Sample records for dna expression vectors

  1. Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

    PubMed Central

    Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

    2012-01-01

    Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

  2. Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

    PubMed

    Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

    2014-11-01

    Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Chromosomal integration of adenoviral vector DNA in vivo.

    PubMed

    Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan

    2010-10-01

    So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.

  4. A Simple And Rapid Minicircle DNA Vector Manufacturing System

    PubMed Central

    Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

    2010-01-01

    Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

  5. [Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

    PubMed

    Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

    2008-02-01

    To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

  6. [Cloning of human CD45 gene and its expression in Hela cells].

    PubMed

    Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang

    2015-11-01

    To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.

  7. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  8. Geminivirus vectors for high-level expression of foreign proteins in plant cells.

    PubMed

    Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S

    2003-02-20

    Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.

  9. Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

    PubMed

    Tolmachov, Oleg E

    2010-04-01

    Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

  10. Reflections on the early development of poxvirus vectors.

    PubMed

    Moss, Bernard

    2013-09-06

    Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.

  11. The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon

    2012-12-01

    The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.

  12. Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

    PubMed Central

    Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

    2010-01-01

    Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

  13. Comprehensive gene expression profiling following DNA vaccination of rainbow trout against infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Purcell, Maureen K.; Nichols, Krista M.; Winton, James R.; Kurath, Gael; Thorgaard, Gary H.; Wheeler, Paul; Hansen, John D.; Herwig, Russell P.; Park, Linda K.

    2006-01-01

    The DNA vaccine based on the glycoprotein gene of Infectious hematopoietic necrosis virus induces a non-specific anti-viral immune response and long-term specific immunity against IHNV. This study characterized gene expression responses associated with the early anti-viral response. Homozygous rainbow trout were injected intra-muscularly (I.M.) with vector DNA or the IHNV DNA vaccine. Gene expression in muscle tissue (I.M. site) was evaluated using a 16,008 feature salmon cDNA microarray. Eighty different genes were significantly modulated in the vector DNA group while 910 genes were modulated in the IHNV DNA vaccinate group relative to control group. Quantitative reverse-transcriptase PCR was used to examine expression of selected immune genes at the I.M. site and in other secondary tissues. In the localized response (I.M. site), the magnitudes of gene expression changes were much greater in the vaccinate group relative to the vector DNA group for the majority of genes analyzed. At secondary systemic sites (e.g. gill, kidney and spleen), type I IFN-related genes were up-regulated in only the IHNV DNA vaccinated group. The results presented here suggest that the IHNV DNA vaccine induces up-regulation of the type I IFN system across multiple tissues, which is the functional basis of early anti-viral immunity.

  14. Water-soluble fullerene (C60) derivatives as nonviral gene-delivery vectors.

    PubMed

    Sitharaman, Balaji; Zakharian, Tatiana Y; Saraf, Anita; Misra, Preeti; Ashcroft, Jared; Pan, Su; Pham, Quynh P; Mikos, Antonios G; Wilson, Lon J; Engler, David A

    2008-01-01

    A new class of water-soluble C60 transfecting agents has been prepared using Hirsch-Bingel chemistry and assessed for their ability to act as gene-delivery vectors in vitro. In an effort to elucidate the relationship between the hydrophobicity of the fullerene core, the hydrophilicity of the water-solubilizing groups, and the overall charge state of the C60 vectors in gene delivery and expression, several different C60 derivatives were synthesized to yield either positively charged, negatively charged, or neutral chemical functionalities under physiological conditions. These fullerene derivatives were then tested for their ability to transfect cells grown in culture with DNA carrying the green fluorescent protein (GFP) reporter gene. Statistically significant expression of GFP was observed for all forms of the C60 derivatives when used as DNA vectors and compared to the ability of naked DNA alone to transfect cells. However, efficient in vitro transfection was only achieved with the two positively charged C60 derivatives, namely, an octa-amino derivatized C60 and a dodeca-amino derivatized C60 vector. All C60 vectors showed an increase in toxicity in a dose-dependent manner. Increased levels of cellular toxicity were observed for positively charged C60 vectors relative to the negatively charged and neutral vectors. Structural analyses using dynamic light scattering and optical microscopy offered further insights into possible correlations between the various derivatized C60 compounds, the C60 vector/DNA complexes, their physical attributes (aggregation, charge) and their transfection efficiencies. Recently, similar Gd@C60-based compounds have demonstrated potential as advanced contrast agents for magnetic resonance imaging (MRI). Thus, the successful demonstration of intracellular DNA uptake, intracellular transport, and gene expression from DNA using C60 vectors suggests the possibility of developing analogous Gd@C60-based vectors to serve simultaneously as both therapeutic and diagnostic agents.

  15. Single-stranded DNA condensed with poly-L-lysine results in nanometric particles that are significantly smaller, more stable in physiological ionic strength fluids and afford higher efficiency of gene delivery than their double-stranded counterparts.

    PubMed

    Molas, M; Bartrons, R; Perales, J C

    2002-08-15

    Nonviral gene transfer vectors have been actively studied in the past years in order to obtain structural entities with minimum size and defined shape. The final size of a gene transfer vector, which is compacted into unimolecular complexes, is directly proportional to the mass of the nucleic acid to be compacted. Thus, the purpose of this study was to assess the possibility of producing ssDNA vectors and their biophysical and biological characterization. We have obtained ssDNA/poly-L-lysine complexes that are significantly smaller than their double-stranded counterparts. We have also identified a lesser aggregative behavior of compacted single-stranded vs. double-stranded DNA vectors in the presence of physiological NaCl concentrations. Expression of compacted ssDNA is observed in hepatoma cell lines. Moreover, we have successfully delivered galactosylated ssDNA complexes into cells that express the asialoglycoprotein receptor via receptor-mediated endocytosis. The reduced size and biophysical behavior of ssDNA vectors may provide an advantage for transfection of eukaryotic cells.

  16. Production of non viral DNA vectors.

    PubMed

    Schleef, Martin; Blaesen, Markus; Schmeer, Marco; Baier, Ruth; Marie, Corinne; Dickson, George; Scherman, Daniel

    2010-12-01

    After some decades of research, development and first clinical approaches to use DNA vectors in gene therapy, cell therapy and DNA vaccination, the requirements for the pharmaceutical manufacturing of gene vectors has improved significantly step by step. Even the expression level and specificity of non viral DNA vectors were significantly modified and followed the success of viral vectors. The strict separation of "viral" and "non viral" gene transfer are historic borders between scientist and we will show that both fields together are able to allow the next step towards successful prevention and therapy. Here we summarize the features of producing and modifying these non-viral gene vectors to ensure the required quality to modify cells and to treat human and animals.

  17. Self-entanglement of long linear DNA vectors using transient non-B-DNA attachment points: a new concept for improvement of non-viral therapeutic gene delivery.

    PubMed

    Tolmachov, Oleg E

    2012-05-01

    The cell-specific and long-term expression of therapeutic transgenes often requires a full array of native gene control elements including distal enhancers, regulatory introns and chromatin organisation sequences. The delivery of such extended gene expression modules to human cells can be accomplished with non-viral high-molecular-weight DNA vectors, in particular with several classes of linear DNA vectors. All high-molecular-weight DNA vectors are susceptible to damage by shear stress, and while for some of the vectors the harmful impact of shear stress can be minimised through the transformation of the vectors to compact topological configurations by supercoiling and/or knotting, linear DNA vectors with terminal loops or covalently attached terminal proteins cannot be self-compacted in this way. In this case, the only available self-compacting option is self-entangling, which can be defined as the folding of single DNA molecules into a configuration with mutual restriction of molecular motion by the individual segments of bent DNA. A negatively charged phosphate backbone makes DNA self-repulsive, so it is reasonable to assume that a certain number of 'sticky points' dispersed within DNA could facilitate the entangling by bringing DNA segments into proximity and by interfering with the DNA slipping away from the entanglement. I propose that the spontaneous entanglement of vector DNA can be enhanced by the interlacing of the DNA with sites capable of mutual transient attachment through the formation of non-B-DNA forms, such as interacting cruciform structures, inter-segment triplexes, slipped-strand DNA, left-handed duplexes (Z-forms) or G-quadruplexes. It is expected that the non-B-DNA based entanglement of the linear DNA vectors would consist of the initial transient and co-operative non-B-DNA mediated binding events followed by tight self-ensnarement of the vector DNA. Once in the nucleoplasm of the target human cells, the DNA can be disentangled by type II topoisomerases. The technology for such self-entanglement can be an avenue for the improvement of gene delivery with high-molecular-weight naked DNA using therapeutically important methods associated with considerable shear stress. Priority applications include in vivo muscle electroporation and sonoporation for Duchenne muscular dystrophy patients, aerosol inhalation to reach the target lung cells of cystic fibrosis patients and bio-ballistic delivery to skin melanomas with the vector DNA adsorbed on gold or tungsten projectiles. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

    PubMed Central

    Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2013-01-01

    DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

  19. In Vivo Functional Genomic Studies of Sterol Carrier Protein-2 Gene in the Yellow Fever Mosquito

    PubMed Central

    Peng, Rong; Maklokova, Vilena I.; Chandrashekhar, Jayadevi H.; Lan, Que

    2011-01-01

    A simple and efficient DNA delivery method to introduce extrachromosomal DNA into mosquito embryos would significantly aid functional genomic studies. The conventional method for delivery of DNA into insects is to inject the DNA directly into the embryos. Taking advantage of the unique aspects of mosquito reproductive physiology during vitellogenesis and an in vivo transfection reagent that mediates DNA uptake in cells via endocytosis, we have developed a new method to introduce DNA into mosquito embryos vertically via microinjection of DNA vectors in vitellogenic females without directly manipulating the embryos. Our method was able to introduce inducible gene expression vectors transiently into F0 mosquitoes to perform functional studies in vivo without transgenic lines. The high efficiency of expression knockdown was reproducible with more than 70% of the F0 individuals showed sufficient gene expression suppression (<30% of the controls' levels). At the cohort level, AeSCP-2 expression knockdown in early instar larvae resulted in detectable phenotypes of the expression deficiency such as high mortality, lowered fertility, and distorted sex ratio after induction of AeSCP-2 siRNA expression in vivo. The results further confirmed the important role of AeSCP-2 in the development and reproduction of A. aegypti. In this study, we proved that extrachromosaomal transient expression of an inducible gene from a DNA vector vertically delivered via vitellogenic females can be used to manipulate gene expression in F0 generation. This new method will be a simple and efficient tool for in vivo functional genomic studies in mosquitoes. PMID:21437205

  20. Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

    PubMed

    Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

    2015-04-01

    Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

  1. Novel Nonreplicating Vaccinia Virus Vector Enhances Expression of Heterologous Genes and Suppresses Synthesis of Endogenous Viral Proteins.

    PubMed

    Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard

    2017-06-06

    Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.

  2. [Construction of Plasmodium falciparum signal peptide peptidase-GFP mutant and its expression analysis in the malaria parasite].

    PubMed

    Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti

    2014-08-01

    To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.

  3. Elimination of both E1 and E2 from adenovirus vectors further improves prospects for in vivo human gene therapy.

    PubMed Central

    Gorziglia, M I; Kadan, M J; Yei, S; Lim, J; Lee, G M; Luthra, R; Trapnell, B C

    1996-01-01

    A novel recombinant adenovirus vector, Av3nBg, was constructed with deletions in adenovirus E1, E2a, and E3 regions and expressing a beta-galactosidase reporter gene. Av3nBg can be propagated at a high titer in a corresponding A549-derived cell line, AE1-2a, which contains the adenovirus E1 and E2a region genes inducibly expressed from separate glucocorticoid-responsive promoters. Av3nBg demonstrated gene transfer and expression comparable to that of Av1nBg, a first-generation adenovirus vector with deletions in E1 and E3. Several lines of evidence suggest that this vector is significantly more attenuated than E1 and E3 deletion vectors. Metabolic DNA labeling studies showed no detectable de novo vector DNA synthesis or accumulation, and metabolic protein labeling demonstrated no detectable de novo hexon protein synthesis for Av3nBg in naive A549 cells even at a multiplicity of infection of up to 3,000 PFU per cell. Additionally, naive A549 cells infected by Av3nBg did not accumulate infectious virions. In contrast, both Av1nBg and Av2Lu vectors showed DNA replication and hexon protein synthesis at multiplicities of infection of 500 PFU per cell. Av2Lu has a deletion in E1 and also carries a temperature-sensitive mutation in E2a. Thus, molecular characterization has demonstrated that the Av3nBg vector is improved with respect to the potential for vector DNA replication and hexon protein expression compared with both first-generation (Av1nBg) and second-generation (Av2Lu) adenoviral vectors. These observations may have important implications for potential use of adenovirus vectors in human gene therapy. PMID:8648763

  4. Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

    PubMed Central

    Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

    2008-01-01

    In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

  5. Antitumor HPV E7-specific CTL activity elicited by in vivo engineered exosomes produced through DNA inoculation.

    PubMed

    Di Bonito, Paola; Chiozzini, Chiara; Arenaccio, Claudia; Anticoli, Simona; Manfredi, Francesco; Olivetta, Eleonora; Ferrantelli, Flavia; Falcone, Emiliana; Ruggieri, Anna; Federico, Maurizio

    2017-01-01

    We recently proved that exosomes engineered in vitro to deliver high amounts of HPV E7 upon fusion with the Nef mut exosome-anchoring protein elicit an efficient anti-E7 cytotoxic T lymphocyte immune response. However, in view of a potential clinic application of this finding, our exosome-based immunization strategy was faced with possible technical difficulties including industrial manufacturing, cost of production, and storage. To overcome these hurdles, we designed an as yet unproven exosome-based immunization strategy relying on delivery by intramuscular inoculation of a DNA vector expressing Nef mut fused with HPV E7. In this way, we predicted that the expression of the Nef mut /E7 vector in muscle cells would result in a continuous source of endogenous (ie, produced by the inoculated host) engineered exosomes able to induce an E7-specific immune response. To assess this hypothesis, we first demonstrated that the injection of a Nef mut /green fluorescent protein-expressing vector led to the release of fluorescent exosomes, as detected in plasma of inoculated mice. Then, we observed that mice inoculated intramuscularly with a vector expressing Nef mut /E7 developed a CD8 + T-cell immune response against both Nef and E7. Conversely, no CD8 + T-cell responses were detected upon injection of vectors expressing either the wild-type Nef isoform of E7 alone, most likely a consequence of their inefficient exosome incorporation. The production of immunogenic exosomes in the DNA-injected mice was formally demonstrated by the E7-specific CD8 + T-cell immune response we detected in mice inoculated with exosomes isolated from plasma of mice inoculated with the Nef mut /E7 vector. Finally, we provide evidence that the injection of Nef mut /E7 DNA led to the generation of effective antigen-specific cytotoxic T lymphocytes whose activity was likely part of the potent, therapeutic antitumor effect we observed in mice implanted with TC-1 tumor cells. In summary, we established a novel method to generate immunogenic exosomes in vivo by the intramuscular inoculation of DNA vectors expressing the exosome-anchoring protein Nef mut and its derivatives.

  6. Problem-Solving Test: Expression Cloning of the Erythropoietin Receptor

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2008-01-01

    Terms to be familiar with before you start to solve the test: cytokines, cytokine receptors, cDNA library, cDNA synthesis, poly(A)[superscript +] RNA, primer, template, reverse transcriptase, restriction endonucleases, cohesive ends, expression vector, promoter, Shine-Dalgarno sequence, poly(A) signal, DNA helicase, DNA ligase, topoisomerases,…

  7. Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.

    PubMed

    Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo

    2016-09-01

    Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.

  8. Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

    USDA-ARS?s Scientific Manuscript database

    A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

  9. Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

    PubMed

    Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

    2016-08-01

    Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

  10. Potentiation of anthrax vaccines using protective antigen-expressing viral replicon vectors.

    PubMed

    Wang, Hai-Chao; An, Huai-Jie; Yu, Yun-Zhou; Xu, Qing

    2015-02-01

    DNA vaccines require improvement for human use because they are generally weak stimulators of the immune system in humans. The efficacy of DNA vaccines can be improved using a viral replicon as vector to administer antigen of pathogen. In this study, we comprehensively evaluated the conventional non-viral DNA, viral replicon DNA or viral replicon particles (VRP) vaccines encoding different forms of anthrax protective antigen (PA) for specific immunity and protective potency against anthrax. Our current results clearly suggested that these viral replicon DNA or VRP vaccines derived from Semliki Forest virus (SFV) induced stronger PA-specific immune responses than the conventional non-viral DNA vaccines when encoding the same antigen forms, which resulted in potent protection against challenge with the Bacillus anthracis strain A16R. Additionally, the naked PA-expressing SFV replicon DNA or VRP vaccines without the need for high doses or demanding particular delivery regimens elicited robust immune responses and afforded completely protective potencies, which indicated the potential of the SFV replicon as vector of anthrax vaccines for use in clinical application. Therefore, our results suggest that these PA-expressing SFV replicon DNA or VRP vaccines may be suitable as candidate vaccines against anthrax. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Transformable Rhodobacter strains, method for producing transformable Rhodobacter strains

    DOEpatents

    Laible, Philip D.; Hanson, Deborah K.

    2018-05-08

    The invention provides an organism for expressing foreign DNA, the organism engineered to accept standard DNA carriers. The genome of the organism codes for intracytoplasmic membranes and features an interruption in at least one of the genes coding for restriction enzymes. Further provided is a system for producing biological materials comprising: selecting a vehicle to carry DNA which codes for the biological materials; determining sites on the vehicle's DNA sequence susceptible to restriction enzyme cleavage; choosing an organism to accept the vehicle based on that organism not acting upon at least one of said vehicle's sites; engineering said vehicle to contain said DNA; thereby creating a synthetic vector; and causing the synthetic vector to enter the organism so as cause expression of said DNA.

  12. Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

    NASA Astrophysics Data System (ADS)

    Lau, Yun-Fai; Kan, Yuet Wai

    1983-09-01

    We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

  13. Overexpression of SASH1 related to the decreased invasion ability of human glioma U251 cells.

    PubMed

    Yang, Liu; Liu, Mei; Gu, Zhikai; Chen, Jianguo; Yan, Yaohua; Li, Jian

    2012-12-01

    The purpose of this study was to investigate the impact of SAM- and SH3-domain containing 1 (SASH1) on the biological behavior of glioma cells, including its effects on cellular growth, proliferation, apoptosis, invasion, and metastasis, and thereby to provide an experimental basis for future therapeutic treatments. A pcDNA3.1-SASH1 eukaryotic expression vector was constructed and transfected into the U251 human glioma cell line. Using the tetrazolium-based colorimetric (MTT) assay, flow cytometry analyses, transwell invasion chamber experiments, and other methods, we examined the impact of SASH1 on the biological behaviors of U251 cells, including effects on viability, cell cycle, apoptosis, and invasion. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-2, MMP-9, and other proteins was observed. Compared to the empty vector and blank control groups, the pcDNA3.1-SASH1 group of U251 cells exhibited significantly reduced cell viability, proliferation, and invasion (p < 0.05), although there was no difference between the empty vector and blank control groups. The pcDNA3.1-SASH1 group demonstrated a significantly higher apoptotic index than did the empty vector and blank control groups (p < 0.05), and the percentage of apoptotic cells was similar between the empty vector and blank control groups. In addition, the pcDNA3.1-SASH1 group expressed significantly lower protein levels of cyclin D1 and MMP-2/9 compared to the control and empty vector groups (p < 0.05) and significantly higher protein levels of caspase-3 than the other two groups (p < 0.05). Cyclin D1, caspase-3, and MMP-2/9 expression was unchanged between the empty vector and blank control groups. SASH1 gene expression might be related to the inhibition of the growth, proliferation, and invasion of U251 cells and the promotion of U251 cells apoptosis.

  14. HCV core protein represses the apoptosis and improves the autophagy of human hepatocytes

    PubMed Central

    Liu, Changhong; Qu, Aihua; Han, Xiaochun; Wang, Yiguo

    2015-01-01

    Objectives: This study aims to investigate the influence on human hepatocytes apoptosis and autophagy by the hepatitis C virus (HCV) core protein. Methods: QSG-7701, a human-derived non-neoplastic liver cell line, was transfected with PIRES-core vector that was a eukaryotic vector to express HCV core protein. Fluorescence microscope was used to observe the changes of nuclei in apoptosis cells by Annex in V-FITC/PI double staining. Flow cytometry was applied to detect the rate of cell apoptosis. Western blotting was used to detect the expression of HCV core protein, transcription factor nuclear factor-kappa B (NF-κB), autophagic biomarker microtubule associated protein 1 light chain 3 (LC3), and Beclin-1. Results: The apoptosis rate was significantly lower (P < 0.05) in QSG7701/core group (transfected with PIRES-core vector, (1.34±0.07)%) than in QSG7701 group (no transfection, (2.35±0.11)%) and in QSG7701 QSG7701/pcDNA3.1 group (transfected with pcDNA3.1 vector, (2.58±0.1)%). NF-κB expression was up-expressed in QSG7701/core group than in QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). LC3-II expression and Beclin-1 expression was significant higher in QSG7701/core group than in the QSG7701/pcDNA3.1 group and QSG7701 group (P < 0.05). Conclusion: HCV core protein can repress the apoptosis and improve the autophagy of QSG7701 through up-regulating NF-κB and Beclin-1 expression. PMID:26629077

  15. [Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

    PubMed

    Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

    2012-11-04

    To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.

  16. Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sontag, Ryan L.; Weber, Thomas J.

    2012-05-04

    In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediatedmore » toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.« less

  17. The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

    PubMed

    Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2012-01-01

    DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

  18. The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

    PubMed Central

    Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

    2012-01-01

    DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

  19. Viral Vectors for in Vivo Gene Transfer

    NASA Astrophysics Data System (ADS)

    Thévenot, E.; Dufour, N.; Déglon, N.

    The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

  20. The targeting expression of the vascular endothelial growth factor gene in endothelial cells regulated by HRE.ppET-1.

    PubMed

    Zheng, Xiangrong; Zhang, Shangshang; Yang, Yujia; Wang, Xia; Zhong, Le; Yu, Xiaohe

    2008-11-01

    The success of gene therapy depends largely on the efficacy of gene delivery vector systems that can deliver genes to target organs or cells selectively and efficiently with minimal toxicity. Here, we show that by using the HRE.ppET-1 regulatory element, we were able to restrict expression of the transgene of vascular endothelial growth factor (VEGF) to endothelial cells exclusively in hypoxic conditions. Eukaryotic expression vectors such as pEGFP-HRE.ppET-1, pcDNA3.1-VEGF+Pa, pcDNA3.1-ppET-1+ EGF+Pa, and pcDNA3.1-HRE.ppET-1+VEGF+Pa were constructed by using a series of nuclear molecule handling methods like PCR, enzyme digestion. The recombinant vectors were transfected into HUVEC cells and HL7702 cells by the lipofectin method. GFP expression was observed with a fluorescence microscope to validate the specificity of expression in endothelial cells under the regulation of HRE.ppET-1 element. Cobalt chloride (final concentration 100 mumol/L) was added to the medium to mimic hypoxia in vitro. After transfection of vectors, the expression of VEGF mRNA was detected by RT-PCR, and the expression of VEGF was detected by Western blotting and ELISA methods under normoxia and hypoxia, respectively. The cell proliferation rate was detected by the MTT test. The expression of GFP revealed that the exterior gene was transcripted effectively in endothelial cells regulated by the HRE.ppET-1 element, while the expression of GFP was very weak in nonendothelial cells. The results of RT-PCR, Western blotting and ELISA showed that VEGF gene expression in the pcDNA3.1-HRE.ppET-1+VEGF+Pa group and in the pcDNA3.1-ppET-1+VEGF+Pa group was higher in hypoxia than it was in normoxia (P<0.05). The MTT test showed that the proliferation rate of HUVEC transfected with HPVA under hypoxia exceeded that of the control group. We conclude that the HRE.ppET-1 element was expressed specifically in endothelial cells, and can increase the expression of VEGF in hypoxia and stimulate proliferation of endothelial cells. Taking advantage of these facts could greatly improve the efficiency of gene therapy. The vector would be valuable for various gene transfer studies targeting endothelial cells.

  1. Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

    PubMed

    Grandchamp, Nicolas; Altémir, Dorothée; Philippe, Stéphanie; Ursulet, Suzanna; Pilet, Héloïse; Serre, Marie-Claude; Lenain, Aude; Serguera, Che; Mallet, Jacques; Sarkis, Chamsy

    2014-01-01

    Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV) is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs) solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int) which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP) which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

  2. Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

    PubMed Central

    Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

    2015-01-01

    Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

  3. Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

    PubMed

    Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

    2015-01-01

    Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

  4. AAVPG: A vigilant vector where transgene expression is induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

  5. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    PubMed

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  6. Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

    PubMed

    Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

    2018-01-26

    Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

  7. Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.

    PubMed

    Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo

    2018-03-20

    DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.

  8. Vector optimization and needle-free intradermal application of a broadly protective polyvalent influenza A DNA vaccine for pigs and humans

    PubMed Central

    Borggren, Marie; Nielsen, Jens; Bragstad, Karoline; Karlsson, Ingrid; Krog, Jesper S; Williams, James A; Fomsgaard, Anders

    2015-01-01

    The threat posed by the 2009 pandemic H1N1 virus emphasized the need for new influenza A virus vaccines inducing a broad cross-protective immune response for use in both humans and pigs. An effective and broad influenza vaccine for pigs would greatly benefit the pork industry and contribute to public health by diminishing the risk of emerging highly pathogenic reassortants. Current inactivated protein vaccines against swine influenza produce only short-lived immunity and have no efficacy against heterologous strains. DNA vaccines are a potential alternative with advantages such as the induction of cellular and humoral immunity, inherent safety and rapid production time. We have previously developed a DNA vaccine encoding selected influenza proteins of pandemic origin and demonstrated broad protective immune responses in ferrets and pigs. In this study, we evaluated our DNA vaccine expressed by next-generation vectors. These new vectors can improve gene expression, but they are also efficiently produced on large scales and comply with regulatory guidelines by avoiding antibiotic resistance genes. In addition, a new needle-free delivery of the vaccine, convenient for mass vaccinations, was compared with intradermal needle injection followed by electroporation. We report that when our DNA vaccine is expressed by the new vectors and delivered to the skin with the needle-free device in the rabbit model, it can elicit an antibody response with the same titers as a conventional vector with intradermal electroporation. The needle-free delivery is already in use for traditional protein vaccines in pigs but should be considered as a practical alternative for the mass administration of broadly protective influenza DNA vaccines. PMID:25746201

  9. [Cloning of Chinese Banna minipig inbred-line alpha1,3-galactosyltransferase gene and construction of its recombinant eukaryotic expression vector].

    PubMed

    Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu

    2009-04-01

    This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.

  10. Intranuclear DNA release is a determinant of transfection activity for a non-viral vector: biocleavable polyrotaxane as a supramolecularly dissociative condenser for efficient intranuclear DNA release.

    PubMed

    Yamada, Yuma; Nomura, Taku; Harashima, Hideyoshi; Yamashita, Atsushi; Katoono, Ryo; Yui, Nobuhiko

    2010-01-01

    It has been believed that nuclear gene delivery is the most important process for gene expression, and various non-viral vectors are currently being developed with this assumption. However, some of our earlier studies revealed a surprising difference in transfection activity between viral and non-viral vectors: this difference is largely due to the result of the intranuclear disposition of DNA rather than its delivery to the nucleus (Hama S. et al. (2006), Quantitative comparison of intracellular trafficking and nuclear transcription between adenoviral and lipoplex systems. Mol. Ther., 13, 786-794). Here, we report on some direct evidence that demonstrates the importance of the release of intranuclear DNA on transfection activity. The data show that transfection activity can be substantially enhanced by integrating a multifunctional envelope-type nano device (MEND) and a biocleavable polyrotaxane (DMAE-SS-PRX) as an artificial condenser. Our integration system showed significantly higher transfection activity compared to conventional gene delivery system. Moreover, this system provides a strong support for our hypothesis that intranuclear DNA disposition plays a critical role in gene expression for non-viral vectors.

  11. Promoter-Based Theranostics for Prostate Cancer

    DTIC Science & Technology

    2016-06-01

    diagnosis vector consists of the tumor-specific PEG-promoter (PEG-Prom) and cDNA of human chorionic gonadotropin β chain (βhCG) as a reporter. We...transfection efficiency. We also used CpG-free cDNA of Figure 5. pCpGfree-PEGwt-HSV1-tk-neo vector expressed functional thymidine kinase in human

  12. Laboratory formulated magnetic nanoparticles for enhancement of viral gene expression in suspension cell line.

    PubMed

    Bhattarai, Shanta Raj; Kim, Sun Young; Jang, Kyu Yun; Lee, Ki Chang; Yi, Ho Keun; Lee, Dae Yeol; Kim, Hak Yong; Hwang, Pyoung Han

    2008-02-01

    One factor critical to successful gene therapy is the development of efficient delivery systems. Although advances in gene transfer technology including viral and non-viral vectors have been made, an ideal vector system has not yet been constructed. Due to the growing concerns over the toxicity and immunogenicity of viral DNA delivery systems, DNA delivery via improve viral routes has become more desirable and advantageous. The ideal improve viral DNA delivery system should be a synthetic materials plus viral vectors. The materials should also be biocompatible, efficient, and modular so that it is tunable to various applications in both research and clinical settings. The successful steps towards this improve viral DNA delivery system is demonstrated: a magnetofection system mediated by modified cationic chitosan-coated iron oxide nanoparticles. Dense colloidal cationic iron oxide nanoparticles serve as an uptake-enhancing component by physical concentration at the cell surface in presence of external magnetic fields; enhanced viral gene expression (3-100-fold) due to the particles is seen as compared to virus vector alone with little virus dose.

  13. Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

    PubMed Central

    2012-01-01

    Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

  14. Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

    PubMed

    Nafissi, Nafiseh; Slavcev, Roderick

    2012-12-06

    While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

  15. Molecular cloning and expression in Saccharomyces cerevisiae and Neurospora crassa of the invertase gene from Neurospora crassa.

    PubMed

    Carú, M; Cifuentes, V; Pincheira, G; Jiménez, A

    1989-10-01

    A plasmid (named pCN2) carrying a 7.6 kb BamHI DNA insert was isolated from a Neurospora crassa genomic library raised in the yeast vector YRp7. Saccharomyces cerevisiae suco and N. crassa inv strains transformed with pNC2 were able to grow on sucrose-based media and expressed invertase activity. Saccharomyces cerevisiae suco (pNC2) expressed a product which immunoreacted with antibody raised against purified invertase from wild type N. crassa, although S. cerevisiae suc+ did not. The cloned DNA hybridized with a 7.6 kb DNA fragment from BamHI-restricted wild type N. crassa DNA. Plasmid pNC2 transformed N. crassa Inv- to Inv+ by integration either near to the endogenous inv locus (40% events) or at other genomic sites (60% events). It appears therefore that the cloned DNA piece encodes the N. crassa invertase enzyme. A 3.8 kb XhoI DNA fragment, derived from pNC2, inserted in YRp7, in both orientation, was able to express invertase activity in yeast, suggesting that it contains an intact invertase gene which is not expressed from a vector promoter.

  16. Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

    PubMed

    Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

    2011-07-01

    Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

  17. Inhibition of histone deacetylation and DNA methylation improves gene expression mediated by the adeno-associated virus/phage in cancer cells.

    PubMed

    Kia, Azadeh; Yata, Teerapong; Hajji, Nabil; Hajitou, Amin

    2013-10-22

    Bacteriophage (phage), viruses that infect bacteria only, have become promising vectors for targeted systemic delivery of genes to cancer, although, with poor efficiency. We previously designed an improved phage vector by incorporating cis genetic elements of adeno-associated virus (AAV). This novel AAV/phage hybrid (AAVP) specifically targeted systemic delivery of therapeutic genes into tumors. To advance the AAVP vector, we recently introduced the stress-inducible Grp78 tumor specific promoter and found that this dual tumor-targeted AAVP provides persistent gene expression, over time, in cancer cells compared to silenced gene expression from the CMV promoter in the parental AAVP. Herein, we investigated the effect of histone deacetylation and DNA methylation on AAVP-mediated gene expression in cancer cells and explored the effect of cell confluence state on AAVP gene expression efficacy. Using a combination of AAVP expressing the GFP reporter gene, flow cytometry, inhibitors of histone deacetylation, and DNA methylation, we have demonstrated that histone deacetylation and DNA methylation are associated with silencing of gene expression from the CMV promoter in the parental AAVP. Importantly, inhibitors of histone deacetylases boost gene expression in cancer cells from the Grp78 promoter in the dual tumor-targeted AAVP. However, cell confluence had no effect on AAVP-guided gene expression. Our findings prove that combination of histone deacetylase inhibitor drugs with the Grp78 promoter is an effective approach to improve AAVP-mediated gene expression in cancer cells and should be considered for AAVP-based clinical cancer gene therapy.

  18. A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

    PubMed Central

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

  19. A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

    PubMed

    Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

    2014-01-01

    Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

  20. [Sendai virus vector: vector development and its application to health care and biotechnology].

    PubMed

    Iida, Akihiro

    2007-06-01

    Sendai virus (SeV) is an enveloped virus with a nonsegmented negative-strand RNA genome and a member of the paramyxovirus family. We have developed SeV vector which has shown a high efficiently of gene transfer and expression of foreign genes to a wide range of dividing and non-dividing mammalian cells and tissues. One of the characteristics of the vector is that the genome is located exclusively in the cytoplasm of infected cells and does not go through a DNA phase; thus there is no concern about unwanted integration of foreign sequences into chromosomal DNA. Therefore, this new class of "cytoplasmic RNA vector", an RNA vector with cytoplasmic expression, is expected to be a safer and more efficient viral vector than existing vectors for application to human therapy in various fields including gene therapy and vaccination. In this review, I describe development of Sendai virus vector, its application in the field of biotechnology and clinical application aiming to treat for a large number of diseases including cancer, cardiovascular disease, infectious diseases and neurologic disorders.

  1. High-level rapid production of full-size monoclonal antibodies in plants by a single-vector DNA replicon system

    PubMed Central

    Huang, Zhong; Phoolcharoen, Waranyoo; Lai, Huafang; Piensook, Khanrat; Cardineau, Guy; Zeitlin, Larry; Whaley, Kevin J.; Arntzen, Charles J.

    2010-01-01

    Plant viral vectors have great potential in rapid production of important pharmaceutical proteins. However, high-yield production of heterooligomeric proteins that require the expression and assembly of two or more protein subunits often suffers problems due to the “competing” nature of viral vectors derived from the same virus. Previously we reported that a bean yellow dwarf virus (BeYDV)-derived, three-component DNA replicon system allows rapid production of single recombinant proteins in plants (Huang et al. 2009). In this article, we report further development of this expression system for its application in high-yield production of oligomeric protein complexes including monoclonal antibodies (mAbs) in plants. We showed that the BeYDV replicon system permits simultaneous efficient replication of two DNA replicons and thus, high-level accumulation of two recombinant proteins in the same plant cell. We also demonstrated that a single vector that contains multiple replicon cassettes was as efficient as the three-component system in driving the expression of two distinct proteins. Using either the non-competing, three-vector system or the multi-replicon single vector, we produced both the heavy and light chain subunits of a protective IgG mAb 6D8 against Ebola virus GP1 (Wilson et al. 2000) at 0.5 mg of mAb per gram leaf fresh weight within 4 days post infiltration of Nicotiana benthamiana leaves. We further demonstrated that full-size tetrameric IgG complex containing two heavy and two light chains was efficiently assembled and readily purified, and retained its functionality in specific binding to inactivated Ebola virus. Thus, our single-vector replicon system provides high-yield production capacity for heterooligomeric proteins, yet eliminates the difficult task of identifying non-competing virus and the need for co-infection of multiple expression modules. The multi-replicon vector represents a significant advance in transient expression technology for antibody production in plants. PMID:20047189

  2. Production of SV40-derived vectors.

    PubMed

    Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

    2010-06-01

    Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

  3. DNA encoding for plant digalactosyldiacylglycerol galactosyltransferase and methods of use

    DOEpatents

    Benning, Christoph; Doermann, Peter

    2003-11-04

    The cDNA encoding digalactosyldiacylglycerol galactosyltransferase (DGD1) is provided. The deduced amino acid sequence is also provided. Methods of making and using DGD1 to screen for new herbicides and alter a plant's leaf lipid composition are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors.

  4. Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

    PubMed

    Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

    1996-07-15

    Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

  5. [Construction and functional identification of eukaryotic expression vector carrying Sprague-Dawley rat MSX-2 gene].

    PubMed

    Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng

    2008-01-01

    To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.

  6. Assessing the potential for AAV vector genotoxicity in a murine model

    PubMed Central

    Li, Hojun; Malani, Nirav; Hamilton, Shari R.; Schlachterman, Alexander; Bussadori, Giulio; Edmonson, Shyrie E.; Shah, Rachel; Arruda, Valder R.; Mingozzi, Federico; Fraser Wright, J.; Bushman, Frederic D.

    2011-01-01

    Gene transfer using adeno-associated virus (AAV) vectors has great potential for treating human disease. Recently, questions have arisen about the safety of AAV vectors, specifically, whether integration of vector DNA in transduced cell genomes promotes tumor formation. This study addresses these questions with high-dose liver-directed AAV-mediated gene transfer in the adult mouse as a model (80 AAV-injected mice and 52 controls). After 18 months of follow-up, AAV-injected mice did not show a significantly higher rate of hepatocellular carcinoma compared with controls. Tumors in mice treated with AAV vectors did not have significantly different amounts of vector DNA compared with adjacent normal tissue. A novel high-throughput method for identifying AAV vector integration sites was developed and used to clone 1029 integrants. Integration patterns in tumor tissue and adjacent normal tissue were similar to each other, showing preferences for active genes, cytosine-phosphate-guanosine islands, and guanosine/cysteine-rich regions. Gene expression data showed that genes near integration sites did not show significant changes in expression patterns compared with genes more distal to integration sites. No integration events were identified as causing increased oncogene expression. Thus, we did not find evidence that AAV vectors cause insertional activation of oncogenes and subsequent tumor formation. PMID:21106988

  7. Ribozyme-mediated cleavage of c-fos mRNA reduces gene expression of DNA synthesis enzymes and metallothionein.

    PubMed Central

    Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M

    1991-01-01

    The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142

  8. Design and construction of functional AAV vectors.

    PubMed

    Gray, John T; Zolotukhin, Serge

    2011-01-01

    Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

  9. Polycation-induced Cell Membrane Permeability Does Not Enhance Cellular Uptake or Expression Efficiency of Delivered DNA

    PubMed Central

    Prevette, Lisa E.; Mullen, Douglas G.; Banaszak Holl, Mark M.

    2010-01-01

    Polycationic materials commonly used to delivery DNA to cells are known to induce cell membrane porosity in a charge-density dependent manner. It has been suggested that these pores may provide a mode of entry of the polymer-DNA complexes (polyplexes) into cells. To examine the correlation between membrane permeability and biological activity, we used two-color flow cytometry on two mammalian cell lines to simultaneously measure gene expression of a plasmid DNA delivered with four common nonviral vectors and cellular uptake of normally excluded fluorescent dye molecules of two different sizes, 668 Da and 2 MDa. We also followed gene expression in cells sorted based on the retention of endogenous fluorescein. We have found that cell membrane porosity caused by polycationic vectors does not enhance internalization or gene expression. Based on this single-cell study, membrane permeability is found to be an unwanted side effect that limits transfection efficiency, possibly through leakage of the delivered nucleic acid through the pores prior to transcription and translation and/or activation of cell defense mechanisms that restrict transgene expression. PMID:20349965

  10. Fowl adenovirus serotype 9 vectored vaccine for protection of avian influenza virus

    USDA-ARS?s Scientific Manuscript database

    A fowl adenovirus serotype 9, a non-pathogenic large double stranded DNA virus, was developed as a viral vector to express influenza genes as a potential vaccine. Two separate constructs were developed that expressed either the hemagglutinin gene of A/Chicken/Jalisco/2012 (H7) or A/ Chicken/Iowa/20...

  11. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dunn, J.J.; Barbour, A.G.

    1996-11-05

    A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface proteinmore » A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.« less

  12. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOEpatents

    Dunn, John J.; Barbour, Alan G.

    1996-11-05

    A method is provided herein for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed.

  13. Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7

    DOEpatents

    Dunn, J.J.; Barbour, A.G.

    1996-11-05

    A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.

  14. Retrovirus-based vectors for transient and permanent cell modification.

    PubMed

    Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

    2015-10-01

    Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Multiplexing clonality: combining RGB marking and genetic barcoding

    PubMed Central

    Cornils, Kerstin; Thielecke, Lars; Hüser, Svenja; Forgber, Michael; Thomaschewski, Michael; Kleist, Nadja; Hussein, Kais; Riecken, Kristoffer; Volz, Tassilo; Gerdes, Sebastian; Glauche, Ingmar; Dahl, Andreas; Dandri, Maura; Roeder, Ingo; Fehse, Boris

    2014-01-01

    RGB marking and DNA barcoding are two cutting-edge technologies in the field of clonal cell marking. To combine the virtues of both approaches, we equipped LeGO vectors encoding red, green or blue fluorescent proteins with complex DNA barcodes carrying color-specific signatures. For these vectors, we generated highly complex plasmid libraries that were used for the production of barcoded lentiviral vector particles. In proof-of-principle experiments, we used barcoded vectors for RGB marking of cell lines and primary murine hepatocytes. We applied single-cell polymerase chain reaction to decipher barcode signatures of individual RGB-marked cells expressing defined color hues. This enabled us to prove clonal identity of cells with one and the same RGB color. Also, we made use of barcoded vectors to investigate clonal development of leukemia induced by ectopic oncogene expression in murine hematopoietic cells. In conclusion, by combining RGB marking and DNA barcoding, we have established a novel technique for the unambiguous genetic marking of individual cells in the context of normal regeneration as well as malignant outgrowth. Moreover, the introduction of color-specific signatures in barcodes will facilitate studies on the impact of different variables (e.g. vector type, transgenes, culture conditions) in the context of competitive repopulation studies. PMID:24476916

  16. The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit

    PubMed Central

    Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.

    2013-01-01

    IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419

  17. Nanoparticle-mediated rhodopsin cDNA but not intron-containing DNA delivery causes transgene silencing in a rhodopsin knockout model.

    PubMed

    Zheng, Min; Mitra, Rajendra N; Filonov, Nazar A; Han, Zongchao

    2016-03-01

    Previously, we compared the efficacy of nanoparticle (NP)-mediated intron-containing rhodopsin (sgRho) vs. intronless cDNA in ameliorating retinal disease phenotypes in a rhodopsin knockout (RKO) mouse model of retinitis pigmentosa. We showed that NP-mediated sgRho delivery achieved long-term expression and phenotypic improvement in RKO mice, but not NP housing cDNA. However, the protein level of the NP-sgRho construct was only 5-10% of wild-type at 8 mo postinjection. To have a better understanding of the reduced levels of long-term expression of the vectors, in the present study, we evaluated the epigenetic changes of subretinal delivering NP-cDNA vs. NP-sgRho in the RKO mouse eyes. Following the administration, DNA methylation and histone status of specific regions (bacteria plasmid backbone, promoter, rhodopsin gene, and scaffold/matrix attachment region) of the vectors were evaluated at various time points. We documented that epigenetic transgene silencing occurred in vector-mediated gene transfer, which were caused by the plasmid backbone and the cDNA of the transgene, but not the intron-containing transgene. No toxicity or inflammation was found in the treated eyes. Our results suggest that cDNA of the rhodopsin transgene and bacteria backbone interfered with the host defense mechanism of DNA methylation-mediated transgene silencing through heterochromatin-associated modifications. © FASEB.

  18. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    PubMed

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  19. Prime-boost bacillus Calmette-Guérin vaccination with lentivirus-vectored and DNA-based vaccines expressing antigens Ag85B and Rv3425 improves protective efficacy against Mycobacterium tuberculosis in mice.

    PubMed

    Xu, Ying; Yang, Enzhuo; Wang, Jianguang; Li, Rui; Li, Guanghua; Liu, Guoyuan; Song, Na; Huang, Qi; Kong, Cong; Wang, Honghai

    2014-10-01

    To prevent the global spread of tuberculosis (TB), more effective vaccines and vaccination strategies are urgently needed. As a result of the success of bacillus Calmette-Guérin (BCG) in protecting children against miliary and meningeal TB, the majority of individuals will have been vaccinated with BCG; hence, boosting BCG-primed immunity will probably be a key component of future vaccine strategies. In this study, we compared the ability of DNA-, protein- and lentiviral vector-based vaccines that express the antigens Ag85B and Rv3425 to boost the effects of BCG in the context of immunity and protection against Mycobacterium tuberculosis in C57BL/6 mice. Our results demonstrated that prime-boost BCG vaccination with a lentiviral vector expressing the antigens Ag85B and Rv3425 significantly enhanced immune responses, including T helper type 1 and CD8(+) cytotoxic T lymphocyte responses, compared with DNA- and protein-based vaccines. However, lentivirus-vectored and DNA-based vaccines greatly improved the protective efficacy of BCG against M. tuberculosis, as indicated by a lack of weight loss and significantly reduced bacterial loads and histological damage in the lung. Our study suggests that the use of lentiviral or DNA vaccines containing the antigens Ag85B and Rv3425 to boost BCG is a good choice for the rational design of an efficient vaccination strategy against TB. © 2014 John Wiley & Sons Ltd.

  20. Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles

    PubMed Central

    Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J

    2012-01-01

    Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168

  1. Core labeling of adenovirus with EGFP

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Le, Long P.; Le, Helen N.; Nelson, Amy R.

    2006-08-01

    The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less

  2. Characterization of constitutive and putative differentially expressed mRNAs by means of expressed sequence tags, differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR from the sand fly vector Lutzomyia longipalpis.

    PubMed

    Ramalho-Ortigão, J M; Temporal, P; de Oliveira , S M; Barbosa, A F; Vilela, M L; Rangel, E F; Brazil, R P; Traub-Cseko, Y M

    2001-01-01

    Molecular studies of insect disease vectors are of paramount importance for understanding parasite-vector relationship. Advances in this area have led to important findings regarding changes in vectors' physiology upon blood feeding and parasite infection. Mechanisms for interfering with the vectorial capacity of insects responsible for the transmission of diseases such as malaria, Chagas disease and dengue fever are being devised with the ultimate goal of developing transgenic insects. A primary necessity for this goal is information on gene expression and control in the target insect. Our group is investigating molecular aspects of the interaction between Leishmania parasites and Lutzomyia sand flies. As an initial step in our studies we have used random sequencing of cDNA clones from two expression libraries made from head/thorax and abdomen of sugar fed L. longipalpis for the identification of expressed sequence tags (EST). We applied differential display reverse transcriptase-PCR and randomly amplified polymorphic DNA-PCR to characterize differentially expressed mRNA from sugar and blood fed insects, and, in one case, from a L. (V.) braziliensis-infected L. longipalpis. We identified 37 cDNAs that have shown homology to known sequences from GeneBank. Of these, 32 cDNAs code for constitutive proteins such as zinc finger protein, glutamine synthetase, G binding protein, ubiquitin conjugating enzyme. Three are putative differentially expressed cDNAs from blood fed and Leishmania-infected midgut, a chitinase, a V-ATPase and a MAP kinase. Finally, two sequences are homologous to Drosophila melanogaster gene products recently discovered through the Drosophila genome initiative.

  3. Part I: Minicircle vector technology limits DNA size restrictions on ex vivo gene delivery using nanoparticle vectors: Overcoming a translational barrier in neural stem cell therapy.

    PubMed

    Fernandes, Alinda R; Chari, Divya M

    2016-09-28

    Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

    PubMed Central

    Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

    2012-01-01

    Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

  5. Liposomal lipid and plasmid DNA delivery to B16/BL6 tumors after intraperitoneal administration of cationic liposome DNA aggregates.

    PubMed

    Reimer, D L; Kong, S; Monck, M; Wyles, J; Tam, P; Wasan, E K; Bally, M B

    1999-05-01

    The transfer of plasmid expression vectors to cells is essential for transfection after administration of lipid-based DNA formulations (lipoplexes). A murine i.p. B16/BL6 tumor model was used to characterize DNA delivery, liposomal lipid delivery, and gene transfer after regional (i.p.) administration of free plasmid DNA and DNA lipoplexes. DNA lipoplexes were prepared using cationic dioleoyldimethylammonium chloride/dioleoylphosphatidylethanolamine (50:50 mol ratio) liposomes mixed with plasmid DNA (1 microgram DNA/10 nmol lipid). The plasmid used contained the chloramphenicol acetyltransferase gene and chloramphenicol acetyltransferase expression (mU/g tumor) was measured to estimate transfection efficiency. Tumor-associated DNA and liposomal lipid levels were measured to estimate the efficiency of lipid-mediated DNA delivery to tumors. Plasmid DNA delivery was estimated using [3H]-labeled plasmid as a tracer, dot blot analysis, and/or Southern analysis. Liposomal lipid delivery was estimated using [14C]-dioleoylphosphatidylethanolamine as a liposomal lipid marker. Gene expression in the B16/BL6 tumors was highly variable, with values ranging from greater than 2,000 mU/g tumor to less than 100 mU/g tumor. There was a tendency to observe enhanced transfection in small (<250 mg) tumors. Approximately 18% of the injected dose of DNA was associated with these small tumors 2 h after i.p. administration. Southern analysis of extracted tumor DNA indicated that plasmid DNA associated with tumors was intact 24 h after administration. DNA and associated liposomal lipid are efficiently bound to tumors after regional administration; however, it is unclear whether delivery is sufficient to abet internalization and appropriate subcellular localization of the expression vector.

  6. Ability of herpes simplex virus vectors to boost immune responses to DNA vectors and to protect against challenge by simian immunodeficiency virus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaur, Amitinder; Sanford, Hannah B.; Garry, Deirdre

    2007-01-20

    The immunogenicity and protective capacity of replication-defective herpes simplex virus (HSV) vector-based vaccines were examined in rhesus macaques. Three macaques were inoculated with recombinant HSV vectors expressing Gag, Env, and a Tat-Rev-Nef fusion protein of simian immunodeficiency virus (SIV). Three other macaques were primed with recombinant DNA vectors expressing Gag, Env, and a Pol-Tat-Nef-Vif fusion protein prior to boosting with the HSV vectors. Robust anti-Gag and anti-Env cellular responses were detected in all six macaques. Following intravenous challenge with wild-type, cloned SIV239, peak and 12-week plasma viremia levels were significantly lower in vaccinated compared to control macaques. Plasma SIV RNAmore » in vaccinated macaques was inversely correlated with anti-Rev ELISPOT responses on the day of challenge (P value < 0.05), anti-Tat ELISPOT responses at 2 weeks post challenge (P value < 0.05) and peak neutralizing antibody titers pre-challenge (P value 0.06). These findings support continued study of recombinant herpesviruses as a vaccine approach for AIDS.« less

  7. Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

    PubMed Central

    Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

    2015-01-01

    Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

  8. [Construction and transfection of eucaryotic expression recombinant vector containing truncated region of UL83 gene of human cytomegalovirus and it's sheltered effect as DNA vaccine].

    PubMed

    Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li

    2006-06-01

    To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was tested by indirect ELISA in mother mouse, the infectious virus was separated with the method of virus separation, and pp65 antigen was checked up by indirect immunofluorescence staining in fetal mouse. Results showed differential antibody of anti-HCMV pp65 was produced in mouse model. Tilter of the antibody was from 1:2.51 to 1:50.79. Results of virus separation and pp65 checkup of fetal mouse brain tissue were negative. So the conclusion can be reached that pEGFP-C1-UL83 as DNA vaccine in vivo has sheltered effect which can prevent HCMV vertical transmission from mother mouse to her fetus.

  9. A universal expression/silencing vector in plants.

    PubMed

    Peretz, Yuval; Mozes-Koch, Rita; Akad, Fuad; Tanne, Edna; Czosnek, Henryk; Sela, Ilan

    2007-12-01

    A universal vector (IL-60 and auxiliary constructs), expressing or silencing genes in every plant tested to date, is described. Plants that have been successfully manipulated by the IL-60 system include hard-to-manipulate species such as wheat (Triticum duram), pepper (Capsicum annuum), grapevine (Vitis vinifera), citrus, and olive (Olea europaea). Expression or silencing develops within a few days in tomato (Solanum lycopersicum), wheat, and most herbaceous plants and in up to 3 weeks in woody trees. Expression, as tested in tomato, is durable and persists throughout the life span of the plant. The vector is, in fact, a disarmed form of Tomato yellow leaf curl virus, which is applied as a double-stranded DNA and replicates as such. However, the disarmed virus does not support rolling-circle replication, and therefore viral progeny single-stranded DNA is not produced. IL-60 does not integrate into the plant's genome, and the construct, including the expressed gene, is not heritable. IL-60 is not transmitted by the Tomato yellow leaf curl virus's natural insect vector. In addition, artificial satellites were constructed that require a helper virus for replication, movement, and expression. With IL-60 as the disarmed helper "virus," transactivation occurs, resulting in an inducible expressing/silencing system. The system's potential is demonstrated by IL-60-derived suppression of a viral-silencing suppressor of Grapevine virus A, resulting in Grapevine virus A-resistant/tolerant plants.

  10. Recombinant adeno-associated virus mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.

    PubMed Central

    Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B

    1997-01-01

    We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population. PMID:9032306

  11. Recombinant adeno-associated virus mediates a high level of gene transfer but less efficient integration in the K562 human hematopoietic cell line.

    PubMed

    Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B

    1997-03-01

    We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population.

  12. A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

    PubMed

    Balakrishnan, R; Bolten, B; Backman, K C

    1994-01-28

    A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

  13. UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

    PubMed

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

  14. HBx drives alpha fetoprotein expression to promote initiation of liver cancer stem cells through activating PI3K/AKT signal pathway.

    PubMed

    Zhu, Mingyue; Li, Wei; Lu, Yan; Dong, Xu; Lin, Bo; Chen, Yi; Zhang, Xueer; Guo, Junli; Li, Mengsen

    2017-03-15

    Hepatitis B virus (HBV)-X protein (HBx) plays critical role in inducing the malignant transformation of liver cells. Alpha fetoprotein (AFP) expression is closely related to hepatocarcinogenesis. We report that Oct4, Klf4, Sox2 and c-myc expression positively associated with AFP(+)/HBV(+) hepatocellular carcinoma(HCC) tissues, and the expression of the stemness markers CD44, CD133 and EpCAM was significantly higher in AFP(+)/HBV(+) HCC tissues compared to normal liver tissues or AFP (-)/HBV(-) HCC tissues. AFP expression turned on prior to expression of Oct4, Klf4, Sox2 and c-myc, and the stemness markers CD44, CD133 and EpCAM in the normal human liver L-02 cell line or CHL cell lines upon transfection with MCV-HBx vectors. Stem-like cells generated more tumour colonies compared to primary cells, and xenografts induced tumourigenesis in nude mice. Expression of reprogramming-related proteins was significantly enhanced in HLE cells while transfected with pcDNA3.1-afp vectors. The specific PI3K inhibitor Ly294002 inhibited the effects of pcDNA3.1-afp vectors. AFP-siRNA vectors were able to inhibit tumour colony formation and reprogramming-related gene expression. Altogether, HBx stimulates AFP expression to induce natural reprogramming of liver cells, and AFP plays a critical role in promoting the initiation of HCC progenitor/stem cells. AFP may be a potential novel biotarget for combating HBV-induced hepatocarcinogenesis. © 2016 UICC.

