Xu, Li; Ding, Zhi-Shan; Zhou, Yun-Kai; Tao, Xue-Fen
2009-06-01
To obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis by RACE PCR,then investigate the character of Secoisolariciresinol Dehydrogenase gene. The full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene was obtained by 3'-RACE and 5'-RACE from Dysosma versipellis. We first reported the full cDNA sequences of Secoisolariciresinol Dehydrogenase in Dysosma versipellis. The acquired gene was 991bp in full length, including 5' untranslated region of 42bp, 3' untranslated region of 112bp with Poly (A). The open reading frame (ORF) encoding 278 amino acid with molecular weight 29253.3 Daltons and isolectric point 6.328. The gene accession nucleotide sequence number in GeneBank was EU573789. Semi-quantitative RT-PCR analysis revealed that the Secoisolariciresinol Dehydrogenase gene was highly expressed in stem. Alignment of the amino acid sequence of Secoisolariciresinol Dehydrogenase indicated there may be some significant amino acid sequence difference among different species. Obtain the full-length cDNA sequence of Secoisolariciresinol Dehydrogenase gene from Dysosma versipellis.
Colombo, M M; Swanton, M T; Donini, P; Prescott, D M
1984-01-01
Oxytricha nova is a hypotrichous ciliate with micronuclei and macronuclei. Micronuclei, which contain large, chromosomal-sized DNA, are genetically inert but undergo meiosis and exchange during cell mating. Macronuclei, which contain only small, gene-sized DNA molecules, provide all of the nuclear RNA needed to run the cell. After cell mating the macronucleus is derived from a micronucleus, a derivation that includes excision of the genes from chromosomes and elimination of the remaining DNA. The eliminated DNA includes all of the repetitious sequences and approximately 95% of the unique sequences. We cloned large restriction fragments from the micronucleus that confer replication ability on a replication-deficient plasmid in Saccharomyces cerevisiae. Sequences that confer replication ability are called autonomously replicating sequences. The frequency and effectiveness of autonomously replicating sequences in micronuclear DNA are similar to those reported for DNAs of other organisms introduced into yeast cells. Of the 12 micronuclear fragments with autonomously replicating sequence activity, 9 also showed homology to macronuclear DNA, indicating that they contain a macronuclear gene sequence. We conclude from this that autonomously replicating sequence activity is nonrandomly distributed throughout micronuclear DNA and is preferentially associated with those regions of micronuclear DNA that contain genes. Images PMID:6092934
Small tandemly repeated DNA sequences of higher plants likely originate from a tRNA gene ancestor.
Benslimane, A A; Dron, M; Hartmann, C; Rode, A
1986-01-01
Several monomers (177 bp) of a tandemly arranged repetitive nuclear DNA sequence of Brassica oleracea have been cloned and sequenced. They share up to 95% homology between one another and up to 80% with other satellite DNA sequences of Cruciferae, suggesting a common ancestor. Both strands of these monomers show more than 50% homology with many tRNA genes; the best homologies have been obtained with Lys and His yeast mitochondrial tRNA genes (respectively 64% and 60%). These results suggest that small tandemly repeated DNA sequences of plants may have evolved from a tRNA gene ancestor. These tandem repeats have probably arisen via a process involving reverse transcription of polymerase III RNA intermediates, as is the case for interspersed DNA sequences of mammalians. A model is proposed to explain the formation of such small tandemly repeated DNA sequences. Images PMID:3774553
Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei
2005-08-15
Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.
Enlightenment of Yeast Mitochondrial Homoplasmy: Diversified Roles of Gene Conversion
Ling, Feng; Mikawa, Tsutomu; Shibata, Takehiko
2011-01-01
Mitochondria have their own genomic DNA. Unlike the nuclear genome, each cell contains hundreds to thousands of copies of mitochondrial DNA (mtDNA). The copies of mtDNA tend to have heterogeneous sequences, due to the high frequency of mutagenesis, but are quickly homogenized within a cell (“homoplasmy”) during vegetative cell growth or through a few sexual generations. Heteroplasmy is strongly associated with mitochondrial diseases, diabetes and aging. Recent studies revealed that the yeast cell has the machinery to homogenize mtDNA, using a common DNA processing pathway with gene conversion; i.e., both genetic events are initiated by a double-stranded break, which is processed into 3′ single-stranded tails. One of the tails is base-paired with the complementary sequence of the recipient double-stranded DNA to form a D-loop (homologous pairing), in which repair DNA synthesis is initiated to restore the sequence lost by the breakage. Gene conversion generates sequence diversity, depending on the divergence between the donor and recipient sequences, especially when it occurs among a number of copies of a DNA sequence family with some sequence variations, such as in immunoglobulin diversification in chicken. MtDNA can be regarded as a sequence family, in which the members tend to be diversified by a high frequency of spontaneous mutagenesis. Thus, it would be interesting to determine why and how double-stranded breakage and D-loop formation induce sequence homogenization in mitochondria and sequence diversification in nuclear DNA. We will review the mechanisms and roles of mtDNA homoplasmy, in contrast to nuclear gene conversion, which diversifies gene and genome sequences, to provide clues toward understanding how the common DNA processing pathway results in such divergent outcomes. PMID:24710143
Holland, M J; Holland, J P; Thill, G P; Jackson, K A
1981-02-10
Segments of yeast genomic DNA containing two enolase structural genes have been isolated by subculture cloning procedures using a cDNA hybridization probe synthesized from purified yeast enolase mRNA. Based on restriction endonuclease and transcriptional maps of these two segments of yeast DNA, each hybrid plasmid contains a region of extensive nucleotide sequence homology which forms hybrids with the cDNA probe. The DNA sequences which flank this homologous region in the two hybrid plasmids are nonhomologous indicating that these sequences are nontandemly repeated in the yeast genome. The complete nucleotide sequence of the coding as well as the flanking noncoding regions of these genes has been determined. The amino acid sequence predicted from one reading frame of both structural genes is extremely similar to that determined for yeast enolase (Chin, C. C. Q., Brewer, J. M., Eckard, E., and Wold, F. (1981) J. Biol. Chem. 256, 1370-1376), confirming that these isolated structural genes encode yeast enolase. The nucleotide sequences of the coding regions of the genes are approximately 95% homologous, and neither gene contains an intervening sequence. Codon utilization in the enolase genes follows the same biased pattern previously described for two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes (Holland, J. P., and Holland, M. J. (1980) J. Biol. Chem. 255, 2596-2605). DNA blotting analysis confirmed that the isolated segments of yeast DNA are colinear with yeast genomic DNA and that there are two nontandemly repeated enolase genes per haploid yeast genome. The noncoding portions of the two enolase genes adjacent to the initiation and termination codons are approximately 70% homologous and contain sequences thought to be involved in the synthesis and processing messenger RNA. Finally there are regions of extensive homology between the two enolase structural genes and two yeast glyceraldehyde-3-phosphate dehydrogenase structural genes within the 5- noncoding portions of these glycolytic genes.
Walker, M D; Park, C W; Rosen, A; Aronheim, A
1990-01-01
Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401
Liu, Juan; Qi, Zhe-Chen; Zhao, Yun-Peng; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun
2012-09-01
The complete nucleotide sequence of the chloroplast genome (cpDNA) of Smilax china L. (Smilacaceae) is reported. It is the first complete cp genome sequence in Liliales. Genomic analyses were conducted to examine the rate and pattern of cpDNA genome evolution in Smilax relative to other major lineages of monocots. The cpDNA genomic sequences were combined with those available for Lilium to evaluate the phylogenetic position of Liliales and to investigate the influence of taxon sampling, gene sampling, gene function, natural selection, and substitution rate on phylogenetic inference in monocots. Phylogenetic analyses using sequence data of gene groups partitioned according to gene function, selection force, and total substitution rate demonstrated evident impacts of these factors on phylogenetic inference of monocots and the placement of Liliales, suggesting potential evolutionary convergence or adaptation of some cpDNA genes in monocots. Our study also demonstrated that reduced taxon sampling reduced the bootstrap support for the placement of Liliales in the cpDNA phylogenomic analysis. Analyses of sequences of 77 protein genes with some missing data and sequences of 81 genes (all protein genes plus the rRNA genes) support a sister relationship of Liliales to the commelinids-Asparagales clade, consistent with the APG III system. Analyses of 63 cpDNA protein genes for 32 taxa with few missing data, however, support a sister relationship of Liliales (represented by Smilax and Lilium) to Dioscoreales-Pandanales. Topology tests indicated that these two alignments do not significantly differ given any of these three cpDNA genomic sequence data sets. Furthermore, we found no saturation effect of the data, suggesting that the cpDNA genomic sequence data used in the study are appropriate for monocot phylogenetic study and long-branch attraction is unlikely to be the cause to explain the result of two well-supported, conflict placements of Liliales. Further analyses using sufficient nuclear data remain necessary to evaluate these two phylogenetic hypotheses regarding the position of Liliales and to address the causes of signal conflict among genes and partitions. Copyright © 2012 Elsevier Inc. All rights reserved.
Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L
1980-01-01
The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547
Lactobacillus heilongjiangensis sp. nov., isolated from Chinese pickle.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2013-11-01
A Gram-stain-positive bacterial strain, S4-3(T), was isolated from traditional pickle in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, pheS gene sequence analysis, rpoA gene sequence analysis, dnaK gene sequence analysis, fatty acid methyl ester (FAME) analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain S4-3(T) showed 97.9-98.7 % 16S rRNA gene sequence similarities, 84.4-94.1 % pheS gene sequence similarities and 94.4-96.9 % rpoA gene sequence similarities to the type strains of Lactobacillus nantensis, Lactobacillus mindensis, Lactobacillus crustorum, Lactobacillus futsaii, Lactobacillus farciminis and Lactobacillus kimchiensis. dnaK gene sequence similarities between S4-3(T) and Lactobacillus nantensis LMG 23510(T), Lactobacillus mindensis LMG 21932(T), Lactobacillus crustorum LMG 23699(T), Lactobacillus futsaii JCM 17355(T) and Lactobacillus farciminis LMG 9200(T) were 95.4, 91.5, 90.4, 91.7 and 93.1 %, respectively. Based upon the data obtained in the present study, a novel species, Lactobacillus heilongjiangensis sp. nov., is proposed and the type strain is S4-3(T) ( = LMG 26166(T) = NCIMB 14701(T)).
Minson, A C; Darby, G K; Wildy, P
1979-11-01
Two independently derived cell lines which carry the herpes simplex type 2 thymidine kinase gene have been examined for the presence of HSV-2-specific DNA sequences. Both cell lines contained 1 to 3 copies per cell of a sequence lying within map co-ordinates 0.2 to 0.4 of the HSV-2 genome. Revertant cells, which contained no detectable thymidine kinase, did not contain this DNA sequence. The failure of EcoR1-restricted HSV-2 DNA to act as a donor of the thymidine kinase gene in transformation experiments suggests that the gene lies close to the EcoR1 restriction site within this sequence at a map position of approx. 0.3. The HSV-2 kinase gene is therefore approximately co-linear with the HSV-1 gene.
DNA sequence responsible for the amplification of adjacent genes.
Pasion, S G; Hartigan, J A; Kumar, V; Biswas, D K
1987-10-01
A 10.3-kb DNA fragment in the 5'-flanking region of the rat prolactin (rPRL) gene was isolated from F1BGH(1)2C1, a strain of rat pituitary tumor cells (GH cells) that produces prolactin in response to 5-bromodeoxyuridine (BrdU). Following transfection and integration into genomic DNA of recipient mouse L cells, this DNA induced amplification of the adjacent thymidine kinase gene from Herpes simplex virus type 1 (HSV1TK). We confirmed the ability of this "Amplicon" sequence to induce amplification of other linked or unlinked genes in DNA-mediated gene transfer studies. When transferred into the mouse L cells with the 10.3-5'rPRL gene sequence of BrdU-responsive cells, both the human growth hormone and the HSV1TK genes are amplified in response to 5-bromodeoxyuridine. This observation is substantiated by BrdU-induced amplification of the cotransferred bacterial Neo gene. Cotransfection studies reveal that the BrdU-induced amplification capability is associated with a 4-kb DNA sequence in the 5'-flanking region of the rPRL gene of BrdU-responsive cells. These results demonstrate that genes of heterologous origin, linked or unlinked, and selected or unselected, can be coamplified when located within the amplification boundary of the Amplicon sequence.
Adeno-associated virus inverted terminal repeats stimulate gene editing.
Hirsch, M L
2015-02-01
Advancements in genome editing have relied on technologies to specifically damage DNA which, in turn, stimulates DNA repair including homologous recombination (HR). As off-target concerns complicate the therapeutic translation of site-specific DNA endonucleases, an alternative strategy to stimulate gene editing based on fragile DNA was investigated. To do this, an episomal gene-editing reporter was generated by a disruptive insertion of the adeno-associated virus (AAV) inverted terminal repeat (ITR) into the egfp gene. Compared with a non-structured DNA control sequence, the ITR induced DNA damage as evidenced by increased gamma-H2AX and Mre11 foci formation. As local DNA damage stimulates HR, ITR-mediated gene editing was investigated using DNA oligonucleotides as repair substrates. The AAV ITR stimulated gene editing >1000-fold in a replication-independent manner and was not biased by the polarity of the repair oligonucleotide. Analysis of additional human DNA sequences demonstrated stimulation of gene editing to varying degrees. In particular, inverted yet not direct, Alu repeats induced gene editing, suggesting a role for DNA structure in the repair event. Collectively, the results demonstrate that inverted DNA repeats stimulate gene editing via double-strand break repair in an episomal context and allude to efficient gene editing of the human chromosome using fragile DNA sequences.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu, Liyou; Yi, T. Y.; Van Nostrand, Joy
Phylogenetic analyses were done for the Shewanella strains isolated from Baltic Sea (38 strains), US DOE Hanford Uranium bioremediation site [Hanford Reach of the Columbia River (HRCR), 11 strains], Pacific Ocean and Hawaiian sediments (8 strains), and strains from other resources (16 strains) with three out group strains, Rhodopseudomonas palustris, Clostridium cellulolyticum, and Thermoanaerobacter ethanolicus X514, using DNA relatedness derived from WCGA-based DNA-DNA hybridizations, sequence similarities of 16S rRNA gene and gyrB gene, and sequence similarities of 6 loci of Shewanella genome selected from a shared gene list of the Shewanella strains with whole genome sequenced based on the averagemore » nucleotide identity of them (ANI). The phylogenetic trees based on 16S rRNA and gyrB gene sequences, and DNA relatedness derived from WCGA hybridizations of the tested Shewanella strains share exactly the same sub-clusters with very few exceptions, in which the strains were basically grouped by species. However, the phylogenetic analysis based on DNA relatedness derived from WCGA hybridizations dramatically increased the differentiation resolution at species and strains level within Shewanella genus. When the tree based on DNA relatedness derived from WCGA hybridizations was compared to the tree based on the combined sequences of the selected functional genes (6 loci), we found that the resolutions of both methods are similar, but the clustering of the tree based on DNA relatedness derived from WMGA hybridizations was clearer. These results indicate that WCGA-based DNA-DNA hybridization is an idea alternative of conventional DNA-DNA hybridization methods and it is superior to the phylogenetics methods based on sequence similarities of single genes. Detailed analysis is being performed for the re-classification of the strains examined.« less
Fractal landscape analysis of DNA walks
NASA Technical Reports Server (NTRS)
Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Sciortino, F.; Simons, M.; Stanley, H. E.
1992-01-01
By mapping nucleotide sequences onto a "DNA walk", we uncovered remarkably long-range power law correlations [Nature 356 (1992) 168] that imply a new scale invariant property of DNA. We found such long-range correlations in intron-containing genes and in non-transcribed regulatory DNA sequences, but not in cDNA sequences or intron-less genes. In this paper, we present more explicit evidences to support our findings.
DNA sequence-dependent mechanics and protein-assisted bending in repressor-mediated loop formation
Boedicker, James Q.; Garcia, Hernan G.; Johnson, Stephanie; Phillips, Rob
2014-01-01
As the chief informational molecule of life, DNA is subject to extensive physical manipulations. The energy required to deform double-helical DNA depends on sequence, and this mechanical code of DNA influences gene regulation, such as through nucleosome positioning. Here we examine the sequence-dependent flexibility of DNA in bacterial transcription factor-mediated looping, a context for which the role of sequence remains poorly understood. Using a suite of synthetic constructs repressed by the Lac repressor and two well-known sequences that show large flexibility differences in vitro, we make precise statistical mechanical predictions as to how DNA sequence influences loop formation and test these predictions using in vivo transcription and in vitro single-molecule assays. Surprisingly, sequence-dependent flexibility does not affect in vivo gene regulation. By theoretically and experimentally quantifying the relative contributions of sequence and the DNA-bending protein HU to DNA mechanical properties, we reveal that bending by HU dominates DNA mechanics and masks intrinsic sequence-dependent flexibility. Such a quantitative understanding of how mechanical regulatory information is encoded in the genome will be a key step towards a predictive understanding of gene regulation at single-base pair resolution. PMID:24231252
Human Chromosome 7: DNA Sequence and Biology
Scherer, Stephen W.; Cheung, Joseph; MacDonald, Jeffrey R.; Osborne, Lucy R.; Nakabayashi, Kazuhiko; Herbrick, Jo-Anne; Carson, Andrew R.; Parker-Katiraee, Layla; Skaug, Jennifer; Khaja, Razi; Zhang, Junjun; Hudek, Alexander K.; Li, Martin; Haddad, May; Duggan, Gavin E.; Fernandez, Bridget A.; Kanematsu, Emiko; Gentles, Simone; Christopoulos, Constantine C.; Choufani, Sanaa; Kwasnicka, Dorota; Zheng, Xiangqun H.; Lai, Zhongwu; Nusskern, Deborah; Zhang, Qing; Gu, Zhiping; Lu, Fu; Zeesman, Susan; Nowaczyk, Malgorzata J.; Teshima, Ikuko; Chitayat, David; Shuman, Cheryl; Weksberg, Rosanna; Zackai, Elaine H.; Grebe, Theresa A.; Cox, Sarah R.; Kirkpatrick, Susan J.; Rahman, Nazneen; Friedman, Jan M.; Heng, Henry H. Q.; Pelicci, Pier Giuseppe; Lo-Coco, Francesco; Belloni, Elena; Shaffer, Lisa G.; Pober, Barbara; Morton, Cynthia C.; Gusella, James F.; Bruns, Gail A. P.; Korf, Bruce R.; Quade, Bradley J.; Ligon, Azra H.; Ferguson, Heather; Higgins, Anne W.; Leach, Natalia T.; Herrick, Steven R.; Lemyre, Emmanuelle; Farra, Chantal G.; Kim, Hyung-Goo; Summers, Anne M.; Gripp, Karen W.; Roberts, Wendy; Szatmari, Peter; Winsor, Elizabeth J. T.; Grzeschik, Karl-Heinz; Teebi, Ahmed; Minassian, Berge A.; Kere, Juha; Armengol, Lluis; Pujana, Miguel Angel; Estivill, Xavier; Wilson, Michael D.; Koop, Ben F.; Tosi, Sabrina; Moore, Gudrun E.; Boright, Andrew P.; Zlotorynski, Eitan; Kerem, Batsheva; Kroisel, Peter M.; Petek, Erwin; Oscier, David G.; Mould, Sarah J.; Döhner, Hartmut; Döhner, Konstanze; Rommens, Johanna M.; Vincent, John B.; Venter, J. Craig; Li, Peter W.; Mural, Richard J.; Adams, Mark D.; Tsui, Lap-Chee
2010-01-01
DNA sequence and annotation of the entire human chromosome 7, encompassing nearly 158 million nucleotides of DNA and 1917 gene structures, are presented. To generate a higher order description, additional structural features such as imprinted genes, fragile sites, and segmental duplications were integrated at the level of the DNA sequence with medical genetic data, including 440 chromosome rearrangement breakpoints associated with disease. This approach enabled the discovery of candidate genes for developmental diseases including autism. PMID:12690205
Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).
Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E
2005-12-02
cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.
Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.
Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F
2011-08-01
Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.
Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong
2013-07-04
Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.
[Genome-scale sequence data processing and epigenetic analysis of DNA methylation].
Wang, Ting-Zhang; Shan, Gao; Xu, Jian-Hong; Xue, Qing-Zhong
2013-06-01
A new approach recently developed for detecting cytosine DNA methylation (mC) and analyzing the genome-scale DNA methylation profiling, is called BS-Seq which is based on bisulfite conversion of genomic DNA combined with next-generation sequencing. The method can not only provide an insight into the difference of genome-scale DNA methylation among different organisms, but also reveal the conservation of DNA methylation in all contexts and nucleotide preference for different genomic regions, including genes, exons, and repetitive DNA sequences. It will be helpful to under-stand the epigenetic impacts of cytosine DNA methylation on the regulation of gene expression and maintaining silence of repetitive sequences, such as transposable elements. In this paper, we introduce the preprocessing steps of DNA methylation data, by which cytosine (C) and guanine (G) in the reference sequence are transferred to thymine (T) and adenine (A), and cytosine in reads is transferred to thymine, respectively. We also comprehensively review the main content of the DNA methylation analysis on the genomic scale: (1) the cytosine methylation under the context of different sequences; (2) the distribution of genomic methylcytosine; (3) DNA methylation context and the preference for the nucleotides; (4) DNA- protein interaction sites of DNA methylation; (5) degree of methylation of cytosine in the different structural elements of genes. DNA methylation analysis technique provides a powerful tool for the epigenome study in human and other species, and genes and environment interaction, and founds the theoretical basis for further development of disease diagnostics and therapeutics in human.
2018-01-01
FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722
Pan, W J; Blackburn, E H
1995-01-01
The rRNA genes in the somatic macronucleus of Tetrahymena thermophila are normally on 21 kb linear palindromic molecules (rDNA). We examined the effect on rRNA gene dosage of transforming T.thermophila macronuclei with plasmid constructs containing a pair of tandemly repeated rDNA replication origin regions unlinked to the rRNA gene. A significant proportion of the plasmid sequences were maintained as high copy circular molecules, eventually consisting solely of tandem arrays of origin regions. As reported previously for cells transformed by a construct in which the same tandem rDNA origins were linked to the rRNA gene [Yu, G.-L. and Blackburn, E. H. (1990) Mol. Cell. Biol., 10, 2070-2080], origin sequences recombined to form linear molecules bearing several tandem repeats of the origin region, as well as rRNA genes. The total number of rDNA origin sequences eventually exceeded rRNA gene copies by approximately 20- to 40-fold and the number of circular replicons carrying only rDNA origin sequences exceeded rRNA gene copies by 2- to 3-fold. However, the rRNA gene dosage was unchanged. Hence, simply monitoring the total number of rDNA origin regions is not sufficient to regulate rRNA gene copy number. Images PMID:7784211
Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G
1995-01-01
The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961
Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.
Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo
2016-09-01
Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J
1995-06-01
Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.
Selective DNA demethylation by fusion of TDG with a sequence-specific DNA-binding domain
Gregory, David J.; Mikhaylova, Lyudmila; Fedulov, Alexey V.
2012-01-01
Our ability to selectively manipulate gene expression by epigenetic means is limited, as there is no approach for targeted reactivation of epigenetically silenced genes, in contrast to what is available for selective gene silencing. We aimed to develop a tool for selective transcriptional activation by DNA demethylation. Here we present evidence that direct targeting of thymine-DNA-glycosylase (TDG) to specific sequences in the DNA can result in local DNA demethylation at potential regulatory sequences and lead to enhanced gene induction. When TDG was fused to a well-characterized DNA-binding domain [the Rel-homology domain (RHD) of NFκB], we observed decreased DNA methylation and increased transcriptional response to unrelated stimulus of inducible nitric oxide synthase (NOS2). The effect was not seen for control genes lacking either RHD-binding sites or high levels of methylation, nor in control mock-transduced cells. Specific reactivation of epigenetically silenced genes may thus be achievable by this approach, which provides a broadly useful strategy to further our exploration of biological mechanisms and to improve control over the epigenome. PMID:22419066
Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)
Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing
1998-01-01
The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330
Gilley, D; Preer, J R; Aufderheide, K J; Polisky, B
1988-01-01
Paramecium tetraurelia can be transformed by microinjection of cloned serotype A gene sequences into the macronucleus. Transformants are detected by their ability to express serotype A surface antigen from the injected templates. After injection, the DNA is converted from a supercoiled form to a linear form by cleavage at nonrandom sites. The linear form appears to replicate autonomously as a unit-length molecule and is present in transformants at high copy number. The injected DNA is further processed by the addition of paramecium-type telomeric sequences to the termini of the linear DNA. To examine the fate of injected linear DNA molecules, plasmid pSA14SB DNA containing the A gene was cleaved into two linear pieces, a 14-kilobase (kb) piece containing the A gene and flanking sequences and a 2.2-kb piece consisting of the procaryotic vector. In transformants expressing the A gene, we observed that two linear DNA species were present which correspond to the two species injected. Both species had Paramecium telomerelike sequences added to their termini. For the 2.2-kb DNA, we show that the site of addition of the telomerelike sequences is directly at one terminus and within one nucleotide of the other terminus. These results indicate that injected procaryotic DNA is capable of autonomous replication in Paramecium macronuclei and that telomeric addition in the macronucleus does not require specific recognition sequences. Images PMID:3211128
Gruszka, Damian; Marzec, Marek; Szarejko, Iwona
2012-06-14
The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L.) Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags) as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD), presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L.) sequence databases, including the "Barley Genome version 0.05" database (encompassing ca. 90% of barley coding sequences) and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. The presented database provides information about the Arabidopsis genes involved in DNA replication and repair, their expression patterns and models of protein interactions. It was designed and established to provide an open-access tool for the identification of monocot homologs of known Arabidopsis genes that are responsible for DNA-related processes. The barley genes identified in the project are currently being analysed to validate their function.
NASA Astrophysics Data System (ADS)
Zhou, Hong; Zhang, Zhinan; Chen, Haiyan; Sun, Renhua; Wang, Hui; Guo, Lei; Pan, Haijian
2010-07-01
In this study, we integrated a DNA barcoding project with an ecological survey on intertidal polychaete communities and investigated the utility of CO1 gene sequence as a DNA barcode for the classification of the intertidal polychaetes. Using 16S rDNA as a complementary marker and combining morphological and ecological characterization, some of dominant and common polychaete species from Chinese coasts were assessed for their taxonomic status. We obtained 22 haplotype gene sequences of 13 taxa, including 10 CO1 sequences and 12 16S rDNA sequences. Based on intra- and inter-specific distances, we built phylogenetic trees using the neighbor-joining method. Our study suggested that the mitochondrial CO1 gene was a valid DNA barcoding marker for species identification in polychaetes, but other genes, such as 16S rDNA, could be used as a complementary genetic marker. For more accurate species identification and effective testing of species hypothesis, DNA barcoding should be incorporated with morphological, ecological, biogeographical, and phylogenetic information. The application of DNA barcoding and molecular identification in the ecological survey on the intertidal polychaete communities demonstrated the feasibility of integrating DNA taxonomy and ecology.
Gomes, S L; Gober, J W; Shapiro, L
1990-01-01
Caulobacter crescentus has a single dnaK gene that is highly homologous to the hsp70 family of heat shock genes. Analysis of the cloned and sequenced dnaK gene has shown that the deduced amino acid sequence could encode a protein of 67.6 kilodaltons that is 68% identical to the DnaK protein of Escherichia coli and 49% identical to the Drosophila and human hsp70 protein family. A partial open reading frame 165 base pairs 3' to the end of dnaK encodes a peptide of 190 amino acids that is 59% identical to DnaJ of E. coli. Northern blot analysis revealed a single 4.0-kilobase mRNA homologous to the cloned fragment. Since the dnaK coding region is 1.89 kilobases, dnaK and dnaJ may be transcribed as a polycistronic message. S1 mapping and primer extension experiments showed that transcription initiated at two sites 5' to the dnaK coding sequence. A single start site of transcription was identified during heat shock at 42 degrees C, and the predicted promoter sequence conformed to the consensus heat shock promoters of E. coli. At normal growth temperature (30 degrees C), a different start site was identified 3' to the heat shock start site that conformed to the E. coli sigma 70 promoter consensus sequence. S1 protection assays and analysis of expression of the dnaK gene fused to the lux transcription reporter gene showed that expression of dnaK is temporally controlled under normal physiological conditions and that transcription occurs just before the initiation of DNA replication. Thus, in both human cells (I. K. L. Milarski and R. I. Morimoto, Proc. Natl. Acad. Sci. USA 83:9517-9521, 1986) and in a simple bacterium, the transcription of a hsp70 gene is temporally controlled as a function of the cell cycle under normal growth conditions. Images PMID:2345134
Wang, Yongming; Lin, Xiuyun; Dong, Bo; Wang, Yingdian; Liu, Bao
2004-01-01
RAPD (randomly amplified polymorphic DNA) and ISSR (inter-simple sequence repeat) fingerprinting on HpaII/MspI-digested genomic DNA of nine elite japonica rice cultivars implies inter-cultivar DNA methylation polymorphism. Using both DNA fragments isolated from RAPD or ISSR gels and selected low-copy sequences as probes, methylation-sensitive Southern blot analysis confirms the existence of extensive DNA methylation polymorphism in both genes and DNA repeats among the rice cultivars. The cultivar-specific methylation patterns are stably maintained, and can be used as reliable molecular markers. Transcriptional analysis of four selected sequences (RdRP, AC9, HSP90 and MMR) on leaves and roots from normal and 5-azacytidine-treated seedlings of three representative cultivars shows an association between the transcriptional activity of one of the genes, the mismatch repair (MMR) gene, and its CG methylation patterns.
Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity
NASA Astrophysics Data System (ADS)
Mukherjee, Shashi Bajaj; Sen, Pradip Kumar
2010-10-01
Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Rivera, Henry; Hernández-Laín, Aurelio; Coca-Robinot, David; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, Miguel A; Martínez-Azorín, Francisco
2017-01-01
Whole-exome sequencing was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase, deficiency of mitochondrial complex III and depletion of mtDNA. With whole-exome sequencing data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in thymidine kinase 2 gene ( TK2; NM_004614.4:c.323 C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes. This patient presents an atypical TK2-related myopathic form of mtDNA depletion syndromes, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in mtDNA depletion syndromes and expanded the phenotypic spectrum.
Kerschner, Joseph E; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J Christopher; Ehrlich, Garth D
2010-04-01
We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription-polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis.
Kerschner, Joseph E.; Erdos, Geza; Hu, Fen Ze; Burrows, Amy; Cioffi, Joseph; Khampang, Pawjai; Dahlgren, Margaret; Hayes, Jay; Keefe, Randy; Janto, Benjamin; Post, J. Christopher; Ehrlich, Garth D.
2010-01-01
Objectives We sought to construct and partially characterize complementary DNA (cDNA) libraries prepared from the middle ear mucosa (MEM) of chinchillas to better understand pathogenic aspects of infection and inflammation, particularly with respect to leukotriene biogenesis and response. Methods Chinchilla MEM was harvested from controls and after middle ear inoculation with nontypeable Haemophilus influenzae. RNA was extracted to generate cDNA libraries. Randomly selected clones were subjected to sequence analysis to characterize the libraries and to provide DNA sequence for phylogenetic analyses. Reverse transcription–polymerase chain reaction of the RNA pools was used to generate cDNA sequences corresponding to genes associated with leukotriene biosynthesis and metabolism. Results Sequence analysis of 921 randomly selected clones from the uninfected MEM cDNA library produced approximately 250,000 nucleotides of almost entirely novel sequence data. Searches of the GenBank database with the Basic Local Alignment Search Tool provided for identification of 515 unique genes expressed in the MEM and not previously described in chinchillas. In almost all cases, the chinchilla cDNA sequences displayed much greater homology to human or other primate genes than with rodent species. Genes associated with leukotriene metabolism were present in both normal and infected MEM. Conclusions Based on both phylogenetic comparisons and gene expression similarities with humans, chinchilla MEM appears to be an excellent model for the study of middle ear inflammation and infection. The higher degree of sequence similarity between chinchillas and humans compared to chinchillas and rodents was unexpected. The cDNA libraries from normal and infected chinchilla MEM will serve as useful molecular tools in the study of otitis media and should yield important information with respect to middle ear pathogenesis. PMID:20433028
King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach
2014-01-01
Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.
Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun
1997-01-01
ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063
Frye, Mark A; Ryu, Euijung; Nassan, Malik; Jenkins, Gregory D; Andreazza, Ana C; Evans, Jared M; McElroy, Susan L; Oglesbee, Devin; Highsmith, W Edward; Biernacka, Joanna M
2017-01-01
Converging genetic, postmortem gene-expression, cellular, and neuroimaging data implicate mitochondrial dysfunction in bipolar disorder. This study was conducted to investigate whether mitochondrial DNA (mtDNA) haplogroups and single nucleotide variants (SNVs) are associated with sub-phenotypes of bipolar disorder. MtDNA from 224 patients with Bipolar I disorder (BPI) was sequenced, and association of sequence variations with 3 sub-phenotypes (psychosis, rapid cycling, and adolescent illness onset) was evaluated. Gene-level tests were performed to evaluate overall burden of minor alleles for each phenotype. The haplogroup U was associated with a higher risk of psychosis. Secondary analyses of SNVs provided nominal evidence for association of psychosis with variants in the tRNA, ND4 and ND5 genes. The association of psychosis with ND4 (gene that encodes NADH dehydrogenase 4) was further supported by gene-level analysis. Preliminary analysis of mtDNA sequence data suggests a higher risk of psychosis with the U haplogroup and variation in the ND4 gene implicated in electron transport chain energy regulation. Further investigation of the functional consequences of this mtDNA variation is encouraged. Copyright © 2016. Published by Elsevier Ltd.
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1987-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1990-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1988-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330
A comprehensive list of cloned human DNA sequences
Schmidtke, Jörg; Cooper, David N.
1989-01-01
A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889
Cooper, David N.; Bacolla, Albino; Férec, Claude; Vasquez, Karen M.; Kehrer-Sawatzki, Hildegard; Chen, Jian-Min
2011-01-01
Different types of human gene mutation may vary in size, from structural variants (SVs) to single base-pair substitutions, but what they all have in common is that their nature, size and location are often determined either by specific characteristics of the local DNA sequence environment or by higher-order features of the genomic architecture. The human genome is now recognized to contain ‘pervasive architectural flaws’ in that certain DNA sequences are inherently mutation-prone by virtue of their base composition, sequence repetitivity and/or epigenetic modification. Here we explore how the nature, location and frequency of different types of mutation causing inherited disease are shaped in large part, and often in remarkably predictable ways, by the local DNA sequence environment. The mutability of a given gene or genomic region may also be influenced indirectly by a variety of non-canonical (non-B) secondary structures whose formation is facilitated by the underlying DNA sequence. Since these non-B DNA structures can interfere with subsequent DNA replication and repair, and may serve to increase mutation frequencies in generalized fashion (i.e. both in the context of subtle mutations and SVs), they have the potential to serve as a unifying concept in studies of mutational mechanisms underlying human inherited disease. PMID:21853507
The full mitochondrial genome sequence of Raillietina tetragona from chicken (Cestoda: Davaineidae).
Liang, Jian-Ying; Lin, Rui-Qing
2016-11-01
In the present study, the complete mitochondrial DNA (mtDNA) sequence of Raillietina tetragona was sequenced and its gene contents and genome organizations was compared with that of other tapeworm. The complete mt genome sequence of R. tetragona is 14,444 bp in length. It contains 12 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes, and two non-coding region. All genes are transcribed in the same direction and have a nucleotide composition high in A and T. The contents of A + T of the complete mt genome are 71.4% for R. tetragona. The R. tetragona mt genome sequence provides novel mtDNA marker for studying the molecular epidemiology and population genetics of Raillietina and has implications for the molecular diagnosis of chicken cestodosis caused by Raillietina.
2012-01-01
Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984
Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed
2012-08-10
Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Regulatory link between DNA methylation and active demethylation in Arabidopsis
Lei, Mingguang; Zhang, Huiming; Julian, Russell; Tang, Kai; Xie, Shaojun; Zhu, Jian-Kang
2015-01-01
De novo DNA methylation through the RNA-directed DNA methylation (RdDM) pathway and active DNA demethylation play important roles in controlling genome-wide DNA methylation patterns in plants. Little is known about how cells manage the balance between DNA methylation and active demethylation activities. Here, we report the identification of a unique RdDM target sequence, where DNA methylation is required for maintaining proper active DNA demethylation of the Arabidopsis genome. In a genetic screen for cellular antisilencing factors, we isolated several REPRESSOR OF SILENCING 1 (ros1) mutant alleles, as well as many RdDM mutants, which showed drastically reduced ROS1 gene expression and, consequently, transcriptional silencing of two reporter genes. A helitron transposon element (TE) in the ROS1 gene promoter negatively controls ROS1 expression, whereas DNA methylation of an RdDM target sequence between ROS1 5′ UTR and the promoter TE region antagonizes this helitron TE in regulating ROS1 expression. This RdDM target sequence is also targeted by ROS1, and defective DNA demethylation in loss-of-function ros1 mutant alleles causes DNA hypermethylation of this sequence and concomitantly causes increased ROS1 expression. Our results suggest that this sequence in the ROS1 promoter region serves as a DNA methylation monitoring sequence (MEMS) that senses DNA methylation and active DNA demethylation activities. Therefore, the ROS1 promoter functions like a thermostat (i.e., methylstat) to sense DNA methylation levels and regulates DNA methylation by controlling ROS1 expression. PMID:25733903
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richardson, C.C.
1993-12-31
This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less
Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi
2004-07-07
Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.
NASA Astrophysics Data System (ADS)
Sun, S. M.; Slightom, J. L.; Hall, T. C.
1981-01-01
A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Variation in the DNA methylation pattern of expressed and nonexpressed genes in chicken.
Cooper, D N; Errington, L H; Clayton, R M
1983-01-01
Using methyl-sensitive and -insensitive restriction enzymes, Hpa II and Msp I, the methylation status of various chicken genes was examined in different tissues and developmental stages. Tissue-specific differences in methylation were found for the delta-crystallin, beta-tubulin, G3PDH, rDNA, and actin genes but not for the histone genes. Developmental decreases in methylation were noted for the delta-crystallin and actin genes in chicken kidney between embryo and adult. Since most of the sequences examined were housekeeping genes, transcriptional differences are apparently not a necessary accompaniment to changes in DNA methylation at the CpG sites examined. The only exception is sperm DNA where the delta-crystallin, beta-tubulin, and actin genes are highly methylated and almost certainly not transcribed. However the G3PDH genes are no more highly methylated in sperm than in other somatic tissues. Many sequences homologous to the rDNA and histone probes used are unmethylated in all tissues examined including sperm, but a methylated rDNA subfraction is more heavily methylated in sperm than in other tissues. We speculate as to the significance of these differences in sperm DNA methylation in the light of possible requirements for early gene activation and the probable deleterious mutagenic effects of heavy methylation within coding sequences.
Cruz, V P; Oliveira, C; Foresti, F
2015-01-01
5S rDNA genes of the stingray Potamotrygon motoro were PCR replicated, purified, cloned and sequenced. Two distinct classes of segments of different sizes were obtained. The smallest, with 342 bp units, was classified as class I, and the largest, with 1900 bp units, was designated as class II. Alignment with the consensus sequences for both classes showed changes in a few bases in the 5S rDNA genes. TATA-like sequences were detected in the nontranscribed spacer (NTS) regions of class I and a microsatellite (GCT) 10 sequence was detected in the NTS region of class II. The results obtained can help to understand the molecular organization of ribosomal genes and the mechanism of gene dispersion.
ERIC Educational Resources Information Center
Rowland-Goldsmith, Melissa
2009-01-01
DNA microarray is an ordered grid containing known sequences of DNA, which represent many of the genes in a particular organism. Each DNA sequence is unique to a specific gene. This technology enables the researcher to screen many genes from cells or tissue grown in different conditions. We developed an undergraduate lecture and laboratory…
Novel numerical and graphical representation of DNA sequences and proteins.
Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D
2006-12-01
We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.
Prescott, D M
1994-01-01
Ciliates contain two types of nuclei: a micronucleus and a macronucleus. The micronucleus serves as the germ line nucleus but does not express its genes. The macronucleus provides the nuclear RNA for vegetative growth. Mating cells exchange haploid micronuclei, and a new macronucleus develops from a new diploid micronucleus. The old macronucleus is destroyed. This conversion consists of amplification, elimination, fragmentation, and splicing of DNA sequences on a massive scale. Fragmentation produces subchromosomal molecules in Tetrahymena and Paramecium cells and much smaller, gene-sized molecules in hypotrichous ciliates to which telomere sequences are added. These molecules are then amplified, some to higher copy numbers than others. rDNA is differentially amplified to thousands of copies per macronucleus. Eliminated sequences include transposonlike elements and sequences called internal eliminated sequences that interrupt gene coding regions in the micronuclear genome. Some, perhaps all, of these are excised as circular molecules and destroyed. In at least some hypotrichs, segments of some micronuclear genes are scrambled in a nonfunctional order and are recorded during macronuclear development. Vegetatively growing ciliates appear to possess a mechanism for adjusting copy numbers of individual genes, which corrects gene imbalances resulting from random distribution of DNA molecules during amitosis of the macronucleus. Other distinctive features of ciliate DNA include an altered use of the conventional stop codons. Images PMID:8078435
A DNA barcode for land plants.
2009-08-04
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK-psbI spacer, and trnH-psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants.
Hollingsworth, Peter M.; Forrest, Laura L.; Spouge, John L.; Hajibabaei, Mehrdad; Ratnasingham, Sujeevan; van der Bank, Michelle; Chase, Mark W.; Cowan, Robyn S.; Erickson, David L.; Fazekas, Aron J.; Graham, Sean W.; James, Karen E.; Kim, Ki-Joong; Kress, W. John; Schneider, Harald; van AlphenStahl, Jonathan; Barrett, Spencer C.H.; van den Berg, Cassio; Bogarin, Diego; Burgess, Kevin S.; Cameron, Kenneth M.; Carine, Mark; Chacón, Juliana; Clark, Alexandra; Clarkson, James J.; Conrad, Ferozah; Devey, Dion S.; Ford, Caroline S.; Hedderson, Terry A.J.; Hollingsworth, Michelle L.; Husband, Brian C.; Kelly, Laura J.; Kesanakurti, Prasad R.; Kim, Jung Sung; Kim, Young-Dong; Lahaye, Renaud; Lee, Hae-Lim; Long, David G.; Madriñán, Santiago; Maurin, Olivier; Meusnier, Isabelle; Newmaster, Steven G.; Park, Chong-Wook; Percy, Diana M.; Petersen, Gitte; Richardson, James E.; Salazar, Gerardo A.; Savolainen, Vincent; Seberg, Ole; Wilkinson, Michael J.; Yi, Dong-Keun; Little, Damon P.
2009-01-01
DNA barcoding involves sequencing a standard region of DNA as a tool for species identification. However, there has been no agreement on which region(s) should be used for barcoding land plants. To provide a community recommendation on a standard plant barcode, we have compared the performance of 7 leading candidate plastid DNA regions (atpF–atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbK–psbI spacer, and trnH–psbA spacer). Based on assessments of recoverability, sequence quality, and levels of species discrimination, we recommend the 2-locus combination of rbcL+matK as the plant barcode. This core 2-locus barcode will provide a universal framework for the routine use of DNA sequence data to identify specimens and contribute toward the discovery of overlooked species of land plants. PMID:19666622
Li, XiaoChing; Wang, Xiu-Jie; Tannenhauser, Jonathan; Podell, Sheila; Mukherjee, Piali; Hertel, Moritz; Biane, Jeremy; Masuda, Shoko; Nottebohm, Fernando; Gaasterland, Terry
2007-01-01
Vocal learning and neuronal replacement have been studied extensively in songbirds, but until recently, few molecular and genomic tools for songbird research existed. Here we describe new molecular/genomic resources developed in our laboratory. We made cDNA libraries from zebra finch (Taeniopygia guttata) brains at different developmental stages. A total of 11,000 cDNA clones from these libraries, representing 5,866 unique gene transcripts, were randomly picked and sequenced from the 3′ ends. A web-based database was established for clone tracking, sequence analysis, and functional annotations. Our cDNA libraries were not normalized. Sequencing ESTs without normalization produced many developmental stage-specific sequences, yielding insights into patterns of gene expression at different stages of brain development. In particular, the cDNA library made from brains at posthatching day 30–50, corresponding to the period of rapid song system development and song learning, has the most diverse and richest set of genes expressed. We also identified five microRNAs whose sequences are highly conserved between zebra finch and other species. We printed cDNA microarrays and profiled gene expression in the high vocal center of both adult male zebra finches and canaries (Serinus canaria). Genes differentially expressed in the high vocal center were identified from the microarray hybridization results. Selected genes were validated by in situ hybridization. Networks among the regulated genes were also identified. These resources provide songbird biologists with tools for genome annotation, comparative genomics, and microarray gene expression analysis. PMID:17426146
Rinke, Jenny; Schäfer, Vivien; Schmidt, Mathias; Ziermann, Janine; Kohlmann, Alexander; Hochhaus, Andreas; Ernst, Thomas
2013-08-01
We sought to establish a convenient, sensitive next-generation sequencing (NGS) method for genotyping the 26 most commonly mutated leukemia-associated genes in a single work flow and to optimize this method for low amounts of input template DNA. We designed 184 PCR amplicons that cover all of the candidate genes. NGS was performed with genomic DNA (gDNA) from a cohort of 10 individuals with chronic myelomonocytic leukemia. The results were compared with NGS data obtained from sequencing of DNA generated by whole-genome amplification (WGA) of 20 ng template gDNA. Differences between gDNA and WGA samples in variant frequencies were determined for 2 different WGA kits. For gDNA samples, 25 of 26 genes were successfully sequenced with a sensitivity of 5%, which was achieved by a median coverage of 492 reads (range, 308-636 reads) per amplicon. We identified 24 distinct mutations in 11 genes. With WGA samples, we reliably detected all mutations above 5% sensitivity with a median coverage of 506 reads (range, 256-653 reads) per amplicon. With all variants included in the analysis, WGA amplification by the 2 kits tested yielded differences in variant frequencies that ranged from -28.19% to +9.94% [mean (SD) difference, -0.2% (4.08%)] and from -35.03% to +18.67% [mean difference, -0.75% (5.12%)]. Our method permits simultaneous analysis of a wide range of leukemia-associated target genes in a single sequencing run. NGS can be performed after WGA of template DNA for reliable detection of variants without introducing appreciable bias.
Guard, Jean; Sanchez-Ingunza, Roxana; Morales, Cesar; Stewart, Tod; Liljebjelke, Karen; Kessel, JoAnn; Ingram, Kim; Jones, Deana; Jackson, Charlene; Fedorka-Cray, Paula; Frye, Jonathan; Gast, Richard; Hinton, Arthur
2012-01-01
Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research. PMID:22998607
de Bellocq, J Goüy; Leirs, H
2009-09-01
Sequences of the complete open reading frame (ORF) for rodents major histocompatibility complex (MHC) class II genes are rare. Multimammate rat (Mastomys natalensis) complementary DNA (cDNA) encoding the alpha and beta chains of MHC class II DQ gene was cloned from a rapid amplifications of cDNA Emds (RACE) cDNA library. The ORFs consist of 801 and 771 bp encoding 266 and 256 amino acid residues for DQB and DQA, respectively. The genomic structure of Mana-DQ genes is globally analogous to that described for other rodents except for the insertion of a serine residue in the signal peptide of Mana-DQB, which is unique among known rodents.
Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y
2004-05-01
Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.
Genetic characterization of the Bifidobacterium breve UCC 2003 hrcA locus.
Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Del Casale, Antonio; Dellaglio, Franco; Neviani, Erasmo; Fitzgerald, Gerald F; van Sinderen, Douwe
2005-12-01
The bacterial heat shock response is characterized by the elevated expression of a number of chaperone complexes and transcriptional regulators, including the DnaJ and the HrcA proteins. Genome analysis of Bifidobacterium breve UCC 2003 revealed a second copy of a dnaJ gene, named dnaJ2, which is flanked by the hrcA gene in a genetic constellation that appears to be unique to the actinobacteria. Phylogenetic analysis using 53 bacterial dnaJ sequences, including both dnaJ1 and dnaJ2 sequences, suggests that these genes have followed a different evolutionary development. Furthermore, the B. breve UCC 2003 dnaJ2 gene seems to be regulated in a manner that is different from that of the previously characterized dnaJ1 gene. The dnaJ2 gene, which was shown to be part of a 2.3-kb bicistronic operon with hrcA, was induced by osmotic shock but not significantly by heat stress. This induction pattern is unlike those of other characterized dnaJ genes and may be indicative of a unique stress adaptation strategy by this commensal microorganism.
Genetic Characterization of the Bifidobacterium breve UCC 2003 hrcA Locus
Ventura, Marco; Canchaya, Carlos; Bernini, Valentina; Del Casale, Antonio; Dellaglio, Franco; Neviani, Erasmo; Fitzgerald, Gerald F.; van Sinderen, Douwe
2005-01-01
The bacterial heat shock response is characterized by the elevated expression of a number of chaperone complexes and transcriptional regulators, including the DnaJ and the HrcA proteins. Genome analysis of Bifidobacterium breve UCC 2003 revealed a second copy of a dnaJ gene, named dnaJ2, which is flanked by the hrcA gene in a genetic constellation that appears to be unique to the actinobacteria. Phylogenetic analysis using 53 bacterial dnaJ sequences, including both dnaJ1 and dnaJ2 sequences, suggests that these genes have followed a different evolutionary development. Furthermore, the B. breve UCC 2003 dnaJ2 gene seems to be regulated in a manner that is different from that of the previously characterized dnaJ1 gene. The dnaJ2 gene, which was shown to be part of a 2.3-kb bicistronic operon with hrcA, was induced by osmotic shock but not significantly by heat stress. This induction pattern is unlike those of other characterized dnaJ genes and may be indicative of a unique stress adaptation strategy by this commensal microorganism. PMID:16332909
Wang, Qiuyan; Wu, Huili; Wang, Anming; Du, Pengfei; Pei, Xiaolin; Li, Haifeng; Yin, Xiaopu; Huang, Lifeng; Xiong, Xiaolong
2010-01-01
DNA family shuffling is a powerful method for enzyme engineering, which utilizes recombination of naturally occurring functional diversity to accelerate laboratory-directed evolution. However, the use of this technique has been hindered by the scarcity of family genes with the required level of sequence identity in the genome database. We describe here a strategy for collecting metagenomic homologous genes for DNA shuffling from environmental samples by truncated metagenomic gene-specific PCR (TMGS-PCR). Using identified metagenomic gene-specific primers, twenty-three 921-bp truncated lipase gene fragments, which shared 64–99% identity with each other and formed a distinct subfamily of lipases, were retrieved from 60 metagenomic samples. These lipase genes were shuffled, and selected active clones were characterized. The chimeric clones show extensive functional and genetic diversity, as demonstrated by functional characterization and sequence analysis. Our results indicate that homologous sequences of genes captured by TMGS-PCR can be used as suitable genetic material for DNA family shuffling with broad applications in enzyme engineering. PMID:20962349
Elrobh, Mohamed S.; Alanazi, Mohammad S.; Khan, Wajahatullah; Abduljaleel, Zainularifeen; Al-Amri, Abdullah; Bazzi, Mohammad D.
2011-01-01
Heat shock proteins are ubiquitous, induced under a number of environmental and metabolic stresses, with highly conserved DNA sequences among mammalian species. Camelus dromedaries (the Arabian camel) domesticated under semi-desert environments, is well adapted to tolerate and survive against severe drought and high temperatures for extended periods. This is the first report of molecular cloning and characterization of full length cDNA of encoding a putative stress-induced heat shock HSPA6 protein (also called HSP70B′) from Arabian camel. A full-length cDNA (2417 bp) was obtained by rapid amplification of cDNA ends (RACE) and cloned in pET-b expression vector. The sequence analysis of HSPA6 gene showed 1932 bp-long open reading frame encoding 643 amino acids. The complete cDNA sequence of the Arabian camel HSPA6 gene was submitted to NCBI GeneBank (accession number HQ214118.1). The BLAST analysis indicated that C. dromedaries HSPA6 gene nucleotides shared high similarity (77–91%) with heat shock gene nucleotide of other mammals. The deduced 643 amino acid sequences (accession number ADO12067.1) showed that the predicted protein has an estimated molecular weight of 70.5 kDa with a predicted isoelectric point (pI) of 6.0. The comparative analyses of camel HSPA6 protein sequences with other mammalian heat shock proteins (HSPs) showed high identity (80–94%). Predicted camel HSPA6 protein structure using Protein 3D structural analysis high similarities with human and mouse HSPs. Taken together, this study indicates that the cDNA sequences of HSPA6 gene and its amino acid and protein structure from the Arabian camel are highly conserved and have similarities with other mammalian species. PMID:21845074
2010-01-01
Comparison of 18S rDNA gene sequences is a very promising method for identification and classification of living organisms. Molecular identification and discrimination of different Dunaliella species were carried out based on the size of 18S rDNA gene and, number and position of introns in the gene. Three types of 18S rDNA structure have already been reported: the gene with a size of ~1770 bp lacking any intron, with a size of ~2170 bp consisting one intron near 5' terminus, and with a size of ~2570 bp harbouring two introns near 5' and 3' termini. Hereby, we report a new 18S rDNA gene arrangement in terms of intron localization and nucleotide sequence in a Dunaliella isolated from Iranian salt lakes (ABRIINW-M1/2). PCR amplification with genus-specific primers resulted in production of a ~2170 bp DNA band, which is similar to that of D. salina 18S rDNA gene containing only one intron near 5' terminus. Whilst, sequence composition of the gene revealed the lack of any intron near 5' terminus in our isolate. Furthermore, another alteration was observed due to the presence of a 440 bp DNA fragment near 3' terminus. Accordingly, 18S rDNA gene of the isolate is clearly different from those of D. salina and any other Dunaliella species reported so far. Moreover, analysis of ITS region sequence showed the diversity of this region compared to the previously reported species. 18S rDNA and ITS sequences of our isolate were submitted with accesion numbers of EU678868 and EU927373 in NCBI database, respectively. The optimum growth rate of this isolate occured at the salinity level of 1 M NaCl. The maximum carotenoid content under stress condition of intense light (400 μmol photon m-2 s-1), high salinity (4 M NaCl) and deficiency of nitrate and phosphate nutritions reached to 240 ng/cell after 15 days. PMID:20377865
Environmental Control Of A Genetic Process
NASA Technical Reports Server (NTRS)
Khosla, Chaitan; Bailey, James E.
1991-01-01
E. coli bacteria altered to contain DNA sequence encoding production of hemoglobin made to produce hemoglobin at rates decreasing with increases in concentration of oxygen in culture media. Represents amplification of part of method described in "Cloned Hemoglobin Genes Enhance Growth Of Cells" (NPO-17517). Manipulation of promoter/regulator DNA sequences opens promising new subfield of recombinant-DNA technology for environmental control of expression of selected DNA sequences. New recombinant-DNA fusion gene products, expression vectors, and nucleotide-base sequences will emerge. Likely applications include such aerobic processes as manufacture of cloned proteins and synthesis of metabolites, production of chemicals by fermentation, enzymatic degradation, treatment of wastes, brewing, and variety of oxidative chemical reactions.
New developments in ancient genomics.
Millar, Craig D; Huynen, Leon; Subramanian, Sankar; Mohandesan, Elmira; Lambert, David M
2008-07-01
Ancient DNA research is on the crest of a 'third wave' of progress due to the introduction of a new generation of DNA sequencing technologies. Here we review the advantages and disadvantages of the four new DNA sequencers that are becoming available to researchers. These machines now allow the recovery of orders of magnitude more DNA sequence data, albeit as short sequence reads. Hence, the potential reassembly of complete ancient genomes seems imminent, and when used to screen libraries of ancient sequences, these methods are cost effective. This new wealth of data is also likely to herald investigations into the functional properties of extinct genes and gene complexes and will improve our understanding of the biological basis of extinct phenotypes.
DNA-DNA hybridization values and their relationship to whole-genome sequence similarities.
Goris, Johan; Konstantinidis, Konstantinos T; Klappenbach, Joel A; Coenye, Tom; Vandamme, Peter; Tiedje, James M
2007-01-01
DNA-DNA hybridization (DDH) values have been used by bacterial taxonomists since the 1960s to determine relatedness between strains and are still the most important criterion in the delineation of bacterial species. Since the extent of hybridization between a pair of strains is ultimately governed by their respective genomic sequences, we examined the quantitative relationship between DDH values and genome sequence-derived parameters, such as the average nucleotide identity (ANI) of common genes and the percentage of conserved DNA. A total of 124 DDH values were determined for 28 strains for which genome sequences were available. The strains belong to six important and diverse groups of bacteria for which the intra-group 16S rRNA gene sequence identity was greater than 94 %. The results revealed a close relationship between DDH values and ANI and between DNA-DNA hybridization and the percentage of conserved DNA for each pair of strains. The recommended cut-off point of 70 % DDH for species delineation corresponded to 95 % ANI and 69 % conserved DNA. When the analysis was restricted to the protein-coding portion of the genome, 70 % DDH corresponded to 85 % conserved genes for a pair of strains. These results reveal extensive gene diversity within the current concept of "species". Examination of reciprocal values indicated that the level of experimental error associated with the DDH method is too high to reveal the subtle differences in genome size among the strains sampled. It is concluded that ANI can accurately replace DDH values for strains for which genome sequences are available.
