plasmid vectors were tested in live mammalian cells to study the transcription inhibition effects of cisplatin ICLs in the context of two different repair backgrounds. Cisplatin ICLs inhibit transcription as effectively as 1,2-d(GpG) crosslinks. We determined that nucleotide excision repair plays a key role in the removal of cisplatin ICLs, acting in a replication-independent fashion. We also found that loss of mismatch repair function dramatically attenuates the transcription inhibition effects by cisplatin ICLs but not 1,2-d(GpG) intrastrand crosslinks. Our results revealed the unique properties of cisplatin ICLs on nucleosome mobility and on transcription, and they defined how these adducts act in a manner completely different from that used for cisplatin 1,2-d(GpG) crosslinks. These new findings provide direct support for a role of ICLs in the pharmacologic activities of cisplatin, despite the lower frequency of their formation.

  12. Effect of long-term removal of iron from asbestos by desferrioxamine B on subsequent mobilization by other chelators and induction of DNA single-strand breaks.

    PubMed

    Chao, C C; Aust, A E

    1994-01-01

    The long-term removal of iron from crocidolite or amosite by desferrioxamine B (DF) at pH 7.5 or 5.0 was studied. Crocidolite or amosite (1 mg/ml) was suspended in 50 mM NaCl at pH 7.5 or 5.0 with the addition of 1 mM DF for up to 90 days. Although the rate of iron mobilization decreased with time, iron was continuously mobilized from both forms of asbestos at pH 5.0 or 7.5. The amount of iron mobilized from crocidolite was at least twice that mobilized from amosite at either pH. Iron was mobilized more rapidly from crocidolite at pH 5.0 than at 7.5 for the first 15 days, but at later times the amount being mobilized at pH 7.5 became equal to or slightly greater than that at 5.0. For amosite, the mobilization at pH 5.0 was always greater than that at pH 7.5. Next, the effect of iron removal from asbestos by DF on subsequent iron mobilization by a second chelator (EDTA or citrate) and on induction of DNA single-strand breaks (SSBs) was studied. Asbestos, treated for up to 15 days with DF at pH 7.5, was washed to remove ferrioxamine and excess DF, then incubated with EDTA or citrate (1 mM). The rates of iron mobilization from both forms of asbestos by a second chelator decreased as more and more iron was removed by DF. Induction of DNA SSBs also decreased, reflecting the unavailability of iron to catalyze the damage. The results suggest three things. First, if long-term mobilization of iron from asbestos occurs in vivo as has been observed in vitro, it may play a role in the long-term biological effects of asbestos. Second, more rapid mobilization of iron from asbestos fibers may occur when the fibers are phagocytized by cells and maintained in phagosomes where the pH is 4.0-5.0. Third, treatment of asbestos by iron chelators, such as DF, prior to exposure to cultured cells or whole animals, may reduce the biological effects of asbestos resulting from iron, but may not completely eliminate them.

  13. Hybrid nano-composites made of ss-DNA/wrapped carbon nanotubes and titania.

    PubMed

    Romio, Martina; Mesa, Camillo La

    2017-04-01

    Multi-walled carbon nanotubes, MWCNTs, are stabilized thanks to the surface wrapping of single-strand DNA, ss-DNA; the resulting adducts are kinetically and thermodynamically stable Such entities build up nano-hybrids with titania, TiO2, nano-particles, in presence of surfactant as an adjuvant. The conditions leading to TiO2 adsorption onto ss-DNA/CNTs were investigated, by optimizing the concentration of adducts, nano-particles (NPs), and of the cationic surfactant (CTAB). Controlling the working conditions makes possible to get homogeneously organized hybrids. Characterization by DLS, electro-phoretic mobility, SEM and AFM clarified the surfactant-assisted association modes between adducts and CTAB-functionalized TiO2. Nano-particles' clustering onto DNA-wrapped adducts gives hybrids trough electrostatic interactions. Surface coverage by TiO2 is significant and homogeneous. It is expected that the reported hybrids can be useful for applications in heterogeneous catalysis.

  14. Impact of radiofrequency radiation on DNA damage and antioxidants in peripheral blood lymphocytes of humans residing in the vicinity of mobile phone base stations.

    PubMed

    Zothansiama; Zosangzuali, Mary; Lalramdinpuii, Miriam; Jagetia, Ganesh Chandra

    2017-01-01

    Radiofrequency radiations (RFRs) emitted by mobile phone base stations have raised concerns on its adverse impact on humans residing in the vicinity of mobile phone base stations. Therefore, the present study was envisaged to evaluate the effect of RFR on the DNA damage and antioxidant status in cultured human peripheral blood lymphocytes (HPBLs) of individuals residing in the vicinity of mobile phone base stations and comparing it with healthy controls. The study groups matched for various demographic data including age, gender, dietary pattern, smoking habit, alcohol consumption, duration of mobile phone use and average daily mobile phone use. The RF power density of the exposed individuals was significantly higher (p < 0.0001) when compared to the control group. The HPBLs were cultured and the DNA damage was assessed by cytokinesis blocked micronucleus (MN) assay in the binucleate lymphocytes. The analyses of data from the exposed group (n = 40), residing within a perimeter of 80 m of mobile base stations, showed significantly (p < 0.0001) higher frequency of micronuclei when compared to the control group, residing 300 m away from the mobile base station/s. The analysis of various antioxidants in the plasma of exposed individuals revealed a significant attrition in glutathione (GSH) concentration (p < 0.01), activities of catalase (CAT) (p < 0.001) and superoxide dismutase (SOD) (p < 0.001) and rise in lipid peroxidation (LOO) when compared to controls. Multiple linear regression analyses revealed a significant association among reduced GSH concentration (p < 0.05), CAT (p < 0.001) and SOD (p < 0.001) activities and elevated MN frequency (p < 0.001) and LOO (p < 0.001) with increasing RF power density.

  15. Mediation of growth factor induced DNA synthesis and calcium mobilization by Gq and Gi2

    PubMed Central

    1993-01-01

    A newly identified subclass of the heterotrimeric GTP binding regulatory protein family, Gq, has been found to be expressed in a diverse range of cell types. We investigated the potential role of this protein in growth factor signal transduction pathways and its potential relationship to the function of other G alpha subclasses. Recent biochemical studies have suggested that Gq regulates the beta 1 isozyme of phospholipase C (PLC beta 1), an effector for some growth factors. By microinjection of inhibitory antibodies specific to distinct G alpha subunits into living cells, we have determined that G alpha q transduces bradykinin- and thrombin-stimulated intracellular calcium transients which are likely to be mediated by PLC beta 1. Moreover, we found that G alpha q function is required for the mitogenic action of both of these growth factors. These results indicate that both thrombin and bradykinin utilize Gq to couple to increases in intracellular calcium, and that Gq is a necessary component of the mitogenic action of these factors. While microinjection of antibodies against G alpha i2 did not abolish calcium transients stimulated by either of these factors, such microinjection prevented DNA synthesis in response to thrombin but not to bradykinin. These data suggest that thrombin- induced mitogenesis requires both Gq and Gi2, whereas bradykinin needs only the former. Thus, different growth factors operating upon the same cell type use overlapping yet distinct sets of G alpha subtypes in mitogenic signal transduction pathways. The direct identification of the coupling of both a pertussis toxin sensitive and insensitive G protein subtype in the mitogenic pathways utilized by thrombin offers an in vivo biochemical clarification of previous results obtained by pharmacologic studies. PMID:8458876

  16. Column-coupling strategies for multidimensional electrophoretic separation techniques.

    PubMed

    Kler, Pablo A; Sydes, Daniel; Huhn, Carolin

    2015-01-01

    Multidimensional electrophoretic separations represent one of the most common strategies for dealing with the analysis of complex samples. In recent years we have been witnessing the explosive growth of separation techniques for the analysis of complex samples in applications ranging from life sciences to industry. In this sense, electrophoretic separations offer several strategic advantages such as excellent separation efficiency, different methods with a broad range of separation mechanisms, and low liquid consumption generating less waste effluents and lower costs per analysis, among others. Despite their impressive separation efficiency, multidimensional electrophoretic separations present some drawbacks that have delayed their extensive use: the volumes of the columns, and consequently of the injected sample, are significantly smaller compared to other analytical techniques, thus the coupling interfaces between two separations components must be very efficient in terms of providing geometrical precision with low dead volume. Likewise, very sensitive detection systems are required. Additionally, in electrophoretic separation techniques, the surface properties of the columns play a fundamental role for electroosmosis as well as the unwanted adsorption of proteins or other complex biomolecules. In this sense the requirements for an efficient coupling for electrophoretic separation techniques involve several aspects related to microfluidics and physicochemical interactions of the electrolyte solutions and the solid capillary walls. It is interesting to see how these multidimensional electrophoretic separation techniques have been used jointly with different detection techniques, for intermediate detection as well as for final identification and quantification, particularly important in the case of mass spectrometry. In this work we present a critical review about the different strategies for coupling two or more electrophoretic separation techniques and the

  17. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    PubMed

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery.

  18. New insight into multifunctional role of peroxiredoxin family protein: Determination of DNA protection properties of bacterioferritin comigratory protein under hyperthermal and oxidative stresses

    SciTech Connect

    Lee, Sangmin; Chung, Jeong Min; Yun, Hyung Joong; Won, Jonghan; Jung, Hyun Suk

    2016-01-22

    Bacterioferritin comigratory protein (BCP) is a monomeric conformer acting as a putative thiol-dependent bacterial peroxidase, however molecular basis of DNA-protection via DNA-binding has not been clearly understood. In this study, we characterized the DNA binding properties of BCP using various lengths and differently shaped architectures of DNA. An electrophoretic mobility shift assay and electron microscopy analysis showed that recombinant TkBCP bound to DNA of a circular shape (double-stranded DNA and single-stranded DNA) and a linear shape (16–1000 bp) as well as various architectures of DNA. In addition, DNA protection experiments indicated that TkBCP can protect DNA against hyperthermal and oxidative stress by removing highly reactive oxygen species (ROS) or by protecting DNA from thermal degradation. Based on these results, we suggest that TkBCP is a multi-functional DNA-binding protein which has DNA chaperon and antioxidant functions. - Highlights: • Bacterioferritin comigratory protein (BCP) protects DNA from oxidative stress by reducing ROS. • TkBCP does not only scavenge ROS, but also protect DNA from hyperthermal stress. • BCP potentially adopts the multi-functional role in DNA binding activities and anti-oxidant functions.

  19. Particle Aggregation due to Combined Gravitational and Electrophoretic Motion

    PubMed

    Wang; Zeng; Loewenberg; Davis

    1997-03-01

    The stability and pairwise aggregation rates of small spherical particles in a heterogeneous suspension under the collective effects of gravitational motion and electrophoretic migration are analyzed. The particles are assumed to be non-Brownian, with thin, unpolarized double layers and different zeta potentials. The gravity vector and the electric field are assumed to be oriented in either the same direction or opposite directions. The particle aggregation rates are always enhanced by the presence of an electric field for parallel alignment of the gravitational and electrophoretic velocities. For antiparallel alignment with the magnitude of the gravitational relative velocity exceeding the magnitude of the electrophoretic relative velocity between two widely separated particles, the particle aggregation rates are reduced by the presence of the electric field, and there is a "collision-forbidden" region in parameter space due to stronger hydrodynamic interactions of the particles for gravitational motion than for electrophoretic motion. For antiparallel alignment with the magnitude of the electrophoretic relative velocity exceeding the magnitude of the gravitational relative velocity between two widely separated particles, the particle aggregation rates are enhanced by the presence of the electric field.

  20. Dimerization of the Klenow fragment of Escherichia coli DNA polymerase I is linked to its mode of DNA binding.

    PubMed

    Bailey, Michael F; Van der Schans, Edwin J C; Millar, David P

    2007-07-10

    Upon associating with a proofreading polymerase, the nascent 3' end of a DNA primer/template has two possible fates. Depending upon its suitability as a substrate for template-directed extension or postsynthetic repair, it will bind either to the 5'-3' polymerase active site, yielding a polymerizing complex, or to the 3'-5' exonuclease site, yielding an editing complex. In this investigation, we use a combination of biochemical and biophysical techniques to probe the stoichiometry, thermodynamic, and kinetic stability of the polymerizing and editing complexes. We use the Klenow fragment of Escherichia coli DNA polymerase I (KF) as a model proofreading polymerase and oligodeoxyribonucleotide primer/templates as model DNA substrates. Polymerizing complexes are produced by mixing KF with correctly base paired (matched) primer/templates, whereas editing complexes are produced by mixing KF with multiply mismatched primer/templates. Electrophoretic mobility shift titrations carried out with matched and multiply mismatched primer/templates give rise to markedly different electrophoretic patterns. In the case of the matched primer/template, the KF.DNA complex is represented by a slow moving band. However, in the case of the multiply mismatched primer/template, the complex is predominantly represented by a fast moving band. Analytical ultracentrifugation measurements indicate that the fast and slow moving bands correspond to 1:1 and 2:1 KF.DNA complexes, respectively. Fluorescence anisotropy titrations reveal that KF binds with a higher degree of cooperativity to the matched primer/template. Taken together, these results indicate that KF is able to dimerize on a DNA primer/template and that dimerization is favored when the first molecule is bound in the polymerizing mode, but disfavored when it is bound in the editing mode. We suggest that self-association of the polymerase may play an important and as yet unexplored role in coordinating high-fidelity DNA replication.