  15. Overexpression of the DNA mismatch repair factor, PMS2, confers hypermutability and DNA damage tolerance.

    PubMed

    Gibson, Shannon L; Narayanan, Latha; Hegan, Denise Campisi; Buermeyer, Andrew B; Liskay, R Michael; Glazer, Peter M

    2006-12-08

    Inherited defects in genes associated with DNA mismatch repair (MMR) have been linked to familial colorectal cancer. Cells deficient in MMR are genetically unstable and demonstrate a tolerance phenotype in response to certain classes of DNA damage. Some sporadic human cancers also show abnormalities in MMR gene function, typically due to diminished expression of one of the MutL homologs, MLH1. Here, we report that overexpression of the MutL homolog, human PMS2, can also cause a disruption of the MMR pathway in mammalian cells, resulting in hypermutability and DNA damage tolerance. A mouse fibroblast cell line carrying a recoverable lambda phage shuttle vector for mutation detection was transfected with either a vector designed to express hPMS2 or with an empty vector control. Cells overexpressing hPMS2 were found to have elevated spontaneous mutation frequencies at the cII reporter gene locus. They also showed an increase in the level of mutations induced by the alkylating agent, methynitrosourea (MNU). Clonogenic survival assays demonstrated increased survival of the PMS2-overexpressing cells following exposure to MNU, consistent with the induction of a damage tolerance phenotype. Similar results were seen in cells expressing a mutant PMS2 gene, containing a premature stop codon at position 134 and representing a variant found in an individual with familial colon cancer. These results show that dysregulation of PMS2 gene expression can disrupt MMR function in mammalian cells and establish an additional carcinogenic mechanism by which cells can develop genetic instability and acquire resistance to cytotoxic cancer therapies.

  16. A DNA replicon system for rapid high-level production of virus-like particles in plants.

    PubMed

    Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles; Mason, Hugh

    2009-07-01

    Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low-level antigen accumulation and long-time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this article, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within 5 days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without P19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. (c) 2009 Wiley Periodicals, Inc.

  17. A DNA replicon system for rapid high-level production of virus-like particles in plants

    PubMed Central

    Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles

    2009-01-01

    Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low level antigen accumulation and long time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this paper, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within five days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without p19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. PMID:19309755

  18. The Ozobranchus leech is a candidate mechanical vector for the fibropapilloma-associated turtle herpesvirus found latently infecting skin tumors on Hawaiian green turtles (Chelonia mydas)

    USGS Publications Warehouse

    Greenblatt, R.J.; Work, Thierry M.; Balazs, G.; Sutton, C.A.; Casey, R.N.; Casey, J.W.

    2004-01-01

    Fibropapillomatosis (FP) of marine turtles is a neoplastic disease of ecological concern. A fibropapilloma-associated turtle herpesvirus (FPTHV) is consistently present, usually at loads exceeding one virus copy per tumor cell. DNA from an array of parasites of green turtles (Chelonia mydas) was examined with quantitative PCR (qPCR) to determine whether any carried viral loads are sufficient to implicate them as vectors for FPTHV. Marine leeches (Ozobranchus spp.) were found to carry high viral DNA loads; some samples approached 10 million copies per leech. Isopycnic sucrose density gradient/qPCR analysis confirmed that some of these copies were associated with particles of the density of enveloped viruses. The data implicate the marine leech Ozobranchus as a mechanical vector for FPTHV. Quantitative RT-PCR analysis of FPTHV gene expression indicated that most of the FPTHV copies in a fibropapilloma have restricted DNA polymerase expression, suggestive of latent infection.

  19. Altering the selection capabilities of common cloning vectors via restriction enzyme mediated gene disruption

    PubMed Central

    2013-01-01

    Background The cloning of gene sequences forms the basis for many molecular biological studies. One important step in the cloning process is the isolation of bacterial transformants carrying vector DNA. This involves a vector-encoded selectable marker gene, which in most cases, confers resistance to an antibiotic. However, there are a number of circumstances in which a different selectable marker is required or may be preferable. Such situations can include restrictions to host strain choice, two phase cloning experiments and mutagenesis experiments, issues that result in additional unnecessary cloning steps, in which the DNA needs to be subcloned into a vector with a suitable selectable marker. Results We have used restriction enzyme mediated gene disruption to modify the selectable marker gene of a given vector by cloning a different selectable marker gene into the original marker present in that vector. Cloning a new selectable marker into a pre-existing marker was found to change the selection phenotype conferred by that vector, which we were able to demonstrate using multiple commonly used vectors and multiple resistance markers. This methodology was also successfully applied not only to cloning vectors, but also to expression vectors while keeping the expression characteristics of the vector unaltered. Conclusions Changing the selectable marker of a given vector has a number of advantages and applications. This rapid and efficient method could be used for co-expression of recombinant proteins, optimisation of two phase cloning procedures, as well as multiple genetic manipulations within the same host strain without the need to remove a pre-existing selectable marker in a previously genetically modified strain. PMID:23497512

  20. Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

    PubMed

    Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

    2016-09-01

    Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

  1. [Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

    PubMed

    Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

    2009-04-01

    This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

  2. Effects of Homology Length in the Repeat Region on Minus-Strand DNA Transfer and Retroviral Replication

    PubMed Central

    Dang, Que; Hu, Wei-Shau

    2001-01-01

    Homology between the two repeat (R) regions in the retroviral genome mediates minus-strand DNA transfer during reverse transcription. We sought to define the effects of R homology lengths on minus-strand DNA transfer. We generated five murine leukemia virus (MLV)-based vectors that contained identical sequences but different lengths of the 3′ R (3, 6, 12, 24 and 69 nucleotides [nt]); 69 nt is the full-length MLV R. After one round of replication, viral titers from the vector with a full-length downstream R were compared with viral titers generated from the other four vectors with reduced R lengths. Viral titers generated from vectors with R lengths reduced to one-third (24 nt) or one-sixth (12 nt) that of the wild type were not significantly affected; however, viral titers generated from vectors with only 3- or 6-nt homology in the R region were significantly lower. Because expression and packaging of the RNA were similar among all the vectors, the differences in the viral titers most likely reflected the impact of the homology lengths on the efficiency of minus-strand DNA transfer. The molecular nature of minus-strand DNA transfer was characterized in 63 proviruses. Precise R-to-R transfer was observed in most proviruses generated from vectors with 12-, 24-, or 69-nt homology in R, whereas aberrant transfers were predominantly used to generate proviruses from vectors with 3- or 6-nt homology. Reverse transcription using RNA transcribed from an upstream promoter, termed read-in RNA transcripts, resulted in most of the aberrant transfers. These data demonstrate that minus-strand DNA transfer is homology driven and a minimum homology length is required for accurate and efficient minus-strand DNA transfer. PMID:11134294

  3. Human XPA and XRCC1 DNA repair proteins expressed in yeast, Saccharomyces cerevisiae.

    PubMed

    Pushnova, E A; Ostanin, K; Thelen, M P

    2001-11-01

    Human XPA and XRCC1 DNA repair proteins have been expressed in a series of novel yeast episomal vectors. Expression of XPA cDNA resulted in synthesis of anti-XPA crossreacting polypeptides of 40 and 42 kDa, the status of the native protein found in human cells. Likewise, the majority of the recombinant XRCC1 found in the yeast intracellular fraction corresponded to the molecular mass of the full-length human protein. Recombinant XPA protein expressed as an NH(2)-terminal polyhistidine fusion could be affinity purified using Ni(2+) agarose. Copyright 2001 Academic Press.

  4. Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

    PubMed

    Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

    2016-04-20

    DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

  5. High-capacity 'gutless' adenoviral vectors.

    PubMed

    Kochanek, S; Schiedner, G; Volpers, C

    2001-10-01

    Adenoviral vectors are promising gene transfer vehicles for different gene therapy applications. High-capacity adenoviral (HC-Ad) vectors address some of the problems that have been observed with replication-defective, E1-deleted first-generation adenoviral vectors: toxicity and immunogenicity due to viral gene expression and 7 to 8 kb capacity limit for the transport of therapeutic DNA. This review summarizes HC-Ad vector-related publications from the past 18 months that are mainly concerned with vector design/production and in vivo applications in different murine models.

  6. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored meleagrid herpesvirus type 1 vaccines.

    PubMed

    Spatz, Stephen J; Volkening, Jeremy D; Mullis, Robert; Li, Fenglan; Mercado, John; Zsak, Laszlo

    2013-10-01

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspected in causing Runting Stunting Syndrome (RSS) in chickens. Initial attempts to express the wild-type gene encoding the capsid protein VP2 of ChPV by insertion into the thymidine kinase gene of MeHV-1 were unsuccessful. However, transient expression of a codon-optimized synthetic VP2 gene cloned into the bicistronic vector pIRES2-Ds-Red2, could be demonstrated by immunocytochemical staining of transfected chicken embryo fibroblasts (CEFs). Red fluorescence could also be detected in these transfected cells since the red fluorescent protein gene is downstream from the internal ribosome entry site (IRES). Strikingly, fluorescence could not be demonstrated in cells transiently transfected with the bicistronic vector containing the wild-type or non-codon-optimized VP2 gene. Immunocytochemical staining of these cells also failed to demonstrate expression of wild-type VP2, indicating that the lack of expression was at the RNA level and the VP2 protein was not toxic to CEFs. Chickens vaccinated with a DNA vaccine consisting of the bicistronic vector containing the codon-optimized VP2 elicited a humoral immune response as measured by a VP2-specific ELISA. This VP2 codon-optimized bicistronic cassette was rescued into the MeHV-1 genome generating a vectored vaccine against ChPV disease.

  7. Expression of chicken parvovirus VP2 in chicken embryo fibroblasts requires codon optimization for production of naked DNA and vectored Meleagrid herpesvirus type 1 vaccines

    USDA-ARS?s Scientific Manuscript database

    Meleagrid herpesvirus type 1 (MeHV-1) is an ideal vector for the expression of antigens from pathogenic avian organisms in order to generate vaccines. Chicken parvovirus (ChPV) is a widespread infectious virus that causes serious disease in chickens. It is one of the etiological agents largely suspe...

  8. Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

    PubMed Central

    Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

    1990-01-01

    Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

  9. Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

    PubMed

    Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

    1990-01-01

    Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

  10. Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

    PubMed

    Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

    2018-04-01

    Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

  11. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

    2015-09-01

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

  12. Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

    PubMed Central

    Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

    1998-01-01

    A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and acquired human diseases affecting cells of erythroid lineage. PMID:9573295

  13. Preparation of Proper Immunogen by Cloning and Stable Expression of cDNA coding for Human Hematopoietic Stem Cell Marker CD34 in NIH-3T3 Mouse Fibroblast Cell Line

    PubMed Central

    Shafaghat, Farzaneh; Abbasi-Kenarsari, Hajar; Majidi, Jafar; Movassaghpour, Ali Akbar; Shanehbandi, Dariush; Kazemi, Tohid

    2015-01-01

    Purpose: Transmembrane CD34 glycoprotein is the most important marker for identification, isolation and enumeration of hematopoietic stem cells (HSCs). We aimed in this study to clone the cDNA coding for human CD34 from KG1a cell line and stably express in mouse fibroblast cell line NIH-3T3. Such artificial cell line could be useful as proper immunogen for production of mouse monoclonal antibodies. Methods: CD34 cDNA was cloned from KG1a cell line after total RNA extraction and cDNA synthesis. Pfu DNA polymerase-amplified specific band was ligated to pGEMT-easy TA-cloning vector and sub-cloned in pCMV6-Neo expression vector. After transfection of NIH-3T3 cells using 3 μg of recombinant construct and 6 μl of JetPEI transfection reagent, stable expression was obtained by selection of cells by G418 antibiotic and confirmed by surface flow cytometry. Results: 1158 bp specific band was aligned completely to reference sequence in NCBI database corresponding to long isoform of human CD34. Transient and stable expression of human CD34 on transfected NIH-3T3 mouse fibroblast cells was achieved (25% and 95%, respectively) as shown by flow cytometry. Conclusion: Cloning and stable expression of human CD34 cDNA was successfully performed and validated by standard flow cytometric analysis. Due to murine origin of NIH-3T3 cell line, CD34-expressing NIH-3T3 cells could be useful as immunogen in production of diagnostic monoclonal antibodies against human CD34. This approach could bypass the need for purification of recombinant proteins produced in eukaryotic expression systems. PMID:25789221

  14. Multicomponent DNA carrier with a vesicular stomatitis virus G-peptide greatly enhances liver-targeted gene expression in mice.

    PubMed

    Schuster, M J; Wu, G Y; Walton, C M; Wu, C H

    1999-01-01

    Genes can be targeted to hepatocytes in vitro and in vivo by the use of asialoorosomucoid-polylysine conjugates. After systemic application, this nonviral vector is recognized by highly selective asialoglycoprotein (AsGP) receptors on the sinusoidal liver cell membrane and is taken up via receptor-mediated endocytosis. As most of the DNA is rapidly transferred to lysosomes where it is degraded, transfection efficiency is low and gene expression transient. To address this problem, we incorporated a pH-dependent synthetic hemolytic peptide derived of the G-protein of Vesicular Stomatitis Virus (VSV) into the gene transfer system, to increase endosomal escape of internalized DNA. The multicomponent carrier binds DNA in a nondamaging way, is still recognized by the AsGP receptor, and is targeted to the liver in vivo. Injection of DNA complexes containing a luciferase marker gene resulted in luciferase expression of 29 000 pg/g liver which corresponded to an increase of a factor of 10(3) overexpression after injection of DNA complexes without endosomolytic peptide. Furthermore, the amount of intact transgene within isolated liver cell nuclei was increased by a factor of 10(1)-10(2) by the use of the multicomponent carriers. These results demonstrate that incorporation of a hemolytic peptide into a nonviral vector can greatly increase gene expression while retaining cell type targetability in vivo.

  15. A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

    PubMed Central

    Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

    2017-01-01

    We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

  16. Formation of AAV Single Stranded DNA Genome from a Circular Plasmid in Saccharomyces cerevisiae

    PubMed Central

    Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

    2011-01-01

    Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3+ clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway. PMID:21853137

  17. Formation of AAV single stranded DNA genome from a circular plasmid in Saccharomyces cerevisiae.

    PubMed

    Cervelli, Tiziana; Backovic, Ana; Galli, Alvaro

    2011-01-01

    Adeno-associated virus (AAV)-based vectors are promising tools for targeted transfer in gene therapy studies. Many efforts have been accomplished to improve production and purification methods. We thought to develop a simple eukaryotic system allowing AAV replication which could provide an excellent opportunity for studying AAV biology and, more importantly, for AAV vector production. It has been shown that yeast Saccharomyces cerevisiae is able to replicate and form the capsid of many viruses. We investigated the ability of the yeast Saccharomyces cerevisiae to carry out the replication of a recombinant AAV (rAAV). When a plasmid containing a rAAV genome in which the cap gene was replaced with the S. cerevisiae URA3 gene, was co-transformed in yeast with a plasmid expressing Rep68, a significant number of URA3(+) clones were scored (more than 30-fold over controls). Molecular analysis of low molecular weight DNA by Southern blotting revealed that single stranded DNA is formed and that the plasmid is entirely replicated. The ssDNA contains the ITRs, URA3 gene and also vector sequences suggesting the presence of two distinct molecules. Its formation was dependent on Rep68 expression and ITR. These data indicate that DNA is not obtained by the canonical AAV replication pathway.

  18. Characterization of various promoter regions of the human DNA helicase-encoding genes and identification of duplicated ets (GGAA) motifs as an essential transcription regulatory element.

    PubMed

    Uchiumi, Fumiaki; Watanabe, Takeshi; Tanuma, Sei-ichi

    2010-05-15

    DNA helicases are important in the regulation of DNA transaction and thereby various cellular functions. In this study, we developed a cost-effective multiple DNA transfection assay with DEAE-dextran reagent and analyzed the promoter activities of the human DNA helicases. The 5'-flanking regions of the human DNA helicase-encoding genes were isolated and subcloned into luciferase (Luc) expression plasmids. They were coated onto 96-well plate and used for co-transfection with a renilla-Luc expression vector into various cells, and dual-Luc assays were performed. The profiles of promoter activities were dependent on cell lines used. Among these human DNA helicase genes, XPB, RecQL5, and RTEL promoters were activated during TPA-induced HL-60 cell differentiation. Interestingly, duplicated ets (GGAA) elements are commonly located around the transcription start sites of these genes. The duplicated GGAA motifs are also found in the promoters of DNA replication/repair synthesis factor genes including PARG, ATR, TERC, and Rb1. Mutation analyses suggested that the duplicated GGAA-motifs are necessary for the basal promoter activity in various cells and some of them positively respond to TPA in HL-60 cells. TPA-induced response of 44-bp in the RTEL promoter was attenuated by co-transfection of the PU.1 expression vector. These findings suggest that the duplicated ets motifs regulate DNA-repair associated gene expressions during macrophage-like differentiation of HL-60 cells. Copyright 2010 Elsevier Inc. All rights reserved.

  19. Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

    PubMed Central

    Podsakoff, G; Wong, K K; Chatterjee, S

    1994-01-01

    Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells. Images PMID:8057446

  20. Efficient gene transfer into nondividing cells by adeno-associated virus-based vectors.

    PubMed

    Podsakoff, G; Wong, K K; Chatterjee, S

    1994-09-01

    Gene transfer vectors based on adeno-associated virus (AAV) are emerging as highly promising for use in human gene therapy by virtue of their characteristics of wide host range, high transduction efficiencies, and lack of cytopathogenicity. To better define the biology of AAV-mediated gene transfer, we tested the ability of an AAV vector to efficiently introduce transgenes into nonproliferating cell populations. Cells were induced into a nonproliferative state by treatment with the DNA synthesis inhibitors fluorodeoxyuridine and aphidicolin or by contact inhibition induced by confluence and serum starvation. Cells in logarithmic growth or DNA synthesis arrest were transduced with vCWR:beta gal, an AAV-based vector encoding beta-galactosidase under Rous sarcoma virus long terminal repeat promoter control. Under each condition tested, vCWR:beta Gal expression in nondividing cells was at least equivalent to that in actively proliferating cells, suggesting that mechanisms for virus attachment, nuclear transport, virion uncoating, and perhaps some limited second-strand synthesis of AAV vectors were present in nondividing cells. Southern hybridization analysis of vector sequences from cells transduced while in DNA synthetic arrest and expanded after release of the block confirmed ultimate integration of the vector genome into cellular chromosomal DNA. These findings may provide the basis for the use of AAV-based vectors for gene transfer into quiescent cell populations such as totipotent hematopoietic stem cells.

  1. Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

    PubMed

    Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

    2001-06-01

    A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

  2. Intratumoral injection of INGN 241, a nonreplicating adenovector expressing the melanoma-differentiation associated gene-7 (mda-7/IL24): biologic outcome in advanced cancer patients.

    PubMed

    Tong, Alex W; Nemunaitis, John; Su, Dan; Zhang, Yuan; Cunningham, Casey; Senzer, Neil; Netto, George; Rich, Dawn; Mhashilkar, Abner; Parker, Karen; Coffee, Keith; Ramesh, Rajagopal; Ekmekcioglu, Suhendan; Grimm, Elizabeth A; van Wart Hood, Jill; Merritt, James; Chada, Sunil

    2005-01-01

    The mda-7 gene (approved gene symbol IL24) is a novel tumor suppressor gene with tumor-apoptotic and immune-activating properties. We completed a Phase I dose-escalation clinical trial, in which a nonreplicating adenoviral construct expressing the mda-7 transgene (INGN 241; Ad-mda7) was administered intratumorally to 22 patients with advanced cancer. Excised tumors were evaluated for vector-specific DNA and RNA, transgenic MDA-7 expression, and biological effects. Successful gene transfer as assessed by DNA- and RT-PCR was demonstrated in 100% of patients evaluated. DNA analyses demonstrated a dose-dependent penetration of INGN 241 (up to 4 x 10(8) copies/mug DNA at the 2 x 10(12) vp dose). A parallel distribution of vector DNA, vector RNA, MDA-7 protein expression, and apoptosis induction was observed in all tumors, with signals decreasing with distance away from the injection site. Additional evidence for bioactivity of INGN 241 was illustrated via regulation of the MDA-7 target genes beta-catenin, iNOS, and CD31. Transient increases (up to 20-fold) of serum IL-6, IL-10, and TNF-alpha were observed. Significantly higher elevations of IL-6 and TNF-alpha were observed in patients who responded clinically to INGN 241. Patients also showed marked increases of CD3+CD8+ T cells posttreatment, suggesting that INGN 241 increased systemic TH1 cytokine production and mobilized CD8+ T cells. Intratumoral delivery of INGN 241 induced apoptosis in a large volume of tumor and elicited tumor-regulatory and immune-activating events that are consistent with the preclinical features of MDA-7/IL-24.

  3. A novel regulatory element (E77) isolated from CHO-K1 genomic DNA enhances stable gene expression in Chinese hamster ovary cells.

    PubMed

    Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo

    2016-05-01

    Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants.

    PubMed

    Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

    2018-01-01

    Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science.

  5. Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

    PubMed Central

    Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

    2018-01-01

    Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science. PMID:29300787

  6. LAMP-1-chimeric DNA vaccines enhance the antibody response in Japanese flounder, Paralichthys olivaceus.

    PubMed

    Rondón-Barragán, Iang; Nozaki, Reiko; Hirono, Ikuo; Kondo, Hidehiro

    2017-08-01

    DNA vaccination is one method to protect farmed fish from viral and bacterial diseases. Chimeric antigens encoded by DNA vaccines have been shown to increase the resistance to viral diseases. Here, we sequenced the gene encoding lysosome-associated membrane protein-1 from Japanese flounder, Paralichthys olivaceus, (JfLAMP-1) and assessed its use in a chimeric DNA vaccine fused with the major capsule protein (MCP) from red seabream iridovirus (RSIV). JfLAMP-1 cDNA has a length of 1248 bp encoding 415 aa, which contains transmembrane and cytoplasmic domains. JfLAMP-1 is constitutively expressed in several tissues and its expression in spleen was upregulated following injection of formalin-killed cells (FKC) of Edwardsiella tarda. Immunofluorescence analysis showed that JfLAMP-1 is distributed in the small and large granules in the cytoplasm and groups close to the nucleus. The DNA encoding the luminal domain of JfLAMP-1 was replaced with the gene for the RSIV MCP, and the construct was cloned in an expression vector (pCIneo). Fish vaccinated with pCLAMP-MCP had significantly higher antibody levels than fish vaccinated with pCIneo vector harboring the MCP gene (p < 0.05) at day 30 post-vaccination. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Electrotransfer of Plasmid Vector DNA into Muscle

    NASA Astrophysics Data System (ADS)

    Miyazaki, Satsuki; Miyazaki, Jun-Ichi

    Wolff et al. (1990) first reported that plasmid DNA injected into skeletal muscle is taken up by muscle cells and the genes in the plasmid are expressed for more than two months thereafter, although the transfected DNA does not usually undergo chromosomal integration (Wolff et al., 1991, 1992). However, the relatively low expression levels attained by this method have hampered its applications for uses other than as a DNA vaccine (Davis et al., 1995). There are a number of reports analyzing the conditions that affect the efficiency of gene transfer by intramuscular DNA injection and assessing the fine structures of expression plasmid vectors that may affect expression levels (Davis et al., 1993; Liang et al., 1996; Norman et al., 1997). Furthermore, various attempts were done to improve the efficiency of gene transfer by intramus cular DNA injection. Consequently, regenerating muscle was shown to produce 80-fold or more protein than did normal muscle, following injection of an expression plas-mid. Muscle regeneration was induced by treatment with cardiotoxin or bupivacaine (Wells, 1993; Vitadello et al., 1994). We previously demonstrated that by combining a strong promoter and bupivacaine pretreatment intramuscular injection of an IL-5 expression plasmid results in IL-5 production in muscle at a level sufficient to induce marked proliferation of eosinophils in the bone marrow and eosinophil infiltration of various organs (Tokui et al., 1997). It was also reported that a single intramuscular injection of an erythropoietin expression plasmid produced physiologically significant elevations in serum erythropoietin levels and increased hematocrits in adult mice (Tripathy et al., 1996). Hematocrits in these animals remained elevated at >60% for at least 90 days after a single injection. However, improvements to this method have not been sufficient to extend its applications including clinical use.

  8. A Modular Lentiviral and Retroviral Construction System to Rapidly Generate Vectors for Gene Expression and Gene Knockdown In Vitro and In Vivo

    PubMed Central

    Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David

    2013-01-01

    The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852

  9. Design, modelling and preliminary characterisation of microneedle-based electrodes for tissue electroporation in vivo

    NASA Astrophysics Data System (ADS)

    O'Mahony, Conor; Houlihan, Ruth; Grygoryev, Konstantin; Ning, Zhenfei; Williams, John; Moore, Tom

    2016-10-01

    We analysed the use of microneedle-based electrodes to enhance electroporation of mouse testis with DNA vectors for production of transgenic mice. Different microneedle formats were developed and tested, and we ultimately used electrodes based on arrays of 500 μm tall microneedles. In a series of experiments involving injection of a DNA vector expressing Green Fluorescent Protein (GFP) and electroporation using microneedle electrodes and a commercially available voltage supply, we compared the performance of flat and microneedle electrodes by measuring GFP expression at various timepoints after electroporation. Our main finding, supported by both experimental and simulated data, is that needles significantly enhanced electroporation of testis.

  10. Factoring nonviral gene therapy into a cure for hemophilia A.

    PubMed

    Gabrovsky, Vanessa; Calos, Michele P

    2008-10-01

    Gene therapy for hemophilia A has fallen short of success despite several clinical trials conducted over the past decade. Challenges to its success include vector immunogenicity, insufficient transgene expression levels of Factor VIII, and inhibitor antibody formation. Gene therapy has been dominated by the use of viral vectors, as well as the immunogenic and oncogenic concerns that accompany these strategies. Because of the complexity of viral vectors, the development of nonviral DNA delivery methods may provide an efficient and safe alternative for the treatment of hemophilia A. New types of nonviral strategies, such as DNA integrating vectors, and the success of several nonviral animal studies, suggest that nonviral gene therapy has curative potential and justifies its clinical development.

  11. Construction and production of oncotropic vectors, derived from MVM(p), that share reduced sequence homology with helper plasmids.

    PubMed

    Clément, Nathalie; Velu, Thierry; Brandenburger, Annick

    2002-09-01

    The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.

  12. UMG Lenti: Novel Lentiviral Vectors for Efficient Transgene- and Reporter Gene Expression in Human Early Hematopoietic Progenitors

    PubMed Central

    Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni

    2014-01-01

    Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183

  13. [Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

    PubMed

    Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

    2013-08-01

    To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

  14. Evaluation of signal transduction pathways after transient cutaneous adenoviral gene delivery

    PubMed Central

    2011-01-01

    Background Adenoviral vectors have provided effective methods for in vivo gene delivery in therapeutic applications. However, these vectors can induce immune responses that may severely affect the ability of vector re-application. There is limited information about the mechanisms and signal transduction pathways involved in adenoviral recognition. For optimization of cutaneous gene therapy it is necessary to investigate molecular mechanisms of virus recognition in epidermal cells. The aim of this study was to investigate the signal transduction of the innate immunity after adenoviral DNA internalization in keratinocytes. Methods In vitro, keratinocytes were transfected with DNA, in the presence and absence of inhibitors for signalling molecules. In vivo, immunocompetent and athymic mice (n = 3 per group) were twice transduced with an Ad-vector. Results The results show an acute induction of type-I-interferon after in vitro transfection. Inhibition of PI3K, p38 MAPK, JNK and NFkappaB resulted in a decreased expression of type-I-interferon. In contrast to immunocompetent mice, athymic mice demonstrated a constant transgene expression and reduced inflammatory response in vivo. Conclusion The results suggest an induction of the innate immunity triggered by cytoplasm localised DNA which is mediated by PI3K-, p38 MAPK-, JNK-, NFkappaB-, JAK/STAT- and ERK1/2-dependent pathways. A stable transgene expression and a reduced inflammatory response in immunodeficient mice have been observed. These results provide potential for an effective adenoviral gene delivery into immunosupressed skin. PMID:21255430

  15. [Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].

    PubMed

    Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min

    2015-05-01

    To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.

  16. Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

    PubMed Central

    Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

    2018-01-01

    Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

  17. [Study on transformation of P-dissolving Penicillium oxalicum P8 with double-marker vector expressing green fluorescent protein and hygromycin B resistance].

    PubMed

    Zhang, Lei; Fan, Bing-Quan; Huang, Wei-Yi

    2005-12-01

    P-dissolving Penicillium oxalicum P8 was isolated previously in this lab which has a considerable ability to dissolve many kinds of inorganic phosphorus and improve crop growth. In order to study rhizosphere colonization of plants by Penicillium oxalicum P8, protoplasts were transformed with a double-marker expression vector of green fluorescent protein and hygromycin B resistance. Some transformants were selected which expressed both the GFP and hygromycin B phosphotransferase and did not show significant morphological or physiological differences as compared to wild-type strain. Southern blot analysis confirmed the heterogeneous genomic integration of the vector DNA into the transformants.

  18. Plasimids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, Sanford A.; Martinez, Susana; Lopez, Paloma; Espinosa, Manuel

    1991-01-01

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme.

  19. Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

    PubMed

    Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

    2014-01-01

    While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

  20. Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

    PubMed Central

    Wettig, Shawn; Slavcev, Roderick A.

    2014-01-01

    While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

  1. Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

    A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

  2. Efficient repair of DNA double-strand breaks in malignant cells with structural instability

    PubMed Central

    Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V.; Nakahara, Kenneth; Aplan, Peter D.

    2009-01-01

    Aberrant repair of DNA double strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1α) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1α promoter from the TK gene, or deletion of either the EF1α promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR. PMID:19909760

  3. Efficient repair of DNA double-strand breaks in malignant cells with structural instability.

    PubMed

    Cheng, Yue; Zhang, Zhenhua; Keenan, Bridget; Roschke, Anna V; Nakahara, Kenneth; Aplan, Peter D

    2010-01-05

    Aberrant repair of DNA double-strand breaks (DSBs) is thought to be important in the generation of gross chromosomal rearrangements (GCRs). To examine how DNA DSBs might lead to GCRs, we investigated the repair of a single DNA DSB in a structurally unstable cell line. An I-SceI recognition site was introduced into OVCAR-8 cells between a constitutive promoter (EF1alpha) and the Herpes simplex virus thymidine kinase (TK) gene, which confers sensitivity to gancyclovir (GCV). Expression of I-SceI in these cells caused a single DSB. Clones with aberrant repair could acquire resistance to GCV by separation of the EF1alpha promoter from the TK gene, or deletion of either the EF1alpha promoter or the TK gene. All mutations that we identified were interstitial deletions. Treatment of cells with etoposide or bleomycin, agents known to produce DNA DSBs following expression of I-SceI also did not generate GCRs. Because we identified solely interstitial deletions using the aforementioned negative selection system, we developed a positive selection system to produce GCR. A construct containing an I-SceI restriction site immediately followed by a hygromycin phosphotransferase cDNA, with no promoter, was stably integrated into OVCAR-8 cells. DNA DSBs were produced by an I-SceI expression vector. None of the hygromycin resistant clones recovered had linked the hygromycin phosphotransferase cDNA to an endogenous promoter, but had instead captured a portion of the I-SceI expression vector. These results indicate that even in a structurally unstable malignant cell line, the majority of DNA DSBs are repaired by religation of the two broken chromosome ends, without the introduction of a GCR.

  4. Tumor transfection after systemic injection of DNA lipid nanocapsules.

    PubMed

    Morille, Marie; Passirani, Catherine; Dufort, Sandrine; Bastiat, Guillaume; Pitard, Bruno; Coll, Jean-Luc; Benoit, Jean-Pierre

    2011-03-01

    With the goal of generating an efficient vector for systemic gene delivery, a new kind of nanocarrier consisting of lipid nanocapsules encapsulating DOTAP/DOPE lipoplexes (DNA LNCs) was pegylated by the post-insertion of amphiphilic and flexible polymers. The aim of this surface modification was to create a long-circulating vector, able to circulate in the blood stream and efficient in transfecting tumoral cells after passive targeting by enhanced permeability and retention effect (EPR effect). PEG conformation, electrostatic features, and hydrophylicity are known to be important factors able to influence the pharmacokinetic behaviour of vectors. In this context, the surface structure characteristics of the newly pegylated DNA LNCs were studied by measuring electrophoretic mobility as a function of ionic strength in order to establish a correlation between surface properties and in vivo performance of the vector. Finally, thanks to this PEGylation, gene expression was measured up to 84-fold higher in tumor compared to other tested organs after intravenous injection. The present results indicate that PEGylated DNA LNCs are promising carriers for an efficient cancer gene therapy. Copyright © 2010 Elsevier Ltd. All rights reserved.

  5. [Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

    PubMed

    Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

    2015-07-01

    To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

  6. Fibrinolysis in Tumor Associated Angiogenesis

    DTIC Science & Technology

    2005-07-01

    tPA expression in mammary vessel assays and in animals with use of retroviral vectors to deliver antisense RNA . We still intend to use that strategy...pads of nude mice. RNA obtained from tumor- and mam- mary fat pad-associated endothelial cells was used to synthesize cDNA and cDNA libraries, which... RNA (mRNA) for tPA and MT1-MMP, with some upregulation of uPA expression. BODY 1. Confirm differential expression of tPA and MT1-MIP with GAPDH control

  7. TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

    PubMed

    Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

    2017-01-01

    During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

  8. TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

    PubMed Central

    Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

    2017-01-01

    During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

  9. Bacterial inosine 5'-monophosphate dehydrogenase ("IMPDH") DNA as a dominant selectable marker in mammals and other eukaryotes

    DOEpatents

    Huberman, Eliezer [Chicago, IL; Baccam, Mekhine J [Woodridge, IL

    2007-02-27

    The present invention relates to a nucleic acid sequence and its corresponding protein sequence useful as a dominant selectable marker in eukaryotes. More specifically the invention relates to a nucleic acid encoding a bacterial IMPDH gene that has been engineered into a eukaryotic expression vectors, thereby permitting bacterial IMPDH expression in mammalian cells. Bacterial IMPDH expression confers resistance to MPA which can be used as dominant selectable marker in eukaryotes including mammals. The invention also relates to expression vectors and cells that express the bacterial IMPDH gene as well as gene therapies and protein synthesis.

  10. Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

    PubMed Central

    Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

    2012-01-01

    The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

  11. Efficient production of recombinant adeno-associated viral vector, serotype DJ/8, carrying the GFP gene.

    PubMed

    Hashimoto, Haruo; Mizushima, Tomoko; Chijiwa, Tsuyoshi; Nakamura, Masato; Suemizu, Hiroshi

    2017-06-15

    The purpose of this study was to establish an efficient method for the preparation of an adeno-associated viral (AAV), serotype DJ/8, carrying the GFP gene (AAV-DJ/8-GFP). We compared the yields of AAV-DJ/8 vector, which were produced by three different combination methods, consisting of two plasmid DNA transfection methods (lipofectamine and calcium phosphate co-precipitation; CaPi) and two virus DNA purification methods (iodixanol and cesium chloride; CsCl). The results showed that the highest yield of AAV-DJ/8-GFP vector was accomplished with the combination method of lipofectamine transfection and iodixanol purification. The viral protein expression levels and the transduction efficacy in HEK293 and CHO cells were not different among four different combination methods for AAV-DJ/8-GFP vectors. We confirmed that the AAV-DJ/8-GFP vector could transduce to human and murine hepatocyte-derived cell lines. These results show that AAV-DJ/8-GFP, purified by the combination of lipofectamine and iodixanol, produces an efficient yield without altering the characteristics of protein expression and AAV gene transduction. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

    1991-03-26

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of Streptococcus pneumoniae. Plasmid pSM22, the vector containing the pneumocccal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 figure.

  13. Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

    2012-01-06

    Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

  14. Cereal transformation through particle bombardment

    NASA Technical Reports Server (NTRS)

    Casas, A. M.; Kononowicz, A. K.; Bressan, R. A.; Hasegawa, P. M.; Mitchell, C. A. (Principal Investigator)

    1995-01-01

    The review focuses on experiments that lead to stable transformation in cereals using microprojectile bombardment. The discussion of biological factors that affect transformation examines target tissues and vector systems for gene transfer. The vector systems include reporter genes, selectable markers, genes of agronomic interest, and vector constructions. Other topics include physical parameters that affect DNA delivery, selection of stably transformed cells and plant regeneration, and analysis of gene expression and transmission to the progeny.

  15. Vaccination with lentiviral vector expressing the nfa1 gene confers a protective immune response to mice infected with Naegleria fowleri.

    PubMed

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon

    2013-07-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.

  16. Vaccination with Lentiviral Vector Expressing the nfa1 Gene Confers a Protective Immune Response to Mice Infected with Naegleria fowleri

    PubMed Central

    Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun

    2013-01-01

    Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321

  17. Expression from cloned DNA of biologically active glycoprotein C of herpes simplex virus type 1 in mammalian cells.

    PubMed

    Ghosh-Choudhury, N; Butcher, M; Ghosh, H P

    1990-03-01

    A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.

  18. Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

    PubMed

    Reece-Hoyes, John S; Walhout, Albertha J M

    2018-01-02

    This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

  19. Bioinspired Star-Shaped Poly(l-lysine) Polypeptides: Efficient Polymeric Nanocarriers for the Delivery of DNA to Mesenchymal Stem Cells.

    PubMed

    Walsh, David P; Murphy, Robert D; Panarella, Angela; Raftery, Rosanne M; Cavanagh, Brenton; Simpson, Jeremy C; O'Brien, Fergal J; Heise, Andreas; Cryan, Sally-Ann

    2018-05-07

    The field of tissue engineering is increasingly recognizing that gene therapy can be employed for modulating in vivo cellular response thereby guiding tissue regeneration. However, the field lacks a versatile and biocompatible gene delivery platform capable of efficiently delivering transgenes to mesenchymal stem cells (MSCs), a cell type often refractory to transfection. Herein, we describe the extensive and systematic exploration of three architectural variations of star-shaped poly(l-lysine) polypeptide (star-PLL) with varying number and length of poly(l-lysine) arms as potential nonviral gene delivery vectors for MSCs. We demonstrate that star-PLL vectors are capable of self-assembling with pDNA to form stable, cationic nanomedicines. Utilizing high content screening, live cell imaging, and mechanistic uptake studies we confirm the intracellular delivery of pDNA by star-PLLs to MSCs is a rapid process, which likely proceeds via a clathrin-independent mechanism. We identify a star-PLL composition with 64 poly(l-lysine) arms and five l-lysine subunits per arm as a particularly efficient vector that is capable of delivering both reporter genes and the therapeutic transgenes bone morphogenetic protein-2 and vascular endothelial growth factor to MSCs. This composition facilitated a 1000-fold increase in transgene expression in MSCs compared to its linear analogue, linear poly(l-lysine). Furthermore, it demonstrated comparable transgene expression to the widely used vector polyethylenimine using a lower pDNA dose with significantly less cytotoxicity. Overall, this study illustrates the ability of the star-PLL vectors to facilitate efficient, nontoxic nucleic acid delivery to MSCs thereby functioning as an innovative nanomedicine platform for tissue engineering applications.

  20. A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

    PubMed

    Tesar, Devin; Hötzel, Isidro

    2013-10-01

    A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

  1. A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

    2006-10-06

    We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

  2. Plasmids containing the gene for DNA polymerase I from Streptococcus pneumoniae

    DOEpatents

    Lacks, S.A.; Martinez, S.; Lopez, P.; Espinosa, M.

    1987-08-28

    A method is disclosed for cloning the gene which encodes a DNA polymerase-exonuclease of /und Streptococcus/ /und pneumoniae/. Plasmid pSM22, the vector containing the pneumococcal polA gene, facilitates the expression of 50-fold greater amounts of the PolI enzyme. 1 fig., 1 tab.

  3. Use of a bacterial expression vector to map the varicella-zoster virus major glycoprotein gene, gC.

    PubMed Central

    Ellis, R W; Keller, P M; Lowe, R S; Zivin, R A

    1985-01-01

    The genome of varicella-zoster virus (VZV) encodes at least three major glycoprotein genes. Among viral gene products, the gC gene products are the most abundant glycoproteins and induce a substantial humoral immune response (Keller et al., J. Virol. 52:293-297, 1984). We utilized two independent approaches to map the gC gene. Small fragments of randomly digested VZV DNA were inserted into a bacterial expression vector. Bacterial colonies transformed by this vector library were screened serologically for antigen expression with monoclonal antibodies to gC. Hybridization of the plasmid DNA from a gC antigen-positive clone revealed homology to the 3' end of the VZV Us segment. In addition, mRNA from VZV-infected cells was hybrid selected by a set of VZV DNA recombinant plasmids and translated in vitro, and polypeptide products were immunoprecipitated by convalescent zoster serum or by monoclonal antibodies to gC. This analysis revealed that the mRNA encoding a 70,000-dalton polypeptide precipitable by anti-gC antibodies mapped to the HindIII C fragment, which circumscribes the entire Us region. We conclude that the VZV gC glycoprotein gene maps to the 3' end of the Us region and is expressed as a 70,000-dalton primary translational product. These results are consistent with the recently reported DNA sequence of Us (A.J. Davison, EMBO J. 2:2203-2209, 1983). Furthermore, glycosylation appears not to be required for a predominant portion of the antigenicity of gC glycoproteins. We also report the tentative map assignments for eight other VZV primary translational products. Images PMID:2981365

  4. Construction of human artificial chromosome vectors by recombineering.

    PubMed

    Kotzamanis, George; Cheung, Wing; Abdulrazzak, Hassan; Perez-Luz, Sara; Howe, Steven; Cooke, Howard; Huxley, Clare

    2005-05-23

    Human artificial chromosomes (HACs) can be formed de novo by transfection of large fragments of cloned alphoid DNA into human HT1080 cells in tissue culture. In order to generate HACs carrying a gene of interest, one can either co-transfect the alphoid DNA and the gene of interest, or one can clone both into a single vector prior to transfection. Here we describe linking approximately 70 kb of alphoid DNA onto a 156-kb BAC carrying the human HPRT gene using Red homologous recombination in the EL350 Escherichia coli host [Lee et al., Genomics 73 (2001) 56-65]. A selectable marker and EGFP marker were then added by loxP/Cre recombination using the arabinose inducible cre gene in the EL350 bacteria. The final construct generates minichromosomes in HT1080 cells and the HPRT gene is expressed. The retrofitting vector can be used to add the approximately 70 kb of alphoid DNA to any BAC carrying a gene of interest to generate a HAC vector. The method can also be used to link any unrelated BAC or PAC insert onto another BAC clone. The EL350 bacteria are an excellent host for building up complex vectors by a combination of homologous and loxP/Cre recombination.

  5. Environmental Control Of A Genetic Process

    NASA Technical Reports Server (NTRS)

    Khosla, Chaitan; Bailey, James E.

    1991-01-01

    E. coli bacteria altered to contain DNA sequence encoding production of hemoglobin made to produce hemoglobin at rates decreasing with increases in concentration of oxygen in culture media. Represents amplification of part of method described in "Cloned Hemoglobin Genes Enhance Growth Of Cells" (NPO-17517). Manipulation of promoter/regulator DNA sequences opens promising new subfield of recombinant-DNA technology for environmental control of expression of selected DNA sequences. New recombinant-DNA fusion gene products, expression vectors, and nucleotide-base sequences will emerge. Likely applications include such aerobic processes as manufacture of cloned proteins and synthesis of metabolites, production of chemicals by fermentation, enzymatic degradation, treatment of wastes, brewing, and variety of oxidative chemical reactions.

  6. Production of Human Papilloma Virus Type 16 E6 Oncoprotein as a Recombinant Protein in Eukaryotic Cells

    PubMed Central

    Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM

    2012-01-01

    Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534

  7. An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

    2006-11-03

    In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

  8. The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

    PubMed Central

    Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

    1982-01-01

    An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

  9. [Construction and expression of recombinant human serum albumin-EPO fusion protein].

    PubMed

    Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

    2011-05-01

    OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

  10. Cytochrome P450 2A13 enhances the sensitivity of human bronchial epithelial cells to aflatoxin B1-induced DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Xuejiao; Jiaojiang District Center for Disease Control and Prevention, 518 Jingdong Rd., Taizhou 318000; Zhang, Zhan

    Cytochrome P450 2A13 (CYP2A13) mainly expresses in human respiratory system and mediates the metabolic activation of aflatoxin B1 (AFB1). Our previous study suggested that CYP2A13 could increase the cytotoxic and apoptotic effects of AFB1 in immortalized human bronchial epithelial cells (BEAS-2B). However, the role of CYP2A13 in AFB1-induced DNA damage is unclear. Using BEAS-2B cells that stably express CYP2A13 (B-2A13), CYP1A2 (B-1A2), and CYP2A6 (B-2A6), we compared their effects in AFB1-induced DNA adducts, DNA damage, and cell cycle changes. BEAS-2B cells that were transfected with vector (B-vector) were used as a control. The results showed that AFB1 (5–80 nM) dose-more » and time-dependently induced DNA damage in B-2A13 cells. AFB1 at 10 and 80 nM significantly augmented this effect in B-2A13 and B-1A2 cells, respectively. B-2A6 cells showed no obvious DNA damage, similar to B-vector cells and the vehicle control. Similarly, compared with B-vector, B-1A2 or B-2A6 cells, B-2A13 cells showed more sensitivity in AFB1-induced γH2AX expression, DNA adduct 8-hydroxy-deoxyguanosine formation, and S-phase cell-cycle arrest. Furthermore, AFB1 activated the proteins related to DNA damage responses, such as ATM, ATR, Chk2, p53, BRCA1, and H2AX, rather than the proteins related to DNA repair. These effects could be almost completely inhibited by 100 μM nicotine (a substrate of CYP2A13) or 1 μM 8-methoxypsoralen (8-MOP; an inhibitor of CYP enzyme). Collectively, these findings suggest that CYP2A13 plays an important role in low-concentration AFB1-induced DNA damage, possibly linking environmental airborne AFB1 to genetic injury in human respiratory system. - Highlights: • CYP2A13 plays a critical role in low concentration of AFB1-induced DNA damage. • B-2A13 cells were more sensitive to AFB1 than B-1A2 cells and B-2A6 cells. • AFB1 dose- and time-dependently induced DNA damage in B-2A13 cells • AFB1-induced DNA adducts and damage can be inhibited by nicotine and 8-MOP.« less

  11. Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

    PubMed

    Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

    2018-05-24

    Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

  12. [Effect of endonuclease G depletion on plasmid DNA uptake and levels of homologous recombination in hela cells].

    PubMed

    Misic, V; El-Mogy, M; Geng, S; Haj-Ahmad, Y

    2016-01-01

    Endonuclease G (EndoG) is a mitochondrial apoptosis regulator that also has roles outside of programmed cell death. It has been implicated as a defence DNase involved in the degradation of exogenous DNA after transfection of mammalian cells and in homologous recombination of viral and endogenous DNA. In this study, we looked at the effect of EndoG depletion on plasmid DNA uptake and the levels of homologous recombination in HeLa cells. We show that the proposed defence role of EndoG against uptake of non-viral DNA vectors does not extend to the cervical carcinoma HeLa cells, as targeting of EndoG expression by RNA interference failed to increase intracellular plasmid DNA levels. However, reducing EndoG levels in HeLa cells resulted in a statistically significant reduction of homologous recombination between two plasmid DNA substrates. These findings suggest that non-viral DNA vectors are also substrates for EndoG in its role in homologous recombination.

  13. Recombinant Salmonella Bacteria Vectoring HIV/AIDS Vaccines

    PubMed Central

    Chin’ombe, Nyasha; Ruhanya, Vurayai

    2013-01-01

    HIV/AIDS is an important public health problem globally. An affordable, easy-to-deliver and protective HIV vaccine is therefore required to curb the pandemic from spreading further. Recombinant Salmonella bacteria can be harnessed to vector HIV antigens or DNA vaccines to the immune system for induction of specific protective immunity. These are capable of activating the innate, humoral and cellular immune responses at both mucosal and systemic compartments. Several studies have already demonstrated the utility of live recombinant Salmonella in delivering expressed foreign antigens as well as DNA vaccines to the host immune system. This review gives an overview of the studies in which recombinant Salmonella bacteria were used to vector HIV/AIDS antigens and DNA vaccines. Most of the recombinant Salmonella-based HIV/AIDS vaccines developed so far have only been tested in animals (mainly mice) and are yet to reach human trials. PMID:24478808

  14. Naturally occurring minichromosome platforms in chromosome engineering: an overview.

    PubMed

    Raimondi, Elena

    2011-01-01

    Artificially modified chromosome vectors are non-integrating gene delivery platforms that can shuttle very large DNA fragments in various recipient cells: theoretically, no size limit exists for the chromosome segments that an engineered minichromosome can accommodate. Therefore, genetically manipulated chromosomes might be potentially ideal vector systems, especially when the complexity of higher eukaryotic genes is concerned. This review focuses on those chromosome vectors generated using spontaneously occurring small markers as starting material. The definition and manipulation of the centromere domain is one of the main obstacles in chromosome engineering: naturally occurring minichromosomes, due to their inherent small size, were helpful in defining some aspects of centromere function. In addition, several distinctive features of small marker chromosomes, like their appearance as supernumerary elements in otherwise normal karyotypes, have been successfully exploited to use them as gene delivery vectors. The key technologies employed for minichromosome engineering are: size reduction, gene targeting, and vector delivery in various recipient cells. In spite of the significant advances that have been recently achieved in all these fields, several unsolved problems limit the potential of artificially modified chromosomes. Still, these vector systems have been exploited in a number of applications where the investigation of the controlled expression of large DNA segments is needed. A typical example is the analysis of genes whose expression strictly depends on the chromosomal environment in which they are positioned, where engineered chromosomes can be envisaged as epigenetically regulated expression systems. A novel and exciting advance concerns the use of engineered minichromosomes to study the organization and dynamics of local chromatin structures.

  15. Infectivity of attenuated poxvirus vaccine vectors and immunogenicity of a raccoonpox vectored rabies vaccine in the Brazilian Free-tailed bat (Tadarida brasiliensis)

    USGS Publications Warehouse

    Stading, Benjamin; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock; Rocke, Tonie E.

    2016-01-01

    Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 x 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats.

  16. Infectivity of attenuated poxvirus vaccine vectors and immunogenicity of a raccoonpox vectored rabies vaccine in the Brazilian Free-tailed bat (Tadarida brasiliensis)

    PubMed Central

    Stading, Ben R.; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock

    2017-01-01

    Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 × 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats. PMID:27650872

  17. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE PAGES

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

    2016-02-04

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  18. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  19. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer.

    PubMed

    Buchlis, George; Podsakoff, Gregory M; Radu, Antonetta; Hawk, Sarah M; Flake, Alan W; Mingozzi, Federico; High, Katherine A

    2012-03-29

    In previous work we transferred a human factor IX-encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer.

  20. Factor IX expression in skeletal muscle of a severe hemophilia B patient 10 years after AAV-mediated gene transfer

    PubMed Central

    Buchlis, George; Podsakoff, Gregory M.; Radu, Antonetta; Hawk, Sarah M.; Flake, Alan W.; Mingozzi, Federico

    2012-01-01

    In previous work we transferred a human factor IX–encoding adeno-associated viral vector (AAV) into skeletal muscle of men with severe hemophilia B. Biopsy of injected muscle up to 1 year after vector injection showed evidence of gene transfer by Southern blot and of protein expression by IHC and immunofluorescent staining. Although the procedure appeared safe, circulating F.IX levels remained subtherapeutic (< 1%). Recently, we obtained muscle tissue from a subject injected 10 years earlier who died of causes unrelated to gene transfer. Using Western blot, IHC, and immunofluorescent staining, we show persistent factor IX expression in injected muscle tissue. F.IX transcripts were detected in injected skeletal muscle using RT-PCR, and isolated whole genomic DNA tested positive for the presence of the transferred AAV vector sequence. This is the longest reported transgene expression to date from a parenterally administered AAV vector, with broad implications for the future of muscle-directed gene transfer. PMID:22271447

  1. Cell-penetrating DNA-binding protein as a safe and efficient naked DNA delivery carrier in vitro and in vivo

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Eun-Sung; Yang, Seung-Woo; Hong, Dong-Ki

    Non-viral gene delivery is a safe and suitable alternative to viral vector-mediated delivery to overcome the immunogenicity and tumorigenesis associated with viral vectors. Using the novel, human-origin Hph-1 protein transduction domain that can facilitate the transduction of protein into cells, we developed a new strategy to deliver naked DNA in vitro and in vivo. The new DNA delivery system contains Hph-1-GAL4 DNA-binding domain (DBD) fusion protein and enhanced green fluorescent protein (EGFP) reporter plasmid that includes the five repeats of GAL4 upstream activating sequence (UAS). Hph-1-GAL4-DBD protein formed complex with plasmid DNA through the specific interaction between GAL4-DBD and UAS,more » and delivered into the cells via the Hph-1-PTD. The pEGFP DNA was successfully delivered by the Hph-1-GAL4 system, and the EGFP was effectively expressed in mammalian cells such as HeLa and Jurkat, as well as in Bright Yellow-2 (BY-2) plant cells. When 10 {mu}g of pEGFP DNA was intranasally administered to mice using Hph-1-GAL4 protein, a high level of EGFP expression was detected throughout the lung tissue for 7 days. These results suggest that an Hph-1-PTD-mediated DNA delivery strategy may be an useful non-viral DNA delivery system for gene therapy and DNA vaccines.« less

  2. A novel RET rearrangement (ACBD5/RET) by pericentric inversion, inv(10)(p12.1;q11.2), in papillary thyroid cancer from an atomic bomb survivor exposed to high-dose radiation.

    PubMed

    Hamatani, Kiyohiro; Eguchi, Hidetaka; Koyama, Kazuaki; Mukai, Mayumi; Nakachi, Kei; Kusunoki, Yoichiro

    2014-11-01

    During analysis of RET/PTC rearrangements in papillary thyroid cancer (PTC) among atomic bomb survivors, a cDNA fragment of a novel type of RET rearrangement was identified in a PTC patient exposed to a high radiation dose using the improved 5' RACE method. This gene resulted from the fusion of the 3' portion of RET containing tyrosine kinase domain to the 5' portion of the acyl-coenzyme A binding domain containing 5 (ACBD5) gene, by pericentric inversion inv(10)(p12.1;q11.2); expression of the fusion gene was confirmed by RT-PCR. ACBD5 gene is ubiquitously expressed in various human normal tissues including thyroid. Full-length cDNA of the ACBD5-RET gene was constructed and then examined for tumorigenicity. Enhanced phosphorylation of ERK proteins in the MAPK pathway was observed in NIH3T3 cells transfected with expression vector encoding the full-length ACBD5/RET cDNA, while this was not observed in the cells transfected with empty expression vector. Stable NIH3T3 transfectants with ACBD5-RET cDNA induced tumor formation after their injection into nude mice. These findings suggest that the ACBD5-RET rearrangement is causatively involved in the development of PTC.