Presence of a consensus DNA motif at nearby DNA sequence of the mutation susceptible CG nucleotides.
Chowdhury, Kaushik; Kumar, Suresh; Sharma, Tanu; Sharma, Ankit; Bhagat, Meenakshi; Kamai, Asangla; Ford, Bridget M; Asthana, Shailendra; Mandal, Chandi C
2018-01-10
Complexity in tissues affected by cancer arises from somatic mutations and epigenetic modifications in the genome. The mutation susceptible hotspots present within the genome indicate a non-random nature and/or a position specific selection of mutation. An association exists between the occurrence of mutations and epigenetic DNA methylation. This study is primarily aimed at determining mutation status, and identifying a signature for predicting mutation prone zones of tumor suppressor (TS) genes. Nearby sequences from the top five positions having a higher mutation frequency in each gene of 42 TS genes were selected from a cosmic database and were considered as mutation prone zones. The conserved motifs present in the mutation prone DNA fragments were identified. Molecular docking studies were done to determine putative interactions between the identified conserved motifs and enzyme methyltransferase DNMT1. Collective analysis of 42 TS genes found GC as the most commonly replaced and AT as the most commonly formed residues after mutation. Analysis of the top 5 mutated positions of each gene (210 DNA segments for 42 TS genes) identified that CG nucleotides of the amino acid codons (e.g., Arginine) are most susceptible to mutation, and found a consensus DNA "T/AGC/GAGGA/TG" sequence present in these mutation prone DNA segments. Similar to TS genes, analysis of 54 oncogenes not only found CG nucleotides of the amino acid Arg as the most susceptible to mutation, but also identified the presence of similar consensus DNA motifs in the mutation prone DNA fragments (270 DNA segments for 54 oncogenes) of oncogenes. Docking studies depicted that, upon binding of DNMT1 methylates to this consensus DNA motif (C residues of CpG islands), mutation was likely to occur. Thus, this study proposes that DNMT1 mediated methylation in chromosomal DNA may decrease if a foreign DNA segment containing this consensus sequence along with CG nucleotides is exogenously introduced to dividing cancer cells. Copyright © 2017 Elsevier B.V. All rights reserved.
COI (cytochrome oxidase-I) sequence based studies of Carangid fishes from Kakinada coast, India.
Persis, M; Chandra Sekhar Reddy, A; Rao, L M; Khedkar, G D; Ravinder, K; Nasruddin, K
2009-09-01
Mitochondrial DNA, cytochrome oxidase-1 gene sequences were analyzed for species identification and phylogenetic relationship among the very high food value and commercially important Indian carangid fish species. Sequence analysis of COI gene very clearly indicated that all the 28 fish species fell into five distinct groups, which are genetically distant from each other and exhibited identical phylogenetic reservation. All the COI gene sequences from 28 fishes provide sufficient phylogenetic information and evolutionary relationship to distinguish the carangid species unambiguously. This study proves the utility of mtDNA COI gene sequence based approach in identifying fish species at a faster pace.
Sequencing and comparing whole mitochondrial genomes ofanimals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boore, Jeffrey L.; Macey, J. Robert; Medina, Monica
2005-04-22
Comparing complete animal mitochondrial genome sequences is becoming increasingly common for phylogenetic reconstruction and as a model for genome evolution. Not only are they much more informative than shorter sequences of individual genes for inferring evolutionary relatedness, but these data also provide sets of genome-level characters, such as the relative arrangements of genes, that can be especially powerful. We describe here the protocols commonly used for physically isolating mtDNA, for amplifying these by PCR or RCA, for cloning,sequencing, assembly, validation, and gene annotation, and for comparing both sequences and gene arrangements. On several topics, we offer general observations based onmore » our experiences to date with determining and comparing complete mtDNA sequences.« less
Sequences in the intergenic spacer influence RNA Pol I transcription from the human rRNA promoter
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, W.M.; Sylvester, J.E.
1994-09-01
In most eucaryotic species, ribosomal genes are tandemly repeated about 100-5000 times per haploid genome. The 43 Kb human rDNA repeat consists of a 13 Kb coding region for the 18S, 5.8S, 28S ribosomal RNAs (rRNAs) and transcribed spacers separated by a 30 Kb intergenic spacer. For species such as frog, mouse and rat, sequences in the intergenic spacer other than the gene promoter have been shown to modulate transcription of the ribosomal gene. These sequences are spacer promoters, enhancers and the terminator for spacer transcription. We are addressing whether the human ribosomal gene promoter is similarly influenced. In-vitro transcriptionmore » run-off assays have revealed that the 4.5 kb region (CBE), directly upstream of the gene promoter, has cis-stimulation and trans-competition properties. This suggests that the CBE fragment contains an enhancer(s) for ribosomal gene transcription. Further experiments have shown that a fragment ({approximately}1.6 kb) within the CBE fragment also has trans-competition function. Deletion subclones of this region are being tested to delineate the exact sequences responsible for these modulating activities. Previous sequence analysis and functional studies have revealed that CBE contains regions of DNA capable of adopting alternative structures such as bent DNA, Z-DNA, and triple-stranded DNA. Whether these structures are required for modulating transcription remains to be determined as does the specific DNA-protein interaction involved.« less
Shitara, M; Tsuboi, Y; Sekizuka, T; Tazumi, A; Moorei, J E; Millar, B C; Taneike, I; Matsuda, M
2008-01-01
Nucleotide sequences of approximately 3.1 kbp consisting of the full-length open reading frame (ORF) for grpE, a non-coding (NC) region and a putative ORF for the full-length dnaK gene (1860 bp) were identified from a urease-positive thermophilic Campylobacter (UPTC) CF89-12 isolate. Then, following the construction of a new degenerate polymerase chain reaction (PCR) primer pair for amplification of the dnaK structural gene, including the transcription terminator region of C. lari isolates, the dnaK region was amplified successfully, TA-cloned and sequenced in nine C. lari isolates. The dnaK gene sequences commenced with an ATG and terminated with a TAA in all 10 isolates, including CF89-12. In addition, the putative ORFs for the dnaK gene locus from seven UPTC isolates consisted of 1860 bases, and the four urease-negative (UN) C. lari isolates included C. lari RM2100 reference strain 1866. Interestingly, different probable ribosome binding sites and hypothetically intrinsic p-independent terminator structures were identified between the seven UPTC and four UN C. lari isolates, respectively. Moreover, it is interesting to note that 20 out of a total of 28 polymorphic sites occurred among amino acid sequences of the dnaK ORF from 11 C. lari isolates, identified to be alternatively UPTC-specific or UN C. lari-specific. In the neighbour-joining tree based on the nucleotide sequence information of the dnaK gene, C. lari forms two major distinct clusters consisting of UPTC and UN C. lari isolates, respectively, with UN C. lari being more closely related to other thermophilic campylobacters than to UPTC.
Langkjær, R. B.; Casaregola, S.; Ussery, D. W.; Gaillardin, C.; Piškur, J.
2003-01-01
The complete sequences of mitochondrial DNA (mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S.cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S.cerevisiae mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S.servazzii contain, in total, five +1 frameshifts. mtDNAs of S.castellii, S.servazzii and S.cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order is very different. Several gene rearrangements have taken place upon separation of the Saccharomyces lineages, and even a part of the transcription units have not been preserved. It seems that the mechanism(s) involved in the generation of the rearrangements has had to ensure that all genes stayed encoded by the same DNA strand. PMID:12799436
DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.
Choudhary, M; Kaplan, S
2000-02-15
This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.
Parallel gene analysis with allele-specific padlock probes and tag microarrays
Banér, Johan; Isaksson, Anders; Waldenström, Erik; Jarvius, Jonas; Landegren, Ulf; Nilsson, Mats
2003-01-01
Parallel, highly specific analysis methods are required to take advantage of the extensive information about DNA sequence variation and of expressed sequences. We present a scalable laboratory technique suitable to analyze numerous target sequences in multiplexed assays. Sets of padlock probes were applied to analyze single nucleotide variation directly in total genomic DNA or cDNA for parallel genotyping or gene expression analysis. All reacted probes were then co-amplified and identified by hybridization to a standard tag oligonucleotide array. The technique was illustrated by analyzing normal and pathogenic variation within the Wilson disease-related ATP7B gene, both at the level of DNA and RNA, using allele-specific padlock probes. PMID:12930977
2009-01-01
Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416
Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg
2009-08-06
Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
Bonen, Linda; Boer, Poppo H.; Gray, Michael W.
1984-01-01
We have determined the sequence of the wheat mitochondrial gene for cytochrome oxidase subunit II (COII) and find that its derived protein sequence differs from that of maize at only three amino acid positions. Unexpectedly, all three replacements are non-conservative ones. The wheat COII gene has a highly-conserved intron at the same position as in maize, but the wheat intron is 1.5 times longer because of an insert relative to its maize counterpart. Hybridization analysis of mitochondrial DNA from rye, pea, broad bean and cucumber indicates strong sequence conservation of COII coding sequences among all these higher plants. However, only rye and maize mitochondrial DNA show homology with wheat COII intron sequences and rye alone with intron-insert sequences. We find that a sequence identical to the region of the 5' exon corresponding to the transmembrane domain of the COII protein is present at a second genomic location in wheat mitochondria. These variations in COII gene structure and size, as well as the presence of repeated COII sequences, illustrate at the DNA sequence level, factors which contribute to higher plant mitochondrial DNA diversity and complexity. ImagesFig. 3.Fig. 4.Fig. 5. PMID:16453565
Massively Parallel DNA Sequencing Facilitates Diagnosis of Patients with Usher Syndrome Type 1
Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-ichi
2014-01-01
Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance. PMID:24618850
Massively parallel DNA sequencing facilitates diagnosis of patients with Usher syndrome type 1.
Yoshimura, Hidekane; Iwasaki, Satoshi; Nishio, Shin-Ya; Kumakawa, Kozo; Tono, Tetsuya; Kobayashi, Yumiko; Sato, Hiroaki; Nagai, Kyoko; Ishikawa, Kotaro; Ikezono, Tetsuo; Naito, Yasushi; Fukushima, Kunihiro; Oshikawa, Chie; Kimitsuki, Takashi; Nakanishi, Hiroshi; Usami, Shin-Ichi
2014-01-01
Usher syndrome is an autosomal recessive disorder manifesting hearing loss, retinitis pigmentosa and vestibular dysfunction, and having three clinical subtypes. Usher syndrome type 1 is the most severe subtype due to its profound hearing loss, lack of vestibular responses, and retinitis pigmentosa that appears in prepuberty. Six of the corresponding genes have been identified, making early diagnosis through DNA testing possible, with many immediate and several long-term advantages for patients and their families. However, the conventional genetic techniques, such as direct sequence analysis, are both time-consuming and expensive. Targeted exon sequencing of selected genes using the massively parallel DNA sequencing technology will potentially enable us to systematically tackle previously intractable monogenic disorders and improve molecular diagnosis. Using this technique combined with direct sequence analysis, we screened 17 unrelated Usher syndrome type 1 patients and detected probable pathogenic variants in the 16 of them (94.1%) who carried at least one mutation. Seven patients had the MYO7A mutation (41.2%), which is the most common type in Japanese. Most of the mutations were detected by only the massively parallel DNA sequencing. We report here four patients, who had probable pathogenic mutations in two different Usher syndrome type 1 genes, and one case of MYO7A/PCDH15 digenic inheritance. This is the first report of Usher syndrome mutation analysis using massively parallel DNA sequencing and the frequency of Usher syndrome type 1 genes in Japanese. Mutation screening using this technique has the power to quickly identify mutations of many causative genes while maintaining cost-benefit performance. In addition, the simultaneous mutation analysis of large numbers of genes is useful for detecting mutations in different genes that are possibly disease modifiers or of digenic inheritance.
Ahmed, Ikhlak; Sarazin, Alexis; Bowler, Chris; Colot, Vincent; Quesneville, Hadi
2011-09-01
Transposable elements (TEs) and their relics play major roles in genome evolution. However, mobilization of TEs is usually deleterious and strongly repressed. In plants and mammals, this repression is typically associated with DNA methylation, but the relationship between this epigenetic mark and TE sequences has not been investigated systematically. Here, we present an improved annotation of TE sequences and use it to analyze genome-wide DNA methylation maps obtained at single-nucleotide resolution in Arabidopsis. We show that although the majority of TE sequences are methylated, ∼26% are not. Moreover, a significant fraction of TE sequences densely methylated at CG, CHG and CHH sites (where H = A, T or C) have no or few matching small interfering RNA (siRNAs) and are therefore unlikely to be targeted by the RNA-directed DNA methylation (RdDM) machinery. We provide evidence that these TE sequences acquire DNA methylation through spreading from adjacent siRNA-targeted regions. Further, we show that although both methylated and unmethylated TE sequences located in euchromatin tend to be more abundant closer to genes, this trend is least pronounced for methylated, siRNA-targeted TE sequences located 5' to genes. Based on these and other findings, we propose that spreading of DNA methylation through promoter regions explains at least in part the negative impact of siRNA-targeted TE sequences on neighboring gene expression.
2004-01-01
The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).
Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai
2014-12-01
The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.
Bourras, Salim; Meyer, Michel; Grandaubert, Jonathan; Lapalu, Nicolas; Fudal, Isabelle; Linglin, Juliette; Ollivier, Benedicte; Blaise, Françoise; Balesdent, Marie-Hélène; Rouxel, Thierry
2012-08-01
The ever-increasing generation of sequence data is accompanied by unsatisfactory functional annotation, and complex genomes, such as those of plants and filamentous fungi, show a large number of genes with no predicted or known function. For functional annotation of unknown or hypothetical genes, the production of collections of mutants using Agrobacterium tumefaciens-mediated transformation (ATMT) associated with genotyping and phenotyping has gained wide acceptance. ATMT is also widely used to identify pathogenicity determinants in pathogenic fungi. A systematic analysis of T-DNA borders was performed in an ATMT-mutagenized collection of the phytopathogenic fungus Leptosphaeria maculans to evaluate the features of T-DNA integration in its particular transposable element-rich compartmentalized genome. A total of 318 T-DNA tags were recovered and analyzed for biases in chromosome and genic compartments, existence of CG/AT skews at the insertion site, and occurrence of microhomologies between the T-DNA left border (LB) and the target sequence. Functional annotation of targeted genes was done using the Gene Ontology annotation. The T-DNA integration mainly targeted gene-rich, transcriptionally active regions, and it favored biological processes consistent with the physiological status of a germinating spore. T-DNA integration was strongly biased toward regulatory regions, and mainly promoters. Consistent with the T-DNA intranuclear-targeting model, the density of T-DNA insertion correlated with CG skew near the transcription initiation site. The existence of microhomologies between promoter sequences and the T-DNA LB flanking sequence was also consistent with T-DNA integration to host DNA mediated by homologous recombination based on the microhomology-mediated end-joining pathway.
Nucleotide sequence of the gene encoding the nitrogenase iron protein of Thiobacillus ferrooxidans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pretorius, I.M.; Rawlings, D.E.; O'Neill, E.G.
1987-01-01
The DNA sequence was determined for the cloned Thiobacillus ferrooxidans nifH and part of the nifD genes. The DNA chains were radiolabeled with (..cap alpha..-/sup 32/P)dCTP (3000 Ci/mmol) or (..cap alpha..-/sup 35/S)dCTP (400 Ci/mmol). A putative T. ferrooxidans nifH promoter was identified whose sequences showed perfect consensus with those of the Klebsiella pneumoniae nif promoter. Two putative consensus upstream activator sequences were also identified. The amino acid sequence was deduced from the DNA sequence. In a comparison of nifH DNA sequences from T. ferrooxidans and eight other nitrogen-fixing microbes, a Rhizobium sp. isolated from Parasponia andersonii showed the greatest homologymore » (74%) and Clostridium pasteurianum (nifH1) showed the least homology (54%). In the comparison of the amino acid sequences of the Fe proteins, the Rhizobium sp. and Rhizobium japonicum showed the greatest homology (both 86%) and C. pasteurianum (nifH1 gene product) demonstrated the least homology (56%) to the T. ferrooxidans Fe protein.« less
On the presence and role of human gene-body DNA methylation
Jjingo, Daudi; Conley, Andrew B.; Yi, Soojin V.; Lunyak, Victoria V.; Jordan, I. King
2012-01-01
DNA methylation of promoter sequences is a repressive epigenetic mark that down-regulates gene expression. However, DNA methylation is more prevalent within gene-bodies than seen for promoters, and gene-body methylation has been observed to be positively correlated with gene expression levels. This paradox remains unexplained, and accordingly the role of DNA methylation in gene-bodies is poorly understood. We addressed the presence and role of human gene-body DNA methylation using a meta-analysis of human genome-wide methylation, expression and chromatin data sets. Methylation is associated with transcribed regions as genic sequences have higher levels of methylation than intergenic or promoter sequences. We also find that the relationship between gene-body DNA methylation and expression levels is non-monotonic and bell-shaped. Mid-level expressed genes have the highest levels of gene-body methylation, whereas the most lowly and highly expressed sets of genes both have low levels of methylation. While gene-body methylation can be seen to efficiently repress the initiation of intragenic transcription, the vast majority of methylated sites within genes are not associated with intragenic promoters. In fact, highly expressed genes initiate the most intragenic transcription, which is inconsistent with the previously held notion that gene-body methylation serves to repress spurious intragenic transcription to allow for efficient transcriptional elongation. These observations lead us to propose a model to explain the presence of human gene-body methylation. This model holds that the repression of intragenic transcription by gene-body methylation is largely epiphenomenal, and suggests that gene-body methylation levels are predominantly shaped via the accessibility of the DNA to methylating enzyme complexes. PMID:22577155
Cameron, Kenneth M.
2009-01-01
Background and Aims Most molecular phylogenetic studies of Orchidaceae have relied heavily on DNA sequences from the plastid genome. Nuclear and mitochondrial loci have only been superficially examined for their systematic value. Since 40% of the genera within Vanilloideae are achlorophyllous mycoheterotrophs, this is an ideal group of orchids in which to evaluate non-plastid gene sequences. Methods Phylogenetic reconstructions for Vanilloideae were produced using independent and combined data from the nuclear 18S, 5·8S and 26S rDNA genes and the mitochondrial atpA gene and nad1b-c intron. Key Results These new data indicate placements for genera such as Lecanorchis and Galeola, for which plastid gene sequences have been mostly unavailable. Nuclear and mitochondrial parsimony jackknife trees are congruent with each other and previously published trees based solely on plastid data. Because of high rates of sequence divergence among vanilloid orchids, even the short 5·8S rDNA gene provides impressive levels of resolution and support. Conclusions Orchid systematists are encouraged to sequence nuclear and mitochondrial gene regions along with the growing number of plastid loci available. PMID:19251715
Ventura, Marco; Zink, Ralf; Fitzgerald, Gerald F; van Sinderen, Douwe
2005-01-01
The incorporation and delivery of bifidobacterial strains as probiotic components in many food preparations expose these microorganisms to a multitude of environmental insults, including heat and osmotic stresses. We characterized the dnaK gene region of Bifidobacterium breve UCC 2003. Sequence analysis of the dnaK locus revealed four genes with the organization dnaK-grpE-dnaJ-ORF1, whose deduced protein products display significant similarity to corresponding chaperones found in other bacteria. Northern hybridization and real-time LightCycler PCR analysis revealed that the transcription of the dnaK operon was strongly induced by osmotic shock but was not induced significantly by heat stress. A 4.4-kb polycistronic mRNA, which represented the transcript of the complete dnaK gene region, was detected. Many other small transcripts, which were assumed to have resulted from intensive processing or degradation of this polycistronic mRNA, were identified. The transcription start site of the dnaK operon was determined by primer extension. Phylogenetic analysis of the available bifidobacterial grpE and dnaK genes suggested that the evolutionary development of these genes has been similar. The phylogeny derived from the various bifidobacterial grpE and dnaK sequences is consistent with that derived from 16S rRNA. The use of these genes in bifidobacterial species as an alternative or complement to the 16S rRNA gene marker provides sequence signatures that allow a high level of discrimination between closely related species of this genus.
van Zyl, Leonel; von Arnold, Sara; Bozhkov, Peter; Chen, Yongzhong; Egertsdotter, Ulrika; MacKay, John; Sederoff, Ronald R.; Shen, Jing; Zelena, Lyubov
2002-01-01
Hybridization of labelled cDNA from various cell types with high-density arrays of expressed sequence tags is a powerful technique for investigating gene expression. Few conifer cDNA libraries have been sequenced. Because of the high level of sequence conservation between Pinus and Picea we have investigated the use of arrays from one genus for studies of gene expression in the other. The partial cDNAs from 384 identifiable genes expressed in differentiating xylem of Pinus taeda were printed on nylon membranes in randomized replicates. These were hybridized with labelled cDNA from needles or embryogenic cultures of Pinus taeda, P. sylvestris and Picea abies, and with labelled cDNA from leaves of Nicotiana tabacum. The Spearman correlation of gene expression for pairs of conifer species was high for needles (r2 = 0.78 − 0.86), and somewhat lower for embryogenic cultures (r2 = 0.68 − 0.83). The correlation of gene expression for tobacco leaves and needles of each of the three conifer species was lower but sufficiently high (r2 = 0.52 − 0.63) to suggest that many partial gene sequences are conserved in angiosperms and gymnosperms. Heterologous probing was further used to identify tissue-specific gene expression over species boundaries. To evaluate the significance of differences in gene expression, conventional parametric tests were compared with permutation tests after four methods of normalization. Permutation tests after Z-normalization provide the highest degree of discrimination but may enhance the probability of type I errors. It is concluded that arrays of cDNA from loblolly pine are useful for studies of gene expression in other pines or spruces. PMID:18629264
Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.
Mukherjee, Anirban; Vasquez, Karen M
2011-08-01
Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. Copyright © 2011 Elsevier Masson SAS. All rights reserved.
CAPRRESI: Chimera Assembly by Plasmid Recovery and Restriction Enzyme Site Insertion.
Santillán, Orlando; Ramírez-Romero, Miguel A; Dávila, Guillermo
2017-06-25
Here, we present chimera assembly by plasmid recovery and restriction enzyme site insertion (CAPRRESI). CAPRRESI benefits from many strengths of the original plasmid recovery method and introduces restriction enzyme digestion to ease DNA ligation reactions (required for chimera assembly). For this protocol, users clone wildtype genes into the same plasmid (pUC18 or pUC19). After the in silico selection of amino acid sequence regions where chimeras should be assembled, users obtain all the synonym DNA sequences that encode them. Ad hoc Perl scripts enable users to determine all synonym DNA sequences. After this step, another Perl script searches for restriction enzyme sites on all synonym DNA sequences. This in silico analysis is also performed using the ampicillin resistance gene (ampR) found on pUC18/19 plasmids. Users design oligonucleotides inside synonym regions to disrupt wildtype and ampR genes by PCR. After obtaining and purifying complementary DNA fragments, restriction enzyme digestion is accomplished. Chimera assembly is achieved by ligating appropriate complementary DNA fragments. pUC18/19 vectors are selected for CAPRRESI because they offer technical advantages, such as small size (2,686 base pairs), high copy number, advantageous sequencing reaction features, and commercial availability. The usage of restriction enzymes for chimera assembly eliminates the need for DNA polymerases yielding blunt-ended products. CAPRRESI is a fast and low-cost method for fusing protein-coding genes.
Kang, Sang-Ho; Lee, Jeong-Hoon; Lee, Hyun Oh; Ahn, Byoung Ohg; Won, So Youn; Sohn, Seong-Han; Kim, Jung Sun
2017-10-06
Glycyrrhiza uralensis and G. glabra, members of the Fabaceae, are medicinally important species that are native to Asia and Europe. Extracts from these plants are widely used as natural sweeteners because of their much greater sweetness than sucrose. In this study, the three complete chloroplast genomes and five 45S nuclear ribosomal (nr)DNA sequences of these two licorice species and an interspecific hybrid are presented. The chloroplast genomes of G. glabra, G. uralensis and G. glabra × G. uralensis were 127,895 bp, 127,716 bp and 127,939 bp, respectively. The three chloroplast genomes harbored 110 annotated genes, including 76 protein-coding genes, 30 tRNA genes and 4 rRNA genes. The 45S nrDNA sequences were either 5,947 or 5,948 bp in length. Glycyrrhiza glabra and G. glabra × G. uralensis showed two types of nrDNA, while G. uralensis contained a single type. The complete 45S nrDNA sequence unit contains 18S rRNA, ITS1, 5.8S rRNA, ITS2 and 26S rRNA. We identified simple sequence repeat and tandem repeat sequences. We also developed four reliable markers for analysis of Glycyrrhiza diversity authentication.
Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.
1988-08-01
The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less
Prychitko, T M; Moore, W S
1997-10-01
Estimating phylogenies from DNA sequence data has become the major methodology of molecular phylogenetics. To date, molecular phylogenetics of the vertebrates has been very dependent on mtDNA, but studies involving mtDNA are limited because the several genes comprising the mt-genome are inherited as a single linkage group. The only apparent solution to this problem is to sequence additional genes, each representing a distinct linkage group, so that the resultant gene trees provide independent estimates of the species tree. There exists the need to find novel gene sequences which contain enough phylogenetic information to resolve relationships between closely related species. A possible source is the nuclear-encoded introns, because they evolve more rapidly than exons. We designed primers to amplify and sequence the 7 intron from the beta-fibrinogen gene for a recently evolved group, the woodpeckers. We sequenced the entire intron for 10 specimens representing five species. Nucleotide substitutions are randomly distributed along the length of the intron, suggesting selective neutrality. A preliminary analysis indicates that the phylogenetic signal in the intron is as strong as that in the mitochondrial encoded cytochrome b (cyt b) gene. The topology of the beta-fibrinogen tree is identical to that of the cyt b tree. This analysis demonstrates the ability of the 7 intron of beta-fibrinogen to provide well resolved, independent gene trees for recently evolved groups and establishes it as a source of sequences to be used in other phylogenetic studies. Copyright 1997 Academic Press
Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E
1996-01-01
Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809
Ko, Kwan Soo; Oh, Won Sup; Peck, Kyong Ran; Lee, Jang Ho; Lee, Nam Yong; Song, Jae-Hoon
2005-07-01
Non-typeable isolates of Streptococcus pneumoniae collected from Asian countries were characterized by optochin susceptibility test, bile solubility test, multilocus sequence typing of housekeeping genes, amplification of virulence-related genes, 16S rDNA-RsaI digestion, and 16S rDNA sequencing. Six of 54 non-typeable pneumococcal isolates showed divergence of gene sequences of recP and xpt from typical pneumococcal strains. Of these six atypical pneumococcal strains, two showed different results in optochin susceptibility or bile solubility test from typical pneumococcal strains. All six isolates showed high sequence dissimilarities of multilocus sequence typing, 16S rDNA sequences, and lytA sequences from typical S. pneumoniae strains. Data from this study suggest that classic tests such as optochin susceptibility and bile solubility tests may lead to incorrect identification of S. pneumoniae. These atypical strains may belong to different bacterial species from S. pneumoniae.
Complexity and Entropy Analysis of DNMT1 Gene
USDA-ARS?s Scientific Manuscript database
Background: The application of complexity information on DNA sequence and protein in biological processes are well established in this study. Available sequences for DNMT1 gene, which is a maintenance methyltransferase is responsible for copying DNA methylation patterns to the daughter strands durin...
Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro
Williams, Jonathan D.; Fleetwood, Sara; Berroyer, Alexandra; Kim, Nayun; Larson, Erik D.
2015-01-01
The formation of highly stable four-stranded DNA, called G-quadruplex (G4), promotes site-specific genome instability. G4 DNA structures fold from repetitive guanine sequences, and increasing experimental evidence connects G4 sequence motifs with specific gene rearrangements. The human transcription factor 3 (TCF3) gene (also termed E2A) is subject to genetic instability associated with severe disease, most notably a common translocation event t(1;19) associated with acute lymphoblastic leukemia. The sites of instability in TCF3 are not randomly distributed, but focused to certain sequences. We asked if G4 DNA formation could explain why TCF3 is prone to recombination and mutagenesis. Here we demonstrate that sequences surrounding the major t(1;19) break site and a region associated with copy number variations both contain G4 sequence motifs. The motifs identified readily adopt G4 DNA structures that are stable enough to interfere with DNA synthesis in physiological salt conditions in vitro. When introduced into the yeast genome, TCF3 G4 motifs promoted gross chromosomal rearrangements in a transcription-dependent manner. Our results provide a molecular rationale for the site-specific instability of human TCF3, suggesting that G4 DNA structures contribute to oncogenic DNA breaks and recombination. PMID:26029241
Parrish, R Ryley; Day, Jeremy J; Lubin, Farah D
2012-07-01
DNA methylation is an epigenetic modification that is essential for the development and mature function of the central nervous system. Due to the relevance of this modification to the transcriptional control of gene expression, it is often necessary to examine changes in DNA methylation patterns with both gene and single-nucleotide resolution. Here, we describe an in-depth basic protocol for direct bisulfite sequencing of DNA isolated from brain tissue, which will permit direct assessment of methylation status at individual genes as well as individual cytosine molecules/nucleotides within a genomic region. This method yields analysis of DNA methylation patterns that is robust, accurate, and reproducible, thereby allowing insights into the role of alterations in DNA methylation in brain tissue.
Turmel, Monique; Otis, Christian; Lemieux, Claude
2002-01-01
The land plants and their immediate green algal ancestors, the charophytes, form the Streptophyta. There is evidence that both the chloroplast DNA (cpDNA) and mitochondrial DNA (mtDNA) underwent substantial changes in their architecture (intron insertions, gene losses, scrambling in gene order, and genome expansion in the case of mtDNA) during the evolution of streptophytes; however, because no charophyte organelle DNAs have been sequenced completely thus far, the suite of events that shaped streptophyte organelle genomes remains largely unknown. Here, we have determined the complete cpDNA (131,183 bp) and mtDNA (56,574 bp) sequences of the charophyte Chaetosphaeridium globosum (Coleochaetales). At the levels of gene content (124 genes), intron composition (18 introns), and gene order, Chaetosphaeridium cpDNA is remarkably similar to land-plant cpDNAs, implying that most of the features characteristic of land-plant lineages were gained during the evolution of charophytes. Although the gene content of Chaetosphaeridium mtDNA (67 genes) closely resembles that of the bryophyte Marchantia polymorpha (69 genes), this charophyte mtDNA differs substantially from its land-plant relatives at the levels of size, intron composition (11 introns), and gene order. Our finding that it shares only one intron with its land-plant counterparts supports the idea that the vast majority of mitochondrial introns in land plants appeared after the emergence of these organisms. Our results also suggest that the events accounting for the spacious intergenic spacers found in land-plant mtDNAs took place late during the evolution of charophytes or coincided with the transition from charophytes to land plants. PMID:12161560
Improvement and Optimization of Two Engineered Phage Resistance Mechanisms in Lactococcus lactis
McGrath, Stephen; Fitzgerald, Gerald F.; van Sinderen, Douwe
2001-01-01
Homologous replication module genes were identified for four P335 type phages. DNA sequence analysis revealed that all four phages exhibited more than 90% DNA homology for at least two genes, designated rep2009 and orf17. One of these genes, rep2009, codes for a putative replisome organizer protein and contains an assumed origin of phage DNA replication (ori2009), which was identical for all four phages. DNA fragments representing the ori2009 sequence confer a phage-encoded resistance (Per) phenotype on lactococcal hosts when they are supplied on a high-copy-number vector. Furthermore, cloning multiple copies of the ori2009 sequence was found to increase the effectiveness of the Per phenotype conferred. A number of antisense plasmids targeting specific genes of the replication module were constructed. Two separate plasmids targeting rep2009 and orf17 were found to efficiently inhibit proliferation of all four phages by interfering with intracellular phage DNA replication. These results represent two highly effective strategies for inhibiting bacteriophage proliferation, and they also identify a novel gene, orf17, which appears to be important for phage DNA replication. Furthermore, these results indicate that although the actual mechanisms of DNA replication are very similar, if not identical, for all four phages, expression of the replication genes is significantly different in each case. PMID:11157223
NASA Astrophysics Data System (ADS)
Holden, Todd; Marchese, P.; Tremberger, G., Jr.; Cheung, E.; Subramaniam, R.; Sullivan, R.; Schneider, P.; Flamholz, A.; Lieberman, D.; Cheung, T.
2008-08-01
We have characterized function related DNA sequences of various organisms using informatics techniques, including fractal dimension calculation, nucleotide and multi-nucleotide statistics, and sequence fluctuation analysis. Our analysis shows trends which differentiate extremophile from non-extremophile organisms, which could be reproduced in extraterrestrial life. Among the systems studied are radiation repair genes, genes involved in thermal shocks, and genes involved in drug resistance. We also evaluate sequence level changes that have occurred during short term evolution (several thousand generations) under extreme conditions.
Le Chevanton, L; Leblon, G
1989-04-15
We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.
Phylogenetic Analysis of Ruminant Theileria spp. from China Based on 28S Ribosomal RNA Gene
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze
2013-01-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode. PMID:24327775
Phylogenetic analysis of ruminant Theileria spp. from China based on 28S ribosomal RNA gene.
Gou, Huitian; Guan, Guiquan; Ma, Miling; Liu, Aihong; Liu, Zhijie; Xu, Zongke; Ren, Qiaoyun; Li, Youquan; Yang, Jifei; Chen, Ze; Yin, Hong; Luo, Jianxun
2013-10-01
Species identification using DNA sequences is the basis for DNA taxonomy. In this study, we sequenced the ribosomal large-subunit RNA gene sequences (3,037-3,061 bp) in length of 13 Chinese Theileria stocks that were infective to cattle and sheep. The complete 28S rRNA gene is relatively difficult to amplify and its conserved region is not important for phylogenetic study. Therefore, we selected the D2-D3 region from the complete 28S rRNA sequences for phylogenetic analysis. Our analyses of 28S rRNA gene sequences showed that the 28S rRNA was useful as a phylogenetic marker for analyzing the relationships among Theileria spp. in ruminants. In addition, the D2-D3 region was a short segment that could be used instead of the whole 28S rRNA sequence during the phylogenetic analysis of Theileria, and it may be an ideal DNA barcode.
A chromatin insulator determines the nuclear localization of DNA.
Gerasimova, T I; Byrd, K; Corces, V G
2000-11-01
Chromatin insulators might regulate gene expression by controlling the subnuclear organization of DNA. We found that a DNA sequence normally located inside of the nucleus moved to the periphery when the gypsy insulator was placed within the sequence. The presence of the gypsy insulator also caused two sequences, normally found in different regions of the nucleus, to come together at a single location. Alterations in this subnuclear organization imposed by the gypsy insulator correlated with changes in gene expression that took place during the heat-shock response. These global changes in transcription were accompanied by dramatic alterations in the distribution of insulator proteins and DNA. The results suggest that the nuclear organization imposed by the gypsy insulator on the chromatin fiber is important for gene expression.
Establishing gene models from the Pinus pinaster genome using gene capture and BAC sequencing.
Seoane-Zonjic, Pedro; Cañas, Rafael A; Bautista, Rocío; Gómez-Maldonado, Josefa; Arrillaga, Isabel; Fernández-Pozo, Noé; Claros, M Gonzalo; Cánovas, Francisco M; Ávila, Concepción
2016-02-27
In the era of DNA throughput sequencing, assembling and understanding gymnosperm mega-genomes remains a challenge. Although drafts of three conifer genomes have recently been published, this number is too low to understand the full complexity of conifer genomes. Using techniques focused on specific genes, gene models can be established that can aid in the assembly of gene-rich regions, and this information can be used to compare genomes and understand functional evolution. In this study, gene capture technology combined with BAC isolation and sequencing was used as an experimental approach to establish de novo gene structures without a reference genome. Probes were designed for 866 maritime pine transcripts to sequence genes captured from genomic DNA. The gene models were constructed using GeneAssembler, a new bioinformatic pipeline, which reconstructed over 82% of the gene structures, and a high proportion (85%) of the captured gene models contained sequences from the promoter regulatory region. In a parallel experiment, the P. pinaster BAC library was screened to isolate clones containing genes whose cDNA sequence were already available. BAC clones containing the asparagine synthetase, sucrose synthase and xyloglucan endotransglycosylase gene sequences were isolated and used in this study. The gene models derived from the gene capture approach were compared with the genomic sequences derived from the BAC clones. This combined approach is a particularly efficient way to capture the genomic structures of gene families with a small number of members. The experimental approach used in this study is a valuable combined technique to study genomic gene structures in species for which a reference genome is unavailable. It can be used to establish exon/intron boundaries in unknown gene structures, to reconstruct incomplete genes and to obtain promoter sequences that can be used for transcriptional studies. A bioinformatics algorithm (GeneAssembler) is also provided as a Ruby gem for this class of analyses.
NASA Astrophysics Data System (ADS)
Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.
1983-03-01
A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fields, C.A.
1994-09-01
This Report concludes the DOE Human Genome Program project, ``Identification of Genes in Anonymous DNA Sequence.`` The central goals of this project have been (1) understanding the problem of identifying genes in anonymous sequences, and (2) development of tools, primarily the automated identification system gm, for identifying genes. The activities supported under the previous award are summarized here to provide a single complete report on the activities supported as part of the project from its inception to its completion.
Evidence for Interspecies Gene Transfer in the Evolution of 2,4-Dichlorophenoxyacetic Acid Degraders
McGowan, Catherine; Fulthorpe, Roberta; Wright, Alice; Tiedje, J. M.
1998-01-01
Small-subunit ribosomal DNA (SSU rDNA) from 20 phenotypically distinct strains of 2,4-dichlorophenoxyacetic acid (2,4-D)-degrading bacteria was partially sequenced, yielding 18 unique strains belonging to members of the alpha, beta, and gamma subgroups of the class Proteobacteria. To understand the origin of 2,4-D degradation in this diverse collection, the first gene in the 2,4-D pathway, tfdA, was sequenced. The sequences fell into three unique classes found in various members of the beta and gamma subgroups of Proteobacteria. None of the α-Proteobacteria yielded tfdA PCR products. A comparison of the dendrogram of the tfdA genes with that of the SSU rDNA genes demonstrated incongruency in phylogenies, and hence 2,4-D degradation must have originated from gene transfer between species. Only those strains with tfdA sequences highly similar to the tfdA sequence of strain JMP134 (tfdA class I) transferred all the 2,4-D genes and conferred the 2,4-D degradation phenotype to a Burkholderia cepacia recipient. PMID:9758850
Impact of Lateral Transfers on the Genomes of Lepidoptera
Drezen, Jean-Michel; Josse, Thibaut; Bézier, Annie; Gauthier, Jérémy; Huguet, Elisabeth
2017-01-01
Transfer of DNA sequences between species regardless of their evolutionary distance is very common in bacteria, but evidence that horizontal gene transfer (HGT) also occurs in multicellular organisms has been accumulating in the past few years. The actual extent of this phenomenon is underestimated due to frequent sequence filtering of “alien” DNA before genome assembly. However, recent studies based on genome sequencing have revealed, and experimentally verified, the presence of foreign DNA sequences in the genetic material of several species of Lepidoptera. Large DNA viruses, such as baculoviruses and the symbiotic viruses of parasitic wasps (bracoviruses), have the potential to mediate these transfers in Lepidoptera. In particular, using ultra-deep sequencing, newly integrated transposons have been identified within baculovirus genomes. Bacterial genes have also been acquired by genomes of Lepidoptera, as in other insects and nematodes. In addition, insertions of bracovirus sequences were present in the genomes of certain moth and butterfly lineages, that were likely corresponding to rearrangements of ancient integrations. The viral genes present in these sequences, sometimes of hymenopteran origin, have been co-opted by lepidopteran species to confer some protection against pathogens. PMID:29120392
Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V
2006-10-15
The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.
DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.
Eernisse, D J
1992-04-01
DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.
Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E
2007-06-01
DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.
Mitochondrial DNA of Vitis vinifera and the issue of rampant horizontal gene transfer.
Goremykin, Vadim V; Salamini, Francesco; Velasco, Riccardo; Viola, Roberto
2009-01-01
The mitochondrial genome of grape (Vitis vinifera), the largest organelle genome sequenced so far, is presented. The genome is 773,279 nt long and has the highest coding capacity among known angiosperm mitochondrial DNAs (mtDNAs). The proportion of promiscuous DNA of plastid origin in the genome is also the largest ever reported for an angiosperm mtDNA, both in absolute and relative terms. In all, 42.4% of chloroplast genome of Vitis has been incorporated into its mitochondrial genome. In order to test if horizontal gene transfer (HGT) has also contributed to the gene content of the grape mtDNA, we built phylogenetic trees with the coding sequences of mitochondrial genes of grape and their homologs from plant mitochondrial genomes. Many incongruent gene tree topologies were obtained. However, the extent of incongruence between these gene trees is not significantly greater than that observed among optimal trees for chloroplast genes, the common ancestry of which has never been in doubt. In both cases, we attribute this incongruence to artifacts of tree reconstruction, insufficient numbers of characters, and gene paralogy. This finding leads us to question the recent phylogenetic interpretation of Bergthorsson et al. (2003, 2004) and Richardson and Palmer (2007) that rampant HGT into the mtDNA of Amborella best explains phylogenetic incongruence between mitochondrial gene trees for angiosperms. The only evidence for HGT into the Vitis mtDNA found involves fragments of two coding sequences stemming from two closteroviruses that cause the leaf roll disease of this plant. We also report that analysis of sequences shared by both chloroplast and mitochondrial genomes provides evidence for a previously unknown gene transfer route from the mitochondrion to the chloroplast.
Su, Chang; Wang, Chao; He, Lin; Yang, Chuanping; Wang, Yucheng
2014-01-01
DNA methylation plays a critical role in the regulation of gene expression. Most studies of DNA methylation have been performed in herbaceous plants, and little is known about the methylation patterns in tree genomes. In the present study, we generated a map of methylated cytosines at single base pair resolution for Betula platyphylla (white birch) by bisulfite sequencing combined with transcriptomics to analyze DNA methylation and its effects on gene expression. We obtained a detailed view of the function of DNA methylation sequence composition and distribution in the genome of B. platyphylla. There are 34,460 genes in the whole genome of birch, and 31,297 genes are methylated. Conservatively, we estimated that 14.29% of genomic cytosines are methylcytosines in birch. Among the methylation sites, the CHH context accounts for 48.86%, and is the largest proportion. Combined transcriptome and methylation analysis showed that the genes with moderate methylation levels had higher expression levels than genes with high and low methylation. In addition, methylated genes are highly enriched for the GO subcategories of binding activities, catalytic activities, cellular processes, response to stimulus and cell death, suggesting that methylation mediates these pathways in birch trees. PMID:25514241
NASA Astrophysics Data System (ADS)
Walker, David Lee
1999-12-01
This study uses dynamical analysis to examine in a quantitative fashion the information coding mechanism in DNA sequences. This exceeds the simple dichotomy of either modeling the mechanism by comparing DNA sequence walks as Fractal Brownian Motion (fbm) processes. The 2-D mappings of the DNA sequences for this research are from Iterated Function System (IFS) (Also known as the ``Chaos Game Representation'' (CGR)) mappings of the DNA sequences. This technique converts a 1-D sequence into a 2-D representation that preserves subsequence structure and provides a visual representation. The second step of this analysis involves the application of Wavelet Packet Transforms, a recently developed technique from the field of signal processing. A multi-fractal model is built by using wavelet transforms to estimate the Hurst exponent, H. The Hurst exponent is a non-parametric measurement of the dynamism of a system. This procedure is used to evaluate gene- coding events in the DNA sequence of cystic fibrosis mutations. The H exponent is calculated for various mutation sites in this gene. The results of this study indicate the presence of anti-persistent, random walks and persistent ``sub-periods'' in the sequence. This indicates the hypothesis of a multi-fractal model of DNA information encoding warrants further consideration. This work examines the model's behavior in both pathological (mutations) and non-pathological (healthy) base pair sequences of the cystic fibrosis gene. These mutations both natural and synthetic were introduced by computer manipulation of the original base pair text files. The results show that disease severity and system ``information dynamics'' correlate. These results have implications for genetic engineering as well as in mathematical biology. They suggest that there is scope for more multi-fractal models to be developed.
Complete mitochondrial DNA sequence of the Eastern keelback mullet Liza affinis.
Gong, Xiaoling; Zhu, Wenjia; Bao, Baolong
2016-05-01
Eastern keelback mullet (Liza affinis) inhabits inlet waters and estuaries of rivers. In this paper, we initially determined the complete mitochondrial genome of Liza affinis. The entire mtDNA sequence is 16,831 bp in length, including 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes and 1 putative control region. Its order and numbers of genes are similar to most bony fishes.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fields, C.A.
1996-06-01
The objective of this project is the development of practical software to automate the identification of genes in anonymous DNA sequences from the human, and other higher eukaryotic genomes. A software system for automated sequence analysis, gm (gene modeler) has been designed, implemented, tested, and distributed to several dozen laboratories worldwide. A significantly faster, more robust, and more flexible version of this software, gm 2.0 has now been completed, and is being tested by operational use to analyze human cosmid sequence data. A range of efforts to further understand the features of eukaryoyic gene sequences are also underway. This progressmore » report also contains papers coming out of the project including the following: gm: a Tool for Exploratory Analysis of DNA Sequence Data; The Human THE-LTR(O) and MstII Interspersed Repeats are subfamilies of a single widely distruted highly variable repeat family; Information contents and dinucleotide compostions of plant intron sequences vary with evolutionary origin; Splicing signals in Drosophila: intron size, information content, and consensus sequences; Integration of automated sequence analysis into mapping and sequencing projects; Software for the C. elegans genome project.« less
[Multiplexing mapping of human cDNAs]. Final report, September 1, 1991--February 28, 1994
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
Using PCR with automated product analysis, 329 human brain cDNA sequences have been assigned to individual human chromosomes. Primers were designed from single-pass cDNA sequences expressed sequence tags (ESTs). Primers were used in PCR reactions with DNA from somatic cell hybrid mapping panels as templates, often with multiplexing. Many ESTs mapped match sequence database records. To evaluate of these matches, the position of the primers relative to the matching region (In), the BLAST scores and the Poisson probability values of the EST/sequence record match were determined. In cases where the gene product was stringently identified by the sequence match hadmore » already been mapped, the gene locus determined by EST was consistent with the previous position which strongly supports the validity of assigning unknown genes to human chromosomes based on the EST sequence matches. In the present cases mapping the ESTs to a chromosome can also be considered to have mapped the known gene product: rolipram-sensitive cAMP phosphodiesterase, chromosome 1; protein phosphatase 2A{beta}, chromosome 4; alpha-catenin, chromosome 5; the ELE1 oncogene, chromosome 10q11.2 or q2.1-q23; MXII protein, chromosome l0q24-qter; ribosomal protein L18a homologue, chromosome 14; ribosomal protein L3, chromosome 17; and moesin, Xp11-cen. There were also ESTs mapped that were closely related to non-human sequence records. These matches therefore can be considered to identify human counterparts of known gene products, or members of known gene families. Examples of these include membrane proteins, translation-associated proteins, structural proteins, and enzymes. These data then demonstrate that single pass sequence information is sufficient to design PCR primers useful for assigning cDNA sequences to human chromosomes. When the EST sequence matches previous sequence database records, the chromosome assignments of the EST can be used to make preliminary assignments of the human gene to a chromosome.« less
2012-01-01
Background The feline genome is valuable to the veterinary and model organism genomics communities because the cat is an obligate carnivore and a model for endangered felids. The initial public release of the Felis catus genome assembly provided a framework for investigating the genomic basis of feline biology. However, the entire set of protein coding genes has not been elucidated. Results We identified and characterized 1227 protein coding feline sequences, of which 913 map to public sequences and 314 are novel. These sequences have been deposited into NCBI's genbank database and complement public genomic resources by providing additional protein coding sequences that fill in some of the gaps in the feline genome assembly. Through functional and comparative genomic analyses, we gained an understanding of the role of these sequences in feline development, nutrition and health. Specifically, we identified 104 orthologs of human genes associated with Mendelian disorders. We detected negative selection within sequences with gene ontology annotations associated with intracellular trafficking, cytoskeleton and muscle functions. We detected relatively less negative selection on protein sequences encoding extracellular networks, apoptotic pathways and mitochondrial gene ontology annotations. Additionally, we characterized feline cDNA sequences that have mouse orthologs associated with clinical, nutritional and developmental phenotypes. Together, this analysis provides an overview of the value of our cDNA sequences and enhances our understanding of how the feline genome is similar to, and different from other mammalian genomes. Conclusions The cDNA sequences reported here expand existing feline genomic resources by providing high-quality sequences annotated with comparative genomic information providing functional, clinical, nutritional and orthologous gene information. PMID:22257742
NASA Astrophysics Data System (ADS)
Kikuchi, Shoshi
2009-02-01
Completion of the high-precision genome sequence analysis of rice led to the collection of about 35,000 full-length cDNA clones and the determination of their complete sequences. Mapping of these full-length cDNA sequences has given us information on (1) the number of genes expressed in the rice genome; (2) the start and end positions and exon-intron structures of rice genes; (3) alternative transcripts; (4) possible encoded proteins; (5) non-protein-coding (np) RNAs; (6) the density of gene localization on the chromosome; (7) setting the parameters of gene prediction programs; and (8) the construction of a microarray system that monitors global gene expression. Manual curation for rice gene annotation by using mapping information on full-length cDNA and EST assemblies has revealed about 32,000 expressed genes in the rice genome. Analysis of major gene families, such as those encoding membrane transport proteins (pumps, ion channels, and secondary transporters), along with the evolution from bacteria to higher animals and plants, reveals how gene numbers have increased through adaptation to circumstances. Family-based gene annotation also gives us a new way of comparing organisms. Massive amounts of data on gene expression under many kinds of physiological conditions are being accumulated in rice oligoarrays (22K and 44K) based on full-length cDNA sequences. Cluster analyses of genes that have the same promoter cis-elements, that have similar expression profiles, or that encode enzymes in the same metabolic pathways or signal transduction cascades give us clues to understanding the networks of gene expression in rice. As a tool for that purpose, we recently developed "RiCES", a tool for searching for cis-elements in the promoter regions of clustered genes.
Lakatos, Béla; Hornyák, Ákos; Demeter, Zoltán; Forgách, Petra; Kennedy, Frances; Rusvai, Miklós
2017-12-01
Adenoviral nucleic acid was detected by polymerase chain reaction (PCR) in formalin-fixed paraffin-embedded tissue samples of a cat that had suffered from disseminated adenovirus infection. The identity of the amplified products from the hexon and DNA-dependent DNA polymerase genes was confirmed by DNA sequencing. The sequences were clearly distinguishable from corresponding hexon and polymerase sequences of other mastadenoviruses, including human adenoviruses. These results suggest the possible existence of a distinct feline adenovirus.
Gu, Chun Tao; Li, Chun Yan; Yang, Li Jie; Huo, Gui Cheng
2014-08-01
A Gram-stain-negative bacterial strain, 10-17(T), was isolated from traditional sourdough in Heilongjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, RNA polymerase β subunit (rpoB) gene sequence analysis, DNA gyrase (gyrB) gene sequence analysis, initiation translation factor 2 (infB) gene sequence analysis, ATP synthase β subunit (atpD) gene sequence analysis, fatty acid methyl ester analysis, determination of DNA G+C content, DNA-DNA hybridization and an analysis of phenotypic features. Strain 10-17(T) was phylogenetically related to Enterobacter hormaechei CIP 103441(T), Enterobacter cancerogenus LMG 2693(T), Enterobacter asburiae JCM 6051(T), Enterobacter mori LMG 25706(T), Enterobacter ludwigii EN-119(T) and Leclercia adecarboxylata LMG 2803(T), having 99.5%, 99.3%, 98.7%, 98.5%, 98.4% and 98.4% 16S rRNA gene sequence similarity, respectively. On the basis of polyphasic characterization data obtained in the present study, a novel species, Enterobacter xiangfangensis sp. nov., is proposed and the type strain is 10-17(T) ( = LMG 27195(T) = NCIMB 14836(T) = CCUG 62994(T)). Enterobacter sacchari Zhu et al. 2013 was reclassified as Kosakonia sacchari comb. nov. on the basis of 16S rRNA, rpoB, gyrB, infB and atpD gene sequence analysis and the type strain is strain SP1(T)( = CGMCC 1.12102(T) = LMG 26783(T)). © 2014 IUMS.
Continuous Influx of Genetic Material from Host to Virus Populations
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane
2016-01-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors. PMID:26829124
Continuous Influx of Genetic Material from Host to Virus Populations.
Gilbert, Clément; Peccoud, Jean; Chateigner, Aurélien; Moumen, Bouziane; Cordaux, Richard; Herniou, Elisabeth A
2016-02-01
Many genes of large double-stranded DNA viruses have a cellular origin, suggesting that host-to-virus horizontal transfer (HT) of DNA is recurrent. Yet, the frequency of these transfers has never been assessed in viral populations. Here we used ultra-deep DNA sequencing of 21 baculovirus populations extracted from two moth species to show that a large diversity of moth DNA sequences (n = 86) can integrate into viral genomes during the course of a viral infection. The majority of the 86 different moth DNA sequences are transposable elements (TEs, n = 69) belonging to 10 superfamilies of DNA transposons and three superfamilies of retrotransposons. The remaining 17 sequences are moth sequences of unknown nature. In addition to bona fide DNA transposition, we uncover microhomology-mediated recombination as a mechanism explaining integration of moth sequences into viral genomes. Many sequences integrated multiple times at multiple positions along the viral genome. We detected a total of 27,504 insertions of moth sequences in the 21 viral populations and we calculate that on average, 4.8% of viruses harbor at least one moth sequence in these populations. Despite this substantial proportion, no insertion of moth DNA was maintained in any viral population after 10 successive infection cycles. Hence, there is a constant turnover of host DNA inserted into viral genomes each time the virus infects a moth. Finally, we found that at least 21 of the moth TEs integrated into viral genomes underwent repeated horizontal transfers between various insect species, including some lepidopterans susceptible to baculoviruses. Our results identify host DNA influx as a potent source of genetic diversity in viral populations. They also support a role for baculoviruses as vectors of DNA HT between insects, and call for an evaluation of possible gene or TE spread when using viruses as biopesticides or gene delivery vectors.
The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.
Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R
1982-01-01
The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791
Immune-Related Transcriptome of Coptotermes formosanus Shiraki Workers: The Defense Mechanism
Hussain, Abid; Li, Yi-Feng; Cheng, Yu; Liu, Yang; Chen, Chuan-Cheng; Wen, Shuo-Yang
2013-01-01
Formosan subterranean termites, Coptotermes formosanus Shiraki, live socially in microbial-rich habitats. To understand the molecular mechanism by which termites combat pathogenic microbes, a full-length normalized cDNA library and four Suppression Subtractive Hybridization (SSH) libraries were constructed from termite workers infected with entomopathogenic fungi (Metarhizium anisopliae and Beauveria bassiana), Gram-positive Bacillus thuringiensis and Gram-negative Escherichia coli, and the libraries were analyzed. From the high quality normalized cDNA library, 439 immune-related sequences were identified. These sequences were categorized as pattern recognition receptors (47 sequences), signal modulators (52 sequences), signal transducers (137 sequences), effectors (39 sequences) and others (164 sequences). From the SSH libraries, 27, 17, 22 and 15 immune-related genes were identified from each SSH library treated with M. anisopliae, B. bassiana, B. thuringiensis and E. coli, respectively. When the normalized cDNA library was compared with the SSH libraries, 37 immune-related clusters were found in common; 56 clusters were identified in the SSH libraries, and 259 were identified in the normalized cDNA library. The immune-related gene expression pattern was further investigated using quantitative real time PCR (qPCR). Important immune-related genes were characterized, and their potential functions were discussed based on the integrated analysis of the results. We suggest that normalized cDNA and SSH libraries enable us to discover functional genes transcriptome. The results remarkably expand our knowledge about immune-inducible genes in C. formosanus Shiraki and enable the future development of novel control strategies for the management of Formosan subterranean termites. PMID:23874972
PMS2 gene mutational analysis: direct cDNA sequencing to circumvent pseudogene interference.