  1. Electrophoretic interactions and aggregation of colloidal biological particles

    NASA Technical Reports Server (NTRS)

    Davis, Robert H.; Nichols, Scott C.; Loewenberg, Michael; Todd, Paul

    1994-01-01

    The separation of cells or particles from solution has traditionally been accomplished with centrifuges or by sedimentation; however, many particles have specific densities close to unity, making buoyancy-driven motion slow or negligible, but most cells and particles carry surface charges, making them ideal for electrophoretic separation. Both buoyancy-driven and electrophoretic separation may be influenced by hydrodynamic interactions and aggregation of neighboring particles. Aggregation by electrophoresis was analyzed for two non-Brownian particles with different zeta potentials and thin double layers migrating through a viscous fluid. The results indicate that the initial rate of electrophoretically-driven aggregation may exceed that of buoyancy-driven aggregation, even under conditions in which buoyancy-driven relative motion of noninteracting particles is dominant.

  2. Electrophoretic gel image analysis software for the molecular biology laboratory.

    PubMed

    Redman, T; Jacobs, T

    1991-06-01

    We present GelReader 1.0, a microcomputer program designed to make precision, digital analysis of one-dimensional electrophoretic gels accessible to the molecular biology laboratory of modest means. Images of electrophoretic gels are digitized via a desktop flatbed scanner from instant photographs, autoradiograms or chromogenically stained blotting media. GelReader is then invoked to locate lanes and bands and generate a report of molecular weights of unknowns, based on specified sets of standards. Frequently used standards can be stored in the program. Lanes and bands can be added or removed, based upon users' subjective preferences. A unique lane histogram feature facilitates precise manual addition of bands missed by the software. Image enhancement features include palette manipulation, histogram equalization, shadowing and magnification. The user interface strikes a balance between program autonomy and user intervention, in recognition of the variability in electrophoretic gel quality and users' analytical needs.

  3. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  4. DNA.

    ERIC Educational Resources Information Center

    Felsenfeld, Gary

    1985-01-01

    Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

  5. Evolution of group I introns in Porifera: new evidence for intron mobility and implications for DNA barcoding.

    PubMed

    Schuster, Astrid; Lopez, Jose V; Becking, Leontine E; Kelly, Michelle; Pomponi, Shirley A; Wörheide, Gert; Erpenbeck, Dirk; Cárdenas, Paco

    2017-03-20

    Mitochondrial introns intermit coding regions of genes and feature characteristic secondary structures and splicing mechanisms. In metazoans, mitochondrial introns have only been detected in sponges, cnidarians, placozoans and one annelid species. Within demosponges, group I and group II introns are present in six families. Based on different insertion sites within the cox1 gene and secondary structures, four types of group I and two types of group II introns are known, which can harbor up to three encoding homing endonuclease genes (HEG) of the LAGLIDADG family (group I) and/or reverse transcriptase (group II). However, only little is known about sponge intron mobility, transmission, and origin due to the lack of a comprehensive dataset. We analyzed the largest dataset on sponge mitochondrial group I introns to date: 95 specimens, from 11 different sponge genera which provided novel insights into the evolution of group I introns. For the first time group I introns were detected in four genera of the sponge family Scleritodermidae (Scleritoderma, Microscleroderma, Aciculites, Setidium). We demonstrated that group I introns in sponges aggregate in the most conserved regions of cox1. We showed that co-occurrence of two introns in cox1 is unique among metazoans, but not uncommon in sponges. However, this combination always associates an active intron with a degenerating one. Earlier hypotheses of HGT were confirmed and for the first time VGT and secondary losses of introns conclusively demonstrated. This study validates the subclass Spirophorina (Tetractinellida) as an intron hotspot in sponges. Our analyses confirm that most sponge group I introns probably originated from fungi. DNA barcoding is discussed and the application of alternative primers suggested.

  6. Cytogenetic evaluation and DNA interaction studies of the food colorants amaranth, erythrosine and tartrazine.

    PubMed

    Mpountoukas, Panagiotis; Pantazaki, Anastasia; Kostareli, Efterpi; Christodoulou, Pantelitsa; Kareli, Dimitra; Poliliou, Stamatia; Mourelatos, Costas; Lambropoulou, Vasso; Lialiaris, Theodore

    2010-10-01

    Food coloring agents, amaranth, erythrosine and tartrazine have been tested at 0.02-8mM in human peripheral blood cells in vitro, in order to investigate their genotoxic, cytotoxic and cytostatic potential. Amaranth at the highest concentration (8mM) demonstrates high genotoxicity, cytostaticity and cytotoxicity. The frequency of SCEs/cell was increased 1.7 times over the control level. Additionally, erythrosine at 8, 4 and 2mM shows a high cytotoxicity and cytostaticity. Finally, tartrazine seems to be toxic at 8 and 4mM. No signs of genotoxicity were observed. Reversely, tartrazine showed cytotoxicity at 1 and 2mM. Furthermore, spectroscopic titration studies for the interaction of these food additives with DNA showed that these dyes bind to calf thymus DNA and distinct isosbestic points are observed clearly suggesting binding of the dyes to DNA. Additionally DNA electrophoretic mobility experiments showed that these colorants are obviously capable for strong binding to linear dsDNA causing its degradation. PCR amplification of all DNA fragments (which previously were pre-treated with three different concentrations of the colorants, extracted from agarose gel after separation and then purified), seems to be attenuated with a manner dye concentration-dependent reflecting in a delayed electrophoretic mobility due to the possible binding of some molecules of the dyes. Evaluation of the data and curves were obtained after quantitative and qualitative analysis of the lanes of the gel by an analyzer computer program. Our results indicate that these food colorants had a toxic potential to human lymphocytes in vitro and it seems that they bind directly to DNA.

  7. Hydrogen peroxide agarose gels for electrophoretic analysis of RNA.

    PubMed

    Pandey, Renu; Saluja, Daman

    2017-10-01

    Efficient electrophoretic separation of isolated total RNA utilizes chemicals and agents to aid in nuclease free environment. However cost, extensive pre-run processing protocols as well as toxic byproducts limit the usage of such protocols. Moreover, these treatments affect the overall electrophoretic results by altering the conductivity of the running buffer and weaken the gel strength. We here provide a protocol for RNA visualization that obviates these shortcomings by preparation of agarose gel with hydrogen peroxide using the regular TAE buffer. The simple, inexpensive protocol exhibits superior results in a horizontal agarose gel electrophoresis. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Long DNA Molecules at Liquid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Li, B.; Sokolov, J.; Rafailovich, M.; Chu, B.

    2006-03-01

    The electrophoresis of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1] in the regime of strong electrostatic interaction. The mobility of lambda- DNA molecules on this surface was found to scale as the square root of the persistent length with the ionic strength at high buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2-4]. At low buffer concentrations the DNA chains are stretched .The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface as found to be higher then for the shorter ones in the electric field. [1]. N. Pernodet, V. Samuilov, K. Shin, et al. Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, et al. Electrophoresis, 23 (2002) 2618-2625. [3] Y.-S. Seo, H.. Luo, V. A. Samuilov, et al. DNA Electrophoresis on nanopatterned surfaces, Nano Letters, 4, 2004, 659-664.

  9. Fine encapsulation of dual-particle electronic ink by incorporating block copolymer for electrophoretic display application.

    PubMed

    Yin, Pei-Pei; Wu, Gang; Dai, Run-Ying; Qin, Wen-Long; Wang, Mang; Chen, Hong-Zheng

    2012-12-15

    The design of the oppositely charged ink particles based on titanium dioxide and carbon black for the monochrome electrophoretic display (EPD) was reported. The white ink particles with acidic surface and black ink particles with basic surface were synthesized and sterically stabilized by long alkyl chains, which were charged oppositely by mixing with basic surfactant (OLOA 1200) and acidic surfactant (Span 80), respectively. The electrophoretic mobility and the Zeta potential were -3.87×10(-10)m(2)V(-1)s(-1) and -25.1 mV for the white ink particles, 3.79×10(-10)m(2)V(-1)s(-1) and 24.6 mV for the black ink particles. In addition, the block copolymer, poly(lauryl methacrylate)-b-poly(2-(dimethylamino)ethyl methacrylate) (PLMA-b-PDMAEMA) synthesized by atom transfer radical polymerization (ATRP), was first incorporated in the modification of the pigments for the fine encapsulation. Then, a stable dual-particle electronic ink with contrast ratio of 120:1 was prepared and encapsulated with the gelatin (GE)/sodium carboxymethylcellulose (NaCMC)/sodium dodecyl sulfate (SDS) microcapsules by complex coacervation method. Finally, the matrix character display prototype driven at a low voltage exhibited excellent performance, the contrast ratio of which was 8:1 at 9 V DC. Copyright © 2012 Elsevier Inc. All rights reserved.

  10. Importance of temperature effect on the electrophoretic behavior of charge-regulated particles.

    PubMed

    Hsu, Jyh-Ping; Tai, Yi-Hsuan; Yeh, Li-Hsien; Tseng, Shiojenn

    2012-01-10

    The Joule heating effect is inevitable in electrophoresis operations. To assess its influence on the performance of electrophoresis, we consider the case of a charge-regulated particle in a solution containing multiple ionic species at temperatures ranging from 298 to 308 K. Using an aqueous SiO(2) dispersion as an example, we show that an increase in the temperature leads to a decrease in both the dielectric constant and the viscosity of the liquid phase, and an increase in both the diffusivity of ions and the particle surface potential. For a particle having a constant surface potential, its electrophoretic mobility is most influenced by the variation in the liquid viscosity as the temperature varies, but for a charged-regulated particle both the liquid viscosity and the surface potential can play an important role. Depending upon the level of pH, the degree of increase in the mobility can be on the order of 40% for a 5 K increase in the temperature. The presence of double-layer polarization, which is significant when the surface potential is sufficiently high, has the effect of inhibiting that increase in the mobility. This implies that the influence of the temperature on the mobility of the particle is most significant when the pH is close to the point of zero charge.

  11. Long DNA Molecules at Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Seo, Young-Soo; Samuilov, Vladimir; Sokolov, John; Rafailovich, Miriam; Chu, Ben

    2003-03-01

    The electrical transport of long DNA molecules was studied using a newly developed method of electrophoresis on flat surfaces [1]. We have shown that a flat silicon substrate, without any surface features, can be used to fractionate DNA on a liquid-solid interface. We determine that the ability of a flat surface to separate DNA molecules results from the local friction between the surface and the adsorbed DNA segments. The mobility of lambda- DNA molecules on this surface was found to scale as the persistent length with the ionic strength of the buffer. This experimental result indicates that at high buffer concentration the separation mechanism of solid-liquid interface electrophoresis is expected to be due to surface friction rather than biased reptation [2]. At low buffer concentrations the adsorbed DNA move in the electrical field parallel to the surface, and also due the electroosmotic convection that drags the DNA chains and they are stretched . The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu. DNA Electrophoresis on a Flat Surface, Physical Review Letters, 85 (2000) 5651-5654. [2] Y.-S. Seo, V.A. Samuilov, J. Sokolov, M. Rafailovich, B. Tinland, J. Kim, B. Chu. DNA separation at a liquid-solid interface, Electrophoresis, 23 (2002) 2618-2625.

  12. Separation of 1-23-kb complementary DNA strands by urea-agarose gel electrophoresis.

    PubMed

    Hegedüs, Eva; Kókai, Endre; Kotlyar, Alexander; Dombrádi, Viktor; Szabó, Gábor

    2009-09-01

    Double-stranded (ds), as well as denatured, single-stranded (ss) DNA samples can be analyzed on urea-agarose gels. Here we report that after denaturation by heat in the presence of 8 M urea, the two strands of the same ds DNA fragment of approximately 1-20-kb size migrate differently in 1 M urea containing agarose gels. The two strands are readily distinguished on Southern blots by ss-specific probes. The different migration of the two strands could be attributed to their different, base composition-dependent conformation impinging on the electrophoretic mobility of the ss molecules. This phenomenon can be exploited for the efficient preparation of strand-specific probes and for the separation of the complementary DNA strands for subsequent analysis, offering a new tool for various cell biological research areas.