  3. [Construction of a general AAV vector regulated by minimal and artificial hypoxic-responsive element].

    PubMed

    Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying

    2011-03-01

    To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.

  4. Expression of human choline kinase in NIH 3T3 fibroblasts increases the mitogenic potential of insulin and insulin-like growth factor I.

    PubMed

    Chung, T; Huang, J S; Mukherjee, J J; Crilly, K S; Kiss, Z

    2000-05-01

    In mammalian cells, growth factors, oncogenes, and carcinogens stimulate phosphocholine (PCho) synthesis by choline kinase (CK), suggesting that PCho may regulate cell growth. To validate the role of PCho in mitogenesis, we determined the effects of insulin, insulin-like growth factor I (IGF-I), and other growth factors on DNA synthesis in NIH 3T3 fibroblast sublines highly expressing human choline kinase (CK) without increasing phosphatidylcholine synthesis. In serum-starved CK expressor cells, insulin and IGF-I stimulated DNA synthesis, p70 S6 kinase (p70 S6K) activity, phosphatidylinositol 3-kinase (PI3K) activity, and activating phosphorylation of p42/p44 mitogen-activated protein kinases (MAPK) to greater extents than in the corresponding vector control cells. Furthermore, the CK inhibitor hemicholinium-3 (HC-3) inhibited insulin- and IGF-I-induced DNA synthesis in the CK overexpressors, but not in the vector control cells. The results indicate that high cellular levels of PCho potentiate insulin- and IGF-I-induced DNA synthesis by MAPK- and p70 S6K-regulated mechanisms.

  5. Stable expression of the hepatitis B virus surface antigen containing pre-S2 protein in mouse cells using a bovine papillomavirus vector.

    PubMed

    Yoneyama, T; Akatsuka, T; Miyamura, T

    1988-08-01

    The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.

  6. Chitosan-based DNA delivery vector targeted to gonadotropin-releasing hormone (GnRH) receptor.

    PubMed

    Boonthum, Chatwalee; Namdee, Katawut; Boonrungsiman, Suwimon; Chatdarong, Kaywalee; Saengkrit, Nattika; Sajomsang, Warayuth; Ponglowhapan, Suppawiwat; Yata, Teerapong

    2017-02-10

    The main purpose of this study was to investigate the application of modified chitosan as a potential vector for gene delivery to gonadotropin-releasing hormone receptor (GnRHR)-expressing cells. Such design of gene carrier could be useful in particular for gene therapy for cancers related to the reproductive system, gene disorders of sexual development, and contraception and fertility control. In this study, a decapeptide GnRH was successfully conjugated to chitosan (CS) as confirmed by proton nuclear magnetic resonance spectroscopy ( 1 H NMR) and Attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The synthesized GnRH-conjugated chitosan (GnRH-CS) was able to condense DNA to form positively charged nanoparticles and specifically deliver plasmid DNA to targeted cells in both two-dimensional (2D) and three-dimensional (3D) cell cultures systems. Importantly, GnRH-CS exhibited higher transfection activity compared to unmodified CS. In conclusion, GnRH-conjugated chitosan can be a promising carrier for targeted DNA delivery to GnRHR-expressing cells. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Cloning strategy for producing brush-forming protein-based polymers.

    PubMed

    Henderson, Douglas B; Davis, Richey M; Ducker, William A; Van Cott, Kevin E

    2005-01-01

    Brush-forming polymers are being used in a variety of applications, and by using recombinant DNA technology, there exists the potential to produce protein-based polymers that incorporate unique structures and functions in these brush layers. Despite this potential, production of protein-based brush-forming polymers is not routinely performed. For the design and production of new protein-based polymers with optimal brush-forming properties, it would be desirable to have a cloning strategy that allows an iterative approach wherein the protein based-polymer product can be produced and evaluated, and then if necessary, it can be sequentially modified in a controlled manner to obtain optimal surface density and brush extension. In this work, we report on the development of a cloning strategy intended for the production of protein-based brush-forming polymers. This strategy is based on the assembly of modules of DNA that encode for blocks of protein-based polymers into a commercially available expression vector; there is no need for custom-modified vectors and no need for intermediate cloning vectors. Additionally, because the design of new protein-based biopolymers can be an iterative process, our method enables sequential modification of a protein-based polymer product. With at least 21 bacterial expression vectors and 11 yeast expression vectors compatible with this strategy, there are a number of options available for production of protein-based polymers. It is our intent that this strategy will aid in advancing the production of protein-based brush-forming polymers.

  8. Dextran and protamine-based solid lipid nanoparticles as potential vectors for the treatment of X-linked juvenile retinoschisis.

    PubMed

    Delgado, Diego; del Pozo-Rodríguez, Ana; Solinís, Maria Ángeles; Avilés-Triqueros, Marcelino; Weber, Bernhard H F; Fernández, Eduardo; Gascón, Alicia R

    2012-04-01

    The goal of the present study was to analyze the potential application of nonviral vectors based on solid lipid nanoparticles (SLN) for the treatment of ocular diseases by gene therapy, specifically X-linked juvenile retinoschisis (XLRS). Vectors were prepared with SLN, dextran, protamine, and a plasmid (pCMS-EGFP or pCEP4-RS1). Formulations were characterized and the in vitro transfection capacity as well as the cellular uptake and the intracellular trafficking were studied in ARPE-19 cells. Formulations were also tested in vivo in Wistar rat eyes, and the efficacy was studied by monitoring the expression of enhanced green fluorescent protein (EGFP) after intravitreal, subretinal, and topical administration. The presence of dextran and protamine in the SLN improved greatly the expression of retinoschisin and EGFP in ARPE-19 cells. The nuclear localization signals of protamine, its ability to protect the DNA, and a shift in the entry mechanism from caveola-mediated to clathrin-mediated endocytosis promoted by the dextran, justify the increase in transfection. After ocular administration of the dextran-protamine-DNA-SLN complex to rat eyes, we detected the expression of EGFP in various types of cells depending on the administration route. Our vectors were also able to transfect corneal cells after topical application. We have demonstrated the potential usefulness of our nonviral vectors loaded with XLRS1 plasmid and provided evidence for their potential application for the management or treatment of degenerative retinal disorders as well as ocular surface diseases.

  9. DyNAVacS: an integrative tool for optimized DNA vaccine design.

    PubMed

    Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena

    2006-07-01

    DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.

  10. Complementary DNA cloning of the pear 1-aminocyclopropane-1-carboxylic acid oxidase gene and agrobacterium-mediated anti-sense genetic transformation.

    PubMed

    Qi, Jing; Dong, Zhen; Zhang, Yu-Xing

    2015-12-01

    The aim of the present study was to genetically modify plantlets of the Chinese yali pear to reduce their expression of ripening-associated 1-aminocyclopropane-1-carboxylic acid oxidase (ACO) and therefore increase the shelf-life of the fruit. Primers were designed with selectivity for the conserved regions of published ACO gene sequences, and yali complementary DNA (cDNA) cloning was performed by reverse transcription quantitative polymerase chain reaction (PCR). The obtained cDNA fragment contained 831 base pairs, encoding 276 amino acid residues, and shared no less than 94% nucleotide sequence identity with other published ACO genes. The cDNA fragment was inversely inserted into a pBI121 expression vector, between the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator, in order to construct the anti‑sense expression vector of the ACO gene; it was transfected into cultured yali plants using Agrobacterium LBA4404. Four independent transgenic lines of pear plantlets were obtained and validated by PCR analysis. A Southern blot assay revealed that there were three transgenic lines containing a single copy of exogenous gene and one line with double copies. The present study provided germplasm resources for the cultivation of novel storage varieties of pears, therefore providing a reference for further applications of anti‑sense RNA technology in the genetic improvement of pears and other fruit.

  11. Construction of a complementary DNA library for Parelaphostrongylus tenuis and identification of a potentially sero-diagnostic recombinant antigen.

    PubMed

    Ogunremi, Oladele; Benjamin, Jane; MacDonald, Lily; Schimpf, Robert

    2008-12-01

    Newly developed serological tests for diagnosing parelaphostrongylosis in cervids, using the excretory-secretory products (ES) of the infective larvae of Parelaphostrongylus tenuis in enzyme-linked immunosorbent assays (ELISAs), have demonstrable superiority over the traditional method of larval recovery and microscopic identification. To generate a source of ELISA antigen by genetic engineering, we created a complementary DNA (cDNA) expression library by the reverse transcription of mRNA of P. tenuis adult worms, and ligation with the vector lambda-ZAP II. The library was screened using antisera produced in mice by immunization with a somatic antigen preparation of adult worms. Seventeen clones were isolated, sequenced, and checked for similarity to other DNA sequences in GenBank. A previously identified parasite gene encoding an aspartyl protease inhibitor (API) was isolated from the cDNA library, subcloned and expressed using the pET expression vector to produce a glutathione S transferase (GST)-His-S.Tag-P. tenuis API fusion protein (molecular weight = 63 kDa). An enzyme-linked immunosorbent assay utilizing the API fusion protein as the coating antigen was used to serologically diagnose all white-tailed deer (WTD, 10 out of 10) that had been inoculated with 6 - 150 L3 P. tenuis, indicating that the antigen may be a useful serodiagnostic antigen for P. tenuis infection in this cervid species.

  12. Influence of sequence and size of DNA on packaging efficiency of parvovirus MVM-based vectors.

    PubMed

    Brandenburger, A; Coessens, E; El Bakkouri, K; Velu, T

    1999-05-01

    We have derived a vector from the autonomous parvovirus MVM(p), which expresses human IL-2 specifically in transformed cells (Russell et al., J. Virol 1992;66:2821-2828). Testing the therapeutic potential of these vectors in vivo requires high-titer stocks. Stocks with a titer of 10(9) can be obtained after concentration and purification (Avalosse et al., J. Virol. Methods 1996;62:179-183), but this method requires large culture volumes and cannot easily be scaled up. We wanted to increase the production of recombinant virus at the initial transfection step. Poor vector titers could be due to inadequate genome amplification or to inefficient packaging. Here we show that intracellular amplification of MVM vector genomes is not the limiting factor for vector production. Several vector genomes of different size and/or structure were amplified to an equal extent. Their amplification was also equivalent to that of a cotransfected wild-type genome. We did not observe any interference between vector and wild-type genomes at the level of DNA amplification. Despite equivalent genome amplification, vector titers varied greatly between the different genomes, presumably owing to differences in packaging efficiency. Genomes with a size close to 100% that of wild type were packaged most efficiently with loss of efficiency at lower and higher sizes. However, certain genomes of identical size showed different packaging efficiencies, illustrating the importance of the DNA sequence, and probably its structure.

  13. Effect of DNA sequence of Fab fragment on yield characteristics and cell growth of E. coli.

    PubMed

    Kulmala, Antti; Huovinen, Tuomas; Lamminmäki, Urpo

    2017-06-19

    Codon usage is one of the factors influencing recombinant protein expression. We were interested in the codon usage of an antibody Fab fragment gene exhibiting extreme toxicity in the E. coli host. The toxic synthetic human Fab gene contained domains optimized by the "one amino acid-one codon" method. We redesigned five segments of the Fab gene with a "codon harmonization" method described by Angov et al. and studied the effects of these changes on cell viability, Fab yield and display on filamentous phage using different vectors and bacterial strains. The harmonization considerably reduced toxicity, increased Fab expression from negligible levels to 10 mg/l, and restored the display on phage. Testing the impact of the individual redesigned segments revealed that the most significant effects were conferred by changes in the constant domain of the light chain. For some of the Fab gene variants, we also observed striking differences in protein yields when cloned from a chloramphenicol resistant vector into an identical vector, except with ampicillin resistance. In conclusion, our results show that the expression of a heterodimeric secretory protein can be improved by harmonizing selected DNA segments by synonymous codons and reveal additional complexity involved in heterologous protein expression.

  14. In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

    PubMed

    Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

    2000-02-01

    Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

  15. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    PubMed

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. Over-expression of angiotensin II type 2 receptor gene induces cell death in lung adenocarcinoma cells.

    PubMed

    Pickel, Lara; Matsuzuka, Takaya; Doi, Chiyo; Ayuzawa, Rie; Maurya, Dharmendra Kumar; Xie, Sheng-Xue; Berkland, Cory; Tamura, Masaaki

    2010-02-01

    The endogenous angiotensin II (Ang II) type 2 receptor (AT 2) has been shown to mediate apoptosis in cardiovascular tissues. Thus, the aim of this study was to explore the anti-cancer effect of AT 2 over-expression on lung adenocarcinoma cells in vitro using adenoviral (Ad), FuGENE, and nanoparticle vectors. All three gene transfection methods efficiently transfected AT 2 cDNA into lung cancer cells but caused minimal gene transfection in normal lung epithelial cells. Ad-AT 2 significantly attenuated multiple human lung cancer cell growth (A549 and H358) as compared to the control viral vector, Ad-LacZ, when cell viability was examined by direct cell count. Examination of annexin V by flow cytometry revealed the activation of the apoptotic pathway via AT 2 over-expression. Western Blot analysis confirmed the activation of caspase-3. Similarly, poly (lactide-co-glycolic acid) (PLGA) biodegradable nanoparticles encapsulated AT 2 plasmid DNA were shown to be effectively taken up into the lung cancer cell. Nanoparticle-based AT 2 gene transfection markedly increased AT 2 expression and resultant cell death in A549 cells. These results indicate that AT 2 over-expression effectively attenuates growth of lung adenocarcinoma cells through intrinsic apoptosis. Our results also suggest that PLGA nanoparticles can be used as an efficient gene delivery vector for lung adenocarcinoma targeted therapy.

  17. Direct and efficient transfection of mouse neural stem cells and mature neurons by in vivo mRNA electroporation.

    PubMed

    Bugeon, Stéphane; de Chevigny, Antoine; Boutin, Camille; Coré, Nathalie; Wild, Stefan; Bosio, Andreas; Cremer, Harold; Beclin, Christophe

    2017-11-01

    In vivo brain electroporation of DNA expression vectors is a widely used method for lineage and gene function studies in the developing and postnatal brain. However, transfection efficiency of DNA is limited and adult brain tissue is refractory to electroporation. Here, we present a systematic study of mRNA as a vector for acute genetic manipulation in the developing and adult brain. We demonstrate that mRNA electroporation is far more efficient than DNA electroporation, and leads to faster and more homogeneous protein expression in vivo Importantly, mRNA electroporation allows the manipulation of neural stem cells and postmitotic neurons in the adult brain using minimally invasive procedures. Finally, we show that this approach can be efficiently used for functional studies, as exemplified by transient overexpression of the neurogenic factor Myt1l and by stably inactivating Dicer nuclease in vivo in adult born olfactory bulb interneurons and in fully integrated cortical projection neurons. © 2017. Published by The Company of Biologists Ltd.

  18. Nuclear routing networks span between nuclear pore complexes and genomic DNA to guide nucleoplasmic trafficking of biomolecules

    PubMed Central

    Malecki, Marek; Malecki, Bianca

    2012-01-01

    In health and disease, biomolecules, which are involved in gene expression, recombination, or reprogramming have to traffic through the nucleoplasm, between nuclear pore complexes (NPCs) and genomic DNA (gDNA). This trafficking is guided by the recently revealed nuclear routing networks (NRNs). In this study, we aimed to investigate, if the NRNs have established associations with the genomic DNA in situ and if the NRNs have capabilities to bind the DNA de novo. Moreover, we aimed to study further, if nucleoplasmic trafficking of the histones, rRNA, and transgenes’ vectors, between the NPCs and gDNA, is guided by the NRNs. We used Xenopus laevis oocytes as the model system. We engineered the transgenes’ DNA vectors equipped with the SV40 LTA nuclear localization signals (NLS) and/or HIV Rev nuclear export signals (NES). We purified histones, 5S rRNA, and gDNA. We rendered all these molecules superparamagnetic and fluorescent for detection with nuclear magnetic resonance (NMR), total reflection x-ray fluorescence (TXRF), energy dispersive x-ray spectroscopy (EDXS), and electron energy loss spectroscopy (EELS). The NRNs span between the NPCs and genomic DNA. They form firm bonds with the gDNA in situ. After complete digestion of the nucleic acids with the RNases and DNases, the newly added DNA - modified with the dNTP analogs, bonds firmly to the NRNs. Moreover, the NRNs guide the trafficking of the DNA transgenes’ vectors - modified with the SV40 LTA NLS, following their import into the nuclei through the NPCs. The pathway is identical to that of histones. The NRNs also guide the trafficking of the DNA transgenes’ vectors, modified with the HIV Rev NES, to the NPCs, followed by their export out of the nuclei. Ribosomal RNAs follow the same pathway. To summarize, the NRNs are the structures connecting the NPCs and the gDNA. They guide the trafficking of the biomolecules between the NPCs and the gDNA. PMID:23275893

  19. Selection of transduced CD34+ progenitors and enzymatic correction of cells from Gaucher patients, with bicistronic vectors.

    PubMed Central

    Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S

    1995-01-01

    The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847

  20. Built-in adjuvanticity of genetically and protein-engineered chimeric molecules for targeting of influenza A peptide epitopes.

    PubMed

    Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I

    2014-10-01

    Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.

  1. An integrated vector system for cellular studies of phage display-derived peptides.

    PubMed

    Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V

    2002-09-15

    Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.

  2. Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

    PubMed

    Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

    1991-08-01

    Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

  3. New gorilla adenovirus vaccine vectors induce potent immune responses and protection in a mouse malaria model.

    PubMed

    Limbach, Keith; Stefaniak, Maureen; Chen, Ping; Patterson, Noelle B; Liao, Grant; Weng, Shaojie; Krepkiy, Svetlana; Ekberg, Greg; Torano, Holly; Ettyreddy, Damodar; Gowda, Kalpana; Sonawane, Sharvari; Belmonte, Arnel; Abot, Esteban; Sedegah, Martha; Hollingdale, Michael R; Moormann, Ann; Vulule, John; Villasante, Eileen; Richie, Thomas L; Brough, Douglas E; Bruder, Joseph T

    2017-07-03

    A DNA-human Ad5 (HuAd5) prime-boost malaria vaccine has been shown to protect volunteers against a controlled human malaria infection. The potency of this vaccine, however, appeared to be affected by the presence of pre-existing immunity against the HuAd5 vector. Since HuAd5 seroprevalence is very high in malaria-endemic areas of the world, HuAd5 may not be the most appropriate malaria vaccine vector. This report describes the evaluation of the seroprevalence, immunogenicity and efficacy of three newly identified gorilla adenoviruses, GC44, GC45 and GC46, as potential malaria vaccine vectors. The seroprevalence of GC44, GC45 and GC46 is very low, and the three vectors are not efficiently neutralized by human sera from Kenya and Ghana, two countries where malaria is endemic. In mice, a single administration of GC44, GC45 and GC46 vectors expressing a murine malaria gene, Plasmodium yoelii circumsporozoite protein (PyCSP), induced robust PyCSP-specific T cell and antibody responses that were at least as high as a comparable HuAd5-PyCSP vector. Efficacy studies in a murine malaria model indicated that a prime-boost regimen with DNA-PyCSP and GC-PyCSP vectors can protect mice against a malaria challenge. Moreover, these studies indicated that a DNA-GC46-PyCSP vaccine regimen was significantly more efficacious than a DNA-HuAd5-PyCSP regimen. These data suggest that these gorilla-based adenovectors have key performance characteristics for an effective malaria vaccine. The superior performance of GC46 over HuAd5 highlights its potential for clinical development.

  4. Modification of the Creator recombination system for proteomics applications--improved expression by addition of splice sites.

    PubMed

    Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

    2006-03-06

    Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.

  5. Modification of the Creator recombination system for proteomics applications – improved expression by addition of splice sites

    PubMed Central

    Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B

    2006-01-01

    Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801

  6. Pyranose 2-oxidase from Phanerochaete chrysosporium : expression in E. coli and biochemical characterization

    Treesearch

    Ines Pisanelli; Magdalena Kujawa; Oliver Spadiut; Roman Kittl; Petr Halada; Jindrich Volc; Michael D. Mozuch; Philip Kersten; Dietmar Haltrich; Clemens Peterbauer

    2009-01-01

    The presented work reports the isolation and heterologous expression of the p2ox gene encoding the flavoprotein pyranose 2-oxidase (P2Ox) from the basidiomycete Phanerochaete chrysosporium. The p2ox cDNA was inserted into the bacterial expression vector pET21a(+) and successfully expressed in Escherichia coli. We obtained active, fully flavinylated recombinant P2Ox in...

  7. [Overexpression of liver kinase B1 inhibits the proliferation of lung cancer cells].

    PubMed

    Li, Yang; Zhang, Libin; Wang, Ping

    2017-01-01

    Objective To explore the effect of overexpressed liver kinase B1(LKB1) on the proliferation of lung cancer cell lines. Methods The expression levels of LKB1 and PTEN in A549, NCI-H23, NCI-H157, XWLC-05, NCI-H446 lung cancer cells were detected by immunocytochemistry (ICC) and Western blotting. Plasmid pcDNA3.1 + -LKB1 and empty vector pcDNA3.1 + -null were separately transfected into the above five cell lines, and then the expression of LKB1 mRNA and protein were determined by quantitative real-time PCR and Western blotting, respectively. Finally, CCK-8 assay was used to analyze the proliferation ability of the transfected cells. Results LKB1 and PTEN were positive in NCI-H23 cells; LKB1 was negative while PTEN was positive in A549 and NCI-H446 cells; both LKB1 and PTEN were negative in NCI-H157 and XWLC-05 cells. Quantitative real-time PCR and Western blotting showed that the expression level of LKB1 significantly increased in the above cell lines transfected with plasmid pcDNA3.1 + -LKB1 compared with the ones with empty vector pcDNA3.1 + -null. Besides, CCK-8 assay showed that the overexpression of LKB1 in the lung cancer cells transfected with pcDNA3.1 + -LKB1 had an obvious inhibitory effect on cell proliferation. Conclusion The expression of LKB1 is down-regulated in most of the lung cell lines to different extent and the over-expression of LKB1 can remarkably inhibit the proliferation ability of lung cancer cell lines.

  8. The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model.

    PubMed

    Suarez, D L; Schultz-Cherry, S

    2000-01-01

    Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.

  9. MIDAS/GPP34, a nuclear gene product, regulates total mitochondrial mass in response to mitochondrial dysfunction.

    PubMed

    Nakashima-Kamimura, Naomi; Asoh, Sadamitsu; Ishibashi, Yoshitomo; Mukai, Yuri; Shidara, Yujiro; Oda, Hideaki; Munakata, Kae; Goto, Yu-Ichi; Ohta, Shigeo

    2005-11-15

    To investigate the regulatory system in mitochondrial biogenesis involving crosstalk between the mitochondria and nucleus, we found a factor named MIDAS (mitochondrial DNA absence sensitive factor) whose expression was enhanced by the absence of mitochondrial DNA (mtDNA). In patients with mitochondrial diseases, MIDAS expression was increased only in dysfunctional muscle fibers. A majority of MIDAS localized to mitochondria with a small fraction in the Golgi apparatus in HeLa cells. To investigate the function of MIDAS, we stably transfected HeLa cells with an expression vector carrying MIDAS cDNA or siRNA. Cells expressing the MIDAS protein and the siRNA constitutively showed an increase and decrease in the total mass of mitochondria, respectively, accompanying the regulation of a mitochondria-specific phospholipid, cardiolipin. In contrast, amounts of the mitochondrial DNA, RNA and proteins did not depend upon MIDAS. Thus, MIDAS is involved in the regulation of mitochondrial lipids, leading to increases of total mitochondrial mass in response to mitochondrial dysfunction.

  10. Recent Advances in Preclinical Developments Using Adenovirus Hybrid Vectors.

    PubMed

    Ehrke-Schulz, Eric; Zhang, Wenli; Gao, Jian; Ehrhardt, Anja

    2017-10-01

    Adenovirus (Ad)-based vectors are efficient gene-transfer vehicles to deliver foreign DNA into living organisms, offering large cargo capacity and low immunogenicity and genotoxicity. As Ad shows low integration rates of their genomes into host chromosomes, vector-derived gene expression decreases due to continuous cell cycling in regenerating tissues and dividing cell populations. To overcome this hurdle, adenoviral delivery can be combined with mechanisms leading to maintenance of therapeutic DNA and long-term effects of the desired treatment. Several hybrid Ad vectors (AdV) exploiting various strategies for long-term treatment have been developed and characterized. This review summarizes recent developments of preclinical approaches using hybrid AdVs utilizing either the Sleeping Beauty transposase system for somatic integration into host chromosomes or designer nucleases, including transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease for permanent gene editing. Further options on how to optimize these vectors further are discussed, which may lead to future clinical applications of these versatile gene-therapy tools.

  11. Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eric Y. Chuang

    2006-08-31

    It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

  12. Prion extraction methods: comparison of bead beating, ultrasonic disruption and repeated freeze-thaw methodologies for the recovery of functional renilla-prion fusion protein from bacteria

    USDA-ARS?s Scientific Manuscript database

    Molecular DNA technology allows for production of mammalian proteins in bacteria at sufficient quantities for downstream use and analysis. Variation in design and engineering of DNA expression vectors imparts selective alterations resulting in the generation of fusion proteins with intrinsic report...

  13. A convenient method of preparing gene vector for real time monitoring transfection process based on the quantum dots

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Hai-Li; Zhang, Ming-Zhen; Li, Xiang-Yong

    2012-11-15

    Highlights: ► An easy and direct way to prepare QDs–DNA complexes was developed. ► Surface charge of QDs was tuned with different ratio of amino and glycolate. ► Transfection efficiency was dependent on the surface zeta potentials of QDs. ► Cellular toxicity of this gene vectors is much lower than commercial liposome. ► Whole intracellular behavior of QDs–DNA complexes can be monitored in real time. -- Abstract: Nanoparticle carrier has been developed by combining water-soluble quantum dots and plasmid DNA expressed enhanced green fluorescent protein (EGFP) in a convenient and direct way. First the QDs with different surface charges weremore » obtained by coating with amino and carboxyl terminals at different ratios. Then plasmid DNA was conjugated to QDs via electrostatic interaction. The resultant QDs–DNA complexes showed enhanced resistance to DNase I digestion. The following transfection experiments demonstrated that the transfection efficiency was dependent on the surface charges on QDs. The real time imaging of the transfection process showed that the nanoparticles experienced binding, penetrating the cell membrane and entering cytoplasm in the first 6 h of transfection. The green fluorescence of EGFP began to appear after 18 h transfection and plasmid DNA was fully expressed in the following 6 h. This new QDs–DNA platform showed great potential as new gene delivery carrier.« less

  14. The Web-Based DNA Vaccine Database DNAVaxDB and Its Usage for Rational DNA Vaccine Design.

    PubMed

    Racz, Rebecca; He, Yongqun

    2016-01-01

    A DNA vaccine is a vaccine that uses a mammalian expression vector to express one or more protein antigens and is administered in vivo to induce an adaptive immune response. Since the 1990s, a significant amount of research has been performed on DNA vaccines and the mechanisms behind them. To meet the needs of the DNA vaccine research community, we created DNAVaxDB ( http://www.violinet.org/dnavaxdb ), the first Web-based database and analysis resource of experimentally verified DNA vaccines. All the data in DNAVaxDB, which includes plasmids, antigens, vaccines, and sources, is manually curated and experimentally verified. This chapter goes over the detail of DNAVaxDB system and shows how the DNA vaccine database, combined with the Vaxign vaccine design tool, can be used for rational design of a DNA vaccine against a pathogen, such as Mycobacterium bovis.

  15. Constructing of DNA vectors with controlled nanosize and single dispersion by block copolymer coating gold nanoparticles as template assembly

    NASA Astrophysics Data System (ADS)

    Li, Junbo; Wu, Wenlan; Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan

    2017-03-01

    Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol- b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG- b-PAMPImB) coating gold nanoparticles (PEG- b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.

  16. Fusagene vectors: a novel strategy for the expression of multiple genes from a single cistron.

    PubMed

    Gäken, J; Jiang, J; Daniel, K; van Berkel, E; Hughes, C; Kuiper, M; Darling, D; Tavassoli, M; Galea-Lauri, J; Ford, K; Kemeny, M; Russell, S; Farzaneh, F

    2000-12-01

    Transduction of cells with multiple genes, allowing their stable and co-ordinated expression, is difficult with the available methodologies. A method has been developed for expression of multiple gene products, as fusion proteins, from a single cistron. The encoded proteins are post-synthetically cleaved and processed into each of their constituent proteins as individual, biologically active factors. Specifically, linkers encoding cleavage sites for the Golgi expressed endoprotease, furin, have been incorporated between in-frame cDNA sequences encoding different secreted or membrane bound proteins. With this strategy we have developed expression vectors encoding multiple proteins (IL-2 and B7.1, IL-4 and B7.1, IL-4 and IL-2, IL-12 p40 and p35, and IL-12 p40, p35 and IL-2 ). Transduction and analysis of over 100 individual clones, derived from murine and human tumour cell lines, demonstrate the efficient expression and biological activity of each of the encoded proteins. Fusagene vectors enable the co-ordinated expression of multiple gene products from a single, monocistronic, expression cassette.

  17. De novo formed satellite DNA-based mammalian artificial chromosomes and their possible applications.

    PubMed

    Katona, Robert L

    2015-02-01

    Mammalian artificial chromosomes (MACs) are non-integrating, autonomously replicating natural chromosome-based vectors that may carry a vast amount of genetic material, which in turn enable potentially prolonged, safe, and regulated therapeutic transgene expression and render MACs as attractive genetic vectors for "gene replacement" or for controlling differentiation pathways in target cells. Satellite-DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian and plant species. These artificially generated accessory chromosomes are composed of predictable DNA sequences, and they contain defined genetic information. SATACs have already passed a number of obstacles crucial to their further development as gene therapy vectors, including large-scale purification, transfer of purified artificial chromosomes into different cells and embryos, generation of transgenic animals and germline transmission with purified SATACs, and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals. SATACs could be used in cell therapy protocols. For these methods, the most versatile target cell would be one that was pluripotent and self-renewing to address multiple disease target cell types, thus making multilineage stem cells, such as adult derived early progenitor cells and embryonic stem cells, as attractive universal host cells.

  18. Lactococci and lactobacilli as mucosal delivery vectors for therapeutic proteins and DNA vaccines

    PubMed Central

    2011-01-01

    Food-grade Lactic Acid Bacteria (LAB) have been safely consumed for centuries by humans in fermented foods. Thus, they are good candidates to develop novel oral vectors, constituting attractive alternatives to attenuated pathogens, for mucosal delivery strategies. Herein, this review summarizes our research, up until now, on the use of LAB as mucosal delivery vectors for therapeutic proteins and DNA vaccines. Most of our work has been based on the model LAB Lactococcus lactis, for which we have developed efficient genetic tools, including expression signals and host strains, for the heterologous expression of therapeutic proteins such as antigens, cytokines and enzymes. Resulting recombinant lactococci strains have been tested successfully for their prophylactic and therapeutic effects in different animal models: i) against human papillomavirus type 16 (HPV-16)-induced tumors in mice, ii) to partially prevent a bovine β-lactoglobulin (BLG)-allergic reaction in mice and iii) to regulate body weight and food consumption in obese mice. Strikingly, all of these tools have been successfully transposed to the Lactobacillus genus, in recent years, within our laboratory. Notably, anti-oxidative Lactobacillus casei strains were constructed and tested in two chemically-induced colitis models. In parallel, we also developed a strategy based on the use of L. lactis to deliver DNA at the mucosal level, and were able to show that L. lactis is able to modulate the host response through DNA delivery. Today, we consider that all of our consistent data, together with those obtained by other groups, demonstrate and reinforce the interest of using LAB, particularly lactococci and lactobacilli strains, to develop novel therapeutic protein mucosal delivery vectors which should be tested now in human clinical trials. PMID:21995317

  19. Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

    PubMed

    Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

    2010-06-01

    To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

  20. Developing de novo human artificial chromosomes in embryonic stem cells using HSV-1 amplicon technology.

    PubMed

    Moralli, Daniela; Monaco, Zoia L

    2015-02-01

    De novo artificial chromosomes expressing genes have been generated in human embryonic stem cells (hESc) and are maintained following differentiation into other cell types. Human artificial chromosomes (HAC) are small, functional, extrachromosomal elements, which behave as normal chromosomes in human cells. De novo HAC are generated following delivery of alpha satellite DNA into target cells. HAC are characterized by high levels of mitotic stability and are used as models to study centromere formation and chromosome organisation. They are successful and effective as gene expression vectors since they remain autonomous and can accommodate larger genes and regulatory regions for long-term expression studies in cells unlike other viral gene delivery vectors currently used. Transferring the essential DNA sequences for HAC formation intact across the cell membrane has been challenging for a number of years. A highly efficient delivery system based on HSV-1 amplicons has been used to target DNA directly to the ES cell nucleus and HAC stably generated in human embryonic stem cells (hESc) at high frequency. HAC were detected using an improved protocol for hESc chromosome harvesting, which consistently produced high-quality metaphase spreads that could routinely detect HAC in hESc. In tumour cells, the input DNA often integrated in the host chromosomes, but in the host ES genome, it remained intact. The hESc containing the HAC formed embryoid bodies, generated teratoma in mice, and differentiated into neuronal cells where the HAC were maintained. The HAC structure and chromatin composition was similar to the endogenous hESc chromosomes. This review will discuss the technological advances in HAC vector delivery using HSV-1 amplicons and the improvements in the identification of de novo HAC in hESc.

  1. Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

    PubMed

    Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

    2015-09-11

    We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. Development of a new vector using Soybean yellow common mosaic virus for gene function study or heterologous protein expression in soybeans.

    PubMed

    Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun

    2016-02-01

    A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. “Direct cloning in Lactobacillus plantarum: Electroporation with non-methylated plasmid DNA enhances transformation efficiency and makes shuttle vectors obsolete”

    PubMed Central

    2012-01-01

    Background Lactic acid bacteria (LAB) play an important role in agricultural as well as industrial biotechnology. Development of improved LAB strains using e.g. library approaches is often limited by low transformation efficiencies wherefore one reason could be differences in the DNA methylation patterns between the Escherichia coli intermediate host for plasmid amplification and the final LAB host. In the present study, we examined the influence of DNA methylation on transformation efficiency in LAB and developed a direct cloning approach for Lactobacillus plantarum CD033. Therefore, we propagated plasmid pCD256 in E. coli strains with different dam/dcm-methylation properties. The obtained plasmid DNA was purified and transformed into three different L. plantarum strains and a selection of other LAB species. Results Best transformation efficiencies were obtained using the strain L. plantarum CD033 and non-methylated plasmid DNA. Thereby we achieved transformation efficiencies of ~ 109 colony forming units/μg DNA in L. plantarum CD033 which is in the range of transformation efficiencies reached with E. coli. Based on these results, we directly transformed recombinant expression vectors received from PCR/ligation reactions into L. plantarum CD033, omitting plasmid amplification in E. coli. Also this approach was successful and yielded a sufficient number of recombinant clones. Conclusions Transformation efficiency of L. plantarum CD033 was drastically increased when non-methylated plasmid DNA was used, providing the possibility to generate expression libraries in this organism. A direct cloning approach, whereby ligated PCR-products where successfully transformed directly into L. plantarum CD033, obviates the construction of shuttle vectors containing E. coli-specific sequences, as e.g. a ColEI origin of replication, and makes amplification of these vectors in E. coli obsolete. Thus, plasmid constructs become much smaller and occasional structural instability or mutagenesis during E. coli propagation is excluded. The results of our study provide new genetic tools for L. plantarum which will allow fast, forward and systems based genetic engineering of this species. PMID:23098256

  4. Molecular transformation, gene cloning, and gene expression systems for filamentous fungi

    USGS Publications Warehouse

    Gold, Scott E.; Duick, John W.; Redman, Regina S.; Rodriguez, Rusty J.

    2001-01-01

    This chapter discusses the molecular transformation, gene cloning, and gene expression systems for filamentous fungi. Molecular transformation involves the movement of discrete amounts of DNA into cells, the expression of genes on the transported DNA, and the sustainable replication of the transforming DNA. The ability to transform fungi is dependent on the stable replication and expression of genes located on the transforming DNA. Three phenomena observed in bacteria, that is, competence, plasmids, and restriction enzymes to facilitate cloning, were responsible for the development of molecular transformation in fungi. Initial transformation success with filamentous fungi, involving the complementation of auxotrophic mutants by exposure to sheared genomic DNA or RNA from wt isolates, occurred with low transformation efficiencies. In addition, it was difficult to retrieve complementing DNA fragments and isolate genes of interest. This prompted the development of transformation vectors and methods to increase efficiencies. The physiological studies performed with fungi indicated that the cell wall could be removed to generate protoplasts. It was evident that protoplasts could be transformed with significantly greater efficiencies than walled cells.

  5. Sensitization of breast cancer cells to doxorubicin via stable cell line generation and overexpression of DFF40.

    PubMed

    Bagheri, Fatemeh; Safarian, Shahrokh; Eslaminejad, Mohamadreza Baghaban; Sheibani, Nader

    2015-12-01

    There are a number of reports demonstrating a relationship between the alterations in DFF40 expression and development of some cancers. Here, increased DFF40 expression in T-47D cells in the presence of doxorubicin was envisaged for therapeutic usage. The T-47D cells were transfected with an eukaryotic expression vector encoding the DFF40 cDNA. Following incubation with doxorubicin, propidium iodide (PI) staining was used for cell cycle distribution analysis. The rates of apoptosis were determined by annexin V/PI staining. Apoptosis was also evaluated using the DNA laddering analysis. The viability of DFF40-transfected cells incubated with doxorubicin was significantly decreased compared with control cells. However, there were no substantial changes in the cell cycle distribution of pIRES2-DFF40 cells incubated with doxorubicin compared to control cells. The expression of DFF40, without doxorubicin incubation, had also no significant effect on the cell cycle distribution. There was no DNA laddering in cells transfected with the empty pIRES2 vector when incubated with doxorubicin. In contrast, DNA laddering was observed in DFF40 transfected cells in the presence of doxorubicin after 48 h. Also, the expression of DFF40 and DFF45 was increased in DFF40 transfected cells in the presence of doxorubicin enhancing cell death. Collectively our results indicated that co-treatment of DFF40-transfected cells with doxorubicin can enhance the killing of these tumor cells via apoptosis. Thus, modulation of DFF40 level may be a beneficial strategy for treatment of chemo-resistant cancers.

  6. SASH1 regulates proliferation, apoptosis, and invasion of osteosarcoma cell.

    PubMed

    Meng, Qingbing; Zheng, Minqian; Liu, Hongbing; Song, Changzhi; Zhang, Wensheng; Yan, Juan; Qin, Ling; Liu, Xiaolan

    2013-01-01

    SASH1, a member of the SLY-family of signal adapter proteins, is a candidate tumor suppressor in breast and colon cancer. The SASH1 protein possesses both the SH3 and SAM domains, indicating that it may play an important role in intracellular signal transduction. Reduced expression of SASH1 is closely related to tumor growth, invasion, metastasis, and poor prognosis. However, the biological role of SASH1 remains unknown in osteosarcoma. To unravel the function of SASH1, we explored the expression of SASH1 in osteosarcoma tissues and its correlation to the clinical pathology of osteosarcoma and analyzed the relationship between SASH1 expression and cell cycle, apoptosis and invasion of osteosarcoma MG-63 cells, using the flow cytometry analysis and transwell invasion chamber experiments. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-9 were observed by western blot. Our results showed that the expression rate of SASH1 mRNA in osteosarcoma tissues was significantly lower than that in normal bone tissue (p = 0.000), that the expression rate of SASH1 mRNA in the carcinoma tissues from patients with lung metastasis was significantly lower than that from patients without lung metastasis (p = 0.041), and that the expression rate of SASH1 mRNA also decreased with increasing Enneking stage (p = 0.032). However, the mRNA expression of SASH1 in osteosarcoma was independent of the patient's gender, age, and tumor size (p = 0.983, 0.343, 0.517, respectively). The SASH1 protein displayed a down-regulation in osteosarcoma tissues compared to normal bone tissue (p = 0.000), displayed a down-regulation in osteosarcoma tissues from patients with lung metastasis compared to from patients without lung metastasis (p = 0.000), and displayed a gradual decrease with increasing Enneking stage (p = 0.000). In addition, the MG-63 cells from pcDNA3.1-SASH1 group exhibited significantly reduced cell viability, proliferation, and invasive ability compared to the empty vector group and blank control group (p = 0.023, 0.001, respectively), and there was no difference between the empty vector group and blank control group. The pcDNA3.1-SASH1 group displayed significantly more apoptotic cells than the empty vector group and blank control group (p = 0.004). The expression of cyclin D1, MMP-9 displayed a down-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000, 0.001, respectively) and the expression levels of caspase-3 displayed an up-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000). Taken together, these data indicated that the overexpression of SASH1 might be associated with the inhibition of growth, proliferation, and invasion of MG-63 cells and the promotion of apoptosis of MG-63 cells.

  7. Metatranscriptomics of Soil Eukaryotic Communities.

    PubMed

    Yadav, Rajiv K; Bragalini, Claudia; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia

    2016-01-01

    Functions expressed by eukaryotic organisms in soil can be specifically studied by analyzing the pool of eukaryotic-specific polyadenylated mRNA directly extracted from environmental samples. In this chapter, we describe two alternative protocols for the extraction of high-quality RNA from soil samples. Total soil RNA or mRNA can be converted to cDNA for direct high-throughput sequencing. Polyadenylated mRNA-derived full-length cDNAs can also be cloned in expression plasmid vectors to constitute soil cDNA libraries, which can be subsequently screened for functional gene categories. Alternatively, the diversity of specific gene families can also be explored following cDNA sequence capture using exploratory oligonucleotide probes.

  8. Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression.

    PubMed

    Umei, Tomohiko C; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

    2017-08-19

    Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming.

  9. Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression

    PubMed Central

    Umei, Tomohiko C.; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

    2017-01-01

    Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming. PMID:28825623

  10. Induction of Human Blood Group A Antigen Expression on Mouse Cells, Using Lentiviral Gene Transduction

    PubMed Central

    Fan, Xiaohu; Lang, Haili; Zhou, Xianpei; Zhang, Li; Yin, Rong; Maciejko, Jessica; Giannitsos, Vasiliki; Motyka, Bruce; Medin, Jeffrey A.; Platt, Jeffrey L.

    2010-01-01

    Abstract The ABO histo-blood group system is the most important antigen system in transplantation medicine, yet no small animal model of the ABO system exists. To determine the feasibility of developing a murine model, we previously subcloned the human α-1,2-fucosyltransferase (H-transferase, EC 2.4.1.69) cDNA and the human α-1,3-N-acetylgalactosaminyltransferase (A-transferase, EC 2.4.1.40) cDNA into lentiviral vectors to study their ability to induce human histo-blood group A antigen expression on mouse cells. Herein we investigated the optimal conditions for human A and H antigen expression in murine cells. We determined that transduction of a bicistronic lentiviral vector (LvEF1-AH-trs) resulted in the expression of A antigen in a mouse endothelial cell line. We also studied the in vivo utility of this vector to induce human A antigen expression in mouse liver. After intrahepatic injection of LvEF1-AH-trs, A antigen expression was observed on hepatocytes as detected by immunohistochemistry and real-time RT-PCR. In human group A erythrocyte-sensitized mice, A antigen expression in the liver was associated with tissue damage, and deposition of antibody and complement. These results suggest that this gene transfer strategy can be used to simulate the human ABO blood group system in a murine model. This model will facilitate progress in the development of interventions for ABO-incompatible transplantation and transfusion scenarios, which are difficult to develop in clinical or large animal settings. PMID:20163247

  11. Cotton Leaf Curl Multan Betasatellite DNA as a Tool to Deliver and Express the Human B-Cell Lymphoma 2 (Bcl-2) Gene in Plants.

    PubMed

    Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar

    2016-05-01

    The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.

  12. [Non-viral gene therapy approach for regenerative recovery of skin wounds in mammals].

    PubMed

    Efremov, A M; Dukhovlinov, I V; Dizhe, E B; Burov, S V; Leko, M V; Akif'ev, B N; Mogilenko, D A; Ivanov, I A; Perevozchikov, A P; Orlov, S V

    2010-01-01

    The rate and character of skin tissue regeneration after wounds, burns and other traumas depend on the cell proliferation within damaged area. Acceleration of healing by stimulation of cell proliferation and extracellular matrix synthesis is one of the most important tasks of modern medicine. There are gene therapy approaches to wound treatment consisting in the transfer of genes encoding mitogenic growth factors to wound area. The most important step in the development of gene therapy approaches is the design of gene delivery tools. In spite of high efficacy of viral vectors, the non-viral means have some preferences (low toxicity, low immunogenity, safety and the absence of backside effects). Among non-viral gene delivery tools, molecular conjugates are the most popular because of their efficacy, simplicity, and the capacity to the targeted gene transfer. In the present work we have developed two molecular conjugates--NLS-TSF7 and NLS-TSF12 consisting of the modified signal of nuclear localization of T-antigen of SV40 virus (cationic part) and the peptide ligands of mammalian transferrin receptor (ligand part). These conjugates bind to plasmid DNA with formation of polyelectrolytic complexes and are capable to deliver plasmid DNA into cells expressing transferrin receptors by receptor-mediated endocytosis. Transfer of the expression vector of luciferase gene in the complex with molecular conjugate NLS-TSF7 to murine surface tissues led to about 100 fold increasing of luciferase activity in comparison with the transfer of free expression vector. Treatment of slash wounds in mice with the complexes of expression vector of synthetic human gene encoding insulin-like growth factor 1 with molecular conjugates NLS-TSF7 led to acceleration of healing in comparison with mice treated with free expression vector. The results obtained confirm the high efficiency of the developed regenerative gene therapy approach for the treatment of damaged skin tissues in mammals.

  13. Virus-Based RNA Silencing Agents and Virus-Derived Expression Vectors as Gene Therapy Vehicles.

    PubMed

    Venkataraman, Srividhya; Ahmad, Tauqeer; AbouHaidar, Mounir G; Hefferon, Kathleen L

    2017-01-01

    In consideration of recent developments in understanding the genomics and proteomics of viruses, the use of viral DNA / RNA sequences as well as their gene expression schemes, have found new in-roads towards the prognosis and therapy of diseases. Correspondingly, the sphere of the patenting scenario has expanded significantly. The current review addresses patented inventions concerning the use of virus sequences as gene silencing machineries and inventions concerning the generation and application of viral sequences as expression vectors. Furthermore, this review also discusses the employment of these patents for clinical, agricultural and biotechnological applications. Considering these objectives, the Delphion Research Intellectual Property Network database was searched using keywords such as "gene silencing", "engineered viruses" and "expression vectors" and descriptions of recent patents on the said topics were discussed. Despite several recent advances in the use of viruses as disease therapy vehicles and biotechnological vectors, these developments have yet to be proven effective in practice, in clinical and field trials. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  14. The establishment of Saccharomyces boulardii surface display system using a single expression vector.

    PubMed

    Wang, Tiantian; Sun, Hui; Zhang, Jie; Liu, Qing; Wang, Longjiang; Chen, Peipei; Wang, Fangkun; Li, Hongmei; Xiao, Yihong; Zhao, Xiaomin

    2014-03-01

    In the present study, an a-agglutinin-based Saccharomyces boulardii surface display system was successfully established using a single expression vector. Based on the two protein co-expression vector pSP-G1 built by Partow et al., a S. boulardii surface display vector-pSDSb containing all the display elements was constructed. The display results of heterologous proteins were confirmed by successfully displaying enhanced green fluorescent protein (EGFP) and chicken Eimeria tenella Microneme-2 proteins (EtMic2) on the S. boulardii cell surface. The DNA sequence of AGA1 gene from S. boulardii (SbAGA1) was determined and used as the cell wall anchor partner. This is the first time heterologous proteins have been displayed on the cell surface of S. boulardii. Because S. boulardii is probiotic and eukaryotic, its surface display system would be very valuable, particularly in the development of a live vaccine against various pathogenic organisms especially eukaryotic pathogens such as protistan parasites. Copyright © 2013 Elsevier Inc. All rights reserved.

  15. Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

    PubMed

    Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

    2010-08-01

    The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

  16. A recombinant fusion protein and DNA vaccines against foot-and-mouth disease virus type Asia 1 infection in guinea pigs.

    PubMed

    Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X

    2003-01-01

    On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.

  17. Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

    PubMed Central

    Throop, Andrea L.; LaBaer, Joshua

    2015-01-01

    The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

  18. Molecular cloning and expression in streptomyces lividans of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

    PubMed

    Malpartida, F; Zalacaín, M; Jiménez, A; Davies, J

    1983-11-30

    The gene encoding the phosphotransferase enzyme that modifies hygromycin B in its producing organism Streptomyces hygroscopicus, has been cloned in the Streptomyces vector pIJ41. Two plasmids, pFM4 and pFM6, containing 2.1 and 19.6 kb inserts of Streptomyces hygroscopicus DNA, respectively, which express the modifying enzyme, have been isolated. A 3.1 kb PstI restriction fragment from pFM4 was inserted in the Streptomyces vector pIJ350 and the resulting plasmids, pMZ11.1 and pMZ11.2, express the hygromycin B-resistance phenotype. The utility of this dominant marker for cloning experiments is discussed in the text.

  19. Cell-surface glycosaminoglycans inhibit intranuclear uptake but promote post-nuclear processes of polyamidoamine dendrimer-pDNA transfection.

    PubMed

    Ziraksaz, Zarrintaj; Nomani, Alireza; Ruponen, Marika; Soleimani, Masoud; Tabbakhian, Majid; Haririan, Ismaeil

    2013-01-23

    Interaction of cell-surface glycosaminoglycans (GAGs) with non-viral vectors seems to be an important factor which modifies the intracellular destination of the gene complexes. Intracellular kinetics of polyamidoamine (PAMAM) dendrimer as a non-viral vector in cellular uptake, intranuclear delivery and transgene expression of plasmid DNA with regard to the cell-surface GAGs has not been investigated until now. The physicochemical properties of the PAMAM-pDNA complexes were characterized by photon correlation spectroscopy, atomic force microscopy, zeta measurement and agarose gel electrophoresis. The transfection efficiency and toxicity of the complexes at different nitrogen to phosphate (N:P) ratios were determined using various in vitro cell models such as human embryonic kidney cells, chinese hamster ovary cells and its mutants lacking cell-surface GAGs or heparan sulphate proteoglycans (HSPGs). Cellular uptake, nuclear uptake and transfection efficiency of the complexes were determined using flow cytometry and optimized cell-nuclei isolation with quantitative real-time PCR and luciferase assay. Physicochemical studies showed that PAMAM dendrimer binds pDNA efficiently, forms small complexes with high positive zeta potential and transfects cells properly at N:P ratios around 5 and higher. The cytotoxicity could be a problem at N:Ps higher than 10. GAGs elimination caused nearly one order of magnitude higher pDNA nuclear uptake and more than 2.6-fold higher transfection efficiency than CHO parent cells. However, neither AUC of nuclear uptake, nor AUC of transfection affected significantly by only cell-surface HSPGs elimination and interesting data related to the effect of GAGs on intranuclear pDNA using PAMAM as delivery vector have been reported in this study. Presented data shows that the rate-limiting step of PAMAM-pDNA complexes transfection is located after delivery to the cell nucleus and GAGs are regarded as an inhibitor of the intranuclear delivery step, while slightly promotes transgene expression. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  1. Intramammary expression and therapeutic effect of a human lysozyme-expressing vector for treating bovine mastitis*

    PubMed Central

    Sun, Huai-Chang; Xue, Fang-Ming; Qian, Ke; Fang, Hao-Xia; Qiu, Hua-Lei; Zhang, Xin-Yu; Yin, Zhao-Hua

    2006-01-01

    To develop a gene therapy strategy for treating bovine mastitis, a new mammary-specific vector containing human lysozyme (hLYZ) cDNA and kanamycin resistance gene was constructed for intramammary expression and clinical studies. After one time acupuncture or intracisternal infusion of healthy cows with 400 μg of the p215C3LYZ vector, over 2.0 μg/ml of rhLYZ could be detected by enzymatic assay for about 3 weeks in the milk samples. Western blotting showed that rhLYZ secreted into milk samples from the vector-injected cows had molecular weight similar to that of the natural hLYZ in human colostrums. Twenty days after the primary injection, the quarters were re-injected with the same vector by quarter acupuncture and even higher concentrations of rhLYZ could be detected. Indirect competitive ELISA of milk samples showed that the vector injection did not induce detectable humoral immune response against hLYZ. Clinical studies showed that twice acupuncture of quarters with the p215C3LYZ vector had overt therapeutic effect on clinical and subclinical mastitis previously treated with antibiotics, including disappearance of clinical symptoms and relatively high microbiological cure rates. These data provide a solid rationale for using the vector to develop gene therapy for treating bovine mastitis. PMID:16532537

  2. Methods for transforming and expression screening of filamentous fungal cells with a DNA library

    DOEpatents

    Teter, Sarah; Lamsa, Michael; Cherry, Joel; Ward, Connie

    2015-06-02

    The present invention relates to methods for expression screening of filamentous fungal transformants, comprising: (a) isolating single colony transformants of a DNA library introduced into E. coli; (b) preparing DNA from each of the single colony E. coli transformants; (c) introducing a sample of each of the DNA preparations of step (b) into separate suspensions of protoplasts of a filamentous fungus to obtain transformants thereof, wherein each transformant contains one or more copies of an individual polynucleotide from the DNA library; (d) growing the individual filamentous fungal transformants of step (c) on selective growth medium, thereby permitting growth of the filamentous fungal transformants, while suppressing growth of untransformed filamentous fungi; and (e) measuring activity or a property of each polypeptide encoded by the individual polynucleotides. The present invention also relates to isolated polynucleotides encoding polypeptides of interest obtained by such methods, to nucleic acid constructs, expression vectors, and recombinant host cells comprising the isolated polynucleotides, and to methods of producing the polypeptides encoded by the isolated polynucleotides.