Wimmer, Katharina; Wernstedt, Annekatrin
2014-01-01
The presence of highly homologous pseudocopies can compromise the mutation analysis of a gene of interest. In particular, when using PCR-based strategies, pseudogene co-amplification has to be effectively prevented. This is often achieved by using primers designed to be parental gene specific according to the reference sequence and by applying stringent PCR conditions. However, there are cases in which this approach is of limited utility. For example, it has been shown that the PMS2 gene exchanges sequences with one of its pseudogenes, named PMS2CL. This results in functional PMS2 alleles containing pseudogene-derived sequences at their 3'-end and in nonfunctional PMS2CL pseudogene alleles that contain gene-derived sequences. Hence, the paralogues cannot be distinguished according to the reference sequence. This shortcoming can be effectively circumvented by using direct cDNA sequencing. This approach is based on the selective amplification of PMS2 transcripts in two overlapping 1.6-kb RT-PCR products. In addition to avoiding pseudogene co-amplification and allele dropout, this method has also the advantage that it allows to effectively identify deletions, splice mutations, and de novo retrotransposon insertions that escape the detection of most DNA-based mutation analysis protocols.
Chae, Heejoon; Lee, Sangseon; Seo, Seokjun; Jung, Daekyoung; Chang, Hyeonsook; Nephew, Kenneth P; Kim, Sun
2016-12-01
Measuring gene expression, DNA sequence variation, and DNA methylation status is routinely done using high throughput sequencing technologies. To analyze such multi-omics data and explore relationships, reliable bioinformatics systems are much needed. Existing systems are either for exploring curated data or for processing omics data in the form of a library such as R. Thus scientists have much difficulty in investigating relationships among gene expression, DNA sequence variation, and DNA methylation using multi-omics data. In this study, we report a system called BioVLAB-mCpG-SNP-EXPRESS for the integrated analysis of DNA methylation, sequence variation (SNPs), and gene expression for distinguishing cellular phenotypes at the pairwise and multiple phenotype levels. The system can be deployed on either the Amazon cloud or a publicly available high-performance computing node, and the data analysis and exploration of the analysis result can be conveniently done using a web-based interface. In order to alleviate analysis complexity, all the process are fully automated, and graphical workflow system is integrated to represent real-time analysis progression. The BioVLAB-mCpG-SNP-EXPRESS system works in three stages. First, it processes and analyzes multi-omics data as input in the form of the raw data, i.e., FastQ files. Second, various integrated analyses such as methylation vs. gene expression and mutation vs. methylation are performed. Finally, the analysis result can be explored in a number of ways through a web interface for the multi-level, multi-perspective exploration. Multi-level interpretation can be done by either gene, gene set, pathway or network level and multi-perspective exploration can be explored from either gene expression, DNA methylation, sequence variation, or their relationship perspective. The utility of the system is demonstrated by performing analysis of phenotypically distinct 30 breast cancer cell line data set. BioVLAB-mCpG-SNP-EXPRESS is available at http://biohealth.snu.ac.kr/software/biovlab_mcpg_snp_express/. Copyright © 2016 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chattopadhyay, Saket; Ely, Abdullah; Bloom, Kristie
2009-11-20
RNA interference (RNAi) may be harnessed to inhibit viral gene expression and this approach is being developed to counter chronic infection with hepatitis B virus (HBV). Compared to synthetic RNAi activators, DNA expression cassettes that generate silencing sequences have advantages of sustained efficacy and ease of propagation in plasmid DNA (pDNA). However, the large size of pDNAs and inclusion of sequences conferring antibiotic resistance and immunostimulation limit delivery efficiency and safety. To develop use of alternative DNA templates that may be applied for therapeutic gene silencing, we assessed the usefulness of PCR-generated linear expression cassettes that produce anti-HBV micro-RNA (miR)more » shuttles. We found that silencing of HBV markers of replication was efficient (>75%) in cell culture and in vivo. miR shuttles were processed to form anti-HBV guide strands and there was no evidence of induction of the interferon response. Modification of terminal sequences to include flanking human adenoviral type-5 inverted terminal repeats was easily achieved and did not compromise silencing efficacy. These linear DNA sequences should have utility in the development of gene silencing applications where modifications of terminal elements with elimination of potentially harmful and non-essential sequences are required.« less
Kubota, Takeo
2013-01-01
Epigenome is defined as DNA and histone modification-dependent gene regulation system. Abnormalities in this system are known to cause various neuro-developmental diseases. We recently reported that neurological symptoms of Rett syndrome, which is an autistic disorder caused by mutations in methyl-CpG binding protein 2 (MeCP2), was associated with failure of epigenomic gene regulation in neuronal cells, and that clinical differences in the identical twins with Rett syndrome in the differences in DNA methylation in neuronal genes, but not caused by DNA sequence differences. Since central nervus system requires precise gene regulation, neurological diseases including Alzheimer and Parkinson diseases may be caused by acquired DNA modification (epigenomic) changes that results in aberrant gene regulation as well as DNA sequence changes congenitally occurred (mutation).
Targeted gene insertion for molecular medicine.
Voigt, Katrin; Izsvák, Zsuzsanna; Ivics, Zoltán
2008-11-01
Genomic insertion of a functional gene together with suitable transcriptional regulatory elements is often required for long-term therapeutical benefit in gene therapy for several genetic diseases. A variety of integrating vectors for gene delivery exist. Some of them exhibit random genomic integration, whereas others have integration preferences based on attributes of the targeted site, such as primary DNA sequence and physical structure of the DNA, or through tethering to certain DNA sequences by host-encoded cellular factors. Uncontrolled genomic insertion bears the risk of the transgene being silenced due to chromosomal position effects, and can lead to genotoxic effects due to mutagenesis of cellular genes. None of the vector systems currently used in either preclinical experiments or clinical trials displays sufficient preferences for target DNA sequences that would ensure appropriate and reliable expression of the transgene and simultaneously prevent hazardous side effects. We review in this paper the advantages and disadvantages of both viral and non-viral gene delivery technologies, discuss mechanisms of target site selection of integrating genetic elements (viruses and transposons), and suggest distinct molecular strategies for targeted gene delivery.
Identification of Genetic Elements Associated with EPSPS Gene Amplification
Gaines, Todd A.; Wright, Alice A.; Molin, William T.; Lorentz, Lothar; Riggins, Chance W.; Tranel, Patrick J.; Beffa, Roland; Westra, Philip; Powles, Stephen B.
2013-01-01
Weed populations can have high genetic plasticity and rapid responses to environmental selection pressures. For example, 100-fold amplification of the 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene evolved in the weed species Amaranthus palmeri to confer resistance to glyphosate, the world’s most important herbicide. However, the gene amplification mechanism is unknown. We sequenced the EPSPS gene and genomic regions flanking EPSPS loci in A. palmeri, and searched for mobile genetic elements or repetitive sequences. The EPSPS gene was 10,229 bp, containing 8 exons and 7 introns. The gene amplification likely proceeded through a DNA-mediated mechanism, as introns exist in the amplified gene copies and the entire amplified sequence is at least 30 kb in length. Our data support the presence of two EPSPS loci in susceptible (S) A. palmeri, and that only one of these was amplified in glyphosate-resistant (R) A. palmeri. The EPSPS gene amplification event likely occurred recently, as no sequence polymorphisms were found within introns of amplified EPSPS copies from R individuals. Sequences with homology to miniature inverted-repeat transposable elements (MITEs) were identified next to EPSPS gene copies only in R individuals. Additionally, a putative Activator (Ac) transposase and a repetitive sequence region were associated with amplified EPSPS genes. The mechanism controlling this DNA-mediated amplification remains unknown. Further investigation is necessary to determine if the gene amplification may have proceeded via DNA transposon-mediated replication, and/or unequal recombination between different genomic regions resulting in replication of the EPSPS gene. PMID:23762434
NASA Astrophysics Data System (ADS)
Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia
2016-10-01
In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.
Selection of a DNA barcode for Nectriaceae from fungal whole-genomes.
Zeng, Zhaoqing; Zhao, Peng; Luo, Jing; Zhuang, Wenying; Yu, Zhihe
2012-01-01
A DNA barcode is a short segment of sequence that is able to distinguish species. A barcode must ideally contain enough variation to distinguish every individual species and be easily obtained. Fungi of Nectriaceae are economically important and show high species diversity. To establish a standard DNA barcode for this group of fungi, the genomes of Neurospora crassa and 30 other filamentous fungi were compared. The expect value was treated as a criterion to recognize homologous sequences. Four candidate markers, Hsp90, AAC, CDC48, and EF3, were tested for their feasibility as barcodes in the identification of 34 well-established species belonging to 13 genera of Nectriaceae. Two hundred and fifteen sequences were analyzed. Intra- and inter-specific variations and the success rate of PCR amplification and sequencing were considered as important criteria for estimation of the candidate markers. Ultimately, the partial EF3 gene met the requirements for a good DNA barcode: No overlap was found between the intra- and inter-specific pairwise distances. The smallest inter-specific distance of EF3 gene was 3.19%, while the largest intra-specific distance was 1.79%. In addition, there was a high success rate in PCR and sequencing for this gene (96.3%). CDC48 showed sufficiently high sequence variation among species, but the PCR and sequencing success rate was 84% using a single pair of primers. Although the Hsp90 and AAC genes had higher PCR and sequencing success rates (96.3% and 97.5%, respectively), overlapping occurred between the intra- and inter-specific variations, which could lead to misidentification. Therefore, we propose the EF3 gene as a possible DNA barcode for the nectriaceous fungi.
Chen, Zhen-Yong; Guo, Xiao-Jiang; Chen, Zhong-Xu; Chen, Wei-Ying; Wang, Ji-Rui
2017-06-01
The binding sites of transcription factors (TFs) in upstream DNA regions are called transcription factor binding sites (TFBSs). TFBSs are important elements for regulating gene expression. To date, there have been few studies on the profiles of TFBSs in plants. In total, 4,873 sequences with 5' upstream regions from 8530 wheat fl-cDNA sequences were used to predict TFBSs. We found 4572 TFBSs for the MADS TF family, which was twice as many as for bHLH (1951), B3 (1951), HB superfamily (1914), ERF (1820), and AP2/ERF (1725) TFs, and was approximately four times higher than the remaining TFBS types. The percentage of TFBSs and TF members showed a distinct distribution in different tissues. Overall, the distribution of TFBSs in the upstream regions of wheat fl-cDNA sequences had significant difference. Meanwhile, high frequencies of some types of TFBSs were found in specific regions in the upstream sequences. Both TFs and fl-cDNA with TFBSs predicted in the same tissues exhibited specific distribution preferences for regulating gene expression. The tissue-specific analysis of TFs and fl-cDNA with TFBSs provides useful information for functional research, and can be used to identify relationships between tissue-specific TFs and fl-cDNA with TFBSs. Moreover, the positional distribution of TFBSs indicates that some types of wheat TFBS have different positional distribution preferences in the upstream regions of genes.
Yuan, Xiao-Long; Gao, Ning; Xing, Yan; Zhang, Hai-Bin; Zhang, Ai-Ling; Liu, Jing; He, Jin-Long; Xu, Yuan; Lin, Wen-Mian; Chen, Zan-Mou; Zhang, Hao; Zhang, Zhe; Li, Jia-Qi
2016-02-25
Substantial evidence has shown that DNA methylation regulates the initiation of ovarian and sexual maturation. Here, we investigated the genome-wide profile of DNA methylation in porcine ovaries at single-base resolution using reduced representation bisulfite sequencing. The biological variation was minimal among the three ovarian replicates. We found hypermethylation frequently occurred in regions with low gene abundance, while hypomethylation in regions with high gene abundance. The DNA methylation around transcriptional start sites was negatively correlated with their own CpG content. Additionally, the methylation level in the bodies of genes was higher than that in their 5' and 3' flanking regions. The DNA methylation pattern of the low CpG content promoter genes differed obviously from that of the high CpG content promoter genes. The DNA methylation level of the porcine ovary was higher than that of the porcine intestine. Analyses of the genome-wide DNA methylation in porcine ovaries would advance the knowledge and understanding of the porcine ovarian methylome.
2011-01-01
Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559
Zhou, Wen-Zhao; Zhang, Yan-Mei; Lu, Jun-Ying; Li, Jun-Feng
2012-01-01
To provide a resource of sisal-specific expressed sequence data and facilitate this powerful approach in new gene research, the preparation of normalized cDNA libraries enriched with full-length sequences is necessary. Four libraries were produced with RNA pooled from Agave sisalana multiple tissues to increase efficiency of normalization and maximize the number of independent genes by SMART™ method and the duplex-specific nuclease (DSN). This procedure kept the proportion of full-length cDNAs in the subtracted/normalized libraries and dramatically enhanced the discovery of new genes. Sequencing of 3875 cDNA clones of libraries revealed 3320 unigenes with an average insert length about 1.2 kb, indicating that the non-redundancy of libraries was about 85.7%. These unigene functions were predicted by comparing their sequences to functional domain databases and extensively annotated with Gene Ontology (GO) terms. Comparative analysis of sisal unigenes and other plant genomes revealed that four putative MADS-box genes and knotted-like homeobox (knox) gene were obtained from a total of 1162 full-length transcripts. Furthermore, real-time PCR showed that the characteristics of their transcripts mainly depended on the tight expression regulation of a number of genes during the leaf and flower development. Analysis of individual library sequence data indicated that the pooled-tissue approach was highly effective in discovering new genes and preparing libraries for efficient deep sequencing. PMID:23202944
Schons-Fonseca, Luciane; da Silva, Josefa B; Milanez, Juliana S; Domingos, Renan H; Smith, Janet L; Nakaya, Helder I; Grossman, Alan D; Ho, Paulo L; da Costa, Renata M A
2016-02-18
We determined the effects of DNA damage caused by ultraviolet radiation on gene expression in Leptospira interrogans using DNA microarrays. These data were integrated with DNA binding in vivo of LexA1, a regulator of the DNA damage response, assessed by chromatin immunoprecipitation and massively parallel DNA sequencing (ChIP-seq). In response to DNA damage, Leptospira induced expression of genes involved in DNA metabolism, in mobile genetic elements and defective prophages. The DNA repair genes involved in removal of photo-damage (e.g. nucleotide excision repair uvrABC, recombinases recBCD and resolvases ruvABC) were not induced. Genes involved in various metabolic pathways were down regulated, including genes involved in cell growth, RNA metabolism and the tricarboxylic acid cycle. From ChIP-seq data, we observed 24 LexA1 binding sites located throughout chromosome 1 and one binding site in chromosome 2. Expression of many, but not all, genes near those sites was increased following DNA damage. Binding sites were found as far as 550 bp upstream from the start codon, or 1 kb into the coding sequence. Our findings indicate that there is a shift in gene expression following DNA damage that represses genes involved in cell growth and virulence, and induces genes involved in mutagenesis and recombination. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Bacterial identification and subtyping using DNA microarray and DNA sequencing.
Al-Khaldi, Sufian F; Mossoba, Magdi M; Allard, Marc M; Lienau, E Kurt; Brown, Eric D
2012-01-01
The era of fast and accurate discovery of biological sequence motifs in prokaryotic and eukaryotic cells is here. The co-evolution of direct genome sequencing and DNA microarray strategies not only will identify, isotype, and serotype pathogenic bacteria, but also it will aid in the discovery of new gene functions by detecting gene expressions in different diseases and environmental conditions. Microarray bacterial identification has made great advances in working with pure and mixed bacterial samples. The technological advances have moved beyond bacterial gene expression to include bacterial identification and isotyping. Application of new tools such as mid-infrared chemical imaging improves detection of hybridization in DNA microarrays. The research in this field is promising and future work will reveal the potential of infrared technology in bacterial identification. On the other hand, DNA sequencing by using 454 pyrosequencing is so cost effective that the promise of $1,000 per bacterial genome sequence is becoming a reality. Pyrosequencing technology is a simple to use technique that can produce accurate and quantitative analysis of DNA sequences with a great speed. The deposition of massive amounts of bacterial genomic information in databanks is creating fingerprint phylogenetic analysis that will ultimately replace several technologies such as Pulsed Field Gel Electrophoresis. In this chapter, we will review (1) the use of DNA microarray using fluorescence and infrared imaging detection for identification of pathogenic bacteria, and (2) use of pyrosequencing in DNA cluster analysis to fingerprint bacterial phylogenetic trees.
Lin, Chentao; Thomashow, Michael F.
1992-01-01
Previous studies have indicated that changes in gene expression occur in Arabidopsis thaliana L. (Heyn) during cold acclimation and that certain of the cor (cold-regulated) genes encode polypeptides that share the unusual property of remaining soluble upon boiling in aqueous solution. Here, we identify a cDNA clone for a cold-regulated gene encoding one of the “boiling-stable” polypeptides, COR15. DNA sequence analysis indicated that the gene, designated cor15, encodes a 14.7-kilodalton hydrophilic polypeptide having an N-terminal amino acid sequence that closely resembles transit peptides that target proteins to the stromal compartment of chloroplasts. Immunological studies indicated that COR15 is processed in vivo and that the mature polypeptide, COR 15m, is present in the soluble fraction of chloroplasts. Possible functions of COR 15m are discussed. ImagesFigure 1Figure 4Figure 5Figure 6Figure 7 PMID:16668917
Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.
Pietrowski, D; Förster, M
2000-01-01
The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).
Mutator gene and hereditary non-polyposis colorectal cancer
de la Chapelle, Albert [Helsingfors, FI; Vogelstein, Bert [Baltimore, MD; Kinzler, Kenneth W [Baltimore, MD
2008-02-05
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Sie, Daoud; Snijders, Peter J F; Meijer, Gerrit A; Doeleman, Marije W; van Moorsel, Marinda I H; van Essen, Hendrik F; Eijk, Paul P; Grünberg, Katrien; van Grieken, Nicole C T; Thunnissen, Erik; Verheul, Henk M; Smit, Egbert F; Ylstra, Bauke; Heideman, Daniëlle A M
2014-10-01
Next generation DNA sequencing (NGS) holds promise for diagnostic applications, yet implementation in routine molecular pathology practice requires performance evaluation on DNA derived from routine formalin-fixed paraffin-embedded (FFPE) tissue specimens. The current study presents a comprehensive analysis of TruSeq Amplicon Cancer Panel-based NGS using a MiSeq Personal sequencer (TSACP-MiSeq-NGS) for somatic mutation profiling. TSACP-MiSeq-NGS (testing 212 hotspot mutation amplicons of 48 genes) and a data analysis pipeline were evaluated in a retrospective learning/test set approach (n = 58/n = 45 FFPE-tumor DNA samples) against 'gold standard' high-resolution-melting (HRM)-sequencing for the genes KRAS, EGFR, BRAF and PIK3CA. Next, the performance of the validated test algorithm was assessed in an independent, prospective cohort of FFPE-tumor DNA samples (n = 75). In the learning set, a number of minimum parameter settings was defined to decide whether a FFPE-DNA sample is qualified for TSACP-MiSeq-NGS and for calling mutations. The resulting test algorithm revealed 82% (37/45) compliance to the quality criteria and 95% (35/37) concordant assay findings for KRAS, EGFR, BRAF and PIK3CA with HRM-sequencing (kappa = 0.92; 95% CI = 0.81-1.03) in the test set. Subsequent application of the validated test algorithm to the prospective cohort yielded a success rate of 84% (63/75), and a high concordance with HRM-sequencing (95% (60/63); kappa = 0.92; 95% CI = 0.84-1.01). TSACP-MiSeq-NGS detected 77 mutations in 29 additional genes. TSACP-MiSeq-NGS is suitable for diagnostic gene mutation profiling in oncopathology.
Assessing the Fidelity of Ancient DNA Sequences Amplified From Nuclear Genes
Binladen, Jonas; Wiuf, Carsten; Gilbert, M. Thomas P.; Bunce, Michael; Barnett, Ross; Larson, Greger; Greenwood, Alex D.; Haile, James; Ho, Simon Y. W.; Hansen, Anders J.; Willerslev, Eske
2006-01-01
To date, the field of ancient DNA has relied almost exclusively on mitochondrial DNA (mtDNA) sequences. However, a number of recent studies have reported the successful recovery of ancient nuclear DNA (nuDNA) sequences, thereby allowing the characterization of genetic loci directly involved in phenotypic traits of extinct taxa. It is well documented that postmortem damage in ancient mtDNA can lead to the generation of artifactual sequences. However, as yet no one has thoroughly investigated the damage spectrum in ancient nuDNA. By comparing clone sequences from 23 fossil specimens, recovered from environments ranging from permafrost to desert, we demonstrate the presence of miscoding lesion damage in both the mtDNA and nuDNA, resulting in insertion of erroneous bases during amplification. Interestingly, no significant differences in the frequency of miscoding lesion damage are recorded between mtDNA and nuDNA despite great differences in cellular copy numbers. For both mtDNA and nuDNA, we find significant positive correlations between total sequence heterogeneity and the rates of type 1 transitions (adenine → guanine and thymine → cytosine) and type 2 transitions (cytosine → thymine and guanine → adenine), respectively. Type 2 transitions are by far the most dominant and increase relative to those of type 1 with damage load. The results suggest that the deamination of cytosine (and 5-methyl cytosine) to uracil (and thymine) is the main cause of miscoding lesions in both ancient mtDNA and nuDNA sequences. We argue that the problems presented by postmortem damage, as well as problems with contamination from exogenous sources of conserved nuclear genes, allelic variation, and the reliance on single nucleotide polymorphisms, call for great caution in studies relying on ancient nuDNA sequences. PMID:16299392
Sharma, Mukul; Vedithi, Sundeep Chaitanya; Das, Madhusmita; Roy, Anindya; Ebenezer, Mannam
2017-01-01
Survival of Mycobacterium leprae, the causative bacteria for leprosy, in the human host is dependent to an extent on the ways in which its genome integrity is retained. DNA repair mechanisms protect bacterial DNA from damage induced by various stress factors. The current study is aimed at understanding the sequence and functional annotation of DNA repair genes in M. leprae. T he genome of M. leprae was annotated using sequence alignment tools to identify DNA repair genes that have homologs in Mycobacterium tuberculosis and Escherichia coli. A set of 96 genes known to be involved in DNA repair mechanisms in E. coli and Mycobacteriaceae were chosen as a reference. Among these, 61 were identified in M. leprae based on sequence similarity and domain architecture. The 61 were classified into 36 characterized gene products (59%), 11 hypothetical proteins (18%), and 14 pseudogenes (23%). All these genes have homologs in M. tuberculosis and 49 (80.32%) in E. coli. A set of 12 genes which are absent in E. coli were present in M. leprae and in Mycobacteriaceae. These 61 genes were further investigated for their expression profiles in the whole transcriptome microarray data of M. leprae which was obtained from the signal intensities of 60bp probes, tiling the entire genome with 10bp overlaps. It was noted that transcripts corresponding to all the 61 genes were identified in the transcriptome data with varying expression levels ranging from 0.18 to 2.47 fold (normalized with 16SrRNA). The mRNA expression levels of a representative set of seven genes ( four annotated and three hypothetical protein coding genes) were analyzed using quantitative Polymerase Chain Reaction (qPCR) assays with RNA extracted from skin biopsies of 10 newly diagnosed, untreated leprosy cases. It was noted that RNA expression levels were higher for genes involved in homologous recombination whereas the genes with a low level of expression are involved in the direct repair pathway. This study provided preliminary information on the potential DNA repair pathways that are extant in M. leprae and the associated genes.
Archaebacterial rhodopsin sequences: Implications for evolution
NASA Technical Reports Server (NTRS)
Lanyi, J. K.
1991-01-01
It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.
Brain cDNA clone for human cholinesterase
DOE Office of Scientific and Technical Information (OSTI.GOV)
McTiernan, C.; Adkins, S.; Chatonnet, A.
1987-10-01
A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less
Exploring the roles of DNA methylation in the metal-reducing bacterium Shewanella oneidensis MR-1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bendall, Matthew L.; Luong, Khai; Wetmore, Kelly M.
2013-08-30
We performed whole genome analyses of DNA methylation in Shewanella 17 oneidensis MR-1 to examine its possible role in regulating gene expression and 18 other cellular processes. Single-Molecule Real Time (SMRT) sequencing 19 revealed extensive methylation of adenine (N6mA) throughout the 20 genome. These methylated bases were located in five sequence motifs, 21 including three novel targets for Type I restriction/modification enzymes. The 22 sequence motifs targeted by putative methyltranferases were determined via 23 SMRT sequencing of gene knockout mutants. In addition, we found S. 24 oneidensis MR-1 cultures grown under various culture conditions displayed 25 different DNA methylation patterns.more » However, the small number of differentially 26 methylated sites could not be directly linked to the much larger number of 27 differentially expressed genes in these conditions, suggesting DNA methylation is 28 not a major regulator of gene expression in S. oneidensis MR-1. The enrichment 29 of methylated GATC motifs in the origin of replication indicate DNA methylation 30 may regulate genome replication in a manner similar to that seen in Escherichia 31 coli. Furthermore, comparative analyses suggest that many 32 Gammaproteobacteria, including all members of the Shewanellaceae family, may 33 also utilize DNA methylation to regulate genome replication.« less
Nucleosome Positioning and Epigenetics
NASA Astrophysics Data System (ADS)
Schwab, David; Bruinsma, Robijn
2008-03-01
The role of chromatin structure in gene regulation has recently taken center stage in the field of epigenetics, phenomena that change the phenotype without changing the DNA sequence. Recent work has also shown that nucleosomes, a complex of DNA wrapped around a histone octamer, experience a sequence dependent energy landscape due to the variation in DNA bend stiffness with sequence composition. In this talk, we consider the role nucleosome positioning might play in the formation of heterochromatin, a compact form of DNA generically responsible for gene silencing. In particular, we discuss how different patterns of nucleosome positions, periodic or random, could either facilitate or suppress heterochromatin stability and formation.
Bricheux, G; Brugerolle, G
1997-08-01
The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.
Gene Deletion in Barley Mediated by LTR-retrotransposon BARE
Shang, Yi; Yang, Fei; Schulman, Alan H.; Zhu, Jinghuan; Jia, Yong; Wang, Junmei; Zhang, Xiao-Qi; Jia, Qiaojun; Hua, Wei; Yang, Jianming; Li, Chengdao
2017-01-01
A poly-row branched spike (prbs) barley mutant was obtained from soaking a two-rowed barley inflorescence in a solution of maize genomic DNA. Positional cloning and sequencing demonstrated that the prbs mutant resulted from a 28 kb deletion including the inflorescence architecture gene HvRA2. Sequence annotation revealed that the HvRA2 gene is flanked by two LTR (long terminal repeat) retrotransposons (BARE) sharing 89% sequence identity. A recombination between the integrase (IN) gene regions of the two BARE copies resulted in the formation of an intact BARE and loss of HvRA2. No maize DNA was detected in the recombination region although the flanking sequences of HvRA2 gene showed over 73% of sequence identity with repetitive sequences on 10 maize chromosomes. It is still unknown whether the interaction of retrotransposons between barley and maize has resulted in the recombination observed in the present study. PMID:28252053
Sirakova, T D; Markaryan, A; Kolattukudy, P E
1994-01-01
An extracellular elastinolytic metalloproteinase, purified from Aspergillus fumigatus isolated from an aspergillosis and patient/and an internal peptide derived from it were subjected to N-terminal sequencing. Oligonucleotide primers based on these sequences were used to PCR amplify a segment of the metalloproteinase cDNA, which was used as a probe to isolate the cDNA and gene for this enzyme. The gene sequence matched exactly with the cDNA sequence except for the four introns that interrupted the open reading frame. According to the deduced amino acid sequence, the metalloproteinase has a signal sequence and 227 additional amino acids preceding the sequence for the mature protein of 389 amino acids with a calculated molecular mass of 42 kDa, which is close to the size of the purified mature fungal proteinase. This sequence contains segments that matched both the N terminus of the mature protein and the internal peptide. A. fumigatus metalloproteinase contains some of the conserved zinc-binding and active-site motifs characteristic of metalloproteinases but shows no overall homology with known metalloproteinases. The cDNA of the mature protein when introduced into Escherichia coli directed the expression of a protein with a size, N-terminal sequence, and immunological cross-reactivity identical to those of the native fungal enzyme. Although the enzyme in the inclusion bodies could not be renatured, expression at 30 degrees C yielded soluble enzyme that showed chromatographic behavior identical to that of the native fungal enzyme and catalyzed hydrolysis of elastin. The metalloproteinase gene described here was not found in Aspergillus flavus. Images PMID:7927676
The complete chloroplast genome of Sinopodophyllum hexandrum Ying (Berberidaceae).
Meng, Lihua; Liu, Ruijuan; Chen, Jianbing; Ding, Chenxu
2017-05-01
The complete nucleotide sequence of the Sinopodophyllum hexandrum Ying chloroplast genome (cpDNA) was determined based on next-generation sequencing technologies in this study. The genome was 157 203 bp in length, containing a pair of inverted repeat (IRa and IRb) regions of 25 960 bp, which were separated by a large single-copy (LSC) region of 87 065 bp and a small single-copy (SSC) region of 18 218 bp, respectively. The cpDNA contained 148 genes, including 96 protein-coding genes, 8 ribosomal RNA genes, and 44 tRNA genes. In these genes, eight harbored a single intron, and two (ycf3 and clpP) contained a couple of introns. The cpDNA AT content of S. hexandrum cpDNA is 61.5%.
Lampel, J S; Aphale, J S; Lampel, K A; Strohl, W R
1992-01-01
The gene encoding a novel milk protein-hydrolyzing proteinase was cloned on a 6.56-kb SstI fragment from Streptomyces sp. strain C5 genomic DNA into Streptomyces lividans 1326 by using the plasmid vector pIJ702. The gene encoding the small neutral proteinase (snpA) was located within a 2.6-kb BamHI-SstI restriction fragment that was partially sequenced. The molecular mass of the deduced amino acid sequence of the mature protein was determined to be 15,740, which corresponds very closely with the relative molecular mass of the purified protein (15,500) determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The N-terminal amino acid sequence of the purified neutral proteinase was determined, and the DNA encoding this sequence was found to be located within the sequenced DNA. The deduced amino acid sequence contains a conserved zinc binding site, although secondary ligand binding and active sites typical of thermolysinlike metalloproteinases are absent. The combination of its small size, deduced amino acid sequence, and substrate and inhibition profile indicate that snpA encodes a novel neutral proteinase. Images PMID:1569011
Genomic organization of the neurofibromatosis 1 gene (NF1)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li, Y.; O`Connell, P.; Huntsman Breidenbach, H.
Neurofibromatosis 1 maps to chromosome band 17q11.2, and the NF1 locus has been partially characterized. Even though the full-length NF1 cDNA has been sequenced, the complete genomic structure of the NF1 gene has not been elucidated. The 5{prime} end of NF1 is embedded in a CpG island containing a NotI restriction site, and the remainder of the gene lies in the adjacent 350-kb NotI fragment. In our efforts to develop a comprehensive screen for NF1 mutations, we have isolated genomic DNA clones that together harbor the entire NF1 cDNA sequence. We have identified all intron-exon boundaries of the coding regionmore » and established that it is composed of 59 exons. Furthermore, we have defined the 3{prime}-untranslated region (3{prime}-UTR) of the NF1 gene; it spans approximately 3.5 kb of genomic DNA sequence and is continuous with the stop codon. Oligonucleotide primer pairs synthesized from exon-flanking DNA sequences were used in the polymerase chain reaction with cloned, chromosome 17-specific genomic DNA as template to amplify NF1 exons 1 through 27b and the exon containing the 3{prime}-UTR separately. This information should be useful for implementing a comprehensive NF1 mutation screen using genomic DNA as template. 41 refs., 3 figs., 2 tabs.« less
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin H; Giver, Lorraine J.
2000-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Recombination of polynucleotide sequences using random or defined primers
Arnold, Frances H.; Shao, Zhixin; Affholter, Joseph A.; Zhao, Huimin; Giver, Lorraine J.
2001-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Tooley, Paul W; Bandyopadhyay, Ranajit; Carras, Marie M; Pazoutová, Sylvie
2006-04-01
Isolates of Claviceps causing ergot on sorghum in India were analysed by AFLP analysis, and by analysis of DNA sequences of the EF-1alpha gene intron 4 and beta-tubulin gene intron 3 region. Of 89 isolates assayed from six states in India, four were determined to be C. sorghi, and the rest C. africana. A relatively low level of genetic diversity was observed within the Indian C. africana population. No evidence of genetic exchange between C. africana and C. sorghi was observed in either AFLP or DNA sequence analysis. Phylogenetic analysis was conducted using DNA sequences from 14 different Claviceps species. A multigene phylogeny based on the EF-1alpha gene intron 4, the beta-tubulin gene intron 3 region, and rDNA showed that C. sorghi grouped most closely with C. gigantea and C. africana. Although the Claviceps species we analysed were closely related, they colonize hosts that are taxonomically very distinct suggesting that there is no direct coevolution of Claviceps with its hosts.
Statistical properties of DNA sequences
NASA Technical Reports Server (NTRS)
Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.
1995-01-01
We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.
Mauchline, T H; Mohan, S; Davies, K G; Schaff, J E; Opperman, C H; Kerry, B R; Hirsch, P R
2010-05-01
To establish a reliable protocol to extract DNA from Pasteuria penetrans endospores for use as template in multiple strand amplification, thus providing sufficient material for genetic analyses. To develop a highly sensitive PCR-based diagnostic tool for P. penetrans. An optimized method to decontaminate endospores, release and purify DNA enabled multiple strand amplification. DNA purity was assessed by cloning and sequencing gyrB and 16S rRNA gene fragments obtained from PCR using generic primers. Samples indicated to be 100%P. penetrans by the gyrB assay were estimated at 46% using the 16S rRNA gene. No bias was detected on cloning and sequencing 12 housekeeping and sporulation gene fragments from amplified DNA. The detection limit by PCR with Pasteuria-specific 16S rRNA gene primers following multiple strand amplification of DNA extracted using the method was a single endospore. Generation of large quantities DNA will facilitate genomic sequencing of P. penetrans. Apparent differences in sample purity are explained by variations in 16S rRNA gene copy number in Eubacteria leading to exaggerated estimations of sample contamination. Detection of single endospores will facilitate investigations of P. penetrans molecular ecology. These methods will advance studies on P. penetrans and facilitate research on other obligate and fastidious micro-organisms where it is currently impractical to obtain DNA in sufficient quantity and quality.
Chigira, M; Watanabe, H
1994-07-01
Preservation of the identity of DNA is the ultimate goal of multicellular organisms. An abnormal DNA sequence in cells within an individual means its parasitic nature in cell society as shown in tumors. Somatic gene arrangement and gene mutation in development may be considered as de novo formation of parasites. It is likely that the developmental process with genetic alterations means symbiosis between altered cells and germ line cells preserving genetic information without alterations, when somatic alteration of DNA sequence is a major mechanism of differentiation. According to the selfish gene theory of Dawkins, germ line cells permit symbiosis when somatic cell society derives clear profit for the replication of original DNA copies.
Advances in DNA sequencing technologies for high resolution HLA typing.
Cereb, Nezih; Kim, Hwa Ran; Ryu, Jaejun; Yang, Soo Young
2015-12-01
This communication describes our experience in large-scale G group-level high resolution HLA typing using three different DNA sequencing platforms - ABI 3730 xl, Illumina MiSeq and PacBio RS II. Recent advances in DNA sequencing technologies, so-called next generation sequencing (NGS), have brought breakthroughs in deciphering the genetic information in all living species at a large scale and at an affordable level. The NGS DNA indexing system allows sequencing multiple genes for large number of individuals in a single run. Our laboratory has adopted and used these technologies for HLA molecular testing services. We found that each sequencing technology has its own strengths and weaknesses, and their sequencing performances complement each other. HLA genes are highly complex and genotyping them is quite challenging. Using these three sequencing platforms, we were able to meet all requirements for G group-level high resolution and high volume HLA typing. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1997-01-07
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.
Diagnostic method employing MSH2 protein
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1998-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1997-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Kang, Seokha; Sultana, Tahera; Eom, Keeseon S; Park, Yung Chul; Soonthornpong, Nathan; Nadler, Steven A; Park, Joong-Ki
2009-01-15
The complete mitochondrial genome sequence was determined for the human pinworm Enterobius vermicularis (Oxyurida: Nematoda) and used to infer its phylogenetic relationship to other major groups of chromadorean nematodes. The E. vermicularis genome is a 14,010-bp circular DNA molecule that encodes 36 genes (12 proteins, 22 tRNAs, and 2 rRNAs). This mtDNA genome lacks atp8, as reported for almost all other nematode species investigated. Phylogenetic analyses (maximum parsimony, maximum likelihood, neighbor joining, and Bayesian inference) of nucleotide sequences for the 12 protein-coding genes of 25 nematode species placed E. vermicularis, a representative of the order Oxyurida, as sister to the main Ascaridida+Rhabditida group. Tree topology comparisons using statistical tests rejected an alternative hypothesis favoring a closer relationship among Ascaridida, Spirurida, and Oxyurida, which has been supported from most studies based on nuclear ribosomal DNA sequences. Unlike the relatively conserved gene arrangement found for most chromadorean taxa, E. vermicularis mtDNA gene order is very unique, not sharing similarity to any other nematode species reported to date. This lack of gene order similarity may represent idiosyncratic gene rearrangements unique to this specific lineage of the oxyurids. To more fully understand the extent of gene rearrangement and its evolutionary significance within the nematode phylogenetic framework, additional mitochondrial genomes representing a greater evolutionary diversity of species must be characterized.
APPLICATION OF DNA MICROARRAYS TO REPRODUCTIVE TOXICOLOGY AND THE DEVELOPMENT OF A TESTIS ARRAY
With the advent of sequence information for entire mammalian genomes, it is now possible to analyze gene expression and gene polymorphisms on a genomic scale. The primary tool for analysis of gene expression is the DNA microarray. We have used commercially available cDNA micro...
Owa, Chie; Poulin, Matthew; Yan, Liying; Shioda, Toshi
2018-01-01
The existence of cytosine methylation in mammalian mitochondrial DNA (mtDNA) is a controversial subject. Because detection of DNA methylation depends on resistance of 5'-modified cytosines to bisulfite-catalyzed conversion to uracil, examined parameters that affect technical adequacy of mtDNA methylation analysis. Negative control amplicons (NCAs) devoid of cytosine methylation were amplified to cover the entire human or mouse mtDNA by long-range PCR. When the pyrosequencing template amplicons were gel-purified after bisulfite conversion, bisulfite pyrosequencing of NCAs did not detect significant levels of bisulfite-resistant cytosines (brCs) at ND1 (7 CpG sites) or CYTB (8 CpG sites) genes (CI95 = 0%-0.94%); without gel-purification, significant false-positive brCs were detected from NCAs (CI95 = 4.2%-6.8%). Bisulfite pyrosequencing of highly purified, linearized mtDNA isolated from human iPS cells or mouse liver detected significant brCs (~30%) in human ND1 gene when the sequencing primer was not selective in bisulfite-converted and unconverted templates. However, repeated experiments using a sequencing primer selective in bisulfite-converted templates almost completely (< 0.8%) suppressed brC detection, supporting the false-positive nature of brCs detected using the non-selective primer. Bisulfite-seq deep sequencing of linearized, gel-purified human mtDNA detected 9.4%-14.8% brCs for 9 CpG sites in ND1 gene. However, because all these brCs were associated with adjacent non-CpG brCs showing the same degrees of bisulfite resistance, DNA methylation in this mtDNA-encoded gene was not confirmed. Without linearization, data generated by bisulfite pyrosequencing or deep sequencing of purified mtDNA templates did not pass the quality control criteria. Shotgun bisulfite sequencing of human mtDNA detected extremely low levels of CpG methylation (<0.65%) over non-CpG methylation (<0.55%). Taken together, our study demonstrates that adequacy of mtDNA methylation analysis using methods dependent on bisulfite conversion needs to be established for each experiment, taking effects of incomplete bisulfite conversion and template impurity or topology into consideration.
van Koningsbruggen, Silvana; Gierliński, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J.; Ariyurek, Yavuz; den Dunnen, Johan T.
2010-01-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope. PMID:20826608
van Koningsbruggen, Silvana; Gierlinski, Marek; Schofield, Pietá; Martin, David; Barton, Geoffey J; Ariyurek, Yavuz; den Dunnen, Johan T; Lamond, Angus I
2010-11-01
The nuclear space is mostly occupied by chromosome territories and nuclear bodies. Although this organization of chromosomes affects gene function, relatively little is known about the role of nuclear bodies in the organization of chromosomal regions. The nucleolus is the best-studied subnuclear structure and forms around the rRNA repeat gene clusters on the acrocentric chromosomes. In addition to rDNA, other chromatin sequences also surround the nucleolar surface and may even loop into the nucleolus. These additional nucleolar-associated domains (NADs) have not been well characterized. We present here a whole-genome, high-resolution analysis of chromatin endogenously associated with nucleoli. We have used a combination of three complementary approaches, namely fluorescence comparative genome hybridization, high-throughput deep DNA sequencing and photoactivation combined with time-lapse fluorescence microscopy. The data show that specific sequences from most human chromosomes, in addition to the rDNA repeat units, associate with nucleoli in a reproducible and heritable manner. NADs have in common a high density of AT-rich sequence elements, low gene density and a statistically significant enrichment in transcriptionally repressed genes. Unexpectedly, both the direct DNA sequencing and fluorescence photoactivation data show that certain chromatin loci can specifically associate with either the nucleolus, or the nuclear envelope.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kamb, A.; Weir, M.; Rudy, B.
1989-06-01
The study of gene family members has been aided by the isolation of related genes on the basis of DNA homology. The authors have adapted the polymerase chain reaction to screen animal genomes very rapidly and reliably for likely gene family members. Using conserved amino acid sequences to design degenerate oligonucleotide primers, they have shown that the genome of the nematode Caenorhabditis elegans contains sequences homologous to many Drosophila genes involved in pattern formation, including the segment polarity gene wingless (vertebrate int-1), and homeobox sequences characteristic of the Antennapedia, engrailed, and paired families. In addition, they have used this methodmore » to show that C. elegans contains at least five different sequences homologous to genes in the tyrosine kinase family. Lastly, they have isolated six potassium channel sequences from humans, a result that validates the utility of the method with large genomes and suggests that human potassium channel gene diversity may be extensive.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geraghty, M.T.; Stetten, G.; Kearns, W.
1994-09-01
X-linked adrenoleukodystrophy (ALD) is a disorder of peroxisomal {beta}-oxidation of very long chain fatty acids. It presents either as progressive dementia in childhood or as progressive paraparesis in later years. Adrenal insufficiency occurs in both phenotypes. The gene of the ALD protein has been mapped to Xq28 and has recently been cloned and characterized. The ALD protein has significant homology to the peroxisomal membrane protein, PMP70 and belongs to the ATP binding cassette superfamily of transporters. We screened a human genomic library with an ALDP cDNA and isolated 5 different but highly similar clones containing sequences corresponding to the 3{prime}more » end of the ALDP gene. Comparison of the sequences over the region corresponding to exon 9 through the 3{prime} end of the ALDP gene reveals {approximately}96% nucleotide identity in both exonic and intronic regions. Splice sites and open reading frames are maintained. Using both FISH and human-rodent DNA mapping panels, we positively assign these ALDP-related sequences to chromosomes 2, 16 and 22, and provisionally to 1 and 20. Southern blot of primate DNA probed with a partial ALDP cDNA (exon 2-10) shows that expansion of ALDP-related sequences occurred in higher primates (chimp, gorilla and human). Although Northern blots show multiple ALDP-hybridizing transcripts in certain tissues, we have no evidence to date for expression of these ALDP-related sequences. In conclusion, our data show there has been an unusual and recent dispersal to multiple chromosomes of structural gene sequences related to the ALDP gene. The functional significance of these sequences remains to be determined but their existence complicates PCR and mutation analysis of the ALDP gene.« less
van Keulen, H; Campbell, S R; Erlandsen, S L; Jarroll, E L
1991-06-01
In an attempt to study Giardia at the DNA sequence level, the rRNA genes of three species, Giardia duodenalis, Giardia ardeae and Giardia muris were cloned and restriction enzyme maps were constructed. The rDNA repeats of these Giardia show completely different restriction enzyme recognition patterns. The size of the rDNA repeat ranges from approximately 5.6 kb in G. duodenalis to 7.6 kb in both G. muris and G. ardeae. These size differences are mainly attributable to the variation in length of the spacer. Minor differences exist among these Giardia in the sizes of their small subunit rRNA and the internal transcribed spacer between small and large subunit rRNA. The genetic maps were constructed by sequence analysis of the DNA around the 5' and 3' ends of the mature rRNA genes and between the rRNA covering the 5.8S rRNA gene and internal transcribed spacer. Comparison of the 5.8S rDNA and 3' end of large subunit rDNA from these three Giardia species showed considerable sequence variation, but the rDNA sequences of G. duodenalis and G. ardeae appear more closely related to each other than to G. muris.
Campo, Daniel; García-Vázquez, Eva
2012-01-01
The 5S rDNA is organized in the genome as tandemly repeated copies of a structural unit composed of a coding sequence plus a nontranscribed spacer (NTS). The coding region is highly conserved in the evolution, whereas the NTS vary in both length and sequence. It has been proposed that 5S rRNA genes are members of a gene family that have arisen through concerted evolution. In this study, we describe the molecular organization and evolution of the 5S rDNA in the genera Lepidorhombus and Scophthalmus (Scophthalmidae) and compared it with already known 5S rDNA of the very different genera Merluccius (Merluccidae) and Salmo (Salmoninae), to identify common structural elements or patterns for understanding 5S rDNA evolution in fish. High intra- and interspecific diversity within the 5S rDNA family in all the genera can be explained by a combination of duplications, deletions, and transposition events. Sequence blocks with high similarity in all the 5S rDNA members across species were identified for the four studied genera, with evidences of intense gene conversion within noncoding regions. We propose a model to explain the evolution of the 5S rDNA, in which the evolutionary units are blocks of nucleotides rather than the entire sequences or single nucleotides. This model implies a "two-speed" evolution: slow within blocks (homogenized by recombination) and fast within the gene family (diversified by duplications and deletions).
Shen, K A; Meyers, B C; Islam-Faridi, M N; Chin, D B; Stelly, D M; Michelmore, R W
1998-08-01
The recent cloning of genes for resistance against diverse pathogens from a variety of plants has revealed that many share conserved sequence motifs. This provides the possibility of isolating numerous additional resistance genes by polymerase chain reaction (PCR) with degenerate oligonucleotide primers. We amplified resistance gene candidates (RGCs) from lettuce with multiple combinations of primers with low degeneracy designed from motifs in the nucleotide binding sites (NBSs) of RPS2 of Arabidopsis thaliana and N of tobacco. Genomic DNA, cDNA, and bacterial artificial chromosome (BAC) clones were successfully used as templates. Four families of sequences were identified that had the same similarity to each other as to resistance genes from other species. The relationship of the amplified products to resistance genes was evaluated by several sequence and genetic criteria. The amplified products contained open reading frames with additional sequences characteristic of NBSs. Hybridization of RGCs to genomic DNA and to BAC clones revealed large numbers of related sequences. Genetic analysis demonstrated the existence of clustered multigene families for each of the four RGC sequences. This parallels classical genetic data on clustering of disease resistance genes. Two of the four families mapped to known clusters of resistance genes; these two families were therefore studied in greater detail. Additional evidence that these RGCs could be resistance genes was gained by the identification of leucine-rich repeat (LRR) regions in sequences adjoining the NBS similar to those in RPM1 and RPS2 of A. thaliana. Fluorescent in situ hybridization confirmed the clustered genomic distribution of these sequences. The use of PCR with degenerate oligonucleotide primers is therefore an efficient method to identify numerous RGCs in plants.
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved
Long, Hannah K.; King, Hamish W.; Patient, Roger K.; Odom, Duncan T.; Klose, Robert J.
2016-01-01
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. PMID:27084945
Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J
2007-06-01
As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.
The complete mitochondrial genome sequence of Eimeria magna (Apicomplexa: Coccidia).
Tian, Si-Qin; Cui, Ping; Fang, Su-Fang; Liu, Guo-Hua; Wang, Chun-Ren; Zhu, Xing-Quan
2015-01-01
In the present study, we determined the complete mitochondrial DNA (mtDNA) sequence of Eimeria magna from rabbits for the first time, and compared its gene contents and genome organizations with that of seven Eimeria spp. from domestic chickens. The size of the complete mt genome sequence of E. magna is 6249 bp, which consists of 3 protein-coding genes (cytb, cox1 and cox3), 12 gene fragments for the large subunit (LSU) rRNA, and 7 gene fragments for the small subunit (SSU) rRNA, without transfer RNA genes, in accordance with that of Eimeria spp. from chickens. The putative direction of translation for three genes (cytb, cox1 and cox3) was the same as those of Eimeria species from domestic chickens. The content of A + T is 65.16% for E. magna mt genome (29.73% A, 35.43% T, 17.09 G and 17.75% C). The E. magna mt genome sequence provides novel mtDNA markers for studying the molecular epidemiology and population genetics of Eimeria spp. and has implications for the molecular diagnosis and control of rabbit coccidiosis.
Sequence heterogeneity in the two 16S rRNA genes of Phormium yellow leaf phytoplasma.
Liefting, L W; Andersen, M T; Beever, R E; Gardner, R C; Forster, R L
1996-01-01
Phormium yellow leaf (PYL) phytoplasma causes a lethal disease of the monocotyledon, New Zealand flax (Phormium tenax). The 16S rRNA genes of PYL phytoplasma were amplified from infected flax by PCR and cloned, and the nucleotide sequences were determined. DNA sequencing and Southern hybridization analysis of genomic DNA indicated the presence of two copies of the 16S rRNA gene. The two 16S rRNA genes exhibited sequence heterogeneity in 4 nucleotide positions and could be distinguished by the restriction enzymes BpmI and BsrI. This is the first record in which sequence heterogeneity in the 16S rRNA genes of a phytoplasma has been determined by sequence analysis. A phylogenetic tree based on 16S rRNA gene sequences showed that PYL phytoplasma is most closely related to the stolbur and German grapevine yellows phytoplasmas, which form the stolbur subgroup of the aster yellows group. This phylogenetic position of PYL phytoplasma was supported by 16S/23S spacer region sequence data. PMID:8795200
Packaging of Dinoroseobacter shibae DNA into Gene Transfer Agent Particles Is Not Random.
Tomasch, Jürgen; Wang, Hui; Hall, April T K; Patzelt, Diana; Preusse, Matthias; Petersen, Jörn; Brinkmann, Henner; Bunk, Boyke; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; Lang, Andrew S; Wagner-Döbler, Irene
2018-01-01
Gene transfer agents (GTAs) are phage-like particles which contain a fragment of genomic DNA of the bacterial or archaeal producer and deliver this to a recipient cell. GTA gene clusters are present in the genomes of almost all marine Rhodobacteraceae (Roseobacters) and might be important contributors to horizontal gene transfer in the world's oceans. For all organisms studied so far, no obvious evidence of sequence specificity or other nonrandom process responsible for packaging genomic DNA into GTAs has been found. Here, we show that knock-out of an autoinducer synthase gene of Dinoroseobacter shibae resulted in overproduction and release of functional GTA particles (DsGTA). Next-generation sequencing of the 4.2-kb DNA fragments isolated from DsGTAs revealed that packaging was not random. DNA from low-GC conjugative plasmids but not from high-GC chromids was excluded from packaging. Seven chromosomal regions were strongly overrepresented in DNA isolated from DsGTA. These packaging peaks lacked identifiable conserved sequence motifs that might represent recognition sites for the GTA terminase complex. Low-GC regions of the chromosome, including the origin and terminus of replication, were underrepresented in DNA isolated from DsGTAs. DNA methylation reduced packaging frequency while the level of gene expression had no influence. Chromosomal regions found to be over- and underrepresented in DsGTA-DNA were regularly spaced. We propose that a "headful" type of packaging is initiated at the sites of coverage peaks and, after linearization of the chromosomal DNA, proceeds in both directions from the initiation site. GC-content, DNA-modifications, and chromatin structure might influence at which sides GTA packaging can be initiated. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Packaging of Dinoroseobacter shibae DNA into Gene Transfer Agent Particles Is Not Random
Wang, Hui; Hall, April T K; Patzelt, Diana; Preusse, Matthias; Petersen, Jörn; Brinkmann, Henner; Bunk, Boyke; Bhuju, Sabin; Jarek, Michael; Geffers, Robert; Lang, Andrew S; Wagner-Döbler, Irene
2018-01-01
Abstract Gene transfer agents (GTAs) are phage-like particles which contain a fragment of genomic DNA of the bacterial or archaeal producer and deliver this to a recipient cell. GTA gene clusters are present in the genomes of almost all marine Rhodobacteraceae (Roseobacters) and might be important contributors to horizontal gene transfer in the world’s oceans. For all organisms studied so far, no obvious evidence of sequence specificity or other nonrandom process responsible for packaging genomic DNA into GTAs has been found. Here, we show that knock-out of an autoinducer synthase gene of Dinoroseobacter shibae resulted in overproduction and release of functional GTA particles (DsGTA). Next-generation sequencing of the 4.2-kb DNA fragments isolated from DsGTAs revealed that packaging was not random. DNA from low-GC conjugative plasmids but not from high-GC chromids was excluded from packaging. Seven chromosomal regions were strongly overrepresented in DNA isolated from DsGTA. These packaging peaks lacked identifiable conserved sequence motifs that might represent recognition sites for the GTA terminase complex. Low-GC regions of the chromosome, including the origin and terminus of replication, were underrepresented in DNA isolated from DsGTAs. DNA methylation reduced packaging frequency while the level of gene expression had no influence. Chromosomal regions found to be over- and underrepresented in DsGTA-DNA were regularly spaced. We propose that a “headful” type of packaging is initiated at the sites of coverage peaks and, after linearization of the chromosomal DNA, proceeds in both directions from the initiation site. GC-content, DNA-modifications, and chromatin structure might influence at which sides GTA packaging can be initiated. PMID:29325123
Tian, Wenzhi; Chua, Kevin; Strober, Warren; Chu, Charles C.
2002-01-01
BACKGROUND: Identification of differentially expressed genes between normal and diseased states is an area of intense current medical research that can lead to the discovery of new therapeutic targets. However, isolation of differentially expressed genes by subtraction often suffers from unreported contamination of the resulting subtraction library with clones containing DNA sequences not from the original RNA samples. MATERIALS AND METHODS: Subtraction using cDNA representational difference analysis (RDA) was performed on human B cells from normal or common variable immunodeficiency patients. The material remaining after the subtraction was cloned and individual clones were sequenced. The sequence of one clone with similarity to integrases (ILG1, integrase-like gene-1) was used to obtain the full length cDNA sequence and as a probe for the presence of this sequence in RNA or genomic DNA samples. RESULTS: After five rounds of cDNA RDA, 23.3% of the clones from the resulting subtraction library contained Escherichia coli DNA. In addition, three clones contained the sequence of a new integrase, ILG1. The full length cDNA sequence of ILG1 exhibits prokaryotic, but not eukaryotic, features. At the DNA level, ILG1 is not similar to any known gene. At the protein level, ILG1 has 58% similarity to integrases from the cryptic P4 bacteriophage family (S clade). The catalytic domain of ILG1 contains the conserved features found in site-specific recombinases. The critical residues that form the catalytic active site pocket are conserved, including the highly conserved R-H-R-Y hallmark of these recombinases. Interestingly, ILG1 was not present in the original B cell populations. By probing genomic DNA, ILG1 could only be detected in the E. coli TOP10F' strain used in our laboratory for molecular cloning, but not in any of its precursor strains, including TOP10. Furthermore, bacteria cultured from the mouth of the laboratory worker who performed cDNA RDA were also positive for ILG1. CONCLUSIONS: In the course of our studies using cDNA RDA, we have isolated and identified ILG1, a likely active site-specific recombinase and new member of the bacteriophage P4 family of integrases. This family of integrases is implicated in the horizontal DNA transfer of pathogenic genes between bacterial species, such as those found in pathogenic strains of E. coli, Shigella, Yersinia, and Vibrio cholera. Using ILG1 as a marker of our laboratory E. coli strain TOP10F', our evidence suggests that contaminating bacterial DNA in our subtraction experiment is due to this laboratory bacterial strain, which colonized exposed surfaces of the laboratory worker. Thus, identification of differentially expressed genes between normal and diseased states could be dramatically improved by using extra precaution to prevent bacterial contamination of samples. PMID:12393938
New progress in snake mitochondrial gene rearrangement.
Chen, Nian; Zhao, Shujin
2009-08-01
To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.