  13. The yeast CDP1 gene encodes a triple-helical DNA-binding protein.

    PubMed

    Musso, M; Bianchi-Scarrà, G; Van Dyke, M W

    2000-11-01

    The formation of triple-helical DNA has been implicated in several cellular processes, including transcription, replication and recombination. While there is no direct evidence for triplexes in vivo, cellular proteins that specifically recognize triplex DNA have been described. Using a purine-motif triplex probe and southwestern library screening, we isolated five independent clones expressing the same C-terminal 210 amino acids of the Saccharomyces cerevisiae protein Cdp1p fused with beta-galactosidase. In electrophoretic mobility shift assays, recombinant Cdp1pDelta1-867 bound Pu-motif triplex DNAs with high affinity (K:(d) approximately 5 nM) and bound Py-motif triplex, duplex and single-stranded DNAs with far lower affinity (0.5-5.0 microM). Genetic analyses revealed that the CDP1 gene product was required for proper chromosome segregation. The possible involvement of triplex DNA in this process is discussed.

  14. Characterizing and Controlling the Motion of ssDNA in a Solid-State Nanopore

    PubMed Central

    Luan, Binquan; Martyna, Glenn; Stolovitzky, Gustavo

    2011-01-01

    Sequencing DNA in a synthetic solid-state nanopore is potentially a low-cost and high-throughput method. Essential to the nanopore-based DNA sequencing method is the ability to control the motion of a single-stranded DNA (ssDNA) molecule at single-base resolution. Experimental studies showed that the average translocation speed of DNA driven by a biasing electric field can be affected by ionic concentration, solvent viscosity, or temperature. Even though it is possible to slow down the average translocation speed, instantaneous motion of DNA is too diffusive to allow each DNA base to stay in front of a sensor site for its measurement. Using extensive all-atom molecular dynamics simulations, we study the diffusion constant, friction coefficient, electrophoretic mobility, and effective charge of ssDNA in a solid-state nanopore. Simulation results show that the spatial fluctuation of ssDNA in 1 ns is comparable to the spacing between neighboring nucleotides in ssDNA, which makes the sensing of a DNA base very difficult. We demonstrate that the recently proposed DNA transistor could potentially solve this problem by electrically trapping ssDNA inside the DNA transistor and ratcheting ssDNA base-by-base in a biasing electric field. When increasing the biasing electric field, we observed that the translocation of ssDNA changes from ratcheting to steady-sliding. The simulated translocation of ssDNA in the DNA transistor was theoretically characterized using Fokker-Planck analysis. PMID:22067161

  15. The Sulfolobus solfataricus radA paralogue sso0777 is DNA damage inducible and positively regulated by the Sta1 protein

    PubMed Central

    Abella, Marc; Rodríguez, Sonia; Paytubi, Sonia; Campoy, Susana; White, Malcolm F.; Barbé, Jordi

    2007-01-01

    Little is known about the regulation of the DNA damage-mediated gene expression in archaea. Here we report that the addition of actinomycin D to Sulfolobus solfataricus cultures triggers the expression of the radA paralogue sso0777. Furthermore, a specific retarded band is observed when electrophoretic mobility shift assays (EMSAs) with crude S. solfataricus cell extracts and the sso0777 promoter were carried out. The protein that binds to this promoter was isolated and identified as Sta1. Footprinting experiments have shown that the Sta1 DNA-binding site is included in the ATTTTTTATTTTCACATGTAAGATGTTTATT sequence, which is located upstream the putative TTG translation starting codon of the sso0777 gene. Additionally, gel electrophoretic mobility retardation experiments using mutant sso0777 promoter derivatives show the presence of three essential motifs (TTATT, CANGNA and TTATT) that are absolutely required for Sta1 DNA binding. Finally, in vitro transcription experiments confirm that Sta1 functions as an activator for sso0777 gene expression being the first identified archaeal regulatory protein associated with the DNA damage-mediated induction of gene expression. PMID:17921500

  16. Monodisperse light color nanoparticle ink toward chromatic electrophoretic displays

    NASA Astrophysics Data System (ADS)

    Peng, Bo; Li, Yue; Li, Jian; Bi, Lei; Lu, Haipeng; Xie, Jianliang; Ren, Xiangling; Cao, Yonghai; Wang, Ning; Meng, Xianwei; Deng, Longjiang; Guo, Zhanhu

    2016-05-01

    The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays.The facile synthesis of nanoparticles for precise image control and fast response of chromatic electrophoretic displays (EPDs) is a challenge. Herein, we report a general method to prepare pink, blue, and yellow nanoparticles with low density and a tunable size of 230-310 nm. The monodispersity is down to 0.02 and surface charges are up to 666e. Importantly, our work highlights the feasibility of chromatic nanoparticles as cost-effective candidates for electrophoretic displays. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr02524b

  17. Electrophoretic separation of human kidney cells at zero gravity

    NASA Technical Reports Server (NTRS)

    Barlow, G. H.; Lazer, S. L.; Rueter, A.; Allen, R. E.

    1977-01-01

    Electrophoretic isolation of cells results in a loss of resolution power caused by the sedimentation of the cells in the media. The results of an experiment to extract urokinase from human embryos during the Apollo Soyuz mission are presented and discussed.

  18. The greater negative charge density of DNA in tris-borate buffers does not enhance DNA condensation by multivalent cations.

    PubMed

    Schwinefus, J J; Bloomfield, V A

    2000-12-01

    As indicated by recent measurements of the electrophoretic free solution mobility, DNA appears to have a greater helical charge density in Tris-borate-EDTA (TBE) buffers than in Tris-acetate-EDTA (TAE) buffers. Since electrostatic forces play a major role in DNA packaging processes, we have investigated the condensation of closed circular plasmid DNA using total intensity and dynamic light scattering in Tris-borate, Tris-acetate, and Tris-cacodylate buffers with cobaltic hexa-amine (III) [Co(NH(3))(3+)(6)]. We find that neither the critical concentration of Co(NH(3))(3+)(6) nor the hydrodynamic radii of the resulting condensates vary significantly in the buffer systems studied here despite the prediction that DNA condensation should occur at significantly lower Co(NH(3))(3+)(6) concentrations in Tris-borate buffers. Assuming a persistence length behavior similar to B-DNA in the presence of multivalent cations, a decrease in the attractive counterion correlation pressure decay length in Tris-borate buffers does not account for our observations. It is possible that the binding of multivalent cations to DNA may hinder borate association with the DNA double helix.

  19. Investigation of the free flow electrophoretic process. Volume 2: Technical analysis

    NASA Technical Reports Server (NTRS)

    Weiss, R. A.; Lanham, J. W.; Richman, D. W.; Walker, C. D.

    1979-01-01

    The effect of gravity on the free flow electrophoretic process was investigated. The demonstrated effects were then compared with predictions made by mathematical models. Results show that the carrier buffer flow was affected by gravity induced thermal convection and that the movement of the separating particle streams was affected by gravity induced buoyant forces. It was determined that if gravity induced buoyant forces were included in the mathematical models, then effective predictions of electrophoresis chamber separation performance were possible. The results of tests performed using various methods of electrophoresis using supportive media show that the mobility and the ability to separate were essentially independent of concentration, providing promise of being able to perform electrophoresis with higher inlet concentrations in space.

  20. Computer simulation of two electrophoretic columns coupled for isoelectric focusing in simple buffers

    NASA Technical Reports Server (NTRS)

    Tsai, Amos; Mosher, Richard A.; Bier, Milan

    1986-01-01

    Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.

  1. Computer simulation of two electrophoretic columns coupled for isoelectric focusing in simple buffers

    NASA Technical Reports Server (NTRS)

    Tsai, Amos; Mosher, Richard A.; Bier, Milan

    1986-01-01

    Computer simulation is used to analyze a system of two electrophoretic columns coupled by mixing the anolyte of one with the catholyte of the other. A mathematical model is presented which is used to predict the pH gradients formed by monovalent buffers in this system, when the currents in the columns are unequal. In the column with the higher current a pH gradient is created which increases from anode to cathode and is potentially useful for isoelectric focusing. The breadth of this gradient is dependent upon the ratio of the currents. The function of the second column is the compensation of buffer migration which occurs in the first column, thereby maintaining constant electrolyte composition. The effects of buffer pKs and mobilities are evaluated.

  2. Correlation between esterase electrophoretic polymorphism and virulence-associated traits in extra-intestinal invasive strains of Escherichia coli.

    PubMed Central

    Goullet, P.; Picard, B.; Contrepois, M.; De Rycke, J.; Barnouin, J.

    1994-01-01

    The electrophoretic variations of carboxylesterase B and of esterases A, C and I, the presence of mannose resistant haemagglutinin, alpha-haemolysin, cytotoxic necrotizing factor type 1 (CNF1) and certain O antigens were compared in 150 strains of Escherichia coli responsible for extra-intestinal infections. Electrophoretic mobilities of outer membrane proteins (OMP) were also studied for strains belonging to O4, O6, O7, O8 and O75 serogroups. Fast migrating allozymes of carboxylesterase B (pattern B1) were correlated with slow migrating allozymes of esterase C, serogroups O7 and O8, lack of virulence factor, and particular OMP patterns, whereas slow migrating allozymes of carboxylesterase B (pattern B2) were correlated with fast migrating allozymes of esterase C, serogroups O2, O4, O6, O18 and O75, virulence factor production, and distinct OMP patterns. Allozymes of esterases A and I were not clearly correlated with the distribution of virulence factors. The pattern B2 was more strongly associated with CNF1 than with alpha-haemolysin and mannose resistant haemagglutinin. These results substantiate the view that the electrophoretic pattern B2 of carboxylesterase B identified most of the highly pathogenic strains implicated in extra-intestinal infection of humans. Images Fig. 2 PMID:7509755

  3. Electrophoretic and aggregation behavior of bovine, horse and human red blood cells in plasma and in polymer solutions.

    PubMed

    Bäumler, H; Neu, B; Mitlöhner, R; Georgieva, R; Meiselman, H J; Kiesewetter, H

    2001-01-01

    The electrophoretic mobility of native and glutaraldehyde-fixed bovine, human, and horse red blood cells (RBC) was investigated as a function of ionic strength (5-150 mM) and concentration of 464 kDa dextran (2 and 3 g/dl); RBC aggregation in autologous plasma and in dextran solutions was also measured. In agreement with previous observations, human and horse RBC form stable rouleaux whereas bovine RBC do not aggregate in either plasma or in dextran 464 kDa solutions. Electrophoretic measurements showed a species-dependent adsorption and depletion of dextran that can be theoretically evaluated. Adsorption of polymer is not a prerequisite for RBC aggregation (bovine RBC show the highest amount of adsorbed dextran yet do not aggregate). Aggregate formation thus occurs as long as the Gibbs free energy difference, given by the osmotic pressure difference between the bulk phase and the polymer-depleted region between two RBC, is larger than the steric and electrostatic repulsive energy contributed by the macromolecules present on the RBC surface. With increasing bulk-phase polymer concentration the depletion layer thickness decreases and the amount of adsorbed macromolecules increases, thereby resulting in an increase of the repulsive component of the interaction energy and decreased aggregation. We thus view electrophoretic measurements of RBC in various media as an important tool for understanding polymer behavior near the red cell surface and hence the mechanisms involved in RBC aggregation.

  4. Unified description of electrophoresis and diffusion for DNA and other polyions.

    PubMed

    Stellwagen, Earle; Lu, Yongjun; Stellwagen, Nancy C

    2003-10-14

    The electrophoretic mobilities and diffusion coefficients of single- and double-stranded DNA molecules up to 50,000 bases or base pairs in size have been analyzed, using mobilities and diffusion coefficients either measured by capillary electrophoresis or taken from the literature. The Einstein equation suggests that the electrophoretic mobilities (mu) and diffusion coefficients (D) should be related by the expression mu/D = Q/k(B)T, where Q is the charge of the polyion (Q = ze(o), where z is the number of charged residues and e(o) is the fundamental electronic charge), k(B) is Boltzmann's constant, and T is the absolute temperature. If this equation were true, the ratio mu/zD should be a constant equal to e(o)/k(B)T (39.6 V(-1)) at 20 degrees C. However, the ratio mu/zD decreases with an increase in molecular weight for both single- and double-stranded DNAs. The mobilities and diffusion coefficients are better described by the modified Einstein equation mu/N(m)D = e(o)/k(B)T, where N is the number of repeat units (bases or base pairs) in the DNA and m is a constant equal to the power law dependence of the diffusion coefficients on molecular weight. The average value of the ratio mu/N(m)D is 40 +/- 4 V(-1) for 36 single- and double-stranded DNA molecules of different sizes, close to the theoretically expected value. The generality of the modified Einstein equation is demonstrated by analyzing literature values for sodium polystyrenesulfonate (PSS). The average value of the ratio mu/N(m)D is 35 +/- 6 V(-1) for 14 PSS samples containing up to 855 monomers.