  3. Alphavirus replicon approach to promoterless analysis of IRES elements.

    PubMed

    Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

    2007-04-10

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

  4. Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

    PubMed Central

    Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

    2007-01-01

    Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

  5. Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system

    PubMed Central

    Kretschmer, Carola; Gruetzner, Ramona; Löfke, Christian; Dagdas, Yasin; Bürstenbinder, Katharina; Marillonnet, Sylvestre

    2018-01-01

    Standardized DNA assembly strategies facilitate the generation of multigene constructs from collections of building blocks in plant synthetic biology. A common syntax for hierarchical DNA assembly following the Golden Gate principle employing Type IIs restriction endonucleases was recently developed, and underlies the Modular Cloning and GoldenBraid systems. In these systems, transcriptional units and/or multigene constructs are assembled from libraries of standardized building blocks, also referred to as phytobricks, in several hierarchical levels and by iterative Golden Gate reactions. Here, a toolkit containing further modules for the novel DNA assembly standards was developed. Intended for use with Modular Cloning, most modules are also compatible with GoldenBraid. Firstly, a collection of approximately 80 additional phytobricks is provided, comprising e.g. modules for inducible expression systems, promoters or epitope tags. Furthermore, DNA modules were developed for connecting Modular Cloning and Gateway cloning, either for toggling between systems or for standardized Gateway destination vector assembly. Finally, first instances of a “peripheral infrastructure” around Modular Cloning are presented: While available toolkits are designed for the assembly of plant transformation constructs, vectors were created to also use coding sequence-containing phytobricks directly in yeast two hybrid interaction or bacterial infection assays. The presented material will further enhance versatility of hierarchical DNA assembly strategies. PMID:29847550

  6. Live attenuated rubella vectors expressing SIV and HIV vaccine antigens replicate and elicit durable immune responses in rhesus macaques

    PubMed Central

    2013-01-01

    Background Live attenuated viruses are among our most potent and effective vaccines. For human immunodeficiency virus, however, a live attenuated strain could present substantial safety concerns. We have used the live attenuated rubella vaccine strain RA27/3 as a vector to express SIV and HIV vaccine antigens because its safety and immunogenicity have been demonstrated in millions of children. One dose protects for life against rubella infection. In previous studies, rubella vectors replicated to high titers in cell culture while stably expressing SIV and HIV antigens. Their viability in vivo, however, as well as immunogenicity and antibody persistence, were unknown. Results This paper reports the first successful trial of rubella vectors in rhesus macaques, in combination with DNA vaccines in a prime and boost strategy. The vectors grew robustly in vivo, and the protein inserts were highly immunogenic. Antibody titers elicited by the SIV Gag vector were greater than or equal to those elicited by natural SIV infection. The antibodies were long lasting, and they were boosted by a second dose of replication-competent rubella vectors given six months later, indicating the induction of memory B cells. Conclusions Rubella vectors can serve as a vaccine platform for safe delivery and expression of SIV and HIV antigens. By presenting these antigens in the context of an acute infection, at a high level and for a prolonged duration, these vectors can stimulate a strong and persistent immune response, including maturation of memory B cells. Rhesus macaques will provide an ideal animal model for demonstrating immunogenicity of novel vectors and protection against SIV or SHIV challenge. PMID:24041113

  7. Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

    PubMed Central

    Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

    2004-01-01

    Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

  8. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  9. Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

    PubMed Central

    Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

    2000-01-01

    We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

  10. Strategies to optimize capsid protein expression and single-stranded DNA formation of adeno-associated virus in Saccharomyces cerevisiae.

    PubMed

    Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T

    2017-08-01

    Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.

  11. Enhanced p53 gene transfer to human ovarian cancer cells using the cationic nonviral vector, DDC.

    PubMed

    Kim, Chong-Kook; Choi, Eun-Jeong; Choi, Sung-Hee; Park, Jeong-Sook; Haider, Khawaja Hasnain; Ahn, Woong Shick

    2003-08-01

    Previously we have formulated a new cationic liposome, DDC, composed of dioleoyltrimethylamino propane (DOTAP), 1,2-dioeoyl-3-phosphophatidylethanolamine (DOPE), and cholesterol (Chol), and it efficiently delivered plasmid DNA into ovarian cancer cells. Mutations in the p53 tumor suppressor gene are the most common molecular genetic abnormalities to be described in ovarian cancer. However, there has been so far no report of nonviral vector-mediated p53 gene deliveries in ovarian cancer. In this study, wild-type p53 DNA was transfected into the ovarian cancer cells, using the DDC as a nonviral vector and the expression and activity of p53 gene were evaluated both in vitro and in vivo. DDC liposomes were prepared by mixing DOTAP:DOPE:Chol in a 1:0.7:0.3 molar ratio using the extrusion method. Plasmid DNA (pp53-EGFP) and DDC complexes were transfected into ovarian carcinoma cells (OVCAR-3 cells) and gene expression was determined by reverse transcription-polymerase chain reaction and Western blot analysis. The cellular growth inhibition and apoptosis of DDC-mediated p53 transfection were assessed by trypan blue exclusion assay and annexin-V staining, respectively. The OVCAR-3 cells treated with DDC/pp53-EGFP complexes were inoculated into female balb/c nude mice and tumor growth was observed. The transfection of liposome-complexed p53 gene resulted in a high level of wild-type p53 mRNA and protein expressions in OVCAR-3 cells. In vitro cell growth assay showed growth inhibition of cancer cells transfected with DDC/pp53-EGFP complexes compared with the control cells. The reestablishment of wild-type p53 function in ovarian cancer cells restored the apoptotic pathway. Following the inoculation of DDC/pp53-EGFP complexes, the volumes of tumors in nude mice were significantly reduced more than 60% compared to the control group. The DDC-mediated p53 DNA delivery may have the potential for clinical application as nonviral vector-mediated ovarian cancer therapy due to its effective induction of apoptosis and tumor growth inhibition.

  12. Enhanced immune response and protective efficacy of a Treponema pallidum Tp92 DNA vaccine vectored by chitosan nanoparticles and adjuvanted with IL-2.

    PubMed

    Zhao, Feijun; Wu, Yimou; Zhang, Xiaohong; Yu, Jian; Gu, Weiming; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wang, Shiping

    2011-10-01

    In this study, the immune-modulatory and protective efficacy of using an interleukin-2 (IL-2) expression plasmid as a genetic adjuvant and chitosan (CS) nanoparticles as vectors to enhance a Tp92 DNA vaccine candidate were investigated in a Treponema pallidum (Tp) rabbit challenge model. CS vectoring of pTp92 or pIL-2 were both demonstrated to augment anti-Tp92 antibody levels induced by pTp92 DNA vaccines. Interestingly, the combination of CS vectored Tp92 and pIL-2 led to the greatest enhancements of anti-Tp92 antibodies and T-cell proliferation (p < 0.05). At week 10 after the first immunization, 15 of the 18 rabbits in each group were challenged with Tp Nichols strain and monitored for skin lesions and ulcer lesions. Ratios of positive skin lesions and ratios of ulcer lesions in groups immunized with pTp92 were significantly lower than those of the empty vector or PBS groups (p < 0.05), demonstrating that pTp92 immunization elicited significant protective efficacy against the Tp Nichols strain challenge. CS vectored and pIL-2 adjuvanted pTp92 immunized animals exhibited the lowest rates of positive skin and ulcer lesions. Male New Zealand white rabbits were randomly assigned to groups (n = 18/group) and immunized intramuscularly with pTp92 based plasmid DNA constructs (100 μg of DNA/rabbit/immunization). Two weeks before Tp challenge (Week 8), three rabbits from each group were used to determine cytokine measurements and fifteen rabbits from each group were used for Tp challenge studies. Intramuscular injection of pTp92 induced strong humoral and cellular immune responses and conferred protection from Tp challenge in rabbits. The use of CS as a pTp92 vector or pIL-2 as an adjuvant achieved a superior level of protective efficacy against Tp challenge, however CS vectored, IL-2 adjuvanted pTp92 immunization conferred the highest level of protective efficacy.

  13. Extended Duration of Transgene Expression from Pegylated POD Nanoparticles Enables Attenuation of Photoreceptor Degeneration

    PubMed Central

    Binder, Christina; Cashman, Siobhan M.; Kumar-Singh, Rajendra

    2013-01-01

    Retinitis pigmentosa (RP) is the most genetically heterogeneous disorder known to cause blindness, involving over 50 different genes. Previously, we have described nanoparticles (NPs) 150 nm in size, comprised of a 3.5 kD peptide (POD) complexed to PEG and DNA (PEGPOD DNA). These NPs expressing GDNF enabled rescue of photoreceptor degeneration in mice up to 11 days post injection. In the current study we examine use of scaffold/ matrix attachment regions (S/MARs), CpG depletion and titration of DNA content of PEGPOD DNA NPs to extend the duration of transgene expression. S/MARs and CpGs did not significantly influence the duration of transgene expression, but did influence its stability. These parameters enabled us to extend transgene expression from 48 hours to 10 weeks. At 77 days post injection, we observed a 76% rescue of the thickness of the retinal outer nuclear layer (ONL) and at 37 days post injection we observed 53% and 55% rescue of the A and B wave ERG amplitudes respectively and 60% rescue of the ONL. Our studies suggest that PEGPOD DNA NPs have potential as gene delivery vectors for the retina. PMID:24278479

  14. Expression, purification, and DNA-binding activity of the solubilized NtrC protein of Herbaspirillum seropedicae.

    PubMed

    Twerdochlib, Adriana L; Chubatsu, Leda S; Souza, Emanuel M; Pedrosa, Fábio O; Steffens, M Berenice R; Yates, M Geoffrey; Rigo, Liu U

    2003-07-01

    NtrC is a bacterial enhancer-binding protein (EBP) that activates transcription by the sigma54 RNA polymerase holoenzyme. NtrC has a three domain structure typical of EBP family. In Herbaspirillum seropedicae, an endophytic diazotroph, NtrC regulates several operons involved in nitrogen assimilation, including glnAntrBC. In order to over-express and purify the NtrC protein, DNA fragments containing the complete structural gene for the whole protein, and for the N-terminal+Central and Central+C-terminal domains were cloned into expression vectors. The NtrC and NtrC(N-terminal+Central) proteins were over-expressed as His-tag fusion proteins upon IPTG addition, solubilized using N-lauryl-sarcosyl and purified by metal affinity chromatography. The over-expressed His-tag-NtrC(Central+C-terminal) fusion protein was partially soluble and was also purified by affinity chromatography. DNA band-shift assays showed that the NtrC protein and the Central+C-terminal domains bound specifically to the H. seropedicae glnA promoter region. The C-terminal domain is presumably necessary for DNA-protein interaction and DNA-binding does not require a phosphorylated protein.

  15. [Construction of plant expression plasmid of chimera SBR-CT delta A1].

    PubMed

    Mai, Sui; Ling, Junqi

    2003-08-01

    The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

  16. Joint capsule treatment with enkephalin-encoding HSV-1 recombinant vector reduces inflammatory damage and behavioural sequelae in rat CFA monoarthritis.

    PubMed

    Lu, Ying; McNearney, Terry A; Wilson, Steven P; Yeomans, David C; Westlund, Karin N

    2008-03-01

    This study assessed enkephalin expression induced by intra-articular application of recombinant, enkephalin-encoding herpes virus (HSV-1) and the impact of expression on nociceptive behaviours and synovial lining inflammation in arthritic rats. Replication-conditional HSV-1 recombinant vectors with cDNA encoding preproenkephalin (HSV-ENK), or control transgene beta-galactosidase cDNA (HSV-beta-gal; control) were injected into knee joints with complete Freund's adjuvant (CFA). Joint temperatures, circumferences and nociceptive behaviours were monitored on days 0, 7, 14 and 21 post CFA and vector treatments. Lumbar (L4-6) dorsal root ganglia (DRG) and spinal cords were immunostained for met-enkephalin (met-ENK), beta-gal, HSV-1 proteins and Fos. Joint tissues were immunostained for met-ENK, HSV-1 proteins, and inflammatory mediators Regulated on Activation, Normal T-cell Expressed and Secreted (RANTES) and cyclo-oxygenase-2, or stained with haematoxylin and eosin for histopathology. Compared to exuberant synovial hypertrophy and inflammatory cell infiltration seen in arthritic rats treated with CFA only or CFA and HSV-beta-gal, the CFA- and HSV-ENK-treated arthritic rats had: (i) striking preservation of synovial membrane cytoarchitecture with minimal inflammatory cell infiltrates; (ii) significantly improved nociceptive behavioural responses to mechanical and thermal stimuli; (iii) normalized Fos staining in lumbar dorsal horn; and (iv) significantly increased met-ENK staining in ipsilateral synovial tissue, lumbar DRG and spinal cord. The HSV-1 and transgene product expression were confined to ipsilateral lumbar DRG (HSV-1, met-ENK, beta-gal). Only transgene product (met-ENK and beta-gal) was seen in lumbar spinal cord sections. Targeted delivery of enkephalin-encoding HSV-1 vector generated safe, sustained opioid-induced analgesia with protective anti-inflammatory blunting in rat inflammatory arthritis.

  17. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

  18. Binding and condensation of plasmid DNA onto functionalized carbon nanotubes: toward the construction of nanotube-based gene delivery vectors.

    PubMed

    Singh, Ravi; Pantarotto, Davide; McCarthy, David; Chaloin, Olivier; Hoebeke, Johan; Partidos, Charalambos D; Briand, Jean-Paul; Prato, Maurizio; Bianco, Alberto; Kostarelos, Kostas

    2005-03-30

    Carbon nanotubes (CNTs) constitute a class of nanomaterials that possess characteristics suitable for a variety of possible applications. Their compatibility with aqueous environments has been made possible by the chemical functionalization of their surface, allowing for exploration of their interactions with biological components including mammalian cells. Functionalized CNTs (f-CNTs) are being intensively explored in advanced biotechnological applications ranging from molecular biosensors to cellular growth substrates. We have been exploring the potential of f-CNTs as delivery vehicles of biologically active molecules in view of possible biomedical applications, including vaccination and gene delivery. Recently we reported the capability of ammonium-functionalized single-walled CNTs to penetrate human and murine cells and facilitate the delivery of plasmid DNA leading to expression of marker genes. To optimize f-CNTs as gene delivery vehicles, it is essential to characterize their interactions with DNA. In the present report, we study the interactions of three types of f-CNTs, ammonium-functionalized single-walled and multiwalled carbon nanotubes (SWNT-NH3+; MWNT-NH3+), and lysine-functionalized single-walled carbon nanotubes (SWNT-Lys-NH3+), with plasmid DNA. Nanotube-DNA complexes were analyzed by scanning electron microscopy, surface plasmon resonance, PicoGreen dye exclusion, and agarose gel shift assay. The results indicate that all three types of cationic carbon nanotubes are able to condense DNA to varying degrees, indicating that both nanotube surface area and charge density are critical parameters that determine the interaction and electrostatic complex formation between f-CNTs with DNA. All three different f-CNT types in this study exhibited upregulation of marker gene expression over naked DNA using a mammalian (human) cell line. Differences in the levels of gene expression were correlated with the structural and biophysical data obtained for the f-CNT:DNA complexes to suggest that large surface area leading to very efficient DNA condensation is not necessary for effective gene transfer. However, it will require further investigation to determine whether the degree of binding and tight association between DNA and nanotubes is a desirable trait to increase gene expression efficiency in vitro or in vivo. This study constitutes the first thorough investigation into the physicochemical interactions between cationic functionalized carbon nanotubes and DNA toward construction of carbon nanotube-based gene transfer vector systems.

  19. Transformation of Sordaria macrospora to hygromycin B resistance: characterization of transformants by electrophoretic karyotyping and tetrad analysis.

    PubMed

    Walz, M; Kück, U

    1995-12-01

    The ascomycete Sordaria macrospora was transformed using different plasmid molecules containing the bacterial hygromycin B resistance gene (hph) under the control of different expression signals. The highest transformation frequency was obtained with vector pMW1. On this plasmid molecule, expression of the hph gene is directed by the upstream region of the isopenicillin N synthetase gene (pcbC) from the deuteromycete Acremonium chrysogenum. Southern analysis suggests that the vector copies are integrated as tandem repeats into the S. macrospora chromosomes and that duplicated sequences are most probably not inactivated by methylation during meiosis. Furthermore, the hygromycin B resistance (hygR) is not correlated with the number of integrated vector molecules. Electrophoretic karyotyping was used to further characterize S. macrospora transformants. Five chromosomal bands were separated by pulsed-field gel electrophoresis (PFGE) representing seven chromosomes with a total genome size of 39.5Mb. Hybridization analysis revealed ectopic integration of vector DNA into different chromosomes. In a few transformants, major rearrangements were detected. Transformants were sexually propagated to analyze the fate of the heterologous vector DNA. Although the hygR phenotype is stably maintained during mitosis, about a third of all lines tested showed loss of the resistance marker gene after meiosis. However, as was concluded from electrophoretic karyotyping, the resistant spores showed a Mendelian segregation of the integrated vector molecules in at least three consecutive generations. Our data indicate that heterologous marker genes can be used for transformation tagging, or the molecular mapping of chromosomal loci in S. macrospora.

  20. Decreased hepatocyte membrane potential differences and GABAA-beta3 expression in human hepatocellular carcinoma.

    PubMed

    Minuk, Gerald Y; Zhang, Manna; Gong, Yuewen; Minuk, Leonard; Dienes, Hans; Pettigrew, Norman; Kew, Michael; Lipschitz, Jeremy; Sun, Dongfeng

    2007-03-01

    To determine whether hepatocyte membrane potential differences (PDs) are depolarized in human HCC and whether depolarization is associated with changes in GABAA receptor expression, hepatocyte PDs and gamma-aminobutyric acid (GABA)A receptor messenger RNA (mRNA) and protein expression were documented in HCC tissues via microelectrode impalement, real-time reverse-transcriptase polymerase chain reaction, and Western blot analysis, respectively. HCC tissues were significantly depolarized (-19.8+/-1.3 versus -25.9+/-3.2 mV, respectively [P<0.05]), and GABAA-beta3 expression was down-regulated (GABAA-beta3 mRNA and protein expression in HCC; 5,693+/-1,385 and 0.29+/-0.11 versus 11,046+/-4,979 copies/100 mg RNA and 0.62+/-0.16 optical density in adjacent tumor tissues, respectively [P=0.002 and P<0.0001, respectively]) when compared with adjacent nontumor tissues. To determine the physiological relevance of the down-regulation, human malignant hepatocytes deficient in GABAA-beta3 receptor expression (Huh-7 cells) were transfected with GABAA-beta3 complementary DNA (cDNA) or vector alone and injected into nu/nu nude mice (n=16-17 group). Tumors developed after a mean (+/-SD) of 51+/-6 days (range: 41-60 days) in 7/16 (44%) mice injected with vector-transfected cells and 70+/-12 days (range: 59-86 days) in 4/17 (24%) mice injected with GABAA-beta3 cDNA-transfected cells (P<0.005). The results of this study indicate that (1) human HCC tissues are depolarized compared with adjacent nontumor tissues, (2) hepatic GABAA-beta3 receptor expression is down-regulated in human HCC, and (3) restoration of GABAA-beta3 receptor expression results in attenuated in vivo tumor growth in nude mice.

  1. DNA modification and functional delivery into human cells using Escherichia coli DH10B

    PubMed Central

    Narayanan, Kumaran; Warburton, Peter E.

    2003-01-01

    The availability of almost the complete human genome as cloned BAC libraries represents a valuable resource for functional genomic analysis, which, however, has been somewhat limited by the ability to modify and transfer this DNA into mammalian cells intact. Here we report a novel comprehensive Escherichia coli-based vector system for the modification, propagation and delivery of large human genomic BAC clones into mammalian cells. The GET recombination inducible homologous recombination system was used in the BAC host strain E.coli DH10B to precisely insert an EGFPneo cassette into the vector portion of a ∼200 kb human BAC clone, providing a relatively simple method to directly convert available BAC clones into suitable vectors for mammalian cells. GET recombination was also used for the targeted deletion of the asd gene from the E.coli chromosome, resulting in defective cell wall synthesis and diaminopimelic acid auxotrophy. Transfer of the Yersinia pseudotuberculosis invasin gene into E.coli DH10B asd– rendered it competent to invade HeLa cells and deliver DNA, as judged by transient expression of green fluorescent protein and stable neomycin-resistant colonies. The efficiency of DNA transfer and survival of HeLa cells has been optimized for incubation time and multiplicity of infection of invasive E.coli with HeLa cells. This combination of E.coli-based homologous recombination and invasion technologies using BAC host strain E.coli DH10B will greatly improve the utility of the available BAC libraries from the human and other genomes for gene expression and functional genomic studies. PMID:12711696

  2. A novel two T-DNA binary vector allows efficient generation of marker-free transgenic plants in three elite cultivars of rice (Oryza sativa L.).

    PubMed

    Breitler, Jean-Christophe; Meynard, Donaldo; Van Boxtel, Jos; Royer, Monique; Bonnot, François; Cambillau, Laurence; Guiderdoni, Emmanuel

    2004-06-01

    A pilot binary vector was constructed to assess the potential of the 2 T-DNA system for generating selectable marker-free progeny plants in three elite rice cultivars (ZhongZuo321, Ariete and Khao Dawk Mali 105) known to exhibit contrasting amenabilities to transformation. The first T-DNA of the vector, delimited by Agrobacterium tumefaciens borders, contains the hygromycin phosphotransferase (hpt) selectable gene and the green fluorescent protein (gfp) reporter gene while the second T-DNA, delimited by Agrobacterium rhizogenes borders, bears the phosphinothricin acetyl transferase (bar) gene, featuring the gene of interest. 82-90% of the hygromycin-resistant primary transformants exhibited tolerance to ammonium glufosinate mediated by the bar gene suggesting very high co-transformation frequency in the three cultivars. All of the regenerated plants were analyzed by Southern blot which confirmed co-integration of the T-DNAs at frequencies consistent with those of co-expression and allowed determination of copy number for each gene as well as detection of two different vector backbone fragments extending between the two T-DNAs. Hygromycin susceptible, ammonium glufosinate tolerant phenotypes represented 14.4, 17.4 and 14.3% of the plants in T1 progenies of ZZ321, Ariete and KDML105 primary transformants, respectively. We developed a statistical model for deducing from the observed copy number of each T-DNA in T0 plants and phenotypic segregations in T1 progenies the most likely constitution and linkage of the T-DNA integration locus. Statistical analysis identified in 40 out of 42 lines a most likely linkage configuration theoretically allowing genetic separation of the two T-DNA types and out segregation of the T-DNA bearing the bar gene. Overall, though improvements of the technology would be beneficial, the 2 T-DNA system appeared to be a useful approach to generate selectable marker-free rice plants with a consistent frequency among cultivars.

  3. Role of WDHD1 in Human Papillomavirus-Mediated Oncogenesis Identified by Transcriptional Profiling of E7-Expressing Cells

    PubMed Central

    Zhou, Yunying; Zhang, Qishu; Gao, Ge; Zhang, Xiaoli; Liu, Yafei; Yuan, Shoudao

    2016-01-01

    ABSTRACT The E7 oncoprotein of the high-risk human papillomavirus (HPV) plays a major role in HPV-induced carcinogenesis. E7 abrogates the G1 cell cycle checkpoint and induces genomic instability, but the mechanism is not fully understood. In this study, we performed RNA sequencing (RNA-seq) to characterize the transcriptional profile of keratinocytes expressing HPV 16 (HPV-16) E7. At the transcriptome level, 236 genes were differentially expressed between E7 and vector control cells. A subset of the differentially expressed genes, most of them novel to E7-expressing cells, was further confirmed by real-time PCR. Of interest, the activities of multiple transcription factors were altered in E7-expressing cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were investigated. The upregulated genes were enriched in cell cycle and DNA replication, as well as in the DNA metabolic process, transcription, DNA damage, DNA repair, and nucleotide metabolism. Specifically, we focused our studies on the gene encoding WDHD1 (WD repeat and high mobility group [HMG]-box DNA-binding protein), one of the genes that was upregulated in E7-expressing cells. WDHD1 is a component of the replisome that regulates DNA replication. Recent studies suggest that WDHD1 may also function as a DNA replication initiation factor as well as a G1 checkpoint regulator. We found that in E7-expressing cells, the steady-state level of WDHD1 protein was increased along with the half-life. Moreover, downregulation of WDHD1 reduced E7-induced G1 checkpoint abrogation and rereplication, demonstrating a novel function for WDHD1. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. IMPORTANCE The high-risk HPV types induce cervical cancer and encode an E7 oncoprotein that plays a major role in HPV-induced carcinogenesis. However, the mechanism by which E7 induces carcinogenesis is not fully understood; specific anti-HPV agents are not available. In this study, we performed RNA-seq to characterize transcriptional profiling of keratinocytes expressing HPV-16 E7 and identified more than 200 genes that were differentially expressed between E7 and vector control cells. Through bioinformatics analysis, pathways altered in E7-expressing cells were identified. Significantly, the WDHD1 gene, one of the genes that is upregulated in E7-expressing cells, was found to play an important role in E7-induced G1 checkpoint abrogation and rereplication. These studies shed light on mechanisms by which HPV induces genomic instability and have therapeutic implications. PMID:27099318

  4. Role of cellular FKBP52 protein in intracellular trafficking of recombinant adeno-associated virus 2 vectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao Weihong; Wu Jianqing; Zhong Li

    2006-09-30

    We have reported that tyrosine-phosphorylated forms of a cellular protein, FKBP52, inhibit the second-strand DNA synthesis of adeno-associated virus 2 (AAV), leading to inefficient transgene expression from recombinant AAV vectors. To further explore the role of FKBP52 in AAV-mediated transduction, we established murine embryo fibroblasts (MEFs) cultures from FKBP52 wild-type (WT), heterozygous (HE), and knockout (KO) mice. Conventional AAV vectors failed to transduce WT MEFs efficiently, and the transduction efficiency was not significantly increased in HE or KO MEFs. AAV vectors failed to traffic efficiently to the nucleus in these cells. Treatment with hydroxyurea (HU) increased the transduction efficiency ofmore » conventional AAV vectors by {approx}25-fold in WT MEFs, but only by {approx}4-fold in KO MEFs. The use of self-complementary AAV (scAAV) vectors, which bypass the requirement of viral second-strand DNA synthesis, revealed that HU treatment increased the transduction efficiency {approx}23-fold in WT MEFs, but only {approx}4-fold in KO MEFs, indicating that the lack of HU treatment-mediated increase in KO MEFs was not due to failure of AAV to undergo viral second-strand DNA synthesis. Following HU treatment, {approx}59% of AAV genomes were present in the nuclear fraction from WT MEFs, but only {approx}28% in KO MEFs, indicating that the pathway by which HU treatment mediates nuclear transport of AAV was impaired in KO MEFs. When KO MEFs were stably transfected with an FKBP52 expression plasmid, HU treatment-mediated increase in the transduction efficiency was restored in these cells, which correlated directly with improved intracellular trafficking. Intact AAV particles were also shown to interact with FKBP52 as well as with dynein, a known cellular protein involved in AAV trafficking. These studies suggest that FKBP52, being a cellular chaperone protein, facilitates intracellular trafficking of AAV, which has implications in the optimal use of recombinant AAV vectors in human gene therapy.« less

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koener, J.F.; Leong, J.A.C.

    A cDNA fragment containing the gene encoding the glycoprotein of infectious hematopoietic necrosis virus was inserted into Autographa californica baculovirus vectors under the control of the polyhedrin promoter. A 66-kilodalton protein, identical in size to the glycosylated glycoprotein of infectious hematopoietic necrosis virus, was expressed at high levels in Spodoptera frugiperda cells infected with the recombinant viruses. The expressed protein reacted with antiserum to the glycoprotein on Western blots.

  6. A rapid and efficient branched DNA hybridization assay to titer lentiviral vectors.

    PubMed

    Nair, Ayyappan; Xie, Jinger; Joshi, Sarasijam; Harden, Paul; Davies, Joan; Hermiston, Terry

    2008-11-01

    A robust assay to titer lentiviral vectors is imperative to qualifying their use in drug discovery, target validation and clinical applications. In this study, a novel branched DNA based hybridization assay was developed to titer lentiviral vectors by quantifying viral RNA genome copy numbers from viral lysates without having to purify viral RNA, and this approach was compared with other non-functional (p24 protein ELISA and viral RT-qPCR) and a functional method (reporter gene expression) used commonly. The RT-qPCR method requires purification of viral RNA and the accuracy of titration therefore depends on the efficiency of purification; this requirement is ameliorated in the hybridization assay as RNA is measured directly in viral lysates. The present study indicates that the hybridization based titration assay performed on viral lysates was more accurate and has additional advantages of being rapid, robust and not dependent on transduction efficiency in different cell types.

  7. Identification of Prostate Cancer-Specific microDNAs

    DTIC Science & Technology

    2014-12-01

    displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

  8. Solid-phase-assisted synthesis of targeting peptide-PEG-oligo(ethane amino)amides for receptor-mediated gene delivery.

    PubMed

    Martin, Irene; Dohmen, Christian; Mas-Moruno, Carlos; Troiber, Christina; Kos, Petra; Schaffert, David; Lächelt, Ulrich; Teixidó, Meritxell; Günther, Michael; Kessler, Horst; Giralt, Ernest; Wagner, Ernst

    2012-04-28

    In the forthcoming era of cancer gene therapy, efforts will be devoted to the development of new efficient and non-toxic gene delivery vectors. In this regard, the use of Fmoc/Boc-protected oligo(ethane amino)acids as building blocks for solid-phase-supported assembly represents a novel promising approach towards fully controlled syntheses of effective gene vectors. Here we report on the synthesis of defined polymers containing the following: (i) a plasmid DNA (pDNA) binding domain of eight succinoyl-tetraethylenpentamine (Stp) units and two terminal cysteine residues; (ii) a central polyethylene glycol (PEG) chain (with twenty-four oxyethylene units) for shielding; and (iii) specific peptides for targeting towards cancer cells. Peptides B6 and c(RGDfK), which bind transferrin receptor and α(v)β(3) integrin, respectively, were chosen because of the high expression of these receptors in many tumoral cells. This study shows the feasibility of designing these kinds of fully controlled vectors and their success for targeted pDNA-based gene transfer. This journal is © The Royal Society of Chemistry 2012

  9. Expression of the genetic suppressor element 24.2 (GSE24.2) decreases DNA damage and oxidative stress in X-linked dyskeratosis congenita cells.

    PubMed

    Manguan-Garcia, Cristina; Pintado-Berninches, Laura; Carrillo, Jaime; Machado-Pinilla, Rosario; Sastre, Leandro; Pérez-Quilis, Carme; Esmoris, Isabel; Gimeno, Amparo; García-Giménez, Jose Luis; Pallardó, Federico V; Perona, Rosario

    2014-01-01

    The predominant X-linked form of Dyskeratosis congenita results from mutations in DKC1, which encodes dyskerin, a protein required for ribosomal RNA modification that is also a component of the telomerase complex. We have previously found that expression of an internal fragment of dyskerin (GSE24.2) rescues telomerase activity in X-linked dyskeratosis congenita (X-DC) patient cells. Here we have found that an increased basal and induced DNA damage response occurred in X-DC cells in comparison with normal cells. DNA damage that is also localized in telomeres results in increased heterochromatin formation and senescence. Expression of a cDNA coding for GSE24.2 rescues both global and telomeric DNA damage. Furthermore, transfection of bacterial purified or a chemically synthesized GSE24.2 peptide is able to rescue basal DNA damage in X-DC cells. We have also observed an increase in oxidative stress in X-DC cells and expression of GSE24.2 was able to diminish it. Altogether our data indicated that supplying GSE24.2, either from a cDNA vector or as a peptide reduces the pathogenic effects of Dkc1 mutations and suggests a novel therapeutic approach.

  10. Expressing Transgenes That Exceed the Packaging Capacity of Adeno-Associated Virus Capsids

    PubMed Central

    Chamberlain, Kyle; Riyad, Jalish Mahmud; Weber, Thomas

    2016-01-01

    Recombinant adeno-associated virus vectors (rAAV) are being explored as gene delivery vehicles for the treatment of various inherited and acquired disorders. rAAVs are attractive vectors for several reasons: wild-type AAVs are nonpathogenic, and rAAVs can trigger long-term transgene expression even in the absence of genome integration—at least in postmitotic tissues. Moreover, rAAVs have a low immunogenic profile, and the various AAV serotypes and variants display broad but distinct tropisms. One limitation of rAAVs is that their genome-packaging capacity is only ∼5 kb. For most applications this is not of major concern because the median human protein size is 375 amino acids. Excluding the ITRs, for a protein of typical length, this allows the incorporation of ∼3.5 kb of DNA for the promoter, polyadenylation sequence, and other regulatory elements into a single AAV vector. Nonetheless, for certain diseases the packaging limit of AAV does not allow the delivery of a full-length therapeutic protein by a single AAV vector. Hence, approaches to overcome this limitation have become an important area of research for AAV gene therapy. Among the most promising approaches to overcome the limitation imposed by the packaging capacity of AAV is the use of dual-vector approaches, whereby a transgene is split across two separate AAV vectors. Coinfection of a cell with these two rAAVs will then—through a variety of mechanisms—result in the transcription of an assembled mRNA that could not be encoded by a single AAV vector because of the DNA packaging limits of AAV. The main purpose of this review is to assess the current literature with respect to dual-AAV-vector design, to highlight the effectiveness of the different methodologies and to briefly discuss future areas of research to improve the efficiency of dual-AAV-vector transduction. PMID:26757051

  11. Novel strategies to construct complex synthetic vectors to produce DNA molecular weight standards.

    PubMed

    Chen, Zhe; Wu, Jianbing; Li, Xiaojuan; Ye, Chunjiang; Wenxing, He

    2009-05-01

    DNA molecular weight standards (DNA markers, nucleic acid ladders) are commonly used in molecular biology laboratories as references to estimate the size of various DNA samples in electrophoresis process. One method of DNA marker production is digestion of synthetic vectors harboring multiple DNA fragments of known sizes by restriction enzymes. In this article, we described three novel strategies-sequential DNA fragment ligation, screening of ligation products by polymerase chain reaction (PCR) with end primers, and "small fragment accumulation"-for constructing complex synthetic vectors and minimizing the mass differences between DNA fragments produced from restrictive digestion of synthetic vectors. The strategy could be applied to construct various complex synthetic vectors to produce any type of low-range DNA markers, usually available commercially. In addition, the strategy is useful for single-step ligation of multiple DNA fragments for construction of complex synthetic vectors and other applications in molecular biology field.

  12. Large inserts for big data: artificial chromosomes in the genomic era.

    PubMed

    Tocchetti, Arianna; Donadio, Stefano; Sosio, Margherita

    2018-05-01

    The exponential increase in available microbial genome sequences coupled with predictive bioinformatic tools is underscoring the genetic capacity of bacteria to produce an unexpected large number of specialized bioactive compounds. Since most of the biosynthetic gene clusters (BGCs) present in microbial genomes are cryptic, i.e. not expressed under laboratory conditions, a variety of cloning systems and vectors have been devised to harbor DNA fragments large enough to carry entire BGCs and to allow their transfer in suitable heterologous hosts. This minireview provides an overview of the vectors and approaches that have been developed for cloning large BGCs, and successful examples of heterologous expression.

  13. GFP is Efficiently Expressed by Wheat Streak Mosaic Virus Using a Range of Tritimovirus NIa Cleavage Sites and Forms Dense Aggregates in Cereal Hosts

    USDA-ARS?s Scientific Manuscript database

    Wheat streak mosaic virus (WSMV)-based transient expression vector was developed to express GFP as a marker protein. The GFP cistron was engineered between the P1 and HC-Pro cistrons in an infectious cDNA clone of WSMV. The cleavage sites, P3/6KI, 6KI/CI, NIa/NIb, or NIb/CP, from WSMV were fused to ...

  14. Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

    DTIC Science & Technology

    1986-11-26

    cloning at the SalI site of pUCI8 vector DNA, iii) by treatment with EcoRl DNA methylase, ligation to EcoRI and cloning at the EcoRl site of pUCI8...cDNA to synthetic Sail linker 10 2.3.10 Treatment of DEN-2 cDNA with EcoRi methylase, followed 10 by ligation to EcoRI linkers and digestion with...picked by the mini plasmid preparation method as described in Maniatis et al. (1982). The procedure followed involved briefly treatment with a

  15. [Overexpression of SEPP1 inhibits the proliferation and induces cell cycle G2/M arrest of 786-O and 769-P human renal carcinoma cells].

    PubMed

    Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu

    2016-06-01

    Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.

  16. Safeguarding Stem Cell-Based Regenerative Therapy against Iatrogenic Cancerogenesis: Transgenic Expression of DNASE1, DNASE1L3, DNASE2, DFFB Controlled By POLA1 Promoter in Proliferating and Directed Differentiation Resisting Human Autologous Pluripotent Induced Stem Cells Leads to their Death

    PubMed Central

    Malecki, Marek; LaVanne, Christine; Alhambra, Dominique; Dodivenaka, Chaitanya; Nagel, Sarah; Malecki, Raf

    2014-01-01

    Introduction The worst possible complication of using stem cells for regenerative therapy is iatrogenic cancerogenesis. The ultimate goal of our work is to develop a self-triggering feedback mechanism aimed at causing death of all stem cells, which resist directed differentiation, keep proliferating, and can grow into tumors. Specific aim The specific aim was threefold: (1) to genetically engineer the DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter; (2) to bioengineer anti-SSEA-4 antibody guided vectors delivering transgenes to human undifferentiated and proliferating pluripotent stem cells; (3) to cause death of proliferating and directed differentiation resisting stem cells by transgenic expression of the human recombinant the DNases (hrDNases). Methods The DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter were genetically engineered. The vectors targeting specifically SSEA-4 expressing stem cells were bioengineered. The healthy volunteers’ bone marrow mononuclear cells (BMMCs) were induced into human, autologous, pluripotent stem cells with non-integrating plasmids. Directed differentiation of the induced stem cells into endothelial cells was accomplished with EGF and BMP. The anti-SSEA 4 antibodies’ guided DNA vectors delivered the transgenes for the human recombinant DNases’ into proliferating stem cells. Results Differentiation of the pluripotent induced stem cells into the endothelial cells was verified by highlighting formation of tight and adherens junctions through transgenic expression of recombinant fluorescent fusion proteins: VE cadherin, claudin, zona occludens 1, and catenin. Proliferation of the stem cells was determined through highlighting transgenic expression of recombinant fluorescent proteins controlled by POLA promoter, while also reporting expression of the transgenes for the hrDNases. Expression of the transgenes for the DNases resulted in complete collapse of the chromatin architecture and degradation of the proliferating cells’ genomic DNA. The proliferating stem cells, but not the differentiating ones, were effectively induced to die. Conclusion Herein, we describe attaining the proof-of-concept for the strategy, whereby transgenic expression of the genetically engineered human recombinant DNases in proliferating and directed differentiation resisting stem cells leads to their death. This novel strategy reduces the risk of iatrogenic neoplasms in stem cell therapy. PMID:25045589

  17. Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

    PubMed

    Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

    2017-01-01

    Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

  18. Dendrimers as Carriers for siRNA Delivery and Gene Silencing: A Review

    PubMed Central

    Huang, Weizhe; He, Ziying

    2013-01-01

    RNA interference (RNAi) was first literaturally reported in 1998 and has become rapidly a promising tool for therapeutic applications in gene therapy. In a typical RNAi process, small interfering RNAs (siRNA) are used to specifically downregulate the expression of the targeted gene, known as the term “gene silencing.” One key point for successful gene silencing is to employ a safe and efficient siRNA delivery system. In this context, dendrimers are emerging as potential nonviral vectors to deliver siRNA for RNAi purpose. Dendrimers have attracted intense interest since their emanating research in the 1980s and are extensively studied as efficient DNA delivery vectors in gene transfer applications, due to their unique features based on the well-defined and multivalent structures. Knowing that DNA and RNA possess a similar structure in terms of nucleic acid framework and the electronegative nature, one can also use the excellent DNA delivery properties of dendrimers to develop effective siRNA delivery systems. In this review, the development of dendrimer-based siRNA delivery vectors is summarized, focusing on the vector features (siRNA delivery efficiency, cytotoxicity, etc.) of different types of dendrimers and the related investigations on structure-activity relationship to promote safe and efficient siRNA delivery system. PMID:24288498

  19. Sequential cloning of chromosomes

    DOEpatents

    Lacks, Sanford A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

  20. Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

    PubMed

    Crosby, Catherine M; Barry, Michael A

    2017-02-18

    Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

  1. Assignment of chromosomal locus and evidence for alternatively spliced mRNAs of a human sperm membrane protein (hSMP-1).

    PubMed

    Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S

    1999-10-06

    The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.

  2. K-RAS(V12) Induces Autocrine Production of EGFR Ligands and Mediates Radioresistance Through EGFR-Dependent Akt Signaling and Activation of DNA-PKcs

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Minjgee, Minjmaa; Toulany, Mahmoud; Kehlbach, Rainer

    2011-12-01

    Purpose: It is known that postirradiation survival of tumor cells presenting mutated K-RAS is mediated through autocrine activation of epidermal growth factor receptor (EGFR). In this study the molecular mechanism of radioresistance of cells overexpressing mutated K-RAS(V12) was investigated. Methods and Materials: Head-and-neck cancer cells (FaDu) presenting wild-type K-RAS were transfected with empty vector or vector expressing mutated K-RAS(V12). The effect of K-RAS(V12) on autocrine production of EGFR ligands, activation of EGFR downstream pathways, DNA damage repair, and postirradiation survival was analyzed. Results: Conditioned medium collected from K-RAS(V12)-transfected cells enhanced activation of the phosphatidylinositol-3-kinase-Akt pathway and increased postirradiation survival ofmore » wild-type K-RAS parental cells when compared with controls. These effects were reversed by amphiregulin (AREG)-neutralizing antibody. In addition, secretion of the EGFR ligands AREG and transforming growth factor {alpha} was significantly increased upon overexpression of K-RAS(V12). Expression of mutated K-RAS(V12) resulted in an increase in radiation-induced DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation at S2056. This increase was accompanied by increased repair of DNA double-strand breaks. Abrogation of DNA-PKcs phosphorylation by serum depletion or AREG-neutralizing antibody underscored the role of autocrine production of EGFR ligands, namely, AREG, in regulating DNA-PKcs activation in K-RAS mutated cells. Conclusions: These data indicate that radioresistance of K-RAS mutated tumor cells is at least in part due to constitutive production of EGFR ligands, which mediate enhanced repair of DNA double-strand breaks through the EGFR-phosphatidylinositol-3-kinase-Akt cascade.« less

  3. Comparative analysis of lentiviral vectors and modular protein nanovectors for traumatic brain injury gene therapy

    PubMed Central

    Negro-Demontel, María Luciana; Saccardo, Paolo; Giacomini, Cecilia; Yáñez-Muñoz, Rafael Joaquín; Ferrer-Miralles, Neus; Vazquez, Esther; Villaverde, Antonio; Peluffo, Hugo

    2014-01-01

    Traumatic brain injury (TBI) remains as one of the leading causes of mortality and morbidity worldwide and there are no effective treatments currently available. Gene therapy applications have emerged as important alternatives for the treatment of diverse nervous system injuries. New strategies are evolving with the notion that each particular pathological condition may require a specific vector. Moreover, the lack of detailed comparative studies between different vectors under similar conditions hampers the selection of an ideal vector for a given pathological condition. The potential use of lentiviral vectors versus several modular protein-based nanovectors was compared using a controlled cortical impact model of TBI under the same gene therapy conditions. We show that variables such as protein/DNA ratio, incubation volume, and presence of serum or chloroquine in the transfection medium impact on both nanovector formation and transfection efficiency in vitro. While lentiviral vectors showed GFP protein 1 day after TBI and increased expression at 14 days, nanovectors showed stable and lower GFP transgene expression from 1 to 14 days. No toxicity after TBI by any of the vectors was observed as determined by resulting levels of IL-1β or using neurological sticky tape test. In fact, both vector types induced functional improvement per se. PMID:26015985

  4. Transcriptional enhancer from milk protein genes

    DOEpatents

    Casperson, Gerald F.; Schmidhauser, Christian T.; Bissell, Mina J.

    1999-01-01

    The invention relates to novel enhancer nucleotide sequences which stimulate transcription of heterologous DNA in cells in culture. The enhancers are derived from major milk protein genes by the process of deletion mapping and functional analysis. The invention also relates to expression vectors containing the novel enhancers.

  5. Problem-Solving Test: The Role of Ubiquitination in Epidermal Growth Factor Receptor Trafficking

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2012-01-01

    Terms to be familiar with before you start to solve the test: growth factor signaling, epidermal growth factor, tyrosine protein kinase, tyrosine phosphorylation, ubiquitin, monoubiquitination, polyubiquitination, site-directed mutagenesis, transfection, expression vector, cDNA, immunoprecipitation, SDS-polyacrylamide gel electrophoresis, Western…

  6. [Transformation of antimicrobial peptide fusion gene of cecropin B and rabbit NP-1 to Houttuynia cordata].

    PubMed

    Dong, Yan; Zhang, Ying; Yi, Lang; Lai, Huili; Zhang, Yaming; Zhou, Lian; Wang, Peixun

    2010-07-01

    To transform the antimicrobial peptide fusion gene of cecropin B and rabbit NP-1(CN) into Houttuynia cordata to improve its antimicrobic capability. The fusion gene of CN designed and synthesized artificially was recombined with expression vector pBI121. The recombined vector was transformed to Agrobacterium tumefaciens LBA4404, by which CN gene was transformed to the explants of H. cordata. The transgenic regeneration plantlets were selected by kanamycin and rapid screening PCR. The transgenic plants were identified by PCR-Southern of genomic DNA and RT-PCR. The disease resistances were detected by antibacterial zone trail of leaf extracts to E. coli K12 and infection by Rhizoctonia solani. Gene of interesting CN was inserted into genomic DNA and expressed in transformed H, cordata, whose resistance to E. coli K12 and Rh. solani was stronger than that of the non-transformed control. The fusion gene CN can improve antimicrobic capability of transformed H. cordata.

  7. Nuclear targeting of viral and non-viral DNA.

    PubMed

    Chowdhury, E H

    2009-07-01

    The nuclear envelope presents a major barrier to transgene delivery and expression using a non-viral vector. Virus is capable of overcoming the barrier to deliver their genetic materials efficiently into the nucleus by virtue of the specialized protein components with the unique amino acid sequences recognizing cellular nuclear transport machinery. However, considering the safety issues in the clinical gene therapy for treating critical human diseases, non-viral systems are highly promising compared with their viral counterparts. This review summarizes the progress on exploring the nuclear traffic mechanisms for the prominent viral vectors and the technological innovations for the nuclear delivery of non-viral DNA by mimicking those natural processes evolved for the viruses as well as for many cellular proteins.

  8. Diagnosis and Prevention of Infection by Phlebotomus Fever Group Viruses

    DTIC Science & Technology

    1991-05-03

    proficient, but non- optimal expression vectors [e.g., pAcRP6, see below]. The two types of recombinant viruses were used to infect Spodoptera ... frugiperda cells and the expressed PT viral proteins characterised (Overton et al., 1987). Recombinant AcNPV having the S DNA in one orientation expressed...proteins virus were raised in mice using the corresponding S. frugiperda infected cell extracts and were employed to identify N and NSs proteins in PT virus

  9. Cutaneous gene expression of plasmid DNA in excised human skin following delivery via microchannels created by radio frequency ablation.

    PubMed

    Birchall, James; Coulman, Sion; Anstey, Alexander; Gateley, Chris; Sweetland, Helen; Gershonowitz, Amikam; Neville, Lewis; Levin, Galit

    2006-04-07

    The skin is a valuable organ for the development and exploitation of gene medicines. Delivering genes to skin is restricted however by the physico-chemical properties of DNA and the stratum corneum (SC) barrier. In this study, we demonstrate the utility of an innovative technology that creates transient microconduits in human skin, allowing DNA delivery and resultant gene expression within the epidermis and dermis layers. The radio frequency (RF)-generated microchannels were of sufficient morphology and depth to permit the epidermal delivery of 100 nm diameter nanoparticles. Model fluorescent nanoparticles were used to confirm the capacity of the channels for augmenting diffusion of macromolecules through the SC. An ex vivo human organ culture model was used to establish the gene expression efficiency of a beta-galactosidase reporter plasmid DNA applied to ViaDerm treated skin. Skin treated with ViaDerm using 50 microm electrode arrays promoted intense levels of gene expression in the viable epidermis. The intensity and extent of gene expression was superior when ViaDerm was used following a prior surface application of the DNA formulation. In conclusion, the RF-microchannel generator (ViaDerm) creates microchannels amenable for delivery of nanoparticles and gene therapy vectors to the viable region of skin.

  10. A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

    PubMed

    Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

    2015-05-01

    Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  11. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodyer, P.R.; Torban, E.; Dehbi, M.

    1994-09-01

    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

  12. Expression of insulin-like growth factor-2 receptors on EL4 lymphoma cells overexpressing growth hormone.

    PubMed

    Farmer, John T; Weigent, Douglas A

    2007-01-01

    In the present study, we report the upregulation of functional IGF-2Rs in cells overexpressing growth hormone (GH). EL4 lymphoma cells stably transfected with an rGH cDNA overexpression vector (GHo) exhibited an increase in the binding of (125)I-IGF-2 with no change in the binding affinity compared to vector alone controls. An increase in the expression of the insulin-like growth factor-2 receptor (IGF-2R) in cells overexpressing GH was confirmed by Western blot analysis and IGF-2R promoter luciferase assays. EL4 cells produce insulin-like growth factor-2 (IGF-2) as detected by the reverse transcription-polymerase chain reaction (RT-PCR); however, no IGF-2 protein was detected by Western analysis. The increase in the expression of the IGF-2R resulted in greater levels of IGF-2 uptake in GHo cells compared to vector alone controls. The data suggest that one of the consequences of the overexpression of GH is an increase in the expression of the IGF-2R.

  13. Sequential cloning of chromosomes

    DOEpatents

    Lacks, S.A.

    1995-07-18

    A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

  14. Non-viral gene delivery regulated by stiffness of cell adhesion substrates.

    PubMed

    Kong, Hyun Joon; Liu, Jodi; Riddle, Kathryn; Matsumoto, Takuya; Leach, Kent; Mooney, David J

    2005-06-01

    Non-viral gene vectors are commonly used for gene therapy owing to safety concerns with viral vectors. However, non-viral vectors are plagued by low levels of gene transfection and cellular expression. Current efforts to improve the efficiency of non-viral gene delivery are focused on manipulations of the delivery vector, whereas the influence of the cellular environment in DNA uptake is often ignored. The mechanical properties (for example, rigidity) of the substrate to which a cell adheres have been found to mediate many aspects of cell function including proliferation, migration and differentiation, and this suggests that the mechanics of the adhesion substrate may regulate a cell's ability to uptake exogeneous signalling molecules. In this report, we present a critical role for the rigidity of the cell adhesion substrate on the level of gene transfer and expression. The mechanism relates to material control over cell proliferation, and was investigated using a fluorescent resonance energy transfer (FRET) technique. This study provides a new material-based control point for non-viral gene therapy.

  15. Oncogene GAEC1 regulates CAPN10 expression which predicts survival in esophageal squamous cell carcinoma

    PubMed Central

    Chan, Dessy; Tsoi, Miriam Yuen-Tung; Liu, Christina Di; Chan, Sau-Hing; Law, Simon Ying-Kit; Chan, Kwok-Wah; Chan, Yuen-Piu; Gopalan, Vinod; Lam, Alfred King-Yin; Tang, Johnny Cheuk-On

    2013-01-01

    AIM: To identify the downstream regulated genes of GAEC1 oncogene in esophageal squamous cell carcinoma and their clinicopathological significance. METHODS: The anti-proliferative effect of knocking down the expression of GAEC1 oncogene was studied by using the RNA interference (RNAi) approach through transfecting the GAEC1-overexpressed esophageal carcinoma cell line KYSE150 with the pSilencer vector cloned with a GAEC1-targeted sequence, followed by MTS cell proliferation assay and cell cycle analysis using flow cytometry. RNA was then extracted from the parental, pSilencer-GAEC1-targeted sequence transfected and pSilencer negative control vector transfected KYSE150 cells for further analysis of different patterns in gene expression. Genes differentially expressed with suppressed GAEC1 expression were then determined using Human Genome U133 Plus 2.0 cDNA microarray analysis by comparing with the parental cells and normalized with the pSilencer negative control vector transfected cells. The most prominently regulated genes were then studied by immunohistochemical staining using tissue microarrays to determine their clinicopathological correlations in esophageal squamous cell carcinoma by statistical analyses. RESULTS: The RNAi approach of knocking down gene expression showed the effective suppression of GAEC1 expression in esophageal squamous cell carcinoma cell line KYSE150 that resulted in the inhibition of cell proliferation and increase of apoptotic population. cDNA microarray analysis for identifying differentially expressed genes detected the greatest levels of downregulation of calpain 10 (CAPN10) and upregulation of trinucleotide repeat containing 6C (TNRC6C) transcripts when GAEC1 expression was suppressed. At the tissue level, the high level expression of calpain 10 protein was significantly associated with longer patient survival (month) of esophageal squamous cell carcinoma compared to the patients with low level of calpain 10 expression (37.73 ± 16.33 vs 12.62 ± 12.44, P = 0.032). No significant correction was observed among the TNRC6C protein expression level and the clinocopathologcial features of esophageal squamous cell carcinoma. CONCLUSION: GAEC1 regulates the expression of CAPN10 and TNRC6C downstream. Calpain 10 expression is a potential prognostic marker in patients with esophageal squamous cell carcinoma. PMID:23687414

  16. Galactosylated DNA lipid nanocapsules for efficient hepatocyte targeting.

    PubMed

    Morille, M; Passirani, C; Letrou-Bonneval, E; Benoit, J-P; Pitard, B

    2009-09-11

    The main objective of gene therapy via a systemic pathway is the development of a stable and non-toxic gene vector that can encapsulate and deliver foreign genetic materials into specific cell types with the transfection efficiency of viral vectors. With this objective, DNA complexed with cationic lipids of DOTAP/DOPE was encapsulated into lipid nanocapsules (LNCs) forming nanocarriers (DNA LNCs) with a size suitable for systemic injection (109+/-6 nm). With the goal of increasing systemic delivery, LNCs were stabilised with long chains of poly(ethylene glycol) (PEG), either from a PEG lipid derivative (DSPE-mPEG(2000)) or from an amphiphilic block copolymer (F108). In order to overcome internalisation difficulties encountered with PEG shield, a specific ligand (galactose) was covalently added at the distal end of the PEG chains, in order to provide active targeting of the asialoglycoprotein-receptor present on hepatocytes. This study showed that DNA LNCs were as efficient as positively charged DOTAP/DOPE lipoplexes for transfection. In primary hepatocytes, when non-galactosylated, the two polymers significantly decreased the transfection, probably by creating a barrier around the DNA LNCs. Interestingly, galactosylated F108 coated DNA LNCs led to a 18-fold increase in luciferase expression compared to non-galactosylated ones.

  17. Gene encoding herbicide safener binding protein

    DOEpatents

    Walton, Jonathan D.; Scott-Craig, John S.