Yohda, Masafumi; Yagi, Osami; Takechi, Ayane; Kitajima, Mizuki; Matsuda, Hisashi; Miyamura, Naoaki; Aizawa, Tomoko; Nakajima, Mutsuyasu; Sunairi, Michio; Daiba, Akito; Miyajima, Takashi; Teruya, Morimi; Teruya, Kuniko; Shiroma, Akino; Shimoji, Makiko; Tamotsu, Hinako; Juan, Ayaka; Nakano, Kazuma; Aoyama, Misako; Terabayashi, Yasunobu; Satou, Kazuhito; Hirano, Takashi
2015-07-01
A Dehalococcoides-containing bacterial consortium that performed dechlorination of 0.20 mM cis-1,2-dichloroethene to ethene in 14 days was obtained from the sediment mud of the lotus field. To obtain detailed information of the consortium, the metagenome was analyzed using the short-read next-generation sequencer SOLiD 3. Matching the obtained sequence tags with the reference genome sequences indicated that the Dehalococcoides sp. in the consortium was highly homologous to Dehalococcoides mccartyi CBDB1 and BAV1. Sequence comparison with the reference sequence constructed from 16S rRNA gene sequences in a public database showed the presence of Sedimentibacter, Sulfurospirillum, Clostridium, Desulfovibrio, Parabacteroides, Alistipes, Eubacterium, Peptostreptococcus and Proteocatella in addition to Dehalococcoides sp. After further enrichment, the members of the consortium were narrowed down to almost three species. Finally, the full-length circular genome sequence of the Dehalococcoides sp. in the consortium, D. mccartyi IBARAKI, was determined by analyzing the metagenome with the single-molecule DNA sequencer PacBio RS. The accuracy of the sequence was confirmed by matching it to the tag sequences obtained by SOLiD 3. The genome is 1,451,062 nt and the number of CDS is 1566, which includes 3 rRNA genes and 47 tRNA genes. There exist twenty-eight RDase genes that are accompanied by the genes for anchor proteins. The genome exhibits significant sequence identity with other Dehalococcoides spp. throughout the genome, but there exists significant difference in the distribution RDase genes. The combination of a short-read next-generation DNA sequencer and a long-read single-molecule DNA sequencer gives detailed information of a bacterial consortium. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride
Matroudi, S.; Zamani, M.R.; Motallebi, M.
2008-01-01
In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242
Xie, Guosen; Mo, Zhongxi
2011-01-21
In this article, we introduce three 3D graphical representations of DNA primary sequences, which we call RY-curve, MK-curve and SW-curve, based on three classifications of the DNA bases. The advantages of our representations are that (i) these 3D curves are strictly non-degenerate and there is no loss of information when transferring a DNA sequence to its mathematical representation and (ii) the coordinates of every node on these 3D curves have clear biological implication. Two applications of these 3D curves are presented: (a) a simple formula is derived to calculate the content of the four bases (A, G, C and T) from the coordinates of nodes on the curves; and (b) a 12-component characteristic vector is constructed to compare similarity among DNA sequences from different species based on the geometrical centers of the 3D curves. As examples, we examine similarity among the coding sequences of the first exon of beta-globin gene from eleven species and validate similarity of cDNA sequences of beta-globin gene from eight species. Copyright © 2010 Elsevier Ltd. All rights reserved.
Effects of DNA Methylation and Chromatin State on Rates of Molecular Evolution in Insects.
Glastad, Karl M; Goodisman, Michael A D; Yi, Soojin V; Hunt, Brendan G
2015-12-04
Epigenetic information is widely appreciated for its role in gene regulation in eukaryotic organisms. However, epigenetic information can also influence genome evolution. Here, we investigate the effects of epigenetic information on gene sequence evolution in two disparate insects: the fly Drosophila melanogaster, which lacks substantial DNA methylation, and the ant Camponotus floridanus, which possesses a functional DNA methylation system. We found that DNA methylation was positively correlated with the synonymous substitution rate in C. floridanus, suggesting a key effect of DNA methylation on patterns of gene evolution. However, our data suggest the link between DNA methylation and elevated rates of synonymous substitution was explained, in large part, by the targeting of DNA methylation to genes with signatures of transcriptionally active chromatin, rather than the mutational effect of DNA methylation itself. This phenomenon may be explained by an elevated mutation rate for genes residing in transcriptionally active chromatin, or by increased structural constraints on genes in inactive chromatin. This result highlights the importance of chromatin structure as the primary epigenetic driver of genome evolution in insects. Overall, our study demonstrates how different epigenetic systems contribute to variation in the rates of coding sequence evolution. Copyright © 2016 Glastad et al.
Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108
Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang
1999-01-01
A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...
Kirby, Ralph; Herron, Paul; Hoskisson, Paul
2011-02-01
Based on available genome sequences, Actinomycetales show significant gene synteny across a wide range of species and genera. In addition, many genera show varying degrees of complex morphological development. Using the presence of gene synteny as a basis, it is clear that an analysis of gene conservation across the Streptomyces and various other Actinomycetales will provide information on both the importance of genes and gene clusters and the evolution of morphogenesis in these bacteria. Genome sequencing, although becoming cheaper, is still relatively expensive for comparing large numbers of strains. Thus, a heterologous DNA/DNA microarray hybridization dataset based on a Streptomyces coelicolor microarray allows a cheaper and greater depth of analysis of gene conservation. This study, using both bioinformatical and microarray approaches, was able to classify genes previously identified as involved in morphogenesis in Streptomyces into various subgroups in terms of conservation across species and genera. This will allow the targeting of genes for further study based on their importance at the species level and at higher evolutionary levels.
Cytochrome oxidase subunit II gene in mitochondria of Oenothera has no intron
Hiesel, Rudolf; Brennicke, Axel
1983-01-01
The cytochrome oxidase subunit II gene has been localized in the mitochondrial genome of Oenothera berteriana and the nucleotide sequence has been determined. The coding sequence contains 777 bp and, unlike the corresponding gene in Zea mays, is not interrupted by an intron. No TGA codon is found within the open reading frame. The codon CGG, as in the maize gene, is used in place of tryptophan codons of corresponding genes in other organisms. At position 742 in the Oenothera sequence the TGG of maize is changed into a CGG codon, where Trp is conserved as the amino acid in other organisms. Homologous sequences occur more than once in the mitochondrial genome as several mitochondrial DNA species hybridize with DNA probes of the cytochrome oxidase subunit II gene. ImagesFig. 5. PMID:16453484
Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.
2016-01-01
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769
Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko
2005-01-01
PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.
Bueno, Danilo; Palacios-Gimenez, Octavio Manuel; Martí, Dardo Andrea; Mariguela, Tatiane Casagrande; Cabral-de-Mello, Diogo Cavalcanti
2016-08-01
The 5S ribosomal DNA (rDNA) sequences are subject of dynamic evolution at chromosomal and molecular levels, evolving through concerted and/or birth-and-death fashion. Among grasshoppers, the chromosomal location for this sequence was established for some species, but little molecular information was obtained to infer evolutionary patterns. Here, we integrated data from chromosomal and nucleotide sequence analysis for 5S rDNA in two Abracris species aiming to identify evolutionary dynamics. For both species, two arrays were identified, a larger sequence (named type-I) that consisted of the entire 5S rDNA gene plus NTS (non-transcribed spacer) and a smaller (named type-II) with truncated 5S rDNA gene plus short NTS that was considered a pseudogene. For type-I sequences, the gene corresponding region contained the internal control region and poly-T motif and the NTS presented partial transposable elements. Between the species, nucleotide differences for type-I were noticed, while type-II was identical, suggesting pseudogenization in a common ancestor. At chromosomal point to view, the type-II was placed in one bivalent, while type-I occurred in multiple copies in distinct chromosomes. In Abracris, the evolution of 5S rDNA was apparently influenced by the chromosomal distribution of clusters (single or multiple location), resulting in a mixed mechanism integrating concerted and birth-and-death evolution depending on the unit.
Li, Zibo; Guo, Xinwu; Tang, Lili; Peng, Limin; Chen, Ming; Luo, Xipeng; Wang, Shouman; Xiao, Zhi; Deng, Zhongping; Dai, Lizhong; Xia, Kun; Wang, Jun
2016-10-01
Circulating cell-free DNA (cfDNA) has been considered as a potential biomarker for non-invasive cancer detection. To evaluate the methylation levels of six candidate genes (EGFR, GREM1, PDGFRB, PPM1E, SOX17, and WRN) in plasma cfDNA as biomarkers for breast cancer early detection, quantitative analysis of the promoter methylation of these genes from 86 breast cancer patients and 67 healthy controls was performed by using microfluidic-PCR-based target enrichment and next-generation bisulfite sequencing technology. The predictive performance of different logistic models based on methylation status of candidate genes was investigated by means of the area under the ROC curve (AUC) and odds ratio (OR) analysis. Results revealed that EGFR, PPM1E, and 8 gene-specific CpG sites showed significantly hypermethylation in cancer patients' plasma and significantly associated with breast cancer (OR ranging from 2.51 to 9.88). The AUC values for these biomarkers were ranging from 0.66 to 0.75. Combinations of multiple hypermethylated genes or CpG sites substantially improved the predictive performance for breast cancer detection. Our study demonstrated the feasibility of quantitative measurement of candidate gene methylation in cfDNA by using microfluidic-PCR-based target enrichment and bisulfite next-generation sequencing, which is worthy of further validation and potentially benefits a broad range of applications in clinical oncology practice. Quantitative analysis of methylation pattern of plasma cfDNA by next-generation sequencing might be a valuable non-invasive tool for early detection of breast cancer.
Detection of DNA Methylation by Whole-Genome Bisulfite Sequencing.
Li, Qing; Hermanson, Peter J; Springer, Nathan M
2018-01-01
DNA methylation plays an important role in the regulation of the expression of transposons and genes. Various methods have been developed to assay DNA methylation levels. Bisulfite sequencing is considered to be the "gold standard" for single-base resolution measurement of DNA methylation levels. Coupled with next-generation sequencing, whole-genome bisulfite sequencing (WGBS) allows DNA methylation to be evaluated at a genome-wide scale. Here, we described a protocol for WGBS in plant species with large genomes. This protocol has been successfully applied to assay genome-wide DNA methylation levels in maize and barley. This protocol has also been successfully coupled with sequence capture technology to assay DNA methylation levels in a targeted set of genomic regions.
Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed
2013-01-01
Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers. PMID:23637766
Beaudet, Denis; Nadimi, Maryam; Iffis, Bachir; Hijri, Mohamed
2013-01-01
Arbuscular mycorrhizal fungi (AMF) are common and important plant symbionts. They have coenocytic hyphae and form multinucleated spores. The nuclear genome of AMF is polymorphic and its organization is not well understood, which makes the development of reliable molecular markers challenging. In stark contrast, their mitochondrial genome (mtDNA) is homogeneous. To assess the intra- and inter-specific mitochondrial variability in closely related Glomus species, we performed 454 sequencing on total genomic DNA of Glomus sp. isolate DAOM-229456 and we compared its mtDNA with two G. irregulare isolates. We found that the mtDNA of Glomus sp. is homogeneous, identical in gene order and, with respect to the sequences of coding regions, almost identical to G. irregulare. However, certain genomic regions vary substantially, due to insertions/deletions of elements such as introns, mitochondrial plasmid-like DNA polymerase genes and mobile open reading frames. We found no evidence of mitochondrial or cytoplasmic plasmids in Glomus species, and mobile ORFs in Glomus are responsible for the formation of four gene hybrids in atp6, atp9, cox2, and nad3, which are most probably the result of horizontal gene transfer and are expressed at the mRNA level. We found evidence for substantial sequence variation in defined regions of mtDNA, even among closely related isolates with otherwise identical coding gene sequences. This variation makes it possible to design reliable intra- and inter-specific markers.
Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo
2003-01-01
To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979
Diagnostic method employing MSH2 nucleic acids
de la Chapelle, Albert; Vogelstein, Bert; Kinzler, Kenneth W.
1997-01-01
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error.sup.+ (RER.sup.+) tumor cells.
Diagnostic method employing MSH2 nucleic acids
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1997-12-02
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +}(RER{sup +}) tumor cells. 19 figs.
Diagnostic method employing MSH2 protein
Chapelle, A. de la; Vogelstein, B.; Kinzler, K.W.
1998-11-17
The human MSH2 gene, responsible for hereditary non-polyposis colorectal cancer, was identified by virtue of its homology to the MutS class of genes, which are involved in DNA mismatch repair. The sequence of cDNA clones of the human gene are provided, and the sequence of the gene can be used to demonstrate the existence of germ line mutations in hereditary non-polyposis colorectal cancer (HNPCC) kindreds, as well as in replication error{sup +} (RER{sup +}) tumor cells. 19 figs.
Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke
1994-12-01
The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less
Global DNA methylation analysis using methyl-sensitive amplification polymorphism (MSAP).
Yaish, Mahmoud W; Peng, Mingsheng; Rothstein, Steven J
2014-01-01
DNA methylation is a crucial epigenetic process which helps control gene transcription activity in eukaryotes. Information regarding the methylation status of a regulatory sequence of a particular gene provides important knowledge of this transcriptional control. DNA methylation can be detected using several methods, including sodium bisulfite sequencing and restriction digestion using methylation-sensitive endonucleases. Methyl-Sensitive Amplification Polymorphism (MSAP) is a technique used to study the global DNA methylation status of an organism and hence to distinguish between two individuals based on the DNA methylation status determined by the differential digestion pattern. Therefore, this technique is a useful method for DNA methylation mapping and positional cloning of differentially methylated genes. In this technique, genomic DNA is first digested with a methylation-sensitive restriction enzyme such as HpaII, and then the DNA fragments are ligated to adaptors in order to facilitate their amplification. Digestion using a methylation-insensitive isoschizomer of HpaII, MspI is used in a parallel digestion reaction as a loading control in the experiment. Subsequently, these fragments are selectively amplified by fluorescently labeled primers. PCR products from different individuals are compared, and once an interesting polymorphic locus is recognized, the desired DNA fragment can be isolated from a denaturing polyacrylamide gel, sequenced and identified based on DNA sequence similarity to other sequences available in the database. We will use analysis of met1, ddm1, and atmbd9 mutants and wild-type plants treated with a cytidine analogue, 5-azaC, or zebularine to demonstrate how to assess the genetic modulation of DNA methylation in Arabidopsis. It should be noted that despite the fact that MSAP is a reliable technique used to fish for polymorphic methylated loci, its power is limited to the restriction recognition sites of the enzymes used in the genomic DNA digestion.
2011-01-01
Background Transcriptome sequencing data has become an integral component of modern genetics, genomics and evolutionary biology. However, despite advances in the technologies of DNA sequencing, such data are lacking for many groups of living organisms, in particular, many plant taxa. We present here the results of transcriptome sequencing for two closely related plant species. These species, Fagopyrum esculentum and F. tataricum, belong to the order Caryophyllales - a large group of flowering plants with uncertain evolutionary relationships. F. esculentum (common buckwheat) is also an important food crop. Despite these practical and evolutionary considerations Fagopyrum species have not been the subject of large-scale sequencing projects. Results Normalized cDNA corresponding to genes expressed in flowers and inflorescences of F. esculentum and F. tataricum was sequenced using the 454 pyrosequencing technology. This resulted in 267 (for F. esculentum) and 229 (F. tataricum) thousands of reads with average length of 341-349 nucleotides. De novo assembly of the reads produced about 25 thousands of contigs for each species, with 7.5-8.2× coverage. Comparative analysis of two transcriptomes demonstrated their overall similarity but also revealed genes that are presumably differentially expressed. Among them are retrotransposon genes and genes involved in sugar biosynthesis and metabolism. Thirteen single-copy genes were used for phylogenetic analysis; the resulting trees are largely consistent with those inferred from multigenic plastid datasets. The sister relationships of the Caryophyllales and asterids now gained high support from nuclear gene sequences. Conclusions 454 transcriptome sequencing and de novo assembly was performed for two congeneric flowering plant species, F. esculentum and F. tataricum. As a result, a large set of cDNA sequences that represent orthologs of known plant genes as well as potential new genes was generated. PMID:21232141
In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library
Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul
2005-01-01
The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642
Asamizu, Erika; Nakamura, Yasukazu; Sato, Shusei; Tabata, Satoshi
2004-02-01
To perform a comprehensive analysis of genes expressed in a model legume, Lotus japonicus, a total of 74472 3'-end expressed sequence tags (EST) were generated from cDNA libraries produced from six different organs. Clustering of sequences was performed with an identity criterion of 95% for 50 bases, and a total of 20457 non-redundant sequences, 8503 contigs and 11954 singletons were generated. EST sequence coverage was analyzed by using the annotated L. japonicus genomic sequence and 1093 of the 1889 predicted protein-encoding genes (57.9%) were hit by the EST sequence(s). Gene content was compared to several plant species. Among the 8503 contigs, 471 were identified as sequences conserved only in leguminous species and these included several disease resistance-related genes. This suggested that in legumes, these genes may have evolved specifically to resist pathogen attack. The rate of gene sequence divergence was assessed by comparing similarity level and functional category based on the Gene Ontology (GO) annotation of Arabidopsis genes. This revealed that genes encoding ribosomal proteins, as well as those related to translation, photosynthesis, and cellular structure were more abundantly represented in the highly conserved class, and that genes encoding transcription factors and receptor protein kinases were abundantly represented in the less conserved class. To make the sequence information and the cDNA clones available to the research community, a Web database with useful services was created at http://www.kazusa.or.jp/en/plant/lotus/EST/.
Fluorescent in situ hybridisation to amphioxus chromosomes.
Castro, Luis Filipe Costa; Holland, Peter William Harold
2002-12-01
We describe an efficient protocol for mapping genes and other DNA sequences to amphioxus chromosomes using fluorescent in situ hybridisation. We apply this method to identify the number and location of ribosomal DNA gene clusters and telomere sequences in metaphase spreads of Branchiostoma floridae. We also describe how the locations of two single copy genes can be mapped relative to each other, and demonstrate this by mapping an amphioxus Pax gene relative to a homologue of the Notch gene. These methods have great potential for performing comparative genomics between amphioxus and vertebrates.
Zhang, Ruijie; Lv, Wenhua; Luan, Meiwei; Zheng, Jiajia; Shi, Miao; Zhu, Hongjie; Li, Jin; Lv, Hongchao; Zhang, Mingming; Shang, Zhenwei; Duan, Lian; Jiang, Yongshuai
2015-11-24
Different human genes often exhibit different degrees of stability in their DNA methylation levels between tissues, samples or cell types. This may be related to the evolution of human genome. Thus, we compared the evolutionary conservation between two types of genes: genes with stable DNA methylation levels (SM genes) and genes with fluctuant DNA methylation levels (FM genes). For long-term evolutionary characteristics between species, we compared the percentage of the orthologous genes, evolutionary rate dn/ds and protein sequence identity. We found that the SM genes had greater percentages of the orthologous genes, lower dn/ds, and higher protein sequence identities in all the 21 species. These results indicated that the SM genes were more evolutionarily conserved than the FM genes. For short-term evolutionary characteristics among human populations, we compared the single nucleotide polymorphism (SNP) density, and the linkage disequilibrium (LD) degree in HapMap populations and 1000 genomes project populations. We observed that the SM genes had lower SNP densities, and higher degrees of LD in all the 11 HapMap populations and 13 1000 genomes project populations. These results mean that the SM genes had more stable chromosome genetic structures, and were more conserved than the FM genes.
Batts, W.N.; Arakawa, C.K.; Bernard, J.; Winton, J.R.
1993-01-01
Biotinylated DNA probes were constructed to hybndize with speclfic sequences within the messenger RNA (mRNA) of the nucleoprotein (N) gene of vlral hemorrhagic septicemia virus (VHSV) reference strains from Europe (07-71) and North Arnenca (Makah) Probes were synthesized that were complementary to (1) a 29-nucleotide sequence near the center of the N gene conlmon to both the 07-71 and Makah reference strains of the virus (2) a unique 28- nucleotide sequence that followed the open readng frame of the Makah N gene mRNA most of which was absent In the 07-71 strain, and (3) a 22-nucleobde sequence wthin the 07-71 N gene that had 6 nllsmatches \
Anwar, R; Booth, A; Churchill, A J; Markham, A F
1996-01-01
The determination of nucleotide sequence is fundamental to the identification and molecular analysis of genes. Direct sequencing of PCR products is now becoming a commonplace procedure for haplotype analysis, and for defining mutations and polymorphism within genes, particularly for diagnostic purposes. A previously unrecognised phenomenon, primer related variability, observed in sequence data generated using Taq cycle sequencing and T7 Sequenase sequencing, is reported. This suggests that caution is necessary when interpreting DNA sequence data. This is particularly important in situations where treatment may be dependent on the accuracy of the molecular diagnosis. Images PMID:16696096
The genome sequence of sweet cherry (Prunus avium) for use in genomics-assisted breeding.
Shirasawa, Kenta; Isuzugawa, Kanji; Ikenaga, Mitsunobu; Saito, Yutaro; Yamamoto, Toshiya; Hirakawa, Hideki; Isobe, Sachiko
2017-10-01
We determined the genome sequence of sweet cherry (Prunus avium) using next-generation sequencing technology. The total length of the assembled sequences was 272.4 Mb, consisting of 10,148 scaffold sequences with an N50 length of 219.6 kb. The sequences covered 77.8% of the 352.9 Mb sweet cherry genome, as estimated by k-mer analysis, and included >96.0% of the core eukaryotic genes. We predicted 43,349 complete and partial protein-encoding genes. A high-density consensus map with 2,382 loci was constructed using double-digest restriction site-associated DNA sequencing. Comparing the genetic maps of sweet cherry and peach revealed high synteny between the two genomes; thus the scaffolds were integrated into pseudomolecules using map- and synteny-based strategies. Whole-genome resequencing of six modern cultivars found 1,016,866 SNPs and 162,402 insertions/deletions, out of which 0.7% were deleterious. The sequence variants, as well as simple sequence repeats, can be used as DNA markers. The genomic information helps us to identify agronomically important genes and will accelerate genetic studies and breeding programs for sweet cherries. Further information on the genomic sequences and DNA markers is available in DBcherry (http://cherry.kazusa.or.jp (8 May 2017, date last accessed)). © The Author 2017. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Whole Gene Capture Analysis of 15 CRC Susceptibility Genes in Suspected Lynch Syndrome Patients.
Jansen, Anne M L; Geilenkirchen, Marije A; van Wezel, Tom; Jagmohan-Changur, Shantie C; Ruano, Dina; van der Klift, Heleen M; van den Akker, Brendy E W M; Laros, Jeroen F J; van Galen, Michiel; Wagner, Anja; Letteboer, Tom G W; Gómez-García, Encarna B; Tops, Carli M J; Vasen, Hans F; Devilee, Peter; Hes, Frederik J; Morreau, Hans; Wijnen, Juul T
2016-01-01
Lynch Syndrome (LS) is caused by pathogenic germline variants in one of the mismatch repair (MMR) genes. However, up to 60% of MMR-deficient colorectal cancer cases are categorized as suspected Lynch Syndrome (sLS) because no pathogenic MMR germline variant can be identified, which leads to difficulties in clinical management. We therefore analyzed the genomic regions of 15 CRC susceptibility genes in leukocyte DNA of 34 unrelated sLS patients and 11 patients with MLH1 hypermethylated tumors with a clear family history. Using targeted next-generation sequencing, we analyzed the entire non-repetitive genomic sequence, including intronic and regulatory sequences, of 15 CRC susceptibility genes. In addition, tumor DNA from 28 sLS patients was analyzed for somatic MMR variants. Of 1979 germline variants found in the leukocyte DNA of 34 sLS patients, one was a pathogenic variant (MLH1 c.1667+1delG). Leukocyte DNA of 11 patients with MLH1 hypermethylated tumors was negative for pathogenic germline variants in the tested CRC susceptibility genes and for germline MLH1 hypermethylation. Somatic DNA analysis of 28 sLS tumors identified eight (29%) cases with two pathogenic somatic variants, one with a VUS predicted to pathogenic and LOH, and nine cases (32%) with one pathogenic somatic variant (n = 8) or one VUS predicted to be pathogenic (n = 1). This is the first study in sLS patients to include the entire genomic sequence of CRC susceptibility genes. An underlying somatic or germline MMR gene defect was identified in ten of 34 sLS patients (29%). In the remaining sLS patients, the underlying genetic defect explaining the MMRdeficiency in their tumors might be found outside the genomic regions harboring the MMR and other known CRC susceptibility genes.
Epigenomics of Development in Populus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauss, Steve; Freitag, Michael; Mockler, Todd
2013-01-10
We conducted research to determine the role of epigenetic modifications during tree development using poplar (Populus trichocarpa), a model woody feedstock species. Using methylated DNA immunoprecipitation (MeDIP) or chromatin immunoprecipitation (ChIP), followed by high-throughput sequencing, we are analyzed DNA and histone methylation patterns in the P. trichocarpa genome in relation to four biological processes: bud dormancy and release, mature organ maintenance, in vitro organogenesis, and methylation suppression. Our project is now completed. We have 1) produced 22 transgenic events for a gene involved in DNA methylation suppression and studied its phenotypic consequences; 2) completed sequencing of methylated DNA from elevenmore » target tissues in wildtype P. trichocarpa; 3) updated our customized poplar genome browser using the open-source software tools (2.13) and (V2.2) of the P. trichocarpa genome; 4) produced summary data for genome methylation in P. trichocarpa, including distribution of methylation across chromosomes and in and around genes; 5) employed bioinformatic and statistical methods to analyze differences in methylation patterns among tissue types; and 6) used bisulfite sequencing of selected target genes to confirm bioinformatics and sequencing results, and gain a higher-resolution view of methylation at selected genes 7) compared methylation patterns to expression using available microarray data. Our main findings of biological significance are the identification of extensive regions of the genome that display developmental variation in DNA methylation; highly distinctive gene-associated methylation profiles in reproductive tissues, particularly male catkins; a strong whole genome/all tissue inverse association of methylation at gene bodies and promoters with gene expression; a lack of evidence that tissue specificity of gene expression is associated with gene methylation; and evidence that genome methylation is a significant impediment to tissue dedifferentiation and redifferentiation in vitro.« less
Jo, Yeong Deuk; Choi, Yoomi; Kim, Dong-Hwan; Kim, Byung-Dong; Kang, Byoung-Cheorl
2014-07-04
Cytoplasmic male sterility (CMS) is an inability to produce functional pollen that is caused by mutation of the mitochondrial genome. Comparative analyses of mitochondrial genomes of lines with and without CMS in several species have revealed structural differences between genomes, including extensive rearrangements caused by recombination. However, the mitochondrial genome structure and the DNA rearrangements that may be related to CMS have not been characterized in Capsicum spp. We obtained the complete mitochondrial genome sequences of the pepper CMS line FS4401 (507,452 bp) and the fertile line Jeju (511,530 bp). Comparative analysis between mitochondrial genomes of peppers and tobacco that are included in Solanaceae revealed extensive DNA rearrangements and poor conservation in non-coding DNA. In comparison between pepper lines, FS4401 and Jeju mitochondrial DNAs contained the same complement of protein coding genes except for one additional copy of an atp6 gene (ψatp6-2) in FS4401. In terms of genome structure, we found eighteen syntenic blocks in the two mitochondrial genomes, which have been rearranged in each genome. By contrast, sequences between syntenic blocks, which were specific to each line, accounted for 30,380 and 17,847 bp in FS4401 and Jeju, respectively. The previously-reported CMS candidate genes, orf507 and ψatp6-2, were located on the edges of the largest sequence segments that were specific to FS4401. In this region, large number of small sequence segments which were absent or found on different locations in Jeju mitochondrial genome were combined together. The incorporation of repeats and overlapping of connected sequence segments by a few nucleotides implied that extensive rearrangements by homologous recombination might be involved in evolution of this region. Further analysis using mtDNA pairs from other plant species revealed common features of DNA regions around CMS-associated genes. Although large portion of sequence context was shared by mitochondrial genomes of CMS and male-fertile pepper lines, extensive genome rearrangements were detected. CMS candidate genes located on the edges of highly-rearranged CMS-specific DNA regions and near to repeat sequences. These characteristics were detected among CMS-associated genes in other species, implying a common mechanism might be involved in the evolution of CMS-associated genes.
NASA Technical Reports Server (NTRS)
Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Hausdorff, J. M.; Havlin, S.; Mietus, J.; Sciortino, F.; Simons, M.
1992-01-01
Here we discuss recent advances in applying ideas of fractals and disordered systems to two topics of biological interest, both topics having common the appearance of scale-free phenomena, i.e., correlations that have no characteristic length scale, typically exhibited by physical systems near a critical point and dynamical systems far from equilibrium. (i) DNA nucleotide sequences have traditionally been analyzed using models which incorporate the possibility of short-range nucleotide correlations. We found, instead, a remarkably long-range power law correlation. We found such long-range correlations in intron-containing genes and in non-transcribed regulatory DNA sequences as well as intragenomic DNA, but not in cDNA sequences or intron-less genes. We also found that the myosin heavy chain family gene evolution increases the fractal complexity of the DNA landscapes, consistent with the intron-late hypothesis of gene evolution. (ii) The healthy heartbeat is traditionally thought to be regulated according to the classical principle of homeostasis, whereby physiologic systems operate to reduce variability and achieve an equilibrium-like state. We found, however, that under normal conditions, beat-to-beat fluctuations in heart rate display long-range power law correlations.
Elder, Robert M; Jayaraman, Arthi
2013-10-10
Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.
DNA copy number changes define spatial patterns of heterogeneity in colorectal cancer
Mamlouk, Soulafa; Childs, Liam Harold; Aust, Daniela; Heim, Daniel; Melching, Friederike; Oliveira, Cristiano; Wolf, Thomas; Durek, Pawel; Schumacher, Dirk; Bläker, Hendrik; von Winterfeld, Moritz; Gastl, Bastian; Möhr, Kerstin; Menne, Andrea; Zeugner, Silke; Redmer, Torben; Lenze, Dido; Tierling, Sascha; Möbs, Markus; Weichert, Wilko; Folprecht, Gunnar; Blanc, Eric; Beule, Dieter; Schäfer, Reinhold; Morkel, Markus; Klauschen, Frederick; Leser, Ulf; Sers, Christine
2017-01-01
Genetic heterogeneity between and within tumours is a major factor determining cancer progression and therapy response. Here we examined DNA sequence and DNA copy-number heterogeneity in colorectal cancer (CRC) by targeted high-depth sequencing of 100 most frequently altered genes. In 97 samples, with primary tumours and matched metastases from 27 patients, we observe inter-tumour concordance for coding mutations; in contrast, gene copy numbers are highly discordant between primary tumours and metastases as validated by fluorescent in situ hybridization. To further investigate intra-tumour heterogeneity, we dissected a single tumour into 68 spatially defined samples and sequenced them separately. We identify evenly distributed coding mutations in APC and TP53 in all tumour areas, yet highly variable gene copy numbers in numerous genes. 3D morpho-molecular reconstruction reveals two clusters with divergent copy number aberrations along the proximal–distal axis indicating that DNA copy number variations are a major source of tumour heterogeneity in CRC. PMID:28120820
Applications of statistical physics and information theory to the analysis of DNA sequences
NASA Astrophysics Data System (ADS)
Grosse, Ivo
2000-10-01
DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.
Schiavo, G; Strillacci, M G; Ribani, A; Bovo, S; Roman-Ponce, S I; Cerolini, S; Bertolini, F; Bagnato, A; Fontanesi, L
2018-06-01
Mitochondrial DNA (mtDNA) insertions have been detected in the nuclear genome of many eukaryotes. These sequences are pseudogenes originated by horizontal transfer of mtDNA fragments into the nuclear genome, producing nuclear DNA sequences of mitochondrial origin (numt). In this study we determined the frequency and distribution of mtDNA-originated pseudogenes in the turkey (Meleagris gallopavo) nuclear genome. The turkey reference genome (Turkey_2.01) was aligned with the reference linearized mtDNA sequence using last. A total of 32 numt sequences (corresponding to 18 numt regions derived by unique insertional events) were identified in the turkey nuclear genome (size ranging from 66 to 1415 bp; identity against the modern turkey mtDNA corresponding region ranging from 62% to 100%). Numts were distributed in nine chromosomes and in one scaffold. They derived from parts of 10 mtDNA protein-coding genes, ribosomal genes, the control region and 10 tRNA genes. Seven numt regions reported in the turkey genome were identified in orthologues positions in the Gallus gallus genome and therefore were present in the ancestral genome that in the Cretaceous originated the lineages of the modern crown Galliformes. Five recently integrated turkey numts were validated by PCR in 168 turkeys of six different domestic populations. None of the analysed numts were polymorphic (i.e. absence of the inserted sequence, as reported in numts of recent integration in other species), suggesting that the reticulate speciation model is not useful for explaining the origin of the domesticated turkey lineage. © 2018 Stichting International Foundation for Animal Genetics.
Near, Thomas J; Dornburg, Alex; Friedman, Matt
2014-11-01
The Gonorynchiformes are the sister lineage of the species-rich Otophysi and provide important insights into the diversification of ostariophysan fishes. Phylogenies of gonorynchiforms inferred using morphological characters and mtDNA gene sequences provide differing resolutions with regard to the sister lineage of all other gonorynchiforms (Chanos vs. Gonorynchus) and support for monophyly of the two miniaturized lineages Cromeria and Grasseichthys. In this study the phylogeny and divergence times of gonorynchiforms are investigated with DNA sequences sampled from nine nuclear genes and a published morphological character matrix. Bayesian phylogenetic analyses reveal substantial congruence among individual gene trees with inferences from eight genes placing Gonorynchus as the sister lineage to all other gonorynchiforms. Seven gene trees resolve Cromeria and Grasseichthys as a clade, supporting previous inferences using morphological characters. Phylogenies resulting from either concatenating the nuclear genes, performing a multispecies coalescent species tree analysis, or combining the morphological and nuclear gene DNA sequences resolve Gonorynchus as the living sister lineage of all other gonorynchiforms, strongly support the monophyly of Cromeria and Grasseichthys, and resolve a clade containing Parakneria, Cromeria, and Grasseichthys. The morphological dataset, which includes 13 gonorynchiform fossil taxa that range in age from Early Cretaceous to Eocene, was analyzed in combination with DNA sequences from the nine nuclear genes and a relaxed molecular clock to estimate times of evolutionary divergence. This "tip dating" strategy accommodates uncertainty in the phylogenetic resolution of fossil taxa that provide calibration information in the relaxed molecular clock analysis. The estimated age of the most recent common ancestor (MRCA) of living gonorynchiforms is slightly older than estimates from previous node dating efforts, but the molecular tip dating estimated ages of Kneriinae (Kneria, Parakneria, Cromeria, and Grasseichthys) and the two paedomorphic lineages, Cromeria and Grasseichthys, are considerably younger. Copyright © 2014 Elsevier Inc. All rights reserved.
The Organization of Repetitive DNA in the Genomes of Amazonian Lizard Species in the Family Teiidae.
Carvalho, Natalia D M; Pinheiro, Vanessa S S; Carmo, Edson J; Goll, Leonardo G; Schneider, Carlos H; Gross, Maria C
2015-01-01
Repetitive DNA is the largest fraction of the eukaryote genome and comprises tandem and dispersed sequences. It presents variations in relation to its composition, number of copies, distribution, dynamics, and genome organization, and participates in the evolutionary diversification of different vertebrate species. Repetitive sequences are usually located in the heterochromatin of centromeric and telomeric regions of chromosomes, contributing to chromosomal structures. Therefore, the aim of this study was to physically map repetitive DNA sequences (5S rDNA, telomeric sequences, tropomyosin gene 1, and retroelements Rex1 and SINE) of mitotic chromosomes of Amazonian species of teiids (Ameiva ameiva, Cnemidophorus sp. 1, Kentropyx calcarata, Kentropyx pelviceps, and Tupinambis teguixin) to understand their genome organization and karyotype evolution. The mapping of repetitive sequences revealed a distinct pattern in Cnemidophorus sp. 1, whereas the other species showed all sequences interspersed in the heterochromatic region. Physical mapping of the tropomyosin 1 gene was performed for the first time in lizards and showed that in addition to being functional, this gene has a structural function similar to the mapped repetitive elements as it is located preferentially in centromeric regions and termini of chromosomes. © 2016 S. Karger AG, Basel.
Gene sequence analyses and other DNA-based methods for yeast species recognition
USDA-ARS?s Scientific Manuscript database
DNA sequence analyses, as well as other DNA-based methodologies, have transformed the way in which yeasts are identified. The focus of this chapter will be on the resolution of species using various types of DNA comparisons. In other chapters in this book, Rozpedowska, Piškur and Wolfe discuss mul...
Reeves, R H; O'Brien, S J
1984-01-01
RD-114 is a replication-competent, xenotropic retrovirus which is homologous to a family of moderately repetitive DNA sequences present at ca. 20 copies in the normal cellular genome of domestic cats. To examine the extent and character of genomic divergence of the RD-114 gene family as well as to assess their positional association within the cat genome, we have prepared a series of molecular clones of endogenous RD-114 DNA segments from a genomic library of cat cellular DNA. Their restriction endonuclease maps were compared with each other as well as to that of the prototype-inducible RD-114 which was molecularly cloned from a chronically infected human cell line. The endogenous sequences analyzed were similar to each other in that they were colinear with RD-114 proviral DNA, were bounded by long terminal redundancies, and conserved many restriction sites in the gag and pol regions. However, the env regions of many of the sequences examined were substantially deleted. Several of the endogenous RD-114 genomes contained a novel envelope sequence which was unrelated to the env gene of the prototype RD-114 env gene but which, like RD-114 and endogenous feline leukemia virus provirus, was found only in species of the genus Felis, and not in other closely related Felidae genera. The endogenous RD-114 sequences each had a distinct cellular flank which indicates that these sequences are not tandem but dispersed nonspecifically throughout the genome. Southern analysis of cat cellular DNA confirmed the conclusions about conserved restriction sites in endogenous sequences and indicated that a single locus may be responsible for the production of the major inducible form of RD-114. Images PMID:6090693
Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin
2011-03-29
Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non-coding sequences. Sequence rearrangement has produced novel chimeric ORFs, which may be candidate genes for CMS. Comparative analysis of several angiosperm mtDNAs indicated that non-coding sequences are the most frequently reorganized during mtDNA evolution in higher plants.
Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A
2009-01-01
Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hadano, S.; Ishida, Y.; Tomiyasu, H.
1994-09-01
To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less
Zhou, Rongqiong; Xia, Qingyou; Huang, Hancheng; Lai, Min; Wang, Zhenxin
2011-10-01
Toxocara canis is a widespread intestinal nematode parasite of dogs, which can also cause disease in humans. We employed an expressed sequence tag (EST) strategy in order to study gene-expression including development, digestion and reproduction of T. canis. ESTs provided a rapid way to identify genes, particularly in organisms for which we have very little molecular information. In this study, a cDNA library was constructed from a female adult of T. canis and 215 high-quality ESTs from 5'-ends of the cDNA clones representing 79 unigenes were obtained. The titer of the primary cDNA library was 1.83×10(6)pfu/mL with a recombination rate of 99.33%. Most of the sequences ranged from 300 to 900bp with an average length of 656bp. Cluster analysis of these ESTs allowed identification of 79 unique sequences containing 28 contigs and 51 singletons. BLASTX searches revealed that 18 unigenes (22.78% of the total) or 70 ESTs (32.56% of the total) were novel genes that had no significant matches to any protein sequences in the public databases. The rest of the 61 unigenes (77.22% of the total) or 145 ESTs (67.44% of the total) were closely matched to the known genes or sequences deposited in the public databases. These genes were classified into seven groups based on their known or putative biological functions. We also confirmed the gene expression patterns of several immune-related genes using RT-PCR examination. This work will provide a valuable resource for the further investigations in the stage-, sex- and tissue-specific gene transcription or expression. Copyright © 2011. Published by Elsevier Inc.
Dionisi, Hebe M.; Chewning, Christopher S.; Morgan, Katherine H.; Menn, Fu-Min; Easter, James P.; Sayler, Gary S.
2004-01-01
We designed a real-time PCR assay able to recognize dioxygenase large-subunit gene sequences with more than 90% similarity to the Ralstonia sp. strain U2 nagAc gene (nagAc-like gene sequences) in order to study the importance of organisms carrying these genes in the biodegradation of naphthalene. Sequencing of PCR products indicated that this real-time PCR assay was specific and able to detect a variety of nagAc-like gene sequences. One to 100 ng of contaminated-sediment total DNA in 25-μl reaction mixtures produced an amplification efficiency of 0.97 without evident PCR inhibition. The assay was applied to surficial freshwater sediment samples obtained in or in close proximity to a coal tar-contaminated Superfund site. Naphthalene concentrations in the analyzed samples varied between 0.18 and 106 mg/kg of dry weight sediment. The assay for nagAc-like sequences indicated the presence of (4.1 ± 0.7) × 103 to (2.9 ± 0.3) × 105 copies of nagAc-like dioxygenase genes per μg of DNA extracted from sediment samples. These values corresponded to (1.2 ± 0.6) × 105 to (5.4 ± 0.4) × 107 copies of this target per g of dry weight sediment when losses of DNA during extraction were taken into account. There was a positive correlation between naphthalene concentrations and nagAc-like gene copies per microgram of DNA (r = 0.89) and per gram of dry weight sediment (r = 0.77). These results provide evidence of the ecological significance of organisms carrying nagAc-like genes in the biodegradation of naphthalene. PMID:15240274
2010-01-01
Background Cryptic species complexes are common among anophelines. Previous phylogenetic analysis based on the complete mtDNA COI gene sequences detected paraphyly in the Neotropical malaria vector Anopheles marajoara. The "Folmer region" detects a single taxon using a 3% divergence threshold. Methods To test the paraphyletic hypothesis and examine the utility of the Folmer region, genealogical trees based on a concatenated (white + 3' COI sequences) dataset and pairwise differentiation of COI fragments were examined. The population structure and demographic history were based on partial COI sequences for 294 individuals from 14 localities in Amazonian Brazil. 109 individuals from 12 localities were sequenced for the nDNA white gene, and 57 individuals from 11 localities were sequenced for the ribosomal DNA (rDNA) internal transcribed spacer 2 (ITS2). Results Distinct A. marajoara lineages were detected by combined genealogical analysis and were also supported among COI haplotypes using a median joining network and AMOVA, with time since divergence during the Pleistocene (<100,000 ya). COI sequences at the 3' end were more variable, demonstrating significant pairwise differentiation (3.82%) compared to the more moderate 2.92% detected by the Folmer region. Lineage 1 was present in all localities, whereas lineage 2 was restricted mainly to the west. Mismatch distributions for both lineages were bimodal, likely due to multiple colonization events and spatial expansion (~798 - 81,045 ya). There appears to be gene flow within, not between lineages, and a partial barrier was detected near Rio Jari in Amapá state, separating western and eastern populations. In contrast, both nDNA data sets (white gene sequences with or without the retention of the 4th intron, and ITS2 sequences and length) detected a single A. marajoara lineage. Conclusions Strong support for combined data with significant differentiation detected in the COI and absent in the nDNA suggest that the divergence is recent, and detectable only by the faster evolving mtDNA. A within subgenus threshold of >2% may be more appropriate among sister taxa in cryptic anopheline complexes than the standard 3%. Differences in demographic history and climatic changes may have contributed to mtDNA lineage divergence in A. marajoara. PMID:20929572
Brown, William M
2015-12-01
Epigenetics is the study of processes--beyond DNA sequence alteration--producing heritable characteristics. For example, DNA methylation modifies gene expression without altering the nucleotide sequence. A well-studied DNA methylation-based phenomenon is genomic imprinting (ie, genotype-independent parent-of-origin effects). We aimed to elucidate: (1) the effect of exercise on DNA methylation and (2) the role of imprinted genes in skeletal muscle gene networks (ie, gene group functional profiling analyses). Gene ontology (ie, gene product elucidation)/meta-analysis. 26 skeletal muscle and 86 imprinted genes were subjected to g:Profiler ontology analysis. Meta-analysis assessed exercise-associated DNA methylation change. g:Profiler found four muscle gene networks with imprinted loci. Meta-analysis identified 16 articles (387 genes/1580 individuals) associated with exercise. Age, method, sample size, sex and tissue variation could elevate effect size bias. Only skeletal muscle gene networks including imprinted genes were reported. Exercise-associated effect sizes were calculated by gene. Age, method, sample size, sex and tissue variation were moderators. Six imprinted loci (RB1, MEG3, UBE3A, PLAGL1, SGCE, INS) were important for muscle gene networks, while meta-analysis uncovered five exercise-associated imprinted loci (KCNQ1, MEG3, GRB10, L3MBTL1, PLAGL1). DNA methylation decreased with exercise (60% of loci). Exercise-associated DNA methylation change was stronger among older people (ie, age accounted for 30% of the variation). Among older people, genes exhibiting DNA methylation decreases were part of a microRNA-regulated gene network functioning to suppress cancer. Imprinted genes were identified in skeletal muscle gene networks and exercise-associated DNA methylation change. Exercise-associated DNA methylation modification could rewind the 'epigenetic clock' as we age. CRD42014009800. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/
Beckenbach, Andrew T.
2012-01-01
The complete mitochondrial DNA sequences of eight representatives of lower Diptera, suborder Nematocera, along with nearly complete sequences from two other species, are presented. These taxa represent eight families not previously represented by complete mitochondrial DNA sequences. Most of the sequences retain the ancestral dipteran mitochondrial gene arrangement, while one sequence, that of the midge Arachnocampa flava (family Keroplatidae), has an inversion of the trnE gene. The most unusual result is the extensive rearrangement of the mitochondrial genome of a winter crane fly, Paracladura trichoptera (family Trichocera). The pattern of rearrangement indicates that the mechanism of rearrangement involved a tandem duplication of the entire mitochondrial genome, followed by random and nonrandom loss of one copy of each gene. Another winter crane fly retains the ancestral diperan gene arrangement. A preliminary mitochondrial phylogeny of the Diptera is also presented. PMID:22155689
USDA-ARS?s Scientific Manuscript database
Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...
NASA Technical Reports Server (NTRS)
Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard
2003-01-01
All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.
NMR studies on the structure and dynamics of lac operator DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, S.C.
Nuclear Magnetic Resonance spectroscopy was used to elucidate the relationships between structure, dynamics and function of the gene regulatory sequence corresponding to the lactose operon operator of Escherichia coli. The length of the DNA fragments examined varied from 13 to 36 base pair, containing all or part of the operator sequence. These DNA fragments are either derived genetically or synthesized chemically. Resonances of the imino protons were assigned by one dimensional inter-base pair nuclear Overhauser enhancement (NOE) measurements. Imino proton exchange rates were measured by saturation recovery methods. Results from the kinetic measurements show an interesting dynamic heterogeneity with amore » maximum opening rate centered about a GTG/CAC sequence which correlates with the biological function of the operator DNA. This particular three base pair sequence occurs frequently and often symmetrically in prokaryotic nd eukaryotic DNA sites where one anticipates specific protein interaction for gene regulation. The observed sequence dependent imino proton exchange rate may be a reflection of variation of the local structure of regulatory DNA. The results also indicate that the observed imino proton exchange rates are length dependent.« less
Cingolani, Pablo; Patel, Viral M.; Coon, Melissa; Nguyen, Tung; Land, Susan J.; Ruden, Douglas M.; Lu, Xiangyi
2012-01-01
This paper describes a new program SnpSift for filtering differential DNA sequence variants between two or more experimental genomes after genotoxic chemical exposure. Here, we illustrate how SnpSift can be used to identify candidate phenotype-relevant variants including single nucleotide polymorphisms, multiple nucleotide polymorphisms, insertions, and deletions (InDels) in mutant strains isolated from genome-wide chemical mutagenesis of Drosophila melanogaster. First, the genomes of two independently isolated mutant fly strains that are allelic for a novel recessive male-sterile locus generated by genotoxic chemical exposure were sequenced using the Illumina next-generation DNA sequencer to obtain 20- to 29-fold coverage of the euchromatic sequences. The sequencing reads were processed and variants were called using standard bioinformatic tools. Next, SnpEff was used to annotate all sequence variants and their potential mutational effects on associated genes. Then, SnpSift was used to filter and select differential variants that potentially disrupt a common gene in the two allelic mutant strains. The potential causative DNA lesions were partially validated by capillary sequencing of polymerase chain reaction-amplified DNA in the genetic interval as defined by meiotic mapping and deletions that remove defined regions of the chromosome. Of the five candidate genes located in the genetic interval, the Pka-like gene CG12069 was found to carry a separate pre-mature stop codon mutation in each of the two allelic mutants whereas the other four candidate genes within the interval have wild-type sequences. The Pka-like gene is therefore a strong candidate gene for the male-sterile locus. These results demonstrate that combining SnpEff and SnpSift can expedite the identification of candidate phenotype-causative mutations in chemically mutagenized Drosophila strains. This technique can also be used to characterize the variety of mutations generated by genotoxic chemicals. PMID:22435069
Isolation and characterization of the chicken trypsinogen gene family.
Wang, K; Gan, L; Lee, I; Hood, L
1995-01-01
Based on genomic Southern hybridizations and cDNA sequence analyses, the chicken trypsinogen gene family can be divided into two multi-member subfamilies, a six-member trypsinogen I subfamily which encodes the cationic trypsin isoenzymes and a three-member trypsinogen II subfamily which encodes the anionic trypsin isoenzymes. The chicken cDNA and genomic clones containing these two subfamilies were isolated and characterized by DNA sequence analysis. The results indicated that the chicken trypsinogen genes encoded a signal peptide of 15 to 16 amino acid residues, an activation peptide of 9 to 10 residues and a trypsin of 223 amino acid residues. The chicken trypsinogens contain all the common catalytic and structural features for trypsins, including the catalytic triad His, Asp and Ser and the six disulphide bonds. The trypsinogen I and II subfamilies share approximately 70% sequence identity at the nucleotide and amino acid level. The sequence comparison among chicken trypsinogen subfamily members and trypsin sequences from other species suggested that the chicken trypsinogen genes may have evolved in coincidental or concerted fashion. Images Figure 6 Figure 7 PMID:7733885
Mahelka, Václav; Krak, Karol; Kopecký, David; Fehrer, Judith; Šafář, Jan; Bartoš, Jan; Hobza, Roman; Blavet, Nicolas; Blattner, Frank R
2017-02-14
The movement of nuclear DNA from one vascular plant species to another in the absence of fertilization is thought to be rare. Here, nonnative rRNA gene [ribosomal DNA (rDNA)] copies were identified in a set of 16 diploid barley ( Hordeum ) species; their origin was traceable via their internal transcribed spacer (ITS) sequence to five distinct Panicoideae genera, a lineage that split from the Pooideae about 60 Mya. Phylogenetic, cytogenetic, and genomic analyses implied that the nonnative sequences were acquired between 1 and 5 Mya after a series of multiple events, with the result that some current Hordeum sp. individuals harbor up to five different panicoid rDNA units in addition to the native Hordeum rDNA copies. There was no evidence that any of the nonnative rDNA units were transcribed; some showed indications of having been silenced via pseudogenization. A single copy of a Panicum sp. rDNA unit present in H. bogdanii had been interrupted by a native transposable element and was surrounded by about 70 kbp of mostly noncoding sequence of panicoid origin. The data suggest that horizontal gene transfer between vascular plants is not a rare event, that it is not necessarily restricted to one or a few genes only, and that it can be selectively neutral.
Previously unknown and highly divergent ssDNA viruses populate the oceans.
Labonté, Jessica M; Suttle, Curtis A
2013-11-01
Single-stranded DNA (ssDNA) viruses are economically important pathogens of plants and animals, and are widespread in oceans; yet, the diversity and evolutionary relationships among marine ssDNA viruses remain largely unknown. Here we present the results from a metagenomic study of composite samples from temperate (Saanich Inlet, 11 samples; Strait of Georgia, 85 samples) and subtropical (46 samples, Gulf of Mexico) seawater. Most sequences (84%) had no evident similarity to sequenced viruses. In total, 608 putative complete genomes of ssDNA viruses were assembled, almost doubling the number of ssDNA viral genomes in databases. These comprised 129 genetically distinct groups, each represented by at least one complete genome that had no recognizable similarity to each other or to other virus sequences. Given that the seven recognized families of ssDNA viruses have considerable sequence homology within them, this suggests that many of these genetic groups may represent new viral families. Moreover, nearly 70% of the sequences were similar to one of these genomes, indicating that most of the sequences could be assigned to a genetically distinct group. Most sequences fell within 11 well-defined gene groups, each sharing a common gene. Some of these encoded putative replication and coat proteins that had similarity to sequences from viruses infecting eukaryotes, suggesting that these were likely from viruses infecting eukaryotic phytoplankton and zooplankton.
Pelnena, Dita; Burnyte, Birute; Jankevics, Eriks; Lace, Baiba; Dagyte, Evelina; Grigalioniene, Kristina; Utkus, Algirdas; Krumina, Zita; Rozentale, Jolanta; Adomaitiene, Irina; Stavusis, Janis; Pliss, Liana; Inashkina, Inna
2017-12-12
The most common mitochondrial disorder in children is Leigh syndrome, which is a progressive and genetically heterogeneous neurodegenerative disorder caused by mutations in nuclear genes or mitochondrial DNA (mtDNA). In the present study, a novel and robust method of complete mtDNA sequencing, which allows amplification of the whole mitochondrial genome, was tested. Complete mtDNA sequencing was performed in a cohort of patients with suspected mitochondrial mutations. Patients from Latvia and Lithuania (n = 92 and n = 57, respectively) referred by clinical geneticists were included. The de novo point mutations m.9185T>C and m.13513G>A, respectively, were detected in two patients with lactic acidosis and neurodegenerative lesions. In one patient with neurodegenerative lesions, the mutation m.9185T>C was identified. These mutations are associated with Leigh syndrome. The present data suggest that full-length mtDNA sequencing is recommended as a supplement to nuclear gene testing and enzymatic assays to enhance mitochondrial disease diagnostics.
Hirsch, B; Endris, V; Lassmann, S; Weichert, W; Pfarr, N; Schirmacher, P; Kovaleva, V; Werner, M; Bonzheim, I; Fend, F; Sperveslage, J; Kaulich, K; Zacher, A; Reifenberger, G; Köhrer, K; Stepanow, S; Lerke, S; Mayr, T; Aust, D E; Baretton, G; Weidner, S; Jung, A; Kirchner, T; Hansmann, M L; Burbat, L; von der Wall, E; Dietel, M; Hummel, M
2018-04-01
The simultaneous detection of multiple somatic mutations in the context of molecular diagnostics of cancer is frequently performed by means of amplicon-based targeted next-generation sequencing (NGS). However, only few studies are available comparing multicenter testing of different NGS platforms and gene panels. Therefore, seven partner sites of the German Cancer Consortium (DKTK) performed a multicenter interlaboratory trial for targeted NGS using the same formalin-fixed, paraffin-embedded (FFPE) specimen of molecularly pre-characterized tumors (n = 15; each n = 5 cases of Breast, Lung, and Colon carcinoma) and a colorectal cancer cell line DNA dilution series. Detailed information regarding pre-characterized mutations was not disclosed to the partners. Commercially available and custom-designed cancer gene panels were used for library preparation and subsequent sequencing on several devices of two NGS different platforms. For every case, centrally extracted DNA and FFPE tissue sections for local processing were delivered to each partner site to be sequenced with the commercial gene panel and local bioinformatics. For cancer-specific panel-based sequencing, only centrally extracted DNA was analyzed at seven sequencing sites. Subsequently, local data were compiled and bioinformatics was performed centrally. We were able to demonstrate that all pre-characterized mutations were re-identified correctly, irrespective of NGS platform or gene panel used. However, locally processed FFPE tissue sections disclosed that the DNA extraction method can affect the detection of mutations with a trend in favor of magnetic bead-based DNA extraction methods. In conclusion, targeted NGS is a very robust method for simultaneous detection of various mutations in FFPE tissue specimens if certain pre-analytical conditions are carefully considered.
Microsatellite DNA in genomic survey sequences and UniGenes of loblolly pine
Craig S Echt; Surya Saha; Dennis L Deemer; C Dana Nelson
2011-01-01
Genomic DNA sequence databases are a potential and growing resource for simple sequence repeat (SSR) marker development in loblolly pine (Pinus taeda L.). Loblolly pine also has many expressed sequence tags (ESTs) available for microsatellite (SSR) marker development. We compared loblolly pine SSR densities in genome survey sequences (GSSs) to those in non-redundant...
Ning, ZhongHua; Hincke, Maxwell T.; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not ‘finished’. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences. PMID:24676480
Zhang, Quan; Liu, Long; Zhu, Feng; Ning, ZhongHua; Hincke, Maxwell T; Yang, Ning; Hou, ZhuoCheng
2014-01-01
Efficiently obtaining full-length cDNA for a target gene is the key step for functional studies and probing genetic variations. However, almost all sequenced domestic animal genomes are not 'finished'. Many functionally important genes are located in these gapped regions. It can be difficult to obtain full-length cDNA for which only partial amino acid/EST sequences exist. In this study we report a general pipeline to obtain full-length cDNA, and illustrate this approach for one important gene (Ovocleidin-17, OC-17) that is associated with chicken eggshell biomineralization. Chicken OC-17 is one of the best candidates to control and regulate the deposition of calcium carbonate in the calcified eggshell layer. OC-17 protein has been purified, sequenced, and has had its three-dimensional structure solved. However, researchers still cannot conduct OC-17 mRNA related studies because the mRNA sequence is unknown and the gene is absent from the current chicken genome. We used RNA-Seq to obtain the entire transcriptome of the adult hen uterus, and then conducted de novo transcriptome assembling with bioinformatics analysis to obtain candidate OC-17 transcripts. Based on this sequence, we used RACE and PCR cloning methods to successfully obtain the full-length OC-17 cDNA. Temporal and spatial OC-17 mRNA expression analyses were also performed to demonstrate that OC-17 is predominantly expressed in the adult hen uterus during the laying cycle and barely at immature developmental stages. Differential uterine expression of OC-17 was observed in hens laying eggs with weak versus strong eggshell, confirming its important role in the regulation of eggshell mineralization and providing a new tool for genetic selection for eggshell quality parameters. This study is the first one to report the full-length OC-17 cDNA sequence, and builds a foundation for OC-17 mRNA related studies. We provide a general method for biologists experiencing difficulty in obtaining candidate gene full-length cDNA sequences.