  5. Electrophoretic Separation of Single Particles Using Nanoscale Thermoplastic Columns.

    PubMed

    Weerakoon-Ratnayake, Kumuditha M; Uba, Franklin I; Oliver-Calixte, Nyoté J; Soper, Steven A

    2016-04-05

    Phenomena associated with microscale electrophoresis separations cannot, in many cases, be applied to the nanoscale. Thus, understanding the electrophoretic characteristics associated with the nanoscale will help formulate relevant strategies that can optimize the performance of separations carried out on columns with at least one dimension below 150 nm. Electric double layer (EDL) overlap, diffusion, and adsorption/desorption properties and/or dielectrophoretic effects giving rise to stick/slip motion are some of the processes that can play a role in determining the efficiency of nanoscale electrophoretic separations. We investigated the performance characteristics of electrophoretic separations carried out in nanoslits fabricated in poly(methyl methacrylate), PMMA, devices. Silver nanoparticles (AgNPs) were used as the model system with tracking of their transport via dark field microscopy and localized surface plasmon resonance. AgNPs capped with citrate groups and the negatively charged PMMA walls (induced by O2 plasma modification of the nanoslit walls) enabled separations that were not apparent when these particles were electrophoresed in microscale columns. The separation of AgNPs based on their size without the need for buffer additives using PMMA nanoslit devices is demonstrated herein. Operational parameters such as the electric field strength, nanoslit dimensions, and buffer composition were evaluated as to their effects on the electrophoretic performance, both in terms of efficiency (plate numbers) and resolution. Electrophoretic separations performed at high electric field strengths (>200 V/cm) resulted in higher plate numbers compared to lower fields due to the absence of stick/slip motion at the higher electric field strengths. Indeed, 60 nm AgNPs could be separated from 100 nm particles in free solution using nanoscale electrophoresis with 100 μm long columns.

  6. Compositional differences between soil humic acids extracted by various methods as evidenced by photosensitizing and electrophoretic properties.

    PubMed

    Gieguzynska, E; Amine-Khodja, A; Trubetskoj, O A; Trubetskaya, O E; Guyot, G; Ter Halle, A; Golebiowska, D; Richard, C

    2009-05-01

    Humic acids (HAs) were isolated from Elliott soil provided by the International Humic Substances Society (1BS102M) by three commonly used methods: (i) 0.1M NaOH (EI-HA), (ii) neutral 0.1M Na(4)P(2)O(7) (L-HA) and subsequent 0.1M NaOH (S-HA), and (iii) 0.1M NaOH+0.1M Na(4)P(2)O(7) (NP-HA). The objective was to evaluate the impact of these extractants on the photosensitizing properties of the isolated HAs. HAs were analyzed for their elemental composition, functional acid groups content, absorption and emission properties, electrophoretic characteristics and ability to produce singlet oxygen using furfuryl alcohol (FFA) as a scavenger. L-HA was slightly more aromatic and oxygenated than the other HAs and contained a higher portion of long-wavelength fluorophores and macromolecules showing low molecular size (MS) and high electrophoretic mobility. L-HA also gave a rate of FFA photooxygenation between 1.25- and 1.6-fold higher than the other HAs. This suggests that the free humic macromolecules ionized at pH 7 and/or weakly bounded on mineral surfaces via cation bridges are of relatively low MS and contribute significantly to the photosensitizing and long-wavelength emitting properties. Differences among the other HAs were more subtle, but the parallel evolution of the reactivity and electrophoretic characteristics was observed. Photochemical and electrophoretic measurements seem to be sensitive indicators to evaluate differences among the extraction procedures of HAs.

  7. Microwaves from UMTS/GSM mobile phones induce long-lasting inhibition of 53BP1/gamma-H2AX DNA repair foci in human lymphocytes.

    PubMed

    Belyaev, Igor Y; Markovà, Eva; Hillert, Lena; Malmgren, Lars O G; Persson, Bertil R R

    2009-02-01

    We have recently described frequency-dependent effects of mobile phone microwaves (MWs) of global system for mobile communication (GSM) on human lymphocytes from persons reporting hypersensitivity to electromagnetic fields and healthy persons. Contrary to GSM, universal global telecommunications system (UMTS) mobile phones emit wide-band MW signals. Hypothetically, UMTS MWs may result in higher biological effects compared to GSM signal because of eventual "effective" frequencies within the wideband. Here, we report for the first time that UMTS MWs affect chromatin and inhibit formation of DNA double-strand breaks co-localizing 53BP1/gamma-H2AX DNA repair foci in human lymphocytes from hypersensitive and healthy persons and confirm that effects of GSM MWs depend on carrier frequency. Remarkably, the effects of MWs on 53BP1/gamma-H2AX foci persisted up to 72 h following exposure of cells, even longer than the stress response following heat shock. The data are in line with the hypothesis that the type of signal, UMTS MWs, may have higher biological efficiency and possibly larger health risk effects compared to GSM radiation emissions. No significant differences in effects between groups of healthy and hypersensitive subjects were observed, except for the effects of UMTS MWs and GSM-915 MHz MWs on the formation of the DNA repair foci, which were different for hypersensitive (P < 0.02[53BP1]//0.01[gamma-H2AX]) but not for control subjects (P > 0.05). The non-parametric statistics used here did not indicate specificity of the differences revealed between the effects of GSM and UMTS MWs on cells from hypersensitive subjects and more data are needed to study the nature of these differences. Copyright 2008 Wiley-Liss, Inc.

  8. Genome-wide DNA methylation identifies trophoblast invasion-related genes: Claudin-4 and Fucosyltransferase IV control mobility via altering matrix metalloproteinase activity.

    PubMed

    Hu, Yuxiang; Blair, John D; Yuen, Ryan K C; Robinson, Wendy P; von Dadelszen, Peter

    2015-05-01

    Previously we showed that extravillous cytotrophoblast (EVT) outgrowth and migration on a collagen gel explant model were affected by exposure to decidual natural killer cells (dNK). This study investigates the molecular causes behind this phenomenon. Genome wide DNA methylation of exposed and unexposed EVT was assessed using the Illumina Infinium HumanMethylation450 BeadChip array (450 K array). We identified 444 differentially methylated CpG loci in dNK-treated EVT compared with medium control (P < 0.05). The genes associated with these loci had critical biological roles in cellular development, cellular growth and proliferation, cell signaling, cellular assembly and organization by Ingenuity Pathway Analysis (IPA). Furthermore, 23 mobility-related genes were identified by IPA from dNK-treated EVT. Among these genes, CLDN4 (encoding claudin-4) and FUT4 (encoding fucosyltransferase IV) were chosen for follow-up studies because of their biological relevance from research on tumor cells. The results showed that the mRNA and protein expressions of both CLDN4 and FUT4 in dNK-treated EVT were significantly reduced compared with control (P < 0.01 for both CLDN4 and FUT4 mRNA expression; P < 0.001 for CLDN4 and P < 0.01 for FUT4 protein expression), and were inversely correlated with DNA methylation. Knocking down CLDN4 and FUT4 by small interfering RNA reduced trophoblast invasion, possibly through the altered matrix metalloproteinase (MMP)-2 and/or MMP-9 expression and activity. Taken together, dNK alter EVT mobility at least partially in association with an alteration of DNA methylation profile. Hypermethylation of CLDN4 and FUT4 reduces protein expression. CLDN4 and FUT4 are representative genes that participate in modulating trophoblast mobility.

  9. Heteroduplex mobility assay-guided sequence discovery: elucidation of the small subunit (18S) rDNA sequences of Pfiesteria piscicida and related dinoflagellates from complex algal culture and environmental sample DNA pools.

    PubMed

    Oldach, D W; Delwiche, C F; Jakobsen, K S; Tengs, T; Brown, E G; Kempton, J W; Schaefer, E F; Bowers, H A; Glasgow, H B; Burkholder, J M; Steidinger, K A; Rublee, P A

    2000-04-11

    The newly described heterotrophic estuarine dinoflagellate Pfiesteria piscicida has been linked with fish kills in field and laboratory settings, and with a novel clinical syndrome of impaired cognition and memory disturbance among humans after presumptive toxin exposure. As a result, there is a pressing need to better characterize the organism and these associations. Advances in Pfiesteria research have been hampered, however, by the absence of genomic sequence data. We employed a sequencing strategy directed by heteroduplex mobility assay to detect Pfiesteria piscicida 18S rDNA "signature" sequences in complex pools of DNA and used those data as the basis for determination of the complete P. piscicida 18S rDNA sequence. Specific PCR assays for P. piscicida and other estuarine heterotrophic dinoflagellates were developed, permitting their detection in algal cultures and in estuarine water samples collected during fish kill and fish lesion events. These tools should enhance efforts to characterize these organisms and their ecological relationships. Heteroduplex mobility assay-directed sequence discovery is broadly applicable, and may be adapted for the detection of genomic sequence data of other novel or nonculturable organisms in complex assemblages.

  10. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  11. DNA

    ERIC Educational Resources Information Center

    Stent, Gunther S.

    1970-01-01

    This history for molecular genetics and its explanation of DNA begins with an analysis of the Golden Jubilee essay papers, 1955. The paper ends stating that the higher nervous system is the one major frontier of biological inquiry which still offers some romance of research. (Author/VW)

  12. An Investigation of Methods of Isolation of β2M1 Globulin (Syn.: Iota Protein, 19S γ Globulin, γ1 Macroglobulin, β2M Globulin) and its Association with Isoagglutinin Activity, together with Preliminary Observations on Other Macroglobulins of Slow Electrophoretic Mobility in Normal Human Serum

    PubMed Central

    Walton, K. W.; Rowe, D. S.; Soothill, J. F.; Stanworth, D. R.

    1963-01-01

    demonstrable in ultracentrifugal concentrates of normal serum. Evidence is presented to suggest that these proteins are nevertheless present as trace components of normal serum. The solubility and electrophoretic characteristics of these proteins resemble those of β2M1 globulin, but they can be distinguished by immunological methods from β2M1 globulin and each other. Attention is drawn to the evidence that β2M2 and β2M3 globulins may also be increased in the serum of some cases of macroglobulinaemia. ImagesFIG. 1FIG. 2FIG. 7FIG. 10FIG. 11FIG. 12FIG. 13

  13. Nuclear aggregates of polyamines in a radiation-induced DNA damage model.

    PubMed

    Iacomino, Giuseppe; Picariello, Gianluca; Stillitano, Ilaria; D'Agostino, Luciano

    2014-02-01

    Polyamines (PA) are believed to protect DNA minimizing the effect of radiation damage either by inducing DNA compaction and aggregation or acting as scavengers of free radicals. Using an in vitro pDNA double strand breakage assay based on gel electrophoretic mobility, we compared the protective capability of PA against γ-radiation with that of compounds generated by the supramolecular self-assembly of nuclear polyamines and phosphates, named Nuclear Aggregates of Polyamines (NAPs). Both unassembled PA and in vitro produced NAPs (ivNAPs) were ineffective in conferring pDNA protection at the sub-mM concentration. Single PA showed an appreciable protective effect only at high (mM) concentrations. However, concentrations of spermine (4+) within a critical range (0.481 mM) induced pDNA precipitation, an event that was not observed with NAPs-pDNA interaction. We conclude that the interaction of individual PA is ineffective to assure DNA protection, simultaneously preserving the flexibility and charge density of the double strand. Furthermore, data obtained by testing polyamine and ivNAPS with the current radiation-induced DNA damage model support the concept that PA-phosphate aggregates are the only forms through which PA interact with DNA.

  14. Fluorescent silver nanocluster DNA probes for multiplexed detection using microfluidic capillary electrophoresis.

    PubMed

    Del Bonis-O'Donnell, Jackson Travis; Fygenson, Deborah K; Pennathur, Sumita

    2015-03-07

    DNA-stabilized fluorescent silver nanoclusters (AgNC DNA) are a new class of fluorophore that are formed by sequence specific interactions between silver and single-stranded DNA. By incorporating both target-binding and fluorescent-reporting sequences into a single synthetic DNA oligomer, AgNC DNA probes eliminate the need to conjugate dye or quencher molecules. In this study, we modify a AgNC DNA probe to demonstrate single-color multiplexed detection of DNA targets. We show that appending different lengths of poly-dT to the probe sequences tunes the electrophoretic mobility of AgNC DNA probes without affecting their fluorescence spectra. We use this to introduce a set of AgNC DNA probes selective for Hepatitis A, B and C target sequences that can be processed together in a simple, single-step protocol and distinguished with a resolution of 3.47 and signal to noise ratio of 17.23 in under 10 seconds by microfluidic capillary electrophoresis.

  15. Electrophoretically deposited multiwalled carbon nanotube based amperometric genosensor for E.coli detection

    NASA Astrophysics Data System (ADS)

    Bhardwaj, Hema; Solanki, Shipra; Sumana, Gajjala

    2016-04-01

    This work reports on a sensitive and selective genosensor fabrication method for Escherichia coli (E.coli) detection. The functionalized multiwalled carbon nanotubes (MWCNT) synthesized via chemical vapour deposition have been deposited electrophoretically onto indium tin oxide coated glass surface and have been utilized as matrices for the covalent immobilization of E.coli specific probe oligonucleotide that was identified from the 16s rRNA coding region of the E.coli genome. This fabricated functionalized MWCNT based platform sought to provide improved fundamental characteristics to electrode interface in terms of electro-active surface area and diffusion coefficient. Electrochemical cyclic voltammetry revealed that this genosensor exhibits a linear response to complementary DNA in the concentration range of 10-7 to 10-12 M with a detection limit of 1×10-12 M.