    1999-01-01

    The cDNA encoding safener binding protein (SafBP), also referred to as SBP1, is set forth in FIG. 5 and SEQ ID No. 1. The deduced amino acid sequence is provided in FIG. 5 and SEQ ID No. 2. Methods of making and using SBP1 and SafBP to alter a plant's sensitivity to certain herbicides or a plant's responsiveness to certain safeners are also provided, as well as expression vectors, transgenic plants or other organisms transfected with said vectors and seeds from said plants.

  18. A versatile expression vector for the growth and amplification of unmodified phage display polypeptides.

    PubMed

    Winton, Alexander J; Baptiste, Janae L; Allen, Mark A

    2018-09-01

    Proteins and polypeptides represent nature's most complex and versatile polymer. They provide complicated shapes, diverse chemical functionalities, and tightly regulated and controlled sizes. Several disease states are related to the misfolding or overproduction of polypeptides and yet polypeptides are present in several therapeutic molecules. In addition to biological roles; short chain polypeptides have been shown to interact with and drive the bio-inspired synthesis or modification of inorganic materials. This paper outlines the development of a versatile cloning vector which allows for the expression of a short polypeptide by controlling the incorporation of a desired DNA coding insert. As a demonstration of the efficacy of the expression system, a solid binding polypeptide identified from M13 phage display was expressed and purified. The solid binding polypeptide was expressed as a soluble 6xHis-SUMO tagged construct. Expression was performed in E. coli using auto-induction followed by Ni-NTA affinity chromatography and ULP1 protease cleavage. Methodology demonstrates the production of greater than 8 mg of purified polypeptide per liter of E. coli culture. Isotopic labeling of the peptide is also demonstrated. The versatility of the designed cloning vector, use of the 6xHis-SUMO solubility partner, bacterial expression in auto-inducing media and the purification methodology make this expressionun vector a readily scalable and user-friendly system for the creation of desired peptide domains. Copyright © 2018. Published by Elsevier Inc.

  19. Poly(amidoamine) Dendrimers Modified with 1,2-Epoxyhexane or 1,2-Epoxydodecane for Enhanced Gene Delivery Applications.

    PubMed

    Xiao, Tongyu; Cao, Xueyan; Hou, Wenxiu; Peng, Chen; Qiu, Jieru; Shi, Xiangyang

    2015-12-01

    We report a new non-viral gene delivery system based on hydrophobically modified poly(amidoamine) (PAMAM) dendrimers. In this study, the periphery of amine-terminated generation 5 (G5) PAMAM dendrimers was partially reacted with 1,2-epoxyhexane and 1,2-epoxydodecane, respectively. The formed hydrophobically modified G5 dendrimers (denoted as G5.NH2-C6 or G5.NH2-C12) were used to complex two different plasmid DNAs (pDNAs) encoding luciferase (Luc) and enhanced green fluorescent protein (EGFP), respectively for gene transfection studies. The polyplexes formed between vectors and pDNA were characterized by gel retardation assay, dynamic light scattering, and zeta potential measurements. We show that the G5.NH2-C6 and G5.NH2-C12 vectors are able to effectively compact the pDNA, allowing for highly efficient gene transfection into a model cell line (HeLa cells) as demonstrated by both Luc assay and confocal microscopic imaging of the EGFP expression. Under the studied N/P ratios (the molar ratio of primary amines of the dendrimers to phosphates in the pDNA backbone) at 2.5 or 5, the transfection efficiency of the dendrimer-based vectors followed the order of G5.NH2-C12 > G5.NH2-C6 > G5.NH2. This enhanced gene transfection capacity is believed to be associated with the enhanced hydrophobic interaction between the vector/pDNA complexes and the relatively hydrophobic cell membranes. The developed hydrophobically modified dendrimers may be used as a promising non-viral vector for enhanced gene delivery applications.

  20. A linear-dendritic cationic vector for efficient DNA grasp and delivery.

    PubMed

    Yang, Bin; Sun, Yun-xia; Yi, Wen-jie; Yang, Juan; Liu, Chen-wei; Cheng, Han; Feng, Jun; Zhang, Xian-zheng; Zhuo, Ren-xi

    2012-07-01

    This paper presents an attempt to design an efficient and biocompatible cationic gene vector via structural optimization that favors the efficient utilization of amine groups for DNA condensation. To this end, a linear-dendritic block copolymer of methoxyl-poly(ethylene glycol)-dendritic polyglycerol-graft-tris(2-aminoethyl)amine (mPEG-DPG-g-TAEA) was prepared with specially designed multiple functions including strong DNA affinity, endosomal buffering and expected serum-tolerance. Based on the transfection in serum-free and serum-conditioned media, the influences of the polymer structures including the degree of polymerization of DPG and TAEA substitution degree were explored. As compared to polyethylenimine (M(w)=5 kDa) (PEI5k) with similar molecular weight and higher amine density, mPEG-DPG-g-TAEA displayed comparably high DNA affinity due to the special linear-dendritic architecture. Consequently, at very low N/P ratio, mPEG-DPG-g-TAEA vectors could mediate efficient in vitro luciferase expression at levels that are comparable with or even superior to the commercially available Lipofectamine™ 2000, while being apparently higher than PEI5k. The designed vectors exhibit considerably higher cell biocompatibility and better resistance against bovine serum albumin adsorption than PEI5k. The stability of the complexes on coincubation with heparin was found to be largely dependent on the polymer structure. As concluded from the comparative transfection study in the absence/presence of chloroquine, it is likely that the polycation itself could produce endosomal buffering. This linear-dendritic vector shows promising potential for the application of gene delivery. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

  1. Conditional immortalization of Gunn rat hepatocytes: an ex vivo model for evaluating methods for bilirubin-UDP-glucuronosyltransferase gene transfer.

    PubMed

    Fox, I J; Chowdhury, N R; Gupta, S; Kondapalli, R; Schilsky, M L; Stockert, R J; Chowdhury, J R

    1995-03-01

    Viral vectors and protein carriers utilizing asialoglycoprotein receptor (ASGR)-mediated endocytosis are being developed to transfer genes for the correction of bilirubin-UDP-glucuronosyltransferase (bilirubin-UGT) deficiency. Ex vivo evaluation of these gene transfer vectors would be facilitated by a cell system that lacks bilirubin-UGT, but expresses differentiated liver functions, including ASGR. We immortalized primary Gunn rat hepatocytes by transduction with a recombinant Moloney murine leukemia virus expressing a thermolabile mutant SV40 large T antigen (tsA58). At 33 degrees C, the immortalized hepatocyte clones expressed SV40 large T antigen, synthesized DNA, and doubled in number every 2 to 3 days. At this temperature, differentiated hepatocyte markers, e.g., albumin, ASGR, and androsterone-UGT, were expressed at 5% to 10% of the levels found in primary hepatocytes maintained in culture for 24 hours. Glutathione-S-transferase Yp (GST-Yp), an oncofetal protein, was expressed in these cells at 33 degrees C, but was undetectable in primary hepatocytes. In contrast, when the cells were cultured at 39 degrees C or 37 degrees C, the large T antigen was degraded, DNA synthesis and cell growth stopped, and morphologic characteristics of differentiated hepatocytes were observed. The expression of albumin, ASGR, and androsterone-UGT, and their corresponding mRNAs, increased to 25% to 40% of the level in primary hepatocytes, whereas GST-Yp expression decreased. Functionality of ASGR was demonstrated by internalization of Texas red-labeled asialoorosomucoid, and binding and degradation of 125I-asialoorosomucoid. After liposome-mediated transfer of a plasmid containing the coding region of human bilirubin-UGT1, driven by the SV40 large T promoter, active human bilirubin-UGT1 was expressed in these cells. The immortalized cells were not tumorigenic after transplantation into severe combined immunodeficiency mice. These conditionally immortalized cells will be useful for ex vivo evaluation of bilirubin-UGT gene transfer vectors.

  2. The construction and use of versatile binary vectors carrying pyrG auxotrophic marker and fluorescent reporter genes for Agrobacterium-mediated transformation of Aspergillus oryzae.

    PubMed

    Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan

    2016-12-01

    Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.

  3. Generation of Oxtr cDNA(HA)-Ires-Cre Mice for Gene Expression in an Oxytocin Receptor Specific Manner.

    PubMed

    Hidema, Shizu; Fukuda, Tomokazu; Hiraoka, Yuichi; Mizukami, Hiroaki; Hayashi, Ryotaro; Otsuka, Ayano; Suzuki, Shingo; Miyazaki, Shinji; Nishimori, Katsuhiko

    2016-05-01

    The neurohypophysial hormone oxytocin (OXT) and its receptor (OXTR) have critical roles in the regulation of pro-social behaviors, including social recognition, pair bonding, parental behavior, and stress-related responses. Supporting this hypothesis, a portion of patients suffering from autism spectrum disorder have mutations, such as single nucleotide polymorphisms, or epigenetic modifications in their OXTR gene. We previously reported that OXTR-deficient mice exhibit pervasive social deficits, indicating the critical role of OXTR in social behaviors. In the present study, we generated Oxtr cDNA(HA)-Ires-Cre knock-in mice, expressing both OXTR and Cre recombinase under the control of the endogenous Oxtr promoter. Knock-in cassette of Oxtr cDNA(HA)-Ires-Cre consisted of Oxtr cDNA tagged with the hemagglutinin epitope at the 3' end (Oxtr cDNA(HA)), internal ribosomal entry site (Ires), and Cre. Cre was expressed in the uterus, mammary gland, kidney, and brain of Oxtr cDNA(HA)-Ires-Cre knock-in mice. Furthermore, the distribution of Cre in the brain was similar to that observed in Oxtr-Venus fluorescent protein expressing mice (Oxtr-Venus), another animal model previously generated by our group. Social behavior of Oxtr cDNA(HA)-Ires-Cre knock-in mice was similar to that of wild-type animals. We demonstrated that this construct is expressed in OXTR-expressing neurons specifically after an infection with the recombinant adeno-associated virus carrying the flip-excision switch vector. Using this system, we showed the transport of the wheat-germ agglutinin tracing molecule from the OXTR-expressing neurons to the innervated neurons in knock-in mice. This study might contribute to the monosynaptic analysis of neuronal circuits and to the optogenetic analysis of neurons expressing OXTR. © 2015 Wiley Periodicals, Inc.

  4. Genome-wide profiling of diel and circadian gene expression in the malaria vector Anopheles gambiae.

    PubMed

    Rund, Samuel S C; Hou, Tim Y; Ward, Sarah M; Collins, Frank H; Duffield, Giles E

    2011-08-09

    Anopheles gambiae, the primary African vector of malaria parasites, exhibits numerous rhythmic behaviors including flight activity, swarming, mating, host seeking, egg laying, and sugar feeding. However, little work has been performed to elucidate the molecular basis for these daily rhythms. To study how gene expression is regulated globally by diel and circadian mechanisms, we have undertaken a DNA microarray analysis of An. gambiae under light/dark cycle (LD) and constant dark (DD) conditions. Adult mated, non-blood-fed female mosquitoes were collected every 4 h for 48 h, and samples were processed with DNA microarrays. Using a cosine wave-fitting algorithm, we identified 1,293 and 600 rhythmic genes with a period length of 20-28 h in the head and body, respectively, under LD conditions, representing 9.7 and 4.5% of the An. gambiae gene set. A majority of these genes was specific to heads or bodies. Examination of mosquitoes under DD conditions revealed that rhythmic programming of the transcriptome is dependent on an interaction between the endogenous clock and extrinsic regulation by the LD cycle. A subset of genes, including the canonical clock components, was expressed rhythmically under both environmental conditions. A majority of genes had peak expression clustered around the day/night transitions, anticipating dawn and dusk. Genes cover diverse biological processes such as transcription/translation, metabolism, detoxification, olfaction, vision, cuticle regulation, and immunity, and include rate-limiting steps in the pathways. This study highlights the fundamental roles that both the circadian clock and light play in the physiology of this important insect vector and suggests targets for intervention.

  5. Functional Analysis of Plant Promoter rpL34 Using the GUS Marker Gene in New Tr,tnsgene Expression Vector pZD428

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mauzey-Amato, Jacqueline M.; Dai, Ziyu

    2000-11-01

    Optimization of the transgene expression system is one of the critical steps for the high level production of heterologous proteins in plants, where the promoter is a key component regulating transgene expression. In this study, the activity of the rpL34 promoter was analyzed in transgenic tobacco (Nicotiana tabacum) NTI calli. A DNA fragment containing the rpL34 promoter and the reporter gene B-D-glucuronidase (GUS) were cloned into binary vector pZD427 to generate the transgene expression vector pZD428. The insertion was verified by enzyme restriction digestion and agarose gel electrophoresis analyses. The DNA fragment containing the rpL34 promoter and GUS reporter genemore » was then integrated into the tobacco genomes via Agrobacterium funiefaciens-mediated NT suspension cell transformation. The transformed CaNi were induced on Murashige and Skoog (MS) plates containing proper amounts of 2,4-D, cefotoxime, and kanamycin. Two hundred and sixty transformed calli were harvested for GUS activity and protein concentration measurements. GUS activity analyses revealed the specific activity up to 278,358 units per milligram total soluble protein. The GUS activity under the control of the rpL34 promoter is much higher than that under the control of the cauliflower mosaic virus 35S promoter, a commonly used promoter in plant biology. These results suggest that the rpL34 promoter is one of the most active promoters that can be used for heterologous protein production in calli and suspension cells.« less

  6. Biophysical Characterization of Copolymer-Protected Gene Vectors (COPROGs)

    PubMed Central

    Hönig, Daniel; DeRouchey, Jason; Jungmann, Ralf; Koch, Christian; Plank, Christian; Rädler, Joachim O.

    2010-01-01

    A copolymer-protected gene vector (COPROG) is a three component gene delivery system consisting of a preformed DNA and branched polyethylenimine (bPEI) complex subsequently modified by the addition of a copolymer (P6YE5C) incorporating both poly(ethylene glycol) (PEG) and anionic peptides. Using fluorescence correlation spectroscopy (FCS) and atomic force microscopy (AFM), we characterized and compared the self-assembly of bPEI/DNA particles and COPROG complexes. In low salt buffer, both bPEI/DNA and COPROG formulations form stable nanoparticles with hydrodynamic radii between 60–120 nm. COPROG particles, as compared to bPEI/DNA, show greatly improved particle stability to both physiological salt as well as low pH conditions. Binding stoichiometry of the three-component COPROG system was investigated by dual-color fluorescence cross-correlation spectroscopy (FCCS). It was found that a significant fraction of P6YE5C copolymer aggregates with excess bPEI forming bPEI/P6YE5C “ghost complexes” with no DNA inside. The ratio of ghost particles to COPROG complexes is about 4:1. In addition we find a large fraction of excess P6YE5C copolymer, which remains unbound in solution. We observe a 2–4 fold enhanced reporter gene expression with COPROG formulations at various equivalents as compared to bPEI-DNA alone. We believe that both complex stabilization as well as the capture of excess bPEI into ghost particles induced by the copolymer is responsible for the improvement in gene expression. PMID:20672861

  7. A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

    PubMed

    Lafuente, M J; Petit, T; Gancedo, C

    1997-12-22

    We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

  8. [Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

    PubMed

    Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

    2006-11-01

    To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

  9. Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

    NASA Astrophysics Data System (ADS)

    Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

    1981-02-01

    Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

  10. Characterization of chicken c-ski oncogene products expressed by retrovirus vectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sutrave, P.; Copeland, T.D.; Hughes, S.H.

    1990-06-01

    The authors have constructed replication-competent avian retrovirus vectors that contain two of the three known types of chicken c-{ital ski} cDNAs and a third vector that contains a truncated c-{ital ski} cDNA. They developed antisera that recognize the c-{ital ski} proteins made by the three transforming c-{ital ski} viruses. All three proteins (apparent molecular masses, 50, 60, and 90 kilodaltons) are localized primarily in the nucleus. The proteins are differentially phosphorylated; immunofluorescence also suggests that there are differences in subnuclear localization of the c-{ital ski} proteins and that c-{ital ski} protein is associated with condensed chromatin in dividing cells.

  11. Development of Genome Engineering Tools from Plant-Specific PPR Proteins Using Animal Cultured Cells.

    PubMed

    Kobayashi, Takehito; Yagi, Yusuke; Nakamura, Takahiro

    2016-01-01

    The pentatricopeptide repeat (PPR) motif is a sequence-specific RNA/DNA-binding module. Elucidation of the RNA/DNA recognition mechanism has enabled engineering of PPR motifs as new RNA/DNA manipulation tools in living cells, including for genome editing. However, the biochemical characteristics of PPR proteins remain unknown, mostly due to the instability and/or unfolding propensities of PPR proteins in heterologous expression systems such as bacteria and yeast. To overcome this issue, we constructed reporter systems using animal cultured cells. The cell-based system has highly attractive features for PPR engineering: robust eukaryotic gene expression; availability of various vectors, reagents, and antibodies; highly efficient DNA delivery ratio (>80 %); and rapid, high-throughput data production. In this chapter, we introduce an example of such reporter systems: a PPR-based sequence-specific translational activation system. The cell-based reporter system can be applied to characterize plant genes of interested and to PPR engineering.

  12. In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering

    PubMed Central

    Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

    2017-01-01

    Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270

  13. In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.

    PubMed

    Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang

    2017-01-01

    Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.

  14. Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

    DTIC Science & Technology

    2009-11-01

    expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a

  15. Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.

    PubMed

    Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L

    1986-09-01

    The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.

  16. Rhizomucor miehei triglyceride lipase is processed and secreted from transformed Aspergillus oryzae.

    PubMed

    Huge-Jensen, B; Andreasen, F; Christensen, T; Christensen, M; Thim, L; Boel, E

    1989-09-01

    The cDNA encoding the precursor of the Rhizomucor miehei triglyceride lipase was inserted in an Aspergillus oryzae expression vector. In this vector the expression of the lipase cDNA is under control of the Aspergillus oryzae alpha-amylase gene promoter and the Aspergillus niger glucoamylase gene terminator. The recombinant plasmid was introduced into Aspergillus oryzae, and transformed colonies were selected and screened for lipase expression. Lipase-positive transformants were grown in a small fermentor, and recombinant triglyceride lipase was purified from the culture broth. The purified enzymatically active recombinant lipase (rRML) secreted from A. oryzae was shown to have the same characteristics with respect to mobility on reducing SDS-gels and amino acid composition as the native enzyme. N-terminal amino acid sequencing indicated that approximately 70% of the secreted rRML had the same N-terminal sequence as the native Rhizomucor miehei enzyme, whereas 30% of the secreted rRML was one amino acid residue shorter in the N-terminal. The recombinant lipase precursor, which has a 70 amino acid propeptide, is thus processed in and secreted from Aspergillus oryzae. We have hereby demonstrated the utility of this organism as a host for the production of recombinant triglyceride lipases.

  17. nanos-Driven expression of piggyBac transposase induces mobilization of a synthetic autonomous transposon in the malaria vector mosquito, Anopheles stephensi.

    PubMed

    Macias, Vanessa M; Jimenez, Alyssa J; Burini-Kojin, Bianca; Pledger, David; Jasinskiene, Nijole; Phong, Celine Hien; Chu, Karen; Fazekas, Aniko; Martin, Kelcie; Marinotti, Osvaldo; James, Anthony A

    2017-08-01

    Transposons are a class of selfish DNA elements that can mobilize within a genome. If mobilization is accompanied by an increase in copy number (replicative transposition), the transposon may sweep through a population until it is fixed in all of its interbreeding members. This introgression has been proposed as the basis for drive systems to move genes with desirable phenotypes into target species. One such application would be to use them to move a gene conferring resistance to malaria parasites throughout a population of vector mosquitos. We assessed the feasibility of using the piggyBac transposon as a gene-drive mechanism to distribute anti-malarial transgenes in populations of the malaria vector, Anopheles stephensi. We designed synthetic gene constructs that express the piggyBac transposase in the female germline using the control DNA of the An. stephensi nanos orthologous gene linked to marker genes to monitor inheritance. Two remobilization events were observed with a frequency of one every 23 generations, a rate far below what would be useful to drive anti-pathogen transgenes into wild mosquito populations. We discuss the possibility of optimizing this system and the impetus to do so. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  18. Alphavirus Replicon DNA Vectors Expressing Ebola GP and VP40 Antigens Induce Humoral and Cellular Immune Responses in Mice

    PubMed Central

    Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan

    2018-01-01

    Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526

  19. Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

    PubMed Central

    Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

    1983-01-01

    We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

  20. [Cloning and expressing of cyclophilin B gene from Schistosoma japonnicum and the analysis of immunoprotective effect].

    PubMed

    Peng, Jinbiao; Han, Hongxiao; Hong, Yang; Wang, Yan; Guo, Fanji; Shi, Yaojun; Fu, Zhiqiang; Liu, Jinming; Cheng, Guofeng; Lin, Jiaojiao

    2010-03-01

    The present study was intend to clone and express the cDNA encoding Cyclophilin B (CyPB) of Schistosoma japonicum, its preliminary biological function and further immunoprotective effect against schistosome infection in mice. RT-PCR technique was applied to amplify a full-length cDNA encoding protein Cyclophilin B (Sj CyPB) from schistosomula cDNA. The expression profiles of Sj CyPB were determined by Real-time PCR using the template cDNAs isolated from 7, 13, 18, 23, 32 and 42 days parasites. The cDNA containing the Open Reading Frame of CyPB was then subcloned into a pGEX-6P-1 vector and transformed into competent Escherichia coli BL21 for expressing. The recombinant protein was renaturated, purified and its antigenicity were detected by Western blotting, and the immunoprotective effect induced by recombinant Sj CyPB was evaluated in Balb/C mice. The cDNA containing the ORF of Sj CyPB was cloned with the length of 672 base pairs, encoding 223 amino acids. Real-time PCR analysis revealed that the gene had the highest expression in 18-day schistosomula, suggesting that Sj CyPB was schistosomula differentially expressed gene. The recombinant protein showed a good antigenicity detected by Western blotting. Animal experiment indicated that the vaccination of recombinant CyPB protein in mice led to 31.5% worm and 41.01% liver egg burden reduction, respectively, compared with those of the control. A full-length cDNA differentially expressed in schistosomula was obtained. The recombinant Sj CyPB protein could induce partial protection against schistosome infection.

  1. Induction of Pro-Angiogenic Factors by Pregnancy-Specific Glycoproteins and Studies on Receptor Usage

    DTIC Science & Technology

    2008-01-01

    expression vector. The purified bacoluvirus DNA, containing PSG11, was purified and used to transfect Spodoptera frugiperda (Sf-9) cells (Invitrogen) to...proteins in Spodoptera frugiperda cells using biotin acceptor peptides. Anal Biochem, 1998. 262(2): p. 122-8. 175. Hirt, B., Selective extraction of

  2. Compositional Bias in Naïve and Chemically-modified Phage-Displayed Libraries uncovered by Paired-end Deep Sequencing.

    PubMed

    He, Bifang; Tjhung, Katrina F; Bennett, Nicholas J; Chou, Ying; Rau, Andrea; Huang, Jian; Derda, Ratmir

    2018-01-19

    Understanding the composition of a genetically-encoded (GE) library is instrumental to the success of ligand discovery. In this manuscript, we investigate the bias in GE-libraries of linear, macrocyclic and chemically post-translationally modified (cPTM) tetrapeptides displayed on the M13KE platform, which are produced via trinucleotide cassette synthesis (19 codons) and NNK-randomized codon. Differential enrichment of synthetic DNA {S}, ligated vector {L} (extension and ligation of synthetic DNA into the vector), naïve libraries {N} (transformation of the ligated vector into the bacteria followed by expression of the library for 4.5 hours to yield a "naïve" library), and libraries chemically modified by aldehyde ligation and cysteine macrocyclization {M} characterized by paired-end deep sequencing, detected a significant drop in diversity in {L} → {N}, but only a minor compositional difference in {S} → {L} and {N} → {M}. Libraries expressed at the N-terminus of phage protein pIII censored positively charged amino acids Arg and Lys; libraries expressed between pIII domains N1 and N2 overcame Arg/Lys-censorship but introduced new bias towards Gly and Ser. Interrogation of biases arising from cPTM by aldehyde ligation and cysteine macrocyclization unveiled censorship of sequences with Ser/Phe. Analogous analysis can be used to explore library diversity in new display platforms and optimize cPTM of these libraries.

  3. Selectable antibiotic resistance marker gene-free transgenic rice harbouring the garlic leaf lectin gene exhibits resistance to sap-sucking planthoppers.

    PubMed

    Sengupta, Subhadipa; Chakraborti, Dipankar; Mondal, Hossain A; Das, Sampa

    2010-03-01

    Rice, the major food crop of world is severely affected by homopteran sucking pests. We introduced coding sequence of Allium sativum leaf agglutinin, ASAL, in rice cultivar IR64 to develop sustainable resistance against sap-sucking planthoppers as well as eliminated the selectable antibiotic-resistant marker gene hygromycin phosphotransferase (hpt) exploiting cre/lox site-specific recombination system. An expression vector was constructed containing the coding sequence of ASAL, a potent controlling agent against green leafhoppers (GLH, Nephotettix virescens) and brown planthopper (BPH, Nilaparvata lugens). The selectable marker (hpt) gene cassette was cloned within two lox sites of the same vector. Alongside, another vector was developed with chimeric cre recombinase gene cassette. Reciprocal crosses were performed between three single-copy T(0) plants with ASAL- lox-hpt-lox T-DNA and three single-copy T(0) plants with cre-bar T-DNA. Marker gene excisions were detected in T(1) hybrids through hygromycin sensitivity assay. Molecular analysis of T(1) plants exhibited 27.4% recombination efficiency. T(2) progenies of L03C04(1) hybrid parent showed 25% cre negative ASAL-expressing plants. Northern blot, western blot and ELISA showed significant level of ASAL expression in five marker-free T(2) progeny plants. In planta bioassay of GLH and BPH performed on these T(2) progenies exhibited radical reduction in survivability and fecundity compared with the untransformed control plants.

  4. Human gene therapy: a brief overview of the genetic revolution.

    PubMed

    Misra, Sanjukta

    2013-02-01

    Advances in biotechnology have brought gene therapy to the forefront of medical research. The prelude to successful gene therapy i.e. the efficient transfer and expression of a variety of human gene into target cells has already been accomplished in several systems. Safe methods have been devised to do this, using several viral and no-viral vectors. Two main approaches emerged: in vivo modification and ex vivo modification. Retrovirus, adenovirus, adeno-associated virus are suitable for gene therapeutic approaches which are based on permanent expression of the therapeutic gene. Non-viral vectors are far less efficient than viral vectors, but they have advantages due to their low immunogenicity and their large capacity for therapeutic DNA. To improve the function of non-viral vectors, the addition of viral functions such as receptor mediated uptake and nuclear translocation of DNA may finally lead to the development of an artificial virus. Gene transfer protocols have been approved for human use in inherited diseases, cancers and acquired disorders. In 1990, the first successful clinical trial of gene therapy was initiated for adenosine deaminase deficiency. Since then, the number of clinical protocols initiated worldwide has increased exponentially. Although preliminary results of these trials are somewhat disappointing, but human gene therapy dreams of treating diseases by replacing or supplementing the product of defective or introducing novel therapeutic genes. So definitely human gene therapy is an effective addition to the arsenal of approaches to many human therapies in the 21st century.

  5. Cloning and baculovirus expression of a desiccation stress gene from the beetle, Tenebrio molitor.

    PubMed

    Graham, L A; Bendena, W G; Walker, V K

    1996-02-01

    The cDNA sequence encoding a novel desiccation stress protein (dsp28) found in the hemolymph of the common yellow mealworm beetle, Tenebrio molitor, has been determined. The sequence encodes a 225 amino acid protein containing a 20 amino acid signal peptide. Dsp28 shows no significant similarity to any known nucleic acid or protein sequence. Levels of dsp28 mRNA were found to increase approx 5-fold following desiccation. Dsp28 cDNA has been cloned into a baculovirus expression vector and the expressed protein was compared to native dsp28. Both dsp28 expressed by recombinant baculovirus and native dsp28 are glycosylated and N-terminally processed. Although dsp28 is induced by cold in addition to desiccation stress, it does not contribute to the freezing point depression (thermal hysteresis) observed in Tenebrio hemolymph.

  6. Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

    PubMed Central

    Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

    2018-01-01

    Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

  7. Comparison of immune responses to different foot-and-mouth disease genetically engineered vaccines in guinea pigs.

    PubMed

    Yao, Qingxia; Qian, Ping; Huang, Qinfeng; Cao, Yi; Chen, Huanchun

    2008-01-01

    The P12A3C gene from FMDV (serotype O) encoding the capsid precursor protein, and the highly immunogenic gene FHG, which encodes multiple epitopes of FMDV capsid proteins, were inserted into eukaryotic expression vectors to compare different candidate genetically engineered vaccines for foot-and-mouth disease (FMD). A modified live pseudorabies virus (MLPRV) was also used to deliver P12A3C. Guinea pigs were inoculated intramuscularly with the candidate vaccines to compare the ability to elicit immunity of the DNA vector and a live viral vector. An indirect enzyme-linked immunosorbent assay (iELISA), virus-neutralization test and lymphoproliferation assay were used to detect antibody and cellular responses. The group immunized with P12A3C delivered by MLPRV produced significantly greater antibody and cellular responses indicating that MLPRV has a greater ability to mediate exogenous gene delivery than the plasmid DNA vector. Comparison of the immune responses induced by P12A3C and FHG, which were both mediated by DNA plasmids, showed that FHG and P12A3C elicited similar cellular responses, while P12A3C induced higher antibody levels, suggesting that P12A3C is a more powerful immunogen than FHG. In challenge experiments, guinea pigs vaccinated with P12A3C delivered by MLPRV were protected fully from FMDV challenge, whereas guinea pigs vaccinated with P12A3C or FHG delivered by DNA plasmid were only protected partially. This study provides a basis for future construction of a genetically engineered vaccine for FMDV.

  8. New ligation independent cloning vectors for expression of recombinant proteins with a self-cleaving CPD/6xHis-tag.

    PubMed

    Biancucci, Marco; Dolores, Jazel S; Wong, Jennifer; Grimshaw, Sarah; Anderson, Wayne F; Satchell, Karla J F; Kwon, Keehwan

    2017-01-05

    Recombinant protein purification is a crucial step for biochemistry and structural biology fields. Rapid robust purification methods utilize various peptide or protein tags fused to the target protein for affinity purification using corresponding matrices and to enhance solubility. However, affinity/solubility-tags often need to be removed in order to conduct functional and structural studies, adding complexities to purification protocols. In this work, the Vibrio cholerae MARTX toxin Cysteine Protease Domain (CPD) was inserted in a ligation-independent cloning (LIC) vector to create a C-terminal 6xHis-tagged inducible autoprocessing enzyme tag, called "the CPD-tag". The pCPD and alternative pCPD/ccdB cloning vectors allow for easy insertion of DNA and expression of the target protein fused to the CPD-tag, which is removed at the end of the purification step by addition of the inexpensive small molecule inositol hexakisphosphate to induce CPD autoprocessing. This process is demonstrated using a small bacterial membrane localization domain and for high yield purification of the eukaryotic small GTPase KRas. Subsequently, pCPD was tested with 40 proteins or sub-domains selected from a high throughput crystallization pipeline. pCPD vectors are easily used LIC compatible vectors for expression of recombinant proteins with a C-terminal CPD/6xHis-tag. Although intended only as a strategy for rapid tag removal, this pilot study revealed the CPD-tag may also increase expression and solubility of some recombinant proteins.

  9. Targeted gene insertion for molecular medicine.

    PubMed

    Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán

    2008-11-01

    Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.

  10. Folic acid-decorated polyamidoamine dendrimer mediates selective uptake and high expression of genes in head and neck cancer cells.

    PubMed

    Xu, Leyuan; Kittrell, Shannon; Yeudall, W Andrew; Yang, Hu

    2016-11-01

    Folic acid (FA)-decorated polyamidoamine dendrimer G4 (G4-FA) was synthesized and studied for targeted delivery of genes to head and neck cancer cells expressing high levels of folate receptors (FRs). Cellular uptake, targeting specificity, cytocompatibility and transfection efficiency were evaluated. G4-FA competes with free FA for the same binding site. G4-FA facilitates the cellular uptake of DNA plasmids in a FR-dependent manner and selectively delivers plasmids to FR-high cells, leading to enhanced gene expression. G4-FA is a suitable vector to deliver genes selectively to head and neck cancer cells. The fundamental understandings of G4-FA as a vector and its encouraging transfection results for head and neck cancer cells provided support for its further testing in vivo.

  11. Sweet Vector for Gene Delivery: the Sugar Decoration of Polyplexes Reduces Cytotoxicity with a Balanced Effect on Gene Expression.

    PubMed

    Albuquerque, Lindomar J C; Alavarse, Alex C; Carlan da Silva, Maria C; Zilse, Morgana S; Barth, Maitê T; Bellettini, Ismael C; Giacomelli, Fernando C

    2018-02-01

    The use of sugar-functionalized polyplexes as a nonviral gene delivery vector with lower cytotoxicity than the well-known polymeric carrier branched polyethyleneimine (BPEI) is investigated. The substitution of primary amine groups in the BPEI chains with lactose residues leads to larger polyplexes, presumably due to the higher amount of polymer required to complete DNA condensation. Nevertheless, the sugar functionalization substantially reduces the cytotoxicity of the assemblies. The nanocomplexes are taken up by the cells to a greater extent, whereas the levels of gene expression are maintained compared to those obtained using BPEI, which is known for its excellent transfection efficiency. Accordingly, the preparation of lower-cytotoxicity polyplexes while maintaining gene expression, which is highly relevant to the field, is demonstrated. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    PubMed

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  13. Agroinoculation of Beet necrotic yellow vein virus cDNA clones results in plant systemic infection and efficient Polymyxa betae transmission.

    PubMed

    Delbianco, Alice; Lanzoni, Chiara; Klein, Elodie; Rubies Autonell, Concepcion; Gilmer, David; Ratti, Claudio

    2013-05-01

    Agroinoculation is a quick and easy method for the infection of plants with viruses. This method involves the infiltration of tissue with a suspension of Agrobacterium tumefaciens carrying binary plasmids harbouring full-length cDNA copies of viral genome components. When transferred into host cells, transcription of the cDNA produces RNA copies of the viral genome that initiate infection. We produced full-length cDNA corresponding to Beet necrotic yellow vein virus (BNYVV) RNAs and derived replicon vectors expressing viral and fluorescent proteins in pJL89 binary plasmid under the control of the Cauliflower mosaic virus 35S promoter. We infected Nicotiana benthamiana and Beta macrocarpa plants with BNYVV by leaf agroinfiltration of combinations of agrobacteria carrying full-length cDNA clones of BNYVV RNAs. We validated the ability of agroclones to reproduce a complete viral cycle, from replication to cell-to-cell and systemic movement and, finally, plant-to-plant transmission by its plasmodiophorid vector. We also showed successful root agroinfection of B. vulgaris, a new tool for the assay of resistance to rhizomania, the sugar beet disease caused by BNYVV. © 2013 BSPP AND BLACKWELL PUBLISHING LTD.

  14. End Joining-Mediated Gene Expression in Mammalian Cells Using PCR-Amplified DNA Constructs that Contain Terminator in Front of Promoter.

    PubMed

    Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji

    2015-12-01

    Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.

  15. Studies on the Pathogenesis of Hepatitis A and Feasibility Studies on a Hepatitis A Vaccine.

    DTIC Science & Technology

    1986-03-14

    virus ; Vaccine; Recombinant DNA; 06 01 Pathogenesis; Immunity 06 02 19. ABSTRACT (Continue on reverse if necessary and identify by block numberf te...objectives of this work are to fur- ther our knowledge of the pathogenesis of hepatitis A virus (HAy) infection in man, and to develop recombinant...expression vectors for hepatitis A virus antigens that can be used to stimulate mucosal immunity. Two viral cDNA sequences encoding different forms of capsid

  16. How Alterations in the Cdt1 Expression Lead to Gene Amplification in Breast Cancer

    DTIC Science & Technology

    2011-07-01

    absence of extrinsic DNA damage. We measured the TLS activity by measuring the mutation frequency in a supF gene (in a shuttle vector) subjected to UV...induced DNA damage before its introduction into the cells. Error-prone TLS activity will mutate the supF gene , which is scored by a blue-white colony...Figure 4A). Sequencing of the mutant supF genes , revealed a mutation spectrum consistent with error prone TLS (Supplemental Table 1). Significantly

  17. Unrestricted Hepatocyte Transduction with Adeno-Associated Virus Serotype 8 Vectors in Mice

    PubMed Central

    Nakai, Hiroyuki; Fuess, Sally; Storm, Theresa A.; Muramatsu, Shin-ichi; Nara, Yuko; Kay, Mark A.

    2005-01-01

    Recombinant adeno-associated virus (rAAV) vectors can mediate long-term stable transduction in various target tissues. However, with rAAV serotype 2 (rAAV2) vectors, liver transduction is confined to only a small portion of hepatocytes even after administration of extremely high vector doses. In order to investigate whether rAAV vectors of other serotypes exhibit similar restricted liver transduction, we performed a dose-response study by injecting mice with β-galactosidase-expressing rAAV1 and rAAV8 vectors via the portal vein. The rAAV1 vector showed a blunted dose-response similar to that of rAAV2 at high doses, while the rAAV8 vector dose-response remained unchanged at any dose and ultimately could transduce all the hepatocytes at a dose of 7.2 × 1012 vector genomes/mouse without toxicity. This indicates that all hepatocytes have the ability to process incoming single-stranded vector genomes into duplex DNA. A single tail vein injection of the rAAV8 vector was as efficient as portal vein injection at any dose. In addition, intravascular administration of the rAAV8 vector at a high dose transduced all the skeletal muscles throughout the body, including the diaphragm, the entire cardiac muscle, and substantial numbers of cells in the pancreas, smooth muscles, and brain. Thus, rAAV8 is a robust vector for gene transfer to the liver and provides a promising research tool for delivering genes to various target organs. In addition, the rAAV8 vector may offer a potential therapeutic agent for various diseases affecting nonhepatic tissues, but great caution is required for vector spillover and tight control of tissue-specific gene expression. PMID:15596817

  18. A novel immunization method to induce cytotoxic T-lymphocyte responses (CTL) against plasmid-encoded herpes simplex virus type-1 glycoprotein D.

    PubMed

    Cruz, P E; Khalil, P L; Dryden, T D; Chiou, H C; Fink, P S; Berberich, S J; Bigley, N J

    1999-03-05

    DNA molecules complexed with an asialoglycoprotein-polycation conjugate, consisting of asialoorosomucoid (ASOR) coupled to poly-L-lysine, can enter hepatocytes which bear receptors for ASOR. We used this receptor-mediated DNA delivery system to deliver plasmid DNA encoding glycoprotein D (gD) of herpes simplex virus type 1 to ASOR-positive cells. Maximum expression of gD protein was seen at 3 days after injection of this preparation in approximately 13% of cells from BALB/c mice [hepatocytes from mice injected intravenously (i.v.) or peritoneal exudate cells from mice injected intraperitoneally (i.p.)]. In comparison with mice injected with either the plasmid vector alone or the gD-containing plasmid uncomplexed to ASOR, mice immunized with gD-containing plasmid complexed with ASOR-poly-L-lysine induced marked antigen-specific CTL responses. BALB/c mice immunized with gD-DNA developed a T-cell-mediated CTL response against target cells expressing gD and MHC class II glycoproteins, but not against cells expressing only gD and MHC class I molecules. In C3H mice, gD-DNA induced a T-cell-mediated CTL response against target cells expressing gD and class I MHC molecules. Serum anti-gD antibody in low titers were produced in both strains of mice. DNA complexed with ASOR-poly-L-lysine induced CTL responses in mice.

  19. A Preliminary Study on a Specifically Expressed Arabidopsis Promotor in Vascular Bundle

    NASA Astrophysics Data System (ADS)

    Yun-hong, Gu; Chuan-xiao, Xie; Li-fang, Wu; Zeng-liang, Yu; Guang-yong, Qin; Yu-ping, Huo

    2003-04-01

    From a population of about 3500 single plants in Arabidopsis promoter trapping bank, one plant whose GUS-gene had been specifically expressed in vascular bundle, was screened by the method of gus tissue staining. The T-DNA flanking sequence was amplified using TAIL-PCR. This band will be purified and connected to TA cloning vector. After sequencing and searching in the genebank, its function will be demonatrated through transformation.

  20. Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

    PubMed

    Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

    2017-08-01

    Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells.

    PubMed

    Hornstein, Benjamin D; Roman, Dany; Arévalo-Soliz, Lirio M; Engevik, Melinda A; Zechiedrich, Lynn

    2016-01-01

    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery.

  2. Effects of Circular DNA Length on Transfection Efficiency by Electroporation into HeLa Cells

    PubMed Central

    Hornstein, Benjamin D.; Roman, Dany; Arévalo-Soliz, Lirio M.; Engevik, Melinda A.

    2016-01-01

    The ability to produce extremely small and circular supercoiled vectors has opened new territory for improving non-viral gene therapy vectors. In this work, we compared transfection of supercoiled DNA vectors ranging from 383 to 4,548 bp, each encoding shRNA against GFP under control of the H1 promoter. We assessed knockdown of GFP by electroporation into HeLa cells. All of our vectors entered cells in comparable numbers when electroporated with equal moles of DNA. Despite similar cell entry, we found length-dependent differences in how efficiently the vectors knocked down GFP. As vector length increased up to 1,869 bp, GFP knockdown efficiency per mole of transfected DNA increased. From 1,869 to 4,257 bp, GFP knockdown efficiency per mole was steady, then decreased with increasing vector length. In comparing GFP knockdown with equal masses of vectors, we found that the shorter vectors transfect more efficiently per nanogram of DNA transfected. Our results rule out cell entry and DNA mass as determining factors for gene knockdown efficiency via electroporation. The length-dependent effects we have uncovered are likely explained by differences in nuclear translocation or transcription. These data add an important step towards clinical applications of non-viral vector delivery. PMID:27918590

  3. Molecular cloning of the cDNA encoding laccase from Trametes versicolor and heterologous expression in Pichia methanolica.

    PubMed

    Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang

    2005-11-01

    A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.

  4. Biodegradable DNA Nanoparticles that Provide Widespread Gene Delivery in the Brain

    PubMed Central

    Mastorakos, Panagiotis; Song, Eric; Zhang, Clark; Berry, Sneha; Park, Hee Won; Kim, Young Eun; Park, Jong Sung; Lee, Seulki; Suk, Jung Soo; Hanes, Justin

    2016-01-01

    Successful gene therapy of neurological disorders is predicated on achieving widespread and uniform transgene expression throughout the affected disease area in the brain. However, conventional gene vectors preferentially travel through low-resistance perivascular spaces and/or are confined to the administration site even with the aid of a pressure-driven flow provided by convection-enhanced delivery. Biodegradable DNA nanoparticles offer a safe gene delivery platform devoid of adverse effects associated with virus-based or synthetic non-biodegradable systems. Using a state-of-the-art biodegradable polymer, poly(β-amino ester), we engineered colloidally stable sub-100 nm DNA nanoparticles coated with a non-adhesive polyethylene glycol corona that are able to avoid the adhesive and steric hindrances imposed by the extracellular matrix. Following convection enhanced delivery, these brain-penetrating nanoparticles were able to homogeneously distribute throughout the rodent striatum and mediate widespread and high-level transgene expression. These nanoparticles provide a biodegradable DNA nanoparticle platform enabling uniform transgene expression patterns in vivo and hold promise for the treatment of neurological diseases. PMID:26680637

  5. Vector Development for the Expression of Foreign Proteins in the Vaccine Strain Brucella abortus S19

    PubMed Central

    Comerci, Diego J.; Pollevick, Guido D.; Vigliocco, Ana M.; Frasch, Alberto C. C.; Ugalde, Rodolfo A.

    1998-01-01

    A vector for the expression of foreign antigens in the vaccine strain Brucella abortus S19 was developed by using a DNA fragment containing the regulatory sequences and the signal peptide of the Brucella bcsp31 gene. This fragment was cloned in broad-host-range plasmid pBBR4MCS, resulting in plasmid pBEV. As a reporter protein, a repetitive antigen of Trypanosoma cruzi was used. The recombinant fusion protein is stably expressed and secreted into the Brucella periplasmic space, inducing a good antibody response against the T. cruzi antigen. The expression of the repetitive antigen in Brucella neither altered its growth pattern nor generated a toxic or lethal effect during experimental infection. The application of this strategy for the generation of live recombinant vaccines and the tagging of B. abortus S19 vaccine is discussed. This is the first time that a recombinant protein has been expressed in the periplasm of brucellae. PMID:9673273

  6. Heterologous viral expression systems in fosmid vectors increase the functional analysis potential of metagenomic libraries.

    PubMed

    Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E

    2013-01-01

    The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.

  7. High-level recombinant protein expression in transgenic plants by using a double-inducible viral vector

    PubMed Central

    Werner, Stefan; Breus, Oksana; Symonenko, Yuri; Marillonnet, Sylvestre; Gleba, Yuri

    2011-01-01

    We describe here a unique ethanol-inducible process for expression of recombinant proteins in transgenic plants. The process is based on inducible release of viral RNA replicons from stably integrated DNA proreplicons. A simple treatment with ethanol releases the replicon leading to RNA amplification and high-level protein production. To achieve tight control of replicon activation and spread in the uninduced state, the viral vector has been deconstructed, and its two components, the replicon and the cell-to-cell movement protein, have each been placed separately under the control of an inducible promoter. Transgenic Nicotiana benthamiana plants incorporating this double-inducible system demonstrate negligible background expression, high (over 0.5 × 104-fold) induction multiples, and high absolute levels of protein expression upon induction (up to 4.3 mg/g fresh biomass). The process can be easily scaled up, supports expression of practically important recombinant proteins, and thus can be directly used for industrial manufacturing. PMID:21825158

  8. DNA compaction into new DNA vectors based on cyclodextrin polymer: surface enhanced Raman spectroscopy characterization.

    PubMed

    Burckbuchler, V; Wintgens, V; Lecomte, S; Percot, A; Leborgne, C; Danos, O; Kichler, A; Amiel, C

    2006-04-05

    The ability of DNA to bind polycation yielding polyplexes is widely used in nonviral gene delivery. The aim of the present study was to evaluate the DNA compaction with a new DNA vector using Raman spectroscopy. The polyplexes result from an association of a beta-cyclodextrin polymer (polybeta-CD), an amphiphilic cationic connector (DC-Chol or adamantane derivative Ada2), and DNA. The charge of the polymeric vector is effectively controlled by simple addition of cationic connector in the medium. We used surface enhanced Raman spectroscopy (SERS) to characterize this ternary complex, monitoring the accessibility of adenyl residues to silver colloids. The first experiments were performed using model systems based on polyA (polyadenosine monophosphate) well characterized by SERS. This model was then extended to plasmid DNA to study polybeta-CD/Ada2/DNA and polybeta-CD/DC-Chol/DNA polyplexes. The SERS spectra show a decrease of signal intensity when the vector/DNA charge ratio (Z+/-) increases. At the highest ratio (Z+/- = 10) the signal is 6-fold and 3-fold less intense than the DNA reference signal for Ada2 and DC-Chol polyplexes, respectively. Thus adenyl residues have a reduced accessibility as DNA is bound to the vector. Moreover, the SERS intensity variations are in agreement with gel electrophoresis and zeta potential experiments on the same systems. The overall study clearly demonstrates that the cationic charges neutralizing the negative charges of DNA result in the formation of stable polyplexes. In vitro transfection efficiency of those DNA vectors are also presented and compared to the classical DC-Chol lipoplexes (DC-Chol/DNA). The results show an increase of the transfection efficiency 2-fold higher with our vector based on polybeta-CD. Copyright 2005 Wiley Periodicals, Inc.

  9. The Role of Tim50 in Chemoresistance and Oncogenesis of Breast Cancer

    DTIC Science & Technology

    2011-02-01

    digested with Hind III and Kpn I and ligated into the pGL3 vector (Promega, Madison WI) upstream of the luciferase reporter gene. This construct was...expressing vector (HC5) or mutant p53-R273H (3 x 106) were cross-linked with 1% formaldehyde for 15 min and the reaction stopped by addition of glycine to...10 mg/ml) and treated with proteinase K (20 mg/ml). Proteins were removed by phenol – chloroform extraction and the DNA isolated by ethanol

  10. NYVAC vector modified by C7L viral gene insertion improves T cell immune responses and effectiveness against leishmaniasis.

    PubMed

    Sánchez-Sampedro, L; Mejías-Pérez, E; S Sorzano, Carlos Óscar; Nájera, J L; Esteban, M

    2016-07-15

    The NYVAC poxvirus vector is used as vaccine candidate for HIV and other diseases, although there is only limited experimental information on its immunogenicity and effectiveness for use against human pathogens. Here we defined the selective advantage of NYVAC vectors in a mouse model by comparing the immune responses and protection induced by vectors that express the LACK (Leishmania-activated C-kinase antigen), alone or with insertion of the viral host range gene C7L that allows the virus to replicate in human cells. Using DNA prime/virus boost protocols, we show that replication-competent NYVAC-LACK that expresses C7L (NYVAC-LACK-C7L) induced higher-magnitude polyfunctional CD8(+) and CD4(+) primary adaptive and effector memory T cell responses (IFNγ, TNFα, IL-2, CD107a) to LACK antigen than non-replicating NYVAC-LACK. Compared to NYVAC-LACK, the NYVAC-LACK-C7L-induced CD8(+) T cell population also showed higher proliferation when stimulated with LACK antigen. After a challenge by subcutaneous Leishmania major metacyclic promastigotes, NYVAC-LACK-C7L-vaccinated mouse groups showed greater protection than the NYVAC-LACK-vaccinated group. Our results indicate that the type and potency of immune responses induced by LACK-expressing NYVAC vectors is improved by insertion of the C7L gene, and that a replication-competent vector as a vaccine renders greater protection against a human pathogen than a non-replicating vector. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

    PubMed Central

    2014-01-01

    Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

  12. Low molecular weight polyethylenimine cross-linked by 2-hydroxypropyl-gamma-cyclodextrin coupled to peptide targeting HER2 as a gene delivery vector.

    PubMed

    Huang, Hongliang; Yu, Hai; Tang, Guping; Wang, Qingqing; Li, Jun

    2010-03-01

    Gene delivery is one of the critical steps for gene therapy. Non-viral vectors have many advantages but suffered from low gene transfection efficiency. Here, in order to develop new polymeric gene vectors with low cytotoxicity and high gene transfection efficiency, we synthesized a cationic polymer composed of low molecular weight polyethylenimine (PEI) of molecular weight of 600 Da cross-linked by 2-hydroxypropyl-gamma-cyclodextrin (HP gamma-CD) and then coupled to MC-10 oligopeptide containing a sequence of Met-Ala-Arg-Ala-Lys-Glu. The oligopeptide can target to HER2, the human epidermal growth factor receptor 2, which is often over expressed in many breast and ovary cancers. The new gene vector was expected to be able to target delivery of genes to HER2 positive cancer cells for gene therapy. The new gene vector was composed of chemically bonded HP gamma-CD, PEI (600 Da), and MC-10 peptide at a molar ratio of 1:3.3:1.2. The gene vector could condense plasmid DNA at an N/P ratio of 6 or above. The particle size of HP gamma-CD-PEI-P/DNA complexes at N/P ratios 40 was around 170-200 nm, with zeta potential of about 20 mV. The gene vector showed very low cytotoxicity, strong targeting specificity to HER2 receptor, and high efficiency of delivering DNA to target cells in vitro and in vivo with the reporter genes. The delivery of therapeutic IFN-alpha gene mediated by the new gene vector and the therapeutic efficiency were also studied in mice animal model. The animal study results showed that the new gene vector HP gamma-CD-PEI-P significantly enhanced the anti-tumor effect on tumor-bearing nude mice as compared to PEI (25 kDa), HP gamma-CD-PEI, and other controls, indicating that this new polymeric gene vector is a potential candidate for cancer gene therapy. (c) 2009 Elsevier Ltd. All rights reserved.

  13. Cloning and heterologous expression of blasticidin S biosynthetic genes from Streptomyces griseochromogenes.

    PubMed

    Cone, M C; Petrich, A K; Gould, S J; Zabriskie, T M

    1998-06-01

    Two small chromosomal DNA fragments (2.6 and 4.8 kb) from the blasticidin S producer Streptomyces griseochromogenes were cloned in the high copy number vector pIJ702 and shown to confer increased resistance to blasticidin S upon S. lividans TK24. These fragments were used to screen a library of S. griseochromogenes DNA prepared in the cosmid shuttle vector pOJ446. Cosmids containing DNA inserts of at least 23 kb were identified which hybridized to one or the other resistance fragment, but not to both. Transformation of S. lividans TK24 with several cosmids hybridizing with the 4.8 kb resistance fragment resulted in clones that produced cytosylglucuronic acid, the first intermediate of the blasticidin S biosynthetic pathway, and other blasticidin-related metabolites. A strain of S. lividans TK24 harboring both the 4.8 kb-hybridizing cosmid and the 2.6 kb resistance fragment cloned in pIJ702 produced 12.5 times as much demethylblasticidin S as the transformant harboring the cosmid alone.

  14. An innovative strategy to clone positive modifier genes of defects caused by mtDNA mutations: MRPS18C as suppressor gene of m.3946G>A mutation in MT-ND1 gene.

    PubMed

    Rodríguez-García, María Elena; Cotrina-Vinagre, Francisco Javier; Carnicero-Rodríguez, Patricia; Martínez-Azorín, Francisco

    2017-07-01

    We have developed a new functional complementation approach to clone modifier genes which overexpression is able to suppress the biochemical defects caused by mtDNA mutations (suppressor genes). This strategy consists in transferring human genes into respiratory chain-deficient fibroblasts, followed by a metabolic selection in a highly selective medium. We used a normalized expression cDNA library in an episomal vector (pREP4) to transfect the fibroblasts, and a medium with glutamine and devoid of any carbohydrate source to select metabolically. Growing the patient's fibroblasts in this selective medium, the deficient cells rapidly disappear unless they are rescued by the cDNA of a suppressor gene. The use of an episomal vector allows us to carry out several rounds of transfection/selection (cyclical phenotypic rescue) to enrich the rescue with true clones of suppressor genes. Using fibroblasts from a patient with epileptic encephalopathy with the m.3946G>A (p.E214K) mutation in the MT-ND1 gene, several candidate genes were identified and one of them was characterized functionally. Thus, overexpression of MRPS18C gene (that encode for bS18m protein) suppressed the molecular defects produced by this mtDNA mutation, recovering the complex I activity and reducing the ROS produced by this complex to normal levels. We suggest that modulation of bS18m expression may be an effective therapeutic strategy for the patients with this mutation.