Genes for cytochrome c oxidase subunit I, URF2, and three tRNAs in Drosophila mitochondrial DNA.
Clary, D O; Wolstenholme, D R
1983-01-01
Genes for URF2, tRNAtrp, tRNAcys, tRNAtyr and cytochrome c oxidase subunit I (COI) have been identified within a sequenced segment of the Drosophila yakuba mtDNA molecule. The five genes are arranged in the order given. Transcription of the tRNAcys and tRNAtyr genes is in the same direction as replication, while transcription of the URF2, tRNAtrp and COI genes is in the opposite direction. A similar arrangement of these genes is found in mammalian mtDNA except that in the latter, the tRNAala and tRNAasn genes are located between the tRNAtrp and tRNAcys genes. Also, a sequence found between the tRNAasn and tRNAcys genes in mammalian mtDNA, which is associated with the initiation of second strand DNA synthesis, is not found in this region of the D. yakuba mtDNA molecule. As the D. yakuba COI gene lacks a standard translation initiation codon, we consider the possibility that the quadruplet ATAA may serve this function. As in other D. yakuba mitochondrial polypeptide genes, AGA codons in the URF2 and COI genes do not correspond in position to arginine-specifying codons in the equivalent genes of mouse and yeast mtDNAs, but do most frequently correspond to serine-specifying codons. PMID:6314262
Cheng, Jinkui; Lai, Jinsheng; Gong, Zhizhong
2016-01-01
DNA polymerase δ plays crucial roles in DNA repair and replication as well as maintaining genomic stability. However, the function of POLD2, the second small subunit of DNA polymerase δ, has not been characterized yet in Arabidopsis (Arabidopsis thaliana). During a genetic screen for release of transcriptional gene silencing, we identified a mutation in POLD2. Whole-genome bisulfite sequencing indicated that POLD2 is not involved in the regulation of DNA methylation. POLD2 genetically interacts with Ataxia Telangiectasia-mutated and Rad3-related and DNA polymerase α. The pold2-1 mutant exhibits genomic instability with a high frequency of homologous recombination. It also exhibits hypersensitivity to DNA-damaging reagents and short telomere length. Whole-genome chromatin immunoprecipitation sequencing and RNA sequencing analyses suggest that pold2-1 changes H3K27me3 and H3K4me3 modifications, and these changes are correlated with the gene expression levels. Our study suggests that POLD2 is required for maintaining genome integrity and properly establishing the epigenetic markers during DNA replication to modulate gene expression. PMID:27208288
Barcoding of fresh water fishes from Pakistan.
Karim, Asma; Iqbal, Asad; Akhtar, Rehan; Rizwan, Muhammad; Amar, Ali; Qamar, Usman; Jahan, Shah
2016-07-01
DNA bar-coding is a taxonomic method that uses small genetic markers in organisms' mitochondrial DNA (mt DNA) for identification of particular species. It uses sequence diversity in a 658-base pair fragment near the 5' end of the mitochondrial cytochrome c oxidase subunit 1 (CO1) gene as a tool for species identification. DNA barcoding is more accurate and reliable method as compared with the morphological identification. It is equally useful in juveniles as well as adult stages of fishes. The present study was conducted to identify three farm fish species of Pakistan (Cyprinus carpio, Cirrhinus mrigala, and Ctenopharyngodon idella) genetically. All of them belonged to family cyprinidae. CO1 gene was amplified. PCR products were sequenced and analyzed by bioinformatic software. Conspecific, congenric, and confamilial k2P nucleotide divergence was estimated. From these findings, it was concluded that the gene sequence, CO1, may serve as milestone for the identification of related species at molecular level.
Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Zhou, Mei; Shaw, Chris
2005-12-01
Phylloxin is a novel prototype antimicrobial peptide from the skin of Phyllomedusa bicolor. Here, we describe parallel identification and sequencing of phylloxin precursor transcript (mRNA) and partial gene structure (genomic DNA) from the same sample of lyophilized skin secretion using our recently-described cloning technique. The open-reading frame of the phylloxin precursor was identical in nucleotide sequence to that previously reported and alignment with the nucleotide sequence derived from genomic DNA indicated the presence of a 175 bp intron located in a near identical position to that found in the dermaseptins. The highly-conserved structural organization of skin secretion peptide genes in P. bicolor can thus be extended to include that encoding phylloxin (plx). These data further reinforce our assertion that application of the described methodology can provide robust genomic/transcriptomic/peptidomic data without the need for specimen sacrifice.
Nakano, Tadao; Okamoto, Munehiro; Ikeda, Yatsukaho; Hasegawa, Hideo
2006-12-01
Sequences of mitochondrial cytochrome c oxidase subunit 1 (CO1) gene, nuclear internal transcribed spacer 2 (ITS2) region of ribosomal DNA (rDNA), and 5S rDNA of Enterobius vermicularis from captive chimpanzees in five zoos/institutions in Japan were analyzed and compared with those of pinworm eggs from humans in Japan. Three major types of variants appearing in both CO1 and ITS2 sequences, but showing no apparent connection, were observed among materials collected from the chimpanzees. Each one of them was also observed in pinworms in humans. Sequences of 5S rDNA were identical in the materials from chimpanzees and humans. Phylogenetic analysis of CO1 gene revealed three clusters with high bootstrap value, suggesting considerable divergence, presumably correlated with human evolution, has occurred in the human pinworms. The synonymy of E. gregorii with E. vermicularis is supported by the molecular evidence.
Colonization of heterochromatic genes by transposable elements in Drosophila.
Dimitri, Patrizio; Junakovic, Nikolaj; Arcà, Bruno
2003-04-01
As a further step toward understanding transposable element-host genome interactions, we investigated the molecular anatomy of introns from five heterochromatic and 22 euchromatic protein-coding genes of Drosophila melanogaster. A total of 79 kb of intronic sequences from heterochromatic genes and 355 kb of intronic sequences from euchromatic genes have been used in Blast searches against Drosophila transposable elements (TEs). The results show that TE-homologous sequences belonging to 19 different families represent about 50% of intronic DNA from heterochromatic genes. In contrast, only 0.1% of the euchromatic intron DNA exhibits homology to known TEs. Intraspecific and interspecific size polymorphisms of introns were found, which are likely to be associated with changes in TE-related sequences. Together, the enrichment in TEs and the apparent dynamic state of heterochromatic introns suggest that TEs contribute significantly to the evolution of genes located in heterochromatin.
Birth and death of genes linked to chromosomal inversion
Furuta, Yoshikazu; Kawai, Mikihiko; Yahara, Koji; Takahashi, Noriko; Handa, Naofumi; Tsuru, Takeshi; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo
2011-01-01
The birth and death of genes is central to adaptive evolution, yet the underlying genome dynamics remain elusive. The availability of closely related complete genome sequences helps to follow changes in gene contents and clarify their relationship to overall genome organization. Helicobacter pylori, bacteria in our stomach, are known for their extreme genome plasticity through mutation and recombination and will make a good target for such an analysis. In comparing their complete genome sequences, we found that gain and loss of genes (loci) for outer membrane proteins, which mediate host interaction, occurred at breakpoints of chromosomal inversions. Sequence comparison there revealed a unique mechanism of DNA duplication: DNA duplication associated with inversion. In this process, a DNA segment at one chromosomal locus is copied and inserted, in an inverted orientation, into a distant locus on the same chromosome, while the entire region between these two loci is also inverted. Recognition of this and three more inversion modes, which occur through reciprocal recombination between long or short sequence similarity or adjacent to a mobile element, allowed reconstruction of synteny evolution through inversion events in this species. These results will guide the interpretation of extensive DNA sequencing results for understanding long- and short-term genome evolution in various organisms and in cancer cells. PMID:21212362
Protection of CpG islands from DNA methylation is DNA-encoded and evolutionarily conserved.
Long, Hannah K; King, Hamish W; Patient, Roger K; Odom, Duncan T; Klose, Robert J
2016-08-19
DNA methylation is a repressive epigenetic modification that covers vertebrate genomes. Regions known as CpG islands (CGIs), which are refractory to DNA methylation, are often associated with gene promoters and play central roles in gene regulation. Yet how CGIs in their normal genomic context evade the DNA methylation machinery and whether these mechanisms are evolutionarily conserved remains enigmatic. To address these fundamental questions we exploited a transchromosomic animal model and genomic approaches to understand how the hypomethylated state is formed in vivo and to discover whether mechanisms governing CGI formation are evolutionarily conserved. Strikingly, insertion of a human chromosome into mouse revealed that promoter-associated CGIs are refractory to DNA methylation regardless of host species, demonstrating that DNA sequence plays a central role in specifying the hypomethylated state through evolutionarily conserved mechanisms. In contrast, elements distal to gene promoters exhibited more variable methylation between host species, uncovering a widespread dependence on nucleotide frequency and occupancy of DNA-binding transcription factors in shaping the DNA methylation landscape away from gene promoters. This was exemplified by young CpG rich lineage-restricted repeat sequences that evaded DNA methylation in the absence of co-evolved mechanisms targeting methylation to these sequences, and species specific DNA binding events that protected against DNA methylation in CpG poor regions. Finally, transplantation of mouse chromosomal fragments into the evolutionarily distant zebrafish uncovered the existence of a mechanistically conserved and DNA-encoded logic which shapes CGI formation across vertebrate species. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Gaber, Rania; Watermann, Iris; Kugler, Christian; Vollmer, Ekkehard; Perner, Sven; Reck, Martin; Goldmann, Torsten
2017-01-01
Targeting epidermal growth factor receptor (EGFR) in patients with non-small-cell lung cancer (NSCLC) having EGFR mutations is associated with an improved overall survival. The aim of this study is to verify, if EGFR mutations detected by immunohistochemistry (IHC) is a convincing way to preselect patients for DNA-sequencing and to figure out, the statistical association between EGFR mutation, wild-type EGFR overexpression, gene copy number gain, which are the main factors inducing EGFR tumorigenic activity and the clinicopathological data. Two hundred sixteen tumor tissue samples of primarily chemotherapeutic naïve NSCLC patients were analyzed for EGFR mutations E746-A750del and L858R and correlated with DNA-sequencing. Two hundred six of which were assessed by IHC, using 6B6 and 43B2 specific antibodies followed by DNA-sequencing of positive cases and 10 already genotyped tumor tissues were also included to investigate debugging accuracy of IHC. In addition, EGFR wild-type overexpression was IHC evaluated and EGFR gene copy number determination was performed by fluorescence in situ hybridization (FISH). Forty-one÷206 (19.9%) cases were positive for mutated EGFR by IHC. Eight of them had EGFR mutations of exons 18-21 by DNA-sequencing. Hit rate of 10 already genotyped NSCLC mutated cases was 90% by IHC. Positive association was found between EGFR mutations determined by IHC and both EGFR overexpression and increased gene copy number (p=0.002 and p<0.001, respectively). Additionally, positive association was detected between EGFR mutations, high tumor grade and clinical stage (p<0.001). IHC staining with mutation specific antibodies was demonstrated as a possible useful screening test to preselect patients for DNA-sequencing.
Pollier, Jacob; González-Guzmán, Miguel; Ardiles-Diaz, Wilson; Geelen, Danny; Goossens, Alain
2011-01-01
cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) is a commonly used technique for genome-wide expression analysis that does not require prior sequence knowledge. Typically, quantitative expression data and sequence information are obtained for a large number of differentially expressed gene tags. However, most of the gene tags do not correspond to full-length (FL) coding sequences, which is a prerequisite for subsequent functional analysis. A medium-throughput screening strategy, based on integration of polymerase chain reaction (PCR) and colony hybridization, was developed that allows in parallel screening of a cDNA library for FL clones corresponding to incomplete cDNAs. The method was applied to screen for the FL open reading frames of a selection of 163 cDNA-AFLP tags from three different medicinal plants, leading to the identification of 109 (67%) FL clones. Furthermore, the protocol allows for the use of multiple probes in a single hybridization event, thus significantly increasing the throughput when screening for rare transcripts. The presented strategy offers an efficient method for the conversion of incomplete expressed sequence tags (ESTs), such as cDNA-AFLP tags, to FL-coding sequences.
Characterization and chromosomal mapping of the human TFG gene involved in thyroid carcinoma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mencinger, M.; Panagopoulos, I.; Andreasson, P.
1997-05-01
Homology searches in the Expressed Sequence Tag Database were performed using SPYGQ-rich regions as query sequences to find genes encoding protein regions similar to the N-terminal parts of the sarcoma-associated EWS and FUS proteins. Clone 22911 (T74973), encoding a SPYGQ-rich region in its 5{prime} end, and several other clones that overlapped 22911 were selected. The combined data made it possible to assemble a full-length cDNA sequence. This cDNA sequence is 1677 bp, containing an initiation codon ATG, an open reading frame of 400 amino acids, a poly(A) signal, and a poly(A) tail. We found 100% identity between the 5{prime} partmore » of the consensus sequence and the 598-bp-long sequence named TFG. The TFG sequence is fused to the 3{prime} end of NTRK1, generating the TRK-T3 fusion transcript found in papillary thyroid carcinoma. The cDNA therefore represents the full-length transcript of the TFG gene. TFG was localized to 3q11-q12 by fluorescence in situ hybridization. The 3{prime} and the 5{prime} ends of the TFG cDNA probe hybridized to a 2.2-kb band on Northern blot filters in all tissues examined. 28 refs., 5 figs., 1 tab.« less
Paugh, Steven W.; Coss, David R.; Bao, Ju; ...
2016-02-04
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
Genes expressed during the development and ripening of watermelon fruit.
Levi, A; Davis, A; Hernandez, A; Wechter, P; Thimmapuram, J; Trebitsh, T; Tadmor, Y; Katzir, N; Portnoy, V; King, S
2006-11-01
A normalized cDNA library was constructed using watermelon flesh mRNA from three distinct developmental time-points and was subtracted by hybridization with leaf cDNA. Random cDNA clones of the watermelon flesh subtraction library were sequenced from the 5' end in order to identify potentially informative genes associated with fruit setting, development, and ripening. One-thousand and forty-six 5'-end sequences (expressed sequence tags; ESTs) were assembled into 832 non-redundant sequences, designated as "EST-unigenes". Of these 832 "EST-unigenes", 254 ( approximately 30%) have no significant homology to sequences published so far for other plant species. Additionally, 168 "EST-unigenes" ( approximately 20%) correspond to genes with unknown function, whereas 410 "EST-unigenes" ( approximately 50%) correspond to genes with known function in other plant species. These "EST-unigenes" are mainly associated with metabolism, membrane transport, cytoskeleton synthesis and structure, cell wall formation and cell division, signal transduction, nucleic acid binding and transcription factors, defense and stress response, and secondary metabolism. This study provides the scientific community with novel genetic information for watermelon as well as an expanded pool of genes associated with fruit development in watermelon. These genes will be useful targets in future genetic and functional genomic studies of watermelon and its development.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Paugh, Steven W.; Coss, David R.; Bao, Ju
MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less
de Cambiaire, Jean-Charles; Otis, Christian; Lemieux, Claude; Turmel, Monique
2006-01-01
Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. While the basal position of the Prasinophyceae is well established, the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae (UTC) remains uncertain. The five complete chloroplast DNA (cpDNA) sequences currently available for representatives of these classes display considerable variability in overall structure, gene content, gene density, intron content and gene order. Among these genomes, that of the chlorophycean green alga Chlamydomonas reinhardtii has retained the least ancestral features. The two single-copy regions, which are separated from one another by the large inverted repeat (IR), have similar sizes, rather than unequal sizes, and differ radically in both gene contents and gene organizations relative to the single-copy regions of prasinophyte and ulvophyte cpDNAs. To gain insights into the various changes that underwent the chloroplast genome during the evolution of chlorophycean green algae, we have sequenced the cpDNA of Scenedesmus obliquus, a member of a distinct chlorophycean lineage. Results The 161,452 bp IR-containing genome of Scenedesmus features single-copy regions of similar sizes, encodes 96 genes, i.e. only two additional genes (infA and rpl12) relative to its Chlamydomonas homologue and contains seven group I and two group II introns. It is clearly more compact than the four UTC algal cpDNAs that have been examined so far, displays the lowest proportion of short repeats among these algae and shows a stronger bias in clustering of genes on the same DNA strand compared to Chlamydomonas cpDNA. Like the latter genome, Scenedesmus cpDNA displays only a few ancestral gene clusters. The two chlorophycean genomes share 11 gene clusters that are not found in previously sequenced trebouxiophyte and ulvophyte cpDNAs as well as a few genes that have an unusual structure; however, their single-copy regions differ considerably in gene content. Conclusion Our results underscore the remarkable plasticity of the chlorophycean chloroplast genome. Owing to this plasticity, only a sketchy portrait could be drawn for the chloroplast genome of the last common ancestor of Scenedesmus and Chlamydomonas. PMID:16638149
Takai, Erina; Totoki, Yasushi; Nakamura, Hiromi; Kato, Mamoru; Shibata, Tatsuhiro; Yachida, Shinichi
2016-01-01
Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies. The genomic landscape of the PDAC genome features four frequently mutated genes (KRAS, CDKN2A, TP53, and SMAD4) and dozens of candidate driver genes altered at low frequency, including potential clinical targets. Circulating cell-free DNA (cfDNA) is a promising resource to detect molecular characteristics of tumors, supporting the concept of "liquid biopsy".We determined the mutational status of KRAS in plasma cfDNA using multiplex droplet digital PCR in 259 patients with PDAC, retrospectively. Furthermore, we constructed a novel modified SureSelect-KAPA-Illumina platform and an original panel of 60 genes. We then performed targeted deep sequencing of cfDNA in 48 patients who had ≥1 % mutant allele frequencies of KRAS in plasma cfDNA.Droplet digital PCR detected KRAS mutations in plasma cfDNA in 63 of 107 (58.9 %) patients with inoperable tumors. Importantly, potentially targetable somatic mutations were identified in 14 of 48 patients (29.2 %) examined by cfDNA sequencing.Our two-step approach with plasma cfDNA, combining droplet digital PCR and targeted deep sequencing, is a feasible clinical approach. Assessment of mutations in plasma cfDNA may provide a new diagnostic tool, assisting decisions for optimal therapeutic strategies for PDAC patients.
Smith, Michael G; Gianoulis, Tara A; Pukatzki, Stefan; Mekalanos, John J; Ornston, L Nicholas; Gerstein, Mark; Snyder, Michael
2007-03-01
Acinetobacter baumannii has emerged as an important and problematic human pathogen as it is the causative agent of several types of infections including pneumonia, meningitis, septicemia, and urinary tract infections. We explored the pathogenic content of this harmful pathogen using a combination of DNA sequencing and insertional mutagenesis. The genome of this organism was sequenced using a strategy involving high-density pyrosequencing, a novel, rapid method of high-throughput sequencing. Excluding the rDNA repeats, the assembled genome is 3,976,746 base pairs (bp) and has 3830 ORFs. A significant fraction of ORFs (17.2%) are located in 28 putative alien islands, indicating that the genome has acquired a large amount of foreign DNA. Consistent with its role in pathogenesis, a remarkable number of the islands (16) contain genes implicated in virulence, indicating the organism devotes a considerable portion of its genes to pathogenesis. The largest island contains elements homologous to the Legionella/Coxiella Type IV secretion apparatus. Type IV secretion systems have been demonstrated to be important for virulence in other organisms and thus are likely to help mediate pathogenesis of A. baumannii. Insertional mutagenesis generated avirulent isolates of A. baumannii and verified that six of the islands contain virulence genes, including two novel islands containing genes that lacked homology with others in the databases. The DNA sequencing approach described in this study allows the rapid elucidation of the DNA sequence of any microbe and, when combined with genetic screens, can identify many novel genes important for microbial pathogenesis.
Phylogenetic Network for European mtDNA
Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari
2001-01-01
The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229
Identification of Genes Related to Paulownia Witches’ Broom by AFLP and MSAP
Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng
2014-01-01
DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches’ broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L−1 MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB. PMID:25196603
Identification of genes related to Paulownia witches' broom by AFLP and MSAP.
Cao, Xibing; Fan, Guoqiang; Deng, Minjie; Zhao, Zhenli; Dong, Yanpeng
2014-08-21
DNA methylation is believed to play important roles in regulating gene expression in plant growth and development. Paulownia witches' broom (PaWB) infection has been reported to be related to gene expression changes in paulownia plantlets. To determine whether DNA methylation is associated with gene expression changes in response to phytoplasma, we investigated variations in genomic DNA sequence and methylation in PaWB plantlets treated with methyl methane sulfonate (MMS) using amplified fragment length polymorphism (AFLP) and methylation-sensitive amplification polymorphism (MSAP) techniques, respectively. The results indicated that PaWB seedings recovered a normal morphology after treatment with more than 15 mg·L(-1) MMS. PaWB infection did not cause changes of the paulownia DNA sequence at the AFLP level; However, DNA methylation levels and patterns were altered. Quantitative real-time PCR (qRT-PCR) showed that three of the methylated genes were up-regulated and three were down-regulated in the MMS-treated PaWB plantlets that had regained healthy morphology. These six genes might be involved in transcriptional regulation, plant defense, signal transduction and energy. The possible roles of these genes in PaWB are discussed. The results showed that changes of DNA methylation altered gene expression levels, and that MSAP might help identify genes related to PaWB.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Leong, JoAnn Ching
The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less
Biomimetic Artificial Epigenetic Code for Targeted Acetylation of Histones.
Taniguchi, Junichi; Feng, Yihong; Pandian, Ganesh N; Hashiya, Fumitaka; Hidaka, Takuya; Hashiya, Kaori; Park, Soyoung; Bando, Toshikazu; Ito, Shinji; Sugiyama, Hiroshi
2018-06-13
While the central role of locus-specific acetylation of histone proteins in eukaryotic gene expression is well established, the availability of designer tools to regulate acetylation at particular nucleosome sites remains limited. Here, we develop a unique strategy to introduce acetylation by constructing a bifunctional molecule designated Bi-PIP. Bi-PIP has a P300/CBP-selective bromodomain inhibitor (Bi) as a P300/CBP recruiter and a pyrrole-imidazole polyamide (PIP) as a sequence-selective DNA binder. Biochemical assays verified that Bi-PIPs recruit P300 to the nucleosomes having their target DNA sequences and extensively accelerate acetylation. Bi-PIPs also activated transcription of genes that have corresponding cognate DNA sequences inside living cells. Our results demonstrate that Bi-PIPs could act as a synthetic programmable histone code of acetylation, which emulates the bromodomain-mediated natural propagation system of histone acetylation to activate gene expression in a sequence-selective manner.
Myopathic mtDNA Depletion Syndrome Due to Mutation in TK2 Gene.
Martín-Hernández, Elena; García-Silva, María Teresa; Quijada-Fraile, Pilar; Rodríguez-García, María Elena; Hernández-Laín, Aurelio; Coca-Robinot, David; Rivera, Henry; Fernández-Toral, Joaquín; Arenas, Joaquín; Martín, MiguelÁngel; Martínez-Azorín, Francisco
2016-02-29
Whole-exome sequencing (WES) was used to identify the disease gene(s) in a Spanish girl with failure to thrive, muscle weakness, mild facial weakness, elevated creatine kinase (CK), deficiency of mitochondrial complex III and depletion of mtDNA. With WES data, it was possible to get the whole mtDNA sequencing and discard any pathogenic variant in this genome. The analysis of whole exome uncovered a homozygous pathogenic mutation in Thymidine kinase 2 gene (TK2; NM_004614.4:c.323C>T, p.T108M). TK2 mutations have been identified mainly in patients with the myopathic form of mtDNA depletion syndromes (MDS). This patient presents an atypical TK2 related-myopathic form of MDS, because despite having a very low content of mtDNA (<20%), she presents a slower and less severe evolution of the disease. In conclusion, our data confirm the role of TK2 gene in MDS and expanded the phenotypic spectrum.
DNA demethylation activates genes in seed maternal integument development in rice (Oryza sativa L.).
Wang, Yifeng; Lin, Haiyan; Tong, Xiaohong; Hou, Yuxuan; Chang, Yuxiao; Zhang, Jian
2017-11-01
DNA methylation is an important epigenetic modification that regulates various plant developmental processes. Rice seed integument determines the seed size. However, the role of DNA methylation in its development remains largely unknown. Here, we report the first dynamic DNA methylomic profiling of rice maternal integument before and after pollination by using a whole-genome bisulfite deep sequencing approach. Analysis of DNA methylation patterns identified 4238 differentially methylated regions underpin 4112 differentially methylated genes, including GW2, DEP1, RGB1 and numerous other regulators participated in maternal integument development. Bisulfite sanger sequencing and qRT-PCR of six differentially methylated genes revealed extensive occurrence of DNA hypomethylation triggered by double fertilization at IAP compared with IBP, suggesting that DNA demethylation might be a key mechanism to activate numerous maternal controlling genes. These results presented here not only greatly expanded the rice methylome dataset, but also shed novel insight into the regulatory roles of DNA methylation in rice seed maternal integument development. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.
Lam, Kathy N; Martens, Eric C; Charles, Trevor C
2018-01-01
Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.
[Current applications of high-throughput DNA sequencing technology in antibody drug research].
Yu, Xin; Liu, Qi-Gang; Wang, Ming-Rong
2012-03-01
Since the publication of a high-throughput DNA sequencing technology based on PCR reaction was carried out in oil emulsions in 2005, high-throughput DNA sequencing platforms have been evolved to a robust technology in sequencing genomes and diverse DNA libraries. Antibody libraries with vast numbers of members currently serve as a foundation of discovering novel antibody drugs, and high-throughput DNA sequencing technology makes it possible to rapidly identify functional antibody variants with desired properties. Herein we present a review of current applications of high-throughput DNA sequencing technology in the analysis of antibody library diversity, sequencing of CDR3 regions, identification of potent antibodies based on sequence frequency, discovery of functional genes, and combination with various display technologies, so as to provide an alternative approach of discovery and development of antibody drugs.
Epigenetics in Prostate Cancer
Albany, Costantine; Alva, Ajjai S.; Aparicio, Ana M.; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M.
2011-01-01
Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a “normal” epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases. PMID:22191037
Epigenetics in prostate cancer.
Albany, Costantine; Alva, Ajjai S; Aparicio, Ana M; Singal, Rakesh; Yellapragada, Sarvari; Sonpavde, Guru; Hahn, Noah M
2011-01-01
Prostate cancer (PC) is the most commonly diagnosed nonskin malignancy and the second most common cause of cancer death among men in the United States. Epigenetics is the study of heritable changes in gene expression caused by mechanisms other than changes in the underlying DNA sequences. Two common epigenetic mechanisms, DNA methylation and histone modification, have demonstrated critical roles in prostate cancer growth and metastasis. DNA hypermethylation of cytosine-guanine (CpG) rich sequence islands within gene promoter regions is widespread during neoplastic transformation of prostate cells, suggesting that treatment-induced restoration of a "normal" epigenome could be clinically beneficial. Histone modification leads to altered tumor gene function by changing chromosome structure and the level of gene transcription. The reversibility of epigenetic aberrations and restoration of tumor suppression gene function have made them attractive targets for prostate cancer treatment with modulators that demethylate DNA and inhibit histone deacetylases.
Sequence and Structure Dependent DNA-DNA Interactions
NASA Astrophysics Data System (ADS)
Kopchick, Benjamin; Qiu, Xiangyun
Molecular forces between dsDNA strands are largely dominated by electrostatics and have been extensively studied. Quantitative knowledge has been accumulated on how DNA-DNA interactions are modulated by varied biological constituents such as ions, cationic ligands, and proteins. Despite its central role in biology, the sequence of DNA has not received substantial attention and ``random'' DNA sequences are typically used in biophysical studies. However, ~50% of human genome is composed of non-random-sequence DNAs, particularly repetitive sequences. Furthermore, covalent modifications of DNA such as methylation play key roles in gene functions. Such DNAs with specific sequences or modifications often take on structures other than the canonical B-form. Here we present series of quantitative measurements of the DNA-DNA forces with the osmotic stress method on different DNA sequences, from short repeats to the most frequent sequences in genome, and to modifications such as bromination and methylation. We observe peculiar behaviors that appear to be strongly correlated with the incurred structural changes. We speculate the causalities in terms of the differences in hydration shell and DNA surface structures.
NASA Astrophysics Data System (ADS)
Novianti, T.; Sadikin, M.; Widia, S.; Juniantito, V.; Arida, E. A.
2018-03-01
Development of unidentified specific gene is essential to analyze the availability these genes in biological process. Identification unidentified specific DNA of HIF 1α genes is important to analyze their contribution in tissue regeneration process in lizard tail (Hemidactylus platyurus). Bioinformatics and PCR techniques are relatively an easier method to identify an unidentified gene. The most widely used method is BLAST (Basic Local Alignment Sequence Tools) method for alignment the sequences from the other organism. BLAST technique is online software from website https://blast.ncbi.nlm.nih.gov/Blast.cgi that capable to generate the similar sequences from closest kinship to distant kindship. Gecko japonicus is a species that it has closest kinship with H. platyurus. Comparing HIF 1 α gene sequence of G. japonicus with the other species used multiple alignment methods from Mega7 software. Conserved base areas were identified using Clustal IX method. Primary DNA of HIF 1 α gene was design by Primer3 software. HIF 1α gene of lizard (H. platyurus) was successfully amplified using a real-time PCR machine by primary DNA that we had designed from Gecko japonicus. Identification unidentified gene of HIF 1a lizard has been done successfully with multiple alignment method. The study was conducted by analyzing during the growth of tail on day 1, 3, 5, 7, 10, 13 and 17 of lizard tail after autotomy. Process amplification of HIF 1α gene was described by CT value in real time PCR machine. HIF 1α expression of gene is quantified by Livak formula. Chi-square statistic test is 0.000 which means that there is a different expression of HIF 1 α gene in every growth day treatment.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-02-15
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.
Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena
2002-01-01
Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (ɛ globin, p53 and γ interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to αλµοστ 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed. PMID:11842122
Kaushik, Mahima; Kukreti, Shrikant
2015-01-01
Our previous work on structural polymorphism shown at a single nucleotide polymorphism (SNP) (A → G) site located on HS4 region of locus control region (LCR) of β-globin gene has established a hairpin → duplex equilibrium corresponding to A → B like DNA transition (Kaushik M, Kukreti, R., Grover, D., Brahmachari, S.K. and Kukreti S. Nucleic Acids Res. 2003; Kaushik M, Kukreti S. Nucleic Acids Res. 2006). The G-allele of A → G SNP has been shown to be significantly associated with the occurrence of β-thalassemia. Considering the significance of this 11-nt long quasi-palindromic sequence [5'-TGGGG(G/A)CCCCA; HP(G/A)11] of β-globin gene LCR, we further explored the differential behavior of the same DNA sequence with its RNA counterpart, using various biophysical and biochemical techniques. In contrast to its DNA counterpart exhibiting a A → B structural transition and an equilibrium between duplex and hairpin forms, the studied RNA oligonucleotide sequence [5'-UGGGG(G/A)CCCCA; RHP(G/A)11] existed only in duplex form (A-conformation) and did not form hairpin. The single residue difference from A to G led to the unusual thermal stability of the RNA structure formed by the studied sequence. Since, naturally occurring mutations and various SNP sites may stabilize or destabilize the local DNA/RNA secondary structures, these structural transitions may affect the gene expression by a change in the protein-DNA recognition patterns.
Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.
2014-01-01
The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655
Hoshino, Tatsuhiko; Inagaki, Fumio
2017-01-01
Next-generation sequencing (NGS) is a powerful tool for analyzing environmental DNA and provides the comprehensive molecular view of microbial communities. For obtaining the copy number of particular sequences in the NGS library, however, additional quantitative analysis as quantitative PCR (qPCR) or digital PCR (dPCR) is required. Furthermore, number of sequences in a sequence library does not always reflect the original copy number of a target gene because of biases caused by PCR amplification, making it difficult to convert the proportion of particular sequences in the NGS library to the copy number using the mass of input DNA. To address this issue, we applied stochastic labeling approach with random-tag sequences and developed a NGS-based quantification protocol, which enables simultaneous sequencing and quantification of the targeted DNA. This quantitative sequencing (qSeq) is initiated from single-primer extension (SPE) using a primer with random tag adjacent to the 5' end of target-specific sequence. During SPE, each DNA molecule is stochastically labeled with the random tag. Subsequently, first-round PCR is conducted, specifically targeting the SPE product, followed by second-round PCR to index for NGS. The number of random tags is only determined during the SPE step and is therefore not affected by the two rounds of PCR that may introduce amplification biases. In the case of 16S rRNA genes, after NGS sequencing and taxonomic classification, the absolute number of target phylotypes 16S rRNA gene can be estimated by Poisson statistics by counting random tags incorporated at the end of sequence. To test the feasibility of this approach, the 16S rRNA gene of Sulfolobus tokodaii was subjected to qSeq, which resulted in accurate quantification of 5.0 × 103 to 5.0 × 104 copies of the 16S rRNA gene. Furthermore, qSeq was applied to mock microbial communities and environmental samples, and the results were comparable to those obtained using digital PCR and relative abundance based on a standard sequence library. We demonstrated that the qSeq protocol proposed here is advantageous for providing less-biased absolute copy numbers of each target DNA with NGS sequencing at one time. By this new experiment scheme in microbial ecology, microbial community compositions can be explored in more quantitative manner, thus expanding our knowledge of microbial ecosystems in natural environments.
Novel variants of the 5S rRNA genes in Eruca sativa.
Singh, K; Bhatia, S; Lakshmikumaran, M
1994-02-01
The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)
Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites
Prouse, Michael B.; Campbell, Malcolm M.
2013-01-01
Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471
Liu, Tianyu; Liang, Yinan; Zhong, Xiuqin; Wang, Ning; Hu, Dandan; Zhou, Xuan; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou
2014-01-01
Dirofilaria immitis (heartworm) is the causative agent of an important zoonotic disease that is spread by mosquitoes. In this study, molecular and phylogenetic characterization of D. immitis were performed based on complete ND1 and 16S rDNA gene sequences, which provided the foundation for more advanced molecular diagnosis, prevention, and control of heartworm diseases. The mutation rate and evolutionary divergence in adult heartworm samples from seven dogs in western China were analyzed to obtain information on genetic diversity and variability. Phylogenetic relationships were inferred using both maximum parsimony (MP) and Bayes methods based on the complete gene sequences. The results suggest that D. immitis formed an independent monophyletic group in which the 16S rDNA gene has mutated more rapidly than has ND1. PMID:24639299
Tange, N; Jong-Young, L; Mikawa, N; Hirono, I; Aoki, T
1997-12-01
A cDNA clone of rainbow trout (Oncorhynchus mykiss) transferrin was obtained from a liver cDNA library. The 2537-bp cDNA sequence contained an open reading frame encoding 691 amino acids and the 5' and 3' noncoding regions. The amino acid sequences at the iron-binding sites and the two N-linked glycosylation sites, and the cysteine residues were consistent with known, conserved vertebrate transferrin cDNA sequences. Single N-linked glycosylation sites existed on the N- and C-lobe. The deduced amino acid sequence of the rainbow trout transferrin cDNA had 92.9% identities with transferrin of coho salmon (Oncorhynchus kisutch); 85%, Atlantic salmon (Salmo salar); 67.3%, medaka (Oryzias latipes); 61.3% Atlantic cod (Gadus morhua); and 59.7%, Japanese flounder (Paralichthys olivaceus). The long and accurate polymerase chain reaction (LA-PCR) was used to amplify approximately 6.5 kb of the transferrin gene from rainbow trout genomic DNA. Restriction fragment length polymorphisms (RFLPs) of the LA-PCR products revealed three digestion patterns in 22 samples.
Cavalier-Smith, Thomas
2015-04-01
Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.
Hall, R L; Moyer, R W
1991-01-01
Entomopoxvirus virions are frequently contained within crystalline occlusion bodies, which are composed of primarily a single protein, spheroidin, which is analogous to the polyhedrin protein of baculovirus. The spheroidin gene of Amsacta moorei entomopoxvirus was identified following the microsequencing of polypeptides generated from cyanogen bromide treatment of spheroidin and the subsequent synthesis of oligonucleotide hybridization probes. DNA sequencing of a 6.8-kb region of DNA containing the spheroidin gene showed that the spheroidin protein is derived from a 3.0-kb open reading frame potentially encoding a protein of 115 kDa. Three copies of the heptanucleotide, TTTTTNT, a sequence associated with early gene transcription in the vertebrate poxviruses, and four in-frame translational termination signals were found within 60 bp upstream of the putative spheroidin gene promoter (TAAATG). The spheroidin gene promoter region contains the sequence TAAATG, which is found in many late promoters of the vertebrate poxviruses and which serves as the site of transcriptional initiation, as shown by primer extension. Primer extension experiments also showed that spheroidin gene transcripts contain 5' poly(A) sequences typical of vertebrate poxvirus late transcripts. The 92 bases upstream of the initiating TAAATG are unusually A + T rich and contain only 7 G or C residues. An analysis of open reading frames around the spheroidin gene suggests that the colinear core of "essential genes" typical of the vertebrate poxviruses is absent in A. moorei entomopoxvirus. Images PMID:1942245
Santini, A C; Santos, H R M; Gross, E; Corrêa, R X
2013-03-11
The genus Burkholderia (β-Proteobacteria) currently comprises more than 60 species, including parasites, symbionts and free-living organisms. Several new species of Burkholderia have recently been described showing a great diversity of phenotypes. We examined the diversity of Burkholderia spp in environmental samples collected from Caatinga and Atlantic rainforest biomes of Bahia, Brazil. Legume nodules were collected from five locations, and 16S rDNA and recA genes of the isolated microorganisms were analyzed. Thirty-three contigs of 16S rRNA genes and four contigs of the recA gene related to the genus Burkholderia were obtained. The genetic dissimilarity of the strains ranged from 0 to 2.5% based on 16S rDNA analysis, indicating two main branches: one distinct branch of the dendrogram for the B. cepacia complex and another branch that rendered three major groups, partially reflecting host plants and locations. A dendrogram designed with sequences of this research and those designed with sequences of Burkholderia-type strains and the first hit BLAST had similar topologies. A dendrogram similar to that constructed by analysis of 16S rDNA was obtained using sequences of the fragment of the recA gene. The 16S rDNA sequences enabled sufficient identification of relevant similarities and groupings amongst isolates and the sequences that we obtained. Only 6 of the 33 isolates analyzed via 16S rDNA sequencing showed high similarity with the B. cepacia complex. Thus, over 3/4 of the isolates have potential for biotechnological applications.
NASA Astrophysics Data System (ADS)
Mackiewicz, P.; Gierlik, A.; Kowalczuk, M.; Szczepanik, D.; Dudek, M. R.; Cebrat, S.
1999-12-01
We have analysed protein coding and intergenic sequences in the Borrelia burgdorferi (the Lyme disease bacterium) genome using different kinds of DNA walks. Genes occupying the leading strand of DNA have significantly different nucleotide composition from genes occupying the lagging strand. Nucleotide compositional bias of the two DNA strands reflects the aminoacid composition of proteins. 96% of genes coding for ribosomal proteins lie on the leading DNA strand, which suggests that the positions of these as well as other genes are non-random. In the B. burgdorferi genome, the asymmetry in intergenic DNA sequences is lower than the asymmetry in the third positions in codons. All these characters of the B. burgdorferi genome suggest that both replication-associated mutational pressure and recombination mechanisms have established the specific structure of the genome and now any recombination leading to inversion of a gene in respect to the direction of replication is forbidden. This property of the genome allows us to assume that it is in a steady state, which enables us to fix some parameters for simulations of DNA evolution.
Genomics in Cardiovascular Disease
Roberts, Robert; Marian, A.J.; Dandona, Sonny; Stewart, Alexandre F.R.
2013-01-01
A paradigm shift towards biology occurred in the 1990’s subsequently catalyzed by the sequencing of the human genome in 2000. The cost of DNA sequencing has gone from millions to thousands of dollars with sequencing of one’s entire genome costing only $1,000. Rapid DNA sequencing is being embraced for single gene disorders, particularly for sporadic cases and those from small families. Transmission of lethal genes such as associated with Huntington’s disease can, through in-vitro fertilization, avoid passing it on to one’s offspring. DNA sequencing will meet the challenge of elucidating the genetic predisposition for common polygenic diseases, especially in determining the function of the novel common genetic risk variants and identifying the rare variants, which may also partially ascertain the source of the missing heritability. The challenge for DNA sequencing remains great, despite human genome sequences being 99.5% identical, the 3 million single nucleotide polymorphisms (SNPs) responsible for most of the unique features add up to 60 new mutations per person which, for 7 billion people, is 420 billion mutations. It is claimed that DNA sequencing has increased 10,000 fold while information storage and retrieval only 16 fold. The physician and health user will be challenged by the convergence of two major trends, whole genome sequencing and the storage/retrieval and integration of the data. PMID:23524054
[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].
Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui
2016-10-01
To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.
Feng, X; Happ, G M
1996-11-14
The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.
Ruppitsch, W; Stöger, A; Indra, A; Grif, K; Schabereiter-Gurtner, C; Hirschl, A; Allerberger, F
2007-03-01
In a bioterrorism event a rapid tool is needed to identify relevant dangerous bacteria. The aim of the study was to assess the usefulness of partial 16S rRNA gene sequence analysis and the suitability of diverse databases for identifying dangerous bacterial pathogens. For rapid identification purposes a 500-bp fragment of the 16S rRNA gene of 28 isolates comprising Bacillus anthracis, Brucella melitensis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis, Yersinia pestis, and eight genus-related and unrelated control strains was amplified and sequenced. The obtained sequence data were submitted to three public and two commercial sequence databases for species identification. The most frequent reason for incorrect identification was the lack of the respective 16S rRNA gene sequences in the database. Sequence analysis of a 500-bp 16S rDNA fragment allows the rapid identification of dangerous bacterial species. However, for discrimination of closely related species sequencing of the entire 16S rRNA gene, additional sequencing of the 23S rRNA gene or sequencing of the 16S-23S rRNA intergenic spacer is essential. This work provides comprehensive information on the suitability of partial 16S rDNA analysis and diverse databases for rapid and accurate identification of dangerous bacterial pathogens.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zezza, D.J.; Stewart, S.E.; Steiner, L.A.
1992-12-15
Xenopus laevis Ig contain two distinct types of L chains, designated [rho] or L1 and [sigma] or L2. The authors have analyzed Xenopus genomic DNA by Southern blotting with cDNA probes specific for L1 V and C regions. Many fragments hybridized to the V probe, but only one or two fragments hybridized to the C probe. Corresponding C, J, and V gene segments were identified on clones isolated from a genomic library prepared from the same DNA. One clone contains a C gene segment separated from a J gene segment by an intron of 3.4 kb. The J and Cmore » gene segments are nearly identical in sequence to cDNA clones analyzed previously. The C segment is somewhat more similar and the J segment considerably more similar in sequence to the corresponding segments of mammalian [kappa] chains than to those of mammalian [lambda] chains. Upstream of the J segment is a typical recombination signal sequence with a spacer of 23 bp, as in J[kappa]. A second clone from the library contains four V gene segments, separated by 2.1 to 3.6 kb. Two of these, V1 and V3, have the expected structural and regulatory features of V genes, and are very similar in sequence to each other and to mammalian V[kappa]. A third gene segment, V2, resembles V1 and V3 in its coding region and nearby 5[prime]-flanking region, but diverges in sequence 5[prime] to position [minus]95 with loss of the octamer promoter element. The fourth V-like segment is similar to the others at the 3[prime]-end, but upstream of codon 64 bears no resemblance in sequence to any Ig V region. All four V segments have typical recombination signal sequences with 12-bp spacers at their 3[prime]-ends, as in V[kappa]. Taken together, the data suggest that Xenopus L1 L chain genes are members of the [kappa] gene family. 80 refs., 9 figs.« less
Structure of the horseradish peroxidase isozyme C genes.
Fujiyama, K; Takemura, H; Shibayama, S; Kobayashi, K; Choi, J K; Shinmyo, A; Takano, M; Yamada, Y; Okada, H
1988-05-02
We have isolated, cloned and characterized three cDNAs and two genomic DNAs corresponding to the mRNAs and genes for the horseradish (Armoracia rusticana) peroxidase isoenzyme C (HPR C). The amino acid sequence of HRP C1, deduced from the nucleotide sequence of one of the cDNA clone, pSK1, contained the same primary sequence as that of the purified enzyme established by Welinder [FEBS Lett. 72, 19-23 (1976)] with additional sequences at the N and C terminal. All three inserts in the cDNA clones, pSK1, pSK2 and pSK3, coded the same size of peptide (308 amino acid residues) if these are processed in the same way, and the amino acid sequence were homologous to each other by 91-94%. Functional amino acids, including His40, His170, Tyr185 and Arg183 and S-S-bond-forming Cys, were conserved in the three isozymes, but a few N-glycosylation sites were not the same. Two HRP C isoenzyme genomic genes, prxC1 and prxC2, were tandem on the chromosomal DNA and each gene consisted of four exons and three introns. The positions in the exons interrupted by introns were the same in two genes. We observed a putative promoter sequence 5' upstream and a poly(A) signal 3' downstream in both genes. The gene product of prxC1 might be processed with a signal sequence of 30 amino acid residues at the N terminus and a peptide consisting of 15 amino acid residues at the C terminus.
Transcriptome analysis by strand-specific sequencing of complementary DNA
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-01-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212
Transcriptome analysis by strand-specific sequencing of complementary DNA.
Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey
2009-10-01
High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.
Arnold, Frances H.; Shao, Zhixin; Zhao, Huimin; Giver, Lorraine J.
2002-01-01
A method for in vitro mutagenesis and recombination of polynucleotide sequences based on polymerase-catalyzed extension of primer oligonucleotides is disclosed. The method involves priming template polynucleotide(s) with random-sequences or defined-sequence primers to generate a pool of short DNA fragments with a low level of point mutations. The DNA fragments are subjected to denaturization followed by annealing and further enzyme-catalyzed DNA polymerization. This procedure is repeated a sufficient number of times to produce full-length genes which comprise mutants of the original template polynucleotides. These genes can be further amplified by the polymerase chain reaction and cloned into a vector for expression of the encoded proteins.
Three closely related herpesviruses are associated with fibropapillomatosis in marine turtles
Quackenbush, S.L.; Work, Thierry M.; Balazs, George H.; Casey, Rufina N.; Rovnak, J.; Chaves, A.; duToit, L.; Baines, J.D.; Parrish, C.R.; Bowser, Paul R.; Casey, James W.
1998-01-01
Green turtle fibropapillomatosis is a neoplastic disease of increasingly significant threat to the survivability of this species. Degenerate PCR primers that target highly conserved regions of genes encoding herpesvirus DNA polymerases were used to amplify a DNA sequence from fibropapillomas and fibromas from Hawaiian and Florida green turtles. All of the tumors tested (n= 23) were found to harbor viral DNA, whereas no viral DNA was detected in skin biopsies from tumor-negative turtles. The tissue distribution of the green turtle herpesvirus appears to be generally limited to tumors where viral DNA was found to accumulate at approximately two to five copies per cell and is occasionally detected, only by PCR, in some tissues normally associated with tumor development. In addition, herpesviral DNA was detected in fibropapillomas from two loggerhead and four olive ridley turtles. Nucleotide sequencing of a 483-bp fragment of the turtle herpesvirus DNA polymerase gene determined that the Florida green turtle and loggerhead turtle sequences are identical and differ from the Hawaiian green turtle sequence by five nucleotide changes, which results in two amino acid substitutions. The olive ridley sequence differs from the Florida and Hawaiian green turtle sequences by 15 and 16 nucleotide changes, respectively, resulting in four amino acid substitutions, three of which are unique to the olive ridley sequence. Our data suggest that these closely related turtle herpesviruses are intimately involved in the genesis of fibropapillomatosis.
2011-01-01
Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637
Clinical utility of circulating tumor DNA for molecular assessment in pancreatic cancer.
Takai, Erina; Totoki, Yasushi; Nakamura, Hiromi; Morizane, Chigusa; Nara, Satoshi; Hama, Natsuko; Suzuki, Masami; Furukawa, Eisaku; Kato, Mamoru; Hayashi, Hideyuki; Kohno, Takashi; Ueno, Hideki; Shimada, Kazuaki; Okusaka, Takuji; Nakagama, Hitoshi; Shibata, Tatsuhiro; Yachida, Shinichi
2015-12-16
Pancreatic ductal adenocarcinoma (PDAC) remains one of the most lethal malignancies. The genomic landscape of the PDAC genome features four frequently mutated genes (KRAS, CDKN2A, TP53, and SMAD4) and dozens of candidate driver genes altered at low frequency, including potential clinical targets. Circulating cell-free DNA (cfDNA) is a promising resource to detect and monitor molecular characteristics of tumors. In the present study, we determined the mutational status of KRAS in plasma cfDNA using multiplex picoliter-droplet digital PCR in 259 patients with PDAC. We constructed a novel modified SureSelect-KAPA-Illumina platform and an original panel of 60 genes. We then performed targeted deep sequencing of cfDNA and matched germline DNA samples in 48 patients who had ≥1% mutant allele frequencies of KRAS in plasma cfDNA. Importantly, potentially targetable somatic mutations were identified in 14 of 48 patients (29.2%) examined by targeted deep sequencing of cfDNA. We also analyzed somatic copy number alterations based on the targeted sequencing data using our in-house algorithm, and potentially targetable amplifications were detected. Assessment of mutations and copy number alterations in plasma cfDNA may provide a prognostic and diagnostic tool to assist decisions regarding optimal therapeutic strategies for PDAC patients.
Structure of CARB-4 and AER-1 CarbenicillinHydrolyzing β-Lactamases
Sanschagrin, François; Bejaoui, Noureddine; Levesque, Roger C.
1998-01-01
We determined the nucleotide sequences of blaCARB-4 encoding CARB-4 and deduced a polypeptide of 288 amino acids. The gene was characterized as a variant of group 2c carbenicillin-hydrolyzing β-lactamases such as PSE-4, PSE-1, and CARB-3. The level of DNA homology between the bla genes for these β-lactamases varied from 98.7 to 99.9%, while that between these genes and blaCARB-4 encoding CARB-4 was 86.3%. The blaCARB-4 gene was acquired from some other source because it has a G+C content of 39.1%, compared to a G+C content of 67% for typical Pseudomonas aeruginosa genes. DNA sequencing revealed that blaAER-1 shared 60.8% DNA identity with blaPSE-3 encoding PSE-3. The deduced AER-1 β-lactamase peptide was compared to class A, B, C, and D enzymes and had 57.6% identity with PSE-3, including an STHK tetrad at the active site. For CARB-4 and AER-1, conserved canonical amino acid boxes typical of class A β-lactamases were identified in a multiple alignment. Analysis of the DNA sequences flanking blaCARB-4 and blaAER-1 confirmed the importance of gene cassettes acquired via integrons in bla gene distribution. PMID:9687391
Réfega, Susana; Girard-Misguich, Fabienne; Bourdieu, Christiane; Péry, Pierre; Labbé, Marie
2003-04-02
Specific antibodies were produced ex vivo from intestinal culture of Eimeria tenella infected chickens. The specificity of these intestinal antibodies was tested against different parasite stages. These antibodies were used to immunoscreen first generation schizont and sporozoite cDNA libraries permitting the identification of new E. tenella antigens. We obtained a total of 119 cDNA clones which were subjected to sequence analysis. The sequences coding for the proteins inducing local immune responses were compared with nucleotide or protein databases and with expressed sequence tags (ESTs) databases. We identified new Eimeria genes coding for heat shock proteins, a ribosomal protein, a pyruvate kinase and a pyridoxine kinase. Specific features of other sequences are discussed.
iMETHYL: an integrative database of human DNA methylation, gene expression, and genomic variation.
Komaki, Shohei; Shiwa, Yuh; Furukawa, Ryohei; Hachiya, Tsuyoshi; Ohmomo, Hideki; Otomo, Ryo; Satoh, Mamoru; Hitomi, Jiro; Sobue, Kenji; Sasaki, Makoto; Shimizu, Atsushi
2018-01-01
We launched an integrative multi-omics database, iMETHYL (http://imethyl.iwate-megabank.org). iMETHYL provides whole-DNA methylation (~24 million autosomal CpG sites), whole-genome (~9 million single-nucleotide variants), and whole-transcriptome (>14 000 genes) data for CD4 + T-lymphocytes, monocytes, and neutrophils collected from approximately 100 subjects. These data were obtained from whole-genome bisulfite sequencing, whole-genome sequencing, and whole-transcriptome sequencing, making iMETHYL a comprehensive database.
Genomics approach to the environmental community of microorganisms
NASA Astrophysics Data System (ADS)
Kawarabayasi, Y.; Maruyama, A.
2004-12-01
It was indicated by microscopic observation or comparison of 16S rDNA sequence that many extremophiles were surviving in many hydrothermal environments. But it is generally said that over 99% of total microbes are now uncultivable. Thus, we planned to identify uncultivable microbes through direct sequencing of environmental DNA. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected from low-temperature hydrothermal water at RM24 in the Southern East Pacific Rise (S-EPR). It was shown that the sequences of some number of clones indicated the similar feature to the intron in eukaryote or tandem repetitive sequence identified in some human familiar diseases. The results indicated that many microorganisms with eukaryotic feature were dominant in low temperature water of S-EPR. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. The ORFs were easily identified all clones determined entire sequence. Thus it can be said that hot springs is good resources for searching novel genes. At last, the mixed microbes isolated from Suiyo seamount were used for construction of shotgun library. The clones in this library contained the ORFs. From some clones in hot spring and Suiyo sample, aminoacyl-tRNA synthatase, which is generally present in all organisms, was isolated by similarity. The phylogenetic analysis of aminoacyl-tRNA synthetase identified indicated that novel and unidentified microorganisms should be present in hot spring or Suiyo seamount. The novel genes identified from Suiyo seamount were also utilized for expression in E. coli. Some gene products were successfully obtained from the E. coli cells as soluble proteins. Some protein indicated the thermostability up to 70_E#8249;C, meaning that the original host cell of this gene should be stable up to the same temperature. Our work indicates that environmental genomics, including the direct cloning, sequencing of environmental DNA and expression of gene identified, is powerful approach to collect novel uncultivable microbes or novel active genes.
DNA methylation of retrotransposons, DNA transposons and genes in sugar beet (Beta vulgaris L.).
Zakrzewski, Falk; Schmidt, Martin; Van Lijsebettens, Mieke; Schmidt, Thomas
2017-06-01
The methylation of cytosines shapes the epigenetic landscape of plant genomes, coordinates transgenerational epigenetic inheritance, represses the activity of transposable elements (TEs), affects gene expression and, hence, can influence the phenotype. Sugar beet (Beta vulgaris ssp. vulgaris), an important crop that accounts for 30% of worldwide sugar needs, has a relatively small genome size (758 Mbp) consisting of approximately 485 Mbp repetitive DNA (64%), in particular satellite DNA, retrotransposons and DNA transposons. Genome-wide cytosine methylation in the sugar beet genome was studied in leaves and leaf-derived callus with a focus on repetitive sequences, including retrotransposons and DNA transposons, the major groups of repetitive DNA sequences, and compared with gene methylation. Genes showed a specific methylation pattern for CG, CHG (H = A, C, and T) and CHH sites, whereas the TE pattern differed, depending on the TE class (class 1, retrotransposons and class 2, DNA transposons). Along genes and TEs, CG and CHG methylation was higher than that of adjacent genomic regions. In contrast to the relatively low CHH methylation in retrotransposons and genes, the level of CHH methylation in DNA transposons was strongly increased, pointing to a functional role of asymmetric methylation in DNA transposon silencing. Comparison of genome-wide DNA methylation between sugar beet leaves and callus revealed a differential methylation upon tissue culture. Potential epialleles were hypomethylated (lower methylation) at CG and CHG sites in retrotransposons and genes and hypermethylated (higher methylation) at CHH sites in DNA transposons of callus when compared with leaves. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Satellite DNA-based artificial chromosomes for use in gene therapy.
Hadlaczky, G
2001-04-01
Satellite DNA-based artificial chromosomes (SATACs) can be made by induced de novo chromosome formation in cells of different mammalian species. These artificially generated accessory chromosomes are composed of predictable DNA sequences and they contain defined genetic information. Prototype human SATACs have been successfully constructed in different cell types from 'neutral' endogenous DNA sequences from the short arm of the human chromosome 15. SATACs have already passed a number of hurdles crucial to their further development as gene therapy vectors, including: large-scale purification; transfer of purified artificial chromosomes into different cells and embryos; generation of transgenic animals and germline transmission with purified SATACs; and the tissue-specific expression of a therapeutic gene from an artificial chromosome in the milk of transgenic animals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khani, S.C.; Lin, D.; Magovcevic, I.