  16. The Drosophila telomere-capping protein Verrocchio binds single-stranded DNA and protects telomeres from DNA damage response.

    PubMed

    Cicconi, Alessandro; Micheli, Emanuela; Vernì, Fiammetta; Jackson, Alison; Gradilla, Ana Citlali; Cipressa, Francesca; Raimondo, Domenico; Bosso, Giuseppe; Wakefield, James G; Ciapponi, Laura; Cenci, Giovanni; Gatti, Maurizio; Cacchione, Stefano; Raffa, Grazia Daniela

    2017-04-07

    Drosophila telomeres are sequence-independent structures maintained by transposition to chromosome ends of three specialized retroelements rather than by telomerase activity. Fly telomeres are protected by the terminin complex that includes the HOAP, HipHop, Moi and Ver proteins. These are fast evolving, non-conserved proteins that localize and function exclusively at telomeres, protecting them from fusion events. We have previously suggested that terminin is the functional analogue of shelterin, the multi-protein complex that protects human telomeres. Here, we use electrophoretic mobility shift assay (EMSA) and atomic force microscopy (AFM) to show that Ver preferentially binds single-stranded DNA (ssDNA) with no sequence specificity. We also show that Moi and Ver form a complex in vivo. Although these two proteins are mutually dependent for their localization at telomeres, Moi neither binds ssDNA nor facilitates Ver binding to ssDNA. Consistent with these results, we found that Ver-depleted telomeres form RPA and γH2AX foci, like the human telomeres lacking the ssDNA-binding POT1 protein. Collectively, our findings suggest that Drosophila telomeres possess a ssDNA overhang like the other eukaryotes, and that the terminin complex is architecturally and functionally similar to shelterin. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. A Novel DNA Binding Mechanism for maf Basic Region-Leucine Zipper Factors Inferred from a MafA-DNA Complex Structure and Binding Specificities

    SciTech Connect

    Lu, Xun; Guanga, Gerald P; Wan, Cheng; Rose, Robert B

    2012-11-13

    MafA is a proto-oncoprotein and is critical for insulin gene expression in pancreatic β-cells. Maf proteins belong to the AP1 superfamily of basic region-leucine zipper (bZIP) transcription factors. Residues in the basic helix and an ancillary N-terminal domain, the Extended Homology Region (EHR), endow maf proteins with unique DNA binding properties: binding a 13 bp consensus site consisting of a core AP1 site (TGACTCA) flanked by TGC sequences and binding DNA stably as monomers. To further characterize maf DNA binding, we determined the structure of a MafA–DNA complex. MafA forms base-specific hydrogen bonds with the flanking G–5C–4 and central C0/G0 bases, but not with the core-TGA bases. However, in vitro binding studies utilizing a pulse–chase electrophoretic mobility shift assay protocol revealed that mutating either the core-TGA or flanking-TGC bases dramatically increases the binding off rate. Comparing the known maf structures, we propose that DNA binding specificity results from positioning the basic helix through unique phosphate contacts. The EHR does not contact DNA directly but stabilizes DNA binding by contacting the basic helix. Collectively, these results suggest a novel multistep DNA binding process involving a conformational change from contacting the core-TGA to contacting the flanking-TGC bases.

  18. Structure-function relationships in human testis-determining factor SRY: an aromatic buttress underlies the specific DNA-bending surface of a high mobility group (HMG) box.

    PubMed

    Racca, Joseph D; Chen, Yen-Shan; Maloy, James D; Wickramasinghe, Nalinda; Phillips, Nelson B; Weiss, Michael A

    2014-11-21

    Human testis determination is initiated by SRY, a Y-encoded architectural transcription factor. Mutations in SRY cause 46 XY gonadal dysgenesis with female somatic phenotype (Swyer syndrome) and confer a high risk of malignancy (gonadoblastoma). Such mutations cluster in the SRY high mobility group (HMG) box, a conserved motif of specific DNA binding and bending. To explore structure-function relationships, we constructed all possible substitutions at a site of clinical mutation (W70L). Our studies thus focused on a core aromatic residue (position 15 of the consensus HMG box) that is invariant among SRY-related HMG box transcription factors (the SOX family) and conserved as aromatic (Phe or Tyr) among other sequence-specific boxes. In a yeast one-hybrid system sensitive to specific SRY-DNA binding, the variant domains exhibited reduced (Phe and Tyr) or absent activity (the remaining 17 substitutions). Representative nonpolar variants with partial or absent activity (Tyr, Phe, Leu, and Ala in order of decreasing side-chain volume) were chosen for study in vitro and in mammalian cell culture. The clinical mutation (Leu) was found to markedly impair multiple biochemical and cellular activities as respectively probed through the following: (i) in vitro assays of specific DNA binding and protein stability, and (ii) cell culture-based assays of proteosomal degradation, nuclear import, enhancer DNA occupancy, and SRY-dependent transcriptional activation. Surprisingly, however, DNA bending is robust to this or the related Ala substitution that profoundly impairs box stability. Together, our findings demonstrate that the folding, trafficking, and gene-regulatory function of SRY requires an invariant aromatic "buttress" beneath its specific DNA-bending surface.

  19. Cloning of human Ca2+ homoeostasis endoplasmic reticulum protein (CHERP): regulated expression of antisense cDNA depletes CHERP, inhibits intracellular Ca2+ mobilization and decreases cell proliferation.

    PubMed Central

    Laplante, J M; O'Rourke, F; Lu, X; Fein, A; Olsen, A; Feinstein, M B

    2000-01-01

    A monoclonal antibody which blocks InsP(3)-induced Ca(2+) release from isolated endoplasmic reticulum was used to isolate a novel 4.0 kb cDNA from a human erythroleukaemia (HEL) cell cDNA expression library. A corresponding mRNA transcript of approx. 4.2 kb was present in all human cell lines and tissues examined, but cardiac and skeletal muscle had an additional transcript of 6.4 kb. The identification in GenBank(R) of homologous expressed sequence tags from many tissues and organisms suggests that the gene is ubiquitously expressed in higher eukaryotes. The gene was mapped to human chromosome 19p13.1. The cDNA predicts a 100 kDa protein, designated Ca(2+) homoeostasis endoplasmic reticulum protein (CHERP), with two putative transmembrane domains, multiple consensus phosphorylation sites, a polyglutamine tract of 12 repeats and regions of imperfect tryptophan and histadine octa- and nona-peptide repeats. In vitro translation of the full-length cDNA produced proteins of M(r) 128000 and 100000, corresponding to protein bands detected by Western blotting of many cell types. CHERP was co-localized in HEL cells with the InsP(3) receptor by two-colour immunofluorescence. Transfection of HEL cells with antisense cDNA led to an 80% decline in CHERP within 5 days of antisense induction, with markedly decreased intracellular Ca(2+) mobilization by thrombin, decreased DNA synthesis and growth arrest, indicating that the protein has an important function in Ca(2+) homoeostasis, growth and proliferation. PMID:10794731

  20. A high mobility group box 1 (HMGB1) gene from Chlamys farreri and the DNA-binding ability and pro-inflammatory activity of its recombinant protein.

    PubMed

    Wang, Mengqiang; Wang, Lingling; Guo, Ying; Zhou, Zhi; Yi, Qilin; Zhang, Daoxiang; Zhang, Huan; Liu, Rui; Song, Linsheng

    2014-02-01

    High-mobility group box 1 (HMGB1) protein, a highly conserved DNA binding protein, plays an important role in maintaining nucleosome structures, transcription, and inflammation. In the present research, a cDNA of 1268 bp for the Zhikong scallop Chlamys farreri HMGB1 (designed as CfHMGB1) was cloned via rapid amplification of cDNA ends (RACE) technique and expression sequence tag (EST) analysis. The complete cDNA sequence of CfHMGB1 contained an open reading frame (ORF) of 648 bp, which encoded a protein of 215 amino acids. The amino acid sequence of CfHMGB1 shared 53-57% similarity with other identified HMGB1s. There were two HMG domains, two low complexity regions and a conserved acidic tail in the amino acid sequence of CfHMGB1. The mRNA transcripts of CfHMGB1 were constitutively expressed in all the tested tissues, including haemocytes, muscle, mantle, gill, hepatopancreas, kidney and gonad, with the highest expression level in hepatopancreas. The mRNA expression profiles of CfHMGB1 in haemocytes after the stimulation with different pathogen-associated molecular patterns (PAMPs), including lipopolysaccharide (LPS), peptidoglycan (PGN) and glucan (Glu), were similar with an up-regulation in the early stage and then recovered to the original level. The recombinant CfHMGB1 protein could bind double-stranded DNA and induce the release of TNF-α activity in mixed primary culture of scallop haemocytes. These results collectively indicated that CfHMGB1, with DNA-binding ability and pro-inflammatory activity, could play an important role in the immune response of scallops.

  1. Nanomaterials for sample pretreatment prior to capillary electrophoretic analysis.

    PubMed

    Adam, Vojtech; Vaculovicova, Marketa

    2017-02-16

    Nanomaterials are, in analytical science, used for a broad range of purposes, covering the area of sample pretreatment as well as separation, detection and identification of target molecules. This review covers the application of nanomaterials for sample pretreatment in capillary electrophoresis. It targets the utilization of nanomaterials for sample purification, preconcentration and/or extraction coupled both off-line and on-line with capillary electrophoretic analysis. Especially due to their large surface area, nanoparticles and nanomaterials are exceptionally helpful in making up for the limited concentration detection limits provided by capillary electrophoresis. This method possesses excellent separation power; however, its sensitivity may be problematic in some cases. Therefore, this review is focused on utilization of nanomaterials as a powerful tool for sample preconcentration, which is so often required prior to capillary electrophoretic analysis.

  2. Atomic-force-controlled capillary electrophoretic nanoprinting of proteins.

    PubMed

    Lovsky, Yulia; Lewis, Aaron; Sukenik, Chaim; Grushka, Eli

    2010-01-01

    The general nanoprinting and nanoinjection of proteins on non-conducting or conducting substrates with a high degree of control both in terms of positional and timing accuracy is an important goal that could impact diverse fields from biotechnology (protein chips) to molecular electronics and from fundamental studies in cell biology to nanophotonics. In this paper, we combine capillary electrophoresis (CE), a separation method with considerable control of protein movement, with the unparalleled positional accuracy of an atomic force microscope (AFM). This combination provides the ability to electrophoretically or electroosmotically correlate the timing of protein migration with AFM control of the protein deposition at a high concentration in defined locations and highly confined volumes estimated to be 2 al. Electrical control of bovine serum albumin printing on standard protein-spotting glass substrates is demonstrated. For this advance, fountain pen nanolithography (FPN) that uses cantilevered glass-tapered capillaries is amended with the placement of electrodes on the nanopipette itself. This results in imposed voltages that are three orders of magnitude less than what is normally used in capillary electrophoresis. The development of atomic-force-controlled capillary electrophoretic printing (ACCEP) has the potential for electrophoretic separation, with high resolution, both in time and in space. The large voltage drop at the tip of the tapered nanopipettes allows for significant increases in concentration of protein in the small printed volumes. All of these attributes combine to suggest that this methodology should have a significant impact in science and technology.

  3. A rapid gel electrophoretic chip for serum cholesterol determination.

    PubMed

    Kaminikado, Kenta; Ikeda, Ryuzo; Idegami, Koutaro; Nagatani, Naoki; Vestergaard, Mun'delanji C; Saito, Masato; Tamiya, Eiichi

    2011-05-07

    We present a rapid gel electrophoretic chip, composed of 2.5% (w/v) acrylamide and 1% (w/v) agarose gel, for serum cholesterol determination using a photo lithography technique. After optimizations, we determined the lipoprotein concentration of standard serum using a conventional enzyme method. The serum was diluted, stained and loaded for 15 min onto the chip. After loading, the intensities of low density lipoprotein cholesterol (LDL-C) and high density lipoprotein cholesterol (HDL-C) bands separated at the chip were estimated using an image analyzer. The intensities of these bands corresponded to concentrations obtained from a standard enzyme-based method. The detected LDL-C and HDL-C concentrations were linear up to 146 mg dL(-1) and 53 mg dL(-1) respectively. Finally, we carried out the cholesterol analysis using real biological samples obtained from nine volunteers using our electrophoretic chip. The LDL-C and HDL-C levels detected using our chip correlated well with the results obtained using the conventional enzyme-based method r(2) = 0.98 and r(2) = 0.86 for LDL-C and HDL-C, respectively. Although our sample size is small and confined only to health volunteers, we have demonstrated that this proof-of-concept gel electrophoretic chip can determine lipoproteins, simultaneously.