  15. A quantitative and high-throughput assay of human papillomavirus DNA replication.

    PubMed

    Gagnon, David; Fradet-Turcotte, Amélie; Archambault, Jacques

    2015-01-01

    Replication of the human papillomavirus (HPV) double-stranded DNA genome is accomplished by the two viral proteins E1 and E2 in concert with host DNA replication factors. HPV DNA replication is an established model of eukaryotic DNA replication and a potential target for antiviral therapy. Assays to measure the transient replication of HPV DNA in transfected cells have been developed, which rely on a plasmid carrying the viral origin of DNA replication (ori) together with expression vectors for E1 and E2. Replication of the ori-plasmid is typically measured by Southern blotting or PCR analysis of newly replicated DNA (i.e., DpnI digested DNA) several days post-transfection. Although extremely valuable, these assays have been difficult to perform in a high-throughput and quantitative manner. Here, we describe a modified version of the transient DNA replication assay that circumvents these limitations by incorporating a firefly luciferase expression cassette in cis of the ori. Replication of this ori-plasmid by E1 and E2 results in increased levels of firefly luciferase activity that can be accurately quantified and normalized to those of Renilla luciferase expressed from a control plasmid, thus obviating the need for DNA extraction, digestion, and analysis. We provide a detailed protocol for performing the HPV type 31 DNA replication assay in a 96-well plate format suitable for small-molecule screening and EC50 determinations. The quantitative and high-throughput nature of the assay should greatly facilitate the study of HPV DNA replication and the identification of inhibitors thereof.

  16. CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes.

    PubMed

    Ehrke-Schulz, Eric; Schiwon, Maren; Leitner, Theo; Dávid, Stephan; Bergmann, Thorsten; Liu, Jing; Ehrhardt, Anja

    2017-12-07

    The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system revolutionized the field of gene editing but viral delivery of the CRISPR/Cas9 system has not been fully explored. Here we adapted clinically relevant high-capacity adenoviral vectors (HCAdV) devoid of all viral genes for the delivery of the CRISPR/Cas9 machinery using a single viral vector. We present a platform enabling fast transfer of the Cas9 gene and gRNA expression units into the HCAdV genome including the option to choose between constitutive or inducible Cas9 expression and gRNA multiplexing. Efficacy and versatility of this pipeline was exemplified by producing different CRISPR/Cas9-HCAdV targeting the human papillomavirus (HPV) 18 oncogene E6, the dystrophin gene causing Duchenne muscular dystrophy (DMD) and the HIV co-receptor C-C chemokine receptor type 5 (CCR5). All CRISPR/Cas9-HCAdV proved to be efficient to deliver the respective CRISPR/Cas9 expression units and to introduce the desired DNA double strand breaks at their intended target sites in immortalized and primary cells.

  17. Foamy virus–mediated gene transfer to canine repopulating cells

    PubMed Central

    Kiem, Hans-Peter; Allen, James; Trobridge, Grant; Olson, Erik; Keyser, Kirsten; Peterson, Laura; Russell, David W.

    2007-01-01

    Foamy virus (FV) vectors are particularly attractive gene-transfer vectors for stem-cell gene therapy because they form a stable transduction intermediate in quiescent cells and can efficiently transduce hematopoietic stem cells. Here, we studied the use of FV vectors to transduce long-term hematopoietic repopulating cells in the dog, a clinically relevant large animal model. Mobilized canine peripheral blood (PB) CD34+ cells were transduced with an enhanced green fluorescent protein (EGFP)–expressing FV vector in an 18-hour transduction protocol. All 3 dogs studied had rapid neutrophil engraftment to greater than 500/μL with a median of 10 days. Transgene expression was detected in all cell lineages (B cells, T cells, granulocytes, red blood cells, and platelets), indicating multilineage engraftment of transduced cells. Up to 19% of blood cells were EGFP+, and this was confirmed at the DNA level by real-time polymerase chain reaction (PCR) and Southern blot analysis. These transduction rates were higher than the best results we obtained previously with lentiviral vectors in a similar transduction protocol. Integration site analysis also demonstrated polyclonal repopulation and the transduction of multipotential hematopoietic repopulating cells. These data suggest that FV vectors should be useful for stem-cell gene therapy, particularly for applications in which short transduction protocols are critical. PMID:16968897

  18. Transgene and immune gene expression following intramuscular injection of Atlantic salmon (Salmo salar L.) with DNA-releasing PLGA nano- and microparticles.

    PubMed

    Hølvold, Linn Benjaminsen; Fredriksen, Børge N; Bøgwald, Jarl; Dalmo, Roy A

    2013-09-01

    The use of poly-(D,L-lactic-co-glycolic) acid (PLGA) particles as carriers for DNA delivery has received considerable attention in mammalian studies. DNA vaccination of fish has been shown to elicit durable transgene expression, but no reports exist on intramuscular administration of PLGA-encapsulated plasmid DNA (pDNA). We injected Atlantic salmon (Salmo salar L.) intramuscularly with a plasmid vector containing a luciferase (Photinus pyralis) reporter gene as a) naked pDNA, b) encapsulated into PLGA nano- (~320 nm) (NP) or microparticles (~4 μm) (MP), c) in an oil-based formulation, or with empty particles of both sizes. The ability of the different pDNA-treatments to induce transgene expression was analyzed through a 70-day experimental period. Anatomical distribution patterns and depot effects were determined by tracking isotope labeled pDNA. Muscle, head kidney and spleen from all treatment groups were analyzed for proinflammatory cytokines (TNF-α, IL-1β), antiviral genes (IFN-α, Mx) and cytotoxic T-cell markers (CD8, Eomes) at mRNA transcription levels at days 1, 2, 4 and 7. Histopathological examinations were performed on injection site samples from days 2, 7 and 30. Injection of either naked pDNA or the oil-formulation was superior to particle treatments for inducing transgene expression at early time-points. Empty particles of both sizes were able to induce proinflammatory immune responses as well as degenerative and inflammatory pathology at the injection site. Microparticles demonstrated injection site depots and an inflammatory pathology comparable to the oil-based formulation. In comparison, the distribution of NP-encapsulated pDNA resembled that of naked pDNA, although encapsulation into NPs significantly elevated the expression of antiviral genes in all tissues. Together the results indicate that while naked pDNA is most efficient for inducing transgene expression, the encapsulation of pDNA into NPs up-regulates antiviral responses that could be of benefit to DNA vaccination. Copyright © 2013 Elsevier Ltd. All rights reserved.

  19. Increased receptor-mediated gene delivery to the liver by protamine-enhanced-asialofetuin-lipoplexes.

    PubMed

    Arangoa, M A; Düzgüneş, N; Tros de Ilarduya, C

    2003-01-01

    A novel lipidic vector composed of DOTAP/Chol liposomes, asialofetuin (AF), protamine sulfate and DNA has been developed. The resulting protamine-AF-lipoplexes improved significantly the levels of gene expression in cultured cells and in the liver upon i.v. administration. Lipoplexes containing the optimal amount of AF (1 microg/microg DNA) showed a 16-fold higher transfection activity in HepG2 cells than non-targeted (plain) complexes. The uptake by cells having asialoglycoprotein receptors (ASGPr) on their plasma membrane was decreased by the addition of free AF, indicating that AF-lipoplexes were taken up specifically by cells via ASGPr-mediated endocytosis. Results from transfections performed in cells defective in ASGPr, ie HeLa cells, confirmed this mechanism. By addition of the condensing peptide, protamine sulfate, smaller complexes were obtained, which enhanced even more the uptake of AF-complexes in HepG2 cells and in the liver. The optimal amount of protamine was 0.4 microg/mcirog DNA, and gene expression was about 5-fold over that obtained with AF-lipoplexes in the absence of the peptide, and 75-fold higher than that with plain conventional lipoplexes. Protamine-AF-lipoplexes increased by a factor of 12 luciferase gene expression in the liver of mice administered systemically via the tail vein, compared to plain complexes. In summary, our findings extend the scope of previous studies where AF-lipoplexes were used to introduce DNA into hepatocytes. The combination of targeting and protamine condensation obviated the need for partial hepatectomy, commonly required to obtain efficient gene delivery in this organ. Since protamine sulfate has been proven to be non-toxic in humans, the novel liver-specific vector described here may be useful for the delivery of clinically important genes to this organ.

  20. Tyrosine Mutation in AAV9 Capsid Improves Gene Transfer to the Mouse Lung.

    PubMed

    Martini, Sabrina V; Silva, Adriana L; Ferreira, Debora; Rabelo, Rafael; Ornellas, Felipe M; Gomes, Karina; Rocco, Patricia R M; Petrs-Silva, Hilda; Morales, Marcelo M

    2016-01-01

    Adeno-associated virus (AAV) vectors are being increasingly used as the vector of choice for in vivo gene delivery and gene therapy for many pulmonary diseases. Recently, it was shown that phosphorylation of surface-exposed tyrosine residues from AAV capsid targets the viral particles for ubiquitination and proteasome-mediated degradation, and mutations of these tyrosine residues lead to highly efficient vector transduction in vitro and in vivo in different organs. In this study, we evaluated the pulmonary transgene expression efficacy of AAV9 vectors containing point mutations in surface-exposed capsid tyrosine residues. Eighteen C57BL/6 mice were randomly assigned into three groups: (1) a control group (CTRL) animals underwent intratracheal (i.t.) instillation of saline, (2) the wild-type AAV9 group (WT-AAV9, 1010 vg), and (3) the tyrosine-mutant Y731F AAV9 group (M-AAV9, 1010 vg), which received (i.t.) self-complementary AAV9 vectors containing the DNA sequence of enhanced green fluorescence protein (eGFP). Four weeks after instillation, lung mechanics, morphometry, tissue cellularity, gene expression, inflammatory cytokines, and growth factor expression were analyzed. No significant differences were observed in lung mechanics and morphometry among the experimental groups. However, the number of polymorphonuclear cells was higher in the WT-AAV9 group than in the CTRL and M-AAV9 groups, suggesting that the administration of tyrosine-mutant AAV9 vectors was better tolerated. Tyrosine-mutant AAV9 vectors significantly improved transgene delivery to the lung (30%) compared with their wild-type counterparts, without eliciting an inflammatory response. Our results provide the impetus for further studies to exploit the use of AAV9 vectors as a tool for pulmonary gene therapy. © 2016 The Author(s) Published by S. Karger AG, Basel.

  1. ACTIVE EFFLUX OF ORGANIC SOLVENTS BY PSEUDOMONAS PUTIDA S12 IS INDUCED BY SOLVENTS

    EPA Science Inventory

    Induction of the membrane-associated organic solvent efflux system SrpABC of Pseudomonas putida S12 was examined by cloning a 312-bp DNA fragment, containing the srp promoter, in the broad-host-range reporter vector pKRZ-1. Compounds that are capable of inducing expression of the...

  2. Design and characterization of plasmids encoding antigenic peptides of Aha1 from Aeromonas hydrophila as prospective fish vaccines.

    PubMed

    Rauta, Pradipta R; Nayak, Bismita; Monteiro, Gabriel A; Mateus, Marília

    2017-01-10

    The current investigation aimed at designing DNA vaccines against Aeromonas hydrophila infections. The DNA vaccine candidates were designed to express two antigenic outer membrane protein (Aha1) peptides and to be delivered by a nanoparticle-based delivery system. Gene sequences of conserved regions of antigenic Aha1 [aha1(211-381), aha1(211-381)opt, aha1(703-999) and aha1(703-999)opt] were cloned into pVAX-GFP expression vector. The selected DNA vaccine candidates were purified from E. coli DH5α and transfected into Chinese hamster ovary cells. The expression of the antigenic peptides was measured in cells along post-transfection time, through the fluorescence intensity of the reporter GFP. The lipofection efficiency of aha-pVAX-GFP was highest after 24h incubation. Formulated PLGA-chitosan nanoparticle/plasmid DNA complexes were characterized in terms of size, size distribution and zeta potential. Nanocomplexes with average diameters in the range of 150-170nm transfected in a similar fashion into CHO cells confirmed transfection efficiency comparable to that of lipofection. DNA entrapment and further DNase digestion assays demonstrated ability for pDNA protection by the nanoparticles against enzymatic digestion. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Construction of broad-host-range cosmid cloning vectors: identification of genes necessary for growth of Methylobacterium organophilum on methanol

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Allen, L.N.; Hanson, R.S.

    Four new cloning vectors have been constructed from the broad-host-range cloning vector pRK290. These vectors, pLA2901, pLA2905, pLA2910, and pLA2917, confer resistance to kanamycin and tetracycline. The latter two are cosmid derivatives of pLA2901. The new vectors can be mobilized into, and are stably maintained in, a variety of gram-negative bacteria. A Sau3A genomic bank of Methylobacterium organophilum strain xx DNA has been constructed in pLA2917, and complementation analysis, with a variety of mutants unable to grow on methanol, revealed at least five separate regions necessary for growth on methanol. Complementation analysis and Tn5 mutagenesis data suggest that at leastmore » three genes are responsible for expression of active methanol dehydrogenase.« less

  4. Reverse Genetics for Newcastle Disease Virus as a Vaccine Vector.

    PubMed

    Kim, Shin-Hee; Samal, Siba K

    2018-02-22

    Newcastle disease virus (NDV) is an economically important pathogen in the poultry industry worldwide. Recovery of infectious NDV from cDNA using reverse genetics has made it possible to manipulate the genome of NDV. This has greatly contributed to our understanding of the molecular biology and pathogenesis of NDV. Furthermore, NDV has modular genome and accommodates insertion of a foreign gene as a transcriptional unit, thus enabling NDV as a vaccine vector against diseases of humans and animals. Avirulent NDV strains (e.g., LaSota and B1) have been commonly used as vaccine vectors. In this protocol, we have described reverse genetics of NDV to be used as a vaccine vector by exemplifying the recovery of NDV vectored avian influenza virus vaccine. Specifically, cloning and recovery of NDV expressing the hemagglutinin protein of highly pathogenic influenza virus were explained. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

  5. The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

    PubMed

    Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

    2010-06-01

    Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

  6. Linear Lepidopteran ambidensovirus 1 sequences drive random integration of a reporter gene in transfected Spodoptera frugiperda cells.

    PubMed

    Rizk, Francine; Laverdure, Sylvain; d'Alençon, Emmanuelle; Bossin, Hervé; Dupressoir, Thierry

    2018-01-01

    The Lepidopteran ambidensovirus 1 isolated from Junonia coenia (hereafter JcDV) is an invertebrate parvovirus considered as a viral transduction vector as well as a potential tool for the biological control of insect pests. Previous works showed that JcDV-based circular plasmids experimentally integrate into insect cells genomic DNA. In order to approach the natural conditions of infection and possible integration, we generated linear JcDV- gfp based molecules which were transfected into non permissive Spodoptera frugiperda ( Sf9 ) cultured cells. Cells were monitored for the expression of green fluorescent protein (GFP) and DNA was analyzed for integration of transduced viral sequences. Non-structural protein modulation of the VP-gene cassette promoter activity was additionally assayed. We show that linear JcDV-derived molecules are capable of long term genomic integration and sustained transgene expression in Sf9 cells. As expected, only the deletion of both inverted terminal repeats (ITR) or the polyadenylation signals of NS and VP genes dramatically impairs the global transduction/expression efficiency. However, all the integrated viral sequences we characterized appear "scrambled" whatever the viral content of the transfected vector. Despite a strong GFP expression, we were unable to recover any full sequence of the original constructs and found rearranged viral and non-viral sequences as well. Cellular flanking sequences were identified as non-coding ones. On the other hand, the kinetics of GFP expression over time led us to investigate the apparent down-regulation by non-structural proteins of the VP-gene cassette promoter. Altogether, our results show that JcDV-derived sequences included in linear DNA molecules are able to drive efficiently the integration and expression of a foreign gene into the genome of insect cells, whatever their composition, provided that at least one ITR is present. However, the transfected sequences were extensively rearranged with cellular DNA during or after random integration in the host cell genome. Lastly, the non-structural proteins seem to participate in the regulation of p9 promoter activity rather than to the integration of viral sequences.

  7. [Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].

    PubMed

    Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min

    2014-03-01

    To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.

  8. Attenuated and Replication-Competent Vaccinia Virus Strains M65 and M101 with Distinct Biology and Immunogenicity as Potential Vaccine Candidates against Pathogens

    PubMed Central

    Sánchez-Sampedro, Lucas; Gómez, Carmen Elena; Mejías-Pérez, Ernesto; Pérez-Jiménez, Eva; Oliveros, Juan Carlos

    2013-01-01

    Replication-competent poxvirus vectors with an attenuation phenotype and with a high immunogenic capacity of the foreign expressed antigen are being pursued as novel vaccine vectors against different pathogens. In this investigation, we have examined the replication and immunogenic characteristics of two vaccinia virus (VACV) mutants, M65 and M101. These mutants were generated after 65 and 101 serial passages of persistently infected Friend erythroleukemia (FEL) cells. In cultured cells of different origins, the mutants are replication competent and have growth kinetics similar to or slightly reduced in comparison with those of the parental Western Reserve (WR) virus strain. In normal and immune-suppressed infected mice, the mutants showed different levels of attenuation and pathogenicity in comparison with WR and modified vaccinia Ankara (MVA) strains. Wide genome analysis after deep sequencing revealed selected genomic deletions and mutations in a number of viral open reading frames (ORFs). Mice immunized in a DNA prime/mutant boost regimen with viral vectors expressing the LACK (Leishmania homologue for receptors of activated C kinase) antigen of Leishmania infantum showed protection or a delay in the onset of cutaneous leishmaniasis. Protection was similar to that triggered by MVA-LACK. In immunized mice, both polyfunctional CD4+ and CD8+ T cells with an effector memory phenotype were activated by the two mutants, but the DNA-LACK/M65-LACK protocol preferentially induced CD4+ whereas DNA-LACK/M101-LACK preferentially induced CD8+ T cell responses. Altogether, our findings showed the adaptive changes of the WR genome during long-term virus-host cell interaction and how the replication competency of M65 and M101 mutants confers distinct biological properties and immunogenicity in mice compared to those of the MVA strain. These mutants could have applicability for understanding VACV biology and as potential vaccine vectors against pathogens and tumors. PMID:23596295

  9. The expression of full length Gp91-phox protein is associated with reduced amphotropic retroviral production.

    PubMed

    Bellantuono, I; Lashford, L S; Rafferty, J A; Fairbairn, L J

    2000-05-01

    As a single gene defect in mature bone marrow cells, chronic granulomatous disease (X-CGD) represents a disorder which may be amenable to gene therapy by the transfer of the missing subunit into hemopoietic stem cells. In the majority of cases lack of Gp91-phox causes the disease. So far, studies involving transfer of Gp91-phox cDNA, including a phase I clinical trial, have yielded disappointing results. Most often, low titers of virus have been reported. In the present study we investigated the possible reasons for low titer amphotropic viral production. To investigate the effect of Gp91 cDNA on the efficiency of retroviral production from the packaging cell line, GP+envAm12, we constructed vectors containing either the native cDNA, truncated versions of the cDNA or a mutated form (LATG) in which the natural translational start codon was changed to a stop codon. Following derivation of clonal packaging cell lines, these were assessed for viral titer by RNA slot blot and analyzed by non-parametrical statistical analysis (Whitney-Mann U-test). An improvement in viral titer of just over two-fold was found in packaging cells containing the start-codon mutant of Gp91 and no evidence of truncated viral RNA was seen in these cells. Further analysis revealed the presence of rearranged forms of the provirus in Gp91-expressing cells, and the production of truncated, unpackaged viral RNA. Protein analysis revealed that LATG-transduced cells did not express full-length Gp91-phox, whereas those containing the wild-type cDNA did. However, a truncated protein was seen in ATG-transduced cells which was also present in wild type cells. No evidence for the presence of a negative transcriptional regulatory element was found from studies with the deletion mutants. A statistically significant effect of protein production on the production of virus from Gp91-expressing cells was found. Our data point to a need to restrict expression of the Gp91-phox protein and its derivatives in order to enhance retroviral production and suggest that improvements in current vectors for CGD gene therapy may need to include controlled, directed expression only in mature neutrophils.

  10. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    PubMed

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  11. Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

    Cancer.gov

    The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

  12. Polyethyleneimine grafted short halloysite nanotubes for gene delivery.

    PubMed

    Long, Zheru; Zhang, Jun; Shen, Yan; Zhou, Changren; Liu, Mingxian

    2017-12-01

    Inorganic nanoparticles have attracted much attentions in gene delivery because of their desirable characteristics including low toxicity, well-controlled characteristics, high gene delivery efficiency, and multi-functionalities. Here, natural occurred halloysite nanotubes (HNTs) were developed as a novel non-viral gene vector. To increase the efficiency of endocytosis, HNTs were firstly shortened into an appropriate size (~200nm). Then polyethyleneimine (PEI) was grafted onto HNTs to bind green fluorescence protein (GFP) labeled pDNA. The structure and physical-chemical properties of PEI grafted HNTs (PEI-g-HNTs) were characterized by various methods. PEI-g-HNTs show lower cytotoxicity than PEI. PEI-g-HNTs are positively charged and can bind DNA tightly at designed N/P ratio from 5:1 to 40:1. PEI-g-HNTs/pDNA complexes show much higher transfection efficiency towards both 293T and HeLa cells compared with PEI/pDNA complexes at the equivalent N/P ratio. The transfection efficiencies of PEI-g-HNTs/pDNA complex towards HeLa cell can reach to 44.4% at N/P ratio of 20. PEI-g-HNTs/pDNA complexes possess a higher GFP protein expression than PEI/pDNA from simple western immunoblots. So, PEI-g-HNTs are potential gene vectors with good biocompatibility and high transfection efficiency, which have promising applications in cancer gene therapy. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Gateway Vectors for Efficient Artificial Gene Assembly In Vitro and Expression in Yeast Saccharomyces cerevisiae

    PubMed Central

    Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi

    2013-01-01

    Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537

  14. Method for introducing unidirectional nested deletions

    DOEpatents

    Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

    2001-01-01

    Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

  15. Efficiency of RAFT-synthesized PDMAEMA in gene transfer to the retina.

    PubMed

    Bitoque, Diogo B; Simão, Sónia; Oliveira, Ana V; Machado, Susana; Duran, Margarita R; Lopes, Eduardo; da Costa, Ana M Rosa; Silva, Gabriela A

    2017-01-01

    Gene therapy has long been heralded as the new hope to evolve from symptomatic care of genetic pathologies to a full cure. Recent successes in using gene therapy for treating several ocular and haematopoietic pathologies have shown the great potential of this approach that, in the early days, relied on the use of viral vectors, which were considered by many to be undesirable for human treatment. Therefore, there is considerable interest and effort in developing non-viral vectors, with efficiency close to that of viral vectors. The aim of this study was to develop suitable non-viral carriers for gene therapy to treat pathologies affecting the retina. In this study poly(2-(N,N-dimethylamino)ethyl methacrylate), PDMAEMA was synthesized by reversible addition-fragmentation chain transfer (RAFT) and the in vitro cytocompatibility and transfection efficiency of a range of polymer:DNA ratios evaluated using a retinal cell line; in vivo biocompatibility was evaluated by ocular injection in C57BL/6 mice. The results showed that through RAFT, it is possible to produce a defined-size polymer that is compatible with cell viability in vitro and capable of efficiently directing gene expression in a polymer-DNA ratio-dependent manner. When injected into the eyes of mice, these vectors induced a transient, mild inflammation, characteristic of the implantation of medical devices. These results form the basis of future studies where RAFT-synthesized PDMAEMA will be used to deliver gene expression systems to the retina of mouse models of retinal pathologies. Copyright © 2014 John Wiley & Sons, Ltd. Copyright © 2014 John Wiley & Sons, Ltd.

  16. Effect of thiol pendant conjugates on plasmid DNA binding, release, and stability of polymeric delivery vectors.

    PubMed

    Bacalocostantis, Irene; Mane, Viraj P; Kang, Michael S; Goodley, Addison S; Muro, Silvia; Kofinas, Peter

    2012-05-14

    Polymers have attracted much attention as potential gene delivery vectors due to their chemical and structural versatility. However, several challenges associated with polymeric carriers, including low transfection efficiencies, insufficient cargo release, and high cytotoxicity levels have prevented clinical implementation. Strong electrostatic interactions between polymeric carriers and DNA cargo can prohibit complete cargo release within the cell. As a result, cargo DNA never reaches the cell's nucleus where gene expression takes place. In addition, highly charged cationic polymers have been correlated with high cytotoxicity levels, making them unsuitable carriers in vivo. Using poly(allylamine) (PAA) as a model, we investigated how pH-sensitive disulfide cross-linked polymer networks can improve the delivery potential of cationic polymer carriers. To accomplish this, we conjugated thiol-terminated pendant chains onto the primary amines of PAA using 2-iminothiolane, developing three new polymer vectors with 5, 13, or 20% thiol modification. Unmodified PAA and thiol-conjugated polymers were tested for their ability to bind and release plasmid DNA, their capacity to protect genetic cargo from enzymatic degradation, and their potential for endolysosomal escape. Our results demonstrate that polymer-plasmid complexes (polyplexes) formed by the 13% thiolated polymer demonstrate the greatest delivery potential. At high N/P ratios, all thiolated polymers (but not unmodified counterparts) were able to resist decomplexation in the presence of heparin, a negatively charged polysaccharide used to mimic in vivo polyplex-protein interactions. Further, all thiolated polymers exhibited higher buffering capacities than unmodified PAA and, therefore, have a greater potential for endolysosomal escape. However, 5 and 20% thiolated polymers exhibited poor DNA binding-release kinetics, making them unsuitable carriers for gene delivery. The 13% thiolated polymers, on the other hand, displayed high DNA binding efficiency and pH-sensitive release.

  17. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.

    2000-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  18. Methods and materials relating to IMPDH and GMP production

    DOEpatents

    Collart, Frank R.; Huberman, Eliezer

    1997-01-01

    Disclosed are purified and isolated DNA sequences encoding eukaryotic proteins possessing biological properties of inosine 5'-monophosphate dehydrogenase ("IMPDH"). Illustratively, mammalian (e.g., human) IMPDH-encoding DNA sequences are useful in transformation or transfection of host cells for the large scale recombinant production of the enzymatically active expression products and/or products (e.g., GMP) resulting from IMPDH catalyzed synthesis in cells. Vectors including IMPDH-encoding DNA sequences are useful in gene amplification procedures. Recombinant proteins and synthetic peptides provided by the invention are useful as immunological reagents and in the preparation of antibodies (including polyclonal and monoclonal antibodies) for quantitative detection of IMPDH.

  19. ECB deacylase mutants

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.

    2002-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  20. Recombination of polynucleotide sequences using random or defined primers

    DOEpatents

    Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.

    2001-01-01

    A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.

  1. Integration Profile and Safety of an Adenovirus Hybrid-Vector Utilizing Hyperactive Sleeping Beauty Transposase for Somatic Integration

    PubMed Central

    Zhang, Wenli; Muck-Hausl, Martin; Wang, Jichang; Sun, Chuanbo; Gebbing, Maren; Miskey, Csaba; Ivics, Zoltan; Izsvak, Zsuzsanna; Ehrhardt, Anja

    2013-01-01

    We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB) transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR) and linear amplification-mediated PCR (LAM-PCR). Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models. PMID:24124483

  2. Ultra-low background DNA cloning system.

    PubMed

    Goto, Kenta; Nagano, Yukio

    2013-01-01

    Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

  3. Induction and maintenance of DNA methylation in plant promoter sequences by apple latent spherical virus-induced transcriptional gene silencing

    PubMed Central

    Kon, Tatsuya; Yoshikawa, Nobuyuki

    2014-01-01

    Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109

  4. A novel recombinant pseudorabies virus expressing parvovirus VP2 gene: Immunogenicity and protective efficacy in swine.

    PubMed

    Chen, Yang; Guo, Wanzhu; Xu, Zhiwen; Yan, Qigui; Luo, Yan; Shi, Qian; Chen, Dishi; Zhu, Ling; Wang, Xiaoyu

    2011-06-16

    Porcine parvovirus (PPV) VP2 gene has been successfully expressed in many expression systems resulting in self-assembly of virus-like particles (VLPs) with similar morphology to the native capsid. Here, a pseudorabies virus (PRV) system was adopted to express the PPV VP2 gene. A recombinant PRV SA215/VP2 was obtained by homologous recombination between the vector PRV viral DNA and a transfer plasmid. Then recombinant virus was purified with plaque purification, and its identity confirmed by PCR amplification, Western blot and indirect immunofluorescence (IFA) analyses. Electronic microscopy of PRV SA215/VP2 confirmed self-assembly of both pseudorabies virus and VLPs from VP2 protein. Immunization of piglets with recombinant virus elicited PRV-specific and PPV-specific humoral immune responses and provided complete protection against a lethal dose of PRV challenges. Gilts immunized with recombinant viruses induced PPV-specific antibodies, and significantly reduced the mortality rate of (1 of 28) following virulent PPV challenge compared with the control (7 of 31). Furthermore, PPV virus DNA was not detected in the fetuses of recombinant virus immunized gilts. In this study, a recombinant PRV SA215/VP2 virus expressing PPV VP2 protein was constructed using PRV SA215 vector. The safety, immunogenicity, and protective efficacy of the recombinant virus were demonstrated in piglets and primiparous gilts. This recombinant PRV SA215/VP2 represents a suitable candidate for the development of a bivalent vaccine against both PRV and PPV infection.

  5. Cloning and Expression of cDNA for Rat Heme Oxygenase

    NASA Astrophysics Data System (ADS)

    Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

    1985-12-01

    Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

  6. Molecular and Immunogenic Properties of Apyrase SP01B and D7-Related SP04 Recombinant Salivary Proteins of Phlebotomus perniciosus from Madrid, Spain

    PubMed Central

    Martín-Martín, Inés

    2013-01-01

    Sand fly salivary proteins are on the spotlight to become vaccine candidates against leishmaniasis and to markers of exposure to sand fly bites due to the host immune responses they elicit. Working with the whole salivary homogenate entails serious drawbacks such as the need for maintaining sand fly colonies and the laborious task of glands dissection. In order to overcome these difficulties, producing recombinant proteins of different vectors has become a major task. In this study, a cDNA library was constructed with the salivary glands of Phlebotomus perniciosus from Madrid, Spain, the most widespread vector of Leishmania infantum in the Mediterranean basin. Analysis of the cDNA sequences showed several polymorphisms among the previously described salivary transcripts. The apyrase SP01B and the D7-related protein SP04 were successfully cloned, expressed in Escherichia coli, and purified. Besides, recombinant proteins were recognized by sera of hamsters and mice previously immunized with saliva through the exposure to uninfected sand fly bites. These results suggest that these two recombinant proteins conserved their immunogenic properties after expression in a prokaryote system. Therefore, this work contributes to expand the knowledge of P. perniciosus saliva that would be eventually used for the development of tools for vector control programs. PMID:24171166

  7. FABP4-mediated homocysteine-induced cholesterol accumulation in THP-1 monocyte-derived macrophages and the potential epigenetic mechanism.

    PubMed

    Jiang, Yideng; Ma, Shengchao; Zhang, Huiping; Yang, Xiaoling; Lu, Guan Jun; Zhang, Hui; He, Yangyang; Kong, Fanqi; Yang, Anning; Xu, Hua; Zhang, Minghao; Jiao, Yun; Li, Guizhong; Cao, Jun; Jia, Yuexia; Jin, Shaoju; Wei, Jun; Shi, Yingkang

    2016-07-01

    Hyperhomocysteinemia (HHcy) is an independent risk factor for the development of atherosclerosis (AS), according to overwhelming number of clinical and epidemiological studies. However, the underlying pathogenic molecular mechanisms by which HHcy promotes AS remain to be fully elucidated. Fatty acid binding protein 4 (FABP4) has been shown to be important in macrophage cholesterol trafficking. The objective of the present study was to determine whether homocysteine (Hcy) accelerates AS through regulating FABP4, and then mediates cholesterol accumulation in macrophages. Hcy concentrations of 0, 50, 100, 200 and 500 µM, and 100 µM Hcy+30 µM vitamin B12 (VB12)+30 µM folic acid (FA) were respectively added to cultured THP‑1 monocyte‑derived macrophages for 24 h. The levels of FABP4, which acts as a key factor connecting cellular lipid accumulation to inflammation, were determined using reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) and western blot analyses in the macrophages. The present study used a nested touchdown methylation‑specific PCR assay to detect the DNA methylation status of the FABP4 promoter region. In addition, the FABP4 gene fragment was inserted into the cloning vector, pcDNA3.1‑EGFP, to construct the recombinant plasmid, pcDNA3.1‑EGFP/FABP4, which was identified using restriction endonuclease digestion analysis and DNA sequencing. The pcDNA3.1‑EGFP/FABP4 expression plasmid was transfected into THP‑1 monocyte‑derived macrophages, mediated by liposome reagent, following which the expression levels of FABP4 were detected using RT‑qPCR and western blot analyses. The present study also determined the intracellular accumulation of total cholesterol in the macrophages. The results indicated that Hcy decreased the levels of FABP4 promoter methylation, but increased the mRNA and protein expression levels of FABP4 in the macrophages, compared with the control group (0 µM Hcy). However, no dose‑dependent changes were observed with increasing concentrations of Hcy. The recombinant fluorescent eukaryotic expression vector, pcDNA3.1‑EGFP/FABP4, was successfully constructed and effectively expressed in the THP‑1 macrophages. The results also showed that FABP4 accelerated the accumulation of cholesterol in the macrophages. Taken together, the results of the present study suggested that FABP4 DNA hypomethylation induced by Hcy may be involved in the overexpression of FABP4, thereby inducing cholesterol accumulation in macrophages.

  8. Advances in Non-Viral DNA Vectors for Gene Therapy

    PubMed Central

    Hardee, Cinnamon L.; Arévalo-Soliz, Lirio Milenka; Hornstein, Benjamin D.; Zechiedrich, Lynn

    2017-01-01

    Uses of viral vectors have thus far eclipsed uses of non-viral vectors for gene therapy delivery in the clinic. Viral vectors, however, have certain issues involving genome integration, the inability to be delivered repeatedly, and possible host rejection. Fortunately, development of non-viral DNA vectors has progressed steadily, especially in plasmid vector length reduction, now allowing these tools to fill in specifically where viral or other non-viral vectors may not be the best options. In this review, we examine the improvements made to non-viral DNA gene therapy vectors, highlight opportunities for their further development, address therapeutic needs for which their use is the logical choice, and discuss their future expansion into the clinic. PMID:28208635

  9. Catalytic site of human protein-glucosylgalactosylhydroxylysine glucosidase: Three crucial carboxyl residues were determined by cloning and site-directed mutagenesis.

    PubMed

    Hamazaki, Hideaki; Hamazaki, Michiko Horikawa

    2016-01-15

    Protein-glucosylgalactosylhydroxylysine glucosidase (PGGHG; EC3.2.1.107) cleaves glucose from disaccharide unit (Glc-α1,2-Gal) linked to hydroxylysine residues of collagen. In the present paper we first show that PGGHG is the product of ATHL1 gene as follows. (1) PGGHG was purified from chick embryos and digested with trypsin. LC-MS/MS analysis suggested the tryptic-peptides were from the ATHL1 gene product. (2) Chick embryo ATHL1 cDNA was cloned to a cloning and expression vector and two plasmid clones with different ATHL1 CDS insert were obtained. (3) Each plasmid DNA was transformed into Escherichia coli cells for expression and two isoforms of chicken PGGHG were obtained. (4) Both isoforms effectively released glucose from type IV collagen. Next, we searched for carboxyl residues crucial for catalytic activity as follows; human ATHL1 cDNA was cloned into a cloning and expression vector and 18 mutants were obtained by site-directed mutagenesis for 15 carboxyl residues conserved in ATHL1 of jawed vertebrates. The expression analysis indicated that substitutions of Asp301, Glu430 and Glu574 with sterically conservative (D301N, E430Q, E574Q) or functionally conservative (D301E, E430D, E574D) residues led to the complete elimination of enzyme activity. These findings lead us to the conclusion that PGGHG is encoded by ATHL1 and three carboxyl residues (corresponding to Asp301, Glu430 and Glu574 of human PGGHG) might be involved in the catalytic site of PGGHG. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Constitutively expressing cell lines that secrete a truncated bovine herpes virus-1 glycoprotein (gpI) stimulate T-lymphocyte responsiveness.

    PubMed

    Leary, T P; Gao, Y; Splitter, G A

    1992-07-01

    The desire to obtain authentically glycosylated viral protein products in sufficient quantity for immunological study has led to the use of eucaryotic expression vectors for protein production. An additional advantage is that these protein products can be studied individually in the absence of their native viral environment. We have cloned a complementary DNA (cDNA) encoding bovine herpes virus-1 (BHV-1) glycoprotein 1 (gpI) into the eucaryotic expression vector, pZipNeo SVX1. Since this protein is normally embedded within the membrane of BHV-1 infected cells, we removed sequences encoding the transmembrane domain of the native protein. After transfection of the plasmid construct into the canine osteosarcoma cell line, D17, or Madin-Darby bovine kidney (MDBK) cells, a truncated BHV-1 (gpI) was secreted into the culture medium as demonstrated by radioimmunoprecipitation and SDS-PAGE. Both a CD4+ T-lymphocyte line specific for BHV-1 and freshly isolated T lymphocytes could recognize and respond to the secreted recombinant gpI. Further, recombinant gpI could elicit both antibody and cellular responses in cattle when used as an immunogen. Having established constitutively glycoprotein producing cell lines, future studies in vaccine evaluation of gpI will be facilitated.

  11. [Expression of Dengue virus type 2 nonstructural protein 3 and isolation of host proteins interacting with it].

    PubMed

    Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen

    2015-12-01

    To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.

  12. [Over-expression of uracil DNA glycosylase 2 (UNG2) enhances the resistance to oxidative damage in HepG2 cells].

    PubMed

    Cao, Liyan; Cheng, Shan; Du, Juan; Guo, Yanhai; Huang, Xiaofeng

    2017-04-01

    Objective To investigate the uracil glycosidic enzyme activity of uracil DNA glycosylase 2 (UNG2) and study the role of UNG2 in the resistance of antioxidant stress of HepG2 cells. Methods The UNG2-expressing vector was built. Western blotting was used to detect the expression of UNG2. Immunofluorescence staining was performed to observe the cellular location of UNG2. Oligonucleotide was used as substrate for the determination of the UNG2 glycosidic enzyme activity. H 2 O 2 toxicity assay was done to study the function of UNG2 in the antioxidant resistance of hepatocellular carcinoma HepG2 cells. Results UNG2 was successfully over-expressed in HEK293FT cells, and UNG2 was found to be mainly located in nucleus. Enzyme activity assay showed that UNG2 had significant oligonucleotide dU glycosidic enzyme activity. H 2 O 2 toxicity assay showed that over-expressed UNG2 could remarkably increase the survival of HepG2 cells after exposed to H 2 O 2 . Conclusion UNG2 possesses specific DNA glycosidic enzyme activity, and it can protect HepG2 cells against oxidative stress damage.

  13. Physical Characterization of Gemini Surfactant-Based Synthetic Vectors for the Delivery of Linear Covalently Closed (LCC) DNA Ministrings

    PubMed Central

    Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn

    2015-01-01

    In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857

  14. Vaxvec: The first web-based recombinant vaccine vector database and its data analysis

    PubMed Central

    Deng, Shunzhou; Martin, Carly; Patil, Rasika; Zhu, Felix; Zhao, Bin; Xiang, Zuoshuang; He, Yongqun

    2015-01-01

    A recombinant vector vaccine uses an attenuated virus, bacterium, or parasite as the carrier to express a heterologous antigen(s). Many recombinant vaccine vectors and related vaccines have been developed and extensively investigated. To compare and better understand recombinant vectors and vaccines, we have generated Vaxvec (http://www.violinet.org/vaxvec), the first web-based database that stores various recombinant vaccine vectors and those experimentally verified vaccines that use these vectors. Vaxvec has now included 59 vaccine vectors that have been used in 196 recombinant vector vaccines against 66 pathogens and cancers. These vectors are classified to 41 viral vectors, 15 bacterial vectors, 1 parasitic vector, and 1 fungal vector. The most commonly used viral vaccine vectors are double-stranded DNA viruses, including herpesviruses, adenoviruses, and poxviruses. For example, Vaxvec includes 63 poxvirus-based recombinant vaccines for over 20 pathogens and cancers. Vaxvec collects 30 recombinant vector influenza vaccines that use 17 recombinant vectors and were experimentally tested in 7 animal models. In addition, over 60 protective antigens used in recombinant vector vaccines are annotated and analyzed. User-friendly web-interfaces are available for querying various data in Vaxvec. To support data exchange, the information of vaccine vectors, vaccines, and related information is stored in the Vaccine Ontology (VO). Vaxvec is a timely and vital source of vaccine vector database and facilitates efficient vaccine vector research and development. PMID:26403370

  15. Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

    PubMed

    Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

    2013-06-24

    Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

  16. cDNA cloning, functional expression and cellular localization of rat liver mitochondrial electron-transfer flavoprotein-ubiquinone oxidoreductase protein.

    PubMed

    Huang, Shengbing; Song, Wei; Lin, Qishui

    2005-08-01

    A membrane-bound protein was purified from rat liver mitochondria. After being digested with V8 protease, two peptides containing identical 14 amino acid residue sequences were obtained. Using the 14 amino acid peptide derived DNA sequence as gene specific primer, the cDNA of correspondent gene 5'-terminal and 3'-terminal were obtained by RACE technique. The full-length cDNA that encoded a protein of 616 amino acids was thus cloned, which included the above mentioned peptide sequence. The full length cDNA was highly homologous to that of human ETF-QO, indicating that it may be the cDNA of rat ETF-QO. ETF-QO is an iron sulfur protein located in mitochondria inner membrane containing two kinds of redox center: FAD and [4Fe-4S] center. After comparing the sequence from the cDNA of the 616 amino acids protein with that of the mature protein of rat liver mitochondria, it was found that the N terminal 32 amino acid residues did not exist in the mature protein, indicating that the cDNA was that of ETF-QOp. When the cDNA was expressed in Saccharomyces cerevisiae with inducible vectors, the protein product was enriched in mitochondrial fraction and exhibited electron transfer activity (NBT reductase activity) of ETF-QO. Results demonstrated that the 32 amino acid peptide was a mitochondrial targeting peptide, and both FAD and iron-sulfur cluster were inserted properly into the expressed ETF-QO. ETF-QO had a high level expression in rat heart, liver and kidney. The fusion protein of GFP-ETF-QO co-localized with mitochondria in COS-7 cells.

  17. [A new strategy of gene therapy for hyperphenylalaninemia rats].

    PubMed

    Jia, X; Liu, J; Xiang, H

    2000-06-01

    To construct a recombinant vector which expresses active phenylalanine-amonia-lyase (PAL) in Lactococcus lactis (L. L.), and to convert phe into cinnamic acid in small intestine by the engineering L. L. to decrease the phe level in the peripheral blood, and to cure hyperphenylalaninemia rats. PAL cDNA from Petroselinum crispum was subcloned into expression vector pMG36e and transformed L. L. The pMG36ePAL/L.L. was screened and characterized by using PCR and HPLC, and prepared as enteric-coated microcapsules and oral liquid type preparation that were given orally to hyperphenylalaninemia-rats. Engineering L. L. expressing PAL activity was obtained. The phe levels plasma of in the rats receiving preparations made from the engineering L. L. were significantly reduced compared with non-treated hyperphenylalaninemia rats. And the effects of different preparations were different from each other. The engineering L. L. expressing PAL activity can reduce the blood phe level of the hyperphenylalaninemia rats. This may be a potential way for PKU gene therapeutics.

  18. Construction and heterologous expression of a truncated Haemagglutinin (HA) protein from the avian influenza virus H5N1 in Escherichia coli.

    PubMed

    Chee Wei, T; Nurul Wahida, A G; Shaharum, S

    2014-12-01

    Malaysia first reported H5N1 poultry case in 2004 and subsequently outbreak in poultry population in 2007. Here, a recombinant gene encoding of peptide epitopes, consisting fragments of HA1, HA2 and a polybasic cleavage site of H5N1 strain Malaysia, was amplified and cloned into pET-47b(+) bacterial expression vector. DNA sequencing and alignment analysis confirmed that the gene had no alteration and in-frame to the vector. Then, His-tagged truncated HA protein was expressed in Escherichia coli BL21 (DE3) under 1 mM IPTG induction. The protein expression was optimized under a time-course induction study and further purified using Ni-NTA agarose under reducing condition. Migration size of protein was detected at 15 kDa by Western blot using anti-His tag monoclonal antibody and demonstrated no discrepancy compared to its calculated molecular weight.

  19. [Prokaryotic expression of recombinant prochymosin gene and its antiserum preparation].

    PubMed

    Li, Xin-ping; Liu, Huan-huan; Pu, Yan; Zhang, Fu-chun; Li, Yi-jie

    2012-07-01

    To optimize the prochymosin (pCHY) gene codons and express the gene in Escherichia coli (E.coli), and to prepare its antiserum and detect chymosin protein specifically. According to codon usage bias of E.coli, prochymosin gene sequence was synthesized based on the conserved sequences of prochymosin gene from bovine, lamb and camel, and then cloned into the plasmid pET-30a and pcDNA3-AAT-COMP-C3d3 (pcD-ACC), respectively. pET-30a-pCHY was expressed, as the detected antigen, in E.coli BL21(DE3) after IPTG induction. RT-PCR was used to detect prochymosin mRNA expression in liver from the mice injected pcDNA3-AAT-COMP-pCHY-C3d3(pACCC) by hydrodynamics-based transfection method. To prepare the antiserum of prochymosin, pACCC and GST-pCHY proteins were used to immunize New Zealand rabbits in accordance with DNA prime-protein boost strategy. Antibody levels were tested by ELISA. Western blotting showed the molecular weight of His-pCHY protein was about 55 000, similar to the expected molecular size. ELISA demonstrated that the titer level of prochymosin antiserum was high. Based on the codon optimization, we have obtained high-titer prochymosin antiserum through DNA vaccine vector pcD-ACC combined with DNA prime-protein boost strategy, similar to that by protein vaccine.

  20. Immunogenicity of a DNA-launched replicon-based canine parvovirus DNA vaccine expressing VP2 antigen in dogs.

    PubMed

    Dahiya, Shyam S; Saini, Mohini; Kumar, Pankaj; Gupta, Praveen K

    2012-10-01

    A replicon-based DNA vaccine encoding VP2 gene of canine parvovirus (CPV) was developed by cloning CPV-VP2 gene into a replicon-based DNA vaccine vector (pAlpha). The characteristics of a replicon-based DNA vaccine like, self-amplification of transcripts and induction of apoptosis were analyzed in transfected mammalian cells. When the pAlpha-CPV-VP2 was injected intradermal as DNA-launched replicon-based DNA vaccine in dogs, it induced CPV-specific humoral and cell mediated immune responses. The virus neutralization antibody and lymphocyte proliferative responses were higher than conventional CPV DNA vaccine and commercial CPV vaccine. These results indicated that DNA-launched replicon-based CPV DNA vaccine was effective in inducing both CPV-specific humoral and cellular immune responses and can be considered as effective alternative to conventional CPV DNA vaccine and commercial CPV vaccine. Crown Copyright © 2012. Published by Elsevier India Pvt Ltd. All rights reserved.

  1. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    PubMed

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  2. Peptide-matrix-mediated gene transfer of an oxygen-insensitive hypoxia-inducible factor-1alpha variant for local induction of angiogenesis.

    PubMed

    Trentin, Diana; Hall, Heike; Wechsler, Sandra; Hubbell, Jeffrey A

    2006-02-21

    Hypoxia-inducible factor (HIF) constitutes a target in therapeutic angiogenesis. HIF-1alpha functions as a sensor of hypoxia and induces expression of vascular endothelial growth factor (VEGF), which then induces angiogenesis. To explore the potential of HIF-1alpha gene therapy in stimulating wound healing, we delivered a gene encoding a stabilized form of HIF-1alpha, lacking the oxygen-sensitive degradation domain, namely HIF-1alpha deltaODD, by using a previously characterized peptide-based gene delivery vector in fibrin as a surgical matrix. The peptide vector consisted of multiple domains: (i) A cysteine-flanked lysine hexamer provided DNA interactions that were stable extracellularly but destabilized intracellularly after reduction of the formed disulfide bonds. This DNA-binding domain was fused to either (ii) a fibrin-binding peptide for entrapment within the matrix or (iii) a nuclear localization sequence for efficient nuclear targeting. The HIF-1alpha deltaODD gene was expressed and translocated to the nucleus under normoxic conditions, leading to up-regulation of vascular endothelial growth factor (VEGF)-A165 mRNA and protein levels in vitro. When the peptide-DNA nanoparticles entrapped in fibrin matrices were applied to full-thickness dermal wounds in the mouse (10 microg per wound in 30 microl of fibrin), angiogenesis was increased comparably strongly to that induced by VEGF-A165 protein (1.25 microg per wound in 30 microl of fibrin). However, the maturity of the vessels induced by HIF-1alpha deltaODD was significantly higher than that induced by VEGF-A165 protein, as shown by stabilization of the neovessels with smooth muscle. Nonviral, local administration of this potent angiogenesis-inducing gene by using this peptide vector represents a powerful approach in tissue engineering and therapeutic angiogenesis.

  3. Satellite DNA-based artificial chromosomes for use in gene therapy.

    PubMed

    Hadlaczky, G

    2001-04-01

    Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.

  4. Construction of an agglutination tool: recombinant Fab fragments biotinylated in vitro.

    PubMed

    Czerwinski, Marcin; Krop-Watorek, Anna; Wasniowska, Kazimiera; Smolarek, Dorota; Spitalnik, Steven L

    2009-11-30

    The pComb3H vector system is used for constructing and panning recombinant antibody libraries. It allows for expression of monovalent Fab fragments, either on the surface of M13 phage, or in the form of soluble proteins secreted into the periplasmic space of bacteria. We constructed a modified pComb3H vector containing cDNA encoding for a 23-amino acid fragment of the Escherichia coli biotin carboxy carrier protein (BCCP), which is an acceptor sequence for biotinylation. The vector was used to express the Fab fragment recognizing human glycophorin A. The purified Fab fragment containing this biotin acceptor sequence was effectively biotinylated in vitro using biotin ligase (BirA). The specificity and avidity of the biotinylated Fab fragments were similar to the previously produced, unmodified Fab fragments. An avidin-alkaline phosphatase conjugate was used to detect the recombinant Fab fragments, instead of secondary antibody. In addition, when biotinylated Fab fragments were mixed with avidin, red blood cells were directly agglutinated.

  5. Generation, Analysis and Functional Annotation of Expressed Sequence Tags from the Sheepshead Minnow (Cyprinodon variegatus)

    DTIC Science & Technology

    2010-01-01

    any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a...CA) were cloned using the pGEM-T Easy Vector System (Promega, Madison, WI) and Electromax DH10B T1 Phage Resistant Cells (Invitrogen, Carlsbad, CA...reactions were performed using 75ng of plasmid DNA template and a M13 (-40) forward primer according to the manufac- turer’s protocol for DNA sequencing of

  6. Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures.

    PubMed

    Zhang, Xiuren; Mason, Hugh

    2006-02-05

    A novel stable transgenic plant expression system was developed using elements of the replication machinery of Bean Yellow Dwarf Virus (BeYDV). The system contains two transgenes: 1) The BeYDV replicon vector with an expression cassette flanked by cis-acting DNA elements of BeYDV, and 2) The viral replication initiator protein (Rep) controlled by an alcohol-inducible promoter. When Rep expression was triggered by treatment with ethanol, it induced release of the BeYDV replicon from stably integrated T-DNA and episomal replication to high copy number. Replicon amplification resulted in substantially increased transgene mRNA levels (up to 80-fold) and translation products (up to 10-fold) after induction of Rep expression by ethanol treatment in tobacco NT1 cells and leaves of whole potato plants. Thus, the BeYDV stable transformant replicon system is a powerful tool for plant-based production of recombinant proteins. (c) 2005 Wiley Periodicals, Inc.

  7. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses.

    PubMed

    Billeter, M A; Naim, H Y; Udem, S A

    2009-01-01

    An overview is given on the development of technologies to allow reverse genetics of RNA viruses, i.e., the rescue of viruses from cDNA, with emphasis on nonsegmented negative-strand RNA viruses (Mononegavirales), as exemplified for measles virus (MV). Primarily, these technologies allowed site-directed mutagenesis, enabling important insights into a variety of aspects of the biology of these viruses. Concomitantly, foreign coding sequences were inserted to (a) allow localization of virus replication in vivo through marker gene expression, (b) develop candidate multivalent vaccines against measles and other pathogens, and (c) create candidate oncolytic viruses. The vector use of these viruses was experimentally encouraged by the pronounced genetic stability of the recombinants unexpected for RNA viruses, and by the high load of insertable genetic material, in excess of 6 kb. The known assets, such as the small genome size of the vector in comparison to DNA viruses proposed as vectors, the extensive clinical experience of attenuated MV as vaccine with a proven record of high safety and efficacy, and the low production cost per vaccination dose are thus favorably complemented.

  8. Protective efficacy of a Treponema pallidum Gpd DNA vaccine vectored by chitosan nanoparticles and fused with interleukin-2.

    PubMed

    Zhao, Feijun; Wang, Shiping; Zhang, Xiaohong; Gu, Weiming; Yu, Jian; Liu, Shuangquan; Zeng, Tiebing; Zhang, Yuejun; Wu, Yimou

    2012-02-01

    In the present study, immunomodulatory responses of a DNA vaccine constructed by fusing Treponema pallidum (Tp) glycerophosphodiester phosphodiesterase (Gpd) to interleukin-2 (IL-2) and using chitosan (CS) nanoparticles as vectors were investigated. New Zealand white rabbits were immunized by intramuscular inoculation of control DNAs, Tp Gpd DNA vaccine, or Gpd-IL-2 fusion DNA vaccine, which were vectored by CS nanoparticles. Levels of the anti-Gpd antibodies and levels of IL-2 and interferon-γ in rabbits were increased upon inoculation of Gpd-IL-2 fusion DNA vaccine, when compared with the inoculation with Gpd DNA vaccine, with CS vectoring increasing the effects. The Gpd-IL-2 fusion DNA vaccine efficiently enhanced the antigen-specific lymphocyte proliferative response. When the rabbits were challenged intradermally with 10(5) Tp (Nichols) spirochetes, the Gpd-IL-2 fusion DNA vaccine conferred better protection than the Gpd DNA vaccine (P < 0.05), as characterized by lower detectable amounts of dark field positive lesions (17.5%), lower ulcerative lesion scores (15%), and faster recovery. Individuals treated with the Tp Gpd-IL-2 fusion DNA vaccine vectored by CS nanoparticles had the lowest amounts of dark field positive lesions (10%) and ulcerations (5%) observed and the fastest recovery (42 days). These results indicate that the Gpd-IL-2 fusion DNA vaccine vectored by CS nanoparticles can efficiently induce Th1-dominant immune responses, improve protective efficacy against Tp spirochete infection, and effectively attenuate development of syphilitic lesions.