1994-09-01
Rhodopsin kinase (RK) is a cytosolic enzyme in rod photoreceptors that initiates the deactivation of the phototransductions cascade by phosphorylating photoactivated rhodopsin. Although the cDNA sequence of bovine RK has been determined previously, no human cDNA or genomic sequence has thus far been available for genetic studies. In order to investigate the possible role of this candidate gene in retinitis pigmentosa (RP) and allied diseases, we have isolated and characterized human cDNA and genomic clones derived from the RK locus. The coding sequence of the human gene is 1692 nucleotides in length and is split into seven exons. The humanmore » and the bovine sequence show 84% identity at the nucleotide level and 92% identity at the amino acid level. Thus far, the intronic sequences flanking each exon except for one have been determined. We have also mapped the human RK gene to chromosome 13q34 using fluorescence in situ hybridization. To our knowledge, no RP gene has as yet been linked to this region. However, since the substrate for RK (rhodopsin) and other members of the phototransduction cascade have been implicated in the pathogenesis of RP, it is conceivable that defects in RK can also cause some forms of this disease. We are evaluating this possibility by screening DNA from 173 patients with autosomal recessive RP and 190 patients with autosomal dominant RP. So far, we have found 11 patients with variant bands. In one patient with autosomal dominant RP we discovered the missense change Ser536Leu. Cosegregation studies and further sequencing of the variant bands are currently underway.« less
The Chapel Hill hemophilia A dog colony exhibits a factor VIII gene inversion
Lozier, Jay N.; Dutra, Amalia; Pak, Evgenia; Zhou, Nan; Zheng, Zhili; Nichols, Timothy C.; Bellinger, Dwight A.; Read, Marjorie; Morgan, Richard A.
2002-01-01
In the Chapel Hill colony of factor VIII-deficient dogs, abnormal sequence (ch8, for canine hemophilia 8, GenBank no. AF361485) follows exons 1–22 in the factor VIII transcript in place of exons 23–26. The canine hemophilia 8 locus (ch8) sequence was found in a 140-kb normal dog genomic DNA bacterial artificial chromosome (BAC) clone that was completely outside the factor VIII gene, but not in BAC clones containing the factor VIII gene. The BAC clone that contained ch8 also contained a homologue of F8A (factor 8 associated) sequence, which participates in a common inversion that causes severe hemophilia A in humans. Fluorescence in situ hybridization analysis indicated that exons 1–26 normally proceed sequentially from telomere to centromere at Xq28, and ch8 is telomeric to the factor VIII gene. The appearance of an “upstream” genomic sequence element (ch8) at the end of the aberrant factor VIII transcript suggested that an inversion of genomic DNA replaced factor VIII exons 22–26 with ch8. The F8A sequence appeared also in overlapping normal BAC clones containing factor VIII sequence. We hypothesized that homologous recombination between copies of canine F8A inside and outside the factor VIII gene had occurred, as in human hemophilia A. High-resolution fluorescent in situ hybridization on hemophilia A dog DNA revealed a pattern consistent with this inversion mechanism. We also identified a HindIII restriction fragment length polymorphism of F8A fragments that distinguished hemophilia A, carrier, and normal dogs' DNA. The Chapel Hill hemophilia A dog colony therefore replicates the factor VIII gene inversion commonly seen in humans with severe hemophilia A. PMID:12242334
Genetic Perturbation of the Maize Methylome[W
Li, Qing; Hermanson, Peter J.; Zaunbrecher, Virginia M.; Song, Jawon; Wendt, Jennifer; Rosenbaum, Heidi; Madzima, Thelma F.; Sloan, Amy E.; Huang, Ji; Burgess, Daniel L.; Richmond, Todd A.; McGinnis, Karen M.; Meeley, Robert B.; Danilevskaya, Olga N.; Vaughn, Matthew W.; Kaeppler, Shawn M.; Jeddeloh, Jeffrey A.
2014-01-01
DNA methylation can play important roles in the regulation of transposable elements and genes. A collection of mutant alleles for 11 maize (Zea mays) genes predicted to play roles in controlling DNA methylation were isolated through forward- or reverse-genetic approaches. Low-coverage whole-genome bisulfite sequencing and high-coverage sequence-capture bisulfite sequencing were applied to mutant lines to determine context- and locus-specific effects of these mutations on DNA methylation profiles. Plants containing mutant alleles for components of the RNA-directed DNA methylation pathway exhibit loss of CHH methylation at many loci as well as CG and CHG methylation at a small number of loci. Plants containing loss-of-function alleles for chromomethylase (CMT) genes exhibit strong genome-wide reductions in CHG methylation and some locus-specific loss of CHH methylation. In an attempt to identify stocks with stronger reductions in DNA methylation levels than provided by single gene mutations, we performed crosses to create double mutants for the maize CMT3 orthologs, Zmet2 and Zmet5, and for the maize DDM1 orthologs, Chr101 and Chr106. While loss-of-function alleles are viable as single gene mutants, the double mutants were not recovered, suggesting that severe perturbations of the maize methylome may have stronger deleterious phenotypic effects than in Arabidopsis thaliana. PMID:25527708
RapGene: a fast and accurate strategy for synthetic gene assembly in Escherichia coli
Zampini, Massimiliano; Stevens, Pauline Rees; Pachebat, Justin A.; Kingston-Smith, Alison; Mur, Luis A. J.; Hayes, Finbarr
2015-01-01
The ability to assemble DNA sequences de novo through efficient and powerful DNA fabrication methods is one of the foundational technologies of synthetic biology. Gene synthesis, in particular, has been considered the main driver for the emergence of this new scientific discipline. Here we describe RapGene, a rapid gene assembly technique which was successfully tested for the synthesis and cloning of both prokaryotic and eukaryotic genes through a ligation independent approach. The method developed in this study is a complete bacterial gene synthesis platform for the quick, accurate and cost effective fabrication and cloning of gene-length sequences that employ the widely used host Escherichia coli. PMID:26062748
Crosby, Lynn; Casey, Warren; Morgan, Kevin; Ni, Hong; Yoon, Lawrence; Easton, Marilyn; Misukonis, Mary; Burleson, Gary; Ghosh, Dipak K.
2010-01-01
Specific bacterial lipopolysaccharides (LPS), IFN-γ, and unmethylated cytosine or guanosine-phosphorothioate containing DNAs (CpG) activate host immunity, influencing infectious responses. Macrophages detect, inactivate and destroy infectious particles, and synthetic CpG sequences invoke similar responses of the innate immune system. Previously, murine macrophage J774 cells treated with CpG induced the expression of nitric oxide synthase 2 (NOS2) and cyclo-oxygenase 2 (COX2) mRNA and protein. In this study murine J774 macrophages were exposed to vehicle, interferon γ + lipopolysaccharide (IFN-g/LPS), non-CpG (SAK1), or two-CpG sequence-containing DNA (SAK2) for 0–18 hr and gene expression changes measured. A large number of immunostimulatory and inflammatory changes were observed. SAK2 was a stronger activator of TNFα- and chemokine expression-related changes than LPS/IFN-g. Up regulation included tumor necrosis factor receptor superfamily genes (TNFRSF’s), IL-1 receptor signaling via stress-activated protein kinase (SAPK), NF-κB activation, hemopoietic maturation factors and sonic hedgehog/wingless integration site (SHH/Wnt) pathway genes. Genes of the TGF-β pathway were down regulated. In contrast, LPS/IFN-g -treated cells showed increased levels for TGF-β signaling genes, which may be linked to the observed up regulation of numerous collagens and down regulation of Wnt pathway genes. SAK1 produced distinct changes from LPS/IFN-g or SAK2. Therefore, J774 macrophages recognize LPS/IFN-g, non-CpG DNA or two-CpG DNA-containing sequences as immunologically distinct. PMID:20097302
de Cambiaire, Jean-Charles; Otis, Christian; Turmel, Monique; Lemieux, Claude
2007-01-01
Background In the Chlorophyta – the green algal phylum comprising the classes Prasinophyceae, Ulvophyceae, Trebouxiophyceae and Chlorophyceae – the chloroplast genome displays a highly variable architecture. While chlorophycean chloroplast DNAs (cpDNAs) deviate considerably from the ancestral pattern described for the prasinophyte Nephroselmis olivacea, the degree of remodelling sustained by the two ulvophyte cpDNAs completely sequenced to date is intermediate relative to those observed for chlorophycean and trebouxiophyte cpDNAs. Chlorella vulgaris (Chlorellales) is currently the only photosynthetic trebouxiophyte whose complete cpDNA sequence has been reported. To gain insights into the evolutionary trends of the chloroplast genome in the Trebouxiophyceae, we sequenced cpDNA from the filamentous alga Leptosira terrestris (Ctenocladales). Results The 195,081-bp Leptosira chloroplast genome resembles the 150,613-bp Chlorella genome in lacking a large inverted repeat (IR) but differs greatly in gene order. Six of the conserved genes present in Chlorella cpDNA are missing from the Leptosira gene repertoire. The 106 conserved genes, four introns and 11 free standing open reading frames (ORFs) account for 48.3% of the genome sequence. This is the lowest gene density yet observed among chlorophyte cpDNAs. Contrary to the situation in Chlorella but similar to that in the chlorophycean Scenedesmus obliquus, the gene distribution is highly biased over the two DNA strands in Leptosira. Nine genes, compared to only three in Chlorella, have significantly expanded coding regions relative to their homologues in ancestral-type green algal cpDNAs. As observed in chlorophycean genomes, the rpoB gene is fragmented into two ORFs. Short repeats account for 5.1% of the Leptosira genome sequence and are present mainly in intergenic regions. Conclusion Our results highlight the great plasticity of the chloroplast genome in the Trebouxiophyceae and indicate that the IR was lost on at least two separate occasions. The intriguing similarities of the derived features exhibited by Leptosira cpDNA and its chlorophycean counterparts suggest that the same evolutionary forces shaped the IR-lacking chloroplast genomes in these two algal lineages. PMID:17610731
The complete chloroplast genome sequence of Dianthus superbus var. longicalycinus.
Gurusamy, Raman; Lee, Do-Hyung; Park, SeonJoo
2016-05-01
The complete chloroplast genome (cpDNA) sequence of Dianthus superbus var. longicalycinus is an economically important traditional Chinese medicine was reported and characterized. The cpDNA of Dianthus superbus var. longicalycinus is 149,539 bp, with 36.3% GC content. A pair of inverted repeats (IRs) of 24,803 bp is separated by a large single-copy region (LSC, 82,805 bp) and a small single-copy region (SSC, 17,128 bp). It encodes 85 protein-coding genes, 36 tRNA genes and 8 rRNA genes. Of 129 individual genes, 13 genes encoded one intron and three genes have two introns.
Influence of DNA sequence on the structure of minicircles under torsional stress
Wang, Qian; Irobalieva, Rossitza N.; Chiu, Wah; Schmid, Michael F.; Fogg, Jonathan M.; Zechiedrich, Lynn
2017-01-01
Abstract The sequence dependence of the conformational distribution of DNA under various levels of torsional stress is an important unsolved problem. Combining theory and coarse-grained simulations shows that the DNA sequence and a structural correlation due to topology constraints of a circle are the main factors that dictate the 3D structure of a 336 bp DNA minicircle under torsional stress. We found that DNA minicircle topoisomers can have multiple bend locations under high torsional stress and that the positions of these sharp bends are determined by the sequence, and by a positive mechanical correlation along the sequence. We showed that simulations and theory are able to provide sequence-specific information about individual DNA minicircles observed by cryo-electron tomography (cryo-ET). We provided a sequence-specific cryo-ET tomogram fitting of DNA minicircles, registering the sequence within the geometric features. Our results indicate that the conformational distribution of minicircles under torsional stress can be designed, which has important implications for using minicircle DNA for gene therapy. PMID:28609782
Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.
Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James
2002-12-01
Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.
Essar, D W; Eberly, L; Crawford, I P
1990-02-01
Pseudomonas putida possesses seven structural genes for enzymes of the tryptophan pathway. All but one, trpG, which encodes the small (beta) subunit of anthranilate synthase, have been mapped on the circular chromosome. This report describes the cloning and sequencing of P. putida trpE, trpG, trpD, and trpC. In P. putida and Pseudomonas aeruginosa, DNA sequence analysis as well as growth and enzyme assays of insertionally inactivated strains indicated that trpG is the first gene in a three-gene operon that also contains trpD and trpC. In P. putida, trpE is 2.2 kilobases upstream from the trpGDC cluster, whereas in P. aeruginosa, they are separated by at least 25 kilobases (T. Shinomiya, S. Shiga, and M. Kageyama, Mol. Gen. Genet., 189:382-389, 1983). The DNA sequence in P. putida shows an open reading frame on the opposite strand between trpE and trpGDC; this putative gene was not characterized. Evidence is also presented for sequence similarities in the 5' untranslated regions of trpE and trpGDC in both pseudomonads; the function of these regions is unknown, but it is possible that they play some role in regulation of these genes, since all the genes respond to repression by tryptophan. The sequences of the anthranilate synthase genes in the fluorescent pseudomonads resemble those of p-aminobenzoate synthase genes of the enteric bacteria more closely than the anthranilate synthase genes of those organisms; however, no requirement for p-aminobenzoate was found in the Pseudomonas mutants created in this study.
Mitochondrial gene rearrangements confirm the parallel evolution of the crab-like form.
Morrison, C L; Harvey, A W; Lavery, S; Tieu, K; Huang, Y; Cunningham, C W
2002-01-01
The repeated appearance of strikingly similar crab-like forms in independent decapod crustacean lineages represents a remarkable case of parallel evolution. Uncertainty surrounding the phylogenetic relationships among crab-like lineages has hampered evolutionary studies. As is often the case, aligned DNA sequences by themselves were unable to fully resolve these relationships. Four nested mitochondrial gene rearrangements--including one of the few reported movements of an arthropod protein-coding gene--are congruent with the DNA phylogeny and help to resolve a crucial node. A phylogenetic analysis of DNA sequences, and gene rearrangements, supported five independent origins of the crab-like form, and suggests that the evolution of the crab-like form may be irreversible. This result supports the utility of mitochondrial gene rearrangements in phylogenetic reconstruction. PMID:11886621
J Genes for Heavy Chain Immunoglobulins of Mouse
NASA Astrophysics Data System (ADS)
Newell, Nanette; Richards, Julia E.; Tucker, Philip W.; Blattner, Frederick R.
1980-09-01
A 15.8-kilobase pair fragment of BALB/c mouse liver DNA, cloned in the Charon 4Aλ phage vector system, was shown to contain the μ heavy chain constant region (CHμ ) gene for the mouse immunoglobulin M. In addition, this fragment of DNA contains at least two J genes, used to code for the carboxyl terminal portion of heavy chain variable regions. These genes are located in genomic DNA about eight kilobase pairs to the 5' side of the CHμ gene. The complete nucleotide sequence of a 1120-base pair stretch of DNA that includes the two J genes has been determined.
Madhaiyan, Munusamy; Poonguzhali, Selvaraj; Kwon, Soon-Wo; Sa, Tong-Min
2009-01-01
A pink-pigmented, aerobic, facultatively methylotrophic bacterial strain, CBMB27T, isolated from leaf tissues of rice (Oryza sativa L. 'Dong-Jin'), was analysed using a polyphasic taxonomic approach. Comparative 16S rRNA gene sequence-based phylogenetic analysis placed the strain in a clade with the species Methylobacterium oryzae, Methylobacterium fujisawaense and Methylobacterium mesophilicum; strain CBMB27T showed sequence similarities of 98.3, 98.5 and 97.3 %, respectively, to the type strains of these three species. DNA-DNA hybridization experiments revealed low levels (<38 %) of DNA-DNA relatedness between strain CBMB27T and its closest relatives. The sequence of the 1-aminocyclopropane-1-carboxylate deaminase gene (acdS) in strain CBMB27T differed from those of close relatives. The major fatty acid of the isolate was C(18 : 1)omega7c and the G+C content of the genomic DNA was 66.8 mol%. Based on the results of 16S rRNA gene sequence analysis, DNA-DNA hybridization, and physiological and biochemical characterization, which enabled the isolate to be differentiated from all recognized species of the genus Methylobacterium, it was concluded that strain CBMB27T represents a novel species in the genus Methylobacterium for which the name Methylobacterium phyllosphaerae sp. nov. is proposed (type strain CBMB27T =LMG 24361T =KACC 11716T =DSM 19779T).
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
SxtA gene sequence analysis of dinoflagellate Alexandrium minutum
NASA Astrophysics Data System (ADS)
Norshaha, Safida Anira; Latib, Norhidayu Abdul; Usup, Gires; Yusof, Nurul Yuziana Mohd
2015-09-01
The dinoflagellate Alexandrium minutum is typically known for the production of potent neurotoxins such as saxitoxin, affecting the health of human seafood consumers via paralytic shellfish poisoning (PSP). These phenomena is related to the harmful algal blooms (HABs) that is believed to be influenced by environmental and nutritional factors. Previous study has revealed that SxtA gene is a starting gene that involved in the saxitoxin production pathway. The aim of this study was to analyse the sequence of the sxtA gene in A. minutum. The dinoflagellates culture was cultured at temperature 26°C with 16:8-hour light:dark photocycle. After the samples were harvested, RNA was extracted, complementary DNA (cDNA) was synthesised and amplified by polymerase chain reaction (PCR). The PCR products were then purified and cloned before sequenced. The SxtA sequence obtained was then analyzed in order to identify the presence of SxtA gene in Alexandrium minutum.
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-01-01
Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700
EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.
Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P
2008-04-10
Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.
Identification of food and beverage spoilage yeasts from DNA sequence analyses
USDA-ARS?s Scientific Manuscript database
Detection, identification, and classification of yeasts has undergone a major transformation in the last decade and a half following application of gene sequence analyses and genome comparisons. Development of a database (barcode) of easily determined DNA sequences from domains 1 and 2 (D1/D2) of th...
Oligo Design: a computer program for development of probes for oligonucleotide microarrays.
Herold, Keith E; Rasooly, Avraham
2003-12-01
Oligonucleotide microarrays have demonstrated potential for the analysis of gene expression, genotyping, and mutational analysis. Our work focuses primarily on the detection and identification of bacteria based on known short sequences of DNA. Oligo Design, the software described here, automates several design aspects that enable the improved selection of oligonucleotides for use with microarrays for these applications. Two major features of the program are: (i) a tiling algorithm for the design of short overlapping temperature-matched oligonucleotides of variable length, which are useful for the analysis of single nucleotide polymorphisms and (ii) a set of tools for the analysis of multiple alignments of gene families and related short DNA sequences, which allow for the identification of conserved DNA sequences for PCR primer selection and variable DNA sequences for the selection of unique probes for identification. Note that the program does not address the full genome perspective but, instead, is focused on the genetic analysis of short segments of DNA. The program is Internet-enabled and includes a built-in browser and the automated ability to download sequences from GenBank by specifying the GI number. The program also includes several utilities, including audio recital of a DNA sequence (useful for verifying sequences against a written document), a random sequence generator that provides insight into the relationship between melting temperature and GC content, and a PCR calculator.
Unternaehrer, Eva; Meyer, Andrea Hans; Burkhardt, Susan C A; Dempster, Emma; Staehli, Simon; Theill, Nathan; Lieb, Roselind; Meinlschmidt, Gunther
2015-01-01
In adults, reporting low and high maternal care in childhood, we compared DNA methylation in two stress-associated genes (two target sequences in the oxytocin receptor gene, OXTR; one in the brain-derived neurotrophic factor gene, BDNF) in peripheral whole blood, in a cross-sectional study (University of Basel, Switzerland) during 2007-2008. We recruited 89 participants scoring < 27 (n = 47, 36 women) or > 33 (n = 42, 35 women) on the maternal care subscale of the Parental Bonding Instrument (PBI) at a previous assessment of a larger group (N = 709, range PBI maternal care = 0-36, age range = 19-66 years; median 24 years). 85 participants gave blood for DNA methylation analyses (Sequenom(R) EpiTYPER, San Diego, CA) and cell count (Sysmex PocH-100i™, Kobe, Japan). Mixed model statistical analysis showed greater DNA methylation in the low versus high maternal care group, in the BDNF target sequence [Likelihood-Ratio (1) = 4.47; p = 0.035] and in one OXTR target sequence Likelihood-Ratio (1) = 4.33; p = 0.037], but not the second OXTR target sequence [Likelihood-Ratio (1) < 0.001; p = 0.995). Mediation analyses indicated that differential blood cell count did not explain associations between low maternal care and BDNF (estimate = -0.005, 95% CI = -0.025 to 0.015; p = 0.626) or OXTR DNA methylation (estimate = -0.015, 95% CI = -0.038 to 0.008; p = 0.192). Hence, low maternal care in childhood was associated with greater DNA methylation in an OXTR and a BDNF target sequence in blood cells in adulthood. Although the study has limitations (cross-sectional, a wide age range, only three target sequences in two genes studied, small effects, uncertain relevance of changes in blood cells to gene methylation in brain), the findings may indicate components of the epiphenotype from early life stress.
Alternative polyadenylation of the gene transcripts encoding a rat DNA polymerase beta.
Konopiński, R; Nowak, R; Siedlecki, J A
1996-10-17
Rat cells produce two different transcripts of DNA polymerase beta (beta-Pol). The low-molecular-weight transcript (1.4 kb) was already sequenced. We report here the cloning and sequencing of the full-length cDNA, corresponding to the high-molecular-weight (HMW) transcript (4.0 kb) of beta-Pol. Sequence data strongly suggest that both transcripts are produced from a single gene by alternative polyadenylation. The HMW transcript contains the entire 1.4 kb transcript sequence and additional 2.2 kb on the 3' end. The 3' UTR of the HMW transcript contains some regulatory sequences which are not present in the 1.4-kb transcript. The A + U-rich fragment and (GU)21 sequence are believed to influence the stability of the mRNA. The functional significance of the A-rich region locally destabilizing double-stranded secondary structure remains unknown.
Modular probes for enriching and detecting complex nucleic acid sequences
NASA Astrophysics Data System (ADS)
Wang, Juexiao Sherry; Yan, Yan Helen; Zhang, David Yu
2017-12-01
Complex DNA sequences are difficult to detect and profile, but are important contributors to human health and disease. Existing hybridization probes lack the capability to selectively bind and enrich hypervariable, long or repetitive sequences. Here, we present a generalized strategy for constructing modular hybridization probes (M-Probes) that overcomes these challenges. We demonstrate that M-Probes can tolerate sequence variations of up to 7 nt at prescribed positions while maintaining single nucleotide sensitivity at other positions. M-Probes are also shown to be capable of sequence-selectively binding a continuous DNA sequence of more than 500 nt. Furthermore, we show that M-Probes can detect genes with triplet repeats exceeding a programmed threshold. As a demonstration of this technology, we have developed a hybrid capture method to determine the exact triplet repeat expansion number in the Huntington's gene of genomic DNA using quantitative PCR.
[Polymorphic loci and polymorphism analysis of short tandem repeats within XNP gene].
Liu, Qi-Ji; Gong, Yao-Qin; Guo, Chen-Hong; Chen, Bing-Xi; Li, Jiang-Xia; Guo, Yi-Shou
2002-01-01
To select polymorphic short tandem repeat markers within X-linked nuclear protein (XNP) gene, genomic clones which contain XNP gene were recognized by homologous analysis with XNP cDNA. By comparing the cDNA with genomic DNA, non-exonic sequences were identified, and short tandem repeats were selected from non-exonic sequences by using BCM search Launcher. Polymorphisms of the short tandem repeats in Chinese population were evaluated by PCR amplification and PAGE. Five short tandem repeats were identified from XNP gene, two of which were polymorphic. Four and 11 alleles were observed in Chinese population for XNPSTR1 and XNPSTR4, respectively. Heterozygosities were 47% for XNPSTR1 and 70% for XNPSTR4. XNPSTR1 and XNPSTR4 localized within 3' end and intron 10, respectively. Two polymorphic short tandem repeats have been identified within XNP gene and will be useful for linkage analysis and gene diagnosis of XNP gene.
Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster
Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur
1987-01-01
The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645
Brouard, Jean-Simon; Otis, Christian; Lemieux, Claude; Turmel, Monique
2008-01-01
Background To gain insight into the branching order of the five main lineages currently recognized in the green algal class Chlorophyceae and to expand our understanding of chloroplast genome evolution, we have undertaken the sequencing of chloroplast DNA (cpDNA) from representative taxa. The complete cpDNA sequences previously reported for Chlamydomonas (Chlamydomonadales), Scenedesmus (Sphaeropleales), and Stigeoclonium (Chaetophorales) revealed tremendous variability in their architecture, the retention of only few ancestral gene clusters, and derived clusters shared by Chlamydomonas and Scenedesmus. Unexpectedly, our recent phylogenies inferred from these cpDNAs and the partial sequences of three other chlorophycean cpDNAs disclosed two major clades, one uniting the Chlamydomonadales and Sphaeropleales (CS clade) and the other uniting the Oedogoniales, Chaetophorales and Chaetopeltidales (OCC clade). Although molecular signatures provided strong support for this dichotomy and for the branching of the Oedogoniales as the earliest-diverging lineage of the OCC clade, more data are required to validate these phylogenies. We describe here the complete cpDNA sequence of Oedogonium cardiacum (Oedogoniales). Results Like its three chlorophycean homologues, the 196,547-bp Oedogonium chloroplast genome displays a distinctive architecture. This genome is one of the most compact among photosynthetic chlorophytes. It has an atypical quadripartite structure, is intron-rich (17 group I and 4 group II introns), and displays 99 different conserved genes and four long open reading frames (ORFs), three of which are clustered in the spacious inverted repeat of 35,493 bp. Intriguingly, two of these ORFs (int and dpoB) revealed high similarities to genes not usually found in cpDNA. At the gene content and gene order levels, the Oedogonium genome most closely resembles its Stigeoclonium counterpart. Characters shared by these chlorophyceans but missing in members of the CS clade include the retention of psaM, rpl32 and trnL(caa), the loss of petA, the disruption of three ancestral clusters and the presence of five derived gene clusters. Conclusion The Oedogonium chloroplast genome disclosed additional characters that bolster the evidence for a close alliance between the Oedogoniales and Chaetophorales. Our unprecedented finding of int and dpoB in this cpDNA provides a clear example that novel genes were acquired by the chloroplast genome through horizontal transfers, possibly from a mitochondrial genome donor. PMID:18558012
Béraud-Colomb, E; Roubin, R; Martin, J; Maroc, N; Gardeisen, A; Trabuchet, G; Goosséns, M
1995-12-01
Analyzing the nuclear DNA from ancient human bones is an essential step to the understanding of genetic diversity in current populations, provided that such systematic studies are experimentally feasible. This article reports the successful extraction and amplification of nuclear DNA from the beta-globin region from 5 of 10 bone specimens up to 12,000 years old. These have been typed for beta-globin frameworks by sequencing through two variable positions and for a polymorphic (AT) chi (T) gamma microsatellite 500 bp upstream of the beta-globin gene. These specimens of human remains are somewhat older than those analyzed in previous nuclear gene sequencing reports and considerably older than those used to study high-copy-number human mtDNA. These results show that the systematic study of nuclear DNA polymorphisms of ancient populations is feasible.
The gene space in wheat: the complete γ-gliadin gene family from the wheat cultivar Chinese Spring.
Anderson, Olin D; Huo, Naxin; Gu, Yong Q
2013-06-01
The complete set of unique γ-gliadin genes is described for the wheat cultivar Chinese Spring using a combination of expressed sequence tag (EST) and Roche 454 DNA sequences. Assemblies of Chinese Spring ESTs yielded 11 different γ-gliadin gene sequences. Two of the sequences encode identical polypeptides and are assumed to be the result of a recent gene duplication. One gene has a 3' coding mutation that changes the reading frame in the final eight codons. A second assembly of Chinese Spring γ-gliadin sequences was generated using Roche 454 total genomic DNA sequences. The 454 assembly confirmed the same 11 active genes as the EST assembly plus two pseudogenes not represented by ESTs. These 13 γ-gliadin sequences represent the complete unique set of γ-gliadin genes for cv Chinese Spring, although not ruled out are additional genes that are exact duplications of these 13 genes. A comparison with the ESTs of two other hexaploid cultivars (Butte 86 and Recital) finds that the most active genes are present in all three cultivars, with exceptions likely due to too few ESTs for detection in Butte 86 and Recital. A comparison of the numbers of ESTs per gene indicates differential levels of expression within the γ-gliadin gene family. Genome assignments were made for 6 of the 13 Chinese Spring γ-gliadin genes, i.e., one assignment from a match to two γ-gliadin genes found within a tetraploid wheat A genome BAC and four genes that match four distinct γ-gliadin sequences assembled from Roche 454 sequences from Aegilops tauschii, the hexaploid wheat D-genome ancestor.
NASA Technical Reports Server (NTRS)
La Duc, Myron T.; Satomi, Masataka; Agata, Norio; Venkateswaran, Kasthuri
2004-01-01
Bacillus anthracis, the causative agent of the human disease anthrax, Bacillus cereus, a food-borne pathogen capable of causing human illness, and Bacillus thuringiensis, a well-characterized insecticidal toxin producer, all cluster together within a very tight clade (B. cereus group) phylogenetically and are indistinguishable from one another via 16S rDNA sequence analysis. As new pathogens are continually emerging, it is imperative to devise a system capable of rapidly and accurately differentiating closely related, yet phenotypically distinct species. Although the gyrB gene has proven useful in discriminating closely related species, its sequence analysis has not yet been validated by DNA:DNA hybridization, the taxonomically accepted "gold standard". We phylogenetically characterized the gyrB sequences of various species and serotypes encompassed in the "B. cereus group," including lab strains and environmental isolates. Results were compared to those obtained from analyses of phenotypic characteristics, 16S rDNA sequence, DNA:DNA hybridization, and virulence factors. The gyrB gene proved more highly differential than 16S, while, at the same time, as analytical as costly and laborious DNA:DNA hybridization techniques in differentiating species within the B. cereus group.
Gibbs, Mark J; Armstrong, John S; Gibbs, Adrian J
2005-01-01
Background Most current DNA diagnostic tests for identifying organisms use specific oligonucleotide probes that are complementary in sequence to, and hence only hybridise with the DNA of one target species. By contrast, in traditional taxonomy, specimens are usually identified by 'dichotomous keys' that use combinations of characters shared by different members of the target set. Using one specific character for each target is the least efficient strategy for identification. Using combinations of shared bisectionally-distributed characters is much more efficient, and this strategy is most efficient when they separate the targets in a progressively binary way. Results We have developed a practical method for finding minimal sets of sub-sequences that identify individual sequences, and could be targeted by combinations of probes, so that the efficient strategy of traditional taxonomic identification could be used in DNA diagnosis. The sizes of minimal sub-sequence sets depended mostly on sequence diversity and sub-sequence length and interactions between these parameters. We found that 201 distinct cytochrome oxidase subunit-1 (CO1) genes from moths (Lepidoptera) were distinguished using only 15 sub-sequences 20 nucleotides long, whereas only 8–10 sub-sequences 6–10 nucleotides long were required to distinguish the CO1 genes of 92 species from the 9 largest orders of insects. Conclusion The presence/absence of sub-sequences in a set of gene sequences can be used like the questions in a traditional dichotomous taxonomic key; hybridisation probes complementary to such sub-sequences should provide a very efficient means for identifying individual species, subtypes or genotypes. Sequence diversity and sub-sequence length are the major factors that determine the numbers of distinguishing sub-sequences in any set of sequences. PMID:15817134
Differential DNA methylation and transcription profiles in date palm roots exposed to salinity
Al-Harrasi, Ibtisam; Al-Yahyai, Rashid
2018-01-01
As a salt-adaptive plant, the date palm (Phoenix dactylifera L.) requires a suitable mechanism to adapt to the stress of saline soils. There is growing evidence that DNA methylation plays an important role in regulating gene expression in response to abiotic stresses, including salinity. Thus, the present study sought to examine the differential methylation status that occurs in the date palm genome when plants are exposed to salinity, and to identify salinity responsive genes that are regulated by DNA methylation. To achieve these, whole-genome bisulfite sequencing (WGBS) was employed and mRNA was sequenced from salinity-treated and untreated roots. The WGBS analysis included 324,987,795 and 317,056,091 total reads of the control and the salinity-treated samples, respectively. The analysis covered about 81% of the total genomic DNA with about 40% of mapping efficiency of the sequenced reads and an average read depth of 17-fold coverage per DNA strand, and with a bisulfite conversion rate of around 99%. The level of methylation within the differentially methylated regions (DMRs) was significantly (p < 0.05, FDR ≤ 0.05) increased in response to salinity specifically at the mCHG and mCHH sequence contexts. Consistently, the mass spectrometry and the enzyme-linked immunosorbent assay (ELISA) showed that there was a significant (p < 0.05) increase in the global DNA methylation in response to salinity. mRNA sequencing revealed the presence of 6,405 differentially regulated genes with a significant value (p < 0.001, FDR ≤ 0.05) in response to salinity. Integration of high-resolution methylome and transcriptome analyses revealed a negative correlation between mCG methylation located within the promoters and the gene expression, while a positive correlation was noticed between mCHG/mCHH methylation rations and gene expression specifically when plants grew under control conditions. Therefore, the methylome and transcriptome relationships vary based on the methylated sequence context, the methylated region within the gene, the protein-coding ability of the gene, and the salinity treatment. These results provide insights into interplay among DNA methylation and gene expression, and highlight the effect of salinity on the nature of this relationship, which may involve other genetic and epigenetic players under salt stress conditions. The results obtained from this project provide the first draft map of the differential methylome and transcriptome of date palm when exposed to an abiotic stress. PMID:29352281
Differential DNA methylation and transcription profiles in date palm roots exposed to salinity.
Al-Harrasi, Ibtisam; Al-Yahyai, Rashid; Yaish, Mahmoud W
2018-01-01
As a salt-adaptive plant, the date palm (Phoenix dactylifera L.) requires a suitable mechanism to adapt to the stress of saline soils. There is growing evidence that DNA methylation plays an important role in regulating gene expression in response to abiotic stresses, including salinity. Thus, the present study sought to examine the differential methylation status that occurs in the date palm genome when plants are exposed to salinity, and to identify salinity responsive genes that are regulated by DNA methylation. To achieve these, whole-genome bisulfite sequencing (WGBS) was employed and mRNA was sequenced from salinity-treated and untreated roots. The WGBS analysis included 324,987,795 and 317,056,091 total reads of the control and the salinity-treated samples, respectively. The analysis covered about 81% of the total genomic DNA with about 40% of mapping efficiency of the sequenced reads and an average read depth of 17-fold coverage per DNA strand, and with a bisulfite conversion rate of around 99%. The level of methylation within the differentially methylated regions (DMRs) was significantly (p < 0.05, FDR ≤ 0.05) increased in response to salinity specifically at the mCHG and mCHH sequence contexts. Consistently, the mass spectrometry and the enzyme-linked immunosorbent assay (ELISA) showed that there was a significant (p < 0.05) increase in the global DNA methylation in response to salinity. mRNA sequencing revealed the presence of 6,405 differentially regulated genes with a significant value (p < 0.001, FDR ≤ 0.05) in response to salinity. Integration of high-resolution methylome and transcriptome analyses revealed a negative correlation between mCG methylation located within the promoters and the gene expression, while a positive correlation was noticed between mCHG/mCHH methylation rations and gene expression specifically when plants grew under control conditions. Therefore, the methylome and transcriptome relationships vary based on the methylated sequence context, the methylated region within the gene, the protein-coding ability of the gene, and the salinity treatment. These results provide insights into interplay among DNA methylation and gene expression, and highlight the effect of salinity on the nature of this relationship, which may involve other genetic and epigenetic players under salt stress conditions. The results obtained from this project provide the first draft map of the differential methylome and transcriptome of date palm when exposed to an abiotic stress.
He, Zhang-Ping; Dai, Xia-Bin; Zhang, Shuai; Zhi, Ting-Ting; Lun, Zhao-Rong; Wu, Zhong-Dao; Yang, Ting-Bao
2016-01-01
The whole sequence (15,057 bp) of the mitochondrial DNA (mtDNA) of the terrestrial snail Achatina fulica (order Stylommatophora) was determined. The mitogenome, as the typical metazoan mtDNA, contains 13 protein-coding genes (PCG), 2 ribosomal RNA genes (rRNA) and 22 transfer RNA genes (tRNA). The tRNA genes include two trnS without standard secondary structure. Interestingly, among the known mitogenomes of Pulmonata species, we firstly characterized an unassigned lengthy sequence (551 bp) between the cox1 and the trnV which may be the CR for the sake of its AT bases usage bias (65.70%) and potential hairpin structure.
Large-Scale Concatenation cDNA Sequencing
Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.
1997-01-01
A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174
Chen, Zhao; Moran, Kimberly; Richards-Yutz, Jennifer; Toorens, Erik; Gerhart, Daniel; Ganguly, Tapan; Shields, Carol L; Ganguly, Arupa
2014-03-01
Sporadic retinoblastoma (RB) is caused by de novo mutations in the RB1 gene. Often, these mutations are present as mosaic mutations that cannot be detected by Sanger sequencing. Next-generation deep sequencing allows unambiguous detection of the mosaic mutations in lymphocyte DNA. Deep sequencing of the RB1 gene on lymphocyte DNA from 20 bilateral and 70 unilateral RB cases was performed, where Sanger sequencing excluded the presence of mutations. The individual exons of the RB1 gene from each sample were amplified, pooled, ligated to barcoded adapters, and sequenced using semiconductor sequencing on an Ion Torrent Personal Genome Machine. Six low-level mosaic mutations were identified in bilateral RB and four in unilateral RB cases. The incidence of low-level mosaic mutation was estimated to be 30% and 6%, respectively, in sporadic bilateral and unilateral RB cases, previously classified as mutation negative. The frequency of point mutations detectable in lymphocyte DNA increased from 96% to 97% for bilateral RB and from 13% to 18% for unilateral RB. The use of deep sequencing technology increased the sensitivity of the detection of low-level germline mosaic mutations in the RB1 gene. This finding has significant implications for improved clinical diagnosis, genetic counseling, surveillance, and management of RB. © 2013 WILEY PERIODICALS, INC.
Drosophila Melanogaster Mitochondrial DNA: Gene Organization and Evolutionary Considerations
Garesse, R.
1988-01-01
The sequence of a 8351-nucleotide mitochondrial DNA (mtDNA) fragment has been obtained extending the knowledge of the Drosophila melanogaster mitochondrial genome to 90% of its coding region. The sequence encodes seven polypeptides, 12 tRNAs and the 3' end of the 16S rRNA and CO III genes. The gene organization is strictly conserved with respect to the Drosophila yakuba mitochondrial genome, and different from that found in mammals and Xenopus. The high A + T content of D. melanogaster mitochondrial DNA is reflected in a reiterative codon usage, with more than 90% of the codons ending in T or A, G + C rich codons being practically absent. The average level of homology between the D. melanogaster and D. yakuba sequences is very high (roughly 94%), although insertion and deletions have been detected in protein, tRNA and large ribosomal genes. The analysis of nucleotide changes reveals a similar frequency for transitions and transversions, and reflects a strong bias against G+C on both strands. The predominant type of transition is strand specific. PMID:3130291
Morise, Hisashi; Miyazaki, Erika; Yoshimitsu, Shoko; Eki, Toshihiko
2012-01-01
Soil nematodes play crucial roles in the soil food web and are a suitable indicator for assessing soil environments and ecosystems. Previous nematode community analyses based on nematode morphology classification have been shown to be useful for assessing various soil environments. Here we have conducted DNA barcode analysis for soil nematode community analyses in Japanese soils. We isolated nematodes from two different environmental soils of an unmanaged flowerbed and an agricultural field using the improved flotation-sieving method. Small subunit (SSU) rDNA fragments were directly amplified from each of 68 (flowerbed samples) and 48 (field samples) isolated nematodes to determine the nucleotide sequence. Sixteen and thirteen operational taxonomic units (OTUs) were obtained by multiple sequence alignment from the flowerbed and agricultural field nematodes, respectively. All 29 SSU rDNA-derived OTUs (rOTUs) were further mapped onto a phylogenetic tree with 107 known nematode species. Interestingly, the two nematode communities examined were clearly distinct from each other in terms of trophic groups: Animal predators and plant feeders were markedly abundant in the flowerbed soils, in contrast, bacterial feeders were dominantly observed in the agricultural field soils. The data from the flowerbed nematodes suggests a possible food web among two different trophic nematode groups and plants (weeds) in the closed soil environment. Finally, DNA sequences derived from the mitochondrial cytochrome oxidase c subunit 1 (COI) gene were determined as a DNA barcode from 43 agricultural field soil nematodes. These nematodes were assigned to 13 rDNA-derived OTUs, but in the COI gene analysis were assigned to 23 COI gene-derived OTUs (cOTUs), indicating that COI gene-based barcoding may provide higher taxonomic resolution than conventional SSU rDNA-barcoding in soil nematode community analysis. PMID:23284767
The bglA Gene of Aspergillus kawachii Encodes Both Extracellular and Cell Wall-Bound β-Glucosidases
Iwashita, Kazuhiro; Nagahara, Tatsuya; Kimura, Hitoshi; Takano, Makoto; Shimoi, Hitoshi; Ito, Kiyoshi
1999-01-01
We cloned the genomic DNA and cDNA of bglA, which encodes β-glucosidase in Aspergillus kawachii, based on a partial amino acid sequence of purified cell wall-bound β-glucosidase CB-1. The nucleotide sequence of the cloned bglA gene revealed a 2,933-bp open reading frame with six introns that encodes an 860-amino-acid protein. Based on the deduced amino acid sequence, we concluded that the bglA gene encodes cell wall-bound β-glucosidase CB-1. The amino acid sequence exhibited high levels of homology with the amino acid sequences of fungal β-glucosidases classified in subfamily B. We expressed the bglA cDNA in Saccharomyces cerevisiae and detected the recombinant β-glucosidase in the periplasm fraction of the recombinant yeast. A. kawachii can produce two extracellular β-glucosidases (EX-1 and EX-2) in addition to the cell wall-bound β-glucosidase. A. kawachii in which the bglA gene was disrupted produced none of the three β-glucosidases, as determined by enzyme assays and a Western blot analysis. Thus, we concluded that the bglA gene encodes both extracellular and cell wall-bound β-glucosidases in A. kawachii. PMID:10584016
Kenny, Daryn; Shen, Lu-Ping; Kolberg, Janice A
2002-09-01
In situ hybridization (ISH) methods for detection of nucleic acid sequences have proved especially powerful for revealing genetic markers and gene expression in a morphological context. Although target and signal amplification technologies have enabled researchers to detect relatively low-abundance molecules in cell extracts, the sensitive detection of nucleic acid sequences in tissue specimens has proved more challenging. We recently reported the development of a branched DNA (bDNA) ISH method for detection of DNA and mRNA in whole cells. Based on bDNA signal amplification technology, bDNA ISH is highly sensitive and can detect one or two copies of DNA per cell. In this study we evaluated bDNA ISH for detection of nucleic acid sequences in tissue specimens. Using normal and human papillomavirus (HPV)-infected cervical biopsy specimens, we explored the cell type-specific distribution of HPV DNA and mRNA by bDNA ISH. We found that bDNA ISH allowed rapid, sensitive detection of nucleic acids with high specificity while preserving tissue morphology. As an adjunct to conventional histopathology, bDNA ISH may improve diagnostic accuracy and prognosis for viral and neoplastic diseases.
Molecular Diagnosis of Infantile Mitochondrial Disease with Targeted Next-Generation Sequencing
Calvo, Sarah E.; Compton, Alison G.; Hershman, Steven G.; Lim, Sze Chern; Lieber, Daniel S.; Tucker, Elena J.; Laskowski, Adrienne; Garone, Caterina; Liu, Shangtao; Jaffe, David B.; Christodoulou, John; Fletcher, Janice M.; Bruno, Damien L; Goldblatt, Jack; DiMauro, Salvatore; Thorburn, David R.; Mootha, Vamsi K.
2012-01-01
Advances in next-generation sequencing (NGS) promise to facilitate diagnosis of inherited disorders. While in research settings NGS has pinpointed causal alleles using segregation in large families, the key challenge for clinical diagnosis is application to single individuals. To explore its diagnostic utility, we performed targeted NGS in 42 unrelated infants with clinical and biochemical evidence of mitochondrial oxidative phosphorylation disease, who were refractory to traditional molecular diagnosis. These devastating mitochondrial disorders are characterized by phenotypic and genetic heterogeneity, with over 100 causal genes identified to date. We performed “MitoExome” sequencing of the mitochondrial DNA (mtDNA) and exons of ~1000 nuclear genes encoding mitochondrial proteins and prioritized rare mutations predicted to disrupt function. Since patients and controls harbored a comparable number of such heterozygous alleles, we could not prioritize dominant acting genes. However, patients showed a five-fold enrichment of genes with two such mutations that could underlie recessive disease. In total, 23/42 (55%) patients harbored such recessive genes or pathogenic mtDNA variants. Firm diagnoses were enabled in 10 patients (24%) who had mutations in genes previously linked to disease. 13 patients (31%) had mutations in nuclear genes never linked to disease. The pathogenicity of two such genes, NDUFB3 and AGK, was supported by cDNA complementation and evidence from multiple patients, respectively. The results underscore the immediate potential and challenges of deploying NGS in clinical settings. PMID:22277967
Identification of a p53-response element in the promoter of the proline oxidase gene
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maxwell, Steve A.; Kochevar, Gerald J.
2008-05-02
Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less
Characterization and expression of the calpastatin gene in Cyprinus carpio.
Chen, W X; Ma, Y
2015-07-03
Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).
Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M
1998-08-01
An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.
Tay, W T; Elfekih, S; Polaszek, A; Court, L N; Evans, G A; Gordon, K H J; De Barro, P J
2017-03-27
Museum specimens represent valuable genomic resources for understanding host-endosymbiont/parasitoid evolutionary relationships, resolving species complexes and nomenclatural problems. However, museum collections suffer DNA degradation, making them challenging for molecular-based studies. Here, the mitogenomes of a single 1912 Sri Lankan Bemisia emiliae cotype puparium, and of a 1942 Japanese Bemisia puparium are characterised using a Next-Generation Sequencing approach. Whiteflies are small sap-sucking insects including B. tabaci pest species complex. Bemisia emiliae's draft mitogenome showed a high degree of homology with published B. tabaci mitogenomes, and exhibited 98-100% partial mitochondrial DNA Cytochrome Oxidase I (mtCOI) gene identity with the B. tabaci species known as Asia II-7. The partial mtCOI gene of the Japanese specimen shared 99% sequence identity with the Bemisia 'JpL' genetic group. Metagenomic analysis identified bacterial sequences in both Bemisia specimens, while hymenopteran sequences were also identified in the Japanese Bemisia puparium, including complete mtCOI and rRNA genes, and various partial mtDNA genes. At 88-90% mtCOI sequence identity to Aphelinidae wasps, we concluded that the 1942 Bemisia nymph was parasitized by an Eretmocerus parasitoid wasp. Our approach enables the characterisation of genomes and associated metagenomic communities of museum specimens using 1.5 ng gDNA, and to infer historical tritrophic relationships in Bemisia whiteflies.
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare . However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes.
Chwialkowska, Karolina; Korotko, Urszula; Kosinska, Joanna; Szarejko, Iwona; Kwasniewski, Miroslaw
2017-01-01
Epigenetic mechanisms, including histone modifications and DNA methylation, mutually regulate chromatin structure, maintain genome integrity, and affect gene expression and transposon mobility. Variations in DNA methylation within plant populations, as well as methylation in response to internal and external factors, are of increasing interest, especially in the crop research field. Methylation Sensitive Amplification Polymorphism (MSAP) is one of the most commonly used methods for assessing DNA methylation changes in plants. This method involves gel-based visualization of PCR fragments from selectively amplified DNA that are cleaved using methylation-sensitive restriction enzymes. In this study, we developed and validated a new method based on the conventional MSAP approach called Methylation Sensitive Amplification Polymorphism Sequencing (MSAP-Seq). We improved the MSAP-based approach by replacing the conventional separation of amplicons on polyacrylamide gels with direct, high-throughput sequencing using Next Generation Sequencing (NGS) and automated data analysis. MSAP-Seq allows for global sequence-based identification of changes in DNA methylation. This technique was validated in Hordeum vulgare. However, MSAP-Seq can be straightforwardly implemented in different plant species, including crops with large, complex and highly repetitive genomes. The incorporation of high-throughput sequencing into MSAP-Seq enables parallel and direct analysis of DNA methylation in hundreds of thousands of sites across the genome. MSAP-Seq provides direct genomic localization of changes and enables quantitative evaluation. We have shown that the MSAP-Seq method specifically targets gene-containing regions and that a single analysis can cover three-quarters of all genes in large genomes. Moreover, MSAP-Seq's simplicity, cost effectiveness, and high-multiplexing capability make this method highly affordable. Therefore, MSAP-Seq can be used for DNA methylation analysis in crop plants with large and complex genomes. PMID:29250096
Pombert, Jean-François; Lemieux, Claude; Turmel, Monique
2006-01-01
Background The phylum Chlorophyta contains the majority of the green algae and is divided into four classes. The basal position of the Prasinophyceae has been well documented, but the divergence order of the Ulvophyceae, Trebouxiophyceae and Chlorophyceae is currently debated. The four complete chloroplast DNA (cpDNA) sequences presently available for representatives of these classes have revealed extensive variability in overall structure, gene content, intron composition and gene order. The chloroplast genome of Pseudendoclonium (Ulvophyceae), in particular, is characterized by an atypical quadripartite architecture that deviates from the ancestral type by a large inverted repeat (IR) featuring an inverted rRNA operon and a small single-copy (SSC) region containing 14 genes normally found in the large single-copy (LSC) region. To gain insights into the nature of the events that led to the reorganization of the chloroplast genome in the Ulvophyceae, we have determined the complete cpDNA sequence of Oltmannsiellopsis viridis, a representative of a distinct, early diverging lineage. Results The 151,933 bp IR-containing genome of Oltmannsiellopsis differs considerably from Pseudendoclonium and other chlorophyte cpDNAs in intron content and gene order, but shares close similarities with its ulvophyte homologue at the levels of quadripartite architecture, gene content and gene density. Oltmannsiellopsis cpDNA encodes 105 genes, contains five group I introns, and features many short dispersed repeats. As in Pseudendoclonium cpDNA, the rRNA genes in the IR are transcribed toward the single copy region featuring the genes typically found in the ancestral LSC region, and the opposite single copy region harbours genes characteristic of both the ancestral SSC and LSC regions. The 52 genes that were transferred from the ancestral LSC to SSC region include 12 of those observed in Pseudendoclonium cpDNA. Surprisingly, the overall gene organization of Oltmannsiellopsis cpDNA more closely resembles that of Chlorella (Trebouxiophyceae) cpDNA. Conclusion The chloroplast genome of the last common ancestor of Oltmannsiellopsis and Pseudendoclonium contained a minimum of 108 genes, carried only a few group I introns, and featured a distinctive quadripartite architecture. Numerous changes were experienced by the chloroplast genome in the lineages leading to Oltmannsiellopsis and Pseudendoclonium. Our comparative analyses of chlorophyte cpDNAs support the notion that the Ulvophyceae is sister to the Chlorophyceae. PMID:16472375
Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.
Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi
2018-05-01
Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.
[Hot topics of circulating tumor DNA testing in breast cancer].
Liu, Y H; Zhou, B; Xu, L; Xin, L
2017-02-01
The progress of gene detection technologies represented by next generation sequencing (NGS) and digital PCR laid a foundation for studies of circulating tumor DNA (ctDNA) in breast cancer. In 2014, the NGS workgroup organized by the College of American Pathologists (CAP) published the College of American Pathologists ' Laboratory Standards for Next - Generation Sequencing Clinical Tests, which provides a blueprint for the standardization of gene testing. In 2015, the Guidelines for Diagnostic Next - generation Sequencing published by the European Society of Human Genetics claimed that NGS is unacceptable in clinical practice before studies guided by guidelines are approved. Although existing studies show the benefits of ctDNA testing in disease monitoring and prognosis analyzing, we have a ways to go to normalize the procedure and build strict detection criteria.
A novel gene, RSD-3/HSD-3.1, encodes a meiotic-related protein expressed in rat and human testis.
Zhang, Xiaodong; Liu, Huixian; Zhang, Yan; Qiao, Yuan; Miao, Shiying; Wang, Linfang; Zhang, Jianchao; Zong, Shudong; Koide, S S
2003-06-01
The expression of stage-specific genes during spermatogenesis was determined by isolating two segments of rat seminiferous tubule at different stages of the germinal epithelium cycle delineated by transillumination-delineated microdissection, combined with differential display polymerase chain reaction to identify the differential transcripts formed. A total of 22 cDNAs were identified and accepted by GenBank as new expressed sequence tags. One of the expressed sequence tags was radiolabeled and used as a probe to screen a rat testis cDNA library. A novel full-length cDNA composed of 2228 bp, designated as RSD-3 (rat sperm DNA no.3, GenBank accession no. AF094609) was isolated and characterized. The reading frame encodes a polypeptide consisting of 526 amino acid residues, containing a number of DNA binding motifs and phosphorylation sites for PKC, CK-II, and p34cdc2. Northern blot of mRNA prepared from various tissues of adult rats showed that RSD-3 is expressed only in the testis. The initial expression of the RSD-3 gene was detected in the testis on the 30th postnatal day and attained adult level on the 60th postnatal day. Immunolocalization of RSD-3 in germ cells of rat testis showed that its expression is restricted to primary spermatocytes, undergoing meiosis division I. A human testis homologue of RSD-3 cDNA, designated as HSD-3.1 (GenBank accession no. AF144487) was isolated by screening the Human Testis Rapid-Screen arrayed cDNA library panels by RT-PCR. The exon-intron boundaries of HSD-3.1 gene were determined by aligning the cDNA sequence with the corresponding genome sequence. The cDNA consisted of 12 exons that span approximately 52.8 kb of the genome sequence and was mapped to chromosome 14q31.3.
Newman, S. M.; Boynton, J. E.; Gillham, N. W.; Randolph-Anderson, B. L.; Johnson, A. M.; Harris, E. H.
1990-01-01
Transformation of chloroplast ribosomal RNA (rRNA) genes in Chlamydomonas has been achieved by the biolistic process using cloned chloroplast DNA fragments carrying mutations that confer antibiotic resistance. The sites of exchange employed during the integration of the donor DNA into the recipient genome have been localized using a combination of antibiotic resistance mutations in the 16S and 23S rRNA genes and restriction fragment length polymorphisms that flank these genes. Complete or nearly complete replacement of a region of the chloroplast genome in the recipient cell by the corresponding sequence from the donor plasmid was the most common integration event. Exchange events between the homologous donor and recipient sequences occurred preferentially near the vector:insert junctions. Insertion of the donor rRNA genes and flanking sequences into one inverted repeat of the recipient genome was followed by intramolecular copy correction so that both copies of the inverted repeat acquired identical sequences. Increased frequencies of rRNA gene transformants were achieved by reducing the copy number of the chloroplast genome in the recipient cells and by decreasing the heterology between donor and recipient DNA sequences flanking the selectable markers. In addition to producing bona fide chloroplast rRNA transformants, the biolistic process induced mutants resistant to low levels of streptomycin, typical of nuclear mutations in Chlamydomonas. PMID:1981764
Sequence analysis of 497 mouse brain ESTs expressed in the substantia nigra
DOE Office of Scientific and Technical Information (OSTI.GOV)
Stewart, G.J.; Savioz, A.; Davies, R.W.