  4. Jet-Printed Active-Matrix Backplanes and Electrophoretic Displays

    NASA Astrophysics Data System (ADS)

    Daniel, Jurgen; Arias, Ana Claudia; Wong, William; Lujan, Rene; Ready, Steve; Krusor, Brent; Street, Robert

    2007-03-01

    The fabrication of large-area electronics, such as active-matrix pixel circuits in flat-panel displays, is becoming increasingly challenging. Particularly for applications such as electronic paper, flexibility of the display and fabrication at extremely low cost is important. Therefore, novel fabrication methods have to be explored. We have developed jet-printing technology to fabricate active-matrix backplanes for paper-like electrophoretic displays. In three approaches we implement several stages of evolution of the printing technology. First, the photolithographic patterning of photoresist used in conventional fabrication is replaced by digital printing of a wax etch mask. Second, the amorphous silicon semiconductor for the thin-film-transistors is replaced with a printed organic semiconductor. Third, the active-matrix pixel circuit is fabricated in an all-additive printing process. In order to test our backplanes we are developing electrophoretic display media. The media is based on microfabricated cell-structures which contain the electrophoretic ink. Particularly for flexible displays, the cells have to be individually sealed and several methods are being explored.

  5. Electrophoretic properties of sulfamethoxazole microcapsules and gelatin-acacia coacervates.

    PubMed

    Takenaka, H; Kawashima, Y; Lin, S Y

    1981-03-01

    The electrophoretic properties of sulfamethoxazole microcapsules and the coacervates prepared by gelatin-acacia coacervation were investigated. The effects of the parameters in the microcapsule preparation, such as the coacervation pH, amount of formaldehyde used for hardening, and drying method of the coacervates, on the zeta-potential of the resultant microcapsules were clarified. The Büchner effect was observed in coacervates in an electric field, which indicated that the coacervate wall was flexible. The zeta-potential versus pH curves of the coacervates appeared on the upper side of the plain sulfamethoxazole, while those of the microcapsules dried conventionally shifted to the lower side due to the denaturation of the gelatin in the microcapsule wall, which occurred during drying. Spray drying increased the denaturation of gelatin, which imparted a negative charge to the spray-dried microcapsules. Formalization of the coacervates refined the electrophoretic behavior of the microcapsules, depending on the amount of formaldehyde used. The zeta-potential of the plain sulfamethoxazole also was measured in the simulated coacervation solution to analyze the mechanism of coacervation electrophoretically.

  6. PM01183, a new DNA minor groove covalent binder with potent in vitro and in vivo anti-tumour activity

    PubMed Central

    Leal, JFM; Martínez-Díez, M; García-Hernández, V; Moneo, V; Domingo, A; Bueren-Calabuig, JA; Negri, A; Gago, F; Guillén-Navarro, MJ; Avilés, P; Cuevas, C; García-Fernández, LF; Galmarini, CM

    2010-01-01

    BACKGROUND AND PURPOSE PM01183 is a new synthetic tetrahydroisoquinoline alkaloid that is currently in phase I clinical development for the treatment of solid tumours. In this study we have characterized the interactions of PM01183 with selected DNA molecules of defined sequence and its in vitro and in vivo cytotoxicity. EXPERIMENTAL APPROACH DNA binding characteristics of PM01183 were studied using electrophoretic mobility shift assays, fluorescence-based melting kinetic experiments and computational modelling methods. Its mechanism of action was investigated using flow cytometry, Western blot analysis and fluorescent microscopy. In vitro anti-tumour activity was determined by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and the in vivo activity utilized several human cancer models. KEY RESULTS Electrophoretic mobility shift assays demonstrated that PM01183 bound to DNA. Fluorescence-based thermal denaturation experiments showed that the most favourable DNA triplets providing a central guanine for covalent adduct formation are AGC, CGG, AGG and TGG. These binding preferences could be rationalized using molecular modelling. PM01183–DNA adducts in living cells give rise to double-strand breaks, triggering S-phase accumulation and apoptosis. The potent cytotoxic activity of PM01183 was ascertained in a 23-cell line panel with a mean GI50 value of 2.7 nM. In four murine xenograft models of human cancer, PM01183 inhibited tumour growth significantly with no weight loss of treated animals. CONCLUSIONS AND IMPLICATIONS PM01183 is shown to bind to selected DNA sequences and promoted apoptosis by inducing double-strand breaks at nanomolar concentrations. The potent anti-tumour activity of PM01183 in several murine models of human cancer supports its development as a novel anti-neoplastic agent. PMID:20977459

  7. Study on the interaction of catechins with human serum albumin using spectroscopic and electrophoretic techniques

    NASA Astrophysics Data System (ADS)

    Trnková, Lucie; Boušová, Iva; Staňková, Veronika; Dršata, Jaroslav

    2011-01-01

    The interaction between eight naturally occurring flavanols (catechin, epicatechin, gallocatechin, epigallocatechin, catechin gallate, epicatechin gallate, gallocatechin gallate, and epigallocatechin gallate) and human serum albumin (HSA) has been investigated by spectroscopic (fluorescence quenching and UV-Vis absorption) and electrophoretic (native and SDS PAGE) techniques under simulated physiological conditions (pH 7.40, 37 °C). The spectroscopic results confirmed the complex formation for the tested systems. The binding constants and the number of binding sites were obtained by analysis of fluorescence data. The strongest binding affinity to HSA was found for epicatechin gallate and decreased in the order epicatechin gallate ⩾ catechin gallate > epigallocatechin gallate > gallocatechin gallate ≫ epicatechin ⩾ catechin > gallocatechin ⩾ epigallocatechin. All free energy changes possessed negative sign indicating the spontaneity of catechin-HSA systems formation. The binding distances between the donor (HSA) and the acceptors (catechins) estimated by the Förster theory revealed that non-radiation energy transfer from HSA to catechins occurred with high possibility. According to results obtained by native PAGE, the galloylated catechins increased the electrophoretic mobility of HSA, which indicated the change in the molecular charge of HSA, whilst the non-galloylated catechins caused no changes. The ability of aggregation and cross-linking of tested catechins with HSA was not proved by SDS-PAGE. The relationship between the structure characteristics of all tested catechins (e.g. presence of the galloyl moiety on the C-ring, the number of hydroxyl groups on the B-ring, and the spatial arrangement of the substituents on the C-ring) and their binding properties to HSA is discussed. The presented study contributes to the current knowledge in the area of protein-ligand binding, particularly catechin-HSA interactions.

  8. Affinity Labeling of the Acetylcholine Receptor in the Electroplax: Electrophoretic Separation in Sodium Dodecyl Sulfate

    PubMed Central

    Reiter, Michael J.; Cowburn, David A.; Prives, Joav M.; Karlin, Arthur

    1972-01-01

    Electroplax, single cells dissected from electric tissue of Electrophorus, are labeled in a two-step procedure: reduction by dithiothreitol followed by alkylation by the affinity label 4-(N-maleimido)-α-benzyltri-[methyl-3H]methylammonium iodide, either alone or in combination with [2,3-14C]N-ethylmaleimide. Electrophoresis in sodium dodecyl sulfate on polyacrylamide gel of an extract, prepared with this detergent, of single-labeled or of double-labeled cells results in a major peak of 3H activity, with a mobility corresponding to a polypeptide of molecular weight 42,000. In addition, in the double-labeled samples, there is a unique peak in the ratio of 3H to 14C that is coincident with the 3H peak. The electrophoretic patterns of extracts of cells in which affinity alkylation of the reduced receptor has been suppressed by dithiobischoline, an affinity oxidizing agent, by cobratoxin, an irreversible ligand, or by hexamethonium, a reversible ligand, show a considerably diminished peak of 3H activity in the region of molecular weight 42,000. This is the predominant difference between the electrophoretic patterns of extracts of unprotected and of protected cells. Furthermore, extracts of cells protected with dithiobischoline before labeling with both tritiated affinity label and [14C]N-ethylmaleimide do not show the peak in the 3H to 14C ratio seen in the absence of protection. Thus, by several diverse criteria, the peak of 3H activity corresponding to a molecular weight of 42,000 contains affinity-labeled acetylcholine receptor or receptor subunit. PMID:4504331

  9. A Key Evolutionary Mutation Enhances DNA Binding of the FOXP2 Forkhead Domain.

    PubMed

    Morris, Gavin; Fanucchi, Sylvia

    2016-04-05

    Forkhead box (FOX) transcription factors share a conserved forkhead DNA binding domain (FHD) and are key role players in the development of many eukaryotic species. Their involvement in various congenital disorders and cancers makes them clinically relevant targets for novel therapeutic strategies. Among them, the FOXP subfamily of multidomain transcriptional repressors is unique in its ability to form DNA binding homo and heterodimers. The truncated FOXP2 FHD, in the absence of the leucine zipper, exists in equilibrium between monomeric and domain-swapped dimeric states in vitro. As a consequence, determining the DNA binding properties of the FOXP2 FHD becomes inherently difficult. In this work, two FOXP2 FHD hinge loop mutants have been generated to successfully prevent both the formation (A539P) and the dissociation (F541C) of the homodimers. This allows for the separation of the two species for downstream DNA binding studies. Comparison of DNA binding of the different species using electrophoretic mobility shift assay, fluorescence anisotropy and isothermal titration calorimetry indicates that the wild-type FOXP2 FHD binds DNA as a monomer. However, comparison of the DNA-binding energetics of the monomer and wild-type FHD, reveals that there is a difference in the mechanism of binding between the two species. We conclude that the naturally occurring reverse mutation (P539A) seen in the FOXP subfamily increases DNA binding affinity and may increase the potential for nonspecific binding compared to other FOX family members.

  10. Sequence-Specific DNA Detection at 10 fM by Electromechanical Signal Transduction

    PubMed Central

    2015-01-01

    Target DNA fragments at 10 fM concentration (approximately 6 × 105 molecules) were detected against a DNA background simulating the noncomplementary genomic DNA present in real samples using a simple, PCR-free, optics-free approach based on electromechanical signal transduction. The development of a rapid, sensitive, and cost-effective nucleic acid detection platform is highly desired for a range of diverse applications. We previously described a potentially low-cost device for sequence-specific nucleic acid detection based on conductance change measurement of a pore blocked by electrophoretically mobilized bead-(peptide nucleic acid probe) conjugates upon hybridization with target nucleic acid. Here, we demonstrate the operation of our device with longer DNA targets, and we describe the resulting improvement in the limit of detection (LOD). We investigated the detection of DNA oligomers of 110, 235, 419, and 1613 nucleotides at 1 pM to 1 fM and found that the LOD decreased as DNA length increased, with 419 and 1613 nucleotide oligomers detectable down to 10 fM. In addition, no false positive responses were obtained with noncomplementary, control DNA fragments of similar length. The 1613-base DNA oligomer is similar in size to 16S rRNA, which suggests that our device may be useful for detection of pathogenic bacteria at clinically relevant concentrations based on recognition of species-specific 16S rRNA sequences. PMID:25203740

  11. Triblock copolymer matrix-based capillary electrophoretic microdevice for high-resolution multiplex pathogen detection.

    PubMed

    Kim, Se Jin; Shin, Gi Won; Choi, Seok Jin; Hwang, Hee Sung; Jung, Gyoo Yeol; Seo, Tae Seok

    2010-03-01

    Rapid and simple analysis for the multiple target pathogens is critical for patient management. CE-SSCP analysis on a microchip provides high speed, high sensitivity, and a portable genetic analysis platform in molecular diagnostic fields. The capability of separating ssDNA molecules in a capillary electrophoretic microchannel with high resolution is a critical issue to perform the precise interpretation in the electropherogram. In this study, we explored the potential of poly(ethyleneoxide)-poly(propyleneoxide)-poly(ethyleneoxide) (PEO-PPO-PEO) triblock copolymer as a sieving matrix for CE-SSCP analysis on a microdevice. To demonstrate the superior resolving power of PEO-PPO-PEO copolymers, 255-bp PCR amplicons obtained from 16S ribosomal RNA genes of four bacterial species, namely Proteus mirabilis, Haemophilus ducreyi, Pseudomonas aeruginosa, and Neisseria meningitidis, were analyzed in the PEO-PPO-PEO matrix in comparison with 5% linear polyacrylamide and commercial GeneScan gel. Due to enhanced dynamic coating and sieving ability, PEO-PPO-PEO copolymer displayed fourfold enhancement of resolving power in the CE-SSCP to separate same-sized DNA molecules. Fivefold input of genomic DNA of P. aeruginosa and/or N. meningitidis produced proportionally increased corresponding amplicon peaks, enabling correct quantitative analysis in the pathogen detection. Besides the high-resolution sieving capability, a facile loading and replenishment of gel in the microchannel due to thermally reversible gelation property makes PEO-PPO-PEO triblock copolymer an excellent matrix in the CE-SSCP analysis on the microdevice.

  12. A New DNA Binding Protein Highly Conserved in Diverse Crenarchaeal Viruses

    SciTech Connect

    Larson, E.T.; Eilers, B.J.; Reiter, D.; Ortmann, A.C.; Young, M.J.; Lawrence, C.M.; /Montana State U. /Tubingen U.