  9. Biodegradable brain-penetrating DNA nanocomplexes and their use to treat malignant brain tumors

    PubMed Central

    Mastorakos, Panagiotis; Zhang, Clark; Song, Eric; Kim, Young Eun; Park, Hee Won; Berry, Sneha; Choi, Won Kyu; Hanes, Justin; Suk, Jung Soo

    2018-01-01

    The discovery of powerful genetic targets has spurred clinical development of gene therapy approaches to treat patients with malignant brain tumors. However, lack of success in the clinic has been attributed to the inability of conventional gene vectors to achieve gene transfer throughout highly disseminated primary brain tumors. Here, we demonstrate ex vivo that small nanocomplexes composed of DNA condensed by a blend of biodegradable polymer, poly(β-amino ester) (PBAE), with PBAE conjugated with 5 kDa polyethylene glycol (PEG) molecules (PBAE-PEG) rapidly penetrate healthy brain parenchyma and orthotopic brain tumor tissues in rats. Rapid diffusion of these DNA-loaded nanocomplexes observed in fresh tissues ex vivo demonstrated that they avoided adhesive trapping in the brain owing to their dense PEG coating, which was critical to achieving widespread transgene expression throughout orthotopic rat brain tumors in vivo following administration by convection enhanced delivery. Transgene expression with the PBAE/PBAE-PEG blended nanocomplexes (DNA-loaded brain-penetrating nanocomplexes, or DNA-BPN) was uniform throughout the tumor core compared to nanocomplexes composed of DNA with PBAE only (DNA-loaded conventional nanocomplexes, or DNA-CN), and transgene expression reached beyond the tumor edge, where infiltrative cancer cells are found, only for the DNA-BPN formulation. Finally, DNA-BPN loaded with anti-cancer plasmid DNA provided significantly enhanced survival compared to the same plasmid DNA loaded in DNA-CN in two aggressive orthotopic brain tumor models in rats. These findings underscore the importance of achieving widespread delivery of therapeutic nucleic acids within brain tumors and provide a promising new delivery platform for localized gene therapy in the brain. PMID:28694032

  10. Enhancement of reverse transfection efficiency by combining stimulated DNA surface desorption and electroporation

    NASA Astrophysics Data System (ADS)

    Creasey, Rhiannon; Hook, Andrew; Thissen, Helmut; Voelcker, Nicolas H.

    2007-12-01

    Transfection cell microarrays (TCMs) are a high-throughput, miniaturised cell-culture system utilising reverse transfection, in which cells are seeded onto a DNA array resulting in localised regions of transfected cells. TCMs are useful for the analysis of gene expression, and can be used to identify genes involved in many cellular processes. This is of significant interest in fields such as tissue engineering, diagnostic screening, and drug testing [1, 2]. Low transfection efficiency has so far limited the application and utility of this technique. Recently, the transfection efficiency of TCMs was improved by an application of a high voltage for a short period of time to the DNA array resulting in the electroporation of cells attached to the surface [3, 4]. Furthermore, application of a low voltage for a longer period of time to the DNA array was shown to improve the transfection efficiency by stimulating the desorption of attached DNA, increasing the concentration of DNA available for cellular uptake [5]. In the present study, the optimisation of the uptake of adsorbed DNA vectors by adherent cells, utilising a voltage bias without compromising cell viability was investigated. This was achieved by depositing negatively charged DNA plasmids onto a positively charged allylamine plasma polymer (ALAPP) layer deposited on highly doped p-type silicon wafers either using a pipettor or a microarray contact printer. Surface-dependant human embryonic kidney (HEK 293 line) cells were cultured onto the DNA vector loaded ALAPP spots and the plasmid transfection events were detected by fluorescence microscopy. Cell viability assays, including fluorescein diacetate (FDA) / Hoechst DNA labelling, were carried out to determine the number of live adherent cells before and after application of a voltage. A protocol was developed to screen for voltage biases and exposure times in order to optimise transfection efficiency and cell viability. Cross-contamination between the microarray spots carrying different DNA vectors was also investigated. By application of a voltage of 286 V/cm for 10 ms, transfection efficiency was doubled compared to using only transfection reagent, whilst maintaining a cell viability of 60-70% of the positive control.

  11. Intramuscular delivery of heterodimeric IL-15 DNA in macaques produces systemic levels of bioactive cytokine inducing proliferation of NK and T cells.

    PubMed

    Bergamaschi, C; Kulkarni, V; Rosati, M; Alicea, C; Jalah, R; Chen, S; Bear, J; Sardesai, N Y; Valentin, A; Felber, B K; Pavlakis, G N

    2015-01-01

    Interleukin-15 (IL-15) is a common γ-chain cytokine that has a significant role in the activation and proliferation of T and NK cells and holds great potential in fighting infection and cancer. We have previously shown that bioactive IL-15 in vivo comprises a complex of the IL-15 chain with the soluble or cell-associated IL-15 receptor alpha (IL-15Rα) chain, which together form the IL-15 heterodimer. We have generated DNA vectors expressing the heterodimeric IL-15 by optimizing mRNA expression and protein trafficking. Repeated administration of these DNA plasmids by intramuscular injection followed by in vivo electroporation in rhesus macaques resulted in sustained high levels of IL-15 in plasma, with no significant toxicity. Administration of DNAs expressing heterodimeric IL-15 also resulted in an increased frequency of NK and T cells undergoing proliferation in peripheral blood. Heterodimeric IL-15 led to preferential expansion of CD8(+)NK cells, all memory CD8(+) T-cell subsets and effector memory CD4(+) T cells. Expression of heterodimeric IL-15 by DNA delivery to the muscle is an efficient procedure to obtain high systemic levels of bioactive cytokine, without the toxicity linked to the high transient cytokine peak associated with protein injection.

  12. Specific insertions of zinc finger domains into Gag-Pol yield engineered retroviral vectors with selective integration properties

    PubMed Central

    Lim, Kwang-il; Klimczak, Ryan; Yu, Julie H.; Schaffer, David V.

    2010-01-01

    Retroviral vectors offer benefits of efficient delivery and stable gene expression; however, their clinical use raises the concerns of insertional mutagenesis and potential oncogenesis due to genomic integration preferences in transcriptional start sites (TSS). We have shifted the integration preferences of retroviral vectors by generating a library of viral variants with a DNA-binding domain inserted at random positions throughout murine leukemia virus Gag-Pol, then selecting for variants that are viable and exhibit altered integration properties. We found seven permissive zinc finger domain (ZFD) insertion sites throughout Gag-Pol, including within p12, reverse transcriptase, and integrase. Comprehensive genome integration analysis showed that several ZFD insertions yielded retroviral vector variants with shifted integration patterns that did not favor TSS. Furthermore, integration site analysis revealed selective integration for numerous mutants. For example, two retroviral variants with a given ZFD at appropriate positions in Gag-Pol strikingly integrated primarily into four common sites out of 3.1 × 109 possible human genome locations (P = 4.6 × 10-29). Our findings demonstrate that insertion of DNA-binding motifs into multiple locations in Gag-Pol can make considerable progress toward engineering safer retroviral vectors that integrate into a significantly narrowed pool of sites on human genome and overcome the preference for TSS. PMID:20616052

  13. Nonviral Vectors for Gene Delivery

    NASA Astrophysics Data System (ADS)

    Baoum, Abdulgader Ahmed

    2011-12-01

    The development of nonviral vectors for safe and efficient gene delivery has been gaining considerable attention recently. An ideal nonviral vector must protect the gene against degradation by nuclease in the extracellular matrix, internalize the plasma membrane, escape from the endosomal compartment, unpackage the gene at some point and have no detrimental effects. In comparison to viruses, nonviral vectors are relatively easy to synthesize, less immunogenic, low in cost, and have no limitation in the size of a gene that can be delivered. Significant progress has been made in the basic science and applications of various nonviral gene delivery vectors; however, the majority of nonviral approaches are still inefficient and often toxic. To this end, two nonviral gene delivery systems using either biodegradable poly(D,L-lactide- co-glycolide) (PLG) nanoparticles or cell penetrating peptide (CPP) complexes have been designed and studied using A549 human lung epithelial cells. PLG nanoparticles were optimized for gene delivery by varying particle surface chemistry using different coating materials that adsorb to the particle surface during formation. A variety of cationic coating materials were studied and compared to more conventional surfactants used for PLG nanoparticle fabrication. Nanoparticles (˜200 nm) efficiently encapsulated plasmids encoding for luciferase (80-90%) and slowly released the same for two weeks. After a delay, moderate levels of gene expression appeared at day 5 for certain positively charged PLG particles and gene expression was maintained for at least two weeks. In contrast, gene expression mediated by polyethyleneimine (PEI) ended at day 5. PLG particles were also significantly less cytotoxic than PEI suggesting the use of these vehicles for localized, sustained gene delivery to the pulmonary epithelium. On the other hand, a more simple method to synthesize 50-200 nm complexes capable of high transfection efficiency or high gene knockdown was also explored. Positively charged CPPs were complexed with pDNA or siRNA, which resulted in 'loose' (˜1 micron) particles. These were then condensed into small nanoparticles by using calcium, which formed "soft" crosslinks by interacting with both phosphates on nucleic acids and amines on CPPs. An optimal amount of CaCl2 produced stable, ˜100 nm complexes that exhibited higher transfection efficiency and gene silencing than PEI polyplexes. CPPs also displayed negligible cytotoxicity up to 5 mg/mL. Biophysical studies of the pDNA structure within complexes suggested that pDNA within CPP complexes (condensed with calcium) had similar structure, but enhanced thermal stability compared to PEI complexes. Thus, CPP complexes emerged as simple, attractive candidates for future studies on nonviral gene delivery in vivo.

  14. High copy and stable expression of the xylanase XynHB in Saccharomyces cerevisiae by rDNA-mediated integration.

    PubMed

    Fang, Cheng; Wang, Qinhong; Selvaraj, Jonathan Nimal; Zhou, Yuling; Ma, Lixin; Zhang, Guimin; Ma, Yanhe

    2017-08-18

    Xylanase is a widely-used additive in baking industry for enhancing dough and bread quality. Several xylanases used in baking industry were expressed in different systems, but their expression in antibiotic free vector system is highly essential and safe. In the present study, an alternative rDNA-mediated technology was developed to increase the copy number of target gene by integrating it into Saccharomyces cerevisiae genome. A xylanase-encoding gene xynHB from Bacillus sp. was cloned into pHBM367H and integrated into S. cerevisiae genome through rDNA-mediated recombination. Exogenous XynHB expressed by recombinant S. cerevisiae strain A13 exhibited higher degradation activity towards xylan than other transformants. The real-time PCR analysis on A13 genome revealed the presence of 13.64 copies of xynHB gene. Though no antibiotics have been used, the genetic stability and the xylanase activity of xynHB remained stable up to 1,011 generations of cultivation. S. cerevisiae strain A13 expressing xylanase reduced the required kneading time and increased the height and diameter of the dough size, which would be safe and effective in baking industry as no antibiotics-resistance risk. The new effective rDNA-mediated technology without using antibiotics here provides a way to clone other food related industrial enzymes for applications.

  15. The use of biodegradable PLGA nanoparticles to mediate SOX9 gene delivery in human mesenchymal stem cells (hMSCs) and induce chondrogenesis.

    PubMed

    Kim, Jae-Hwan; Park, Ji Sun; Yang, Han Na; Woo, Dae Gyun; Jeon, Su Yeon; Do, Hyun-Jin; Lim, Hye-Young; Kim, Jung Mo; Park, Keun-Hong

    2011-01-01

    In stem cell therapy, transfection of specific genes into stem cells is an important technique to induce cell differentiation. To perform gene transfection in human mesenchymal stem cells (hMSCs), we designed and fabricated a non-viral vector system for specific stem cell differentiation. Several kinds of gene carriers were evaluated with regard to their transfection efficiency and their ability to enhance hMSCs differentiation. Of these delivery vehicles, biodegradable poly (DL-lactic-co-glycolic acid) (PLGA) nanoparticles yielded the best results, as they complexed with high levels of plasmid DNA (pDNA), allowed robust gene expression in hMSCs, and induced chondrogenesis. Polyplexing with polyethylenimine (PEI) enhanced the cellular uptake of SOX9 DNA complexed with PLGA nanoparticles both in vitro and in vivo. The expression of enhanced green fluorescent protein (EGFP) and SOX9 increased up to 75% in hMSCs transfected with PEI/SOX9 complexed PLGA nanoparticles 2 days after transfection. SOX9 gene expression was evaluated by RT-PCR, real time-qPCR, glycosaminoglycan (GAG)/DNA levels, immunoblotting, histology, and immunofluorescence. Copyright © 2010 Elsevier Ltd. All rights reserved.

  16. Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

    PubMed

    Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

    2016-08-30

    The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

  17. Antheraea pernyi silk fibroin for targeted gene delivery of VEGF165-Ang-1 with PEI.

    PubMed

    Ma, Caili; Lv, Linlin; Liu, Yu; Yu, Yanni; You, Renchuan; Yang, Jicheng; Li, Mingzhong

    2014-06-01

    Vascularization is a crucial challenge in tissue engineering. One solution for this problem is to implant scaffolds that contain functional genes that promote vascularization by providing angiogenic growth factors via a gene delivery carrier. Poly(ethylenimine) (PEI) is a gene delivery carrier with high transfection efficiency but with cytotoxicity. To solve this problem, we utilized Antheraea pernyi silk fibroin (ASF), which has favorable cytocompatibility and biodegradability, RGD sequences and a negative charge, in conjunction with PEI, as the delivery vector for vascular endothelial growth factor (VEGF) 165-angiopoietin-1 (Ang-1) dual gene simultaneous expression plasmid, creating an ASF/PEI/pDNA complex. The results suggested that the zeta potential of the ASF/PEI/pDNA complex was significantly lower than that of the PEI/pDNA complex. Decreased nitrogen and increased oxygen on the surface of the complex demonstrated that the ASF had successfully combined with the surface of the PEI/pDNA. Furthermore, the complexes resisted digestion by nucleic acid enzymes and degradation by serum. L929 cells were cultured and transfected in vitro and improved cytotoxicity was found when the cells were transfected with ASF/PEI/pDNA compared with PEI/pDNA. In addition, the transfection efficiency and VEGF secretion increased. In general, this study provides a novel method for decreasing the cytotoxicity of PEI gene delivery vectors and increasing transfection efficiency of angiogenesis-related genes.

  18. Construction of a star-shaped copolymer as a vector for FGF receptor-mediated gene delivery in vitro and in vivo.

    PubMed

    Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun

    2010-09-13

    The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.

  19. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

    PubMed

    Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

    2016-06-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

  20. A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

    PubMed Central

    Mei, Yu; Kernodle, Bliss M.; Hill, John H.

    2016-01-01

    Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

  1. Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes

    PubMed Central

    Kita-Matsuo, Hiroko; Barcova, Maria; Prigozhina, Natalie; Salomonis, Nathan; Wei, Karen; Jacot, Jeffrey G.; Nelson, Brandon; Spiering, Sean; Haverslag, René; Kim, Changsung; Talantova, Maria; Bajpai, Ruchi; Calzolari, Diego; Terskikh, Alexey; McCulloch, Andrew D.; Price, Jeffrey H.; Conklin, Bruce R.; Chen, H. S. Vincent; Mercola, Mark

    2009-01-01

    Background Developmental, physiological and tissue engineering studies critical to the development of successful myocardial regeneration therapies require new ways to effectively visualize and isolate large numbers of fluorescently labeled, functional cardiomyocytes. Methodology/Principal Findings Here we describe methods for the clonal expansion of engineered hESCs and make available a suite of lentiviral vectors for that combine Blasticidin, Neomycin and Puromycin resistance based drug selection of pure populations of stem cells and cardiomyocytes with ubiquitous or lineage-specific promoters that direct expression of fluorescent proteins to visualize and track cardiomyocytes and their progenitors. The phospho-glycerate kinase (PGK) promoter was used to ubiquitously direct expression of histone-2B fused eGFP and mCherry proteins to the nucleus to monitor DNA content and enable tracking of cell migration and lineage. Vectors with T/Brachyury and α-myosin heavy chain (αMHC) promoters targeted fluorescent or drug-resistance proteins to early mesoderm and cardiomyocytes. The drug selection protocol yielded 96% pure cardiomyocytes that could be cultured for over 4 months. Puromycin-selected cardiomyocytes exhibited a gene expression profile similar to that of adult human cardiomyocytes and generated force and action potentials consistent with normal fetal cardiomyocytes, documenting these parameters in hESC-derived cardiomyocytes and validating that the selected cells retained normal differentiation and function. Conclusion/Significance The protocols, vectors and gene expression data comprise tools to enhance cardiomyocyte production for large-scale applications. PMID:19352491

  2. Comparison of Current Regulatory Status for Gene-Based Vaccines in the U.S., Europe and Japan

    PubMed Central

    Nakayama, Yoshikazu; Aruga, Atsushi

    2015-01-01

    Gene-based vaccines as typified by plasmid DNA vaccines and recombinant viral-vectored vaccines are expected as promising solutions against infectious diseases for which no effective prophylactic vaccines exist such as HIV, dengue virus, Ebola virus and malaria, and for which more improved vaccines are needed such as tuberculosis and influenza virus. Although many preclinical and clinical trials have been conducted to date, no DNA vaccines or recombinant viral-vectored vaccines expressing heterologous antigens for human use have yet been licensed in the U.S., Europe or Japan. In this research, we describe the current regulatory context for gene-based prophylactic vaccines against infectious disease in the U.S., Europe, and Japan. We identify the important considerations, in particular, on the preclinical assessments that would allow these vaccines to proceed to clinical trials, and the differences on the regulatory pathway for the marketing authorization in each region. PMID:26344953

  3. [Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

    PubMed

    Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

    2011-01-01

    To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

  4. Homologous and heterologous recombination between adenovirus vector DNA and chromosomal DNA.

    PubMed

    Stephen, Sam Laurel; Sivanandam, Vijayshankar Ganesh; Kochanek, Stefan

    2008-11-01

    Adenovirus vector DNA is perceived to remain as episome following gene transfer. We quantitatively and qualitatively analysed recombination between high capacity adenoviral vector (HC-AdV) and chromosomal DNA following gene transfer in vitro. We studied homologous and heterologous recombination with a single HC-AdV carrying (i) a large genomic HPRT fragment with the HPRT CHICAGO mutation causing translational stop upon homologous recombination with the HPRT locus and (ii) a selection marker to allow for clonal selection in the event of heterologous recombination. We analysed the sequences at the junctions between vector and chromosomal DNA. In primary cells and in cell lines, the frequency of homologous recombination ranged from 2 x 10(-5) to 1.6 x 10(-6). Heterologous recombination occurred at rates between 5.5 x 10(-3) and 1.1 x 10(-4). HC-AdV DNA integrated via the termini mostly as intact molecules. Analysis of the junction sequences indicated vector integration in a relatively random manner without an obvious preference for particular chromosomal regions, but with a preference for integration into genes. Integration into protooncogenes or tumor suppressor genes was not observed. Patchy homologies between vector termini and chromosomal DNA were found at the site of integration. Although the majority of integrations had occurred without causing mutations in the chromosomal DNA, cases of nucleotide substitutions and insertions were observed. In several cases, deletions of even relative large chromosomal regions were likely. These results extend previous information on the integration patterns of adenovirus vector DNA and contribute to a risk-benefit assessment of adenovirus-mediated gene transfer.

  5. Expression of simian virus 40 T antigen in Escherichia coli: localization of T-antigen origin DNA-binding domain to within 129 amino acids.

    PubMed Central

    Arthur, A K; Höss, A; Fanning, E

    1988-01-01

    The genomic coding sequence of the large T antigen of simian virus 40 (SV40) was cloned into an Escherichia coli expression vector by joining new restriction sites, BglII and BamHI, introduced at the intron boundaries of the gene. Full-length large T antigen, as well as deletion and amino acid substitution mutants, were inducibly expressed from the lac promoter of pUC9, albeit with different efficiencies and protein stabilities. Specific interaction with SV40 origin DNA was detected for full-length T antigen and certain mutants. Deletion mutants lacking T-antigen residues 1 to 130 and 260 to 708 retained specific origin-binding activity, demonstrating that the region between residues 131 and 259 must carry the essential binding domain for DNA-binding sites I and II. A sequence between residues 302 and 320 homologous to a metal-binding "finger" motif is therefore not required for origin-specific binding. However, substitution of serine for either of two cysteine residues in this motif caused a dramatic decrease in origin DNA-binding activity. This region, as well as other regions of the full-length protein, may thus be involved in stabilizing the DNA-binding domain and altering its preference for binding to site I or site II DNA. Images PMID:2835505

  6. Reproducible and efficient murine CNS gene delivery using a microprocessor-controlled injector.

    PubMed

    Brooks, A I; Halterman, M W; Chadwick, C A; Davidson, B L; Haak-Frendscho, M; Radel, C; Porter, C; Federoff, H J

    1998-04-30

    To develop a reproducible gene transfer method for the murine CNS we evaluated delivery of various gene vehicles using mechanical or manual stereotaxic intracranial inoculation. A microprocessor controlled microsyringe pump (The World Precision Instruments/UltraMicroPump) programmable for volume, rate and syringe size and designed to dispense nanoliter and picoliter volumes was compared to a standard manual deliver method. Gene transfer efficiency of two viral vectors, two synthetic cationic lipid molecules, and naked DNA were evaluated in mice injected unilaterally in two brain regions. Animals received 1 microl over 10 min. of either HSVlac (1 x 10(5) b.f.u), AdLac (1 x 10(5) p.f.u), Tfx-10 or Tfx-20 (2.6 microg DNA in 2.0 microl Tfx; 1:1 charge ratio of DNA to liposome), or naked DNA (HSVlac plasmid, 10 microg/microl). After 4 days, animals from each group were perfused and tissue prepared for X-gal histochemical detection of beta-galactosidase expression. Blue cells were observed in the HSV, Adenovirus, and Tfx-20 groups only at the injection site in animals injected using the UMP. Animals injected manually exhibited fewer blue cells and positive cells were not restricted to the injection site. To quantify expression, tissue punches harvested from the injection sites as well as other brain regions were analyzed using a chemiluminescent reporter assay to detect beta-galactosidase (Galacto-Light). These data indicated increased activity in all animals injected with a lacZ containing vector via the UMP as compared to manual delivery: A 41% increase in the expression levels of beta-gal in HSVlac infected animals (p = 0.0029); a 29% increase in Adlac infected animals (p = 0.01); a 56% increase in Tfx-10 transduced animals (p = 0.04); a 24% increase in Tfx-20 transduced animals (p = 0.01); and a 69% increase in naked DNA gene transfer (p = 0.05). Total beta-galactosidase activity was greatest in HSVlac infected mice followed by Adlac > Tfx-20 > Tfx-10 = naked DNA.

  7. Transient Expression of Lumbrokinase (PI239) in Tobacco (Nicotiana tabacum) Using a Geminivirus-Based Single Replicon System Dissolves Fibrin and Blood Clots.

    PubMed

    Dickey, Alexia; Wang, Nan; Cooper, Edwin; Tull, Lauren; Breedlove, Drew; Mason, Hugh; Liu, Dehu; Wang, Kevin Yueju

    2017-01-01

    Lumbrokinases, a group of fibrinolytic enzymes extracted from earthworm, have been widely used to prevent and treat various cardiovascular diseases. They specifically target fibrin to effectively degrade thrombi without major side effects. Plant expression systems are becoming potential alternative expression platforms for producing pharmaceutical proteins. In this work, a lumbrokinase (PI239) was produced from a plant system. Both wild-type (WT) and plant codon-optimized (OP) PI239 gene sequences were synthesized and cloned into a geminivirus-based single-vector DNA replicon system. Both vectors were independently expressed in tobacco (Nicotiana tabacum) leaves transiently by agroinfiltration. Overexpressed PI239 resulted in sudden tissue necrosis 3 days after infiltration. Remaining proteins were purified through His-tag affinity chromatography and analyzed with SDS-PAGE and Western blot methods. Purified PI239 successfully degraded artificial fibrin with relative activity of 13,400 U/mg when compared with commercial lumbrokinase product. In vitro tests demonstrated that plant-derived PI239 dissolved human blood clots and that the plant expression system is capable of producing functional PI239.

  8. Novel narrow-host-range vectors for direct cloning of foreign DNA in Pseudomonas.

    PubMed

    Boivin, R; Bellemare, G; Dion, P

    1994-01-01

    Narrow-host-range vectors, based on an indigenous replicon and containing a multiple cloning site, have been constructed in a Pseudomonas host capable of growth on unusual substrates. The new cloning vectors yield sufficient amounts of DNA for preparative purposes and belong to an incompatibility group different from that of the incP and incQ broad-host-range vectors. One of these vectors, named pDB47F, was used to clone, directly in Pseudomonas, DNA fragments from Agrobacterium, Pseudomonas, and Rhizobium. A clone containing Agrobacterium and KmR gene sequences was transformed with a higher efficiency than an RSF1010-derived vector (by as much as 1250-fold) in four out of five Pseudomonas strains tested. The considerable efficiency obtained with this system makes possible the direct cloning and phenotypic selection of foreign DNA in Pseudomonas.

  9. Targeting both viral and host determinants of human immunodeficiency virus entry, using a new lentiviral vector coexpressing the T20 fusion inhibitor and a selective CCL5 intrakine.

    PubMed

    Petit, Nicolas; Dorgham, Karim; Levacher, Béatrice; Burlion, Aude; Gorochov, Guy; Marodon, Gilles

    2014-08-01

    Numerous strategies targeting early and late steps of the HIV life cycle have been proposed for gene therapy. However, targeting viral and host determinants of HIV entry is the only strategy that would prevent viral DNA-mediated CD4(+) cell death while diminishing the possibility for the virus to escape. To this end, we devised a bicistronic lentiviral vector expressing the membrane-bound form of the T20 fusion inhibitor, referred to as the C46 peptide, and a CCR5 superagonist, modified to sequester CCR5 away from the cell surface, referred to as the P2-CCL5 intrakine. We tested the effects of the vector on HIV infection and replication, using the human CEMR5 cell line expressing CD4 and CCR5, and primary human T cells. Transduced cells expressed the C46 peptide, detected with the 2F5 monoclonal antibody by flow cytometry. Expression of the P2-CCL5 intrakine correlates with lower levels of cell surface CCR5. Complete protection against HIV infection could be observed in cells expressing the protective transgenes. Importantly, we show that the combination of the transgenes was more potent than either transgene alone, showing the interest of expressing two entry inhibitors to inhibit HIV infection. Last, genetically modified cells possessed a selective advantage over nonmodified cells on HIV challenge in vitro, showing that modified cells were protected from HIV-induced cell death. Our results demonstrate that lentiviral vectors coexpressing the T20 fusion inhibitor and the P2-CCL5 intrakine represent promising tools for HIV gene therapy.

  10. Three-Dimensional Imaging of the Intracellular Fate of Plasmid DNA and Transgene Expression: ZsGreen1 and Tissue Clearing Method CUBIC Are an Optimal Combination for Multicolor Deep Imaging in Murine Tissues.

    PubMed

    Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru

    2016-01-01

    Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Hui; Wu Jihong; Li Huiming

    The interaction of vascular endothelial growth factor (VEGF) and its receptors (Flt-1, Flk-1/KDR) is correlated with neovascularization in the eyes. Therefore, blocking the binding of VEGF and the corresponding receptor has become critical for inhibiting corneal neovascularization. In this study, we have expressed the cDNA for sFlk-1 under the control of cytomegalovirus immediate-early promoter (CMV) from an E1/partial E3 deleted replication defective recombinant adenovirus, and Ad.sflk-1 expression was determined by Western blotting. We have shown that conditioned media from Ad.sflk-1-infected ARPE-19 cells significantly reduced VEGF-induced human umbilical vein endothelial cells (HUVEC) and murine endothelial cells (SVEC) proliferation in vitro comparedmore » with the control vector. In vivo, adenoviral vectors expressing green fluorescent protein alone (Ad.GFP) were utilized to monitor gene transfer to the cornea. Moreover, in the models of corneal neovascularization, the injection of Ad.sflk-1 (10{sup 8} PFU) into the anterior chamber could significantly inhibit angiogenic changes compared with Ad.null-injected and vehicle-injected models. Immunohistochemical analysis showed that corneal endothelial cells and corneal stroma of cauterized rat eyes were efficiently transduced and expressed sFlk-1. These results not only support that adenoviral vectors are capable of high-level transgene expression but also demonstrate that Ad.sflk-1 gene therapy might be a feasible approach for inhibiting the development of corneal neovascularization.« less

  12. Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B

    PubMed Central

    Jackson, Kasey L.; Dayton, Robert D.; Deverman, Benjamin E.; Klein, Ronald L.

    2016-01-01

    Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats. PMID:27867348

  13. Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B.

    PubMed

    Jackson, Kasey L; Dayton, Robert D; Deverman, Benjamin E; Klein, Ronald L

    2016-01-01

    Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats.

  14. Bcr/Abl interferes with the Fanconi anemia/BRCA pathway: implications in the chromosomal instability of chronic myeloid leukemia cells.

    PubMed

    Valeri, Antonio; Alonso-Ferrero, Maria Eugenia; Río, Paula; Pujol, María Roser; Casado, José A; Pérez, Laura; Jacome, Ariana; Agirre, Xabier; Calasanz, Maria José; Hanenberg, Helmut; Surrallés, Jordi; Prosper, Felipe; Albella, Beatriz; Bueren, Juan A

    2010-12-28

    Chronic myeloid leukemia (CML) is a malignant clonal disorder of the hematopoietic system caused by the expression of the BCR/ABL fusion oncogene. Although it is well known that CML cells are genetically unstable, the mechanisms accounting for this genomic instability are still poorly understood. Because the Fanconi anemia (FA) pathway is believed to control several mechanisms of DNA repair, we investigated whether this pathway was disrupted in CML cells. Our data show that CML cells have a defective capacity to generate FANCD2 nuclear foci, either in dividing cells or after DNA damage. Similarly, human cord blood CD34(+) cells transduced with BCR/ABL retroviral vectors showed impaired FANCD2 foci formation, whereas FANCD2 monoubiquitination in these cells was unaffected. Soon after the transduction of CD34(+) cells with BCR/ABL retroviral vectors a high proportion of cells with supernumerary centrosomes was observed. Similarly, BCR/ABL induced a high proportion of chromosomal abnormalities, while mediated a cell survival advantage after exposure to DNA cross-linking agents. Significantly, both the impaired formation of FANCD2 nuclear foci, and also the predisposition of BCR/ABL cells to develop centrosomal and chromosomal aberrations were reverted by the ectopic expression of BRCA1. Taken together, our data show for the first time a disruption of the FA/BRCA pathway in BCR/ABL cells, suggesting that this defective pathway should play an important role in the genomic instability of CML by the co-occurrence of centrosomal amplification and DNA repair deficiencies.

  15. Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.

    PubMed

    Yue, Chang-Wu; Zhang, Yi-Zheng

    2009-03-01

    A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.

  16. Multiplex analysis of DNA

    DOEpatents

    Church, George M.; Kieffer-Higgins, Stephen

    1992-01-01

    This invention features vectors and a method for sequencing DNA. The method includes the steps of: a) ligating the DNA into a vector comprising a tag sequence, the tag sequence includes at least 15 bases, wherein the tag sequence will not hybridize to the DNA under stringent hybridization conditions and is unique in the vector, to form a hybrid vector, b) treating the hybrid vector in a plurality of vessels to produce fragments comprising the tag sequence, wherein the fragments differ in length and terminate at a fixed known base or bases, wherein the fixed known base or bases differs in each vessel, c) separating the fragments from each vessel according to their size, d) hybridizing the fragments with an oligonucleotide able to hybridize specifically with the tag sequence, and e) detecting the pattern of hybridization of the tag sequence, wherein the pattern reflects the nucleotide sequence of the DNA.

  17. A Feature Selection Algorithm to Compute Gene Centric Methylation from Probe Level Methylation Data.

    PubMed

    Baur, Brittany; Bozdag, Serdar

    2016-01-01

    DNA methylation is an important epigenetic event that effects gene expression during development and various diseases such as cancer. Understanding the mechanism of action of DNA methylation is important for downstream analysis. In the Illumina Infinium HumanMethylation 450K array, there are tens of probes associated with each gene. Given methylation intensities of all these probes, it is necessary to compute which of these probes are most representative of the gene centric methylation level. In this study, we developed a feature selection algorithm based on sequential forward selection that utilized different classification methods to compute gene centric DNA methylation using probe level DNA methylation data. We compared our algorithm to other feature selection algorithms such as support vector machines with recursive feature elimination, genetic algorithms and ReliefF. We evaluated all methods based on the predictive power of selected probes on their mRNA expression levels and found that a K-Nearest Neighbors classification using the sequential forward selection algorithm performed better than other algorithms based on all metrics. We also observed that transcriptional activities of certain genes were more sensitive to DNA methylation changes than transcriptional activities of other genes. Our algorithm was able to predict the expression of those genes with high accuracy using only DNA methylation data. Our results also showed that those DNA methylation-sensitive genes were enriched in Gene Ontology terms related to the regulation of various biological processes.

  18. Vaxvec: The first web-based recombinant vaccine vector database and its data analysis.

    PubMed

    Deng, Shunzhou; Martin, Carly; Patil, Rasika; Zhu, Felix; Zhao, Bin; Xiang, Zuoshuang; He, Yongqun

    2015-11-27

    A recombinant vector vaccine uses an attenuated virus, bacterium, or parasite as the carrier to express a heterologous antigen(s). Many recombinant vaccine vectors and related vaccines have been developed and extensively investigated. To compare and better understand recombinant vectors and vaccines, we have generated Vaxvec (http://www.violinet.org/vaxvec), the first web-based database that stores various recombinant vaccine vectors and those experimentally verified vaccines that use these vectors. Vaxvec has now included 59 vaccine vectors that have been used in 196 recombinant vector vaccines against 66 pathogens and cancers. These vectors are classified to 41 viral vectors, 15 bacterial vectors, 1 parasitic vector, and 1 fungal vector. The most commonly used viral vaccine vectors are double-stranded DNA viruses, including herpesviruses, adenoviruses, and poxviruses. For example, Vaxvec includes 63 poxvirus-based recombinant vaccines for over 20 pathogens and cancers. Vaxvec collects 30 recombinant vector influenza vaccines that use 17 recombinant vectors and were experimentally tested in 7 animal models. In addition, over 60 protective antigens used in recombinant vector vaccines are annotated and analyzed. User-friendly web-interfaces are available for querying various data in Vaxvec. To support data exchange, the information of vaccine vectors, vaccines, and related information is stored in the Vaccine Ontology (VO). Vaxvec is a timely and vital source of vaccine vector database and facilitates efficient vaccine vector research and development. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

    PubMed

    Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

    2015-01-01

    To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Allelic Variation of Cytochrome P450s Drives Resistance to Bednet Insecticides in a Major Malaria Vector.

    PubMed

    Ibrahim, Sulaiman S; Riveron, Jacob M; Bibby, Jaclyn; Irving, Helen; Yunta, Cristina; Paine, Mark J I; Wondji, Charles S

    2015-10-01

    Scale up of Long Lasting Insecticide Nets (LLINs) has massively contributed to reduce malaria mortality across Africa. However, resistance to pyrethroid insecticides in malaria vectors threatens its continued effectiveness. Deciphering the detailed molecular basis of such resistance and designing diagnostic tools is critical to implement suitable resistance management strategies. Here, we demonstrated that allelic variation in two cytochrome P450 genes is the most important driver of pyrethroid resistance in the major African malaria vector Anopheles funestus and detected key mutations controlling this resistance. An Africa-wide polymorphism analysis of the duplicated genes CYP6P9a and CYP6P9b revealed that both genes are directionally selected with alleles segregating according to resistance phenotypes. Modelling and docking simulations predicted that resistant alleles were better metabolizers of pyrethroids than susceptible alleles. Metabolism assays performed with recombinant enzymes of various alleles confirmed that alleles from resistant mosquitoes had significantly higher activities toward pyrethroids. Additionally, transgenic expression in Drosophila showed that flies expressing resistant alleles of both genes were significantly more resistant to pyrethroids compared with those expressing the susceptible alleles, indicating that allelic variation is the key resistance mechanism. Furthermore, site-directed mutagenesis and functional analyses demonstrated that three amino acid changes (Val109Ile, Asp335Glu and Asn384Ser) from the resistant allele of CYP6P9b were key pyrethroid resistance mutations inducing high metabolic efficiency. The detection of these first DNA markers of metabolic resistance to pyrethroids allows the design of DNA-based diagnostic tools to detect and track resistance associated with bednets scale up, which will improve the design of evidence-based resistance management strategies.

  1. Allelic Variation of Cytochrome P450s Drives Resistance to Bednet Insecticides in a Major Malaria Vector

    PubMed Central

    Ibrahim, Sulaiman S.; Riveron, Jacob M.; Bibby, Jaclyn; Irving, Helen; Yunta, Cristina; Paine, Mark J. I.; Wondji, Charles S.

    2015-01-01

    Scale up of Long Lasting Insecticide Nets (LLINs) has massively contributed to reduce malaria mortality across Africa. However, resistance to pyrethroid insecticides in malaria vectors threatens its continued effectiveness. Deciphering the detailed molecular basis of such resistance and designing diagnostic tools is critical to implement suitable resistance management strategies. Here, we demonstrated that allelic variation in two cytochrome P450 genes is the most important driver of pyrethroid resistance in the major African malaria vector Anopheles funestus and detected key mutations controlling this resistance. An Africa-wide polymorphism analysis of the duplicated genes CYP6P9a and CYP6P9b revealed that both genes are directionally selected with alleles segregating according to resistance phenotypes. Modelling and docking simulations predicted that resistant alleles were better metabolizers of pyrethroids than susceptible alleles. Metabolism assays performed with recombinant enzymes of various alleles confirmed that alleles from resistant mosquitoes had significantly higher activities toward pyrethroids. Additionally, transgenic expression in Drosophila showed that flies expressing resistant alleles of both genes were significantly more resistant to pyrethroids compared with those expressing the susceptible alleles, indicating that allelic variation is the key resistance mechanism. Furthermore, site-directed mutagenesis and functional analyses demonstrated that three amino acid changes (Val109Ile, Asp335Glu and Asn384Ser) from the resistant allele of CYP6P9b were key pyrethroid resistance mutations inducing high metabolic efficiency. The detection of these first DNA markers of metabolic resistance to pyrethroids allows the design of DNA-based diagnostic tools to detect and track resistance associated with bednets scale up, which will improve the design of evidence-based resistance management strategies. PMID:26517127

  2. Two Distinct Approaches for CRISPR-Cas9-Mediated Gene Editing in Cryptococcus neoformans and Related Species.

    PubMed

    Wang, Ping

    2018-06-27

    Cryptococcus neoformans and related species are encapsulated basidiomycetous fungi that cause meningoencephalitis in individuals with immune deficiency. This pathogen has a tractable genetic system; however, gene disruption via electroporation remains difficult, while biolistic transformation is often limited by lack of multiple genetic markers and the high initial cost of equipment. The approach using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) has become the technology of choice for gene editing in many organisms due to its simplicity, efficiency, and versatility. The technique has been successfully demonstrated in C. neoformans and Cryptococcus deneoformans in which two DNA plasmids expressing either the Streptococcus pyogenes CAS9 gene or the guide RNA (gRNA) were employed. However, potential adverse effects due to constitutive expression and the time-consuming process of constructing vectors to express each gRNA remain as a primary barrier for wide adaptation. This report describes the delivery of preassembled CRISPR-Cas9-gRNA ribonucleoproteins (RNPs) via electroporation that is able to generate edited mutant alleles. RNP-mediated CRISPR-Cas9 was used to replace the wild-type GIB2 gene encoding a Gβ-like/RACK1 Gib2 protein with a gib2 :: NAT allele via homologous recombination in both C. neoformans and C. deneoformans In addition, a DNA plasmid (pCnCas9:U6-gRNA) that expresses both Cas9 and gRNA, allowing for convenient yet low-cost DNA-mediated gene editing, is described. pCnCas9:U6-gRNA contains an endogenous U6 promoter for gRNA expression and restriction sites for one-step insertion of a gRNA. These approaches and resources provide new opportunities to accelerate genetic studies of Cryptococcus species. IMPORTANCE For genetic studies of the Cryptococcus genus, generation of mutant strains is often hampered by a limited number of selectable genetic markers, the tedious process of vector construction, side effects, and other limitations, such as the high cost of acquiring a particle delivery system. CRISPR-Cas9 technology has been demonstrated in Cryptococcus for genome editing. However, it remains labor-intensive and time-consuming since it requires the identification of a suitable type III RNA polymerase promoter for gRNA expression. In addition, there may be potential adverse effects caused by constitutive expressions of Cas9 and gRNA. Here, I report the use of a ribonucleoprotein-mediated CRISPR-Cas9 technique for genome editing of C. neoformans and related species. Together with the custom-constructed pCnCas9:U6-gRNA vector that allows low-cost and time-saving DNA-based CRISPR-Cas9, my approach adds to the molecular toolbox for dissecting the molecular mechanism of pathogenesis in this important group of fungal pathogens. Copyright © 2018 Wang.

  3. Preclinical Demonstration of Lentiviral Vector-mediated Correction of Immunological and Metabolic Abnormalities in Models of Adenosine Deaminase Deficiency

    PubMed Central

    Carbonaro, Denise A; Zhang, Lin; Jin, Xiangyang; Montiel-Equihua, Claudia; Geiger, Sabine; Carmo, Marlene; Cooper, Aaron; Fairbanks, Lynette; Kaufman, Michael L; Sebire, Neil J; Hollis, Roger P; Blundell, Michael P; Senadheera, Shantha; Fu, Pei-Yu; Sahaghian, Arineh; Chan, Rebecca Y; Wang, Xiaoyan; Cornetta, Kenneth; Thrasher, Adrian J; Kohn, Donald B; Gaspar, H Bobby

    2014-01-01

    Gene transfer into autologous hematopoietic stem cells by γ-retroviral vectors (gRV) is an effective treatment for adenosine deaminase (ADA)–deficient severe combined immunodeficiency (SCID). However, current gRV have significant potential for insertional mutagenesis as reported in clinical trials for other primary immunodeficiencies. To improve the efficacy and safety of ADA-SCID gene therapy (GT), we generated a self-inactivating lentiviral vector (LV) with a codon-optimized human cADA gene under the control of the short form elongation factor-1α promoter (LV EFS ADA). In ADA−/− mice, LV EFS ADA displayed high-efficiency gene transfer and sufficient ADA expression to rescue ADA−/− mice from their lethal phenotype with good thymic and peripheral T- and B-cell reconstitution. Human ADA-deficient CD34+ cells transduced with 1–5 × 107 TU/ml had 1–3 vector copies/cell and expressed 1–2x of normal endogenous levels of ADA, as assayed in vitro and by transplantation into immune-deficient mice. Importantly, in vitro immortalization assays demonstrated that LV EFS ADA had significantly less transformation potential compared to gRV vectors, and vector integration-site analysis by nrLAM-PCR of transduced human cells grown in immune-deficient mice showed no evidence of clonal skewing. These data demonstrated that the LV EFS ADA vector can effectively transfer the human ADA cDNA and promote immune and metabolic recovery, while reducing the potential for vector-mediated insertional mutagenesis. PMID:24256635

  4. Unusual Properties of Regulatory DNA from the Drosophila Engrailed Gene: Three ``pairing-Sensitive'' Sites within a 1.6-Kb Region

    PubMed Central

    Kassis, J. A.

    1994-01-01

    We have previously shown that a 2-kb fragment of engrailed DNA can suppress expression of a linked marker gene, white, in the P element vector CaSpeR. This suppression is dependent on the presence of two copies of engrailed DNA-containing P elements (P[en]) in proximity in the Drosophila genome (either in cis or in trans). In this study, the 2-kb fragment was dissected and found to contain three fragments of DNA which could mediate white suppression [called ``pairing-sensitive sites'' (PS)]. A PS site was also identified in regulatory DNA from the Drosophila escargot gene. The eye colors of six different P[en] insertions in the escargot gene suggest an interaction between P[en]-encoded and genome-encoded PS sites. I hypothesize that white gene expression from P[en] is repressed by the formation of a protein complex which is initiated at the engrailed PS sites and also requires interactions with flanking genomic DNA. Genes were sought which influence the function of PS sites. Mutations in some Polycomb and trithorax group genes were found to affect the eye color from some P[en] insertion sites. However, different mutations affected expression from different P[en] insertion sites and no one mutation was found to affect expression from all P[en] insertion sites examined. These results suggest that white expression from P[en] is not directly regulated by members of the Polycomb and trithorax group genes, but in some cases can be influenced by them. I propose that engrailed PS sites normally act to promote interactions between distantly located engrailed regulatory sites and the engrailed promoter. PMID:8005412

  5. The ATRX cDNA is prone to bacterial IS10 element insertions that alter its structure.

    PubMed

    Valle-García, David; Griffiths, Lyra M; Dyer, Michael A; Bernstein, Emily; Recillas-Targa, Félix

    2014-01-01

    The SWI/SNF-like chromatin-remodeling protein ATRX has emerged as a key factor in the regulation of α-globin gene expression, incorporation of histone variants into the chromatin template and, more recently, as a frequently mutated gene across a wide spectrum of cancers. Therefore, the availability of a functional ATRX cDNA for expression studies is a valuable tool for the scientific community. We have identified two independent transposon insertions of a bacterial IS10 element into exon 8 of ATRX isoform 2 coding sequence in two different plasmids derived from a single source. We demonstrate that these insertion events are common and there is an insertion hotspot within the ATRX cDNA. Such IS10 insertions produce a truncated form of ATRX, which significantly compromises its nuclear localization. In turn, we describe ways to prevent IS10 insertion during propagation and cloning of ATRX-containing vectors, including optimal growth conditions, bacterial strains, and suggested sequencing strategies. Finally, we have generated an insertion-free plasmid that is available to the community for expression studies of ATRX.

  6. A novel recombinant pseudorabies virus expressing parvovirus VP2 gene: Immunogenicity and protective efficacy in swine

    PubMed Central

    2011-01-01

    Background Porcine parvovirus (PPV) VP2 gene has been successfully expressed in many expression systems resulting in self-assembly of virus-like particles (VLPs) with similar morphology to the native capsid. Here, a pseudorabies virus (PRV) system was adopted to express the PPV VP2 gene. Methods A recombinant PRV SA215/VP2 was obtained by homologous recombination between the vector PRV viral DNA and a transfer plasmid. Then recombinant virus was purified with plaque purification, and its identity confirmed by PCR amplification, Western blot and indirect immunofluorescence (IFA) analyses. Electronic microscopy of PRV SA215/VP2 confirmed self-assembly of both pseudorabies virus and VLPs from VP2 protein. Results Immunization of piglets with recombinant virus elicited PRV-specific and PPV-specific humoral immune responses and provided complete protection against a lethal dose of PRV challenges. Gilts immunized with recombinant viruses induced PPV-specific antibodies, and significantly reduced the mortality rate of (1 of 28) following virulent PPV challenge compared with the control (7 of 31). Furthermore, PPV virus DNA was not detected in the fetuses of recombinant virus immunized gilts. Conclusions In this study, a recombinant PRV SA215/VP2 virus expressing PPV VP2 protein was constructed using PRV SA215 vector. The safety, immunogenicity, and protective efficacy of the recombinant virus were demonstrated in piglets and primiparous gilts. This recombinant PRV SA215/VP2 represents a suitable candidate for the development of a bivalent vaccine against both PRV and PPV infection. PMID:21679423

  7. Geminiviruses for biotechnology: the art of parasite taming.

    PubMed

    Lozano-Durán, Rosa

    2016-04-01

    Viruses are intracellular pathogens that have evolved efficient strategies for replication and expression of their proteins in the host cells. Geminiviruses - plant viruses with small circular single-stranded DNA genomes - effectively manipulate plant cell processes for viral functions, entailing great potential for biotechnological applications. This potentiality has been realized in the form of protein expression and gene-silencing vectors, and, more recently, vectors for genome editing - a technology that these viruses seem particularly well-suited to facilitate. This insight offers an overview of the biological properties of geminiviruses, with emphasis on those leveraging development of geminivirus-based replicons. It illustrates the basis for engineering geminivirus-based replicons and their applications. Furthermore, it discusses the reported use and future perspectives of geminivirus-based replicons for genome editing. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  8. Efficient production of antibody Fab fragment by transient gene expression in insect cells.

    PubMed

    Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki

    2017-08-01

    Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  9. Persistent interferon transgene expression by RNA interference-mediated silencing of interferon receptors.

    PubMed

    Takahashi, Yuki; Vikman, Elin; Nishikawa, Makiya; Ando, Mitsuru; Watanabe, Yoshihiko; Takakura, Yoshinobu

    2010-09-01

    The in vivo half-life of interferons (IFNs) is very short, and its extension would produce a better therapeutic outcome in IFN-based therapy. Delivery of IFN genes is one solution for providing a sustained supply. IFNs have a variety of functions, including the suppression of transgene expression, through interaction with IFN receptors (IFNRs). This suppression could prevent IFNs from being expressed from vectors delivered. Silencing the expression of IFNAR and IFNGR, the receptors for type I and II IFNs, respectively, in cells expressing IFNs may prolong transgene expression of IFNs. Mouse melanoma B16-BL6 cells or mouse liver were selected as a site expressing IFNs (not a target for IFN gene therapy) and IFN-expressing plasmid DNA was delivered with or without small interfering RNA (siRNA) targeting IFNRs. Transfection of B16-BL6 cells with siRNA targeting IFNAR1 subunit (IFNAR1) resulted in the reduced expression of IFNAR on the cell surface. This silencing significantly increased the IFN-beta production in cells that were transfected with IFN-beta-expressing plasmid DNA. Similar results were obtained with the combination of IFN-gamma and IFNGR. Co-injection of IFN-beta-expressing plasmid DNA with siRNA targeting IFNAR1 into mice resulted in sustained plasma concentration of IFN-beta. These results provide experimental evidence that the RNAi-mediated silencing of IFNRs in cells expressing IFN, such as hepatocytes, is an effective approach for improving transgene expression of IFNs when their therapeutic target comprises cells other than those expressing IFNs.

  10. Expression and activity analysis of a new fusion protein targeting ovarian cancer cells.

    PubMed

    Su, Manman; Chang, Weiqin; Wang, Dingding; Cui, Manhua; Lin, Yang; Wu, Shuying; Xu, Tianmin

    2015-09-01

    The aim of the present study was to develop a new therapeutic drug to improve the prognosis of ovarian cancer patients. Human urokinase-type plasminogen activator (uPA)17-34-kunitz-type protease inhibitor (KPI) eukaryotic expression vector was constructed and recombinant human uPA17-34-KPI (rhuPA17-34-KPI) in P. pastoris was expressed. In the present study, the DNA sequences that encode uPA 17-34 amino acids were created according to the native amino acids sequence and inserted into the KPI-pPICZαC vector, which was constructed. Then, uPA17‑34-KPI-pPICZαC was transformed into P. pastoris X-33, and rhuPA17-34-KPI was expressed by induction of methanol. The bioactivities of a recombinant fusion protein were detected with trypsin inhibition analysis, and the inhibitory effects on the growth of ovarian cancer cells were identified using the TUNEL assay, in vitro wound‑healing assay and Matrigel model analysis. The results of the DNA sequence analysis of the recombinant vector uPA17-34-KPI‑pPICZα demonstrated that the DNA‑encoding human uPA 17-34 amino acids, 285-288 amino acids of amyloid precursor protein (APP) and 1-57 amino acids of KPI were correctly inserted into the pPICZαC vector. Following induction by methonal, the fusion protein with a molecular weight of 8.8 kDa was observed using SDS-PAGE and western blot analysis. RhuPA17-34-KPI was expressed in P. pastoris with a yield of 50 mg/l in a 50-ml tube. The recombinant fusion protein was able to inhibit the activity of trypsin, inhibit growth and induce apoptosis of SKOV3 cells, and inhibit the invasion and metastasis of ovarian cancer cells. By considering uPA17-34 amino acid specific binding uPAR as the targeted part of fusion protein and utilizing the serine protease inhibitor activity of KPI, it was found that the recombinant fusion protein uPA17-34-KPI inhibited the invasion and metastasis of ovarian tumors, and may therefore be regarded as effective in targeted treatment.

  11. Construction of a genomic DNA library with a TA vector and its application in cloning of the phytoene synthase gene from the cyanobacterium Spirulina platensis M-135

    NASA Astrophysics Data System (ADS)

    Yoshikazu, Kawata; Shin-Ichi, Yano; Hiroyuki, Kojima

    1998-03-01

    An efficient and simple method for constructing a genomic DNA library using a TA cloning vector is presented. It is based on the sonicative cleavage of genomic DNA and modification of fragment ends with Taq DNA polymerase, followed by ligation using a TA vector. This method was applied for cloning of the phytoene synthase gene crt B from Spirulina platensis. This method is useful when genomic DNA cannot be efficiently digested with restriction enzymes, a problem often encountered during the construction of a genomic DNA library of cyanobacteria.

  12. Establishment of conditional vectors for hairpin siRNA knockdowns

    PubMed Central

    Matsukura, Shiro; Jones, Peter A.; Takai, Daiya

    2003-01-01

    Small interference RNA (siRNA) is an emerging methodology in reverse genetics. Here we report the development of a new tetracycline-inducible vector-based siRNA system, which uses a tetracycline-responsive derivative of the U6 promoter and the tetracycline repressor for conditional in vivo transcription of short hairpin RNA. This method prevents potential lethality immediately after transfection of a vector when the targeted gene is indispensable, or the phenotype of the knockdown is lethal or results in a growth abnormality. We show that the controlled knockdown of DNA methyltransferase 1 (DNMT1) in human cancer resulted in growth arrest. Removal of the inducer, doxycycline, from treated cells led to re-expression of the targeted gene. Thus the method allows for a highly controlled approach to gene knockdown. PMID:12888529

  13. Efficient generation of rat induced pluripotent stem cells using a non-viral inducible vector.

    PubMed

    Merkl, Claudia; Saalfrank, Anja; Riesen, Nathalie; Kühn, Ralf; Pertek, Anna; Eser, Stefan; Hardt, Markus Sebastian; Kind, Alexander; Saur, Dieter; Wurst, Wolfgang; Iglesias, Antonio; Schnieke, Angelika

    2013-01-01

    Current methods of generating rat induced pluripotent stem cells are based on viral transduction of pluripotency inducing genes (Oct4, Sox2, c-myc and Klf4) into somatic cells. These activate endogenous pluripotency genes and reprogram the identity of the cell to an undifferentiated state. Epigenetic silencing of exogenous genes has to occur to allow normal iPS cell differentiation. To gain more control over the expression of exogenous reprogramming factors, we used a novel doxycycline-inducible plasmid vector encoding Oct4, Sox2, c-Myc and Klf4. To ensure efficient and controlled generation of iPS cells by plasmid transfection we equipped the reprogramming vector with a bacteriophage φC31 attB site and used a φC31 integrase expression vector to enhance vector integration. A series of doxycycline-independent rat iPS cell lines were established. These were characterized by immunocytochemical detection of Oct4, SSEA1 and SSEA4, alkaline phosphatase staining, methylation analysis of the endogenous Oct4 promoter and RT-PCR analysis of endogenous rat pluripotency genes. We also determined the number of vector integrations and the extent to which reprogramming factor gene expression was controlled. Protocols were developed to generate embryoid bodies and rat iPS cells demonstrated as pluripotent by generating derivatives of all three embryonic germ layers in vitro, and teratoma formation in vivo. All data suggest that our rat iPS cells, generated by plasmid based reprogramming, are similar to rat ES cells. Methods of DNA transfection, protein transduction and feeder-free monolayer culture of rat iPS cells were established to enable future applications.