1997-01-15
The use of subtracted, region-specific cDNA libraries combined with single-pass cDNA sequencing allows the discovery of novel genes and facilitates molecular description of the tissue or region involved. We report the sequence of 497 mouse expressed sequence tags (ESTs) from two subtracted libraries enriched for cDNAs expressed in the substantia nigra, a brain region with important roles in movement control and Parkinson disease. Of these, 238 ESTs give no database matches and therefore derive from novel genes. A further 115 ESTs show sequence similarity to ESTs from other organisms, which themselves do not yield any significant database matches to genesmore » of known function. Fifty-six ESTs show sequence similarity to previously identified genes whose mouse homologues have not been reported. The total number of ESTs reported that are new for the mouse is 407, which, together with the 90 ESTs corresponding to known mouse genes or cDNAs, contributes to the molecular description of the substantia nigra. 21 refs., 4 tabs.« less
Yang, Tao; Zhang, Wei; Du, Meng; Jiao, Kui
2008-05-30
2,6-Pyridinedicarboxylic acid (PDC) was electropolymerized on the glassy carbon electrode (GCE) surface combined with carboxylic group-functionalized single-walled carbon nanotubes (SWNTs) by cyclic voltammetry (CV) to form PDC-SWNTs composite film, which was rich in negatively charged carboxylic group. Then, poly(diallyldimethyl ammonium chloride) (PDDA), a linear cationic polyelectrolyte, was electrostatically adsorbed on the PDC-SWNTs/GCE surface. DNA probes with negatively charged phosphate group at the 5' end were immobilized on the PDDA/PDC-SWNTs/GCE due to the strong electrostatic attraction between PDDA and phosphate group of DNA. It has been found that modification of the electrode with PDC-SWNTs film has enhanced the effective electrode surface area and electron-transfer ability, in addition to providing negatively charged groups for the electrostatic assembly of cationic polyelectrolyte. PDDA plays a key role in the attachment of DNA probes to the PDC-SWNTs composite film and acts as a bridge to connect DNA with PDC-SWNTs film. The cathodic peak current of methylene blue (MB), an electroactive label, decreased obviously after the hybridization of DNA probe (ssDNA) with the complementary DNA (cDNA). This peak current change was used to monitor the recognition of the specific sequences related to PAT gene in the transgenic corn and the polymerase chain reaction (PCR) amplification of NOS gene from the sample of transgenic soybean with satisfactory results. Under optimal conditions, the dynamic detection range of the sensor to PAT gene target sequence was from 1.0x10(-11) to 1.0x10(-6) mol/L with the detection limit of 2.6x10(-12) mol/L.
Genome editing with CompoZr custom zinc finger nucleases (ZFNs).
Hansen, Keith; Coussens, Matthew J; Sago, Jack; Subramanian, Shilpi; Gjoka, Monika; Briner, Dave
2012-06-14
Genome editing is a powerful technique that can be used to elucidate gene function and the genetic basis of disease. Traditional gene editing methods such as chemical-based mutagenesis or random integration of DNA sequences confer indiscriminate genetic changes in an overall inefficient manner and require incorporation of undesirable synthetic sequences or use of aberrant culture conditions, potentially confusing biological study. By contrast, transient ZFN expression in a cell can facilitate precise, heritable gene editing in a highly efficient manner without the need for administration of chemicals or integration of synthetic transgenes. Zinc finger nucleases (ZFNs) are enzymes which bind and cut distinct sequences of double-stranded DNA (dsDNA). A functional CompoZr ZFN unit consists of two individual monomeric proteins that bind a DNA "half-site" of approximately 15-18 nucleotides (see Figure 1). When two ZFN monomers "home" to their adjacent target sites the DNA-cleavage domains dimerize and create a double-strand break (DSB) in the DNA. Introduction of ZFN-mediated DSBs in the genome lays a foundation for highly efficient genome editing. Imperfect repair of DSBs in a cell via the non-homologous end-joining (NHEJ) DNA repair pathway can result in small insertions and deletions (indels). Creation of indels within the gene coding sequence of a cell can result in frameshift and subsequent functional knockout of a gene locus at high efficiency. While this protocol describes the use of ZFNs to create a gene knockout, integration of transgenes may also be conducted via homology-directed repair at the ZFN cut site. The CompoZr Custom ZFN Service represents a systematic, comprehensive, and well-characterized approach to targeted gene editing for the scientific community with ZFN technology. Sigma scientists work closely with investigators to 1) perform due diligence analysis including analysis of relevant gene structure, biology, and model system pursuant to the project goals, 2) apply this knowledge to develop a sound targeting strategy, 3) then design, build, and functionally validate ZFNs for activity in a relevant cell line. The investigator receives positive control genomic DNA and primers, and ready-to-use ZFN reagents supplied in both plasmid DNA and in-vitro transcribed mRNA format. These reagents may then be delivered for transient expression in the investigator's cell line or cell type of choice. Samples are then tested for gene editing at the locus of interest by standard molecular biology techniques including PCR amplification, enzymatic digest, and electrophoresis. After positive signal for gene editing is detected in the initial population, cells are single-cell cloned and genotyped for identification of mutant clones/alleles.
Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.
Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M
1996-01-01
The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645
Enterococcus Xinjiangensis sp. nov., Isolated from Yogurt of Xinjiang, China.
Ren, Xiaopu; Li, Mingyang; Guo, Dongqi
2016-09-01
A Gram-strain-positive bacterial strain 48(T) was isolated from traditional yogurt in Xinjiang Province, China. The bacterium was characterized by a polyphasic approach, including 16S rRNA gene sequence analysis, polymerase α subunit (rpoA) gene sequence analysis, determination of DNA G+C content, DNA-DNA hybridization with the type strain of Enterococcus ratti and analysis of phenotypic features. Strain 48(T) accounted for 96.1, 95.8, 95.8, and 95.7 % with Enterococcus faecium CGMCC 1.2136(T), Enterococcus hirae ATCC 9790(T), Enterococcus durans CECT 411(T), and E. ratti ATCC 700914(T) in the 16S rRNA gene sequence similarities, respectively. The sequence of rpoA gene showed similarities of 99.0, 96.0, 96.0, and 96 % with that of E. faecium ATCC 19434(T), Enterococcus villorum LMG12287, E. hirae ATCC 9790(T), and E. durans ATCC 19432(T), respectively. Based upon of polyphasic characterization data obtained in the study, a novel species, Enterococcus xinjiangensis sp. nov., was proposed and the type strain was 48(T)(=CCTCC AB 2014041(T) = JCM 30200(T)).
Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H
1994-01-01
We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.
2015-02-01
The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less
Sugita, Mamoru; Shinozaki, Kazuo; Sugiura, Masahiro
1985-01-01
The nucleotide sequence of a tRNALys(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNAGly(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long. Images PMID:16593561
Sugita, M; Shinozaki, K; Sugiura, M
1985-06-01
The nucleotide sequence of a tRNA(Lys)(UUU) gene on tobacco (Nicotiana tabacum) chloroplast DNA has been determined. This gene is located 215 base pairs upstream from the gene for the 32,000-dalton thylakoid membrane protein on the same DNA strand and has a 2526-base-pair intron in the anticodon loop. The intron boundary sequence does not follow the G-U/A-G rule but is similar to those of tobacco chloroplast split genes for tRNA(Gly)(UCC) and ribosomal proteins L2 and S12. The intron contains one major open reading frame of 509 codons. The codon usage in the open reading frame resembles those observed in the genes for tobacco chloroplast proteins so far analyzed. The primary transcript of this tRNA gene is 2.7 kilobases long.
Comparative Analysis of the Complete Chloroplast Genome of Four Endangered Herbals of Notopterygium
Yang, Jiao; Yue, Ming; Niu, Chuan; Ma, Xiong-Feng; Li, Zhong-Hu
2017-01-01
Notopterygium H. de Boissieu (Apiaceae) is an endangered perennial herb endemic to China. A good knowledge of phylogenetic evolution and population genomics is conducive to the establishment of effective management and conservation strategies of the genus Notopterygium. In this study, the complete chloroplast (cp) genomes of four Notopterygium species (N. incisum C. C. Ting ex H. T. Chang, N. oviforme R. H. Shan, N. franchetii H. de Boissieu and N. forrestii H. Wolff) were assembled and characterized using next-generation sequencing. We investigated the gene organization, order, size and repeat sequences of the cp genome and constructed the phylogenetic relationships of Notopterygium species based on the chloroplast DNA and nuclear internal transcribed spacer (ITS) sequences. Comparative analysis of plastid genome showed that the cp DNA are the standard double-stranded molecule, ranging from 157,462 bp (N. oviforme) to 159,607 bp (N. forrestii) in length. The circular DNA each contained a large single-copy (LSC) region, a small single-copy (SSC) region, and a pair of inverted repeats (IRs). The cp DNA of four species contained 85 protein-coding genes, 37 transfer RNA (tRNA) genes and 8 ribosomal RNA (rRNA) genes, respectively. We determined the marked conservation of gene content and sequence evolutionary rate in the cp genome of four Notopterygium species. Three genes (psaI, psbI and rpoA) were possibly under positive selection among the four sampled species. Phylogenetic analysis showed that four Notopterygium species formed a monophyletic clade with high bootstrap support. However, the inconsistent interspecific relationships with the genus Notopterygium were identified between the cp DNA and ITS markers. The incomplete lineage sorting, convergence evolution or hybridization, gene infiltration and different sampling strategies among species may have caused the incongruence between the nuclear and cp DNA relationships. The present results suggested that Notopterygium species may have experienced a complex evolutionary history and speciation process. PMID:28422071
Transcriptional mapping of the ribosomal RNA region of mouse L-cell mitochondrial DNA.
Nagley, P; Clayton, D A
1980-01-01
The map positions in mouse mitochondrial DNA of the two ribosomal RNA genes and adjacent genes coding several small transcripts have been determined precisely by application of a procedure in which DNA-RNA hybrids have been subjected to digestion by S1 nuclease under conditions of varying severity. Digestion of the DNA-RNA hybrids with S1 nuclease yielded a series of species which were shown to contain ribosomal RNA molecules together with adjacent transcripts hybridized conjointly to a continuous segment of mitochondrial DNA. There is one small transcript about 60 bases long whose gene adjoins the sequences coding the 5'-end of the small ribosomal RNA (950 bases) and which lies approximately 200 nucleotides from the D-loop origin of heavy strand mitochondrial DNA synthesis. An 80-base transcript lies between the small and large ribosomal RNA genes, and genes for two further short transcript (each about 80 bases in length) abut the sequences coding the 3'-end of the large ribosomal RNA (approximately 1500 bases). The ability to isolate a discrete DNA-RNA hybrid species approximately 2700 base pairs in length containing all these transcripts suggests that there can be few nucleotides in this region of mouse mitochondrial DNA which are not represented as stable RNA species. Images PMID:6253898
Zill, Oliver A.; Sebisanovic, Dragan; Lopez, Rene; Blau, Sibel; Collisson, Eric A.; Divers, Stephen G.; Hoon, Dave S. B.; Kopetz, E. Scott; Lee, Jeeyun; Nikolinakos, Petros G.; Baca, Arthur M.; Kermani, Bahram G.; Eltoukhy, Helmy; Talasaz, AmirAli
2015-01-01
Next-generation sequencing of cell-free circulating solid tumor DNA addresses two challenges in contemporary cancer care. First this method of massively parallel and deep sequencing enables assessment of a comprehensive panel of genomic targets from a single sample, and second, it obviates the need for repeat invasive tissue biopsies. Digital SequencingTM is a novel method for high-quality sequencing of circulating tumor DNA simultaneously across a comprehensive panel of over 50 cancer-related genes with a simple blood test. Here we report the analytic and clinical validation of the gene panel. Analytic sensitivity down to 0.1% mutant allele fraction is demonstrated via serial dilution studies of known samples. Near-perfect analytic specificity (> 99.9999%) enables complete coverage of many genes without the false positives typically seen with traditional sequencing assays at mutant allele frequencies or fractions below 5%. We compared digital sequencing of plasma-derived cell-free DNA to tissue-based sequencing on 165 consecutive matched samples from five outside centers in patients with stage III-IV solid tumor cancers. Clinical sensitivity of plasma-derived NGS was 85.0%, comparable to 80.7% sensitivity for tissue. The assay success rate on 1,000 consecutive samples in clinical practice was 99.8%. Digital sequencing of plasma-derived DNA is indicated in advanced cancer patients to prevent repeated invasive biopsies when the initial biopsy is inadequate, unobtainable for genomic testing, or uninformative, or when the patient’s cancer has progressed despite treatment. Its clinical utility is derived from reduction in the costs, complications and delays associated with invasive tissue biopsies for genomic testing. PMID:26474073
Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I
1987-01-01
cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.
Intra-isolate genome variation in arbuscular mycorrhizal fungi persists in the transcriptome.
Boon, E; Zimmerman, E; Lang, B F; Hijri, M
2010-07-01
Arbuscular mycorrhizal fungi (AMF) are heterokaryotes with an unusual genetic makeup. Substantial genetic variation occurs among nuclei within a single mycelium or isolate. AMF reproduce through spores that contain varying fractions of this heterogeneous population of nuclei. It is not clear whether this genetic variation on the genome level actually contributes to the AMF phenotype. To investigate the extent to which polymorphisms in nuclear genes are transcribed, we analysed the intra-isolate genomic and cDNA sequence variation of two genes, the large subunit ribosomal RNA (LSU rDNA) of Glomus sp. DAOM-197198 (previously known as G. intraradices) and the POL1-like sequence (PLS) of Glomus etunicatum. For both genes, we find high sequence variation at the genome and transcriptome level. Reconstruction of LSU rDNA secondary structure shows that all variants are functional. Patterns of PLS sequence polymorphism indicate that there is one functional gene copy, PLS2, which is preferentially transcribed, and one gene copy, PLS1, which is a pseudogene. This is the first study that investigates AMF intra-isolate variation at the transcriptome level. In conclusion, it is possible that, in AMF, multiple nuclear genomes contribute to a single phenotype.
Asamizu, E; Nakamura, Y; Sato, S; Tabata, S
2000-06-30
For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.
rpoB Gene Sequencing for Identification of Corynebacterium Species
Khamis, Atieh; Raoult, Didier; La Scola, Bernard
2004-01-01
The genus Corynebacterium is a heterogeneous group of species comprising human and animal pathogens and environmental bacteria. It is defined on the basis of several phenotypic characters and the results of DNA-DNA relatedness and, more recently, 16S rRNA gene sequencing. However, the 16S rRNA gene is not polymorphic enough to ensure reliable phylogenetic studies and needs to be completely sequenced for accurate identification. The almost complete rpoB sequences of 56 Corynebacterium species were determined by both PCR and genome walking methods. In all cases the percent similarities between different species were lower than those observed by 16S rRNA gene sequencing, even for those species with degrees of high similarity. Several clusters supported by high bootstrap values were identified. In order to propose a method for strain identification which does not require sequencing of the complete rpoB sequence (approximately 3,500 bp), we identified an area with a high degree of polymorphism, bordered by conserved sequences that can be used as universal primers for PCR amplification and sequencing. The sequence of this fragment (434 to 452 bp) allows accurate species identification and may be used in the future for routine sequence-based identification of Corynebacterium species. PMID:15364970
Molecular-Sized DNA or RNA Sequencing Machine | NCI Technology Transfer Center | TTC
The National Cancer Institute's Gene Regulation and Chromosome Biology Laboratory is seeking statements of capability or interest from parties interested in collaborative research to co-develop a molecular-sized DNA or RNA sequencing machine.
The mitochondrial genome of Moniliophthora roreri, the frosty pod rot pathogen of cacao.
Costa, Gustavo G L; Cabrera, Odalys G; Tiburcio, Ricardo A; Medrano, Francisco J; Carazzolle, Marcelo F; Thomazella, Daniela P T; Schuster, Stephen C; Carlson, John E; Guiltinan, Mark J; Bailey, Bryan A; Mieczkowski, Piotr; Pereira, Gonçalo A G; Meinhardt, Lyndel W
2012-05-01
In this study, we report the sequence of the mitochondrial (mt) genome of the Basidiomycete fungus Moniliophthora roreri, which is the etiologic agent of frosty pod rot of cacao (Theobroma cacao L.). We also compare it to the mtDNA from the closely-related species Moniliophthora perniciosa, which causes witches' broom disease of cacao. The 94 Kb mtDNA genome of M. roreri has a circular topology and codes for the typical 14 mt genes involved in oxidative phosphorylation. It also codes for both rRNA genes, a ribosomal protein subunit, 13 intronic open reading frames (ORFs), and a full complement of 27 tRNA genes. The conserved genes of M. roreri mtDNA are completely syntenic with homologous genes of the 109 Kb mtDNA of M. perniciosa. As in M. perniciosa, M. roreri mtDNA contains a high number of hypothetical ORFs (28), a remarkable feature that make Moniliophthoras the largest reservoir of hypothetical ORFs among sequenced fungal mtDNA. Additionally, the mt genome of M. roreri has three free invertron-like linear mt plasmids, one of which is very similar to that previously described as integrated into the main M. perniciosa mtDNA molecule. Moniliophthora roreri mtDNA also has a region of suspected plasmid origin containing 15 hypothetical ORFs distributed in both strands. One of these ORFs is similar to an ORF in the mtDNA gene encoding DNA polymerase in Pleurotus ostreatus. The comparison to M. perniciosa showed that the 15 Kb difference in mtDNA sizes is mainly attributed to a lower abundance of repetitive regions in M. roreri (5.8 Kb vs 20.7 Kb). The most notable differences between M. roreri and M. perniciosa mtDNA are attributed to repeats and regions of plasmid origin. These elements might have contributed to the rapid evolution of mtDNA. Since M. roreri is the second species of the genus Moniliophthora whose mtDNA genome has been sequenced, the data presented here contribute valuable information for understanding the evolution of fungal mt genomes among closely-related species. Crown Copyright © 2012. Published by Elsevier Ltd. All rights reserved.
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-06-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation.
Fukuda, Tomoyuki; Ohta, Kunihiro; Ohya, Yoshikazu
2006-01-01
VMA1-derived endonuclease (VDE), a homing endonuclease in Saccharomyces cerevisiae, is encoded by the mobile intein-coding sequence within the nuclear VMA1 gene. VDE recognizes and cleaves DNA at the 31-bp VDE recognition sequence (VRS) in the VMA1 gene lacking the intein-coding sequence during meiosis to insert a copy of the intein-coding sequence at the cleaved site. The mechanism underlying the meiosis specificity of VMA1 intein-coding sequence homing remains unclear. We studied various factors that might influence the cleavage activity in vivo and found that VDE binding to the VRS can be detected only when DNA cleavage by VDE takes place, implying that meiosis-specific DNA cleavage is regulated by the accessibility of VDE to its target site. As a possible candidate for the determinant of this accessibility, we analyzed chromatin structure around the VRS and revealed that local chromatin structure near the VRS is altered during meiosis. Although the meiotic chromatin alteration exhibits correlations with DNA binding and cleavage by VDE at the VMA1 locus, such a chromatin alteration is not necessarily observed when the VRS is embedded in ectopic gene loci. This suggests that nucleosome positioning or occupancy around the VRS by itself is not the sole mechanism for the regulation of meiosis-specific DNA cleavage by VDE and that other mechanisms are involved in the regulation. PMID:16757746
Molecular detection and characterization of Anaplasma platys in dogs and ticks in Cuba.
Silva, Claudia Bezerra da; Santos, Huarrisson Azevedo; Navarrete, Maylín González; Ribeiro, Carla Carolina Dias Uzedo; Gonzalez, Belkis Corona; Zaldivar, Maykelin Fuentes; Pires, Marcus Sandes; Peckle, Maristela; Costa, Renata Lins da; Vitari, Gabriela Lopes Vivas; Massard, Carlos Luiz
2016-07-01
Canine cyclic thrombocytopenia, an infectious disease caused by Anaplasma platys is a worldwide dog health problem. This study aimed to detect and characterize A. platys deoxyribonucleic acid (DNA) in dogs and ticks from Cuba using molecular methods. The study was conducted in four cities of Cuba (Habana del Este, Boyeros, Cotorro and San José de las Lajas). Blood samples were collected from 100 dogs in these cities. The animals were inspected for the detection of tick infestation and specimens were collected. Genomic DNA was extracted from dog blood and ticks using a commercial kit. Genomic DNA samples from blood and ticks were tested by a nested polymerase chain reaction (nPCR) to amplify 678 base pairs (bp) from the 16S ribosomal DNA (rDNA) of A. platys. Positive samples in nPCR were also subjected to PCR to amplify a fragment of 580bp from the citrate synthase (gltA) gene and the products were sequenced. Only Rhipicephalus sanguineus sensu lato (s.l.) was found on dogs, and 10.20% (n=5/49) of these ticks plus sixteen percent (16.0%, n=16/100) of dogs were considered positive for A. platys by nPCR targeting the 16S rDNA gene. All analyzed gltA and 16S rDNA sequences showed a 99-100% identity with sequences of A. platys reported in around the world. Phylogenetic analysis showed two defined clusters for the 16S rDNA gene and three defined clusters for the gltA gene. Based on the gltA gene, the deduced amino acid sequence showed two mutations at positions 88 and 168 compared with the sequence DQ525687 (GenBank ID from Italian sample), used as a reference in the alignment. A preliminary study on the epidemiological aspects associated with infection by A. platys showed no statistical association with the variables studied (p>0.05). This is the first evidence of the presence of A. platys in dogs and ticks in Cuba. Further studies are needed to evaluate the epidemiological aspects of A. platys infection in Cuban dogs. Copyright © 2016 Elsevier GmbH. All rights reserved.
[Hydrophidae identification through analysis on Cyt b gene barcode].
Liao, Li-xi; Zeng, Ke-wu; Tu, Peng-fei
2015-08-01
Hydrophidae, one of the precious traditional Chinese medicines, is generally drily preserved to prevent corruption, but it is hard to identify the species of Hydrophidae through the appearance because of the change due to the drying process. The identification through analysis on gene barcode, a new technique in species identification, can avoid the problem. The gene barcodes of the 6 species of Hydrophidae like Lapemis hardwickii were aquired through DNA extraction and gene sequencing. These barcodes were then in sequence alignment and test the identification efficency by BLAST. Our results revealed that the barcode sequences performed high identification efficiency, and had obvious difference between intra- and inter-species. These all indicated that Cyt b DNA barcoding can confirm the Hydrophidae identification.
Khalil, Mohamed I; Sommer, Marvin H; Hay, John; Ruyechan, William T; Arvin, Ann M
2015-07-01
The VZV genome has two origins of DNA replication (oriS), each of which consists of an AT-rich sequence and three origin binding protein (OBP) sites called Box A, C and B. In these experiments, the mutation in the core sequence CGC of the Box A and C not only inhibited DNA replication but also inhibited both ORF62 and ORF63 expression in reporter gene assays. In contrast the Box B mutation did not influence DNA replication or flanking gene transcription. These results suggest that efficient DNA replication enhances ORF62 and ORF63 transcription. Recombinant viruses carrying these mutations in both sites and one with a deletion of the whole oriS were constructed. Surprisingly, the recombinant virus lacking both copies of oriS retained the capacity to replicate in melanoma and HELF cells suggesting that VZV has another origin of DNA replication. Copyright © 2015 Elsevier Inc. All rights reserved.
Mochida, Keiichi; Uehara-Yamaguchi, Yukiko; Takahashi, Fuminori; Yoshida, Takuhiro; Sakurai, Tetsuya; Shinozaki, Kazuo
2013-01-01
A comprehensive collection of full-length cDNAs is essential for correct structural gene annotation and functional analyses of genes. We constructed a mixed full-length cDNA library from 21 different tissues of Brachypodium distachyon Bd21, and obtained 78,163 high quality expressed sequence tags (ESTs) from both ends of ca. 40,000 clones (including 16,079 contigs). We updated gene structure annotations of Brachypodium genes based on full-length cDNA sequences in comparison with the latest publicly available annotations. About 10,000 non-redundant gene models were supported by full-length cDNAs; ca. 6,000 showed some transcription unit modifications. We also found ca. 580 novel gene models, including 362 newly identified in Bd21. Using the updated transcription start sites, we searched a total of 580 plant cis-motifs in the −3 kb promoter regions and determined a genome-wide Brachypodium promoter architecture. Furthermore, we integrated the Brachypodium full-length cDNAs and updated gene structures with available sequence resources in wheat and barley in a web-accessible database, the RIKEN Brachypodium FL cDNA database. The database represents a “one-stop” information resource for all genomic information in the Pooideae, facilitating functional analysis of genes in this model grass plant and seamless knowledge transfer to the Triticeae crops. PMID:24130698
Mitochondrial DNA sequence analysis of four Alzheimer`s and Parkinson`s disease patients
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brown, M.D.; Shoffner, J.M.; Wallace, D.C.
1996-01-22
The mitochondrial DNA (mtDNA) sequence was determined on 3 patients with Alzheimer`s disease (AD) exhibiting AD plus Parkinson`s disease (PD) neuropathologic changes and one patient with PD. Patient mtDNA sequences were compared to the standard Cambridge sequence to identify base changes. In the first AD + PD patient, 2 of the 15 nucleotide substitutions may contribute to the neuropathology, a nucleotide pair (np) 4336 transition in the tRNA{sup Gln} gene found 7.4 times more frequently in patients than in controls, and a unique np 721 transition in the 12S rRNA gene which was not found in 70 other patients ormore » 905 controls. In the second AD + PD patient, 27 nucleotide substitutions were detected, including an np 3397 transition in the ND1 gene which converts a conserved methionine to a valine. In the third AD + PD patient, 2 polymorphic base substitutions frequently found at increased frequency in Leber`s hereditary optic neuropathy patients were observed, an np 4216 transition in ND1 and an np 13708 transition in the ND5 gene. For the PD patient, 2 novel variants were observed among 25 base substitutions, an np 1709 substitution in the 16S rRNA gene and an np 15851 missense mutation in the cytb gene. Further studies will be required to demonstrate a casual role for these base substitutions in neurodegenerative disease. 68 refs., 2 tabs.« less
Salient Features of Endonuclease Platforms for Therapeutic Genome Editing.
Certo, Michael T; Morgan, Richard A
2016-03-01
Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications.
Salient Features of Endonuclease Platforms for Therapeutic Genome Editing
Certo, Michael T; Morgan, Richard A
2016-01-01
Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications. PMID:26796671
Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K
2001-01-24
We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoshida, Michihiro C.; Wada, Makio; Satoh, Hitoshi
1988-07-01
The human HST1 gene, previously designated the hst gene, and now assigned the name HSTF1 for heparin-binding secretory transforming factor in human gene nomenclature, was originally identified as a transforming gene in DNAs from human stomach cancers by transfection assay with mouse NIH 3T3 cells. The amino acid sequence of the product deduced from DNA sequences of the HST1 cDNA and genomic clones had approximately 40% homology to human basic and acidic fibroblast growth factors and mouse Int-2-encoded protein. The authors have mapped the human HST1 gene to chromosome 11 at band q13.3 by Southern blot hybridization analysis of amore » panel of human and mouse somatic cell hybrids and in situ hybridization with an HST1 cDNA probe. The HST1 gene was found to be amplified in DNAs obtained from a stomach cancer and a vulvar carcinoma cell line, A431. In all of these samples of DNA, the INT2 gene, previously mapped to human chromosome 11q13, was also amplified to the same degree as the HST1 gene.« less
Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko
2001-01-01
Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698
Chevrier, Sandy; Boidot, Romain
2014-10-06
The widespread use of Next Generation Sequencing has opened up new avenues for cancer research and diagnosis. NGS will bring huge amounts of new data on cancer, and especially cancer genetics. Current knowledge and future discoveries will make it necessary to study a huge number of genes that could be involved in a genetic predisposition to cancer. In this regard, we developed a Nextera design to study 11 complete genes involved in DNA damage repair. This protocol was developed to safely study 11 genes (ATM, BARD1, BRCA1, BRCA2, BRIP1, CHEK2, PALB2, RAD50, RAD51C, RAD80, and TP53) from promoter to 3'-UTR in 24 patients simultaneously. This protocol, based on transposase technology and gDNA enrichment, gives a great advantage in terms of time for the genetic diagnosis thanks to sample multiplexing. This protocol can be safely used with blood gDNA.
Li, Qian-Nan; Guo, Lei; Hou, Yi; Ou, Xiang-Hong; Liu, Zhonghua; Sun, Qing-Yuan
2018-06-22
Polycystic ovary syndrome (PCOS), a familial aggregation disease that causes anovulation in women, has well-recognised characteristics, two of which are hyperinsulinaemia and hyperandrogenaemia. To determine whether the DNA methylation status is altered in oocytes by high insulin and androgen levels, we generated a mouse model with hyperinsulinaemia and hyperandrogenaemia by injection of insulin and human chorionic gonadotrophin and investigated DNA methylation changes through single-cell level whole genome bisulphite sequencing. Our results showed that hyperinsulinaemia and hyperandrogenaemia had no significant effects on the global DNA methylation profile and different functional regions of genes, but did alter methylation status of some genes, which were significantly enriched in 17 gene ontology (GO) terms (P<0.05) by GO analysis. Among differently methylated genes, some were related to the occurrence of PCOS. Based on our results, we suggest that hyperinsulinaemia and hyperandrogenaemia may cause changes in some DNA methylation loci in oocytes.
Generation of Leishmania Hybrids by Whole Genomic DNA Transformation
Coelho, Adriano C.; Leprohon, Philippe; Ouellette, Marc
2012-01-01
Genetic exchange is a powerful tool to study gene function in microorganisms. Here, we tested the feasibility of generating Leishmania hybrids by electroporating genomic DNA of donor cells into recipient Leishmania parasites. The donor DNA was marked with a drug resistance marker facilitating the selection of DNA transfer into the recipient cells. The transferred DNA was integrated exclusively at homologous locus and was as large as 45 kb. The independent generation of L. infantum hybrids with L. major sequences was possible for several chromosomal regions. Interfering with the mismatch repair machinery by inactivating the MSH2 gene enabled an increased efficiency of recombination between divergent sequences, hence favouring the selection of hybrids between species. Hybrids were shown to acquire the phenotype derived from the donor cells, as demonstrated for the transfer of drug resistance genes from L. major into L. infantum. The described method is a first step allowing the generation of in vitro hybrids for testing gene functions in a natural genomic context in the parasite Leishmania. PMID:23029579
Sakurai, Tetsuya; Plata, Germán; Rodríguez-Zapata, Fausto; Seki, Motoaki; Salcedo, Andrés; Toyoda, Atsushi; Ishiwata, Atsushi; Tohme, Joe; Sakaki, Yoshiyuki; Shinozaki, Kazuo; Ishitani, Manabu
2007-01-01
Background Cassava, an allotetraploid known for its remarkable tolerance to abiotic stresses is an important source of energy for humans and animals and a raw material for many industrial processes. A full-length cDNA library of cassava plants under normal, heat, drought, aluminum and post harvest physiological deterioration conditions was built; 19968 clones were sequence-characterized using expressed sequence tags (ESTs). Results The ESTs were assembled into 6355 contigs and 9026 singletons that were further grouped into 10577 scaffolds; we found 4621 new cassava sequences and 1521 sequences with no significant similarity to plant protein databases. Transcripts of 7796 distinct genes were captured and we were able to assign a functional classification to 78% of them while finding more than half of the enzymes annotated in metabolic pathways in Arabidopsis. The annotation of sequences that were not paired to transcripts of other species included many stress-related functional categories showing that our library is enriched with stress-induced genes. Finally, we detected 230 putative gene duplications that include key enzymes in reactive oxygen species signaling pathways and could play a role in cassava stress response features. Conclusion The cassava full-length cDNA library here presented contains transcripts of genes involved in stress response as well as genes important for different areas of cassava research. This library will be an important resource for gene discovery, characterization and cloning; in the near future it will aid the annotation of the cassava genome. PMID:18096061
DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.
Lao, G; Ghangas, G S; Jung, E D; Wilson, D B
1991-01-01
The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434
Processing and population genetic analysis of multigenic datasets with ProSeq3 software.
Filatov, Dmitry A
2009-12-01
The current tendency in molecular population genetics is to use increasing numbers of genes in the analysis. Here I describe a program for handling and population genetic analysis of DNA polymorphism data collected from multiple genes. The program includes a sequence/alignment editor and an internal relational database that simplify the preparation and manipulation of multigenic DNA polymorphism datasets. The most commonly used DNA polymorphism analyses are implemented in ProSeq3, facilitating population genetic analysis of large multigenic datasets. Extensive input/output options make ProSeq3 a convenient hub for sequence data processing and analysis. The program is available free of charge from http://dps.plants.ox.ac.uk/sequencing/proseq.htm.
Hughes, Colin E; Eastwood, Ruth J; Donovan Bailey, C
2005-01-01
Phylogenetic analyses of DNA sequences have prompted spectacular progress in assembling the Tree of Life. However, progress in constructing phylogenies among closely related species, at least for plants, has been less encouraging. We show that for plants, the rapid accumulation of DNA characters at higher taxonomic levels has not been matched by conventional sequence loci at the species level, leaving a lack of well-resolved gene trees that is hindering investigations of many fundamental questions in plant evolutionary biology. The most popular approach to address this problem has been to use low-copy nuclear genes as a source of DNA sequence data. However, this has had limited success because levels of variation among nuclear intron sequences across groups of closely related species are extremely variable and generally lower than conventionally used loci, and because no universally useful low-copy nuclear DNA sequence loci have been developed. This suggests that solutions will, for the most part, be lineage-specific, prompting a move away from ‘universal’ gene thinking for species-level phylogenetics. The benefits and limitations of alternative approaches to locate more variable nuclear loci are discussed and the potential of anonymous non-genic nuclear loci is highlighted. Given the virtually unlimited number of loci that can be generated using these new approaches, it is clear that effective screening will be critical for efficient selection of the most informative loci. Strategies for screening are outlined. PMID:16553318
Trading genes along the silk road: mtDNA sequences and the origin of central Asian populations.
Comas, D; Calafell, F; Mateu, E; Pérez-Lezaun, A; Bosch, E; Martínez-Arias, R; Clarimon, J; Facchini, F; Fiori, G; Luiselli, D; Pettener, D; Bertranpetit, J
1998-01-01
Central Asia is a vast region at the crossroads of different habitats, cultures, and trade routes. Little is known about the genetics and the history of the population of this region. We present the analysis of mtDNA control-region sequences in samples of the Kazakh, the Uighurs, the lowland Kirghiz, and the highland Kirghiz, which we have used to address both the population history of the region and the possible selective pressures that high altitude has on mtDNA genes. Central Asian mtDNA sequences present features intermediate between European and eastern Asian sequences, in several parameters-such as the frequencies of certain nucleotides, the levels of nucleotide diversity, mean pairwise differences, and genetic distances. Several hypotheses could explain the intermediate position of central Asia between Europe and eastern Asia, but the most plausible would involve extensive levels of admixture between Europeans and eastern Asians in central Asia, possibly enhanced during the Silk Road trade and clearly after the eastern and western Eurasian human groups had diverged. Lowland and highland Kirghiz mtDNA sequences are very similar, and the analysis of molecular variance has revealed that the fraction of mitochondrial genetic variance due to altitude is not significantly different from zero. Thus, it seems unlikely that altitude has exerted a major selective pressure on mitochondrial genes in central Asian populations. PMID:9837835
Uchoi, Ajit; Malik, Surendra Kumar; Choudhary, Ravish; Kumar, Susheel; Rohini, M R; Pal, Digvender; Ercisli, Sezai; Chaudhury, Rekha
2016-06-01
Phylogenetic relationships of Indian Citron (Citrus medica L.) with other important Citrus species have been inferred through sequence analyses of rbcL and matK gene region of chloroplast DNA. The study was based on 23 accessions of Citrus genotypes representing 15 taxa of Indian Citrus, collected from wild, semi-wild, and domesticated stocks. The phylogeny was inferred using the maximum parsimony (MP) and neighbor-joining (NJ) methods. Both MP and NJ trees separated all the 23 accessions of Citrus into five distinct clusters. The chloroplast DNA (cpDNA) analysis based on rbcL and matK sequence data carried out in Indian taxa of Citrus was useful in differentiating all the true species and species/varieties of probable hybrid origin in distinct clusters or groups. Sequence analysis based on rbcL and matK gene provided unambiguous identification and disposition of true species like C. maxima, C. medica, C. reticulata, and related hybrids/cultivars. The separation of C. maxima, C. medica, and C. reticulata in distinct clusters or sub-clusters supports their distinctiveness as the basic species of edible Citrus. However, the cpDNA sequence analysis of rbcL and matK gene could not find any clear cut differentiation between subgenera Citrus and Papeda as proposed in Swingle's system of classification.
Sastre-Garau, X; Favre, M; Couturier, J; Orth, G
2000-08-01
We previously described two genital carcinomas (IC2, IC4) containing human papillomavirus type 16 (HPV-16)- or HPV-18-related sequences integrated in chromosomal bands containing the c-myc (8q24) or N-myc (2p24) gene, respectively. The c-myc gene was rearranged and amplified in IC2 cells without evidence of overexpression. The N-myc gene was amplified and highly transcribed in IC4 cells. Here, the sequence of an 8039 bp IC4 DNA fragment containing the integrated viral sequences and the cellular junctions is reported. A 3948 bp segment of the genome of HPV-45 encompassing the upstream regulatory region and the E6 and E7 ORFs was integrated into the untranslated part of N-myc exon 3, upstream of the N-myc polyadenylation signal. Both N-myc and HPV-45 sequences were amplified 10- to 20-fold. The 3' ends of the major N-myc transcript were mapped upstream of the 5' junction. A minor N-myc/HPV-45 fusion transcript was also identified, as well as two abundant transcripts from the HPV-45 E6-E7 region. Large amounts of N-myc protein were detected in IC4 cells. A major alteration of c-myc sequences in IC2 cells involved the insertion of a non-coding sequence into the second intron and their co-amplification with the third exon, without any evidence for the integration of HPV-16 sequences within or close to the gene. Different patterns of myc gene alterations may thus be associated with integration of HPV DNA in genital tumours, including the activation of the protooncogene via a mechanism of insertional mutagenesis and/or gene amplification.
Oligo/Polynucleotide-Based Gene Modification: Strategies and Therapeutic Potential
Sargent, R. Geoffrey; Kim, Soya
2011-01-01
Oligonucleotide- and polynucleotide-based gene modification strategies were developed as an alternative to transgene-based and classical gene targeting-based gene therapy approaches for treatment of genetic disorders. Unlike the transgene-based strategies, oligo/polynucleotide gene targeting approaches maintain gene integrity and the relationship between the protein coding and gene-specific regulatory sequences. Oligo/polynucleotide-based gene modification also has several advantages over classical vector-based homologous recombination approaches. These include essentially complete homology to the target sequence and the potential to rapidly engineer patient-specific oligo/polynucleotide gene modification reagents. Several oligo/polynucleotide-based approaches have been shown to successfully mediate sequence-specific modification of genomic DNA in mammalian cells. The strategies involve the use of polynucleotide small DNA fragments, triplex-forming oligonucleotides, and single-stranded oligodeoxynucleotides to mediate homologous exchange. The primary focus of this review will be on the mechanistic aspects of the small fragment homologous replacement, triplex-forming oligonucleotide-mediated, and single-stranded oligodeoxynucleotide-mediated gene modification strategies as it relates to their therapeutic potential. PMID:21417933
The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelilhood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the...
The phylogenetic relationship of Alexandrium monilatum to other Alexandrium spp. was explored using 18S rDNA sequences. Maximum likelihood phylogenetic analysis of the combined rDNA sequences established that A. monilatum paired with Alexandrium taylori and that the pair was the ...
The control of lambda DNA terminase synthesis.
Murialdo, H; Davidson, A; Chow, S; Gold, M
1987-01-01
Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140
Pang, Huili; Kitahara, Maki; Tan, Zhongfang; Wang, Yanping; Qin, Guangyong; Ohkuma, Moriya; Cai, Yimin
2012-10-01
Characterization and identification of strain CW 1 ( = JCM 17161) isolated from corn silage were performed. Strain CW 1 was a Gram-positive, catalase-negative and homofermentative rod that produced the DL-form of lactic acid. This strain exhibited more than 99.6% 16S rRNA gene sequence similarity and greater than 82% DNA-DNA reassociation with type strains of Lactobacillus kimchii, L. bobalius and L. paralimentarius. To clarify the taxonomic positions of these type strains, phenotypic characterization, 16S rRNA gene sequencing, ribotyping and DNA-DNA relatedness were examined. The three type strains displayed different L-arabinose, lactose, melibiose, melezitose, raffinose and N-acetyl-β-glucosaminidase fermentation patterns. Phylogenetic analysis showed that L. paralimentarius is a closer neighbour of L. kimchii and L. bobalius, sharing 99.5-99.9% 16S rRNA gene sequence similarity, which was confirmed by the high DNA-DNA relatedness (≥82%) between L. paralimentarius JCM 10415(T), L. bobalius JCM 16180(T) and L. kimchii JCM 10707(T). Therefore, it is proposed that L. kimchii and L. bobalius should be reclassified as later synonyms of L. paralimentarius.
Marinospirillum insulare sp. nov., a novel halophilic helical bacterium isolated from kusaya gravy.
Satomi, M; Kimura, B; Hayashi, M; Okuzumi, M; Fujii, T
2004-01-01
A novel species that belongs to the genus Marinospirillum is described on the basis of phenotypic characteristics, phylogenetic analysis of 16S rRNA and gyrB gene sequences and DNA-DNA hybridization. Four strains of helical, halophilic, Gram-negative, heterotrophic bacteria were isolated from kusaya gravy, which is fermented brine that is used for the production of traditional dried fish in the Izu Islands of Japan. All of the new isolates were motile by means of bipolar tuft flagella, of small cell size, coccoid-body-forming and aerophilic; it was concluded that they belong to the same bacterial species, based on DNA-DNA hybridization values (>70% DNA relatedness). DNA G+C contents of the new strains were 42-43 mol% and they had isoprenoid quinone Q-8 as the major component. Phylogenetic analysis of 16S rRNA gene sequences indicated that the new isolates were members of the genus Marinospirillum; sequence similarity of the new isolates to Marinospirillum minutulum, Marinospirillum megaterium and Marinospirillum alkaliphilum was 98.5, 98.2 and 95.2%, respectively. Phylogenetic analysis based on the gyrB gene indicated that the new isolates had enough phylogenetic distance from M. minutulum and M. megaterium to be regarded as different species, with 84.7 and 78.7% sequence similarity, respectively. DNA-DNA hybridization showed that the new isolates had <36% DNA relatedness to M. minutulum and M. megaterium, supporting the phylogenetic conclusion. Thus, a novel species is proposed: Marinospirillum insulare sp. nov. (type strain, KT=LMG 21802T=NBRC 100033T).
Assiri, Abdullah S; El-Gamal, Basiouny A; Hafez, Elsayed E; Haidara, Mohamed A
2014-12-01
To produce an effective recombinant streptokinase (rSK) from pathogenic Streptococcus pyogenes isolate in yeast, and evaluate its potential for thrombolytic therapy. This study was conducted from November 2012 to December 2013 at King Khalid University, Abha, Kingdom of Saudi Arabia (KSA). Throat swabs collected from 45 pharyngitis patients in Asser Central Hospital, Abha, KSA were used to isolate Streptococcus pyogenes. The bacterial DNA was used for amplification of the streptokinase gene (1200 bp). The gene was cloned and in vitro transcribed in an eukaryotic expression vector that was transformed into yeast Pichia pastoris SMD1168, and the rSK protein was purified and tested for its thrombolytic activity. The Streptococcus pyogenes strain was isolated and its DNA nucleotide sequence revealed similarity to other Streptococcus pyogenes in the Gene bank. Sequencing of the amplified gene based on DNA nucleotide sequence revealed a SK gene closely related to other SK genes in the Gene bank. However, based on deduced amino acids sequence, the gene formed a separate cluster different from clusters formed by other examined genes, suggesting a new bacterial isolate and accordingly a new gene. The purified protein showed 82% clot lysis compared to a commercial SK (81%) at an enzyme concentration of 2000 U/ml. The present yeast rSK showed similar thrombolytic activity in vitro as that of a commercial SK, suggesting its potential for thrombolytic therapy and large scale production.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sung, Z.R.
1988-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less
Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson
2014-03-01
16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).
Geiss, K T; Abbas, G M; Makaroff, C A
1994-04-01
The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.
Sequence Composition and Gene Content of the Short Arm of Rye (Secale cereale) Chromosome 1
Fluch, Silvia; Kopecky, Dieter; Burg, Kornel; Šimková, Hana; Taudien, Stefan; Petzold, Andreas; Kubaláková, Marie; Platzer, Matthias; Berenyi, Maria; Krainer, Siegfried; Doležel, Jaroslav; Lelley, Tamas
2012-01-01
Background The purpose of the study is to elucidate the sequence composition of the short arm of rye chromosome 1 (Secale cereale) with special focus on its gene content, because this portion of the rye genome is an integrated part of several hundreds of bread wheat varieties worldwide. Methodology/Principal Findings Multiple Displacement Amplification of 1RS DNA, obtained from flow sorted 1RS chromosomes, using 1RS ditelosomic wheat-rye addition line, and subsequent Roche 454FLX sequencing of this DNA yielded 195,313,589 bp sequence information. This quantity of sequence information resulted in 0.43× sequence coverage of the 1RS chromosome arm, permitting the identification of genes with estimated probability of 95%. A detailed analysis revealed that more than 5% of the 1RS sequence consisted of gene space, identifying at least 3,121 gene loci representing 1,882 different gene functions. Repetitive elements comprised about 72% of the 1RS sequence, Gypsy/Sabrina (13.3%) being the most abundant. More than four thousand simple sequence repeat (SSR) sites mostly located in gene related sequence reads were identified for possible marker development. The existence of chloroplast insertions in 1RS has been verified by identifying chimeric chloroplast-genomic sequence reads. Synteny analysis of 1RS to the full genomes of Oryza sativa and Brachypodium distachyon revealed that about half of the genes of 1RS correspond to the distal end of the short arm of rice chromosome 5 and the proximal region of the long arm of Brachypodium distachyon chromosome 2. Comparison of the gene content of 1RS to 1HS barley chromosome arm revealed high conservation of genes related to chromosome 5 of rice. Conclusions The present study revealed the gene content and potential gene functions on this chromosome arm and demonstrated numerous sequence elements like SSRs and gene-related sequences, which can be utilised for future research as well as in breeding of wheat and rye. PMID:22328922
Sequencing, Analysis, and Annotation of Expressed Sequence Tags for Camelus dromedarius
Al-Swailem, Abdulaziz M.; Shehata, Maher M.; Abu-Duhier, Faisel M.; Al-Yamani, Essam J.; Al-Busadah, Khalid A.; Al-Arawi, Mohammed S.; Al-Khider, Ali Y.; Al-Muhaimeed, Abdullah N.; Al-Qahtani, Fahad H.; Manee, Manee M.; Al-Shomrani, Badr M.; Al-Qhtani, Saad M.; Al-Harthi, Amer S.; Akdemir, Kadir C.; Otu, Hasan H.
2010-01-01
Despite its economical, cultural, and biological importance, there has not been a large scale sequencing project to date for Camelus dromedarius. With the goal of sequencing complete DNA of the organism, we first established and sequenced camel EST libraries, generating 70,272 reads. Following trimming, chimera check, repeat masking, cluster and assembly, we obtained 23,602 putative gene sequences, out of which over 4,500 potentially novel or fast evolving gene sequences do not carry any homology to other available genomes. Functional annotation of sequences with similarities in nucleotide and protein databases has been obtained using Gene Ontology classification. Comparison to available full length cDNA sequences and Open Reading Frame (ORF) analysis of camel sequences that exhibit homology to known genes show more than 80% of the contigs with an ORF>300 bp and ∼40% hits extending to the start codons of full length cDNAs suggesting successful characterization of camel genes. Similarity analyses are done separately for different organisms including human, mouse, bovine, and rat. Accompanying web portal, CAGBASE (http://camel.kacst.edu.sa/), hosts a relational database containing annotated EST sequences and analysis tools with possibility to add sequences from public domain. We anticipate our results to provide a home base for genomic studies of camel and other comparative studies enabling a starting point for whole genome sequencing of the organism. PMID:20502665
Turmel, Monique; Otis, Christian; Lemieux, Claude
2007-01-01
Background The Streptophyta comprises all land plants and six groups of charophycean green algae. The scaly biflagellate Mesostigma viride (Mesostigmatales) and the sarcinoid Chlorokybus atmophyticus (Chlorokybales) represent the earliest diverging lineages of this phylum. In trees based on chloroplast genome data, these two charophycean green algae are nested in the same clade. To validate this relationship and gain insight into the ancestral state of the mitochondrial genome in the Charophyceae, we sequenced the mitochondrial DNA (mtDNA) of Chlorokybus and compared this genome sequence with those of three other charophycean green algae and the bryophytes Marchantia polymorpha and Physcomitrella patens. Results The Chlorokybus genome differs radically from its 42,424-bp Mesostigma counterpart in size, gene order, intron content and density of repeated elements. At 201,763-bp, it is the largest mtDNA yet reported for a green alga. The 70 conserved genes represent 41.4% of the genome sequence and include nad10 and trnL(gag), two genes reported for the first time in a streptophyte mtDNA. At the gene order level, the Chlorokybus genome shares with its Chara, Chaetosphaeridium and bryophyte homologues eight to ten gene clusters including about 20 genes. Notably, some of these clusters exhibit gene linkages not previously found outside the Streptophyta, suggesting that they originated early during streptophyte evolution. In addition to six group I and 14 group II introns, short repeated sequences accounting for 7.5% of the genome were identified. Mitochondrial trees were unable to resolve the correct position of Mesostigma, due to analytical problems arising from accelerated sequence evolution in this lineage. Conclusion The Chlorokybus and Mesostigma mtDNAs exemplify the marked fluidity of the mitochondrial genome in charophycean green algae. The notion that the mitochondrial genome was constrained to remain compact during charophycean evolution is no longer tenable. Our data raise the possibility that the emergence of land plants was not associated with a substantial gain of intergenic sequences by the mitochondrial genome. PMID:17537252
VaDiR: an integrated approach to Variant Detection in RNA.
Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy
2018-02-01
Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.
USDA-ARS?s Scientific Manuscript database
Changes in gene regulation that underlie phenotypic evolution can be encoded directly in the DNA sequence or mediated by chromatin modifications such as DNA methylation. It has been hypothesized that the evolution of social behavior is associated with enhanced gene regulatory potential, which may in...
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Lu, L; Komada, M; Kitamura, N
1998-06-15
Hrs is a 115kDa zinc finger protein which is rapidly tyrosine phosphorylated in cells stimulated with various growth factors. We previously purified the protein from a mouse cell line and cloned its cDNA. In the present study, we cloned a human Hrs cDNA from a human placenta cDNA library by cross-hybridization, using the mouse cDNA as a probe, and determined its nucleotide sequence. The human Hrs cDNA encoded a 777-amino-acid protein whose sequence was 93% identical to that of mouse Hrs. Northern blot analysis showed that the Hrs mRNA was about 3.0kb long and was expressed in all the human adult and fetal tissues tested. In addition, we showed by genomic Southern blot analysis that the human Hrs gene was a single-copy gene with a size of about 20kb. Furthermore, the human Hrs gene was mapped to chromosome 17 by Southern blotting of genomic DNAs from human/rodent somatic cell hybrids. Copyright 1998 Elsevier Science B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Lau, Yun-Fai; Kan, Yuet Wai
1983-09-01
We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.
Hussey, Richard S; Huang, Guozhong; Allen, Rex
2011-01-01
Identifying parasitism genes encoding proteins secreted from a plant-parasitic nematode's esophageal gland cells and injected through its stylet into plant tissue is the key to understanding the molecular basis of nematode parasitism of plants. Parasitism genes have been cloned by directly microaspirating the cytoplasm from the esophageal gland cells of different parasitic stages of cyst or root-knot nematodes to provide mRNA to create a gland cell-specific cDNA library by long-distance reverse-transcriptase polymerase chain reaction. cDNA clones are sequenced and deduced protein sequences with a signal peptide for secretion are identified for high-throughput in situ hybridization to confirm gland-specific expression.
Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G
1992-05-01
Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)
Identification and analysis of pig chimeric mRNAs using RNA sequencing data
2012-01-01
Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561
Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.
Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y
1996-01-01
The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.
Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro
2011-05-01
Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.
Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
DOE Office of Scientific and Technical Information (OSTI.GOV)
Karathanasis, S.K.; Ferris, E.; Haddad, I.A.
1987-10-01
The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including themore » DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis.« less
Informational structure of genetic sequences and nature of gene splicing
NASA Astrophysics Data System (ADS)
Trifonov, E. N.
1991-10-01
Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.
DNA polymerase having modified nucleotide binding site for DNA sequencing
Tabor, Stanley; Richardson, Charles
1997-01-01
Modified gene encoding a modified DNA polymerase wherein the modified polymerase incorporates dideoxynucleotides at least 20-fold better compared to the corresponding deoxynucleotides as compared with the corresponding naturally-occurring DNA polymerase.
Single-Stranded γPNAs for In Vivo Site-Specific Genome Editing via Watson-Crick Recognition
Bahal, Raman; Quijano, Elias; McNeer, Nicole Ali; Liu, Yanfeng; Bhunia, Dinesh C.; López-Giráldez, Francesco; Fields, Rachel J.; Saltzman, W. Mark; Ly, Danith H.; Glazer, Peter M.
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction. PMID:25174576
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
[Application of the polymerase chain reaction (PCR) in the diagnosis of Hb S-beta(+)-thalassemia].
Harano, K; Harano, T; Kushida, Y; Ueda, S
1991-08-01
Isoelectric focusing of the hemolysate prepared from a two-year-old American black boy with microcytic hypochromia showed the presence of a high percentage (63.3%) of such Hb variant as Hb S, while the levels of Hb A, Hb F and Hb A2 were 20.0%, 12.7%, and 4.0%, respectively. The ratio of the non-alpha-chain to the alpha-chain of the biosynthesized globin chains was 0.49. The variant was identified as Hb S by amino acid analysis of the abnormal peptide (beta T-1) and digestion of DNA amplified by the polymerase chain reaction with enzyme Eco 81 I. This was further confirmed by DNA sequencing. DNA sequencing of a beta-gene without the beta s-mutation revealed a nucleotide change of T to C in the polyadenylation signal sequence AATAAA 3' to the beta-gene, resulting in beta(+)-thalassemia. These results are consistent with the existence of a beta s-gene and a beta(+)-thalassemia gene in trans.
Benne, R; De Vries, B F; Van den Burg, J; Klaver, B
1983-01-01
The nucleotide sequence of a 2.5-kb segment of the maxi-circle of Trypanosoma brucei mtDNA has been determined. The segment contains the gene for apocytochrome b, which displays about 25% homology at the amino acid level to the apocytochrome b gene from fungal and mammalian mtDNAs. Northern blot and S1 nuclease analyses have yielded accurate map positions of an RNA species in an area that coincides with the reading frame. The segment also contains two pairs of overlapping unassigned reading frames, which lack homology with any known mitochondrial gene or URF. The DNA sequence in these areas is AG-rich (70%), resulting in URFs with an unusually high level of glycine and charged amino acids (60%). They may not encode proteins, in spite of their size and the fact that abundant transcripts are mapped in these areas. Images PMID:6314266
Povedano, Eloy; Valverde, Alejandro; Ruiz-Valdepeñas Montiel, Víctor; Pedrero, María; Yáñez-Sedeño, Paloma; Barderas, Rodrigo; San Segundo-Acosta, Pablo; Peláez-García, Alberto; Mendiola, Marta; Hardisson, David; Campuzano, Susana; Pingarron, José Manuel
2018-05-09
We report a rapid and sensitive electrochemical strategy for the detection of gene-specific 5-methylcytosine DNA methylation. Magnetic beads (MBs) modified with an antibody specific for 5-methylcytosines (5-mC) are employed for the selective capture of any 5-mC methylated single-stranded (ss)DNA sequence. A flanking region next to the 5-mCs of the captured methylated ssDNA is recognized by selective hybridization with a synthetic biotinylated DNA sequence, further labeled with an HRP streptavidin conjugate. Amperometric transduction at disposable screen-printed carbon electrodes (SPCEs) is employed. The developed biosensor exhibits a dynamic range from 3.9 to 500 pM and a detection limit of 1.2 pM for the methylated synthetic sequence of the tumor suppressor gene O-6-methylguanine-DNA methyltransferase (MGMT) promoter region. The applicability of this strategy is demonstrated through the 45 min-analysis of specific methylation in the MGMT promoter region directly in raw spiked human serum samples and in genomic DNA extracted from U-87 glioblastoma cells and paraffin-embedded brain tumor tissues without any amplification and pretreatment step. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Ocan, Moses; Bwanga, Freddie; Okeng, Alfred; Katabazi, Fred; Kigozi, Edgar; Kyobe, Samuel; Ogwal-Okeng, Jasper; Obua, Celestino
2016-08-19
In the absence of an effective vaccine, malaria treatment and eradication is still a challenge in most endemic areas globally. This is especially the case with the current reported emergence of resistance to artemisinin agents in Southeast Asia. This study therefore explored the prevalence of K13-propeller gene polymorphisms among Plasmodium falciparum parasites in northern Uganda. Adult patients (≥18 years) presenting to out-patients department of Lira and Gulu regional referral hospitals in northern Uganda were randomly recruited. Laboratory investigation for presence of plasmodium infection among patients was done using Plasmodium falciparum exclusive rapid diagnostic test, histidine rich protein-2 (HRP2) (Pf). Finger prick capillary blood from patients with a positive malaria test was spotted on a filter paper Whatman no. 903. The parasite DNA was extracted using chelex resin method and sequenced for mutations in K13-propeller gene using Sanger sequencing. PCR DNA sequence products were analyzed using in DNAsp 5.10.01software, data was further processed in Excel spreadsheet 2007. A total of 60 parasite DNA samples were sequenced. Polymorphisms in the K13-propeller gene were detected in four (4) of the 60 parasite DNA samples sequenced. A non-synonymous polymorphism at codon 533 previously detected in Cambodia was found in the parasite DNA samples analyzed. Polymorphisms at codon 522 (non-synonymous) and codon 509 (synonymous) were also found in the samples analyzed. The study found evidence of positive selection in the Plasmodium falciparum population in northern Uganda (Tajima's D = -1.83205; Fu and Li's D = -1.82458). Polymorphism in the K13-propeller gene previously reported in Cambodia has been found in the Ugandan Plasmodium falciparum parasites. There is need for continuous surveillance for artemisinin resistance gene markers in the country.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Prody, C.A.; Dreyfus, P.; Soreq, H.