    2007-07-09

    Sulfolobus turreted icosahedral virus (STIV) infects Sulfolobus species found in the hot springs of Yellowstone National Park. Its 37 open reading frames (ORFs) generally lack sequence similarity to other genes. One exception, however, is ORF B116. While its function is unknown, orthologs are found in three additional crenarchaeal viral families. Due to the central importance of this protein family to crenarchaeal viruses, we have undertaken structural and biochemical studies of B116. The structure reveals a previously unobserved fold consisting of a five-stranded beta-sheet flanked on one side by three alpha helices. Two subunits come together to form a homodimer with a 10-stranded mixed beta-sheet, where the topology of the central strands resembles an unclosed beta-barrel. Highly conserved loops rise above the surface of the saddle-shaped protein and suggest an interaction with the major groove of DNA. The predicted B116-DNA interaction is confirmed by electrophoretic mobility shift assays.

  13. Long non-coding RNA PARTICLE bridges histone and DNA methylation.

    PubMed

    O'Leary, Valerie Bríd; Hain, Sarah; Maugg, Doris; Smida, Jan; Azimzadeh, Omid; Tapio, Soile; Ovsepian, Saak Victor; Atkinson, Michael John

    2017-05-11

    PARTICLE (Gene PARTICL- 'Promoter of MAT2A-Antisense RadiaTion Induced Circulating LncRNA) expression is transiently elevated following low dose irradiation typically encountered in the workplace and from natural sources. This long non-coding RNA recruits epigenetic silencers for cis-acting repression of its neighbouring Methionine adenosyltransferase 2A gene. It now emerges that PARTICLE operates as a trans-acting mediator of DNA and histone lysine methylation. Chromatin immunoprecipitation sequencing (ChIP-seq) and immunological evidence established elevated PARTICLE expression linked to increased histone 3 lysine 27 trimethylation. Live-imaging of dbroccoli-PARTICLE revealing its dynamic association with DNA methyltransferase 1 was confirmed by flow cytometry, immunoprecipitation and direct competitive binding interaction through electrophoretic mobility shift assay. Acting as a regulatory docking platform, the long non-coding RNA PARTICLE serves to interlink epigenetic modification machineries and represents a compelling innovative component necessary for gene silencing on a global scale.

  14. Electrical Transport of Long DNA Molecules on Liuid-Solid Interfaces

    NASA Astrophysics Data System (ADS)

    Samuilov, Vladimir; Seo, Young-Soo; Sokolov, Jonathan; Rafailovich, Miriam; Chu, Benjamin

    2002-03-01

    The electrical transport properties of long DNA molecules were studied based upon a newly developed method of electrophoresis on flat surfaces [1]. The electrophoretic mobilities of DNA in the presence of Si surface were found to be approximately one order less than in free solution. The electropherogram peaks of 1 kb- and Hind III DNA ladders have been clearly identified. The experimental dependencies of the mobilities on molecular weight were found to be scaled with power law with the exponents of an opposite sign at 2 different buffer concentrations: negative for surface transport at 10 -2 M concentration of TBE buffer and positive at 10 -3 M. A novel mechanism responsible for DNA molecules separation in the presence of the surface at low buffer concentrations has been developed. The multi-ion system is governed by the Nernst-Planck equations (ion movement due to convection, migration and diffusion), in combination with the Poisson-Boltzmann equation. The discrepancy from charge neutrality that occurs in the diffuse double layer very close to the substrate is the driving force for the Navier-Stokes equation, which finally results in a liquid movement very close to the surface that is denoted as electro-osmosis. The adsorbed DNA move due to the electrical field parallel to the surface, and also due the electro-osmotic convection that drags the DNA chains if they are only partly adsorbed. The electric double layer is responsible for a velocity profile of the electroosmotic flow. The net electrophoretic mobility of longer DNA, being trapped closer to the surface, is higher than of the shorter ones in the electric field, oriented along the surface. The main features of the electro-hydrodynamic instability related to λ and T2 DNA molecules aggregation, observed in our system, are consistent with our model. This work was supported by NSF-MRSEC Program. [1]. N. Pernodet, V. Samuilov, K. Shin, J. Sokolov, M.H. Rafailovich, D. Gersappe, B. Chu, DNA Electrophoresis on a

  15. Tilted hexagonal post arrays: DNA electrophoresis in anisotropic media.

    PubMed

    Chen, Zhen; Dorfman, Kevin D

    2014-02-01

    Using Brownian dynamics simulations, we show that DNA electrophoresis in a hexagonal array of micron-sized posts changes qualitatively when the applied electric field vector is not coincident with the lattice vectors of the array. DNA electrophoresis in such "tilted" post arrays is superior to the standard "un-tilted" approach; while the time required to achieve a resolution of unity in a tilted post array is similar to an un-tilted array at a low-electric field strengths, this time (i) decreases exponentially with electric field strength in a tilted array and (ii) increases exponentially with electric field strength in an un-tilted array. Although the DNA dynamics in a post array are complicated, the electrophoretic mobility results indicate that the "free path," i.e. the average distance of ballistic trajectories of point-sized particles launched from random positions in the unit cell until they intersect the next post, is a useful proxy for the detailed DNA trajectories. The analysis of the free path reveals a fundamental connection between anisotropy of the medium and DNA transport therein that goes beyond simply improving the separation device.

  16. Imidazolyl-Naphthalenediimide-Based Threading Intercalators of DNA.

    PubMed

    Suseela, Y V; Das, Shubhajit; Pati, Swapan K; Govindaraju, T

    2016-11-17

    Intercalation by threading is anticipated to feature in DNA-binding molecules for developing DNA-targeted diagnostics and therapeutics. We investigated the role of an imidazolyl moiety in threading intercalators of DNA by employing a number of imidazolyl-naphthalenediimide conjugates. Threading intercalation was studied by UV spectroscopy, competitive binding fluorescent dye displacement, circular dichroism, isothermal calorimetry, and computational analysis. NIm6 was found to be a strong candidate, with good half-life, as revealed by dissociation kinetic analysis. Computational studies supported intercalation of the naphthalene core between base pairs and binding of the imidazolyl moieties in the adjacent grooves (threading mechanism) through electrostatic and hydrogen-bonding interactions. The interaction of the positively charged imidazolium moieties with the negatively charged phosphate backbone of DNA contributed to the favorable enthalpy change, as revealed by the experimental and computational data. Threading intercalation by NIm6 caused significant retardation of DNA in an electrophoretic mobility shift assay. The biological significance of potent imidazolyl naphthalenediimide conjugates was demonstrated by the inhibition of topo- isomerase I activity and cytotoxicity against HeLa cells. © 2016 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1.

    PubMed Central

    Sebastian, J; Sancar, G B

    1991-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. We report here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 upstream repression sequence, that together regulate induction of PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. A prominent feature of the foot-printed region is a 22-base-pair palindrome. Deletion of the PHR1 upstream repression sequence increased the basal level expression of PHR1 in vivo and decreased induction after exposure of cells to UV radiation or methyl methanesulfonate, whereas insertion of the PRP binding site between the CYC1 upstream activation sequence and "TATA" sequence reduced basal level expression and conferred damage responsiveness upon a reporter gene. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription. Images PMID:1763039

  18. Electromigration of single molecules of DNA in a crystalline array of 300-nm silica colloids.

    PubMed

    Zhang, Hui; Wirth, Mary J

    2005-03-01

    The velocities and conformations of single DNA chains were probed as they electromigrated at varying electric field strength through a crystalline array of silica colloids. An optically transparent film consisting of 300-nm silica colloids was formed on glass as a transparent crystalline layer of 7 mum thickness with an effective pore size of 45 nm. The behaviors of individual lambda-DNA molecules (48,502 base pairs) electromigrating through this material were observed to be analogous to the behaviors of long DNA chains in electrophoresis gels, including chain extension, hooking of chains around the matrix, and hernia formation. The electrophoretic mobility of lambda-DNA in this dense, narrow-pore material is surprisingly high: 1.8 cm2/Vs at 10 V/cm, which is at least as high as for much wider-pore gels. Imaging of the single molecules revealed that higher field strength caused increased chain extension and increased mobility, which reached an apparent plateau just above 2.0 cm2/Vs at 200 V/cm. Pulsed, crossed electric fields of 200 V/cm at 120 degrees to one another were applied to the material. The DNA chains were observed by imaging to electromigrate in an orderly fashion, and the migration rate was found to be length-dependent. The results indicate that these thin, robust, self-assembling inorganic materials are interesting as possible alternatives to polymeric gels for higher speed electrophoresis.

  19. Simple and practical staining of DNA with GelRed in agarose gel electrophoresis.

    PubMed

    Huang, Qing; Baum, Larry; Fu, Wei-Ling

    2010-01-01

    Although SYBR Gold or SYBR Green I have been used in the loading buffer as a DNA stain safer than ethidium bromide for agarose gel electrophoresis, electrophoretic mobility of DNA is altered and thus DNA fragment size cannot be accurately determined. A method using GelRed in the loading buffer was developed to stain DNA fragments in agarose gel electrophoresis. Among various concentrations of GelRed, SYBR Gold, or SYBR Green I tested in the loading buffer, only the highest tested concentration of GelRed, i.e., 100x GelRed, did not change band mobility. Evaluations using various sizes of PCR products at different concentrations further confirmed that 100x GelRed could be used to accurately determine DNA fragment size. The reagent can be stored at 4 degrees C for at least 1 year without a decrease in staining sensitivity. The 100x GelRed is a sensitive and safe alternative to ethidium bromide and better than either SYBR Gold or SYBR Green I for size determination in agarose gel electrophoresis. Our laboratory now uses the GelRed method routinely with great consistency and success.

  20. Mechanism of spacer integration links the CRISPR/Cas system to transposition as a form of mobile DNA.

    PubMed

    Dyda, Fred; Hickman, Alison B

    2015-01-01

    It has recently become clear that many bacterial and archaeal species possess adaptive immune systems. These are typified by multiple copies of DNA sequences known as clustered regularly interspaced short palindromic repeats (CRISPRs). These CRISPR repeats are the sites at which short spacers containing sequences of previously encountered foreign DNA are integrated, and the spacers serve as the molecular memory of previous invaders. In vivo work has demonstrated that two CRISPR-associated proteins - Cas1 and Cas2 - are required for spacer integration, but the mechanism by which this is accomplished remained unclear. Here we review a recent paper describing the in vitro reconstitution of CRISPR spacer integration using purified Cas1 and Cas2 and place the results in context of similar DNA transposition reactions and the crystal structure of the Cas1/Cas2 complex.

  1. High flow-resolution for mobility estimation in 2D-ENMR of proteins using maximum entropy method (MEM-ENMR).

    PubMed

    Thakur, Sunitha B; He, Qiuhong

    2006-11-01

    Multidimensional electrophoretic NMR (nD-ENMR) is a potentially powerful tool for structural characterization of co-existing proteins and protein conformations. By applying a DC electric field pulse, the electrophoretic migration rates of different proteins were detected experimentally in a new dimension of electrophoretic flow. The electrophoretic mobilities were employed to differentiate protein signals. In U-shaped ENMR sample chambers, individual protein components in a solution mixture followed a cosinusoidal electrophoretic interferogram as a function of its unique electrophoretic migration rate. After Fourier transformation in the electrophoretic flow dimension, the protein signals were resolved at different resonant frequencies proportional to their electrophoretic mobilities. Currently, the mobility resolution of the proteins in the electrophoretic flow dimension is limited by severe truncations of the electrophoretic interferograms due to the finite electric field strength available before the onset of heat-induced convection. In this article, we present a successful signal processing method, the Burg's maximum entropy method (MEM), to analyze the truncated ENMR signals (MEM-ENMR). Significant enhancement in flow resolution was demonstrated using two-dimensional ENMR of two protein samples: a lysozyme solution and a solution mixture of bovine serum albumin (BSA) and ubiquitin. The electrophoretic mobilities of lysozyme, BSA and ubiquitin were measured from the MEM analysis as 7.5x10(-5), 1.9x10(-4) and 8.7x10(-5) cm2 V-1 s-1, respectively. Results from computer simulations confirmed a complete removal of truncation artifacts in the MEM-ENMR spectra with 3- to 6-fold resolution enhancement.

  2. High flow-resolution for mobility estimation in 2D-ENMR of proteins using maximum entropy method (MEM-ENMR)

    NASA Astrophysics Data System (ADS)

    Thakur, Sunitha B.; He, Qiuhong

    2006-11-01

    Multidimensional electrophoretic NMR (nD-ENMR) is a potentially powerful tool for structural characterization of co-existing proteins and protein conformations. By applying a DC electric field pulse, the electrophoretic migration rates of different proteins were detected experimentally in a new dimension of electrophoretic flow. The electrophoretic mobilities were employed to differentiate protein signals. In U-shaped ENMR sample chambers, individual protein components in a solution mixture followed a cosinusoidal electrophoretic interferogram as a function of its unique electrophoretic migration rate. After Fourier transformation in the electrophoretic flow dimension, the protein signals were resolved at different resonant frequencies proportional to their electrophoretic mobilities. Currently, the mobility resolution of the proteins in the electrophoretic flow dimension is limited by severe truncations of the electrophoretic interferograms due to the finite electric field strength available before the onset of heat-induced convection. In this article, we present a successful signal processing method, the Burg's maximum entropy method (MEM), to analyze the truncated ENMR signals (MEM-ENMR). Significant enhancement in flow resolution was demonstrated using two-dimensional ENMR of two protein samples: a lysozyme solution and a solution mixture of bovine serum albumin (BSA) and ubiquitin. The electrophoretic mobilities of lysozyme, BSA and ubiquitin were measured from the MEM analysis as 7.5 × 10 -5, 1.9 × 10 -4 and 8.7 × 10 -5 cm 2 V -1 s -1, respectively. Results from computer simulations confirmed a complete removal of truncation artifacts in the MEM-ENMR spectra with 3- to 6-fold resolution enhancement.