  14. A Herpes Simplex Virus-Derived Replicative Vector Expressing LIF Limits Experimental Demyelinating Disease and Modulates Autoimmunity

    PubMed Central

    Nygårdas, Michaela; Paavilainen, Henrik; Müther, Nadine; Nagel, Claus-Henning; Röyttä, Matias; Sodeik, Beate; Hukkanen, Veijo

    2013-01-01

    Herpes simplex virus type 1 (HSV-1) has properties that can be exploited for the development of gene therapy vectors. The neurotropism of HSV enables delivery of therapeutic genes to the nervous system. Using a bacterial artificial chromosome (BAC), we constructed an HSV-1(17+)-based replicative vector deleted of the neurovirulence gene γ134.5, and expressing leukemia inhibitory factor (LIF) as a transgene for treatment of experimental autoimmune encephalomyelitis (EAE). EAE is an inducible T-cell mediated autoimmune disease of the central nervous system (CNS) and is used as an animal model for multiple sclerosis. Demyelination and inflammation are hallmarks of both diseases. LIF is a cytokine that has the potential to limit demyelination and oligodendrocyte loss in CNS autoimmune diseases and to affect the T-cell mediated autoimmune response. In this study SJL/J mice, induced for EAE, were treated with a HSV-LIF vector intracranially and the subsequent changes in disease parameters and immune responses during the acute disease were investigated. Replicating HSV-LIF and its DNA were detected in the CNS during the acute infection, and the vector spread to the spinal cord but was non-virulent. The HSV-LIF significantly ameliorated the EAE and contributed to a higher number of oligodendrocytes in the brains when compared to untreated mice. The HSV-LIF therapy also induced favorable changes in the expression of immunoregulatory cytokines and T-cell population markers in the CNS during the acute disease. These data suggest that BAC-derived HSV vectors are suitable for gene therapy of CNS disease and can be used to test the therapeutic potential of immunomodulatory factors for treatment of EAE. PMID:23700462

  15. The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression

    PubMed Central

    Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie

    2004-01-01

    Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153

  16. Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

    PubMed Central

    Matroudi, S.; Zamani, M.R.; Motallebi, M.

    2008-01-01

    In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

  17. Turning self-destructing Salmonella into a universal DNA vaccine delivery platform.

    PubMed

    Kong, Wei; Brovold, Matthew; Koeneman, Brian A; Clark-Curtiss, Josephine; Curtiss, Roy

    2012-11-20

    We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases.

  18. Turning self-destructing Salmonella into a universal DNA vaccine delivery platform

    PubMed Central

    Kong, Wei; Brovold, Matthew; Koeneman, Brian A.; Clark-Curtiss, Josephine; Curtiss, Roy

    2012-01-01

    We previously developed a biological containment system using recombinant Salmonella Typhimurium strains that are attenuated yet capable of synthesizing protective antigens. The regulated delayed attenuation and programmed self-destructing features designed into these S. Typhimurium strains enable them to efficiently colonize host tissues and allow release of the bacterial cell contents after lysis. To turn such a recombinant attenuated Salmonella vaccine (RASV) strain into a universal DNA vaccine-delivery vehicle, our approach was to genetically modify RASV strains to display a hyperinvasive phenotype to maximize Salmonella host entry and host cell internalization, to enable Salmonella endosomal escape to release a DNA vaccine into the cytosol, and to decrease Salmonella-induced pyroptosis/apoptosis that allows the DNA vaccine time to traffic to the nucleus for efficient synthesis of encoded protective antigens. A DNA vaccine vector that encodes a domain that contributes to the arabinose-regulated lysis phenotype but has a eukaryotic promoter was constructed. The vector was then improved by insertion of multiple DNA nuclear-targeting sequences for efficient nuclear trafficking and gene expression, and by increasing nuclease resistance to protect the plasmid from host degradation. A DNA vaccine encoding influenza WSN virus HA antigen delivered by the RASV strain with the best genetic attributes induced complete protection to mice against a lethal influenza virus challenge. Adoption of these technological improvements will revolutionize means for effective delivery of DNA vaccines to stimulate mucosal, systemic, and cellular protective immunities, and lead to a paradigm shift in cost-effective control and prevention of a diversity of diseases. PMID:23129620

  19. A pair of new BAC and BIBAC vectors that facilitate BAC/BIBAC library construction and intact large genomic DNA insert exchange.

    PubMed

    Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong

    2011-10-11

    Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.

  20. A pilot study of dose-intensified procarbazine, CCNU, vincristine for poor prognosis brain tumors utilizing fibronectin-assisted, retroviral-mediated modification of CD34+ peripheral blood cells with O6-methylguanine DNA methyltransferase.

    PubMed

    Cornetta, K; Croop, J; Dropcho, E; Abonour, R; Kieran, M W; Kreissman, S; Reeves, L; Erickson, L C; Williams, D A

    2006-09-01

    Administration of chemotherapy is often limited by myelosuppression. Expression of drug-resistance genes in hematopoietic cells has been proposed as a means to decrease the toxicity of cytotoxic agents. In this pilot study, we utilized a retroviral vector expressing methylguanine DNA methyltransferase (MGMT) to transduce hematopoietic progenitors, which were subsequently used in the setting of alkylator therapy (procarbazine, CCNU, vincristine (PCV)) for poor prognosis brain tumors. Granulocyte colony-stimulating factor (G-CSF)-mobilized peripheral blood progenitor cells were collected by apheresis and enriched for CD34+ expression. Nine subjects were infused with CD34+-enriched cells treated in a transduction procedure involving a 4-day exposure to cytokines with vector exposure on days 3 and 4. No major adverse event was related to the gene therapy procedure. Importantly, the engraftment kinetics of the treated product was similar to unmanipulated peripheral blood stem cells, suggesting that the ex vivo manipulation did not significantly reduce engrafting progenitor cell function. Gene-transduced cells were detected in all subjects. Although the level and duration was limited, patients receiving cells transduced using fibronectin 'preloaded' with virus supernatant appeared to show improved in vivo marking frequency. These findings demonstrate the feasibility and safety of utilizing MGMT-transduced CD34+ peripheral blood progenitor cells in the setting of chemotherapy.

  1. Display of a maize cDNA library on baculovirus infected insect cells.

    PubMed

    Meller Harel, Helene Y; Fontaine, Veronique; Chen, Hongying; Jones, Ian M; Millner, Paul A

    2008-08-12

    Maize is a good model system for cereal crop genetics and development because of its rich genetic heritage and well-characterized morphology. The sequencing of its genome is well advanced, and new technologies for efficient proteomic analysis are needed. Baculovirus expression systems have been used for the last twenty years to express in insect cells a wide variety of eukaryotic proteins that require complex folding or extensive posttranslational modification. More recently, baculovirus display technologies based on the expression of foreign sequences on the surface of Autographa californica (AcMNPV) have been developed. We investigated the potential of a display methodology for a cDNA library of maize young seedlings. We constructed a full-length cDNA library of young maize etiolated seedlings in the transfer vector pAcTMVSVG. The library contained a total of 2.5 x 10(5) independent clones. Expression of two known maize proteins, calreticulin and auxin binding protein (ABP1), was shown by western blot analysis of protein extracts from insect cells infected with the cDNA library. Display of the two proteins in infected insect cells was shown by selective biopanning using magnetic cell sorting and demonstrated proof of concept that the baculovirus maize cDNA display library could be used to identify and isolate proteins. The maize cDNA library constructed in this study relies on the novel technology of baculovirus display and is unique in currently published cDNA libraries. Produced to demonstrate proof of principle, it opens the way for the development of a eukaryotic in vivo display tool which would be ideally suited for rapid screening of the maize proteome for binding partners, such as proteins involved in hormone regulation or defence.

  2. Long non-coding RNA MEG3 inhibits the proliferation and metastasis of oral squamous cell carcinoma by regulating the WNT/β-catenin signaling pathway.

    PubMed

    Liu, Zongxiang; Wu, Cui; Xie, Nina; Wang, Penglai

    2017-10-01

    This study aimed to investigate how long non-coding RNA (lncRNA) maternally expressed gene 3 (MEG3) inhibits the growth and metastasis of oral squamous cell carcinoma (OSCC) by regulating WNT/β-catenin signaling pathway in order to explore the antitumor effect of MEG3 and to provide a potential molecular target for the treatment of OSCC. The RT-qPCR technique was used to quantitatively analyze the expression of MEG3 in cancer and adjacent tissues collected from the patients after surgery. Using the Lipofectamine method, the MEG3 overexpression vector and the siRNA interference vector were constructed and transfected into SCC15 and Cal27 cells, respectively, followed by cell proliferation, apoptosis and metastasis analyses. The semi-quantitative analysis of the expression of the β-catenin protein in transfected cells was performed by the western blot analysis, and the activity of the WNT/β-catenin signaling pathway was analyzed using the TOP/FOP flash reporters. In addition, the cells were treated with decitabine to investigate the correlation between the MEG3 expression and the DNA methylation. Results showed that the expression level of MEG3 was significantly decreased in OSCC (p<0.05) and overexpression of MEG3 inhibited the proliferation and metastasis of cancer cells and promoted apoptosis. Importantly, MEG3 played a role as a tumor suppressor by inhibiting the WNT/β-catenin signaling pathway. In addition, the expression of the MEG3 was significantly affected by the degree of DNA methylation. It was concluded that the lncRNA MEG3 can inhibit the growth and metastasis of OSCC by negatively regulating the WNT/β-catenin signaling pathway.

  3. Folic acid conjugated mPEG-PEI600 as an efficient non-viral vector for targeted nucleic acid delivery.

    PubMed

    Xu, Zhenhua; Jin, Jiefu; Siu, Leo K S; Yao, Hong; Sze, Johnny; Sun, Hongzhe; Kung, Hsiang-Fu; Poon, Wai Sang; Ng, Samuel S M; Lin, Marie C

    2012-04-15

    In this study we describe a novel polymer, mPPS-FA, synthesized as a potential gene transfer vector. To complete mPPS-FA, folic acid was conjugated to a backbone (named mPPS) consisting of a copolymer of methyl PEG-2000, PEI-600, and sebacoyl chloride. (1)H NMR, FT-IR, and UV spectroscopy were used to characterize the structure of mPPS-FA. It was revealed that mPPS-FA holds the ability to bind plasmid DNA yielding positively charged particles (polyplexes). Dynamic light scattering (DLS) and TEM techniques were used to study the size and morphology of the formed mPPS-FA/DNA nanocomplexes. The mPPS-FA/DNA nanoparticles exhibited low cytotoxicity as transfection of B16-F0, U87MG, CHO-1, and Ho-8910 cells produced >80% viability indicating low cytotoxicity of the polymer. The ability of mPPS-FA to deliver EGFP plasmid to melanoma B16-F0, U87, CHO-1, Ho-8910, and A549 cells was investigated in vitro as compared to the lipid-based transfection agent Lipofectamine2000 and Linear PEI 22 kDa (L-PEI 22 kDa). We found that mPPS-FA/DNA complexes yielded the highest GFP transfection efficiency in B16-F0, U87, CHO-1, and Ho-8910 cells, which all highly express folate receptors (FR), at an mPPS-FA/DNA ratio (w/w) of 15. Furthermore, the transfection of mPPS-FA/DNA complexes in CHO-1 cells could be competitively blocked by free folic acid molecules. In contrast, in low FR expressing A549 cells, mPPS-FA showed similar low transfection efficiency as mPPS. Taken together, mPPS-FA showed the highest efficiency in vitro and the potential to be developed as a nonviral gene carrier. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. System and method for introduction and stabilization of genes in Thermus sp.

    DOEpatents

    Kayser, Kevin J.; Park, Ho-Shin; Kilbane, II, John J.

    2005-03-01

    A method for introducing and stabilizing heterologous and recombinant genes in a thermophilic host in which a characteristic gene defining a detectable host characteristic is inactivated or deleted from the thermophilic host, resulting in a modified thermophilic host expressing an absence of the detectable host characteristic. A DNA fragment of interest is inserted into the modified thermophilic host together with an intact characteristic gene, whereby the detectable host characteristic is restored to the thermophilic host, thereby enabling detection and confirmation of successful transformation using plasmid vectors and integration of the DNA fragment into the chromosome of the thermophilic host.

  5. Mapping of Heavy Chain Genes for Mouse Immunoglobulins M and D

    NASA Astrophysics Data System (ADS)

    Liu, Chih-Ping; Tucker, Philip W.; Mushinski, J. Frederic; Blattner, Frederick R.

    1980-09-01

    A single DNA fragment containing both μ and δ immunoglobulin heavy chain genes has been cloned from normal BALB/c mouse liver DNA with a new λ phage vector Charon 28. The physical distance between the membrane terminal exon of μ and the first domain of δ is 2466 base pairs, with δ on the 3' side of μ . A single transcript could contain a variable region and both μ and δ constant regions. The dual expression of immunoglobulins M and D on spleen B cells may be due to alternate splicing of this transcript.

  6. Cloning and expression of N22 region of Torque Teno virus (TTV) genome and use of peptide in developing immunoassay for TTV antibodies

    PubMed Central

    2014-01-01

    Background Torque Teno Virus (TTV) is a DNA virus with high rate of prevalence globally. Since its discovery in 1997, several studies have questioned the role of this virus in causing disease. However, it still remains an enigma. Although methods are available for detection of TTV infection, there is still a need for simple, rapid and reliable method for screening of this virus in human population. Present investigation describes the cloning and expression of N22 region of TTV-genome and the use of expressed peptide in development of immunoassay to detect anti-TTV antibodies in serum. Since TTV genotype-1 is more common in India, the serum positive for genotype-1 was used as source of N22 for expression purpose. Methods Full length N22 region of ORF1 from TTV genotype-1 was amplified and cloned in pGEM®-T Easy vector. After cloning, the amplicon was transformed and expressed as a fusion protein containing hexa-histidine tag in pET-28a(+) vector using BL21 E. coli cells as host. Expression was conducted both in LB medium as well as ZYP-5052 auto-induction medium. The expressed peptide was purified using metal-chelate affinity chromatography and used as antigen in developing a blot immunoassay. Results Analysis of translated product by SDS-PAGE and western blotting demonstrated the presence of 25 kDa polypeptide produced after expression. Solubility studies showed the polypeptide to be associated with insoluble fraction. The use of this peptide as antigen in blot assay produced prominent spot on membrane treated with sera from TTV-infected patients. Analysis of sera from 75 patients with liver and renal diseases demonstrated a successful implication of N22 polypeptide based immunoassay in screening sera for anti-TTV antibodies. Comparison of the immunoassay developed using expressed N22 peptide with established PCR method for TTV-DNA detection showed good coherence between TTV-DNA and presence of anti-TTV antibodies in the sera analysed. Conclusions This concludes that TTV N22 region may be expressed and safely used as antigen for blot assay to detect anti-TTV antibodies in sera. PMID:24884576

  7. A Luciferase Functional Quantitative Assay for Measuring NF-ĸB Promoter Transactivation Mediated by HTLV-1 and HTLV-2 Tax Proteins.

    PubMed

    Bergamo, Elisa; Diani, Erica; Bertazzoni, Umberto; Romanelli, Maria Grazia

    2017-01-01

    HTLV-1 and HTLV-2 viruses express Tax transactivator proteins required for viral genome transcription and capable of transforming cells in vivo and in vitro. Although Tax oncogenic potential needs to be further elucidated, it is well established that Tax proteins activate, among others, transcription factors of the NF-ĸB family, which are involved in immune and inflammatory responses, cell growth, apoptosis, stress responses and oncogenesis. Here, we describe a reporter gene assay applied for quantitative analysis of Tax-dependent NF-ĸB activation. The procedure is based on co-transfection of two individual vectors containing the cDNA for firefly and Renilla luciferase enzymes and vectors expressing Tax proteins. The luciferase expression is driven by cis-NF-ĸB promoter regulatory elements responsive to Tax transactivating factor. This assay is particularly useful to investigate Tax influence on NF-ĸB activation mediated by viral or host factors.

  8. Cloning of novel cellulases from cellulolytic fungi: heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris.

    PubMed

    Salinas, Alejandro; Vega, Marcela; Lienqueo, María Elena; Garcia, Alejandro; Carmona, Rene; Salazar, Oriana

    2011-12-10

    Total cDNA isolated from cellulolytic fungi cultured in cellulose was examined for the presence of sequences encoding for endoglucanases. Novel sequences encoding for glycoside hydrolases (GHs) were identified in Fusarium oxysporum, Ganoderma applanatum and Trametes versicolor. The cDNA encoding for partial sequences of GH family 61 cellulases from F. oxysporum and G. applanatum shares 58 and 68% identity with endoglucanases from Glomerella graminicola and Laccaria bicolor, respectively. A new GH family 5 endoglucanase from T. versicolor was also identified. The cDNA encoding for the mature protein was completely sequenced. This enzyme shares 96% identity with Trametes hirsuta endoglucanase and 22% with Trichoderma reesei endoglucanase II (EGII). The enzyme, named TvEG, has N-terminal family 1 carbohydrate binding module (CBM1). The full length cDNA was cloned into the pPICZαB vector and expressed as an active, extracellular enzyme in the methylotrophic yeast Pichia pastoris. Preliminary studies suggest that T. versicolor could be useful for lignocellulose degradation. Copyright © 2011 Elsevier Inc. All rights reserved.

  9. In vitro and in vivo gene delivery using chitosan/hyaluronic acid nanoparticles: Influences of molecular mass of hyaluronic acid and lyophilization on transfection efficiency.

    PubMed

    Sato, Toshinori; Nakata, Mitsuhiro; Yang, Zhihong; Torizuka, Yu; Kishimoto, Satoko; Ishihara, Masayuki

    2017-08-01

    Lyophilization is an effective method for preserving nonviral gene vectors. To improve the stability and transgene expression of lyophilized plasmid DNA (pDNA) complexes, we coated the surfaces of pDNA/chitosan complexes with hyaluronic acid (HA) of varying molecular masses. The transgene expression of pDNA/chitosan/HA ternary complexes was characterized in vitro and in vivo. pDNA complexes were lyophilized overnight and the resultant products with spongy, porous consistencies were stored at -30, 4 or 25°C for 2 weeks. Rehydrated complexes were characterized using gel retardation assays, aiming to confirm complex formation, measure particle size and evaluate zeta potential, as well as conduct luciferase gene reporter assays. The anti-tumor effects of pDNA ternary complexes were evaluated using suicide gene (pTK) coding thymidine kinase in Huh7-implanted mice. Transfection efficiencies of pDNA/chitosan/HA ternary complexes were dependent on the average molecular masses of HA. The coating of pDNA/chitosan complexes with HA maintained the cellular transfection efficiencies of lyophilized pDNA ternary complexes. Furthermore, intratumoral injection of lyophilized, rehydrated pDNA ternary complexes into tumor-bearing mice showed a significant suppression of tumor growth. The coating of pDNA/chitosan complexes with high-molecular-weight HA augmented the stability and cellular transfection ability of the complexes after lyophilization-rehydration. Copyright © 2017 John Wiley & Sons, Ltd.

  10. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray

    PubMed Central

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-01-01

    AIM: To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. METHODS: The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. RESULTS: Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. CONCLUSION: Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators. PMID:12632483

  11. Analysis of gene expression profile induced by EMP-1 in esophageal cancer cells using cDNA Microarray.

    PubMed

    Wang, Hai-Tao; Kong, Jian-Ping; Ding, Fang; Wang, Xiu-Qin; Wang, Ming-Rong; Liu, Lian-Xin; Wu, Min; Liu, Zhi-Hua

    2003-03-01

    To obtain human esophageal cancer cell EC9706 stably expressed epithelial membrane protein-1 (EMP-1) with integrated eukaryotic plasmid harboring the open reading frame (ORF) of human EMP-1, and then to study the mechanism by which EMP-1 exerts its diverse cellular action on cell proliferation and altered gene profile by exploring the effect of EMP-1. The authors first constructed pcDNA3.1/myc-his expression vector harboring the ORF of EMP-1 and then transfected it into human esophageal carcinoma cell line EC9706. The positive clones were analyzed by Western blot and RT-PCR. Moreover, the cell growth curve was observed and the cell cycle was checked by FACS technique. Using cDNA microarray technology, the authors compared the gene expression pattern in positive clones with control. To confirm the gene expression profile, semi-quantitative RT-PCR was carried out for 4 of the randomly picked differentially expressed genes. For those differentially expressed genes, classification was performed according to their function and cellular component. Human EMP-1 gene can be stably expressed in EC9706 cell line transfected with human EMP-1. The authors found the cell growth decreased, among which S phase was arrested and G1 phase was prolonged in the transfected positive clones. By cDNA microarray analysis, 35 genes showed an over 2.0 fold change in expression level after transfection, with 28 genes being consistently up-regulated and 7 genes being down-regulated. Among the classified genes, almost half of the induced genes (13 out of 28 genes) were related to cell signaling, cell communication and particularly to adhesion. Overexpression of human EMP-1 gene can inhibit the proliferation of EC9706 cell with S phase arrested and G1 phase prolonged. The cDNA microarray analysis suggested that EMP-1 may be one of regulators involved in cell signaling, cell communication and adhesion regulators.

  12. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  13. Semiflexible polymer dynamics with a bead-spring model

    NASA Astrophysics Data System (ADS)

    Barkema, Gerard T.; Panja, Debabrata; van Leeuwen, J. M. J.

    2014-11-01

    We study the dynamical properties of semiflexible polymers with a recently introduced bead-spring model. We focus on double-stranded DNA (dsDNA). The two parameters of the model, T* and ν, are chosen to match its experimental force-extension curve. In comparison to its groundstate value, the bead-spring Hamiltonian is approximated in the first order by the Hessian that is quadratic in the bead positions. The eigenmodes of the Hessian provide the longitudinal (stretching) and transverse (bending) eigenmodes of the polymer, and the corresponding eigenvalues match well with the established phenomenology of semiflexible polymers. At the Hessian approximation of the Hamiltonian, the polymer dynamics is linear. Using the longitudinal and transverse eigenmodes, for the linearized problem, we obtain analytical expressions of (i) the autocorrelation function of the end-to-end vector, (ii) the autocorrelation function of a bond (i.e. a spring, or a tangent) vector at the middle of the chain, and (iii) the mean-square displacement of a tagged bead in the middle of the chain, as the sum over the contributions from the modes—the so-called ‘mode sums’. We also perform simulations with the full dynamics of the model. The simulations yield numerical values of the correlations functions (i-iii) that agree very well with the analytical expressions for the linearized dynamics. This does not however mean that the nonlinearities are not present. In fact, we also study the mean-square displacement of the longitudinal component of the end-to-end vector that showcases strong nonlinear effects in the polymer dynamics, and we identify at least an effective t7/8 power-law regime in its time-dependence. Nevertheless, in comparison to the full mean-square displacement of the end-to-end vector the nonlinear effects remain small at all times—it is in this sense we state that our results demonstrate that the linearized dynamics suffices for dsDNA fragments that are shorter than or comparable to the persistence length. Our results are consistent with those of the wormlike chain (WLC) model, the commonly used descriptive tool of semiflexible polymers.

  14. A review of therapeutic prospects of non-viral gene therapy in the retinal pigment epithelium

    PubMed Central

    Koirala, Adarsha; Conley, Shannon M.; Naash, Muna I.

    2013-01-01

    Ocular gene therapy has been extensively explored in recent years as a therapeutic avenue to target diseases of the cornea, retina and retinal pigment epithelium (RPE). Adeno-associated virus (AAV)-mediated gene therapy has shown promise in several RPE clinical trials but AAVs have limited payload capacity and potential immunogenicity. Traditionally however, non-viral alternatives have been plagued by low transfection efficiency, short-term expression and low expression levels. Recently, these drawbacks have begun to be overcome by the use of specialty carriers such as polylysine, liposomes, or polyethyleneimines, and by inclusion of suitable DNA elements to enhance gene expression and longevity. Recent advancements in the field have yielded non-viral vectors that have favorable safety profiles, lack immunogenicity, exhibit long-term elevated gene expression, and show efficient transfection in the retina and RPE, making them poised to transition to clinical applications. Here we discuss the advancements in nanotechnology and vector engineering that have improved the prospects for clinical application of non-viral gene therapy in the RPE. PMID:23796578

  15. Phage Display Breast Carcinoma cDNA Libraries: Isolation of Clones Which Specifically Bind to Membrane Glycoproteins, Mucins, and Endothelial Cell Surface

    DTIC Science & Technology

    1999-07-01

    nutrients and waste and UV 2237 fibrosarcoma sublines (17). Expression of elimination, cell surfaces are also important for the galectin-1, another member of...10B capsid protein. Therefore, this GAG CGG AAA ATG GCA GAC AAT TTT TCG CTC CAT ... vector was chosen to assess the feasibility of phage met Ala Asp

  16. Cloning and study of the pectate lyase gene of Erwinia carotovora

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

    1986-04-01

    The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

  17. Mucosal prior to systemic application of recombinant adenovirus boosting is more immunogenic than systemic application twice but confers similar protection against SIV-challenge in DNA vaccine-primed macaques

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schulte, Reiner; Suh, You-Suk; Sauermann, Ulrike

    2009-01-20

    We investigated the immunogenicity and efficacy of a bimodal prime/boost vaccine regimen given by various routes in the Simian immunodeficiency virus (SIV) rhesus monkey model for AIDS. Twelve animals were immunized with SIV DNA-vectors followed by the application of a recombinant adenovirus (rAd5) expressing the same genes either intramuscularly (i.m.) or by oropharyngeal spray. The second rAd5-application was given i.m. All vaccinees plus six controls were challenged orally with SIVmac239 12 weeks post-final immunization. Both immunization strategies induced strong SIV Gag-specific IFN-{gamma} and T-cell proliferation responses and mediated a conservation of CD4{sup +} memory T-cells and a reduction of viralmore » load during peak viremia following infection. Interestingly, the mucosal group was superior to the systemic group regarding breadth and strength of SIV-specific T-cell responses and exhibited lower vector specific immune responses. Therefore, our data warrant the inclusion of mucosal vector application in a vaccination regimen which makes it less invasive and easier to apply.« less

  18. Transcriptomic response of the insect vector, Peregrinus maidis, to Maize mosaic rhabdovirus and identification of conserved responses to propagative viruses in hopper vectors.

    PubMed

    Martin, Kathleen M; Barandoc-Alviar, Karen; Schneweis, Derek J; Stewart, Catherine L; Rotenberg, Dorith; Whitfield, Anna E

    2017-09-01

    Maize mosaic virus (MMV) is a plant-pathogenic rhabdovirus that is transmitted by the corn planthopper, Peregrinus maidis, in a propagative manner. P. maidis supports long-term MMV infections with no negative effects on insect performance. To elucidate whole-body transcriptome responses to virus infection, RNA-Seq was used to examine differential gene expression of virus-infected adult insects, and libraries were prepared from replicated groups of virus-exposed insects and non-exposed insects. From the 68,003 de novo-assembled transcripts, 144 were differentially-expressed (DE) during viral infection with comparable numbers up- and down-regulated. DE transcripts with similarity to genes associated with transposable elements (i.e., RNA-directed DNA polymerases) were enriched and may represent a mechanisim for modulating virus infection. Comparison of the P. maidis DE transcripts to published propagative virus-responsive transcript databases for two other hopper vectors revealed that 16% of the DE transcripts were shared across the three systems and may represent conserved responses to propagative viruses. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Molecular cloning and characterization of a gene regulating flowering time from Alfalfa (Medicago sativa L.).

    PubMed

    Zhang, Tiejun; Chao, Yuehui; Kang, Junmei; Ding, Wang; Yang, Qingchuan

    2013-07-01

    Genes that regulate flowering time play crucial roles in plant development and biomass formation. Based on the cDNA sequence of Medicago truncatula (accession no. AY690425), the LFY gene of alfalfa was cloned. Sequence similarity analysis revealed high homology with FLO/LFY family genes of other plants. When fused to the green fluorescent protein, MsLFY protein was localized in the nucleus of onion (Allium cepa L.) epidermal cells. The RT-qPCR analysis of MsLFY expression patterns showed that the expression of MsLFY gene was at a low level in roots, stems, leaves and pods, and the expression level in floral buds was the highest. The expression of MsLFY was induced by GA3 and long photoperiod. Plant expression vector was constructed and transformed into Arabidopsis by the agrobacterium-mediated methods. PCR amplification with the transgenic Arabidopsis genome DNA indicated that MsLFY gene had integrated in Arabidopsis genome. Overexpression of MsLFY specifically caused early flowering under long day conditions compared with non-transgenic plants. These results indicated MsLFY played roles in promoting flowering time.

  20. Molecular cloning, sequencing, and expression of Eimeria tenella HSP70 partial gene.

    PubMed

    Bogado, A L G; Martins, G F; Sasse, J P; Guimarães, J da S; Garcia, J L

    2017-03-15

    Members of the Eimeria genus are protozoan parasites of the subphylum Apicomplexa (Eimeriidae family), and belong to the coccidia group. Eimeria tenella is one of the most pathogenic species owing to its ability to penetrate the mucosa, and cause inflammation and damage. It is an obligate intracellular parasite that causes disease by destroying the host cells during multiplication. Heat shock protein 70 (HSP70) is a molecular chaperone that prevents cellular stress. The objective of this study was to clone, sequence, and express E. tenella HSP70 protein. After selecting the region of highest hydrophilicity in the hsp70 gene, we cloned complementary DNA (cDNA) into a pTrcHis2-TOPO vector and transformed it into TOP10 Escherichia coli cells; after induction, the bacteria expressed a 23-kDa protein with insoluble expression levels of approximately 5 mg/L. In summary, the partial hsp70 gene was successfully expressed in E. coli, producing a 23-kDa protein under insoluble conditions, and the antigen characteristics predicted by hydrophilicity analysis suggest the development of a vaccine for use in avian coccidiosis.

  1. Enhancement of VP6 immunogenicity and protective efficacy against rotavirus by VP2 in a genetic immunization.

    PubMed

    Lopez-Guerrero, D V; Arias, N; Gutierrez-Xicotencatl, L; Chihu-Amparan, L; González, A; Pedroza-Saavedra, A; Rosas-Salgado, G; Villegas-Garcia, J C; Badillo-Godinez, O; Fernandez, G; Lopez, S; Esquivel-Guadarrama, F

    2018-05-24

    VP2/VP6 virus like particles (VLPs) are very effective in inducing protection against the rotavirus infection in animal models. Individually, VP6 can also induce protection. However, there is no information about the immunogenicity of VP2. The aim of this work was to evaluate the efficacy of DNA vaccines codifying for VP2 or VP6, alone or combined, to induce protection against the rotavirus infection. Murine rotavirus VP2 and VP6 genes were cloned into the pcDNA3 vector. Adult BALB/c mice were inoculated three times by intramuscular (i.m.) injections with 100 or 200µg of pcDNA3-VP2 or pcDNA3-VP6 alone or co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6. Two weeks after the last inoculation, mice were challenged with the wild type murine rotavirus strain epizootic diarrhea of infant mice (EDIM wt ). We found that both plasmids, pcDNA3-VP2 and pcDNA3-VP6, were able to induce rotavirus-specific serum antibodies, but not intestinal rotavirus-specific IgA; only 200µg of pcDNA3-VP6 induced 35% protection against the infection. A similar level of protection was found when mice were co-administered with 100µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:1 ratio). However, the best protection (up to 58%) occurred when mice were inoculated with 10µg of pcDNA3-VP2/100µg of pcDNA3-VP6 (1:10 ratio). These results indicate that the DNA plasmid expressing VP6 is a better vaccine candidate that the one expressing VP2. However, when co-expressed, VP2 potentiates the immunogenicity and protective efficacy of VP6. Copyright © 2017. Published by Elsevier Ltd.

  2. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  3. Impact of the Central Polypurine Tract on the Kinetics of Human Immunodeficiency Virus Type 1 Vector Transduction

    PubMed Central

    Van Maele, Bénédicte; De Rijck, Jan; De Clercq, Erik; Debyser, Zeger

    2003-01-01

    Lentiviral vectors derived from human immunodeficiency virus type 1 (HIV-1) show great promise as gene carriers for future gene therapy. Insertion of a fragment containing the central polypurine tract (cPPT) in HIV-1 vector constructs is known to enhance transduction efficiency drastically, reportedly by facilitating the nuclear import of HIV-1 cDNA through a central DNA flap. We have studied the impact of the cPPT on the kinetics of HIV-1 vector transduction by real-time PCR. The kinetics of total HIV-1 DNA, two-long-terminal-repeat (2-LTR) circles, and, by an Alu-PCR, integrated proviral DNA were monitored. About 6 to 12 h after transduction, the total HIV-1 DNA reached a maximum level, followed by a steep decrease. The 2-LTR circles peaked after 24 to 48 h and were diluted upon cell division. Integration of HIV-1 DNA was first detected at 12 h postinfection. When HIV-1 vectors that contained the cPPT were used, DNA synthesis was similar but a threefold higher amount of 2-LTR circles was detected, confirming the impact on nuclear import. Moreover, a 10-fold increase in the amount of integrated DNA was observed in the presence of the cPPT. Only in the absence of the cPPT was a saturation in 2-LTR circle formation seen at a high multiplicity of infection, suggesting a role for the cPPT in overcoming a barrier to the nuclear import of HIV-1 DNA. A major effect of the central DNA flap on the juxtaposition of both LTRs is unlikely, since transduction with HIV-1 vectors containing ectopic cPPT fragments resulted in increased amounts of 2-LTR circles as well as integrated DNA. Inhibitors of transduction by cPPT-containing HIV vectors were also studied by real-time PCR. The reverse transcriptase inhibitor azidothymidine (AZT) and the nonnucleoside reverse transcriptase inhibitor α-APA clearly inhibited viral DNA synthesis, whereas integrase inhibitors such as the diketo acid L-708,906 and the pyranodipyrimidine V-165 specifically inhibited integration. PMID:12663775

  4. Molecular characterization of two serine proteases expressed in gut tissue of the African trypanosome vector, Glossina morsitans morsitans.

    PubMed

    Yan, J; Cheng, Q; Li, C B; Aksoy, S

    2001-02-01

    Serine proteases are major insect gut enzymes involved in digestion of dietary proteins, and in addition they have been implicated in the process of pathogen establishment in several vector insects. The medically important vector, tsetse fly (Diptera:Glossinidiae), is involved in the transmission of African trypanosomes, which cause devastating diseases in animals and humans. Both the male and female tsetse can transmit trypanosomes and both are strict bloodfeeders throughout all stages of their development. Here, we describe the characterization of two putative serine protease-encoding genes, Glossina serine protease-1 (Gsp1) and Glossina serine protease-2 (Gsp2) from gut tissue. Both putative cDNA products represent prepro peptides with hydrophobic signal peptide sequences associated with their 5'-end terminus. The Gsp1 cDNA encodes a putative mature protein of 245 amino acids with a molecular mass of 26 428 Da, while the predicted size of the 228 amino acid mature peptide encoded by Gsp2 cDNA is 24 573 Da. Both deduced peptides contain the Asp/His/Ser catalytic triad and the conserved residues surrounding it which are characteristic of serine proteases. In addition, both proteins have the six-conserved cysteine residues to form the three-cysteine bonds typically present in invertebrate serine proteases. Based on the presence of substrate specific residues, the Gsp1 gene encodes a chymotrypsin-like protease while Gsp2 gene encodes for a protein with trypsin-like activity. Both proteins are encoded by few loci in tsetse genome, being present in one or two copies only. The mRNA expression levels for the genes do not vary extensively throughout the digestive cycle, and high levels of mRNAs can be readily detected in the gut tissue of newly emerged flies. The levels of trypsin and chymotrypsin activities in the gut lumen increase following blood feeding and change significantly in the gut cells throughout the digestion cycle. Hence, the regulation of expression for trypsin and chymotrypsin occurs at the post-transcriptional level in tsetse. Both the coding sequences and patterns of expression of Gsp1 and Gsp2 genes are similar to the serine proteases that have been reported from the bloodfeeding insect Stomoxys calcitrans.

  5. Stachyose synthesis in seeds of adzuki bean (Vigna angularis): molecular cloning and functional expression of stachyose synthase.

    PubMed

    Peterbauer, T; Mucha, J; Mayer, U; Popp, M; Glössl, J; Richter, A

    1999-12-01

    Stachyose is the major soluble carbohydrate in seeds of a number of important crop species. It is synthesized from raffinose and galactinol by the action of stachyose synthase (EC 2.4.1.67). We report here on the identification of a cDNA encoding stachyose synthase from seeds of adzuki bean (Vigna angularis Ohwi et Ohashi). Based on internal amino acid sequences of the enzyme purified from adzuki bean, oligonucleotides were designed and used to amplify corresponding sequences from adzuki bean cDNA by RT-PCR, followed by rapid amplification of cDNA ends (RACE-PCR). The complete cDNA sequence comprised 3046 nucleotides and included an open reading frame which encoded a polypeptide of 857 amino acid residues. The entire coding region was amplified by PCR, engineered into the baculovirus expression vector pVL1393 and introduced into Spodoptera frugiperda (Sf21) insect cells for heterologous expression. The recombinant protein was immunologically reactive with polyclonal antibodies raised against stachyose synthase purified from adzuki bean and was shown to be a functional stachyose synthase with the same catalytic properties as its native counterpart. High levels of stachyose synthase mRNA were transiently accumulated midway through seed development, and the enzyme was also present in mature seeds and during germination.

  6. cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

    PubMed

    Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

    2005-04-01

    A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

  7. Specific transfection of inflamed brain by macrophages: a new therapeutic strategy for neurodegenerative diseases.

    PubMed

    Haney, Matthew J; Zhao, Yuling; Harrison, Emily B; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D; Klyachko, Natalia L; Mosley, R Lee; Gendelman, Howard E; Kabanov, Alexander V; Batrakova, Elena V

    2013-01-01

    The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders.

  8. Specific Transfection of Inflamed Brain by Macrophages: A New Therapeutic Strategy for Neurodegenerative Diseases

    PubMed Central

    Haney, Matthew J.; Zhao, Yuling; Harrison, Emily B.; Mahajan, Vivek; Ahmed, Shaheen; He, Zhijian; Suresh, Poornima; Hingtgen, Shawn D.; Klyachko, Natalia L.; Mosley, R. Lee; Gendelman, Howard E.; Kabanov, Alexander V.; Batrakova, Elena V.

    2013-01-01

    The ability to precisely upregulate genes in inflamed brain holds great therapeutic promise. Here we report a novel class of vectors, genetically modified macrophages that carry reporter and therapeutic genes to neural cells. Systemic administration of macrophages transfected ex vivo with a plasmid DNA (pDNA) encoding a potent antioxidant enzyme, catalase, produced month-long expression levels of catalase in the brain resulting in three-fold reductions in inflammation and complete neuroprotection in mouse models of Parkinson's disease (PD). This resulted in significant improvements in motor functions in PD mice. Mechanistic studies revealed that transfected macrophages secreted extracellular vesicles, exosomes, packed with catalase genetic material, pDNA and mRNA, active catalase, and NF-κb, a transcription factor involved in the encoded gene expression. Exosomes efficiently transfer their contents to contiguous neurons resulting in de novo protein synthesis in target cells. Thus, genetically modified macrophages serve as a highly efficient system for reproduction, packaging, and targeted gene and drug delivery to treat inflammatory and neurodegenerative disorders. PMID:23620794

  9. A Potential Food-Grade Cloning Vector for Streptococcus thermophilus That Uses Cadmium Resistance as the Selectable Marker

    PubMed Central

    Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.

    2003-01-01

    A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023

  10. A potential food-grade cloning vector for Streptococcus thermophilus that uses cadmium resistance as the selectable marker.

    PubMed

    Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W

    2003-10-01

    A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.

  11. Differential Activation of Cellular DNA Damage Responses by Replication-Defective and Replication-Competent Adenovirus Mutants

    PubMed Central

    Prakash, Anand; Jayaram, Sumithra

    2012-01-01

    Adenovirus (Ad) mutants that lack early region 4 (E4) activate the phosphorylation of cellular DNA damage response proteins. In wild-type Ad type 5 (Ad5) infections, E1b and E4 proteins target the cellular DNA repair protein Mre11 for redistribution and degradation, thereby interfering with its ability to activate phosphorylation cascades important during DNA repair. The characteristics of Ad infection that activate cellular DNA repair processes are not yet well understood. We investigated the activation of DNA damage responses by a replication-defective Ad vector (AdRSVβgal) that lacks E1 and fails to produce the immediate-early E1a protein. E1a is important for activating early gene expression from the other viral early transcription units, including E4. AdRSVβgal can deliver its genome to the cell, but it is subsequently deficient for viral early gene expression and DNA replication. We studied the ability of AdRSVβgal-infected cells to induce cellular DNA damage responses. AdRSVβgal infection does activate formation of foci containing the Mdc1 protein. However, AdRSVβgal fails to activate phosphorylation of the damage response proteins Nbs1 and Chk1. We found that viral DNA replication is important for Nbs1 phosphorylation, suggesting that this step in the viral life cycle may provide an important trigger for activating at least some DNA repair proteins. PMID:23015708

  12. An efficient nonviral gene-delivery vector based on hyperbranched cationic glycogen derivatives.

    PubMed

    Liang, Xuan; Ren, Xianyue; Liu, Zhenzhen; Liu, Yingliang; Wang, Jue; Wang, Jingnan; Zhang, Li-Ming; Deng, David Yb; Quan, Daping; Yang, Liqun

    2014-01-01

    The purpose of this study was to synthesize and evaluate hyperbranched cationic glycogen derivatives as an efficient nonviral gene-delivery vector. A series of hyperbranched cationic glycogen derivatives conjugated with 3-(dimethylamino)-1-propylamine (DMAPA-Glyp) and 1-(2-aminoethyl) piperazine (AEPZ-Glyp) residues were synthesized and characterized by Fourier-transform infrared and hydrogen-1 nuclear magnetic resonance spectroscopy. Their buffer capacity was assessed by acid-base titration in aqueous NaCl solution. Plasmid deoxyribonucleic acid (pDNA) condensation ability and protection against DNase I degradation of the glycogen derivatives were assessed using agarose gel electrophoresis. The zeta potentials and particle sizes of the glycogen derivative/pDNA complexes were measured, and the images of the complexes were observed using atomic force microscopy. Blood compatibility and cytotoxicity were evaluated by hemolysis assay and MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) assay, respectively. pDNA transfection efficiency mediated by the cationic glycogen derivatives was evaluated by flow cytometry and fluorescence microscopy in the 293T (human embryonic kidney) and the CNE2 (human nasopharyngeal carcinoma) cell lines. In vivo delivery of pDNA in model animals (Sprague Dawley rats) was evaluated to identify the safety and transfection efficiency. The hyperbranched cationic glycogen derivatives conjugated with DMAPA and AEPZ residues were synthesized. They exhibited better blood compatibility and lower cytotoxicity when compared to branched polyethyleneimine (bPEI). They were able to bind and condense pDNA to form the complexes of 100-250 nm in size. The transfection efficiency of the DMAPA-Glyp/pDNA complexes was higher than those of the AEPZ-Glyp/pDNA complexes in both the 293T and CNE2 cells, and almost equal to those of bPEI. Furthermore, pDNA could be more safely delivered to the blood vessels in brain tissue of Sprague Dawley rats by the DMAPA-Glyp derivatives, and then expressed as green fluorescence protein, compared with the control group. The hyperbranched cationic glycogen derivatives, especially the DMAPA-Glyp derivatives, showed high gene-transfection efficiency, good blood compatibility, and low cyto toxicity when transfected in vitro and in vivo, which are novel potential nonviral gene vectors.

  13. Downregulation of SASH1 correlates with tumor progression and poor prognosis in ovarian carcinoma

    PubMed Central

    REN, XIAOYAN; LIU, YIFEI; TAO, YUMEI; ZHU, GUOXIANG; PEI, MEILAN; ZHANG, JIANGUO; LIU, JIAN

    2016-01-01

    SAM- and SH3-domain containing 1 (SASH1) is a recently identified tumor suppressor gene that is required in the tumorigenesis of breast and other solid carcinomas. The SASH1 protein contains SH3 and SAM domains, indicating that it may serve an important role in intracellular signal transduction. The purpose of the present study was to investigate the expression of SASH1 in ovarian carcinoma and the correlation between its expression with clinical pathological features and clinical significance, and the effect of SASH1 on cell proliferation, apoptosis and migration of ovarian SKOV3 cells. The human ovarian carcinoma tissues and adjacent normal tissues were collected following surgery. Reverse transcription-quantitative polymerase chain reaction and western blot analysis were used to detect the expression levels of SASH1 mRNA and protein, respectively. The expression levels of SASH1 mRNA and protein in ovarian carcinoma tissues were significantly lower than that observed in adjacent normal tissues (P<0.05). The expression levels of SASH1 in samples from patients without lymph nodes metastasis and patients with early FIGO stage was lower than those with lymph nodes metastasis and patients with advanced FIGO stage (P<0.05). Flow cytometry analysis and Transwell invasion chamber experiments were used to investigate the effect of SASH1 on the cell proliferation, apoptosis and migration of SKOV3 cells. The recombinant plasmid pcDNA3.1-SASH1 was constructed and transfected into SKOV3 cells. In addition, the SKOV3 cells in the pcDNA3.1-SASH1 group exhibited significantly reduced cell growth, proliferation, and migration ability compared to the empty vector group and normal group (P<0.01). There were a greater number of apoptotic cells in the pcDNA3.1-SASH1 group compared to the empty vector group and normal group (P<0.01). Taken together, these results indicated that SASH1 may be a tumor suppressor gene in ovarian carcinoma, and SASH1 expression inhibited growth, proliferation and migration, and enhanced apoptosis of SKOV3 cells. PMID:27123075

  14. Downregulation of SASH1 correlates with tumor progression and poor prognosis in ovarian carcinoma.

    PubMed

    Ren, Xiaoyan; Liu, Yifei; Tao, Yumei; Zhu, Guoxiang; Pei, Meilan; Zhang, Jianguo; Liu, Jian

    2016-05-01

    SAM- and SH3-domain containing 1 (SASH1) is a recently identified tumor suppressor gene that is required in the tumorigenesis of breast and other solid carcinomas. The SASH1 protein contains SH3 and SAM domains, indicating that it may serve an important role in intracellular signal transduction. The purpose of the present study was to investigate the expression of SASH1 in ovarian carcinoma and the correlation between its expression with clinical pathological features and clinical significance, and the effect of SASH1 on cell proliferation, apoptosis and migration of ovarian SKOV3 cells. The human ovarian carcinoma tissues and adjacent normal tissues were collected following surgery. Reverse transcription-quantitative polymerase chain reaction and western blot analysis were used to detect the expression levels of SASH1 mRNA and protein, respectively. The expression levels of SASH1 mRNA and protein in ovarian carcinoma tissues were significantly lower than that observed in adjacent normal tissues (P<0.05). The expression levels of SASH1 in samples from patients without lymph nodes metastasis and patients with early FIGO stage was lower than those with lymph nodes metastasis and patients with advanced FIGO stage (P<0.05). Flow cytometry analysis and Transwell invasion chamber experiments were used to investigate the effect of SASH1 on the cell proliferation, apoptosis and migration of SKOV3 cells. The recombinant plasmid pcDNA3.1-SASH1 was constructed and transfected into SKOV3 cells. In addition, the SKOV3 cells in the pcDNA3.1-SASH1 group exhibited significantly reduced cell growth, proliferation, and migration ability compared to the empty vector group and normal group (P<0.01). There were a greater number of apoptotic cells in the pcDNA3.1-SASH1 group compared to the empty vector group and normal group (P<0.01). Taken together, these results indicated that SASH1 may be a tumor suppressor gene in ovarian carcinoma, and SASH1 expression inhibited growth, proliferation and migration, and enhanced apoptosis of SKOV3 cells.

  15. Ternary polyplex micelles with PEG shells and intermediate barrier to complexed DNA cores for efficient systemic gene delivery.

    PubMed

    Li, Junjie; Chen, Qixian; Zha, Zengshi; Li, Hui; Toh, Kazuko; Dirisala, Anjaneyulu; Matsumoto, Yu; Osada, Kensuke; Kataoka, Kazunori; Ge, Zhishen

    2015-07-10

    Simultaneous achievement of prolonged retention in blood circulation and efficient gene transfection activity in target tissues has always been a major challenge hindering in vivo applications of nonviral gene vectors via systemic administration. Herein, we constructed novel rod-shaped ternary polyplex micelles (TPMs) via complexation between the mixed block copolymers of poly(ethylene glycol)-b-poly{N'-[N-(2-aminoethyl)-2-aminoethyl]aspartamide} (PEG-b-PAsp(DET)) and poly(N-isopropylacrylamide)-b-PAsp(DET) (PNIPAM-b-PAsp(DET)) and plasmid DNA (pDNA) at room temperature, exhibiting distinct temperature-responsive formation of a hydrophobic intermediate layer between PEG shells and pDNA cores through facile temperature increase from room temperature to body temperature (~37 °C). As compared with binary polyplex micelles of PEG-b-PAsp(DET) (BPMs), TPMs were confirmed to condense pDNA into a more compact structure, which achieved enhanced tolerability to nuclease digestion and strong counter polyanion exchange. In vitro gene transfection results demonstrated TPMs exhibiting enhanced gene transfection efficiency due to efficient cellular uptake and endosomal escape. Moreover, in vivo performance evaluation after intravenous injection confirmed that TPMs achieved significantly prolonged blood circulation, high tumor accumulation, and promoted gene expression in tumor tissue. Moreover, TPMs loading therapeutic pDNA encoding an anti-angiogenic protein remarkably suppressed tumor growth following intravenous injection into H22 tumor-bearing mice. These results suggest TPMs with PEG shells and facilely engineered intermediate barrier to inner complexed pDNA have great potentials as systemic nonviral gene vectors for cancer gene therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Altered DNA Methylation and Expression Profiles of 8-Oxoguanine DNA Glycosylase 1 in Lens Tissue from Age-related Cataract Patients.

    PubMed

    Wang, Yong; Li, Fei; Zhang, Guowei; Kang, Lihua; Qin, Bai; Guan, Huaijin

    2015-01-01

    Oxidative stress and DNA damage contribute to the pathogenesis of age-related cataract (ARC). Most oxidative DNA lesions are repaired via the base excision repair (BER) proteins including 8-oxoguanine DNA glycosylase 1 (OGG1). This study examined DNA methylation of CpG islands upstream of OGG1 and their relation to the gene expression in lens cortex from ARC patients. The clinical case-control study consisted of 15 cortical type of ARC patients and 15 age-matched non-ARC controls who received transparent lens extraction due to vitreoretinal diseases. OGG1 expression in lens cortex was analyzed by qRT-PCR and Western blot. The localization and the proportion of cells positive for OGG1 were determined by immunofluorescence. Bisulfite-sequencing PCR (BSP) was performed to evaluate the methylation status of CpG islands near OGG1 in DNA extracted from lens cortex. To test relationship between the methylation and the expression of the gene of interest, 5-Aza-2'-deoxycytidine (5-Aza-dC) was used to induce demethylation of cultured human lens epithelium B-3 (HLE B-3). To test the role of OGG1 in the repair of cellular damage, HLE B-3 was transfected with OGG1 vector, followed by ultraviolet radiation b (UVB) exposure to induce apoptosis. The mRNA and protein levels of OGG1 were significantly reduced in the lens cortex of ARC. Immunofluorescence showed that the proportion of OGG1-positive cells decreased significantly in ARC cortex in comparison with the control. The CpG island in first exon of OGG1 displayed hypermethylation in the DNA extracted from the lens cortex of ARC. Treatment of HLEB-3 cells with 5-Aza-dC upregulated OGG1 expression. UVB-induced apoptosis was attenuated after transfection with OGG1. A reduced OGG1 expression was correlated with hypermethylation of a CpG island of OGG1 in lens cortex of ARC. The role of epigenetic change in OGG1 gene in the susceptibility to oxidative stress induced cortical ARC is warranted to further study.

  17. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  18. New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

    DOE PAGES

    Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

    2008-01-01

    A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

  19. Increased proliferation of endothelial cells with overexpression of soluble TNF-alpha receptor I gene.

    PubMed

    Sugano, Masahiro; Tsuchida, Keiko; Tomita, Hideharu; Makino, Naoki

    2002-05-01

    Vascular endothelial growth factor (VEGF) can overcome a potential anti-angiogenic effect of TNF-alpha by inhibiting endothelial apoptosis induced by this cytokine. Soluble TNF-alpha receptor I (sTNFRI) is an extracellular domain of TNFRI and antagonizes the activity of TNF-alpha. Here we report that sTNFRI is able to stimulate the growth of endothelial cells not by antagonizing TNF-alpha. Exogenously added recombinant human sTNFRI stimulated significantly more cell growth of human umbilical venous endothelial cells (HUVEC) with a low dose (50-200 pg/ml) compared with smooth muscle cells. In contrast, monoclonal antibody against TNF-alpha did not stimulate growth of human HUVEC. The sTNFRI expression plasmid (pcDNA3.1 plasmid) was introduced into the cell culture using OPTI-MEM, lipofectin and transferrin. Growth of HUVEC transfected with sTNFRI vector also increased significantly compared with those transfected with control vector. HUVEC transfected with sTNFRI vector increased the extracellular domain of TNFRI mRNA levels, but did not affect the intracellular domain of TNFRI mRNA levels. Accumulation of sTNFRI significantly increased in conditioned medium from HUVEC transfected with sTNFRI vector compared with those transfected with control vector. HUVEC transfected with sTNFRI vector not only increased sTNFRI but also prevented shedding of sTNFRI from TNFRI. The TNF-alpha -induced internucleosomic fragmentation was also significantly prevented in HUVEC transfected with sTNFRI vector compared with those transfected with control vector. These results suggest that instead of growth factors such as VEGF, local transfection of the sTNFRI gene may have potential therapeutic value in vascular diseases in which TNF-alpha is also usually highly expressed.

  20. Plasmids of corynebacteria.

    PubMed

    Deb, J K; Nath, N

    1999-06-01

    Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Top