1989-01-01
A 100-fold DNA amplification in the CHE gene, coding for serum butyrylcholinesterase (BtChoEase), was found in a farmer expressing silent CHE phenotype. Individuals homozygous for this gene display a defective serum BtChoEase and are particularly vulnerable to poisoning by agricultural organophosphorus insecticides, to which all members of this family had long been exposed. DNA blot hybridization with regional BtChoEase cDNA probes suggested that the amplification was most intense in regions encoding central sequences within BtChoEase cDNA, whereas distal sequences were amplified to a much lower extent. This is in agreement with the onion skin model, based on amplification of genesmore » in cultured cells and primary tumors. The amplification was absent in the grandparents but present at the same extent in one of their sons and in a grandson, with similar DNA blot hybridization patterns. In situ hybridization experiments localized the amplified sequences to the long arm of chromosome 3, close to the site where the authors previously mapped the CHE gene. Altogether, these observations suggest that the initial amplification event occurred early in embryogenesis, spermatogenesis, or oogenesis, where the CHE gene is intensely active and where cholinergic functioning was indicated to be physiologically necessary. These findings demonstrate a de novo amplification in apparently healthy individuals within an autosomal gene producing a target protein to an inhibitor.« less
Isolation and Expression of the Lysis Genes of Actinomyces naeslundii Phage Av-1
Delisle, Allan L.; Barcak, Gerard J.; Guo, Ming
2006-01-01
Like most gram-positive oral bacteria, Actinomyces naeslundii is resistant to salivary lysozyme and to most other lytic enzymes. We are interested in studying the lysins of phages of this important oral bacterium as potential diagnostic and therapeutic agents. To identify the Actinomyces phage genes encoding these species-specific enzymes in Escherichia coli, we constructed a new cloning vector, pAD330, that can be used to enrich for and isolate phage holin genes, which are located adjacent to the lysin genes in most phage genomes. Cloned holin insert sequences were used to design sequencing primers to identify nearby lysin genes by using whole phage DNA as the template. From partial digestions of A. naeslundii phage Av-1 genomic DNA we were able to clone, in independent experiments, inserts that complemented the defective λ holin in pAD330, as evidenced by extensive lysis after thermal induction. The DNA sequence of the inserts in these plasmids revealed that both contained the complete lysis region of Av-1, which is comprised of two holin-like genes, designated holA and holB, and an endolysin gene, designated lysA. We were able to subclone and express these genes and determine some of the functional properties of their gene products. PMID:16461656
Itoh, S; Abe, Y; Kubo, A; Okuda, M; Shimoji, M; Nakayama, K; Kamataki, T
1997-02-07
An 11.5 kb fragment of the mouse Cyp3a16 gene containing the 5' flanking region was isolated from the lambda DASHII mouse genomic library. A part of the 5' flanking region and the first exon of Cyp3a16 gene were sequenced. S1 mapping analysis showed the presence of two transcriptional initiation sites. The first exon was completely identical to Cyp3a16 cDNA. The identity of 5' flanking sequences between Cyp3a16 and Cyp3a11 genes was about 69%. A typical TATA box and a basic transcription element (BTE) were found as seen with other CYP3A genes from various animal species Moreover, some putative transcriptional regulatory elements were also found in addition to the sequence motif seen for the formation of Z-type DNA. To examine the transcriptional activity of Cyp3a11 gene, DNA fragments in the 5'-flanking region of the gene were inserted front of the luciferase structural gene, and the constructs were transfected in primary hepatocytes. The analysis of the luciferase activity indicated that the region between -146 and -56 was necessary for the transcription of CYP3a16 gene.
Woods, J P; Heinecke, E L; Goldman, W E
1998-04-01
We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.
Chromosome-encoded narrow-spectrum Ambler class A beta-lactamase GIL-1 from Citrobacter gillenii.
Naas, Thierry; Aubert, Daniel; Ozcan, Ayla; Nordmann, Patrice
2007-04-01
A novel beta-lactamase gene was cloned from the whole-cell DNA of an enterobacterial Citrobacter gillenii reference strain that displayed a weak narrow-spectrum beta-lactam-resistant phenotype and was expressed in Escherichia coli. It encoded a clavulanic acid-inhibited Ambler class A beta-lactamase, GIL-1, with a pI value of 7.5 and a molecular mass of ca. 29 kDa. GIL-1 had the highest percent amino acid sequence identity with TEM-1 and SHV-1, 77%, and 67%, respectively, and only 46%, 31%, and 32% amino acid sequence identity with CKO-1 (C. koseri), CdiA1 (C. diversus), and SED-1 (C. sedlaki), respectively. The substrate profile of the purified GIL-1 was similar to that of beta-lactamases TEM-1 and SHV-1. The blaGIL-1 gene was chromosomally located, as revealed by I-CeuI experiments, and was constitutively expressed at a low level in C. gillenii. No gene homologous to the regulatory ampR genes of chromosomal class C beta-lactamases was found upstream of the blaGIL-1 gene, which fits the noninducibility of beta-lactamase expression in C. gillenii. Rapid amplification of DNA 5' ends analysis of the promoter region revealed putative promoter sequences that diverge from what has been identified as the consensus sequence in E. coli. The blaGIL-1 gene was part of a 5.5-kb DNA fragment bracketed by a 9-bp duplication and inserted between the d-lactate dehydrogenase gene and the ydbH genes; this DNA fragment was absent in other Citrobacter species. This work further illustrates the heterogeneity of beta-lactamases in Citrobacter spp., which may indicate that the variability of Citrobacter species is greater than expected.
Exome-wide Sequencing Shows Low Mutation Rates and Identifies Novel Mutated Genes in Seminomas.
Cutcutache, Ioana; Suzuki, Yuka; Tan, Iain Beehuat; Ramgopal, Subhashini; Zhang, Shenli; Ramnarayanan, Kalpana; Gan, Anna; Lee, Heng Hong; Tay, Su Ting; Ooi, Aikseng; Ong, Choon Kiat; Bolthouse, Jonathan T; Lane, Brian R; Anema, John G; Kahnoski, Richard J; Tan, Patrick; Teh, Bin Tean; Rozen, Steven G
2015-07-01
Testicular germ cell tumors are the most common cancer diagnosed in young men, and seminomas are the most common type of these cancers. There have been no exome-wide examinations of genes mutated in seminomas or of overall rates of nonsilent somatic mutations in these tumors. The objective was to analyze somatic mutations in seminomas to determine which genes are affected and to determine rates of nonsilent mutations. Eight seminomas and matched normal samples were surgically obtained from eight patients. DNA was extracted from tissue samples and exome sequenced on massively parallel Illumina DNA sequencers. Single-nucleotide polymorphism chip-based copy number analysis was also performed to assess copy number alterations. The DNA sequencing read data were analyzed to detect somatic mutations including single-nucleotide substitutions and short insertions and deletions. The detected mutations were validated by independent sequencing and further checked for subclonality. The rate of nonsynonymous somatic mutations averaged 0.31 mutations/Mb. We detected nonsilent somatic mutations in 96 genes that were not previously known to be mutated in seminomas, of which some may be driver mutations. Many of the mutations appear to have been present in subclonal populations. In addition, two genes, KIT and KRAS, were affected in two tumors each with mutations that were previously observed in other cancers and are presumably oncogenic. Our study, the first report on exome sequencing of seminomas, detected somatic mutations in 96 new genes, several of which may be targetable drivers. Furthermore, our results show that seminoma mutation rates are five times higher than previously thought, but are nevertheless low compared to other common cancers. Similar low rates are seen in other cancers that also have excellent rates of remission achieved with chemotherapy. We examined the DNA sequences of seminomas, the most common type of testicular germ cell cancer. Our study identified 96 new genes in which mutations occurred during seminoma development, some of which might contribute to cancer development or progression. The study also showed that the rates of DNA mutations during seminoma development are higher than previously thought, but still lower than for other common solid-organ cancers. Such low rates are also observed among other cancers that, like seminomas, show excellent rates of disease remission after chemotherapy. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.
Active bacterial community structure along vertical redox gradients in Baltic Sea sediment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jansson, Janet; Edlund, Anna; Hardeman, Fredrik
Community structures of active bacterial populations were investigated along a vertical redox profile in coastal Baltic Sea sediments by terminal-restriction fragment length polymorphism (T-RFLP) and clone library analysis. According to correspondence analysis of T-RFLP results and sequencing of cloned 16S rRNA genes, the microbial community structures at three redox depths (179 mV, -64 mV and -337 mV) differed significantly. The bacterial communities in the community DNA differed from those in bromodeoxyuridine (BrdU)-labeled DNA, indicating that the growing members of the community that incorporated BrdU were not necessarily the most dominant members. The structures of the actively growing bacterial communities weremore » most strongly correlated to organic carbon followed by total nitrogen and redox potentials. Bacterial identification by sequencing of 16S rRNA genes from clones of BrdU-labeled DNA and DNA from reverse transcription PCR (rt-PCR) showed that bacterial taxa involved in nitrogen and sulfur cycling were metabolically active along the redox profiles. Several sequences had low similarities to previously detected sequences indicating that novel lineages of bacteria are present in Baltic Sea sediments. Also, a high number of different 16S rRNA gene sequences representing different phyla were detected at all sampling depths.« less
Isolation of Onchocerca lupi in Dogs and Black Flies, California, USA
Hassan, Hassan K.; Bolcen, Shanna; Kubofcik, Joseph; Nutman, Thomas B.; Eberhard, Mark L.; Middleton, Kelly; Wekesa, Joseph Wakoli; Ruedas, Gimena; Nelson, Kimberly J.; Dubielzig, Richard; De Lombaert, Melissa; Silverman, Bruce; Schorling, Jamie J.; Adler, Peter H.; Beeler, Emily S.
2015-01-01
In southern California, ocular infections caused by Onchocerca lupi were diagnosed in 3 dogs (1 in 2006, 2 in 2012). The infectious agent was confirmed through morphologic analysis of fixed parasites in tissues and by PCR and sequencing of amplicons derived from 2 mitochondrially encoded genes and 1 nuclear-encoded gene. A nested PCR based on the sequence of the cytochrome oxidase subunit 1 gene of the parasite was developed and used to screen Simulium black flies collected from southern California for O. lupi DNA. Six (2.8%; 95% CI 0.6%–5.0%) of 213 black flies contained O. lupi DNA. Partial mitochondrial16S rRNA gene sequences from the infected flies matched sequences derived from black fly larvae cytotaxonomically identified as Simulium tribulatum. These data implicate S. tribulatum flies as a putative vector for O. lupi in southern California. PMID:25897954
Identification of human chromosome 22 transcribed sequences with ORF expressed sequence tags
de Souza, Sandro J.; Camargo, Anamaria A.; Briones, Marcelo R. S.; Costa, Fernando F.; Nagai, Maria Aparecida; Verjovski-Almeida, Sergio; Zago, Marco A.; Andrade, Luis Eduardo C.; Carrer, Helaine; El-Dorry, Hamza F. A.; Espreafico, Enilza M.; Habr-Gama, Angelita; Giannella-Neto, Daniel; Goldman, Gustavo H.; Gruber, Arthur; Hackel, Christine; Kimura, Edna T.; Maciel, Rui M. B.; Marie, Suely K. N.; Martins, Elizabeth A. L.; Nóbrega, Marina P.; Paçó-Larson, Maria Luisa; Pardini, Maria Inês M. C.; Pereira, Gonçalo G.; Pesquero, João Bosco; Rodrigues, Vanderlei; Rogatto, Silvia R.; da Silva, Ismael D. C. G.; Sogayar, Mari C.; de Fátima Sonati, Maria; Tajara, Eloiza H.; Valentini, Sandro R.; Acencio, Marcio; Alberto, Fernando L.; Amaral, Maria Elisabete J.; Aneas, Ivy; Bengtson, Mário Henrique; Carraro, Dirce M.; Carvalho, Alex F.; Carvalho, Lúcia Helena; Cerutti, Janete M.; Corrêa, Maria Lucia C.; Costa, Maria Cristina R.; Curcio, Cyntia; Gushiken, Tsieko; Ho, Paulo L.; Kimura, Elza; Leite, Luciana C. C.; Maia, Gustavo; Majumder, Paromita; Marins, Mozart; Matsukuma, Adriana; Melo, Analy S. A.; Mestriner, Carlos Alberto; Miracca, Elisabete C.; Miranda, Daniela C.; Nascimento, Ana Lucia T. O.; Nóbrega, Francisco G.; Ojopi, Élida P. B.; Pandolfi, José Rodrigo C.; Pessoa, Luciana Gilbert; Rahal, Paula; Rainho, Claudia A.; da Ro's, Nancy; de Sá, Renata G.; Sales, Magaly M.; da Silva, Neusa P.; Silva, Tereza C.; da Silva, Wilson; Simão, Daniel F.; Sousa, Josane F.; Stecconi, Daniella; Tsukumo, Fernando; Valente, Valéria; Zalcberg, Heloisa; Brentani, Ricardo R.; Reis, Luis F. L.; Dias-Neto, Emmanuel; Simpson, Andrew J. G.
2000-01-01
Transcribed sequences in the human genome can be identified with confidence only by alignment with sequences derived from cDNAs synthesized from naturally occurring mRNAs. We constructed a set of 250,000 cDNAs that represent partial expressed gene sequences and that are biased toward the central coding regions of the resulting transcripts. They are termed ORF expressed sequence tags (ORESTES). The 250,000 ORESTES were assembled into 81,429 contigs. Of these, 1,181 (1.45%) were found to match sequences in chromosome 22 with at least one ORESTES contig for 162 (65.6%) of the 247 known genes, for 67 (44.6%) of the 150 related genes, and for 45 of the 148 (30.4%) EST-predicted genes on this chromosome. Using a set of stringent criteria to validate our sequences, we identified a further 219 previously unannotated transcribed sequences on chromosome 22. Of these, 171 were in fact also defined by EST or full length cDNA sequences available in GenBank but not utilized in the initial annotation of the first human chromosome sequence. Thus despite representing less than 15% of all expressed human sequences in the public databases at the time of the present analysis, ORESTES sequences defined 48 transcribed sequences on chromosome 22 not defined by other sequences. All of the transcribed sequences defined by ORESTES coincided with DNA regions predicted as encoding exons by genscan. (http://genes.mit.edu/GENSCAN.html). PMID:11070084
Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir
2017-12-01
A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.
Kyndt, Tina; Quispe, Dora; Zhai, Hong; Jarret, Robert; Ghislain, Marc; Liu, Qingchang; Gheysen, Godelieve
2015-01-01
Agrobacterium rhizogenes and Agrobacterium tumefaciens are plant pathogenic bacteria capable of transferring DNA fragments [transfer DNA (T-DNA)] bearing functional genes into the host plant genome. This naturally occurring mechanism has been adapted by plant biotechnologists to develop genetically modified crops that today are grown on more than 10% of the world’s arable land, although their use can result in considerable controversy. While assembling small interfering RNAs, or siRNAs, of sweet potato plants for metagenomic analysis, sequences homologous to T-DNA sequences from Agrobacterium spp. were discovered. Simple and quantitative PCR, Southern blotting, genome walking, and bacterial artificial chromosome library screening and sequencing unambiguously demonstrated that two different T-DNA regions (IbT-DNA1 and IbT-DNA2) are present in the cultivated sweet potato (Ipomoea batatas [L.] Lam.) genome and that these foreign genes are expressed at detectable levels in different tissues of the sweet potato plant. IbT-DNA1 was found to contain four open reading frames (ORFs) homologous to the tryptophan-2-monooxygenase (iaaM), indole-3-acetamide hydrolase (iaaH), C-protein (C-prot), and agrocinopine synthase (Acs) genes of Agrobacterium spp. IbT-DNA1 was detected in all 291 cultigens examined, but not in close wild relatives. IbT-DNA2 contained at least five ORFs with significant homology to the ORF14, ORF17n, rooting locus (Rol)B/RolC, ORF13, and ORF18/ORF17n genes of A. rhizogenes. IbT-DNA2 was detected in 45 of 217 genotypes that included both cultivated and wild species. Our finding, that sweet potato is naturally transgenic while being a widely and traditionally consumed food crop, could affect the current consumer distrust of the safety of transgenic food crops. PMID:25902487
D.J. Glass; N. Takebayashi; L. Olson; D.L. Taylor
2013-01-01
The number of sequences from both formally described taxa and uncultured environmental DNA deposited in the International Nucleotide Sequence Databases has increased substantially over the last two decades. Although the majority of these sequences represent authentic gene copies, there is evidence of DNA artifacts in these databases as well. These include lab artifacts...
Phylogenetic position of the pentastomida and [pan]crustacean relationships
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lavrov, Dennis V.; Brown, Wesley M.; Boore, Jeffrey L.
2004-01-31
Pentastomids are a small group of vermiform animals with unique morphology and parasitic lifestyle. They are generally recognized as being related to the Arthropoda, however the nature of this relationship is controversial. We have determined the complete sequence of the mitochondrial DNA (mtDNA) of the pentastomid Armillifer armillatus and complete, or nearly complete, mtDNA sequences from representatives of four previously unsampled groups of Crustacea: Remipedia (Speleonectes tulumensis), Cephalocarida (Hutchinsoniella macracantha), Cirripedia (Pollicipes polymerus), and Branchiura (Argulus americanus). Analyses of the mtDNA gene arrangements and sequences determined in this study indicate unambiguously that pentastomids are a group of modified crustaceans likelymore » related to branchiurans. In addition, gene arrangement comparisons strongly support an unforeseen assemblage of pentastomids with maxillopod and cephalocarid crustaceans, to the exclusion of remipedes, branchiopods, malacos tracans and insects.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hanson, R.S.
Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less
Takita, Eiji; Kohda, Katsunori; Tomatsu, Hajime; Hanano, Shigeru; Moriya, Kanami; Hosouchi, Tsutomu; Sakurai, Nozomu; Suzuki, Hideyuki; Shinmyo, Atsuhiko; Shibata, Daisuke
2013-01-01
Ligation, the joining of DNA fragments, is a fundamental procedure in molecular cloning and is indispensable to the production of genetically modified organisms that can be used for basic research, the applied biosciences, or both. Given that many genes cooperate in various pathways, incorporating multiple gene cassettes in tandem in a transgenic DNA construct for the purpose of genetic modification is often necessary when generating organisms that produce multiple foreign gene products. Here, we describe a novel method, designated PRESSO (precise sequential DNA ligation on a solid substrate), for the tandem ligation of multiple DNA fragments. We amplified donor DNA fragments with non-palindromic ends, and ligated the fragment to acceptor DNA fragments on solid beads. After the final donor DNA fragments, which included vector sequences, were joined to the construct that contained the array of fragments, the ligation product (the construct) was thereby released from the beads via digestion with a rare-cut meganuclease; the freed linear construct was circularized via an intra-molecular ligation. PRESSO allowed us to rapidly and efficiently join multiple genes in an optimized order and orientation. This method can overcome many technical challenges in functional genomics during the post-sequencing generation. PMID:23897972
Duyk, G M; Kim, S W; Myers, R M; Cox, D R
1990-11-01
Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons.
Duyk, G M; Kim, S W; Myers, R M; Cox, D R
1990-01-01
Identification and recovery of transcribed sequences from cloned mammalian genomic DNA remains an important problem in isolating genes on the basis of their chromosomal location. We have developed a strategy that facilitates the recovery of exons from random pieces of cloned genomic DNA. The basis of this "exon trapping" strategy is that, during a retroviral life cycle, genomic sequences of nonviral origin are correctly spliced and may be recovered as a cDNA copy of the introduced segment. By using this genetic assay for cis-acting sequences required for RNA splicing, we have screened approximately 20 kilobase pairs of cloned genomic DNA and have recovered all four predicted exons. PMID:2247475
Duret, Laurent; Cohen, Jean; Jubin, Claire; Dessen, Philippe; Goût, Jean-François; Mousset, Sylvain; Aury, Jean-Marc; Jaillon, Olivier; Noël, Benjamin; Arnaiz, Olivier; Bétermier, Mireille; Wincker, Patrick; Meyer, Eric; Sperling, Linda
2008-01-01
Ciliates are the only unicellular eukaryotes known to separate germinal and somatic functions. Diploid but silent micronuclei transmit the genetic information to the next sexual generation. Polyploid macronuclei express the genetic information from a streamlined version of the genome but are replaced at each sexual generation. The macronuclear genome of Paramecium tetraurelia was recently sequenced by a shotgun approach, providing access to the gene repertoire. The 72-Mb assembly represents a consensus sequence for the somatic DNA, which is produced after sexual events by reproducible rearrangements of the zygotic genome involving elimination of repeated sequences, precise excision of unique-copy internal eliminated sequences (IES), and amplification of the cellular genes to high copy number. We report use of the shotgun sequencing data (>106 reads representing 13× coverage of a completely homozygous clone) to evaluate variability in the somatic DNA produced by these developmental genome rearrangements. Although DNA amplification appears uniform, both of the DNA elimination processes produce sequence heterogeneity. The variability that arises from IES excision allowed identification of hundreds of putative new IESs, compared to 42 that were previously known, and revealed cases of erroneous excision of segments of coding sequences. We demonstrate that IESs in coding regions are under selective pressure to introduce premature termination of translation in case of excision failure. PMID:18256234
cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.
Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T
1999-02-01
A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.
Variation of 45S rDNA intergenic spacers in Arabidopsis thaliana.
Havlová, Kateřina; Dvořáčková, Martina; Peiro, Ramon; Abia, David; Mozgová, Iva; Vansáčová, Lenka; Gutierrez, Crisanto; Fajkus, Jiří
2016-11-01
Approximately seven hundred 45S rRNA genes (rDNA) in the Arabidopsis thaliana genome are organised in two 4 Mbp-long arrays of tandem repeats arranged in head-to-tail fashion separated by an intergenic spacer (IGS). These arrays make up 5 % of the A. thaliana genome. IGS are rapidly evolving sequences and frequent rearrangements inside the rDNA loci have generated considerable interspecific and even intra-individual variability which allows to distinguish among otherwise highly conserved rRNA genes. The IGS has not been comprehensively described despite its potential importance in regulation of rDNA transcription and replication. Here we describe the detailed sequence variation in the complete IGS of A. thaliana WT plants and provide the reference/consensus IGS sequence, as well as genomic DNA analysis. We further investigate mutants dysfunctional in chromatin assembly factor-1 (CAF-1) (fas1 and fas2 mutants), which are known to have a reduced number of rDNA copies, and plant lines with restored CAF-1 function (segregated from a fas1xfas2 genetic background) showing major rDNA rearrangements. The systematic rDNA loss in CAF-1 mutants leads to the decreased variability of the IGS and to the occurrence of distinct IGS variants. We present for the first time a comprehensive and representative set of complete IGS sequences, obtained by conventional cloning and by Pacific Biosciences sequencing. Our data expands the knowledge of the A. thaliana IGS sequence arrangement and variability, which has not been available in full and in detail until now. This is also the first study combining IGS sequencing data with RFLP analysis of genomic DNA.
Analysis of methylated patterns and quality-related genes in tobacco (Nicotiana tabacum) cultivars.
Jiao, Junna; Jia, Yanlong; Lv, Zhuangwei; Sun, Chuanfei; Gao, Lijie; Yan, Xiaoxiao; Cui, Liusu; Tang, Zongxiang; Yan, Benju
2014-08-01
Methylation-sensitive amplified polymorphism was used in this study to investigate epigenetic information of four tobacco cultivars: Yunyan 85, NC89, K326, and Yunyan 87. The DNA fragments with methylated information were cloned by reamplified PCR and sequenced. The results of Blast alignments showed that the genes with methylation information included chitinase, nitrate reductase, chloroplast DNA, mitochondrial DNA, ornithine decarboxylase, ribulose carboxylase, and promoter sequences. Homologous comparison in three cloned gene sequences (nitrate reductase, ornithine decarboxylase, and ribulose decarboxylase) indicated that geographic factors had significant influence on the whole genome methylation. Introns also contained different information in different tobacco cultivars. These findings suggest that synthetic mechanisms for tobacco aromatic components could be affected by different environmental factors leading to variation of noncoding regions in the genome, which finally results in different fragrance and taste in different tobacco cultivars.
Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross
1999-01-01
Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978
In trans paired nicking triggers seamless genome editing without double-stranded DNA cutting.
Chen, Xiaoyu; Janssen, Josephine M; Liu, Jin; Maggio, Ignazio; 't Jong, Anke E J; Mikkers, Harald M M; Gonçalves, Manuel A F V
2017-09-22
Precise genome editing involves homologous recombination between donor DNA and chromosomal sequences subjected to double-stranded DNA breaks made by programmable nucleases. Ideally, genome editing should be efficient, specific, and accurate. However, besides constituting potential translocation-initiating lesions, double-stranded DNA breaks (targeted or otherwise) are mostly repaired through unpredictable and mutagenic non-homologous recombination processes. Here, we report that the coordinated formation of paired single-stranded DNA breaks, or nicks, at donor plasmids and chromosomal target sites by RNA-guided nucleases based on CRISPR-Cas9 components, triggers seamless homology-directed gene targeting of large genetic payloads in human cells, including pluripotent stem cells. Importantly, in addition to significantly reducing the mutagenicity of the genome modification procedure, this in trans paired nicking strategy achieves multiplexed, single-step, gene targeting, and yields higher frequencies of accurately edited cells when compared to the standard double-stranded DNA break-dependent approach.CRISPR-Cas9-based gene editing involves double-strand breaks at target sequences, which are often repaired by mutagenic non-homologous end-joining. Here the authors use Cas9 nickases to generate coordinated single-strand breaks in donor and target DNA for precise homology-directed gene editing.
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
Fidelity of DNA Replication in Normal and Malignant Human Brest Cells.
1995-08-31
cellular DNA replication machinery, we have initiated experiments that utilize a multiprotein DNA replication complex (MRC) isolated from breast cancer...gene in an in vitro DNA replication assay. By utilizing the target gene in a bacterial mutant selection assay we have begun to determine the...frequency with which mutational sequence errors occur as a result of the in vitro DNA replication mediated by the breast cancer cell MRC and the normal breast
Stec, James; Wang, Jing; Coombes, Kevin; Ayers, Mark; Hoersch, Sebastian; Gold, David L.; Ross, Jeffrey S; Hess, Kenneth R.; Tirrell, Stephen; Linette, Gerald; Hortobagyi, Gabriel N.; Symmans, W. Fraser; Pusztai, Lajos
2005-01-01
We examined how well differentially expressed genes and multigene outcome classifiers retain their class-discriminating values when tested on data generated by different transcriptional profiling platforms. RNA from 33 stage I-III breast cancers was hybridized to both Affymetrix GeneChip and Millennium Pharmaceuticals cDNA arrays. Only 30% of all corresponding gene expression measurements on the two platforms had Pearson correlation coefficient r ≥ 0.7 when UniGene was used to match probes. There was substantial variation in correlation between different Affymetrix probe sets matched to the same cDNA probe. When cDNA and Affymetrix probes were matched by basic local alignment tool (BLAST) sequence identity, the correlation increased substantially. We identified 182 genes in the Affymetrix and 45 in the cDNA data (including 17 common genes) that accurately separated 91% of cases in supervised hierarchical clustering in each data set. Cross-platform testing of these informative genes resulted in lower clustering accuracy of 45 and 79%, respectively. Several sets of accurate five-gene classifiers were developed on each platform using linear discriminant analysis. The best 100 classifiers showed average misclassification error rate of 2% on the original data that rose to 19.5% when tested on data from the other platform. Random five-gene classifiers showed misclassification error rate of 33%. We conclude that multigene predictors optimized for one platform lose accuracy when applied to data from another platform due to missing genes and sequence differences in probes that result in differing measurements for the same gene. PMID:16049308
2012-01-01
Background In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Results Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. Conclusions We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species. PMID:22805587
Yang, Huaan; Tao, Ye; Zheng, Zequn; Li, Chengdao; Sweetingham, Mark W; Howieson, John G
2012-07-17
In the last 30 years, a number of DNA fingerprinting methods such as RFLP, RAPD, AFLP, SSR, DArT, have been extensively used in marker development for molecular plant breeding. However, it remains a daunting task to identify highly polymorphic and closely linked molecular markers for a target trait for molecular marker-assisted selection. The next-generation sequencing (NGS) technology is far more powerful than any existing generic DNA fingerprinting methods in generating DNA markers. In this study, we employed a grain legume crop Lupinus angustifolius (lupin) as a test case, and examined the utility of an NGS-based method of RAD (restriction-site associated DNA) sequencing as DNA fingerprinting for rapid, cost-effective marker development tagging a disease resistance gene for molecular breeding. Twenty informative plants from a cross of RxS (disease resistant x susceptible) in lupin were subjected to RAD single-end sequencing by multiplex identifiers. The entire RAD sequencing products were resolved in two lanes of the 16-lanes per run sequencing platform Solexa HiSeq2000. A total of 185 million raw reads, approximately 17 Gb of sequencing data, were collected. Sequence comparison among the 20 test plants discovered 8207 SNP markers. Filtration of DNA sequencing data with marker identification parameters resulted in the discovery of 38 molecular markers linked to the disease resistance gene Lanr1. Five randomly selected markers were converted into cost-effective, simple PCR-based markers. Linkage analysis using marker genotyping data and disease resistance phenotyping data on a F8 population consisting of 186 individual plants confirmed that all these five markers were linked to the R gene. Two of these newly developed sequence-specific PCR markers, AnSeq3 and AnSeq4, flanked the target R gene at a genetic distance of 0.9 centiMorgan (cM), and are now replacing the markers previously developed by a traditional DNA fingerprinting method for marker-assisted selection in the Australian national lupin breeding program. We demonstrated that more than 30 molecular markers linked to a target gene of agronomic trait of interest can be identified from a small portion (1/8) of one sequencing run on HiSeq2000 by applying NGS based RAD sequencing in marker development. The markers developed by the strategy described in this study are all co-dominant SNP markers, which can readily be converted into high throughput multiplex format or low-cost, simple PCR-based markers desirable for large scale marker implementation in plant breeding programs. The high density and closely linked molecular markers associated with a target trait help to overcome a major bottleneck for implementation of molecular markers on a wide range of germplasm in breeding programs. We conclude that application of NGS based RAD sequencing as DNA fingerprinting is a very rapid and cost-effective strategy for marker development in molecular plant breeding. The strategy does not require any prior genome knowledge or molecular information for the species under investigation, and it is applicable to other plant species.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Kovács, Endre R; Benko, Mária
2009-03-01
Partial genome characterisation of a novel adenovirus, found recently in organ samples of multiple species of dead birds of prey, was carried out by sequence analysis of PCR-amplified DNA fragments. The virus, named as raptor adenovirus 1 (RAdV-1), has originally been detected by a nested PCR method with consensus primers targeting the adenoviral DNA polymerase gene. Phylogenetic analysis with the deduced amino acid sequence of the small PCR product has implied a new siadenovirus type present in the samples. Since virus isolation attempts remained unsuccessful, further characterisation of this putative novel siadenovirus was carried out with the use of PCR on the infected organ samples. The DNA sequence of the central genome part of RAdV-1, encompassing nine full (pTP, 52K, pIIIa, III, pVII, pX, pVI, hexon, protease) and two partial (DNA polymerase and DBP) genes and exceeding 12 kb pairs in size, was determined. Phylogenetic tree reconstructions, based on several genes, unambiguously confirmed the preliminary classification of RAdV-1 as a new species within the genus Siadenovirus. Further study of RAdV-1 is of interest since it represents a rare adenovirus genus of yet undetermined host origin.
Chen, Rui; Jiang, Li-Yun; Qiao, Ge-Xia
2012-01-01
The mitochondrial gene COI has been widely used by taxonomists as a standard DNA barcode sequence for the identification of many animal species. However, the COI region is of limited use for identifying certain species and is not efficiently amplified by PCR in all animal taxa. To evaluate the utility of COI as a DNA barcode and to identify other barcode genes, we chose the aphid subfamily Lachninae (Hemiptera: Aphididae) as the focus of our study. We compared the results obtained using COI with two other mitochondrial genes, COII and Cytb. In addition, we propose a new method to improve the efficiency of species identification using DNA barcoding. Three mitochondrial genes (COI, COII and Cytb) were sequenced and were used in the identification of over 80 species of Lachninae. The COI and COII genes demonstrated a greater PCR amplification efficiency than Cytb. Species identification using COII sequences had a higher frequency of success (96.9% in "best match" and 90.8% in "best close match") and yielded lower intra- and higher interspecific genetic divergence values than the other two markers. The use of "tag barcodes" is a new approach that involves attaching a species-specific tag to the standard DNA barcode. With this method, the "barcoding overlap" can be nearly eliminated. As a result, we were able to increase the identification success rate from 83.9% to 95.2% by using COI and the "best close match" technique. A COII-based identification system should be more effective in identifying lachnine species than COI or Cytb. However, the Cytb gene is an effective marker for the study of aphid population genetics due to its high sequence diversity. Furthermore, the use of "tag barcodes" can improve the accuracy of DNA barcoding identification by reducing or removing the overlap between intra- and inter-specific genetic divergence values.
Yang, Christine; McLeod, Andrea J.; Cotton, Allison M.; de Leeuw, Charles N.; Laprise, Stéphanie; Banks, Kathleen G.; Simpson, Elizabeth M.; Brown, Carolyn J.
2012-01-01
Regulatory sequences can influence the expression of flanking genes over long distances, and X chromosome inactivation is a classic example of cis-acting epigenetic gene regulation. Knock-ins directed to the Mus musculus Hprt locus offer a unique opportunity to analyze the spread of silencing into different human DNA sequences in the identical genomic environment. X chromosome inactivation of four knock-in constructs, including bacterial artificial chromosome (BAC) integrations of over 195 kb, was demonstrated by both the lack of expression from the inactive X chromosome in females with nonrandom X chromosome inactivation and promoter DNA methylation of the human transgene in females. We further utilized promoter DNA methylation to assess the inactivation status of 74 human reporter constructs comprising >1.5 Mb of DNA. Of the 47 genes examined, only the PHB gene showed female DNA hypomethylation approaching the level seen in males, and escape from X chromosome inactivation was verified by demonstration of expression from the inactive X chromosome. Integration of PHB resulted in lower DNA methylation of the flanking HPRT promoter in females, suggesting the action of a dominant cis-acting escape element. Female-specific DNA hypermethylation of CpG islands not associated with promoters implies a widespread imposition of DNA methylation during X chromosome inactivation; yet transgenes demonstrated differential capacities to accumulate DNA methylation when integrated into the identical location on the inactive X chromosome, suggesting additional cis-acting sequence effects. As only one of the human transgenes analyzed escaped X chromosome inactivation, we conclude that elements permitting ongoing expression from the inactive X are rare in the human genome. PMID:23023002
Śliwińska-Jewsiewicka, A; Kuciński, M; Kirtiklis, L; Dobosz, S; Ocalewicz, K; Jankun, Malgorzata
2015-08-01
Brook trout Salvelinus fontinalis (Mitchill, 1814) chromosomes have been analyzed using conventional and molecular cytogenetic techniques enabling characteristics and chromosomal location of heterochromatin, nucleolus organizer regions (NORs), ribosomal RNA-encoding genes and telomeric DNA sequences. The C-banding and chromosome digestion with the restriction endonucleases demonstrated distribution and heterogeneity of the heterochromatin in the brook trout genome. DNA sequences of the ribosomal RNA genes, namely the nucleolus-forming 28S (major) and non-nucleolus-forming 5S (minor) rDNAs, were physically mapped using fluorescence in situ hybridization (FISH) and primed in situ labelling. The minor rDNA locus was located on the subtelo-acrocentric chromosome pair No. 9, whereas the major rDNA loci were dispersed on 14 chromosome pairs, showing a considerable inter-individual variation in the number and location. The major and minor rDNA loci were located at different chromosomes. Multichromosomal location (3-6 sites) of the NORs was demonstrated by silver nitrate (AgNO3) impregnation. All Ag-positive i.e. active NORs corresponded to the GC-rich blocks of heterochromatin. FISH with telomeric probe showed the presence of the interstitial telomeric site (ITS) adjacent to the NOR/28S rDNA site on the chromosome 11. This ITS was presumably remnant of the chromosome rearrangement(s) leading to the genomic redistribution of the rDNA sequences. Comparative analysis of the cytogenetic data among several related salmonid species confirmed huge variation in the number and the chromosomal location of rRNA gene clusters in the Salvelinus genome.
2004-01-01
Abstract The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer. PMID:15581228
Bishop, Micah A; Steiner, Jörg M; Moore, Lisa E; Williams, David A
2004-10-01
The purpose of this study was to evaluate the cationic trypsinogen gene in miniature schnauzers for possible mutations. Genetic mutations have been linked with hereditary pancreatitis in humans. Four miniature schnauzers were selected on the basis of a clinical history of pancreatitis. One healthy miniature schnauzer and 1 healthy mixed breed canine were enrolled as controls. DNA was extracted from these canines using a commercial kit. Primers were designed to amplify the entire canine cationic trypsinogen cDNA sequence. A polymerase chain reaction (PCR) was performed and products were purified and sequenced. All sequences were then compared. The healthy control canine, a healthy miniature schnauzer, and the 4 miniature schnauzers with pancreatitis showed identical sequences of the cationic trypsinogen gene to the published sequence. We conclude that, in contrast to humans with hereditary pancreatitis, mutations of the cationic trypsinogen gene do not play a major role in the genesis of pancreatitis in the miniature schnauzer.
Thauvin-Robinet, Christel; Franco, Brunella; Saugier-Veber, Pascale; Aral, Bernard; Gigot, Nadège; Donzel, Anne; Van Maldergem, Lionel; Bieth, Eric; Layet, Valérie; Mathieu, Michèle; Teebi, Ahmad; Lespinasse, James; Callier, Patrick; Mugneret, Francine; Masurel-Paulet, Alice; Gautier, Elodie; Huet, Frédéric; Teyssier, Jean-Raymond; Tosi, Mario; Frébourg, Thierry; Faivre, Laurence
2009-02-01
Oral-facial-digital type I syndrome (OFDI) is characterised by an X-linked dominant mode of inheritance with lethality in males. Clinical features include facial dysmorphism with oral, dental and distal abnormalities, polycystic kidney disease and central nervous system malformations. Considerable allelic heterogeneity has been reported within the OFD1 gene, but DNA bi-directional sequencing of the exons and intron-exon boundaries of the OFD1 gene remains negative in more than 20% of cases. We hypothesized that genomic rearrangements could account for the majority of the remaining undiagnosed cases. Thus, we took advantage of two independent available series of patients with OFDI syndrome and negative DNA bi-directional sequencing of the exons and intron-exon boundaries of the OFD1 gene from two different European labs: 13/36 cases from the French lab; 13/95 from the Italian lab. All patients were screened by a semiquantitative fluorescent multiplex method (QFMPSF) and relative quantification by real-time PCR (qPCR). Six OFD1 genomic deletions (exon 5, exons 1-8, exons 1-14, exons 10-11, exons 13-23 and exon 17) were identified, accounting for 5% of OFDI patients and for 23% of patients with negative mutation screening by DNA sequencing. The association of DNA direct sequencing, QFMPSF and qPCR detects OFD1 alteration in up to 85% of patients with a phenotype suggestive of OFDI syndrome. Given the average percentage of large genomic rearrangements (5%), we suggest that dosage methods should be performed in addition to DNA direct sequencing analysis to exclude the involvement of the OFD1 transcript when there are genetic counselling issues. (c) 2008 Wiley-Liss, Inc.
Identification of Streptococcus mitis321A vaccine antigens based on reverse vaccinology
Zhang, Qiao; Lin, Kexiong; Wang, Changzheng; Xu, Zhi; Yang, Li; Ma, Qianli
2018-01-01
Streptococcus mitis (S. mitis) may transform into highly pathogenic bacteria. The aim of the present study was to identify potential antigen targets for designing an effective vaccine against the pathogenic S. mitis321A. The genome of S. mitis321A was sequenced using an Illumina Hiseq2000 instrument. Subsequently, Glimmer 3.02 and Tandem Repeat Finder (TRF) 4.04 were used to predict genes and tandem repeats, respectively, with DNA sequence function analysis using the Basic Local Alignment Search Tool (BLAST) in the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Cluster of Orthologous Groups of proteins (COG) databases. Putative gene antigen candidates were screened with BLAST ahead of phylogenetic tree analysis. The DNA sequence assembly size was 2,110,680 bp with 40.12% GC, 6 scaffolds and 9 contig. Consequently, 1,944 genes were predicted, and 119 TRF, 56 microsatellite DNA, 10 minisatellite DNA and 154 transposons were acquired. The predicted genes were associated with various pathways and functions concerning membrane transport and energy metabolism. Multiple putative genes encoding surface proteins, secreted proteins and virulence factors, as well as essential genes were determined. The majority of essential genes belonged to a phylogenetic lineage, while 321AGL000129 and 321AGL000299 were on the same branch. The current study provided useful information regarding the biological function of the S. mitis321A genome and recommends putative antigen candidates for developing a potent vaccine against S. mitis. PMID:29620181
Link, Gerhard
1984-01-01
A nuclease-treated plastid extract from mustard (Sinapis alba L.) allows efficient transcription of cloned plastid DNA templates. In this in vitro system, the major runoff transcript of the truncated gene for the 32 000 mol. wt. photosystem II protein was accurately initiated from a site close to or identical with the in vivo start site. By using plasmids with deletions in the 5'-flanking region of this gene as templates, a DNA region required for efficient and selective initiation was detected ˜28-35 nucleotides upstream of the transcription start site. This region contains the sequence element TTGACA, which matches the consensus sequence for prokaryotic `−35' promoter elements. In the absence of this region, a region ˜13-27 nucleotides upstream of the start site still enables a basic level of specific transcription. This second region contains the sequence element TATATAA, which matches the consensus sequence for the `TATA' box of genes transcribed by RNA polymerase II (or B). The region between the `TATA'-like element and the transcription start site is not sufficient but may be required for specific transcription of the plastid gene. This latter region contains the sequence element TATACT, which resembles the prokaryotic `−10' (Pribnow) box. Based on the structural and transcriptional features of the 5' upstream region, a `promoter switch' mechanism is proposed, which may account for the developmentally regulated expression of this plastid gene. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Figure 5. PMID:16453540
A novel paired domain DNA recognition motif can mediate Pax2 repression of gene transcription.
Håvik, B; Ragnhildstveit, E; Lorens, J B; Saelemyr, K; Fauske, O; Knudsen, L K; Fjose, A
1999-12-20
The paired domain (PD) is an evolutionarily conserved DNA-binding domain encoded by the Pax gene family of developmental regulators. The Pax proteins are transcription factors and are involved in a variety of processes such as brain development, patterning of the central nervous system (CNS), and B-cell development. In this report we demonstrate that the zebrafish Pax2 PD can interact with a novel type of DNA sequences in vitro, the triple-A motif, consisting of a heptameric nucleotide sequence G/CAAACA/TC with an invariant core of three adjacent adenosines. This recognition sequence was found to be conserved in known natural Pax5 repressor elements involved in controlling the expression of the p53 and J-chain genes. By identifying similar high affinity binding sites in potential target genes of the Pax2 protein, including the pax2 gene itself, we obtained further evidence that the triple-A sites are biologically significant. The putative natural target sites also provide a basis for defining an extended consensus recognition sequence. In addition, we observed in transformation assays a direct correlation between Pax2 repressor activity and the presence of triple-A sites. The results suggest that a transcriptional regulatory function of Pax proteins can be modulated by PD binding to different categories of target sequences. Copyright 1999 Academic Press.
“Agrolistic” transformation of plant cells: Integration of T-strands generated in planta
Hansen, Geneviève; Chilton, Mary-Dell
1996-01-01
We describe a novel plant transformation technique, termed “agrolistic,” that combines the advantages of the Agrobacterium transformation system with the high efficiency of biolistic DNA delivery. Agrolistic transformation allows integration of the gene of interest without undesired vector sequence. The virulence genes virD1 and virD2 from Agrobacterium tumefaciens that are required in bacteria for excision of T-strands from the tumor-inducing plasmid were placed under the control of the CaMV35S promoter and codelivered with a target plasmid containing border sequences flanking the gene of interest. Transient expression assays in tobacco and in maize cells indicated that vir gene products caused strand-specific nicking in planta at the right border sequence, similar to VirD1/VirD2-catalyzed T-strand excision observed in Agrobacterium. Agrolistically transformed tobacco calli were obtained after codelivery of virD1 and virD2 genes together with a selectable marker flanked by border sequences. Some inserts exhibited right junctions with plant DNA that corresponded precisely to the sequence expected for T-DNA (portion of the tumor-inducing plasmid that is transferred to plant cells) insertion events. We designate these as “agrolistic” inserts, as distinguished from “biolistic” inserts. Both types of inserts were found in some transformed lines. The frequency of agrolistic inserts was 20% that of biolistic inserts. PMID:8962167
Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu
2004-01-01
The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.
Martins, C; Galetti, P M
2001-10-01
To address understanding the organization of the 5S rRNA multigene family in the fish genome, the nucleotide sequence and organization array of 5S rDNA were investigated in the genus Leporinus, a representative freshwater fish group of South American fauna. PCR, subgenomic library screening, genomic blotting, fluorescence in situ hybridization, and DNA sequencing were employed in this study. Two arrays of 5S rDNA were identified for all species investigated, one consisting of monomeric repeat units of around 200 bp and another one with monomers of 900 bp. These 5S rDNA arrays were characterized by distinct NTS sequences (designated NTS-I and NTS-II for the 200- and 900-bp monomers, respectively); however, their coding sequences were nearly identical. The 5S rRNA genes were clustered in two chromosome loci, a major one corresponding to the NTS-I sites and a minor one corresponding to the NTS-II sites. The NTS-I sequence was variable among Leporinus spp., whereas the NTS-II was conserved among them and even in the related genus Schizodon. The distinct 5S rDNA arrays might characterize two 5S rRNA gene subfamilies that have been evolving independently in the genome.
Wang, Xiaojie; Tang, Chunlei; Zhang, Gang; Li, Yingchun; Wang, Chenfang; Liu, Bo; Qu, Zhipeng; Zhao, Jie; Han, Qingmei; Huang, Lili; Chen, Xianming; Kang, Zhensheng
2009-01-01
Background Puccinia striiformis f. sp. tritici is a fungal pathogen causing stripe rust, one of the most important wheat diseases worldwide. The fungus is strictly biotrophic and thus, completely dependent on living host cells for its reproduction, which makes it difficult to study genes of the pathogen. In spite of its economic importance, little is known about the molecular basis of compatible interaction between the pathogen and wheat host. In this study, we identified wheat and P. striiformis genes associated with the infection process by conducting a large-scale transcriptomic analysis using cDNA-AFLP. Results Of the total 54,912 transcript derived fragments (TDFs) obtained using cDNA-AFLP with 64 primer pairs, 2,306 (4.2%) displayed altered expression patterns after inoculation, of which 966 showed up-regulated and 1,340 down-regulated. 186 TDFs produced reliable sequences after sequencing of 208 TDFs selected, of which 74 (40%) had known functions through BLAST searching the GenBank database. Majority of the latter group had predicted gene products involved in energy (13%), signal transduction (5.4%), disease/defence (5.9%) and metabolism (5% of the sequenced TDFs). BLAST searching of the wheat stem rust fungus genome database identified 18 TDFs possibly from the stripe rust pathogen, of which 9 were validated of the pathogen origin using PCR-based assays followed by sequencing confirmation. Of the 186 reliable TDFs, 29 homologous to genes known to play a role in disease/defense, signal transduction or uncharacterized genes were further selected for validation of cDNA-AFLP expression patterns using qRT-PCR analyses. Results confirmed the altered expression patterns of 28 (96.5%) genes revealed by the cDNA-AFLP technique. Conclusion The results show that cDNA-AFLP is a reliable technique for studying expression patterns of genes involved in the wheat-stripe rust interactions. Genes involved in compatible interactions between wheat and the stripe rust pathogen were identified and their expression patterns were determined. The present study should be helpful in elucidating the molecular basis of the infection process, and identifying genes that can be targeted for inhibiting the growth and reproduction of the pathogen. Moreover, this study can also be used to elucidate the defence responses of the genes that were of plant origin. PMID:19566949
Newer Gene Editing Technologies toward HIV Gene Therapy
Manjunath, N.; Yi, Guohua; Dang, Ying; Shankar, Premlata
2013-01-01
Despite the great success of highly active antiretroviral therapy (HAART) in ameliorating the course of HIV infection, alternative therapeutic approaches are being pursued because of practical problems associated with life-long therapy. The eradication of HIV in the so-called “Berlin patient” who received a bone marrow transplant from a CCR5-negative donor has rekindled interest in genome engineering strategies to achieve the same effect. Precise gene editing within the cells is now a realistic possibility with recent advances in understanding the DNA repair mechanisms, DNA interaction with transcription factors and bacterial defense mechanisms. Within the past few years, four novel technologies have emerged that can be engineered for recognition of specific DNA target sequences to enable site-specific gene editing: Homing Endonuclease, ZFN, TALEN, and CRISPR/Cas9 system. The most recent CRISPR/Cas9 system uses a short stretch of complementary RNA bound to Cas9 nuclease to recognize and cleave target DNA, as opposed to the previous technologies that use DNA binding motifs of either zinc finger proteins or transcription activator-like effector molecules fused to an endonuclease to mediate sequence-specific DNA cleavage. Unlike RNA interference, which requires the continued presence of effector moieties to maintain gene silencing, the newer technologies allow permanent disruption of the targeted gene after a single treatment. Here, we review the applications, limitations and future prospects of novel gene-editing strategies for use as HIV therapy. PMID:24284874
Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.
2010-01-01
Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180
Genome Fragmentation Is Not Confined to the Peridinin Plastid in Dinoflagellates
Espelund, Mari; Minge, Marianne A.; Gabrielsen, Tove M.; Nederbragt, Alexander J.; Shalchian-Tabrizi, Kamran; Otis, Christian; Turmel, Monique; Lemieux, Claude; Jakobsen, Kjetill S.
2012-01-01
When plastids are transferred between eukaryote lineages through series of endosymbiosis, their environment changes dramatically. Comparison of dinoflagellate plastids that originated from different algal groups has revealed convergent evolution, suggesting that the host environment mainly influences the evolution of the newly acquired organelle. Recently the genome from the anomalously pigmented dinoflagellate Karlodinium veneficum plastid was uncovered as a conventional chromosome. To determine if this haptophyte-derived plastid contains additional chromosomal fragments that resemble the mini-circles of the peridin-containing plastids, we have investigated its genome by in-depth sequencing using 454 pyrosequencing technology, PCR and clone library analysis. Sequence analyses show several genes with significantly higher copy numbers than present in the chromosome. These genes are most likely extrachromosomal fragments, and the ones with highest copy numbers include genes encoding the chaperone DnaK(Hsp70), the rubisco large subunit (rbcL), and two tRNAs (trnE and trnM). In addition, some photosystem genes such as psaB, psaA, psbB and psbD are overrepresented. Most of the dnaK and rbcL sequences are found as shortened or fragmented gene sequences, typically missing the 3′-terminal portion. Both dnaK and rbcL are associated with a common sequence element consisting of about 120 bp of highly conserved AT-rich sequence followed by a trnE gene, possibly serving as a control region. Decatenation assays and Southern blot analysis indicate that the extrachromosomal plastid sequences do not have the same organization or lengths as the minicircles of the peridinin dinoflagellates. The fragmentation of the haptophyte-derived plastid genome K. veneficum suggests that it is likely a sign of a host-driven process shaping the plastid genomes of dinoflagellates. PMID:22719952
DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns
Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo
2017-01-01
Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean
2006-07-01
The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.
Nonneutral mitochondrial DNA variation in humans and chimpanzees
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nachman, M.W.; Aquadro, C.F.; Brown, W.M.
1996-03-01
We sequenced the NADH dehydrogenase subunit 3 (ND3) gene from a sample of 61 humans, five common chimpanzees, and one gorilla to test whether patterns of mitochondrial DNA (mtDNA) variation are consistent with a neutral model of molecular evolution. Within humans and within chimpanzees, the ratio of replacement to silent nucleotide substitutions was higher than observed in comparisons between species, contrary to neutral expectations. To test the generality of this result, we reanalyzed published human RFLP data from the entire mitochondrial genome. Gains of restriction sites relative to a known human mtDNA sequence were used to infer unambiguous nucleotide substitutions.more » We also compared the complete mtDNA sequences of three humans. Both the RFLP data and the sequence data reveal a higher ratio of replacement to silent nucleotide substitutions within humans than is seen between species. This pattern is observed at most or all human mitochondrial genes and is inconsistent with a strictly neutral model. These data suggest that many mitochondrial protein polymorphisms are slightly deleterious, consistent with studies of human mitochondrial diseases. 59 refs., 2 figs., 8 tabs.« less
Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron
2016-01-01
Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341
Evers, R; Grummt, I
1995-01-01
Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036
DNA methylation assessment from human slow- and fast-twitch skeletal muscle fibers
Begue, Gwénaëlle; Raue, Ulrika; Jemiolo, Bozena
2017-01-01
A new application of the reduced representation bisulfite sequencing method was developed using low-DNA input to investigate the epigenetic profile of human slow- and fast-twitch skeletal muscle fibers. Successful library construction was completed with as little as 15 ng of DNA, and high-quality sequencing data were obtained with 32 ng of DNA. Analysis identified 143,160 differentially methylated CpG sites across 14,046 genes. In both fiber types, selected genes predominantly expressed in slow or fast fibers were hypomethylated, which was supported by the RNA-sequencing analysis. These are the first fiber type-specific methylation data from human skeletal muscle and provide a unique platform for future research. NEW & NOTEWORTHY This study validates a low-DNA input reduced representation bisulfite sequencing method for human muscle biopsy samples to investigate the methylation patterns at a fiber type-specific level. These are the first fiber type-specific methylation data reported from human skeletal muscle and thus provide initial insight into basal state differences in myosin heavy chain I and IIa muscle fibers among young, healthy men. PMID:28057818
The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...
Capsicum annuum dehydrin, an osmotic-stress gene in hot pepper plants.
Chung, Eunsook; Kim, Soo-Yong; Yi, So Young; Choi, Doil
2003-06-30
Osmotic stress-related genes were selected from an EST database constructed from 7 cDNA libraries from different tissues of the hot pepper. A full-length cDNA of Capsicum annuum dehydrin (Cadhn), a late embryogenesis abundant (lea) gene, was selected from the 5' single pass sequenced cDNA clones and sequenced. The deduced polypeptide has 87% identity with potato dehydrin C17, but very little identity with the dehydrin genes of other organisms. It contains a serine-tract (S-segment) and 3 conserved lysine-rich domains (K-segments). Southern blot analysis showed that 2 copies are present in the hot pepper genome. Cadhn was induced by osmotic stress in leaf tissues as well as by the application of abscisic acid. The RNA was most abundant in green fruit. The expression of several osmotic stress-related genes was examined and Cadhn proved to be the most abundantly expressed of these in response to osmotic stress.
Brief Guide to Genomics: DNA, Genes and Genomes
... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...
Identification of an expressed gene in Dipylidium caninum.
Miranda, Rodrigo R C; Costa-Júnior, Livio M; Campos, Artur K; Santos, Hudson A; Rabelo, Elida M L
2004-10-01
Recombinant DNA studies have been focused on developing vaccines to different cestodes. But few studies involving Dipylidium caninum molecular biology and genes have been done. Only partial sequences of mitochondrial DNA and ribosomal RNA gene are available in databases. Any molecular work with this parasite, including epidemiology, study of drug-resistant strains, and vaccine development, is hampered by the lack of knowledge of its genome. Thus, the knowledge of specific genes of different developmental stages of D. caninum is crucial to locate potential targets to be used as candidates to develop a vaccine and/or new drugs against this parasite. Here we report, for the first time, the sequencing of a fragment of a D. caninum expressed gene.
Flynn, Theodore M.; Koval, Jason C.; Greenwald, Stephanie M.; Owens, Sarah M.; Kemner, Kenneth M.; Antonopoulos, Dionysios A.
2017-01-01
We present DNA sequence data in FASTA-formatted files from aerobic environmental microcosms inoculated with a sole carbon source. DNA sequences are of 16S rRNA genes present in DNA extracted from each microcosm along with the environmental samples (soil, water) used to inoculate them. These samples were sequenced using the Illumina MiSeq platform at the Environmental Sample Preparation and Sequencing Facility at Argonne National Laboratory. This data is compatible with standard microbiome analysis pipelines (e.g., QIIME, mothur, etc.).