  3. [Characterization of recombinant single-stranded DNA-binding protein from Escherichia coli and its application in accurate pyrosequencing].

    PubMed

    Wang, Jianping; Zou, Bingjie; Chen, Zhiyao; Ma, Yinjiao; Xu, Shu; Zhou, Guohua

    2011-10-01

    We expressed recombinant single-stranded DNA-binding protein (r-SSBP) from Escherichia coli with the molecular weight of 24-kDa by using genetic engineering strategy, and demonstrated the single-stranded DNA (ssDNA)-binding activity of r-SSBP by electrophoretic mobility shift assay (EMSA). To further characterize r-SSBP, we studied the effects of r-SSBP on melting temperature (T(m)) of DNA. The results showed that r-SSBP could bind to ssDNA, and lower the T(m) of DNA, especially for single-base mismatched DNA. Therefore, r-SSBP significantly increased the T(m) difference between single-base mismatched DNA and perfect matched DNA. These results are very beneficial for single-nucleotide polymorphism detection. Moreover, we applied r-SSBP in high sensitive pyrosequencing system developed by our group. The results suggest that the r-SSBP decreased non-specific signals, corrected the proportion of signal peak height and improved the performance of pyrosequencing.

  4. Two-Tailed Comet Assay (2T-Comet): Simultaneous Detection of DNA Single and Double Strand Breaks.

    PubMed

    Cortés-Gutiérrez, Elva I; Fernández, José Luis; Dávila-Rodríguez, Martha I; López-Fernández, Carmen; Gosálvez, Jaime

    2017-01-01

    A modification of the original comet assay was developed for the simultaneous evaluation of DNA single strand breaks (SSBs) and double strand breaks (DSBs) in human spermatozoa. The two-dimensional perpendicular tail comet assay (2T-comet) combines non-denaturing and denaturant conditions to the same sperm nucleoid. In this case, the species-specific deproteinized sperm is first subjected to an electrophoretic field under non-denaturing conditions to mobilize isolated free discrete DNA fragments produced from DSBs; this is then followed by a second electrophoresis running perpendicular to the first one but under alkaline conditions to produce DNA denaturation, exposing SSBs on the same linear DNA chain or DNA fragments flanked by DSBs. This procedure results in a two dimensional comet tail emerging from the core where two types of original DNA affected molecule can be simultaneously discriminated. The 2T-comet is a fast, sensitive, and reliable procedure to distinguish between single and double strand DNA damage within the same cell. It is an innovative method for assessing sperm DNA integrity, which has important implications for human fertility and andrological pathology. This technique may be adapted to assess different DNA break types in other species and other cell types.

  5. DNA Damage-Induced HSPC Malfunction Depends on ROS Accumulation Downstream of IFN-1 Signaling and Bid Mobilization.

    PubMed

    Tasdogan, Alpaslan; Kumar, Suresh; Allies, Gabriele; Bausinger, Julia; Beckel, Franziska; Hofemeister, Helmut; Mulaw, Medhanie; Madan, Vikas; Scharfetter-Kochanek, Karin; Feuring-Buske, Michaela; Doehner, Konstanze; Speit, Günter; Stewart, A Francis; Fehling, Hans Joerg

    2016-12-01

    Mouse mutants with an impaired DNA damage response frequently exhibit a set of remarkably similar defects in the HSPC compartment that are of largely unknown molecular basis. Using Mixed-Lineage-Leukemia-5 (Mll5)-deficient mice as prototypical examples, we have identified a mechanistic pathway linking DNA damage and HSPC malfunction. We show that Mll5 deficiency results in accumulation of DNA damage and reactive oxygen species (ROS) in HSPCs. Reduction of ROS efficiently reverses hematopoietic defects, establishing ROS as a major cause of impaired HSPC function. The Ink4a/Arf locus also contributes to HSPC phenotypes, at least in part via promotion of ROS. Strikingly, toxic ROS levels in Mll5(-/-) mice are critically dependent on type 1 interferon (IFN-1) signaling, which triggers mitochondrial accumulation of full-length Bid. Genetic inactivation of Bid diminishes ROS levels and reverses HSPC defects in Mll5(-/-) mice. Overall, therefore, our findings highlight an unexpected IFN-1 > Bid > ROS pathway underlying DNA damage-associated HSPC malfunction.

  6. Changes in DNA methylation and transgenerational mobilization of a transposable element (mPing) by the Topoisomerase II inhibitor, Etoposide, in rice

    PubMed Central

    2012-01-01

    Background Etoposide (epipodophyllotoxin) is a chemical commonly used as an anti-cancer drug which inhibits DNA synthesis by blocking topoisomerase II activity. Previous studies in animal cells have demonstrated that etoposide constitutes a genotoxic stress which may induce genomic instability including mobilization of normally quiescent transposable elements (TEs). However, it remained unknown whether similar genetically mutagenic effects could be imposed by etoposide in plant cells. Also, no information is available with regard to whether the drug may cause a perturbation of epigenetic stability in any organism. Results To investigate whether etoposide could generate genetic and/or epigenetic instability in plant cells, we applied etoposide to germinating seeds of six cultivated rice (Oryza sativa L.) genotypes including both subspecies, japonica and indica. Based on the methylation-sensitive gel-blotting results, epigenetic changes in DNA methylation of three TEs (Tos17, Osr23 and Osr36) and two protein-encoding genes (Homeobox and CDPK-related genes) were detected in the etoposide-treated plants (S0 generation) in four of the six studied japonica cultivars, Nipponbare, RZ1, RZ2, and RZ35, but not in the rest japonica cultivar (Matsumae) and the indica cultivar (93-11). DNA methylation changes in the etoposide-treated S0 rice plants were validated by bisulfite sequencing at both of two analyzed loci (Tos17 and Osr36). Transpositional activity was tested for eight TEs endogenous to the rice genome in both the S0 plants and their selfed progenies (S1 and S2) of one of the cultivars, RZ1, which manifested heritable phenotypic variations. Results indicated that no transposition occurred in the etoposide-treated S0 plants for any of the TEs. Nonetheless, a MITE transposon, mPing, showed rampant mobilization in the S1 and S2 progenies descended from the drug-treated S0 plants. Conclusions Our results demonstrate that etoposide imposes a similar genotoxic stress on

  7. Selectively-etched nanochannel electrophoretic and electrochemical devices

    DOEpatents

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2006-06-27

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  8. Selectively-etched nanochannel electrophoretic and electrochemical devices

    DOEpatents

    Surh, Michael P.; Wilson, William D.; Barbee, Jr., Troy W.; Lane, Stephen M.

    2004-11-16

    Nanochannel electrophoretic and electrochemical devices having selectively-etched nanolaminates located in the fluid transport channel. The normally flat surfaces of the nanolaminate having exposed conductive (metal) stripes are selectively-etched to form trenches and baffles. The modifications of the prior utilized flat exposed surfaces increase the amount of exposed metal to facilitate electrochemical redox reaction or control the exposure of the metal surfaces to analytes of large size. These etched areas variously increase the sensitivity of electrochemical detection devices to low concentrations of analyte, improve the plug flow characteristic of the channel, and allow additional discrimination of the colloidal particles during cyclic voltammetry.

  9. Antisera against electrophoretically purified tubulin stimulate colchicine-binding activity.

    PubMed Central

    Aubin, J E; Subrahmanyan, L; Kalnins, V I; Ling, V

    1976-01-01

    Several rabbit antisera have been prepared against reduced and alkylated, electrophoretically purified tubulin isolated from chick brain. These antisera give a single precipitin line in Ouchterlony double diffusion plates when tested against partially purified tubulin, and label specifically microtubule- and tubulin-containing structures, such as mitotic spindles, cilia, and vinblastine-induced crystals, in a variety of cells. The same antisera also display the unique ability to stimulate the colchicine-binding activity of tubulin preparations from chick brain and Chinese hamster ovary tissue culture cells. This specific stimulation of colchicine binding activity is also obtained with the gamma globulin fractions purified by ammonium sulfate precipitation of these antisera. Images PMID:57619

  10. Power and limitations of electrophoretic separations in proteomics strategies.

    PubMed

    Rabilloud, Thierry; Vaezzadeh, Ali R; Potier, Noelle; Lelong, Cécile; Leize-Wagner, Emmanuelle; Chevallet, Mireille

    2009-01-01

    Proteomics can be defined as the large-scale analysis of proteins. Due to the complexity of biological systems, it is required to concatenate various separation techniques prior to mass spectrometry. These techniques, dealing with proteins or peptides, can rely on chromatography or electrophoresis. In this review, the electrophoretic techniques are under scrutiny. Their principles are recalled, and their applications for peptide and protein separations are presented and critically discussed. In addition, the features that are specific to gel electrophoresis and that interplay with mass spectrometry (i.e., protein detection after electrophoresis, and the process leading from a gel piece to a solution of peptides) are also discussed.

  11. AN ELECTROPHORETIC STUDY OF NEPHROTIC SERA AND URINE

    PubMed Central

    Longsworth, L. G.; MacInnes, D. A.

    1940-01-01

    The electrophoretic patterns of the sera and urine of two cases of lipoid nephrosis have been obtained and have been compared with a typical pattern of normal serum. The patterns of the pathological sera deviated widely from the normal, indicating relatively low albumin and high globulin content. The comparison of the patterns of nephrotic sera cleared by centrifugation and by ether extraction shows that a large portion of the β globulin consisted of a labile lipo-protein. The pattern of the nephrotic urine proteins resembled that of normal serum, with, however, significant differences. PMID:19870946

  12. DNA Extraction by Isotachophoresis in a Microfluidic Channel

    SciTech Connect

    Stephenson, S J

    2011-08-10

    Biological assays have many applications. For example, forensics personnel and medical professionals use these tests to diagnose diseases and track their progression or identify pathogens and the host response to them. One limitation of these tests, however, is that most of them target only one piece of the sample - such as bacterial DNA - and other components (e.g. host genomic DNA) get in the way, even though they may be useful for different tests. To address this problem, it would be useful to extract several different substances from a complex biological sample - such as blood - in an inexpensive and efficient manner. This summer, I worked with Maxim Shusteff at Lawrence Livermore National Lab on the Rapid Automated Sample Prep project. The goal of the project is to solve the aforementioned problem by creating a system that uses a series of different extraction methods to extract cells, bacteria, and DNA from a complex biological sample. Biological assays can then be run on purified output samples. In this device, an operator could input a complex sample such as blood or saliva, and would receive separate outputs of cells, bacteria, viruses, and DNA. I had the opportunity to work this summer with isotachophoresis (ITP), a technique that can be used to extract nucleic acids from a sample. This technique is intended to be the last stage of the purification device. Isotachophoresis separates particles based on different electrophoretic mobilities. This technique is convenient for out application because free solution DNA mobility is approximately equal for DNA longer than 300 base pairs in length. The sample of interest - in our case DNA - is fed into the chip with streams of leading electrolyte (LE) and trailing electrolyte (TE). When an electric field is applied, the species migrate based on their electrophoretic mobilities. Because the ions in the leading electrolyte have a high electrophoretic mobility, they race ahead of the slower sample and trailing

  13. Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis.

    PubMed

    Walz, M; Kück, U

    1995-12-01

    The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.

  14. Carbon dots based FRET for the detection of DNA damage.

    PubMed

    Kudr, Jiri; Richtera, Lukas; Xhaxhiu, Kledi; Hynek, David; Heger, Zbynek; Zitka, Ondrej; Adam, Vojtech

    2017-02-09

    Here, we aimed our attention at the synthesis of carbon dots (C-dots) with the ability to interact with DNA to suggest an approach for the detection of DNA damage. Primarily, C-dots modified with amine moieties were synthesized using the one-step microwave pyrolysis of citric acid in the presence of diethylenetriamine. The C-dots showed strong photoluminescence with a quantum yield of 4%. In addition, the C-dots (2.8±0.8nm) possessed a good colloidal stability and exhibited a positive surface charge (ζ=36mV) at a neutral pH. An interaction study of the C-dots and the DNA fragment of λ bacteriophage was performed, and the DNA binding resulted in changes to the photoluminescent and absorption properties of the C-dots. A binding of the C-dots to DNA was also